Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us

Journal of Bacteriology, January 2003, p . 80-88, Vol . 185, No . 1

The SecB Chaperone Is Bifunctional in Serratia marcescens: SecB Is Involved in the Sec Pathway and Required for HasA Secretion by the ABC Transporter

Guillaume Sapriel, Cécile Wandersman, and Philippe Delepelaire*

Unité des Membranes Bactériennes, URA CNRS 2172, Institut Pasteur, 75724 Paris Cedex 15, France

Received 18 July 2002/ Accepted 8 October 2002


   ABSTRACT

 
HasA is the secreted hemophore of the heme acquisition system (Has) of Serratia marcescens . It is secreted by a specific ABC transporter apparatus composed of three proteins: HasD, an inner membrane ABC protein; HasE, another inner membrane protein; and HasF, a TolC homolog . Except for HasF, the structural genes of the Has system are encoded by an iron-regulated operon . In previous studies, this secretion system has been reconstituted in Escherichia coli, where it requires the presence of the SecB chaperone, the Sec pathway-dedicated chaperone . We cloned and inactivated the secB gene from S . marcescens . We show that S . marcescens SecB is 93% identical to E . coli SecB and complements the secretion defects of a secB mutant of E . coli for both the Sec and ABC pathways of HasA secretion . In S . marcescens, SecB inactivation affects translocation by the Sec pathway and abolishes HasA secretion . This demonstrates that S . marcescens SecB is the genuine chaperone for HasA secretion in S . marcescens . These results also demonstrate that S . marcescens SecB is bifunctional, as it is involved in two separate secretion pathways . We investigated the effects of secB point mutations in the reconstituted HasA secretion pathway by comparing the translocation of a Sec substrate in various mutants . Two different patterns of SecB residue effects were observed, suggesting that SecB functions may differ for the Sec and ABC pathways .


   INTRODUCTION

 
The type I secretion pathway (or ATP-binding cassette [ABC] pathway) is one of several pathways used by gram-negative bacteria to secrete proteins into the extracellular medium . It is widespread and is used for the secretion of proteins with various functions (3) . It involves a secretion apparatus composed of three proteins: the ABC protein; the so-called membrane fusion protein in the cytoplasmic membrane, and a specific outer membrane protein of the TolC class, which creates a channel about 30 Å in diameter through the periplasmic space and the outer membrane (17) through which the secreted protein is most likely translocated .

The type I secretion pathway presents several characteristic features . Secretion occurs in a single step, directly from the cytoplasm to the extracellular medium . The secretion signal is in most cases located at the C-terminal end of the secreted protein and is not cleaved during secretion . As a consequence, the secreted protein is entirely synthesized before secretion . The secretion apparatus assembles on demand, in response to a signal triggered by the association of this secretion signal with the ABC component of the secretion machinery (22, 36) . The size of the proteins secreted by the type I pathway ranges from 50 to more than 4,000 amino acids . However, given the size of the channel created by the outer membrane component, this channel can only accommodate globular proteins of at most 150 to 200 amino acids, imposing strict constraints on the secretion process . We have recently shown that a folded ABC substrate cannot be translocated through the ABC secretion apparatus (8) .

HasA is the secreted hemophore of the Serratia marcescens Has system (heme acquisition system) . This 188-amino-acid protein is secreted by an ABC pathway under iron starvation conditions and is able to acquire heme from various hemoproteins and to deliver it to a specific outer membrane receptor, HasR, which is responsible for the internalization of heme and its use as a source of iron/porphyrin (15, 25) . As a model system, we previously used the HasA secretion system from S . marcescens reconstituted in Escherichia coli . This reconstituted secretion system consists of hasA, the structural gene for the HasA hemophore, and hasD and hasE, the structural genes for the ABC and membrane fusion protein components, respectively . tolC, on the E . coli chromosome, encoded the outer membrane component (4) .

Using this reconstituted system, we have previously shown that a molecular chaperone is required for HasA secretion in E . coli . This chaperone is SecB, usually known as the gram-negative Sec pathway-dedicated chaperone (10) . Previous studies also showed that HasA is able to fold within the cytoplasm and that it ceases to be secretion competent once folded (8) . It has also been shown that the HasA N-terminal region and SecB cooperate in efficient HasA secretion . These results suggest a model in which, during translation, SecB, HasA, and the ABC apparatus associate, preventing HasA folding and favoring the productive interaction of the C-terminal secretion signal with the ABC apparatus for efficient secretion (33) .

We have also shown that overproduction of a chimeric protein (known to interact irreversibly with SecB, thereby sequestering SecB and preventing it from fulfilling its function) leads to the inhibition of HasA secretion . This result was obtained both in the reconstituted system in E . coli and in the original host, S . marcescens (10) . This suggests that, in the original host, a chaperone is indeed involved in HasA secretion . However, we could not determine whether this chaperone was SecB or another unidentified S . marcescens chaperone that could interact with the overproduced chimeric protein . It is unclear whether this chaperone is an S . marcescens SecB homolog or another chaperone specifically dedicated to HasA secretion via the specific type I apparatus .

Functional promiscuity of chaperones has been documented in many cases . Under certain circumstances, the DnaK/DnaJ/GrpE combination can substitute for SecB function (2) . No SecB homolog for which sequence data are available has been identified in gram-positive bacteria . However, another analogous chaperone protein is necessary for the secretion of a subset of proteins via the Sec translocation machinery . This cytoplasmic chaperone is CsaA in Bacillus subtilis . It does not resemble SecB in either sequence or structure . However, CsaA is able to stimulate protein export in an E . coli SecB- strain and thus complements SecB function . CsaA also displays chaperone-like activity in vitro (28) .

In the case of the HasA secretion-dedicated chaperone in S . marcescens, both hypotheses (endogenous SecB or a specific chaperone) seem to be tenable . A SecB homolog has been identified in S . marcescens on the basis of cross-reaction of a particular species with anti-E . coli SecB antibodies (9) . Conversely, the specificity of the SecB chaperone for the Sec translocation system, especially the specific interaction with SecA (14), the ATPase of the Sec translocation system, make the involvement of SecB in type I secretion all the more puzzling .

