|
|
Plasmid, 1986 Mar, 15(2), 159 - 62 Overproduction of proteins encoded by lambda replicon-integrated plasmid: effect of partial inactivation of cI repressor; Ohta A et al.; Composite plasmids containing the 7.2-kb fragment of bacteriophage lambda cI857cro27, essential for lambda DNA replication and its control, have been constructed . The plasmids contained, in addition, pBR322, a part of Co1E1, and the Escherichia coli pss gene, coding for phosphatidylserine synthase . When the plasmid-harboring cells were induced at different temperatures, the phosphatidylserine synthase production was maximum at 37 degrees C, and the specific activities at 37 degrees C continuously increased until the culture reached saturation . The results suggest that, when the cro gene is defective, only a transient temperature for inactivation of cI repressor provides both the increase in copy number of the plasmids and cellular activities that allow overproduction of the plasmid-encoded protein. Mol Gen Genet, 1986 Mar, 202(3), 467 - 70 The alpha-glucosyltransferases of bacteriophages T2, T4 and T6 . A comparison of their primary structures; Gram H et al.; With the aim of comparing the primary structures of gene products coded for by T-even bacteriophages we constructed clone libraries of the DNAs of bacteriophages T2 and T6 . Using hybrid M13 phages carrying the gene for the T4-coded alpha-glucosyl transferase (alpha gt) we isolated corresponding T2 and T6 clones . The nucleotide sequences of the three alpha gt genes and the amino acid sequences derived were compared . The differences between the genes and their products are discussed in terms of structure, function and evolutionary aspects. Genetics, 1986 Mar, 112(3), 409 - 20 A genetic analysis of primary products of bacteriophage lambda recombination; Huisman O et al.; Primary products of bacteriophage lambda recombination that display heterozygosity as a consequence of the presence of regions of heteroduplex DNA are rare in standard lambda crosses . Phage manifesting heterozygosity at a given allele are evident when recombinants, emerging from a cross, are selected for an exchange in a neighboring interval . We show that the abundance of such heterozygotes can be increased 10- to 20-fold by selection on an E . coli indicator that is defective in methyl-directed mismatch repair (mutL) . Thus, the activity of the methyl-directed mismatch repair system is, at least in part, responsible for the low frequency of detectably heterozygous phage emerging from a standard cross . In a mutL indicator, many primary products of recombination are replicated without the intervention of mismatch repair.--The products of a six-factor phage cross have been plated on a mutL indicator allowing visual detection of those phage products heterozygous for one of the allelic pairs, cI . By genetic analysis, we show that the heteroduplex regions of these primary products of recombination are on the average about 4 kb in length and can include as much as half of the lambda genome. J Virol, 1986 Mar, 57(3), 875 - 82 Involvement of host DNA gyrase in growth of bacteriophage T5; Constantinou A et al.; Bacteriophage T5 did not grow at the nonpermissive temperature of 42 degrees C in Escherichia coli carrying a temperature-sensitive mutation in gyrB {gyrB(Ts)}, but it did grow in gyrA(Ts) mutants at 42 degrees C . These findings indicate that the A subunit of host DNA gyrase is unnecessary, whereas the B subunit is necessary for growth of T5 . The necessity for the B subunit was confirmed by a strong inhibition of T5 growth by novobiocin and coumermycin A1, which interfere specifically with the function of the B subunit of host DNA gyrase . However, T5 growth was also strongly inhibited by nalidixic acid, which interferes specifically with the function of the A subunit . This inhibition was due to the interaction of nalidixic acid with the A subunit and not just to its binding to DNA, because appropriate mutations in the gyrA gene of the host conferred nalidixic acid resistance to the host and resistance to T5 growth in such a host . The inhibition by nalidixic acid was also not due to a cell poison formed between nalidixic acid and the A subunit (K . N . Kreuzer and N . R . Cozzarelli, J . Bacteriol . 140:424-435, 1979) because nalidixic acid inhibited growth of T5 in a gyrA(Ts) mutant (KNK453) at 42 degrees C . We suggest that T5 grows in KNK453 at 42 degrees C because its gyrA(Ts) mutation is leaky for T5 . Inhibition of T5 growth due to inactivation of host DNA gyrase was caused mainly by inhibition of T5 DNA replication . In addition, however, late T5 genes were barely expressed when host DNA gyrase was inactivated. Nucleic Acids Res, 1986 Feb 25, 14(4), 1845 - 61 Effect of SSB protein on cleavage of single-stranded DNA by phi X gene A protein and A* protein; van Mansfeld AD et al.; Gene A protein of bacteriophage phi X174 plays a role as a site-specific endonuclease in the initiation and termination of phi X rolling circle DNA replication . To clarify the sequence requirements of this protein we have studied the cleavage of single-stranded restriction fragments from phi X and G4 viral DNAs using purified gene A protein . The results show that in both viral DNAs cleavage occurs at the origin and at one additional site which shows striking sequence homology with the origin region . During rolling circle replication the single-stranded viral DNA tail is covered with single-stranded DNA binding (SSB) protein . Therefore, we have also studied the effect of SSB on phi X gene A protein cleavage . In these conditions only single-stranded fragments containing the complete or almost complete origin region of 30 bases are cleaved, whereas cleavage at the additional sites of phi X or G4 viral DNAs does not occur . A model for termination of rolling circle replication which is based on these findings is presented . Finally, we present evidence that the second product of gene A, the A* protein, cleaves phi X viral DNA at the additional cleavage site in the presence of SSB, not only in vitro but also in vivo . The functional significance of this cleavage in vivo is discussed. J Immunol, 1986 Feb 15, 136(4), 1482 - 9 The mouse Thy-1.2 glycoprotein gene: complete sequence and identification of an unusual promoter; Ingraham HA et al.; Recombinant bacteriophage and cosmid clones containing the gene for the mouse Thy-1.2 glycoprotein were isolated and characterized . The complete sequence of the gene was determined, including a previously unidentified exon located 2.1 kb upstream of the portion of the gene encoding the Thy-1.2 glycoprotein . The transcriptional initiation site was located by S1 nuclease protection mapping in both T lymphocytes and neural cells and was found to be located immediately upstream of this exon . S1 nuclease protection mapping was also used to define the 3' end of the Thy-1.2 transcription unit, and no evidence for alternate mRNA processing was found . Thus, the mouse Thy-1.2 gene is 5447 base pairs in length, including promoter sequences, rather than 2094 as previously described . The mouse and rat Thy-1 genes are highly homologous in both introns and exons . However, the mouse Thy-1 cDNA and rat Thy-1 cDNA differ significantly in sequence in the 5' untranslated region . This suggests that the transcriptional initiation site of the mouse and rat genes may be located at different positions within the genomic sequence and may be related to the differing tissue distribution of Thy-1 in the two species. J Biol Chem, 1986 Feb 5, 261(4), 1653 - 5 The ionic properties of the filamentous bacteriophages Pf1 and fd; Zimmermann K et al.; The surface charge of the filamentous bacteriophages Pf1 and fd was determined by polyelectrolyte titration covering a range from pH 3 to 9 . The isoelectric point was measured at pH 4.0 for Pf1 and at pH 4.2 for fd . Close agreement of experimental and calculated data was found, confirming the hypothesis that charged residues in the DNA are neutralized by oppositely charged residues of the coat proteins . Almost perfect consistence is reached when structural details of the viruses are included. J Biol Chem, 1986 Feb 5, 261(4), 1499 - 502 Sequences complementary to the brain-specific "identifier" sequences exist in L-type pyruvate kinase mRNA (a liver-specific messenger) and in transcripts especially abundant in muscle; Lone YC et al.; A sequence complementary to the brain-specific identifier sequence has been found in the 3' untranslated extension of the heavy 3.2-kilobase (kb) long liver L-type pyruvate kinase mRNA while it is absent in the other two 2- and 2.2-kb long pyruvate kinase mRNA species . A 53-base fragment corresponding to this identifier sequence was subcloned in both orientations in the single-stranded bacteriophage M13, both strands being used as probes to detect homologous sequence in different tissues . Both strands are transcribed in various tissues and are detected in heterogeneous high molecular weight RNA species which are especially abundant in the adult muscle . In addition, the probe identical to the identifier sequence recognized a discrete 0.6-kb RNA species in the muscle and the probe complementary to the identifier-sequence recognized the expected two small brain-specific identifier BC-1 and BC-2 RNAs described by Sutcliffe et al . (Sutcliffe, J . G., Milner, R . J., Bloom, F . E., and Lerner, R . A . (1982) Proc . Natl . Acad . Sci . U . S . A . 79, 4942-4946; Sutcliffe, J . G., Milner, R . J., Gottesfeld, J . M., and Lerner, R . A . (1984) Nature 308, 237-241; Milner, R . J., Bloom, F . E., Lai, C., Lerner, R . A., and Sutcliffe, J . G . (1984) Proc . Natl . Acad . Sci . U . S . A . 