|
|
|
Journal of Bacteriology, January 2003, p . 80-88, Vol . 185, No . 1 The SecB Chaperone Is Bifunctional in Serratia marcescens: SecB Is Involved in the Sec Pathway and Required for HasA Secretion by the ABC TransporterGuillaume Sapriel, Cécile Wandersman, and Philippe Delepelaire* Unité des Membranes Bactériennes, URA CNRS 2172, Institut Pasteur, 75724 Paris Cedex 15, France Received 18 July 2002/ Accepted 8 October 2002
The type I secretion pathway presents several characteristic features . Secretion occurs in a single step, directly from the cytoplasm to the extracellular medium . The secretion signal is in most cases located at the C-terminal end of the secreted protein and is not cleaved during secretion . As a consequence, the secreted protein is entirely synthesized before secretion . The secretion apparatus assembles on demand, in response to a signal triggered by the association of this secretion signal with the ABC component of the secretion machinery (22, 36) . The size of the proteins secreted by the type I pathway ranges from 50 to more than 4,000 amino acids . However, given the size of the channel created by the outer membrane component, this channel can only accommodate globular proteins of at most 150 to 200 amino acids, imposing strict constraints on the secretion process . We have recently shown that a folded ABC substrate cannot be translocated through the ABC secretion apparatus (8) . HasA is the secreted hemophore of the Serratia marcescens Has system (heme acquisition system) . This 188-amino-acid protein is secreted by an ABC pathway under iron starvation conditions and is able to acquire heme from various hemoproteins and to deliver it to a specific outer membrane receptor, HasR, which is responsible for the internalization of heme and its use as a source of iron/porphyrin (15, 25) . As a model system, we previously used the HasA secretion system from S . marcescens reconstituted in Escherichia coli . This reconstituted secretion system consists of hasA, the structural gene for the HasA hemophore, and hasD and hasE, the structural genes for the ABC and membrane fusion protein components, respectively . tolC, on the E . coli chromosome, encoded the outer membrane component (4) . Using this reconstituted system, we have previously shown that a molecular chaperone is required for HasA secretion in E . coli . This chaperone is SecB, usually known as the gram-negative Sec pathway-dedicated chaperone (10) . Previous studies also showed that HasA is able to fold within the cytoplasm and that it ceases to be secretion competent once folded (8) . It has also been shown that the HasA N-terminal region and SecB cooperate in efficient HasA secretion . These results suggest a model in which, during translation, SecB, HasA, and the ABC apparatus associate, preventing HasA folding and favoring the productive interaction of the C-terminal secretion signal with the ABC apparatus for efficient secretion (33) . We have also shown that overproduction of a chimeric protein (known to interact irreversibly with SecB, thereby sequestering SecB and preventing it from fulfilling its function) leads to the inhibition of HasA secretion . This result was obtained both in the reconstituted system in E . coli and in the original host, S . marcescens (10) . This suggests that, in the original host, a chaperone is indeed involved in HasA secretion . However, we could not determine whether this chaperone was SecB or another unidentified S . marcescens chaperone that could interact with the overproduced chimeric protein . It is unclear whether this chaperone is an S . marcescens SecB homolog or another chaperone specifically dedicated to HasA secretion via the specific type I apparatus . Functional promiscuity of chaperones has been documented in many cases . Under certain circumstances, the DnaK/DnaJ/GrpE combination can substitute for SecB function (2) . No SecB homolog for which sequence data are available has been identified in gram-positive bacteria . However, another analogous chaperone protein is necessary for the secretion of a subset of proteins via the Sec translocation machinery . This cytoplasmic chaperone is CsaA in Bacillus subtilis . It does not resemble SecB in either sequence or structure . However, CsaA is able to stimulate protein export in an E . coli SecB- strain and thus complements SecB function . CsaA also displays chaperone-like activity in vitro (28) . In the case of the HasA secretion-dedicated chaperone in S . marcescens, both hypotheses (endogenous SecB or a specific chaperone) seem to be tenable . A SecB homolog has been identified in S . marcescens on the basis of cross-reaction of a particular species with anti-E . coli SecB antibodies (9) . Conversely, the specificity of the SecB chaperone for the Sec translocation system, especially the specific interaction with SecA (14), the ATPase of the Sec translocation system, make the involvement of SecB in type I secretion all the more puzzling . The aim of this study was to identify the genuine chaperone involved in HasA secretion in the original host and to determine further the precise role of this chaperone protein by comparison with that of SecB in E . coli .