The aim of this study was to identify the genuine chaperone involved in HasA secretion in the original host and to determine further the precise role of this chaperone protein by comparison with that of SecB in E . coli .


   MATERIALS AND METHODS

 
Strains and media. The E . coli and S . marcescens strains and plasmids used in this work are listed in Table 1 . Cells were grown at 30°C or 37°C in Luria-Bertani (LB) (27) rich medium with appropriate antibiotics or at 30°C in M9 minimal medium with 0.4% glycerol as the carbon source . E . coli MC4100 (araD139 {Delta}lacU169 rpsL150 relA1 flbB5301 deoC1 ptsF25 rbsR) was from our laboratory collection . PAP105 ({Delta}lac-pro [F' traD36 pro AB lacIq lacZ{Delta}M15 Tn10]) was used for cloning . MC4100(pTP223) was used for transformation with linear DNA after induction of lambda recombination functions from pTP223 (31) with 1 mM isopropylthiogalactopyranoside (IPTG) for 2 h . Spontaneous loss of pTP223 was observed after the recombination event . Antibiotics were used at the following concentrations in E . coli: ampicillin, 100 µg/ml; kanamycin, 50 µg/ml; chloramphenicol, 50 µg/ml; spectinomycin, 50 µg/ml; tetracycline, 7.5 µg/ml; and apramycin, 50 µg/ml . In S . marcescens they were ampicillin, 1,000 µg/ml; kanamycin, 300 µg/ml; and spectinomycin, 300 µg/ml .


TABLE 1 . Strains and plasmids

 
Strain construction(i) Construction of E . coli MC4100 {Delta}secB-gpsA::Apra. A 5.2-kb EcoRI fragment from E . coli encompassing the secB-gpsA region in a pBR322 derivative (pHK205) was obtained from C . Kumamoto (16) . This cloned DNA fragment contains 1.8 kb of genomic DNA from the region upstream from secB and 1.9 kb of genomic DNA from the region downstream from gpsA . The secB-gpsA genes were replaced by the apramycin resistance gene from pUCApra (5), leading to the isolation of pHK205{Delta}secB-gpsA::Apra . A 2-kb SphI-StuI linear DNA fragment corresponding to the apramycin cassette flanked by homologous regions from either side of secB and gpsA was used to electroporate MC4100(pTP223) . Recombinant clones were selected for apramycin resistance on minimal M9 medium supplemented with 0.4% glycerol and 0.2% casamino acids and checked for ampicillin susceptibility . Ampicillin-sensitive recombinant clones were isolated and found to be able to grow with glycerol as a carbon source and not with glucose due to the absence of the gpsA gene, as expected due to the absence of GpsA, involved in the first step of lipid biosynthesis (34) . The construct present in the recombinants was checked by PCR with oligomers binding both to the cassette and to sequences outside the secB-gpsA region . Products of the correct size were amplified (data not shown) .

(ii) Construction of nonpolar E . coli MC4100 {Delta}secB. A nonpolar {Delta}secB strain was constructed as follows . Two oligomers were used for PCR amplification with the same plasmid used before as the template . The resulting PCR product was self-ligated, creating a nonpolar deletion of the secB gene, leaving six codons at the 5' end and 16 at the 3' end of the secB gene . A 5-kb EcoRI-PstI fragment was isolated and used to transform MC4100 {Delta}secB-gpsA::Apra(pTP223) . Recombinant clones were selected on M9 minimal medium supplemented with 0.4% glucose and 0.2% casamino acids, without antibiotics . Ampicillin-sensitive, apramycin-sensitive, and tetracycline-sensitive clones were isolated . Their inserts were checked by PCR with oligomers binding to sequences outside the secB gene; in each case, products of the correct size were obtained (not shown) . Immunoblotting of the recombinant cells showed them to be devoid of SecB (see Fig . 2) .


 FIG . 2 . Complementation of an E . coli secB deletion mutant by SecB from S . marcescens (SecBSm) . (A) Coomassie blue-stained gel of supernatants from MC4100(pSYCAC1 + pAM238) (lane 1), MC4100 {Delta}secB(pSYCAC1 + pAM238) (lane 2), and MC4100 {Delta}secB(pSYCAC1 + psecBSm/pAM238) (lane 3) . In each case, the equivalent of 1 OD600 unit was loaded on the gel . (B) immunodetection with anti-MBP antibody of whole-cell pellets after maltose induction of MC4100(pAM238) (lane 1), MC4100 {Delta}secB(pAM238) (lane 2), and MC4100,{Delta}secB (psecBSm/pAM238) (lane 3) . The equivalent of 0.1 OD600 unit was loaded on the gel . The star indicates a contaminating band . (C) Immunodetection of SecB with anti-E . coli SecB (SecBEc) antibodies . MC4100(pAM238) (lane 1), MC4100 {Delta}secB(pAM238) (lane 2), and MC4100 {Delta}secB (psecBSm/pAM238) (lane 3) . The equivalent of 0.1 OD600 unit was loaded on the gel . The star indicates a contaminating band.

 
(iii) Construction of chromosomal secB point and double mutations in E . coli MC4100. We also created point mutations of secB on the E . coli chromosome by recombination with plasmids bearing secB mutations, digested with EcoRI and PstI . Point mutations of secB affecting amino acid positions 20, 24, 75, and 77 affect SecA binding (37) . SphI-EcoRI fragments from plasmids bearing the corresponding single mutations were inserted into pBGS18+ (35) digested with EcoRI and SphI . AccI-EcoRI fragments from these plasmids were swapped between plasmids so as to obtain plasmids bearing the double mutations D20A L75R, D20A E77Q, E24A L75R, and E24A E77Q . Sequencing was used to confirm the mutations .