81, 713-717; Sutcliffe, J . G., Milner, R . J., Gottesfeld, J . M., and Reynolds, W . (1984) Science 225, 1308-1314). J Biol Chem, 1986 Feb 5, 261(4), 1782 - 5 The nucleotide sequence of the Escherichia coli K12 dnaJ+ gene . A gene that encodes a heat shock protein; Bardwell JC et al.; The Escherichia coli dnaJ gene product is required for bacteriophage lambda DNA replication at all temperatures . It is also essential for bacterial viability in at least some conditions, since mutations in it result in temperature-sensitive bacterial growth . We have previously cloned the dnaJ gene and shown that its product migrates as a Mr 37,000 polypeptide under denaturing conditions . Here we present the primary DNA sequence of the dnaJ gene . It codes for a processed basic protein (63 basic and 51 acidic amino acids) composed of 375 amino acids totaling Mr 40,973 . The predicted NH2-terminal amino acid sequence, overall amino acid composition, and isoelectric point agree well with those of the purified protein . We present evidence that the rate of expression of the dnaJ protein is increased by heat shock under the control of the htpR (rpoH) gene product. Anal Biochem, 1986 Feb 1, 152(2), 339 - 45 Determination of a particle's radius by two-dimensional agarose gel electrophoresis; Serwer P et al.; Electrophoresis in an agarose gel dilute enough to be almost nonretarding, followed by electrophoresis in an orthogonal direction into a more concentrated agarose gel, has been developed as a procedure to determine the radius of spherical particles . Unlike procedures of unidirectional electrophoresis in a single gel, the above procedure can be used to compare the radii of particles that differ in solid-support-free electrophoretic mobility . Accuracy of 0.3 nm has been achieved with particles 30 nm in radius . It was found that the apparent radius of the spherical capsid of bacteriophage P22 decreased by 3% during elevated temperature-induced ejection of DNA from the capsid . Though originally designed for use with multimolecular particles, the procedure described here should also be useful with monomolecular particles. J Ultrastruct Mol Struct Res, 1986 Feb, 94(2), 105 - 13 Bacteriophage T3 gene 8 product oligomer structure; Carazo JM et al.; The structure of the connector of bacteriophage T3 (built up by the product of gene 8) has been studied in two dimensions by combined use of translational and rotational image filtering procedures applied to tetragonal ordered aggregates of the former oligomers . This analysis, performed up to 1/1.6 nm-1 resolution, has revealed the existence of a 12-fold symmetry in the outermost region of the specimen (mainly between radii 5.2 and 6.7 nm), a 6-fold one in the inner region (between radii 1.7 and 3.2 nm), and a hole in its center . These features are very similar to the ones described for the connectors of other phages, such as T4, lambda, and phi 29, thus suggesting a common mechanism for the functions carried out by this viral region. Dev Biol, 1986 Feb, 113(2), 501 - 11 Calmodulin gene expression during sea urchin development: persistence of a prevalent maternal protein; Floyd EE et al.; Calmodulin gene expression during embryogenesis of the sea urchin Strongylocentrotus purpuratus was investigated . Several identical bacteriophages containing a cDNA insert encoding sea urchin calmodulin (CM-1) were identified by screening a lambda gt10 library of S . purpuratus gastrula-stage cDNAs with a chicken calmodulin cDNA sequence . A 1.2-kb cDNA fragment from CM-1 was subcloned into pUC-8 to give plasmid pCAL-8 . pCAL-8 contains a single open reading frame encoding 79 amino acids, a termination codon, and 0.9 kb of 3'-untranslated message . This sea urchin amino acid sequence shows 95% homology to amino acid residues 69-148 of the predicted sequence of chicken calmodulin . Northern analysis showed that pCAL-8 hybridizes to a single size (3.2 kb) of mRNA in both embryonic and adult somatic tissues . Genome blots suggested that there is a single calmodulin gene in the S . purpuratus genome . We used pCAL-8 to study calmodulin mRNA accumulation in S . purpuratus embryos . Calmodulin mRNA is present in the unfertilized egg at the level of a typical rare-class mRNA (1000-2000 transcripts) and accumulates approximately 100-fold to levels representing about 1/10th of 1% of the total mRNA in pluteus-stage cells . Synthesis of calmodulin, identified by two-dimensional gel electrophoresis, shows a similar developmental pattern . However, in spite of the very active synthesis of calmodulin during embryogenesis, most of the calmodulin in the pluteus is apparently provided for by an enormous store of calmodulin in the egg, corresponding to about 2% of the mass of total protein. Proc Natl Acad Sci U S A, 1986 Feb, 83(4), 1084 - 8 Cloning and expression of a cDNA coding for the anticoagulant hirudin from the bloodsucking leech, Hirudo medicinalis; Harvey RP et al.; Cloned cDNAs have been isolated that encode a variant of hirudin, a potent thrombin inhibitor that is secreted by the salivary glands of the medicinal leech, Hirudo medicinalis . This variant probably corresponds to a form that has been purified from leech heads but differs in amino acid sequence from the hirudin purified from whole leeches . There are at least three hirudin transcripts detectable in leech RNAs that are different in size, site of synthesis, inducibility by starvation, and relationship to hirudin activity . The new hirudin variant predicted by the cDNA and the heterodisperse transcription products suggest a hirudin protein family . The hirudin cDNA was expressed in Escherichia coli under the control of the bacteriophage lambda PL promoter . The recombinant product is biologically active, inhibiting the cleavage by thrombin of fibrinogen and a synthetic tripeptide substrate. J Bacteriol, 1986 Feb, 165(2), 363 - 6 Cloning, overproduction, and purification of the B2 subunit of ribonucleoside-diphosphate reductase; Salowe SP et al.; The nrdB gene, which encodes the B2 subunit of Escherichia coli ribonucleotide reductase (EC 1.17.4.1), was cloned into multicopy plasmid pSPS2 . This vector, which contains the pL promoter of bacteriophage lambda and the tetracycline resistance gene of pBR322, was transformed into a lysogenic host with a thermolabile repressor . In the newly constructed strain, subunit B2 constituted approximately 25% of the soluble protein after heat induction, an overproduction of several hundredfold relative to the wild-type strain . Purification to homogeneity of the overproduced protein was accomplished by using DEAE and quaternary aminoethyl ion-exchange resins. Mol Cell Biol, 1986 Feb, 6(2), 502 - 10 Characterization and chromosome assignment of the human homolog of int-2, a potential proto-oncogene; Casey G et al.; int-2 is one of two cellular genes (int-1 and int-2) currently implicated in the genesis of mammary carcinomas by mouse mammary tumor virus and may constitute a novel cellular proto-oncogene . Using low-stringency hybridization with mouse int-2 probes, we established that homologous genes exist in a variety of mammalian species, including humans, but failed to detect related sequences in other classes and phyla . Recombinant bacteriophage clones and a single cosmid encompassing the human int-2 gene were isolated and characterized by restriction enzyme mapping . A survey of nine primary human breast tumors, three breast tumor cell lines, and three normal individuals revealed no evidence for gross amplification or rearrangement of the int-2 locus . Three distinct restriction fragment length polymorphisms were observed which could prove useful in future linkage studies . By a combination of in situ hybridization of metaphase chromosomes and somatic cell genetics, the human int-2 gene was mapped to chromosome 11, band q13. EMBO J, 1986 Feb, 5(2), 433 - 40 The integrase family of site-specific recombinases: regional similarities and global diversity; Argos P et al.; A combination of two methods for detecting distant relationships in protein primary sequences was used to compare the site-specific recombination proteins encoded by bacteriophage lambda, phi 80, P22, P2, 186, P4 and P1 . This group of proteins exhibits an unexpectedly large diversity of sequences . Despite this diversity, all of the recombinases can be aligned in their C-terminal halves . A 40-residue region near the C terminus is particularly well conserved in all the proteins and is homologous to a region near the C terminus of the yeast 2 mu plasmid Flp protein . This family of recombinases does not appear to be related to any other site-specific recombinases . Three positions are perfectly conserved within this family: histidine, arginine and tyrosine are found at respective alignment positions 396, 399 and 433 within the well-conserved C-terminal region . We speculate that these residues contribute to the active site of this family of recombinases, and suggest that tyrosine-433 forms a transient covalent linkage to DNA during strand cleavage and rejoining. Nippon Sanka Fujinka Gakkai Zasshi, 1986 Feb, 38(2), 253 - 60 Measurement of human prolactin messenger RNA in decidual tissues using complementary DNA probe cloned in M13mp9 bacteriophage; Suganuma N et al.; A human prolactin (PRL) cDNA clone was digested with restriction enzyme Pst I and the resultant fragments were cloned into bacteriophage M13mp9 . Single stranded recombinant DNAs having a coding strand of the PRL cDNA were selected by hybridization with 125I-labeled PRL mRNA obtained from human prolactinoma tissue . One of the single stranded recombinant DNAs was purified by agarose gel electrophoresis and labeled with 125I to a specific activity of 1.4 X 10(8) cpm per microgram of DNA . The probe could be successfully used in RNA dot hybridization . Analysis of poly (A) RNAs from prolactinoma, liver and placental tissues revealed that this probe was specific to PRL mRNA sequence . Hybridization of poly (A) RNA from decidual tissue to this probe revealed the presence of PRL mRNA sequence . However, PRL mRNA in decidua was at least 20,000 times less than that in pituitary prolactinoma. Proc Natl Acad Sci U S A, 1986 Feb, 83(4), 922 - 6 Bacteriophage T4 DNA topoisomerase mediates illegitimate recombination in vitro; Ikeda H; We have found that purified T4 DNA topoisomerase promotes recombination between two phage lambda DNA molecules in an in vitro system . In this cross, T4 DNA topoisomerase alone is able to catalyze the recombination and produce a linear monomer recombinant DNA that can be packaged in vitro . ATP is not required for this recombination, while oxolinic acid stimulates it . The recombinant DNA molecules contain duplications or deletions, and the crossovers take place between nonhomologous and nonspecific sequences of lambda DNA . Therefore, the recombination mediated by the T4 DNA topoisomerase is an illegitimate recombination that is similar to that mediated by Escherichia coli DNA gyrase . A model was proposed previously in which DNA gyrase molecules that are bound to DNA associate with each other and lead to the exchange of DNA strands through the exchange of DNA gyrase subunits . This model is also applicable to the recombination mediated by T4 DNA topoisomerase. J Gen Virol, 1986 Feb, 67 ( Pt 2), 333 - 43 In vitro packaging of foreign DNA into heads of bacteriophage T1; Hug H et al.; The isolation of a collection of 44 morphologically T1-like phages is described . It is shown that these phages share some similarity with T1 in terms of cross-inactivation with anti-T1 