(ii) Construction of nonpolar E . coli MC4100
Cloning of the grxC-cysE region from S . marcescens.
Genomic DNA from S . marcescens SM365 was prepared and partially digested with Sau3A . Fragments 1 to 3 kb in size were purified and ligated to dephosphorylated and BamHI-digested pUC18 (Pharmacia) . The resulting library was used to transform strain MC4100
Codon usage clearly differed from that of E . coli gpsA, with a higher proportion of G/C residues in the third position of codons . Upstream from this open reading frame, we found a 435-nucleotide open reading frame with no initiator methionine that encoded a 144-amino-acid polypeptide displaying 93% identity to the last 144 amino acids of E . coli SecB . As in E . coli, this open reading frame overlapped gpsA by 1 nucleotide . Downstream from this open reading frame, we found another incomplete open reading frame displaying sequence similarity to the 5' end of cysE, the gene downstream from gpsA in E . coli . As S . marcescens secB was incomplete, PCR amplification was carried out, using the genomic library of S . marcescens DNA as a template, with one primer binding to the plasmid (universal primer M13) and one binding to S . marcescens secB (TTCGAAGGAGATATCCTTGGTATAG; secbsmN35) . This PCR yielded a fragment of about 0.7 kb in size, which was sequenced and used to design primers to amplify the whole grxC-cysE genomic region from SM365 genomic DNA, ensuring that the recombinant clone was not the result of an artifact . To reconstruct the whole S . marcescens grxC-cysE' region on a plasmid, the original recombinant clone complementing E . coli gpsA was digested with EcoRI and BstBI, as was the 0.7-kb PCR product; ligation yielded the grxC-cysE' region of S . marcescens cloned into pUC18 . Finally, S . marcescens secB was cloned in pAM238: two oligomeric primers were used to amplify a fragment about 0.6 kb in size, which was digested with EcoRI and HindIII and ligated into pAM238 digested with EcoRI and HindIII . Sequencing was carried out at Genome Express . Inactivation of secB on the S . marcescens chromosome. We also made use of the lambda exo bet gam recombination functions from pTP223 introduced in S . marcescens on plasmid pKOBEGA, an ampicillin-resistant derivative of pKOBEG with heat-sensitive replication and arabinose-mediated control of the expression of recombination functions (6) . A three-way PCR using oligomeric primers was carried out to generate a PCR fragment composed of a selectable antibiotic resistance cassette (in our case kanamycin from pUC4K) flanked by a 0.5-kb homologous region from each side of the gene to be inactivated . The details of the method will be published elsewhere .
The resulting PCR product was used to transform SM365(pKOBEGA) after the induction of lambda recombination functions with arabinose . Kanamycin-resistant clones were selected at 30°C and cured of pKOBEGA by plating and incubating at 37°C . We carried out PCR, using genomic DNA as the template, to check for correct construction . Finally, the SM365
Analysis of cell fractions. In most cases, E . coli and S . marcescens harboring recombinant plasmids were grown to the late exponential phase at 30°C in LB medium supplemented with the appropriate antibiotics . We used 0.4 mM dipyridyl in LB medium to induce the has operon in S . marcescens (25) . The culture was centrifuged at 10,000 x g for 10 min, proteins were precipitated from the supernatant by incubation with 20% trichloroacetic acid for 1 h at 4°C, and the precipitated proteins were harvested by centrifugation, washed in 80% acetone, resuspended in sample buffer, and subjected to electrophoresis (21) . Cell pellets were washed once in 100 mM Tris (pH 8.0)-1 mM EDTA and directly resuspended in sample buffer . Immunodetection was carried out as previously described (26) with anti-SecB, anti-HasA, anti-TolC, and anti-PrtSM sera raised in rabbits . The maltose system was induced by incubation with 0.4% maltose for 20 min during the exponential growth phase . Pulse-chase experiments in S . marcescens. For maltose-binding protein (MBP) labeling, cells were grown in M9 minimal medium at 30°C with 0.2% glycerol and 0.2% maltose as carbon sources . Cells were labeled at an optical density at 600 nm (OD600) of 0.5 for 15 or 30 s in the presence of [35S]methionine and then chased with an excess of unlabeled methionine . For the 15 s of labeling, no chase was carried out . The 30-s labeling time points were 0, 30 s, and 1, 2, and 5 min of chase . For each point, the whole culture was trichloroacetic acid precipitated . Immunoprecipitation was then carried out with anti-E . coli MBP antibodies . For HasA labeling, cells were grown in M9 minimal medium at 30°C with 0.4% glycerol as a carbon source and 0.2 mM dipyridyl to induce the Has operon . Cells were labeled at an OD600 of 0.2 for 1 min in the presence of [35S]methionine and then chased with an excess of unlabeled methionine . Three samples were taken, at 0, 5, and 30 min of chase . For each point, whole culture, supernatant, and cells were collected and trichloroacetic acid precipitated . Immunoprecipitation was then carried out with anti-HasA antibodies .