Cloning of the grxC-cysE region from S . marcescens. Genomic DNA from S . marcescens SM365 was prepared and partially digested with Sau3A . Fragments 1 to 3 kb in size were purified and ligated to dephosphorylated and BamHI-digested pUC18 (Pharmacia) . The resulting library was used to transform strain MC4100 {Delta}secB-gpsA::Apra, and transformants were selected for growth on rich medium supplemented with ampicillin and apramycin . A few clones were obtained, and the plasmids they contained were analyzed; several harbored the same 2-kb insert, which was further analyzed . Sequencing of the insert indicated that it contained an open reading frame of 1,023 nucleotides encoding a 340-amino-acid protein displaying 85.3% identity to E . coli GpsA . This open reading frame was thus identified as S . marcescens gpsA .

Codon usage clearly differed from that of E . coli gpsA, with a higher proportion of G/C residues in the third position of codons . Upstream from this open reading frame, we found a 435-nucleotide open reading frame with no initiator methionine that encoded a 144-amino-acid polypeptide displaying 93% identity to the last 144 amino acids of E . coli SecB . As in E . coli, this open reading frame overlapped gpsA by 1 nucleotide . Downstream from this open reading frame, we found another incomplete open reading frame displaying sequence similarity to the 5' end of cysE, the gene downstream from gpsA in E . coli . As S . marcescens secB was incomplete, PCR amplification was carried out, using the genomic library of S . marcescens DNA as a template, with one primer binding to the plasmid (universal primer M13) and one binding to S . marcescens secB (TTCGAAGGAGATATCCTTGGTATAG; secbsmN35) . This PCR yielded a fragment of about 0.7 kb in size, which was sequenced and used to design primers to amplify the whole grxC-cysE genomic region from SM365 genomic DNA, ensuring that the recombinant clone was not the result of an artifact .

To reconstruct the whole S . marcescens grxC-cysE' region on a plasmid, the original recombinant clone complementing E . coli gpsA was digested with EcoRI and BstBI, as was the 0.7-kb PCR product; ligation yielded the grxC-cysE' region of S . marcescens cloned into pUC18 . Finally, S . marcescens secB was cloned in pAM238: two oligomeric primers were used to amplify a fragment about 0.6 kb in size, which was digested with EcoRI and HindIII and ligated into pAM238 digested with EcoRI and HindIII . Sequencing was carried out at Genome Express .

Inactivation of secB on the S . marcescens chromosome. We also made use of the lambda exo bet gam recombination functions from pTP223 introduced in S . marcescens on plasmid pKOBEGA, an ampicillin-resistant derivative of pKOBEG with heat-sensitive replication and arabinose-mediated control of the expression of recombination functions (6) . A three-way PCR using oligomeric primers was carried out to generate a PCR fragment composed of a selectable antibiotic resistance cassette (in our case kanamycin from pUC4K) flanked by a 0.5-kb homologous region from each side of the gene to be inactivated . The details of the method will be published elsewhere .

The resulting PCR product was used to transform SM365(pKOBEGA) after the induction of lambda recombination functions with arabinose . Kanamycin-resistant clones were selected at 30°C and cured of pKOBEGA by plating and incubating at 37°C . We carried out PCR, using genomic DNA as the template, to check for correct construction . Finally, the SM365{Delta}secB::Kan strain was devoid of SecB, as shown by immunoblotting with anti-E . coli SecB antibodies (see Fig . 3) . Sequences of the oligomers used for strain construction are available on request .


 FIG . 3 . Effect of secB deletion on pre-MBP processing in S . marcescens . (A) Immunodetection of SecB with anti-E . coli SecB antibodies in whole cells of E . coli MC4100, MC4100 {Delta}secB, S . marcescens SM365, and SM365 {Delta}secB::Kan . The equivalent of 0.1 OD600 unit was loaded in each lane . (B) Immunodetection of MBP with anti-E . coli MBP antibodies in SM365 in the presence of 0.4% glucose or 0.4% maltose and in SM365 {Delta}secB::Kan in the presence of 0.4% glucose or 0.4% maltose . (C) Pulse-chase analysis of pre-MBP processing in SM365 and SM365 {Delta}secB::Kan after immunoprecipitation with anti-MBP antibodies . The lower two lanes correspond to a single pulse of 15 s.

 
Plasmids. All plasmids used in this study are shown Table 1, together with the proteins they encode . Two oligomers were used to construct a variant of HasA devoid of residues 11 to 20; pSYC134/pUC was amplified with two phosphorylated oligomers, pGCTGCTGTCATAATTGACTGAAAA and pGGCCAGTGGGCTTCGACATTCGGT, and the resulting PCR product was self-ligated to yield pHasA{Delta}11-20/pUC . The construction was verified by sequencing . Plasmids were isolated, E . coli was transformed, and all DNA manipulations were performed by standard methods (32) .

Analysis of cell fractions. In most cases, E . coli and S . marcescens harboring recombinant plasmids were grown to the late exponential phase at 30°C in LB medium supplemented with the appropriate antibiotics . We used 0.4 mM dipyridyl in LB medium to induce the has operon in S . marcescens (25) . The culture was centrifuged at 10,000 x g for 10 min, proteins were precipitated from the supernatant by incubation with 20% trichloroacetic acid for 1 h at 4°C, and the precipitated proteins were harvested by centrifugation, washed in 80% acetone, resuspended in sample buffer, and subjected to electrophoresis (21) . Cell pellets were washed once in 100 mM Tris (pH 8.0)-1 mM EDTA and directly resuspended in sample buffer . Immunodetection was carried out as previously described (26) with anti-SecB, anti-HasA, anti-TolC, and anti-PrtSM sera raised in rabbits . The maltose system was induced by incubation with 0.4% maltose for 20 min during the exponential growth phase .