serum, particle proteins and DNA packaging in vitro by the headful process . Virion DNA extracted from these phages was treated with T1 in vitro packaging extracts and the reaction mixtures were tested for the formation of infectious phage particles . The packaging efficiencies observed varied from about 1 to 100% of that of virion T1 DNA . Phage lambda virion DNA was packaged with an efficiency of between 0.01 and 2% (5 X 10(1) to 3 X 10(3) p.f.u./micrograms DNA), the shorter deleted derivative lambda L47 being packaged more efficiently than normal length lambda C1857 DNA . Virion DNA from phages T3 and T7 was also packaged at an efficiency similar to that for lambda . The in vitro packaging of T1 DNA requires the presence of the pac sequence which initiates headful packaging from a concatemeric precursor . The high efficiency of packaging DNA from some of the T1-like phages may indicate the presence of similar packaging sequences . However, in the case of lambda L47, which is known not to contain such a sequence, the in vitro DNA packaging reaction must occur by a secondary pathway unrelated to the headful mechanism. Virology, 1986 Feb, 149(1), 128 - 31 Mutations in bacteriophage lambda that alter phage dependence on the htpR gene product of Escherichia coli; Fuerst CR; Six mutants of lambda having reduced dependence on the htpR function of Escherichia coli were isolated from lambda cIts857 . Burst sizes in htpRts cells at 40.5 degrees were in the range of 10 to 20 particles per cell . Mapping and complementation analysis of one of the mutants suggested that the mutation in this isolate is in gene J . Additional evidence that the mutations in most of the isolates are in J was provided by the finding that all but one of the mutants differ from the parental phage in properties pertaining to extended host range. Virology, 1986 Jan 30, 148(2), 298 - 311 The overproduction and characterization of the bacteriophage Mu regulatory DNA-binding protein ner; Tolias PP et al.; The bacteriophage Mu ner gene has been cloned under the control of the lacUV5 promoter in the expression vector pOP95-15 . The gene products of the recombinant plasmid, pUD88, visualized by in vitro coupled transcription-translation, are the bacteriophage Mu ner protein (8 kDa) and a 23 KDa protein consisting of the amino terminus of gpA (Mu transposase) fused to the carboxy terminus of beta-lactamase . DNA-binding activity was measured by the retardation of migration of a 32P-labeled DNA restriction fragment (containing the presumed ner-binding sites) in polyacrylamide gels . We have demonstrated specific association of ner to its binding sites to occur within 30 sec after the addition of impure extracts of ner overproducing cells . Much of this binding was dissociated within 30 sec by competition with a 20-fold molar excess of specific unlabeled DNA restriction fragment, but was resistant to dissociation when competed with unlabeled heterologous DNA for as long as 45 min at 37 degrees . By adapting a method for DNA-footprinting using impure extracts of ner overproducing cells, we were able to determine that the ner-binding sites are located between nucleotides 1026 and 1058 from the Mu left end . These results support the hypothesis that ner is similar to the cro regulatory protein from bacteriophage lambda and acts to regulate Mu early gene expression and the choice between lytic and lysogenic development. J Biol Chem, 1986 Jan 25, 261(3), 1286 - 92 Signal recognition particle mediates the insertion of a transmembrane protein which has a cytoplasmic NH2 terminus; Holland EC et al.; The mechanism by which rat liver asialoglycoprotein receptor (rat hepatic lectin, RHL) is inserted into membranes has been investigated . RHL is a prototype for transmembrane proteins which are oriented with their NH2 termini in the cytoplasm and their COOH termini outside the cell . Such transmembrane proteins are synthesized without cleavable NH2-terminal signal sequences . An in vitro translation system has been developed in which RHL is translated from RNA produced in a bacteriophage SP6 in vitro transcription system . RHL produced in this way can be inserted cotranslationally in the correct orientation into dog pancreas microsomes . This insertion process has been shown to be dependent on the signal recognition particle and its receptor (the docking protein) in the microsomal membranes . A detailed mechanism for the insertion of this type of transmembrane protein into the lipid bilayer is proposed. Nucleic Acids Res, 1986 Jan 24, 14(2), 737 - 49 Thymine glycol lesions terminate chain elongation by DNA polymerase I in vitro; Clark JM et al.; Single-strand circular DNA from bacteriophage M13mp9 was chemically modified with osmium tetroxide to introduce specifically cis-thymine glycol lesions, a major type of DNA damage produced by ionizing radiation . An oligonucleotide primer was extended on damaged and undamaged templates using either the large fragment of E . coli pol I or T4 DNA polymerase . The reaction products were analysed by electrophoresis alongside a DNA sequence ladder . Synthesis on the damaged templates terminated at positions opposite thymine bases in the template . These results indicate that cis-thymine glycol lesions in single-strand DNA constitute blocks to synthesis by DNA polymerases in vitro . Surprisingly, replication halts after the correct nucleotide, dAMP, is inserted opposite the lesion . These results imply that the primary effect of the thymine glycol lesion is suppression of DNA synthesis and that the lesion is not a potent mutagen. Nucleic Acids Res, 1986 Jan 24, 14(2), 779 - 95 The full length coding sequence of rat liver androsterone UDP-glucuronyltransferase cDNA and comparison with other members of this gene family; Jackson MR et al.; Cloned cDNAs coding for hepatic UDP-glucuronyltransferase (UDPGT) have been isolated from a rat liver cDNA library in the expression vector bacteriophage lambda gt11 using anti-UDPGT antibodies . Four different mRNAs have been identified by sequencing of 15 UDPGT cDNA clones . The sequences of the four classes of cDNA were determined to be 85-95% homologous . Restriction fragments were isolated from the cDNA in each class and used as class specific probes . Hybridisation of these probes to northern blots of total RNA prepared from the livers of normal and genetically deficient Wistar rats identified the cDNA in class 4 with androsterone UDPGT . Translation of the cDNA sequence of clone rlug 23, the longest member of class 4, allowed determination of the complete amino acid sequence of androsterone UDPGT. J Mol Biol, 1986 Jan 20, 187(2), 197 - 212 Bacteriophage P1 cre gene and its regulatory region . Evidence for multiple promoters and for regulation by DNA methylation; Sternberg N et al.; The bacteriophage P1 site-specific recombination system consists of two components, a site, loxP, at which recombination occurs, and a recombinase protein, Cre . In this paper, we present the DNA sequence of the cre structural gene and its upstream regulatory region . Analysis of the sequence indicates: (1) that cre encodes a protein of 343 amino acids; (2) that cre and loxP are separated by a 434 base-pair region that contains a 73 amino acid open reading frame, orf1; and (3) that cre and orf1 are oriented with their amino-terminal ends proximal to loxP . We have identified three promoters that are located upstream of the cre structural gene . Their activities range from 7 to 10% of the activity of the galactose operon promoter . The promoter furthest from cre, pR1, contains two Dam methylation sites (5'-G-A-T-C-3') in its -35 region, and is sensitive to Dam methylation . Its transcription is three- to fourfold higher in a dam- host than it is in a dam+ host . The promoter closest to cre, pR3, signals the production of an RNA transcript that functions inefficiently for Cre protein synthesis because it lacks a ribosome recognition site . None of the three cre promoters is sensitive to proteins expressed by the P1 prophage, including the c1 repressor protein . To assess the role of cre in the P1 life-cycle, we isolated cre mutants and studied their behavior in recA+ and recA- hosts . Those studies indicate that Cre is dispensable for viral vegetative growth and lysogeny in a recA+ host, but is required for both processes in a recA- host . The cre requirement for lysogeny suggests that the protein is essential for the cyclization of newly injected terminally redundant virion DNA . The requirement for vegetative growth suggests that Cre also has a role to play in the viral lytic cycle after the viral DNA has been cyclized. J Mol Biol, 1986 Jan 20, 187(2), 225 - 39 Binding of purified wild-type and mutant pi initiation proteins to a replication origin region of plasmid R6K; Filutowicz M et al.; The three replication origins of the antibiotic resistance plasmid R6K require for their activity in Escherichia coli a DNA segment containing seven 22 base-pair direct repeats and a plasmid-encoded initiation protein (pi) . The pi protein functions in the negative control of R6K replication, in addition to its requirement for the initiation of replication . Construction of a plasmid containing the pi structural gene (pir) downstream from the inducible pR promoter of bacteriophage lambda provided high levels of production of pi protein in E . coli . The pi protein was purified and shown to possess general DNA binding properties with a preference for DNA fragments containing the gamma origin of replication, the operator region of the pir gene and the R6K beta-origin region . Velocity sedimentation analysis indicates that the pi protein exists as a dimer in its native form . Agarose gel electrophoresis analysis of pi-gamma-origin complexes suggests that one pi dimer binds to each copy of the 22 base-pair direct repeats in the gamma origin region . Purified mutant pi protein obtained from a temperature-sensitive initiation mutant (pir 105-ts) exhibited temperature-sensitive binding activity to the gamma-origin region, whereas two mutant proteins exhibiting a high copy number phenotype were unaltered (pir104-cop) or slightly reduced (pir1-cop) in binding activity . The patterns of DNase I protection and enhancement were similar for the wild-type and mutant proteins examined. FEBS Lett, 1986 Jan 20, 195(1-2), 61 - 4 Cloning and DNA sequence of the 5'-exonuclease gene of bacteriophage T5; Kaliman AV et al.; The nucleotide sequence of the BalI-PstI fragment of T5 DNA, 1347 bp in length, coding for 5'-exonuclease (D15 gene), has been determined . A coding region of the gene contains 873 bp and is preceded by a typical