A library of S . marcescens chromosomal DNA fragments (1 to 3 kb) in pUC18 was used to transform this strain, and recombinant clones were selected for growth on rich medium supplemented with ampicillin . Several clones were obtained and studied further . Three such clones contained the same 2.3-kb insert, the sequence of which revealed the presence of a gpsA analog, together with the 5' end of a gene analogous to cysE and a gene analogous to secB but lacking the first 12 codons identified in E . coli secB . The entire secB gene, together with an upstream region of 500 bp, was then obtained (see Materials and Methods) . We found that the putative S . marcescens SecB was 156 amino acids long and 93% identical to E . coli SecB (155 amino acids) and that the putative S . marcescens GpsA was 340 amino acids long and 85% identical to E . coli GpsA (339 amino acids) . As in E . coli, the stop codon of secB from S . marcescens overlaps the start codon of gpsA . The structure of the region is conserved between E . coli and S . marcescens, with cysE downstream from gpsA and grxC and yibN upstream from secB (not shown) . The sequence has been deposited in GenBank (BankIt480659 AF528189) . Sequence alignment of SecB proteins from different bacteria (Fig . 1) shows residue conservation . In particular, all residues for which mutations affecting function in E . coli have been identified are either completely conserved or very strongly conserved .
S . marcescens strain from which secB was deleted had defective pre-MBP processing. We then investigated whether HasA secretion in S . marcescens was dependent upon SecB, as in the reconstituted system in E . coli, or whether another chaperone might fulfill this function in the original host . An S . marcescens secB mutant was constructed by replacing the secB gene with a kanamycin resistance cassette . The DNA construct was made so that the insertion of the cassette was nonpolar with respect to the expression of the downstream gpsA gene, so that the resulting strain could grow in the absence of glycerol . Kanamycin-resistant clones were obtained . They were checked by PCR for the absence of secB and its replacement by the kanamycin resistance cassette (not shown) and by antibodies for the absence of the SecB protein (see Fig . 3A) . The S . marcescens secB mutant presented no apparent growth defect . This indicates that, as in E . coli, secB is not an essential gene in S . marcescens . We also detected, in our SM365 strain, a polypeptide cross-reacting with anti-E . coli MBP antibodies . This protein was induced by 0.4% maltose and was thus identified as S . marcescens MBP . A similar protein has already been identified in Serratia and shown to complement E . coli MBP in terms of function (7) . In the secB mutant of S . marcescens, a higher-molecular-weight cross-reacting band was also found, which we tentatively identified as the precursor of MBP, absent in the wild-type strain (Fig . 3B) . Thus, pre-MBP processing is probably dependent upon SecB in S . marcescens . A pulse-chase experiment was also carried out to prove in a kinetic fashion that S . marcescens SecB is indeed involved in pre-MBP processing (Fig . 3C) . Whereas in the wild-type strain, pre-MBP was hardly detected at the earliest time point (15 s of pulse), the precursor was readily detected in the secB mutant strain, and some precursor was never chased even for the longest chase . This is exactly what was observed for the secB mutant of E . coli, showing that SecB is indeed required for export of pre-MBP in S . marcescens.
S . marcescens strain from which secB was deleted did not secrete HasA.