Pulse-chase experiments in S . marcescens. For maltose-binding protein (MBP) labeling, cells were grown in M9 minimal medium at 30°C with 0.2% glycerol and 0.2% maltose as carbon sources . Cells were labeled at an optical density at 600 nm (OD600) of 0.5 for 15 or 30 s in the presence of [35S]methionine and then chased with an excess of unlabeled methionine . For the 15 s of labeling, no chase was carried out . The 30-s labeling time points were 0, 30 s, and 1, 2, and 5 min of chase . For each point, the whole culture was trichloroacetic acid precipitated . Immunoprecipitation was then carried out with anti-E . coli MBP antibodies .

For HasA labeling, cells were grown in M9 minimal medium at 30°C with 0.4% glycerol as a carbon source and 0.2 mM dipyridyl to induce the Has operon . Cells were labeled at an OD600 of 0.2 for 1 min in the presence of [35S]methionine and then chased with an excess of unlabeled methionine . Three samples were taken, at 0, 5, and 30 min of chase . For each point, whole culture, supernatant, and cells were collected and trichloroacetic acid precipitated . Immunoprecipitation was then carried out with anti-HasA antibodies .


   RESULTS

 
Cloning of S . marcescens secB. In E . coli and many other gram-negative bacteria, secB forms part of an operon that also contains gpsA, which encodes the glycerol-3-phosphate dehydrogenase involved in the synthesis of almost all lipid precursors . The polar effect of some secB mutations on gpsA gene expression thus accounts for the glycerol auxotrophy of secB::Tn5 strains (34) . We reasoned that if, in S . marcescens as in E . coli, secB and gpsA belong to the same operon, it should be possible to isolate a fragment of the S . marcescens chromosome that carries at least gpsA and preferably also secB, able to complement a gpsA mutant from E . coli . To this end, we deleted the entire secB-gpsA region in E . coli . As expected, this strain grew on minimal glycerol medium but not on minimal glucose medium . It was also unable to produce isolated colonies on LB medium unless the medium was supplemented with glycerol .

A library of S . marcescens chromosomal DNA fragments (1 to 3 kb) in pUC18 was used to transform this strain, and recombinant clones were selected for growth on rich medium supplemented with ampicillin . Several clones were obtained and studied further . Three such clones contained the same 2.3-kb insert, the sequence of which revealed the presence of a gpsA analog, together with the 5' end of a gene analogous to cysE and a gene analogous to secB but lacking the first 12 codons identified in E . coli secB . The entire secB gene, together with an upstream region of 500 bp, was then obtained (see Materials and Methods) . We found that the putative S . marcescens SecB was 156 amino acids long and 93% identical to E . coli SecB (155 amino acids) and that the putative S . marcescens GpsA was 340 amino acids long and 85% identical to E . coli GpsA (339 amino acids) . As in E . coli, the stop codon of secB from S . marcescens overlaps the start codon of gpsA . The structure of the region is conserved between E . coli and S . marcescens, with cysE downstream from gpsA and grxC and yibN upstream from secB (not shown) . The sequence has been deposited in GenBank (BankIt480659 AF528189) . Sequence alignment of SecB proteins from different bacteria (Fig . 1) shows residue conservation . In particular, all residues for which mutations affecting function in E . coli have been identified are either completely conserved or very strongly conserved .


 FIG . 1 . Sequence comparison of SecB from various gram-negative bacteria . Sma, S . marcescens; Eco, E . coli; Sty, Salmonella enterica serovar Typhimurium; Ype, Yersinia pestis; Vch, Vibrio cholerae; Pmu, Pasteurella multocida; Hin, Haemophilus influenzae; Bsp, Buchnera sp.; Pfl, Pseudomonas fluorescens; Bap, Buchnera aphidicola; Pao, Pseudomonas aeruginosa; Xax, Xanthomonas axonopodis; Xca, Xanthomonas campestris; Xfa, Xylella fastidiosa; Nme, Neisseria meningitidis . Completely conserved residues are highlighted in black, and strongly conserved ones are in grey . Stars above the sequences point towards residues for which mutants have been obtained (see Fig . 6) . The extreme N and C termini have been omitted from the alignments.

 
S . marcescens SecB complements E . coli SecB defects. We investigated whether S . marcescens SecB was able to complement E . coli SecB function by cloning the S . marcescens secB gene into pAM238, yielding pSecBSm/pAM, which was used to transform the MC4100 {Delta}secB strain . Two phenotypes associated with SecB deficiency were investigated: defective HasA secretion in the reconstituted system and defective pre-MBP processing at the steady-state level . In both cases (Fig . 2A and 2B), pSecBsm/pAM fully complemented the defects observed, indicating that S . marcescens SecB is functional in E . coli . We also showed that S . marcescens SecB cross-reacted strongly with E . coli SecB (see Fig . 2C), as reported previously (9) .

S . marcescens strain from which secB was deleted had defective pre-MBP processing. We then investigated whether HasA secretion in S . marcescens was dependent upon SecB, as in the reconstituted system in E . coli, or whether another chaperone might fulfill this function in the original host . An S . marcescens secB mutant was constructed by replacing the secB gene with a kanamycin resistance cassette . The DNA construct was made so that the insertion of the cassette was nonpolar with respect to the expression of the downstream gpsA gene, so that the resulting strain could grow in the absence of glycerol . Kanamycin-resistant clones were obtained . They were checked by PCR for the absence of secB and its replacement by the kanamycin resistance cassette (not shown) and by antibodies for the absence of the SecB protein (see Fig . 3A) .

The S . marcescens secB mutant presented no apparent growth defect . This indicates that, as in E . coli, secB is not an essential gene in S . marcescens . We also detected, in our SM365 strain, a polypeptide cross-reacting with anti-E . coli MBP antibodies . This protein was induced by 0.4% maltose and was thus identified as S . marcescens MBP . A similar protein has already been identified in Serratia and shown to complement E . coli MBP in terms of function (7) . In the secB mutant of S . marcescens, a higher-molecular-weight cross-reacting band was also found, which we tentatively identified as the precursor of MBP, absent in the wild-type strain (Fig . 3B) . Thus, pre-MBP processing is probably dependent upon SecB in S . marcescens . A pulse-chase experiment was also carried out to prove in a kinetic fashion that S . marcescens SecB is indeed involved in pre-MBP processing (Fig . 3C) . Whereas in the wild-type strain, pre-MBP was hardly detected at the earliest time point (15 s of pulse), the precursor was readily detected in the secB mutant strain, and some precursor was never chased even for the longest chase . This is exactly what was observed for the secB mutant of E . coli, showing that SecB is indeed required for export of pre-MBP in S . marcescens.