Shine-Dalgarno sequence . The D15 gene belongs to a cluster, consisting of at least 3 genes, in which a termination codon of a preceding gene overlaps an initiation codon of the following one . The sequence contains an open reading frame for 291 amino acid residues . The molecular mass of the 5'-exonuclease calculated from the predicted amino acid sequence is 33 400 Da. J Mol Biol, 1986 Jan 20, 187(2), 213 - 24 hflB, a new Escherichia coli locus regulating lysogeny and the level of bacteriophage lambda cII protein; Banuett F et al.; The level of the viral cII protein has been proposed to be the crucial determinant in the lysis-lysogeny decision of bacteriophage lambda . A new Escherichia coli locus (hflB) has been identified in which a mutation (hflB29) leads to high frequency of lysogeny by lambda . A double mutant defective in both hflB and the previously identified hflA gene displays a more severe Hfl- phenotype than either single mutant . The hflB locus is at 69 minutes on the E . coli map, 85% co-transducible with argG . The hflB29 mutation results in increased stability of the phage cII protein (increasing its half-life twofold) and is recessive to hflB+ . We conclude that the hflB+ locus is a negative regulator of cII, perhaps coding for or regulating a protease that acts on cII . In addition, we observe that the can1 mutation, an alteration of the cII gene that results in enhanced lysogenization, leads to increased stability of cII protein . These observations reinforce the view that the level of cII is a key factor in the lysis-lysogeny decision of lambda. Cell, 1986 Jan 17, 44(1), 137 - 45 Deletion mapping of Sindbis virus DI RNAs derived from cDNAs defines the sequences essential for replication and packaging; Levis R et al.; Defective-interfering (DI) genomes of a virus contain sequence information essential for their replication and packaging . They need not contain any coding information and therefore are a valuable tool for identifying cis-acting, regulatory sequences in a viral genome . To identify these sequences in a DI genome of Sindbis virus, we cloned a cDNA copy of a complete DI genome directly downstream of the promoter for the SP6 bacteriophage DNA dependent RNA polymerase . The cDNA was transcribed into RNA, which was transfected into chicken embryo fibroblasts in the presence of helper Sindbis virus . After one to two passages the DI RNA became the major viral RNA species in infected cells . Data from a series of deletions covering the entire DI genome show that only sequences in the 162 nucleotide region at the 5' terminus and in the 19 nucleotide region at the 3' terminus are specifically required for replication and packaging of these genomes. Virology, 1986 Jan 15, 148(1), 198 - 209 Novel dimeric configurations from bacteriophage G4 replicative form DNA; Fishel RA et al.; The oligomeric fraction of the replicative form of phage G4 was prepared by sedimentation on three successive CsCl velocity gradients followed by resolution on CsCl-propidium diiodide equilibrium gradients and subfractions through the equilibrium gradients were examined by electron microscopy . The most frequent dimer species were the circular dimer, the singly linked catenane and the figure 8; these occurred in a ratio of 10:3:1 . The high enrichment for dimers and other oligomers made possible the observation and the determination of the frequency of occurrence of a number of minor species, some of them of novel configuration . These are (a) dimers similar to figure 8s except containing long, apparently four-stranded junctions common to the two halves (theta forms); (2) dimers similar to those in (1) except that the long junctions separate the two halves (dumbbell forms); (3) multiply catenated dimers with apparent right-handed intertwines; and (4) dimers containing a knot . Theta forms cleaved by EcoRI were shown to be stable under conditions in which EcoRI-treated figure 8s were resolved by branch migration. Biochemistry, 1986 Jan 14, 25(1), 251 - 6 Bacteriophage P22 Cro protein: sequence, purification, and properties; Poteete AR et al.; The DNA sequence of part of the bacteriophage P22 early regulatory region, including genes cro and c1, was determined . The protein product of the cro gene consists of 61 amino acid residues, and that of c1, 92 amino acid residues . Both genes were placed separately in plasmids from which they are expressed from a controllable promoter in vivo . Induced cells bearing the cro-expressing plasmid were used as a source for purifying and characterizing the Cro protein . The amino-terminal sequence of this protein was found to be as predicted by the DNA sequence; close agreement was also observed between its predicted and experimentally determined amino acid composition and molar extinction coefficient at 280 nm . In gel filtration experiments, Cro protein at concentrations around 10(-5) M appears to have a molecular weight of 8600, which is more consistent with monomers (6800) than with dimers (13 600) . Cro protein binds specifically to the three repressor binding sites in the P22 right operator; in order of decreasing affinity, these are OR3, OR1, and OR2. Biochemistry, 1986 Jan 14, 25(1), 21 - 5 Large-scale overproduction and rapid purification of the Escherichia coli ssb gene product . Expression of the ssb gene under lambda PL control; Lohman TM et al.; We report a rapid procedure for the large-scale purification of the Escherichia coli encoded single-strand binding (SSB) protein, helix-destabilizing protein which is essential for replication, recombination, and repair processes in E . coli . To facilitate the isolation of large quantities of the ssb gene product, we have subcloned the ssb gene into a temperature-inducible expression vector, pPLc28 {Remaut, E., Stanssens, P., & Fiers, W . (1981) Gene 15, 81-93}, carrying the bacteriophage lambda PL promoter . A large overproduction of the ssb gene product results upon shifting the temperature of E . coli strains which carry the plasmid and also produce the thermolabile lambda cI857 repressor . After 5 h of induction, the ssb gene product represents approximately 10% of the total cell protein . The overexpression of the ssb gene and the purification protocol reported here enable one to isolate SSB protein (greater than 99% pure) with final yields of approximately 3 mg of SSB protein/g of cell paste . In fact, very pure (greater than 99%) SSB protein can be obtained after approximately 8 h, starting from frozen cells in the absence of any columns, although inclusion of a single-stranded DNA-cellulose column is generally recommended to ensure that the purified SSB protein possesses DNA binding activity . The ability to easily purify 1 g of SSB protein from 300-350 g of induced cells will facilitate physical studies requiring large quantities of this important protein. Nucleic Acids Res, 1986 Jan 10, 14(1), 141 - 58 Sequence landscapes; Clift B et al.; We describe a method for representing the structure of repeating sequences in nucleic-acids, proteins and other texts . A portion of the sequence is presented at the bottom of a CRT screen . Above the sequence is its landscape, which looks like a mountain range . Each mountain corresponds to a subsequence of the sequence . At the peak of every mountain is written the number of times that the subsequence appears . A data structure called a DAWG, which can be built in time proportional to the length of the sequence, is used to construct the landscape . For the 40 thousand bases of bacteriophage T7, the DAWG can be built in 30 seconds . The time to display any portion of the landscape is less than a second . Using sequence landscapes, one can quickly locate significant repeats. Nucleic Acids Res, 1986 Jan 10, 14(1), 109 - 26 Analysis of the occurrence of promoter-sites in DNA; Mulligan ME et al.; We show that the occurrence and homology score (1) of promoter-sites in DNA depends upon the base composition of the DNA . We used simple probability theory to calculate the mean homology score expected for all promoter-sites that had a specific match in the canonical hexamers . By using the square root of this mean score as a measure of significance, we objectively classify all promoter-sites which are reported . We tested the theoretical approach in two ways . First, we used the program (PROMSEARCH) to analyze approximately 150,000 base pairs of random sequence DNA with different base compositions and we found excellent agreement with the theoretical predictions . Our second test was the analysis of a number of sequences drawn from the GENBANK DNA sequence database . We have analyzed 20 bacterial and bacteriophage sequences, which consisted of at least one operon, for promoter-sites . We found no absolute preference for promoter-sites within noncoding regions . We show the results of analyzing the phages lambda, T7 and fd, and the E . coli lac operon . The major known promoters in these sequences were all found correctly . We discuss the question of the location of a number of minor promoter-sites and show how PROMSEARCH can be used to help identify the correct location of the promoter . This approach can be applied to the search for any DNA site and should allow greater objectivity when comparing DNA sequences for meaningful subsequences. FEBS Lett, 1986 Jan 6, 194(2), 245 - 8 T7 and E . coli share homology for replication-related gene products; Toh H; Recently, the complete nucleotide sequence of the bacteriophage T7 genome was determined and 50 genes were identified on the genome . We compared amino acid sequences of all the gene products of T7 and replication-related gene products of E . coli . As a result, we found that T7 and E . coli share homology for each pair of exonuclease, DNA primase and helix-destabilizing protein . For E . coli, these gene products are known to be involved in the process of discontinuous DNA replication . These observations suggest that T7 and E . coli have a common origin for a part of their replication systems. J Biol Chem, 1986 Jan 5, 261(1), 391 - 6 Bacteriophage P1 Cre-loxP site-specific recombination . Site-specific DNA topoisomerase activity of the Cre recombination protein; Abremski K et al.; Site-specific recombination in bacteriophage P1 occurs between two loxP sites in the presence of the Cre recombination protein . The structure of the 34-base pair loxP site consists of two 13-base pair inverted repeats separated by an 8-base pair spacer region . A mutation in the loxP site has been constructed which deletes one of the internal bases of the spacer region at the axis of dyad symmetry . This mutant loxP site shows a 