The secB mutant strain, together with its wild-type parent strain, was tested for HasA secretion upon induction of the chromosomal has system by iron chelation . HasA secretion was readily observed in the wild-type strain upon iron chelation (Fig . 4A, lanes 3 and 4), but this was not the case in the secB mutant (Fig . 4A, lanes 1 and 2) . Intracellular HasA was barely detectable in the secB mutant (not shown) . The HasA secretion defect of the secB mutant of S . marcescens was fully complemented by a plasmid encoding S . marcescens SecB (Fig . 4A, lanes 7 and 8) but not by a control plasmid (Fig . 4A, lanes 5 and 6) . The HasA secretion defect of the secB mutant of S . marcescens was not complemented by a multicopy plasmid encoding HasA under the control of the plac promoter (Fig . 4B, lanes 8 and 9 compared to 6 and 7); in this case, HasA is expressed independently from iron starvation at a relatively high level (lanes 2 and 4) and was found to accumulate within the cells of strain SM365
S . marcescens secretes at least two other proteins via another ABC transporter: the metalloprotease PrtSM and a lipase (1, 23) . We had previously studied the secretion of PrtSM and analogous proteases from Erwinia chrysanthemi and shown that their secretion was SecB independent in the reconstituted system in E . coli (10) . PrtSM metalloprotease secretion was also tested in the original host and found to be unaffected in the secB mutant of S . marcescens, since equal amounts of metalloprotease PrtSM were found in the supernatants of SM365 and SM365
secB mutant of S . marcescens possesses a functional HasA secretion apparatus. SecB might exert its effect either on the secreted protein or on the secretion apparatus itself . We thus investigated in the original host the secretion of a variant of HasA, which is largely SecB independent in the reconstituted system (see Fig . 5, lower part) . This variant presents a deletion of amino acids 11 to 20 and was produced from a high-copy-number plasmid . Upon induction of the has system by iron starvation, secretion of this variant was readily observed in SM365, together with a concomitant decrease in the amount of extracellular HasA (see Fig . 5, upper part) . As in E . coli, this HasA variant was also secreted in the secB mutant of S . marcescens, although to a much lesser extent, indicating that the absence of SecB in S . marcescens does not completely impair the functioning of the HasA secretion apparatus .
Our results show that, in S . marcescens, SecB performs functions in the general Sec pathway and in the secretion of HasA via its ABC transporter . These results indicate that SecB is a dual-function molecule in S . marcescens, interacting with Sec and non-Sec substrates and directing different substrates to different pathways . They also raise the question of possible differences in the mechanism of action of the SecB chaperone in the Sec and ABC pathways . Point mutations in secB affect HasA secretion to different extents in the reconstituted system. SecB fulfills two distinct functions in the Sec pathway, antifolding activity and targeting to SecA (the Sec ATPase) . SecB mutations can be divided into at least two subclasses: (i) those affecting the interaction with SecA, greatly decreasing the rate of MBP export (residues 20, 24, 75, and 77 of E . coli SecB), and (ii) those affecting the oligomeric structure of SecB, which reduce the affinity for Sec precursors and cause only mild defects in the rate of MBP export (residues 74, 76, 78, and 80 of E . coli SecB) (16, 29) . We thus assessed the effect in the ABC pathway of these known SecB mutations (the residues of which are conserved in S . marcescens SecB) and for double mutations, which we constructed . These experiments were carried out in the reconstituted secretion system in E . coli . Some SecB mutations (D20A, E24A, L75Q, L75R, and E77V) that strongly affect pre-MBP processing only mildly affected HasA secretion (see Fig . 6) . Double mutations affecting these residues were constructed (D20A/L75R, D20A/E77V, E24A/L75R, and E24A/E77V), and all had only mild effects on HasA secretion (secretion was halved, whereas a complete lack of SecB resulted in less than 10% residual HasA secretion) . Thus, these residues, although strongly involved in pre-MBP translocation, have no great effect on HasA secretion .