S . marcescens strain from which secB was deleted did not secrete HasA. The secB mutant strain, together with its wild-type parent strain, was tested for HasA secretion upon induction of the chromosomal has system by iron chelation . HasA secretion was readily observed in the wild-type strain upon iron chelation (Fig . 4A, lanes 3 and 4), but this was not the case in the secB mutant (Fig . 4A, lanes 1 and 2) . Intracellular HasA was barely detectable in the secB mutant (not shown) . The HasA secretion defect of the secB mutant of S . marcescens was fully complemented by a plasmid encoding S . marcescens SecB (Fig . 4A, lanes 7 and 8) but not by a control plasmid (Fig . 4A, lanes 5 and 6) . The HasA secretion defect of the secB mutant of S . marcescens was not complemented by a multicopy plasmid encoding HasA under the control of the plac promoter (Fig . 4B, lanes 8 and 9 compared to 6 and 7); in this case, HasA is expressed independently from iron starvation at a relatively high level (lanes 2 and 4) and was found to accumulate within the cells of strain SM365{Delta}secB (Fig . 4B, lanes 4 and 5), indicating that SecB did not exert its effect via HasA expression .


 FIG . 4 . Effect of secB deletion on HasA secretion in S . marcescens . (A) Immunodetection of HasA in the supernatant of several S . marcescens strains without (lanes 1, 3, 5, and 7) or with induction of the has system with 0.4 mM dipyridyl (lanes 2, 4, 6, and 8) . The equivalent of 2 OD600 units was loaded in each lane . Lanes 1 and 2, SM365 {Delta}secB; lanes 3 and 4, SM365; lanes 5 and 6, SM365 {Delta}secB(pAM238); lanes 7 and 8, SM365 {Delta}secB(pSecBSm/pAM238) . (B) Immunodetection of HasA in whole cells and supernatants from SM365 and SM365 {Delta}secB harboring pSYC134/pAM without or with induction of the has operon with dipyridyl . Ct indicates SM365 not harboring pSYC134/pAM . (C) Pulse-chase analysis of HasA secretion in SM365 and SM365{Delta}secB::Kan . Cells were labeled and HasA was immunoprecipitated in the various fractions (T, total; S, supernatant; C, cell pellet) at the times indicated (in minutes) . (D) Immunodetection of PrtSM with anti-PrtSM antibody in supernatants of SM365 and SM365 {Delta}secB . The equivalent of 2 OD600 units was loaded in each lane.

 
Pulse-chase studies followed by immunoprecipitation with anti-HasA antibodies were carried out . This experiment indicated that a fraction of HasA was readily and quickly secreted by the SM365 strain . On the contrary, it was synthesized at comparable levels in the SM365 {Delta}secB strain and not secreted at all even at long times of chase; it was rapidly degraded inside the cell (Fig . 4C, 5-min chase for the SM365 {Delta}secB strain) . This unambiguously establishes the strict requirement for SecB in HasA secretion in S . marcescens . We consistently observed that the pool of HasA synthesized during the pulse was not completely secreted by the wild-type strain; it might be that, owing to the very low Kd of HasA for its outer membrane receptor HasR, part of the secreted HasA is tightly bound to the HasR receptor, making it behave as a cellular protein . We did not attempt to measure more precisely the kinetics of HasA secretion, since our time resolution is limited by the time of separation of the supernatant from the whole cells .

S . marcescens secretes at least two other proteins via another ABC transporter: the metalloprotease PrtSM and a lipase (1, 23) . We had previously studied the secretion of PrtSM and analogous proteases from Erwinia chrysanthemi and shown that their secretion was SecB independent in the reconstituted system in E . coli (10) . PrtSM metalloprotease secretion was also tested in the original host and found to be unaffected in the secB mutant of S . marcescens, since equal amounts of metalloprotease PrtSM were found in the supernatants of SM365 and SM365 {Delta}secB (Fig . 4D) .

secB mutant of S . marcescens possesses a functional HasA secretion apparatus. SecB might exert its effect either on the secreted protein or on the secretion apparatus itself . We thus investigated in the original host the secretion of a variant of HasA, which is largely SecB independent in the reconstituted system (see Fig . 5, lower part) . This variant presents a deletion of amino acids 11 to 20 and was produced from a high-copy-number plasmid . Upon induction of the has system by iron starvation, secretion of this variant was readily observed in SM365, together with a concomitant decrease in the amount of extracellular HasA (see Fig . 5, upper part) . As in E . coli, this HasA variant was also secreted in the secB mutant of S . marcescens, although to a much lesser extent, indicating that the absence of SecB in S . marcescens does not completely impair the functioning of the HasA secretion apparatus .


 FIG . 5 . Secretion of HasA{Delta}11-20 in various S . marcescens and E . coli strains . Immunodetection of HasA{Delta}11-20 in supernatants and whole cells of SM365, SM365 {Delta}secB::Kan, and SM365UV3 harboring pHasA{Delta}11-20/pUC, in the absence or presence of 0.4 mM dipyridyl . The equivalent of 2 OD600 units was loaded for the supernatants and of 0.2 OD600 units for the whole-cell pellets . The lower part shows a Coomassie blue-stained gel of supernatants from E . coli MC4100(pSYC150 + pHasA/pUC), MC4100 {Delta}secB(pSYC150 + pHasA/pUC), MC4100(pSYC150 + pHasA{Delta}11-20/pUC), and MC4100 {Delta}secB(pSYC150 + pHasA{Delta}11-20/pUC).