10-fold reduction in recombination activity with a wild-type site both in vivo and in vitro . This low level of intramolecular recombination between a wild-type loxP site and the mutant loxP501 site is observed in vitro only when the DNA substrate is supercoiled . The majority of the supercoiled substrate is relaxed by the Cre protein, and on longer incubations, single-stranded nicks accumulate in the DNA . We have determined that these nicks occur in both the wild-type and the mutant sites . The positions of these nicks correspond to the positions of cleavage found during recombination of two wild-type sites, suggesting that the Cre protein is attempting to carry out recombination with the mutant site but most of the time this reaction is abortive . We have determined that the Cre protein relaxes a supercoiled topoisomer of a DNA substrate containing one wild-type site and one mutant site to yield a distribution of topoisomers whose linking numbers differ by steps of one, indicating that Cre can act as a type I topoisomerase. J Biol Chem, 1986 Jan 5, 261(1), 386 - 90 Formation of transmembrane channels in liposomes during injection of lambda DNA; Roessner CA et al.; Bacteriophage lambda binds to unilamellar liposomes bearing its receptor protein, LamB, and the lambda DNA can be injected into the internal aqueous space . During this process, transmembrane channels are formed in the liposomes which permit the entry and escape of small molecules, but not proteins . The channels are stable and persist after DNA injection. Gene, 1986, 43(1-2), 123 - 30 Molecular cloning of a cDNA for human delta-aminolevulinate dehydratase; Wetmur JG et al.; A cDNA encoding human delta-aminolevulinic acid dehydratase (ALA-D; EC 4.2.1.24), the second enzyme in the heme biosynthetic pathway, was isolated from a human liver cDNA expression library . Of the original 17 clones selected with anti-ALA-D antibody, only four expressed anti-ALA-D epitopes as assessed by rescreening with antibody preabsorbed with purified antigen . Subsequent screening of the antibody-positive clones with mixed oligodeoxynucleotide (oligo) probes, synthesized to correspond to human N-terminal and bovine active-site peptide sequences, identified three clones which hybridized only with the oligo probes for the bovine amino acid (aa) sequences . Restriction endonucleases analysis revealed that these three clones contained the same 800-bp cDNA insert . This insert was recloned into bacteriophage M13mp18 and mp19 and sequenced by primer extension . The aa sequence predicted from the partial nucleotide sequence was found to be essentially colinear with the sequences of four bovine ALA-D peptides, totaling 35 non-overlapping aa residues. J Neurosci Res, 1986, 16(1), 37 - 49 Isolation and sequence of cDNA clones coding for the precursor to the gamma subunit of mouse muscle nicotinic acetylcholine receptor; Boulter J et al.; cDNA libraries have been constructed in plasmid (pBR322) and bacteriophage lambda gammagt10) vectors with poly (A+) RNA isolated from the nonfusing mouse muscle cell line BC3H-1 . The libraries were screened with a restriction fragment derived from a genomic clone coding for a human acetylcholine receptor gamma subunit . Several clones were obtained whose cDNA inserts possessed nucleotide and deduced amino acid sequence homology with acetylcholine receptor gamma subunits from Torpedo californica, chick, calf, and human . One isolate, lambda BMG419, has 88 nucleotides of 5'-untranslated sequence, an open reading frame of 1,557 nucleotides coding for the precursor to the mouse acetylcholine receptor gamma subunit, and 144 nucleotides of 3'-untranslated sequence . Alignment of the lambda BMG419-deduced amino acid sequence with homologs from other species predicts a precursor peptide of 519 amino acids and a mature protein of 497 amino acids, with nonglycosylated molecular weights of 58,744 and 56,424 daltons, respectively . Comparison of the deduced amino acid sequence of the mouse gamma subunit with Torpedo, chick, calf, and human sequences showed overall homologies of 54%, 67%, 90%, and 90%, respectively; however, significantly higher homologies were found in several putative functional domains . Radiolabeled lambda BMG419 has been used to identify homologous RNA species, one of approximately 2 kb and one of about 3.5 kb, in poly (A+) RNA prepared from BC3H-1 cells and denervated mouse limb muscle . gamma Subunit-coding RNA species are considerably more abundant in denervated than in innervated muscle, suggesting that neural regulation of the abundance of the gamma subunit is exerted through regulation of the amount of its mRNA. Gene, 1986, 43(3), 205 - 11 Nucleotide sequence identity of mitochondrial DNA from different human tissues; Monnat RJ Jr et al.; Recombinant DNA techniques have been used to search for mitochondrial (mt) nucleotide (nt) sequence differences between human tissues within an individual . mtDNA isolated from brain, heart, liver, kidney, and skeletal muscle of two different individuals was cleaved with SacI and XbaI, and then cloned in bacteriophage M13 . Partial nt sequence determination of 121 independently isolated recombinant M13 clones containing either the cytochrome oxidase subunit III gene or the D-loop region of human mtDNA revealed base substitution differences between individuals, and between each individual and the published human mtDNA sequence . A majority of these base substitutions were transitions . No systematic nt sequence differences were identified between tissues within an individual, however . These results suggest that mtDNA sequence alterations do not accompany organogenesis, and that somatic mutations do not accumulate in the mtDNA of different human tissues to a level of greater than one nt substitution per molecule. Gene, 1986, 42(1), 113 - 7 Synthesis of a fixed-length single-stranded DNA probe by blocking primer extension in bacteriophage M13; Liu JZ et al.; A simple and efficient technique has been developed for preparing radiolabeled single-stranded (ss) probes of determined length and high specific radioactivity . The human beta-globin gene intervening segment II (IVSII) fragment (0.9-kb) was inserted between the EcoRI and BamHI sites of M13mp11 and used as a template for ss probe synthesis . The M13 hybridization probe primer (M13 Hpp) was annealed to the recombinant M13mp11-beta IVSII template DNA . This M13 Hpp was next blocked by the enzymatic addition of a dideoxy adenosine monophosphate (ddAMP) residue to the 3' OH group of the primer . The M13 universal sequencing primer was then annealed and used to prepare an ss copy of the beta-IVSII fragment . Synthesis of the ss fragment was terminated by the presence of the dd-blocked M13 Hpp yielding a specific 0.9-kb ss beta-IVSII probe. Physiol Chem Phys Med NMR, 1986, 18(4), 275 - 85 Phage T7-inactivation test . A possibility of quantitative mutagenicity screening; Ronto G et al.; A new method is described for the quantitative characterization of the genotoxic effect of chemicals . The method is based on the determination of the inactivation of bacteriophage T7 and on the application of a simple mathematical model valid for the processes during, or at least in the initial stage of the interaction of chemicals and phages . A value characteristic for the chemical is defined and it is determined from the inactivation kinetics . Typical inactivation kinetic curves and some problems of the application of the model as well as the mutagenicity index values determined for about 30 substances are presented . The substances examined have mutagenicity index values covering a range of six orders of magnitude . The obtained values are compared with the results of different mutagenicity/carcinogenicity tests and discussed on the basis of data in the literature . The presented method is proposed to be applied for quantitative mutagenicity screening of chemicals. Gene, 1986, 49(2), 207 - 13 Construction of recombinant vaccinia virus strains using single-stranded DNA insertion vectors; Wilson EM et al.; The ability of single-stranded (ss) DNA, isolated from recombinant M13 bacteriophage, to direct the insertion of foreign genetic elements into the vaccinia virus (VV) genome was examined . An identical chimeric transcriptional unit {VV promoter/chloramphenicol acetyl transferase (CAT) gene embedded in DNA sequences encoding vaccinia virus thymidine kinase (TK)} was inserted into either the previously characterized plasmid insertion vector, pGS20, or into M13mp18 . It was found that the ss vector (M13mp18:TK/CAT) was four times more efficient than the plasmid vector (pGS20:CAT) in catalyzing homologous recombination of the cat gene by marker transfer into the VV genome . Furthermore, Southern blot analyses and CAT enzymatic activity assays confirmed that the structure of the M13-derived recombinant genomes were as expected and that the chimeric genes were fully active . Although the precise mechanism responsible for the ss DNA-catalyzed insertion event is not known, these results are discussed with respect to the advantages of using M13-based vectors with which to manipulate and insert genetic information into infectious VV recombinants. Gene, 1986, 49(2), 199 - 205 Linear DNA replication: inverted terminal repeats of five closely related Escherichia coli bacteriophages; Savilahti H et al.; The closely related lipid-containing bacteriophages PRD1, PR4, PR5, PR722 and L17 isolated from different parts of the world have double-stranded DNA genomes which replicate in a linear form . The nucleotide (nt) sequences of the genome termini of these viruses reveal 110-111-bp-long inverted terminal repeats (ITRs) . Both ends of the viral DNA are identical . The first 18 bp and the last 35 bp of the ITRs are totally conserved in all viruses . Between these conserved nt sequences there is a variable sequence, which enables us to divide the phages into two groups . Comparison of the virus ITRs led also to the identification of a 10-bp-long A + T stretch, where the only changes observed were transversions between A and T . The termini of the PRD1 virus family genomes exhibit sequence similarities to those of phi 29 and Cp-1 families. Gene, 1986, 48(1), 165 - 74 Nucleotide sequence and transcription of a human tRNA gene cluster with four genes; Chang YN et al.; A bacteriophage lambda clone containing a 20-kb human DNA segment was isolated and found to harbor a cluster of four tRNA genes . An 8.2-kb HindIII subfragment encompassing the genes was cloned into pBR322 for restriction mapping and DNA sequence analysis . The genes were found to be arranged as