Our previous studies with a reconstituted Has system showed that SecB was required for HasA secretion in E . coli (10) . Furthermore, results obtained in S . marcescens with a species interfering with SecB suggested that an analogous chaperone protein fulfilled the same function in the original host . By constructing a secB null mutant of S . marcescens, we have shown that the required chaperone for HasA secretion in the original host is indeed S . marcescens SecB, as in the reconstituted system in E . coli . This result confirms that the requirement for SecB is not specific to the reconstitution in a heterologous host . It also seems that the Has system does not require a specific dedicated chaperone . Instead, we showed that, in the original host, SecB was involved in two different secretion pathways, the Sec pathway and a type I pathway specific for secretion of the HasA hemophore . This provides a direct demonstration that a supposedly Sec-dedicated chaperone may be recruited by another secretion machinery with mechanisms entirely different from those of the Sec pathway . In contrast to what is observed in the Sec pathway, in which the effects of SecB deficiency are mostly kinetic, it appears that a lack of SecB in the original host leads to a complete loss of HasA secretion . This bifunctional role of SecB in S . marcescens raises several questions about the functions of this chaperone . The question of whether SecB functions similarly in the Has secretion and Sec pathways could be partially answered by studies of secB mutants, as we showed that the pattern of secB point mutation effect differed for HasA secretion and MBP translocation . We will discuss the possible roles of SecB in HasA secretion: antifolding activity, targeting to the ABC apparatus, and selection of the appropriate secretion pathways . In contrast to what was observed for MBP translocation, HasA secretion was strongly affected by mutations of residues affecting the dimer-tetramer equilibrium (such as residue 76) and substrate binding . It therefore seems probable that the tetrameric structure of SecB is required for HasA secretion . These results suggest that antifolding activity may be the main function of SecB in HasA secretion . However, to test this hypothesis, true mutations of the peptide-binding site of SecB would be required . We have previously shown that HasA secretion is not dependent on SecA activity . Indeed, HasA secretion is not affected by the presence of azide, which abolishes SecA ATPase activity (data not shown) . Consistent with this result, and in contrast to the results obtained for MBP translocation, mutations of SecB residues specifically involved in SecA interaction had a much lesser effect on HasA secretion (factor of 2 for the double mutants) than did the absence of SecB . These results suggest that the SecA targeting function of SecB is not involved in HasA secretion . We have previously proposed and shown that the specificity of SecB for the Has system is based on an early SecB-mediated interaction of the N-terminal part of HasA with the ABC transporter (8, 33) . We have also shown that SecB interacts in vitro with the ABC protein . Thus, it is possible that SecB interacts directly with the ABC protein . The residues specifically involved in this possible interaction remain to be identified . Given the bifunctional role of SecB, the mechanism involved must facilitate distinction between Sec and non-Sec substrates once SecB is bound to its substrate . The specificity of SecB for the Sec system is based on the interaction between SecB and SecA, the ATPase of the Sec system, and the specific interaction of SecB with precursors in vivo (11, 12) . The basis for the in vivo selection of substrates by SecB is largely unknown, but the interaction between SecB and SecA is known to involve the C-terminal part of SecA and at least four SecB residues pointing towards the exterior of the molecule, comprising a patch of negatively charged residues that specifically interact with SecA (13, 14, 16, 29, 30, 38) . It is therefore possible that selection of the appropriate pathway from these two pathways involving SecB is determined by the substrate itself . In the case of HasA, we have shown that an N-terminal region of the protein is involved in the interaction with the ABC protein and secretion efficiency (33) . The presence of this N-terminal part of HasA may be responsible for directing the substrate towards the ABC apparatus . It is also possible that another factor specifically recognizes HasA and targets it to the Has system .
G.S . is supported by a fellowship from the Fondation pour la Recherche Médicale . This work was supported by the Institut Pasteur and CNRS (URA 2172) .
What Is Molecular Microbiology?,
What Is Pcr?,
What Is Fermentation?,
What Is Listeria Monocytogenes?,
What Is Prokaryote?,
o,
Bacterium,
s,
Bacteria,
c,
Microbes,
i,
Microbiology,
n,
Microorganisms,
c,
Salmonella,
e,
Bacteriological,
a,
Bacillus,
i,
Cell cultures,
a,
S. cerevisiae,
o,
Cell cultures,
r,
S. cerevisiae,
r,
Bacillus,
s,
Cell cultures,
c,
Salmonella,
c,
Antibiotic treatment,
e,
Escherichia coli,
a,
Brevibacteria,
r,
Vancomycin,
c,
S. cerevisiae,
n,
Clostridia,
n,
Petri dish,
c,
Gram negative,
e,
Yeasts,
i,
Microflora,
o,
Microbiological
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||