 
To rule out the possible secretion of this variant by another pathway, we used the SMUV3 strain, carrying a kanamycin cartridge in the hasA gene, with a polar effect on the expression of the downstream hasDE genes (26) . This strain does not secrete HasA and does not secrete this HasA variant introduced on a plasmid . Thus, no other system is able to secrete this HasA variant (Fig . 5, upper part) . The secretion efficiency of this HasA variant in the secB mutant of S . marcescens was much lower than that in the secB mutant of E . coli (Fig . 5, lower part); this might be due to differences in the amounts of secretion functions in the original host and in the reconstituted system, where they are produced from a plasmid . One might also envisage that the secretion of this variant is still partially SecB dependent in the original host . Moreover, in the secB mutant strain, HasF/TolC, the outer membrane component of the HasA secretion apparatus, was not affected (data not shown), ruling out a possible SecB effect on this component . HasD and HasE, the two other components of the secretion apparatus, could not be detected with our antibodies in the wild-type and secB mutant strains .

Our results show that, in S . marcescens, SecB performs functions in the general Sec pathway and in the secretion of HasA via its ABC transporter . These results indicate that SecB is a dual-function molecule in S . marcescens, interacting with Sec and non-Sec substrates and directing different substrates to different pathways . They also raise the question of possible differences in the mechanism of action of the SecB chaperone in the Sec and ABC pathways .

Point mutations in secB affect HasA secretion to different extents in the reconstituted system. SecB fulfills two distinct functions in the Sec pathway, antifolding activity and targeting to SecA (the Sec ATPase) . SecB mutations can be divided into at least two subclasses: (i) those affecting the interaction with SecA, greatly decreasing the rate of MBP export (residues 20, 24, 75, and 77 of E . coli SecB), and (ii) those affecting the oligomeric structure of SecB, which reduce the affinity for Sec precursors and cause only mild defects in the rate of MBP export (residues 74, 76, 78, and 80 of E . coli SecB) (16, 29) . We thus assessed the effect in the ABC pathway of these known SecB mutations (the residues of which are conserved in S . marcescens SecB) and for double mutations, which we constructed . These experiments were carried out in the reconstituted secretion system in E . coli .

Some SecB mutations (D20A, E24A, L75Q, L75R, and E77V) that strongly affect pre-MBP processing only mildly affected HasA secretion (see Fig . 6) . Double mutations affecting these residues were constructed (D20A/L75R, D20A/E77V, E24A/L75R, and E24A/E77V), and all had only mild effects on HasA secretion (secretion was halved, whereas a complete lack of SecB resulted in less than 10% residual HasA secretion) . Thus, these residues, although strongly involved in pre-MBP translocation, have no great effect on HasA secretion .


 FIG . 6 . Effect of secB point mutations on HasA secretion in the reconstituted system in E . coli . The name of the mutation and the residues affected are shown . (A) Coomassie blue-stained gel of supernatants from various secB mutants of MC4100 harboring pSYCAC1; the equivalent of 1 OD600 unit was loaded in each lane . (B) Immunodetection of SecB in the corresponding whole-cell pellets.

 
Other SecB mutations (C76Y and Q80R) that caused only mild defects in MBP export had a very strong effect on HasA secretion . In both cases, the SecB amount was either very strongly (Q80R) or somewhat (C76Y) reduced, precluding further analysis of the effects of those mutations . On the other hand, the two other SecB mutations, F74I and V78F, that caused only mild defects in MBP export had no effect on HasA secretion . Thus, the effects of these SecB residues on pre-MBP translocation and HasA secretion are different .


   DISCUSSION

 
In this study, we cloned the secB gene from S . marcescens and showed that it is organized similarly to the equivalent gene in E . coli, with the gpsA gene downstream and the grxC and yibN genes upstream . This structure is conserved in several gram-negative bacteria and facilitated the cloning of the gene using a gpsA mutant strain of E . coli . As in E . coli (18), secB is not an essential gene in S . marcescens, and the stop codon of secB overlaps the start codon of gpsA (20) . We also showed that S . marcescens SecB fully complemented E . coli SecB .

Our previous studies with a reconstituted Has system showed that SecB was required for HasA secretion in E . coli (10) . Furthermore, results obtained in S . marcescens with a species interfering with SecB suggested that an analogous chaperone protein fulfilled the same function in the original host . By constructing a secB null mutant of S . marcescens, we have shown that the required chaperone for HasA secretion in the original host is indeed S . marcescens SecB, as in the reconstituted system in E . coli . This result confirms that the requirement for SecB is not specific to the reconstitution in a heterologous host . It also seems that the Has system does not require a specific dedicated chaperone . Instead, we showed that, in the original host, SecB was involved in two different secretion pathways, the Sec pathway and a type I pathway specific for secretion of the HasA hemophore . This provides a direct demonstration that a supposedly Sec-dedicated chaperone may be recruited by another secretion machinery with mechanisms entirely different from those of the Sec pathway . In contrast to what is observed in the Sec pathway, in which the effects of SecB deficiency are mostly kinetic, it appears that a lack of SecB in the original host leads to a complete loss of HasA secretion .

This bifunctional role of SecB in S . marcescens raises several questions about the functions of this chaperone . The question of whether SecB functions similarly in the Has secretion and Sec pathways could be partially answered by studies of secB mutants, as we showed that the pattern of secB point mutation effect differed for HasA secretion and MBP translocation . We will discuss the possible roles of SecB in HasA secretion: antifolding activity, targeting to the ABC apparatus, and selection of the appropriate secretion pathways .

In contrast to what was observed for MBP translocation, HasA secretion was strongly affected by mutations of residues affecting the dimer-tetramer equilibrium (such as residue 76) and substrate binding . It therefore seems probable that the tetrameric structure of SecB is required for HasA secretion . These results suggest that antifolding activity may be the main function of SecB in HasA secretion . However, to test this hypothesis, true mutations of the peptide-binding site of SecB would be required .