two tandem pairs, separated by 3 kb . A proline tRNAAGG gene is separated from a leucine tRNAAAG gene by a 724-bp intergenic region in the first pair, and a second proline tRNAAGG gene is 316 bp from a threonine tRNAUGU gene in the second pair, with the leucine tRNA gene being of opposite polarity to the other three genes . A putative Alu-like element was found to occur within a 2.0-kb DNA fragment, at least 0.7 kb from the tRNA gene cluster . The coding sequences of the two proline tRNAAGG genes are identical . The coding regions of all four tRNA genes contain consensus internal split promoter sequences and do not have intervening sequences nor the CCA trinucleotide found in mature tRNAs . The 3'-flanking regions of these four tRNA genes have normal RNA polymerase III termination sites of at least four consecutive T nucleotides . No apparent homologies occur between the 5'-flanking regions of these genes . All four tRNA genes are accurately transcribed in an in vitro HeLa cell-free system, and the RNase T1 fingerprints of the mature-sized tRNA transcripts were found to be consistent with the DNA sequences of the genes. Gene, 1986, 49(2), 245 - 51 The nucleotide sequence of gene 21 of bacteriophage T4 coding for the prohead protease; Keller B et al.; We have sequenced gene 21 coding for the bacteriophage T4 prohead protease . The sequence codes for a protein of 212 amino acids (aa) with an Mr of 23,251 . A second possible in-frame initiation site was also found which would code for an Mr 18,440 protein . Evidence is presented that this second site is used in vivo . The only striking homology of gp21 to other proteins is with the serine proteases . The protein is homologous to a short aa sequence around the active site, but has a His where the active site Ser is normally found . However, mutation of this His to Ser gave a functional protein that could not be inhibited by serine protease inhibitors . We have located three sites in the gene that give rise to temperature-sensitive mutations . One of these is towards the N-terminus of the gene, the other two flank the region that shows homology with serine proteases . Attempts to overproduce the protein in Escherichia coli failed due to the extreme lability of the enzyme . A frame-shift mutation in the gene was therefore constructed which allowed the synthesis of large amounts of a stable N-terminal fragment of the protein. Gene, 1986, 48(2-3), 251 - 6 Screening recombinant clones containing sequences homologous to Escherichia coli genes using single-stranded bacteriophage vector; Wei YG et al.; Detection and isolation of Escherichia coli clones carrying vectors with foreign DNA sequences partially homologous to specific E . coli genes is difficult because denatured DNA in the host genome can hybridize with the probe . In this paper we present a procedure which simplifies this task by using bacteriophage M13 as the cloning vector . The procedure takes advantage of the secretory properties of the phage, as well as the property of nitrocellulose membrane to bind protein and single-stranded DNA but not double-stranded DNA . This procedure is shown to be effective in identifying E . coli clones containing sequences of Chlamydomonas reinhardtii chloroplast DNA that are homologous to the rpoC gene of E . coli . We suggest that this procedure can be used generally for rapid isolation of DNA sequences that are homologous to E . coli genes. Appl Environ Microbiol, 1986 Jan, 51(1), 126 - 31 Transformation and transfection of anthracycline-producing streptomycetes; Lampel JS et al.; Streptomyces peucetius and Streptomyces strain C5, producers or anthracycline antibiotics, were converted to protoplasts from vegetatively growing mycelia . Conditions are described for maximal protoplast formation (greater than 99%) and for regeneration frequencies of up to 13% . Streptomycete plasmids pIJ61, pIJ702, and pIJ922, from the replicons SLP1, pIJ101, and SCP2, respectively, were isolated from Streptomyces lividans 66 and successfully introduced into S . peucetius and Streptomyces strain C5 by polyethylene glycol-mediated protoplast transformation . Frequencies of up to 10(6) transformations X microgram of plasmid DNA-1 were achieved by these procedures . Analyses showed that the two anthracycline-producing strains can stably harbor the plasmids without deletion of plasmid sequences or loss of the plasmids for several transfers through selective media . Fragments of DNA from S . peucetius ligated into pIJ702 and introduced into Streptomyces strain C5 were stable after several transfers through selective media . Both anthracycline producers also were sensitive to infection and transfection by actinophages KC401 and KC515, clear plaque derivatives of bacteriophage phi C31 . Optimal conditions were determined for the transfection of S . peucetius and Streptomyces strain C5 protoplasts with phi C31 KC401 and KC515 DNA with liposome-assisted, polyethylene glycol-mediated protoplast transfection. Gene, 1986, 48(2-3), 257 - 66 Cloning and expression of the isopenicillin N synthetase gene from Penicillium chrysogenum; Carr LG et al.; The isopenicillin N synthetase (IPS) gene from Penicillium chrysogenum was isolated from a recombinant bacteriophage lambda library using the Cephalosporium acremonium IPS (cIPS) gene as a heterologous hybridization probe . The protein coding region of the P . chrysogenum IPS (pIPS) gene was about 74% homologous to the cIPS gene, and the predicted amino acid sequences of the encoded proteins were about 73% homologous . Escherichia coli cells with the pIPS gene contained IPS activity whereas untransformed cells were completely devoid of this enzymatic activity . The transformed cells were also shown to contain an abundant protein accounting for about 10% of total cell protein which reacted strongly with anti-cIPS antiserum. J Bacteriol, 1986 Jan, 165(1), 181 - 92 Protein fusions of beta-galactosidase to the ferrichrome-iron receptor of Escherichia coli K-12; Coulton JW et al.; The fusion-generating phage lambda plac Mu1 was used to produce fusions of lacZ to fhuA, the gene encoding the ferrichrome-iron receptor (FhuA protein) in the outer membrane of Escherichia coli K-12 . Fusions to the fhuA gene in a delta (lac) strain were selected by their resistance to bacteriophage phi 80 vir . Ten independent (fhuA'-'lacZ) fusions were all Lac+ and were resistant to the lethal agents which require the FhuA protein as receptor, i.e., phi 80 vir, T5, T1, UC-1, and colicin M; none could utilize ferrichrome as the sole iron source . Specialized transducing phages were obtained by illegitimate excision from the chromosome of each of the fusion-bearing strains, and EcoRI fragments which encoded the fusions were subcloned into the high-copy plasmid pMLB524 . Physical mapping of the fusion-containing plasmids confirmed the presence of three restriction sites which were also located on the chromosomal DNA of sequences near the fhuA gene . The direction of transcription of the fhuA gene was deduced from the direction of transcription of the (fhuA'-'lacZ) gene fusion . Identification of the chimeric proteins was made by both radiolabeling cells and immunoprecipitating the LacZ-containing proteins with antibody to beta-galactosidase and by preparing whole cell extracts from Lac+ cells containing the cloned gene fusions . Two sizes of (FhuA'-'LacZ) proteins were detected, 121 kDa and 124 kDa . The DNA sequences at the unique fusion joints were determined . The sequence information allowed us to identify three distinct fusion joints which were grouped as follows, type I fusions, 5'-ACT GCT CAG CCA A-3'; type IIa fusions, 5'-GCG GTT GAA CCG A-3'; and type IIb fusions: 5'-ACC GCT GCA CCT G-3' . To orient these fhuA fusion joints, the complete nucleotide sequence of the fhuA gene was determined from a 2,902-base-pair fragment of DNA . A single open reading frame was found which translated into a 747-amino acid polypeptide . The signal sequence of 33 amino acids was followed by a mature protein with a molecular weight of 78,992 . Alignment of the amino acid sequence of the FhuA protein with the amino acid sequences presented for two other tonB-dependent receptor proteins in the outer membrane of E . coli showed an area of local homology at the amino terminus of all three proteins. Gene, 1986, 50(1-3), 69 - 85 The production of generalized transducing phage by bacteriophage lambda; Sternberg N; Generalized transduction has for about 30 years been a major tool in the genetic manipulation of bacterial chromosomes . However, throughout that time little progress has been made in understanding how generalized transducing particles are produced . The experiments presented in this paper use phage lambda to assess some of the factors that affect that process . The results of those experiments indicate: the production of generalized transducing particles by bacteriophage lambda is inhibited by the phage lambda exonuclease (Exo) . Also inhibited by lambda Exo is the production of lambda docR particles, a class of particles whose packaging is initiated in bacterial DNA and terminated at the normal phage packaging site, cos . In contrast, the production of lambda docL particles, a class of particles whose packaging is initiated at cos and terminated in bacterial DNA, is unaffected by lambda Exo; lambda-generalized transducing particles are not detected in induced lysis-defective (S-) lambda lysogens until about 60-90 min after prophage induction . Since wild-type lambda would normally lyse cells by 60 min, the production of lambda-generalized transducing particles depends on the phage being lysis-defective; if transducing lysates are prepared by phage infection then the frequency of generalized transduction for different bacterial markers varies over a 10-20-fold range . In contrast, if transducing lysates are prepared by the induction of a lambda lysogen containing an excision-defective prophage, then the variation in transduction frequency is much greater, and markers adjacent to, and on both sides of, the prophage are transduced with much higher frequencies than are other markers; if the prophage is replication-defective then the increased transduction of prophage-proximal markers is eliminated; measurements of total DNA in induced lysogens indicate that part of the increase in transduction frequency following prophage induction can be accounted for by an increase in the amount of prophage-proximal bacterial DNA in the cell . Measurements of DNA in transducing particles indicate that the rest of the increase is probably due to the preferential packaging of the prophage-proximal bacterial DNA . These results are most easily interpreted in terms of a model for the initiation of bacterial DNA packaging by lambda, in which the proteins involved (Ter) do not recognize any particular sequence in bacterial DNA but rather recognize some feature of the DNA tht is sensitive to lambda exonuclease, such as a nick or a double-stranded cut.