We have previously shown that HasA secretion is not dependent on SecA activity . Indeed, HasA secretion is not affected by the presence of azide, which abolishes SecA ATPase activity (data not shown) . Consistent with this result, and in contrast to the results obtained for MBP translocation, mutations of SecB residues specifically involved in SecA interaction had a much lesser effect on HasA secretion (factor of 2 for the double mutants) than did the absence of SecB . These results suggest that the SecA targeting function of SecB is not involved in HasA secretion . We have previously proposed and shown that the specificity of SecB for the Has system is based on an early SecB-mediated interaction of the N-terminal part of HasA with the ABC transporter (8, 33) . We have also shown that SecB interacts in vitro with the ABC protein . Thus, it is possible that SecB interacts directly with the ABC protein . The residues specifically involved in this possible interaction remain to be identified .

Given the bifunctional role of SecB, the mechanism involved must facilitate distinction between Sec and non-Sec substrates once SecB is bound to its substrate . The specificity of SecB for the Sec system is based on the interaction between SecB and SecA, the ATPase of the Sec system, and the specific interaction of SecB with precursors in vivo (11, 12) . The basis for the in vivo selection of substrates by SecB is largely unknown, but the interaction between SecB and SecA is known to involve the C-terminal part of SecA and at least four SecB residues pointing towards the exterior of the molecule, comprising a patch of negatively charged residues that specifically interact with SecA (13, 14, 16, 29, 30, 38) .

It is therefore possible that selection of the appropriate pathway from these two pathways involving SecB is determined by the substrate itself . In the case of HasA, we have shown that an N-terminal region of the protein is involved in the interaction with the ABC protein and secretion efficiency (33) . The presence of this N-terminal part of HasA may be responsible for directing the substrate towards the ABC apparatus . It is also possible that another factor specifically recognizes HasA and targets it to the Has system .

 


   ACKNOWLEDGMENTS

 
We thank Laurent Debarbieux for helpful comments during this work, Jean-Marc Ghigo for help in construction of the SM365 {Delta}secB strain, Jean-Michel Betton for the gift of anti-SecB and anti-MBP antibodies, and Carol Kumamoto for the gift of secB point mutants .

G.S . is supported by a fellowship from the Fondation pour la Recherche Médicale . This work was supported by the Institut Pasteur and CNRS (URA 2172) .


   FOOTNOTES

 
* Corresponding author . Mailing address: Unité des Membranes Bactériennes, URA CNRS 2172, Institut Pasteur, 25-28 rue du Dr . Roux, 75724 Paris Cedex 15, France . Phone: 33 1 40 61 32 76 . Fax: 33 1 45 68 87 90 . E-mail: pdelep{at}pasteur.fr .


   REFERENCES

 

  1. Akatsuka, H., E . Kawai, K . Omori, S . Komatsubara, T . Shibatani, and T . Tosa. 1994 . The lipA gene of Serratia marcescens which encodes an extracellular lipase having no N-terminal signal peptide . J . Bacteriol . 176:1949-1956.
  2. Altman, E., C . A . Kumamoto, and S . D . Emr. 1991 . Heat-shock proteins can substitute for SecB function during protein export in Escherichia coli . EMBO J . 10:239-245.
  3. Binet, R., S . Letoffe, J . M . Ghigo, P . Delepelaire, and C . Wandersman. 1997 . Protein secretion by Gram-negative bacterial ABC exporters—a review . Gene 192:7-11.
  4. Binet, R., and C . Wandersman. 1996 . Cloning of the Serratia marcescens hasF gene encoding the Has ABC exporter outer membrane component: a TolC analogue . Mol . Microbiol . 22:265-273.
  5. Blondelet-Rouault, M . H., J . Weiser, A . Lebrihi, P . Branny, and J . L . Pernodet. 1997 . Antibiotic resistance gene cassettes derived from the omega interposon for use in E . coli and Streptomyces . Gene 190:315-317.
  6. Chaveroche, M . K., J . M . Ghigo, and C . d'Enfert. 2000 . A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans . Nucleic Acids Res . 28:E97.
  7. Dahl, M . K., and M . D . Manson. 1985 . Interspecific reconstitution of maltose transport and chemotaxis in Escherichia coli with maltose-binding protein from various enteric bacteria . J . Bacteriol . 164:1057-1063.
  8. Debarbieux, L., and C . Wandersman. 2001 . Folded HasA inhibits its own secretion through its ABC exporter . EMBO J . 20:4657-4663.
  9. de Cock, H., and J . Tommassen. 1991 . Conservation of components of the Escherichia coli export machinery in prokaryotes . FEMS Microbiol . Lett . 64:195-199.
  10. Delepelaire, P., and C . Wandersman. 1998 . The SecB chaperone is involved in the secretion of the Serratia marcescens HasA protein through an ABC transporter . EMBO J . 17:936-944.
  11. Driessen, A . J. 2001 . SecB, a molecular chaperone with two faces . Trends Microbiol . 9:193-196.
  12. Driessen, A . J., P . Fekkes, and J . P . van der Wolk. 1998 . The Sec system . Curr . Opin . Microbiol . 1:216-222.
  13. Fekkes, P., J . G . de Wit, J . P . van der Wolk, H . H . Kimsey, C . A . Kumamoto, and A . J . Driessen. 1998 . Preprotein transfer to the Escherichia coli translocase requires the cooperative binding of SecB and the signal sequence to SecA . Mol . Microbiol . 29:1179-1190.
  14. Fekkes, P., C . van der Does, and A . J . Driessen. 1997 . The molecular chaperone SecB is released from the carboxy-terminus of SecA during initiation of precursor protein translocation . EMBO J . 16:6105-6113.
  15. Ghigo, J . M., S . Létoffé, and C . Wandersman. 1997 . A new type of hemophore-dependent heme acquisition system of Serratia marcescens reconstituted in Escherichia coli . J . Bacteriol . 179:3572-3579.
  16. Kimsey, H . H., M . D . Dagarag, and C . A . Kumamoto. 1995 . Diverse effects of mutation on the activity of the Escherichia coli export chaperone SecB . J . Biol . Chem . 270:22831-22835.
  17. Koronakis, V., A . Sharff, E . Koronakis, B . Luisi, and C . Hughes. 2000 . Crystal structure of the bacterial membrane protein TolC central to multidrug efflux and protein export . Nature 405:914-919.
  18. Kumamoto, C . A., and J . Beckwith. 1985 . Evidence for specificity at an early step in protein export in Escherichia coli . J . Bacteriol . 163:267-274.
  19. Kumamoto, C . A., and J . Beckwith. 1983 . Mutations in a new gene, secB, cause defective protein localization in Escherichia coli . J . Bacteriol . 154:253-260.
  20. Kumamoto, C . A., and A . K . Nault. 1989 . Characterization of the Escherichia coli protein-export gene secB . Gene 75:167-175.
  21. Laemmli, U . K. 1970 . Cleavage of structural proteins during the assembly of the head of the bacteriophage T4 . Nature 227:680-685.
  22. Létoffé, S., P . Delepelaire, and C . Wandersman. 1996 . Protein secretion in gram-negative bacteria: assembly of the three components of ABC protein-mediated exporters is ordered and promoted by substrate binding . EMBO J . 15:5804-5811.
  23. Létoffé, S., P . Delepelaire, and C . Wandersman. 1991 . Cloning and expression in Escherichia coli of the Serratia marcescens metalloprotease gene: secretion of the protease from E . coli in the presence of the Erwinia chrysanthemi protease secretion functions . J . Bacteriol . 173:2160-2166.
  24. Létoffé, S., J . M . Ghigo, and C . Wandersman. 1993 . Identification of two components of the Serratia marcescens metalloprotease transporter: protease SM secretion in Escherichia coli is TolC dependent . J . Bacteriol . 175:7321-7328.
  25. Létoffé, S., J . M . Ghigo, and C . Wandersman. 1994 . Iron acquisition from heme and hemoglobin by a Serratia marcescens extracellular protein . Proc . Natl . Acad . Sci . USA 91:9876-9880.
  26. Létoffé, S., J . M . Ghigo, and C . Wandersman. 1994 . Secretion of the Serratia marcescens HasA protein by an ABC transporter . J . Bacteriol . 176:5372-5377.
  27. Miller, J . H. 1992 . A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria . Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  28. Muller, J . P., S . Bron, G . Venema, and J . M . van Dijl. 2000 . Chaperone-like activities of the CsaA protein of Bacillus subtilis . Microbiology 146:77-88.
  29. Muren, E . M., D . Suciu, T . B . Topping, C . A . Kumamoto, and L . L . Randall. 1999 . Mutational alterations in the homotetrameric chaperone SecB that implicate the structure as dimer of dimers . J . Biol . Chem . 274:19397-19402.
  30. Pearce, J. 2001 . Secs and chaperones: crystal structure of SecB . Trends Biochem . Sci . 26:90.
  31. Poteete, A . R., and A . C . Fenton. 1984 . Lambda red-dependent growth and recombination of phage P22 . Virology 134:161-167.
  32. Sambrook, J., E . F . Fritsch, and T . Maniatis. 1989 . Molecular cloning: a laboratory manual, 2nd ed . Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  33. Sapriel, G., C . Wandersman, and P . Delepelaire. 2002 . The N terminus of the HasA protein and the SecB chaperone cooperate in the efficient targeting and secretion of HasA via the ATP-binding cassette transporter . J . Biol . Chem . 277:6726-6732.
  34. Shimizu, H., K . Nishiyama, and H . Tokuda. 1997 . Expression of gpsA encoding biosynthetic sn-glycerol 3-phosphate dehydrogenase suppresses both the LB- phenotype of a secB null mutant and the cold-sensitive phenotype of a secG null mutant . Mol . Microbiol . 26:1013-1021.
  35. Spratt, B . G., P . J . Hedge, S . Tchlesen, A . Edelman, and J . K . Broomesmith. 1986 . Kanamycin-resistant vectors that are analogues of plasmids pUC8, pUC9, pEMBL1-8 and pEMBL1-9 . Gene 41:337-342.
  36. Thanabalu, T., E . Koronakis, C . Hughes, and V . Koronakis. 1998 . Substrate-induced assembly of a contiguous channel for protein export from E . coli: reversible bridging of an inner-membrane translocase to an outer membrane exit pore . EMBO J . 17:6487-6496.
  37. Woodbury, R . L., T . B . Topping, D . L . Diamond, D . Suciu, C . A . Kumamoto, S . J . Hardy, and L . L . Randall. 2000 . Complexes between protein export chaperone SecB and SecA . Evidence for separate sites on SecA providing binding energy and regulatory interactions . J . Biol . Chem . 275:24191-24198.
  38. Xu, Z., J . D . Knafels, and K . Yoshino. 2000 . Crystal structure of the bacterial protein export chaperone SecB . Nat . Struct . Biol . 7:1172-1177.
  39. Yanisch-Perron, C., J . Vieira, and J . Messing. 1985 . Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors . Gene 33:103-119.

 

 

 

Free Online Full-text Article

 

 

 

 

What Is Molecular Microbiology?, What Is Pcr?, What Is Fermentation?, What Is Listeria Monocytogenes?, What Is Prokaryote?, o, Bacterium, s, Bacteria, c, Microbes, i, Microbiology, n, Microorganisms, c, Salmonella, e, Bacteriological, a, Bacillus, i, Cell cultures, a, S. cerevisiae, o, Cell cultures, r, S. cerevisiae, r, Bacillus, s, Cell cultures, c, Salmonella, c, Antibiotic treatment, e, Escherichia coli, a, Brevibacteria, r, Vancomycin, c, S. cerevisiae, n, Clostridia, n, Petri dish, c, Gram negative, e, Yeasts, i, Microflora, o, Microbiological




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005