(ABSTRACT TRUNCATED AT 400 WORDS) Gene, 1986, 50(1-3), 101 - 9 Transposition studies of mini-Mu plasmids constructed from the chemically synthesized ends of bacteriophage Mu; Patterson TA et al.; We describe below the chemical synthesis of the right and left ends of bacteriophage Mu and characterize the activity of these synthetic ends in mini-Mu transposition . Mini-Mu plasmids were constructed which carry the synthetic Mu ends together with the Mu A and B genes under control of the bacteriophage lambda pL promoter . Derepression of pL leads to a high frequency of mini-Mu transposition (5.6 X 10(-2) which is dependent on the presence of the Mu ends and the Mu A and B proteins . Five deletion mutants in the Mu ends were tested in the mini-Mu transposition system and their effects on transposition are described. Basic Life Sci, 1986, 40, 265 - 78 Extrachromosomal elements of extrachromosomal elements of Paramecium and their extrachromosomal elements; Quackenbush RL et al.; Expression of killer traits in Paramecium is due to a complex interaction between the lower eukaryote host and two or three elements that can be viewed either as extrachromosomal elements or as endosymbionts . In all cases, the determinants of the killer trait are carried by obligate bacterial endosymbionts belonging to the genus Caedibacter . However, the actual genetic determinants for expression of these traits are not an integral part of the symbiont genome . They are located on extrachromosomal genetic elements (plasmids or bacteriophages) which essentially are molecular endosymbionts of Caedibacter . In the case of the plasmids, they are associated with yet another set of extrachromosomal genetic elements, which are transposons . These transposons have been observed to move into new sites in the plasmids and even to disrupt expression of R body production and the killer trait . Thus, the transposons can be considered either as extrachromosomal elements of extrachromosomal elements (plasmids) of extrachromosomal elements (C . taeniospiralis) of paramecia, or as molecular parasites of molecular endosymbionts (plasmids) of bacterial endosymbionts of paramecia. Gene, 1986, 48(1), 101 - 8 Electron microscopic analysis of in vitro transposition intermediates of bacteriophage Mu DNA; Miller JL et al.; Bacteriophage Mu is a highly efficient transposon and the only moveable element for which an in vitro transposition system has been reported . Recently, this system has been used by Craigie and Mizuuchi {Cell 41 (1985) 867-876} to identify and biochemically characterize intermediates in the transposition process . We have utilized the in vitro transposition system to generate intermediates in the transposition process and have analyzed these intermediates by electron-microscopic methods . Partial denaturation mapping has shown the intermediates to be theta-shaped structures in which the phi X174 target DNA is joined to the mini-Mu plasmid at the ends of the Mu genome . Our results are in agreement with the previous biochemical studies and the type of intermediate we observe is exactly what is predicted by the Shapiro model of transposition {Proc . Natl . Acad . Sci . USA 76 (1979) 1933-1937}. Gene, 1986, 45(3), 311 - 6 Direct expression of urogastrone gene in Escherichia coli; Kishimoto F et al.; Human epidermal growth factor (urogastrone; UG) is a 53-amino acid polypeptide hormone . A 192-bp DNA fragment containing the coding sequence for methionyl UG (Met-UG) and the ribosome-binding site (RBS) was chemically synthesized and placed downstream from the promotor for the Escherichia coli outer-membrane lipoprotein gene (lpp) on a plasmid . E . coli cells harboring the plasmid directed the synthesis of Met-UG at 10(2)-10(3) molecules per cell . Next, the coding sequence for Met-UG was inserted in a runaway-replication plasmid and expressed under the control of the lpp promoter and the RBS derived from bacteriophage Mu cII gene . Upon heat induction, the cells harboring the recombinant plasmid synthesized 10(5) molecules of Met-UG per cell. Gene, 1986, 45(2), 193 - 201 A plasmid expression vector that permits stabilization of both mRNAs and proteins encoded by the cloned genes; Duvoisin RM et al.; Two new expression vectors have been constructed to take advantage of several useful properties of bacteriophage T4-infected Escherichia coli . These plasmids, pRDB8 and pRDB9, contain the promoter region and start codon of T4 gene 32, a contiguous multiple cloning site (MCS), and translation and transcription termination signals . DNA fragments inserted into the MCS are transcribed and translated at a high level in both uninfected and phage T4-infected cells . Furthermore, the extreme stability of the hybrid mRNA after infection permits the specific biosynthetic labeling of the protein encoded by the cloned gene . In addition, the cloned gene product is stabilized, since the host-mediated degradation of foreign proteins is inhibited by phage infection . The properties of this expression system were demonstrated with the constant region of a rabbit immunoglobulin lambda light chain (C lambda) gene . Although proteolytic degradation of the C lambda fusion protein was rapid in uninfected cells, degradation was blocked in phage-infected cells and the protein accumulated in greater amounts. J Inherit Metab Dis, 1986, 9 Suppl 1, 3 - 16 Introduction to recombinant DNA; Scott J; This paper describes the current state of knowledge of methods for analysing gene structure and localization . Illustrations are given of the preparation of complementary DNA libraries and their screening by positive-negative selection, the use of synthetic oligodeoxynucleotides and the use of antibodies . Analysis of the EGF precursor is used as an example to show its close relationship to plasma membrane receptor and its homology with the LDL receptor . Analysis of cloned genome DNA by use of bacteriophage lambda or cosmids gives useful information about gene regulation and evolution . Mutations by frame shift, point or missence mutations are discussed with reference to the LDL receptor and the apolipoproteins . The techniques of gene mapping by rat-human cell hybridization and hybridization in situ are illustrated, again with reference to genes coding for enzymes of cholesterol metabolism, the apolipoproteins and insulin-like growth factors . Finally the potential of in vitro mutagenesis and the injection of cloned DNA into the fertilized mouse ovum are discussed. Gene, 1986, 45(1), 77 - 86 Unusual occurrence of EcoP1 and EcoP15 recognition sites and counterselection of type II methylation and restriction sequences in bacteriophage T7 DNA; Schroeder C et al.; Selected and counterselected oligodeoxynucleotide sequences were identified in the total sequence of bacteriophage T7 DNA using a statistical criterion derived for a probability model of the Markov chain type . All extremely rare tetra- and pentadeoxynucleotides are (or contain) recognition sequences for the Escherichia coli DNA methylases dam or dcm . Most of the 37 hexadeoxynucleotides absent from T7 DNA are recognition sequences for type II modification/restriction enzymes of E . coli or related species . In contrast to most restriction sites counterselected during evolution, the EcoP1 site GGTCT occurs 126 times in the T7 genome, and phage T7 replication is severely repressed in P1-lysogenic host cells . We demonstrate that the frequency of the EcoP1 site is determined by that of the overlapping recognition sites for T7 primase, an essential phage enzyme . The recognition site of a type III enzyme, EcoP15, is also not counterselected . In T7 DNA all 36 EcoP15 sites are arranged in such a manner that the sequence CAGCAG is confined to the H strand, the complementary sequence CTGCTG to the L strand . This "strand bias" is highly significant and, therefore, very probably selected . A functional relation between this strand bias and the refractive behaviour of phage T7 to EcoP15 restriction is suspected. Gene, 1986, 44(1), 133 - 8 Cloning and expression of a chloramphenicol acetyltransferase gene in cytosine-substituted T4 bacteriophage; Noguchi T et al.; We have developed an efficient method for transferring foreign genes into the T4 phage genome . Any foreign genes inserted into the T4 uvsY gene cloned on plasmids can be transferred into a cytosine-substituted T4dC(delta NB5060) phage genome by a replacement type of recombination . To achieve this, we constructed chimeric plasmids which had a chloramphenicol acetyltransferase gene (cat) derived from transposon Tn9 inserted into the Bg/II site within the T4 uvsY gene on pBR322 . The cat gene was then transferred by in vivo recombination into the T4dC(delta NB5060) phage genome . Moreover, it was demonstrated that the cat gene in the hybrid T4dC phage was expressed upon phage infection and development. Gene, 1986, 43(1-2), 59 - 67 The sequence and mom-transactivation function of the C gene of bacteriophage Mu; Heisig P et al.; The mom gene of bacteriophage Mu encodes a DNA modification function . The gene is regulated on the transcriptional level by Dam-specific methylation and a trans-acting Mu function, and on a post-transcriptional level by the product of gene com . The gene encoding the transactivator has been cloned and mapped . By complementation analysis the activation function (also designated Dad) was shown to be the product of gene C . Transactivation of the mom promoter was shown in the following assay: the mom promoter and N-terminal part of com were fused in frame to lacZ . Cells containing such fusion plasmids were infected with M13 clones expressing C in the presence of IPTG and XGal . Successful transactivation results in the formation of blue plaques . Moreover, we have determined the sequence of gene C and found that it has a coding capacity of 140 amino acids . The promoter for C (pc) is likely to be located at least 0.5 kb upstream from the gene . A transcription terminator is found directly downstream from the C-coding region. Gene, 1986, 43(1-2), 155 - 67 Nucleotide sequence and transcription of a human glycine tRNAGCC gene and nearby pseudogene; Pirtle IL et al.; A bacteriophage lambda clone containing a 15.4-kb human DNA fragment was isolated and found to contain a glycine tRNA gene and, 758 bp away, a pseudogene, both with an anticodon of GCC . The nucleotide (nt) sequence of a 1362-bp segment of this clone, encompassing the gene, pseudogene, and their flanking regions, was determined . The gene and pseudogene have an identical sequence of eight nt (5'-CAGCTGGA-3') in their 5'-flanking regions immediately preceding the coding regions, as well as characteristic transcription termination sites of five consecutive T nt in the 3'-flanking regions . Neither of these genes has intervening sequences . Only one of the two genes was efficiently transcribed in vitro by RNA polymerase III in a HeLa cell-free system . During the course of transcription, primary transcripts of one gene were processed to yield mature-sized products . In contrast, the level of transcription of the second gene was significantly less than that of the first, and no mature-sized products could be detected . The nt sequence of the inefficiently transcribed gene has two base substitutions compared to the sequence of the efficiently transcribed gene, and the DNA sequence predicted from the human placental tRNAGlyGCC sequence . One of these nt substitutions is a C to T transition in the TTCG sequence within the B block of the characteristic internal split promoter sequence . The precursor-product relationships of the tRNA transcripts were established by comparing the RNase T1 and RNase A fingerprints of the precursors and products. Gene, 1986, 41(2-3), 315 - 9 Orientation and sequence analysis of right ends and target sites of bacteriophage mu and D108 insertions in the plasmid pSC101; Szatmari GB et al.; We have isolated four independent insertions of the entire 37-kb D108cts 10 genome in the low-copy-number plasmid pSC101 in vivo . They were all formed by replicative transposition during the D108 lytic cycle . The orientation of these four insertions was found to be the same, with the left ends facing towards pSC101 replication, and the right end facing in the direction of all pSC101 transcription, as was previously found for a Mucts62 insertion in pSC101, pMC321 . The exact sites of insertion of two of the D108 prophages, as well as the Mu prophage, have been determined by sequence analysis . All three insertions caused a 5-bp duplication of pSC101 sequences at the target site, as has been found for insertions formed by conservative integration upon lysogeny . Moreover, we have determined the nucleotide sequence of the first 75 bp of the right end of D108 and, though this end is interchangeable with the right end of Mu as a substrate for either phage's transposition functions, there are a number of nucleotide differences between them. Gene, 1986, 41(2-3), 193 - 200 Cloning and expression of the bacteriophage T3 RNA polymerase gene; Morris CE et al.; The gene that encodes the RNA polymerase of bacteriophage T3 (gene 1) has been cloned into a pBR322 derivative under the control of an inducible lacUV5 promoter . Large quantities of the protein are synthesized after induction of cells that carry this plasmid . RNA polymerase purified from these overproducing cells selectively initiates transcription from T3 promoter sequences as demonstrated by transcription of a dual promoter plasmid that carries both T3 and T7 promoters . Cells that carry the T3 RNA polymerase gene can complement amber mutants of T3 that are defective in gene 1 but not gene 1 amber mutants of T7, and vice versa; this experiment demonstrates the specificity of these enzymes in vivo. Gene, 1986, 41(1), 39 - 46 Plasmid pKUN9, a versatile vector for the selective packaging of both DNA strands into single-stranded DNA-containing phage-like particles; Peeters BP et al.; A versatile vector plasmid, pKUN9, has been constructed which, simply by infecting cells harboring this plasmid with either bacteriophage IKe or Ff (M13, fd, and fl), permits the selective packaging of both of its DNA strands into, single-stranded (ss) DNA-containing, phage-like particles . The plasmid, which is a derivative of plasmid pUC9 {Vieira and Messing, Gene 19 (1982) 269-276}, contains in opposite orientations the replication origins and contiguous packaging signals of the distantly related filamentous phages IKe and Ff . As a result of the selective packaging, both strands of a DNA fragment cloned in pKUN9 can be obtained in a single-stranded form and can be sequenced by the dideoxy method using commercially available (+) and (-) sequencing primers . In addition, plasmid pKUN9 possesses all unique properties incorporated in the M13mp phages and the pUC plasmids. Gene, 1986, 41(1), 129 - 34 Ultraviolet irradiation of DNA: a way of generating partial digests for rapid restriction site mapping; Whittaker PA et al.; UV-irradiation of DNA can inhibit the activity of certain restriction endonucleases because of thymine dimer formation within the enzyme recognition sequence . The number of sites affected depends upon the dose of UV, thus making it easier to control the extent of enzyme digestion than by either limiting the digestion time, or the amount of enzyme . Restriction-site maps of bacteriophage lambda recombinants are readily produced by labelling DNA using a radioactive oligonucleotide that is complementary to either the left or right cohesive end of lambda, irradiating the DNA with UV light, limit digesting with the appropriate enzyme, and calculating the size of the fragments detected after gel electrophoresis and autoradiography. Gene, 1986, 41(1), 103 - 11 Expression of immunogenically reactive diphtheria toxin fusion proteins under the control of the pR promoter of bacteriophage lambda; Zettlmeissl G et al.; The tox228 gene encoding the non-toxic, immunologically cross-reactive CRM228 mutant diphtheria toxin (DT) has been cloned downstream of the PR promoter and the cro translational initiation region of bacteriophage lambda carried by plasmid pCQV2 (Queen, 1983) . Efficient transcription but no appreciable amount of a translational product corresponding to complete DT could be detected in Escherichia coli hosts . Deletion of 320 bp from the C-terminal region of the B-fragment of DT, and fusion of the truncated tox228 gene to lacZ yielded several hybrid beta-galactosidases (beta Gal) in an E . coli lon- strain in addition to beta Gal . The various DT fragments fused to beta Gal were immunologically reactive and were identified with antibodies specifically directed against the A- or the B-fragment of DT . Antibodies raised against the DT-beta Gal fusion proteins in guinea pigs cross-reacted with wild-type DT and its B-fragment and protected Vero cells in tissue culture against the lethal action of DT . Immunized guinea pigs survived upon injection of a five-fold lethal dose of wild-type DT. Appl Environ Microbiol, 1986 Jan, 51(1), 211 - 3 Concentration of viruses in beef extract by flocculation with ammonium sulfate; Shields PA et al.; Bacteriophages and enteroviruses in water were adsorbed to positively charged filters (Virosorb 1MDS {AMF Cuno, Inc., Meriden, Conn.} or Seitz S {Republic Filters, Milldaler, Conn.}) . Adsorbed viruses were eluted by treating the filters with 10% beef extract, pH 9 . Organic flocculation of the beef extract at pH 3.5 permitted recovery of more than 40% of the enteroviruses tested but less than 15% of the bacteriophages present . A method was developed that uses salts at pH 7 to flocculate beef extract . Two volumes of saturated ammonium sulfate were added to beef extract, and both enteroviruses and bacteriophages were adsorbed to the flocs that formed . Greater than 70% of the enteroviruses and bacteriophages were recovered by centrifuging the sample and suspending the flocs in a small volume of distilled water. J Cell Biol, 1986 Jan, 102(1), 189 - 93 Alternatively spliced mRNAs code for different polypeptide chains of the chicken neural cell adhesion molecule (N-CAM); Murray BA et al.; Rabbit polyclonal antibodies directed against the chicken neural cell adhesion molecule (N-CAM) were used to isolate four overlapping cDNA clones from a chicken cDNA expression library in bacteriophage gamma gt11 . These clones collectively accounted for 3.8 kilobases of N-CAM mRNA sequence and hybridized specifically to two 6-7-kilobase brain polyadenylated RNA species that co-migrated with previously identified N-CAM mRNAs . DNA fragments derived from an internal region of the cloned cDNA sequences hybridized to the larger but not to the smaller N-CAM mRNA species, while fragments on either side of this region hybridized to both mRNAs . A cDNA fragment that recognized only the larger mRNA was subcloned into gamma gt11, and the expressed fusion protein was used to affinity-purify rabbit polyclonal antibodies; the antibodies recognized only the larger of the two structurally related N-CAM polypeptides . In contrast, when several cDNA clones that recognized both mRNAs were used to purify antibodies, the antibodies recognized both polypeptides . The results, in conjunction with other data indicating that there is one gene specifying N-CAM, suggest that different N-CAM polypeptides are synthesized from multiple N-CAM messages generated by alternative splicing of transcripts from a single N-CAM gene. J Bacteriol, 1986 Jan, 165(1), 219 - 25 Mycoplasma restriction: identification of a new type of restriction specificity for DNA containing 5-methylcytosine; Sladek TL et al.; Mycoplasma bacteriophage L51 single-stranded DNA and L2 double-stranded DNA are host cell modified and restricted when they transfect Acholeplasma laidlawii JA1 and K2 cells . The L51 genome has a single restriction endonuclease MboI site (recognition sequence GATC), which contains 5-methylcytosine when the DNA is isolated from L51 phage grown in K2 cells but is unmethylated when the DNA is from phage grown in JA1 cells . This GATC sequence is nonessential, since an L51 mutant in which the MboI site was deleted was still viable . DNA from this deletion mutant phage was not restricted during transfection of either strain K2 or JA1 . Therefore, strain K2 restricts DNA containing the sequence GATC, and strain JA1 restricts DNA containing the sequence GAT 5-methylcytosine . We conclude that K2 cells have a restriction system specific for DNA containing the sequence GATC and protect their DNA by methylating cytosine in this sequence . In contrast, JA1 cells (which contain no methylated DNA bases) have a newly discovered type of restriction-modification system . From results of studies of the restriction of specifically methylated DNAs, we conclude that JA1 cells restrict DNA containing 5-methylcytosine, regardless of the nucleotide sequence containing 5-methylcytosine . This is the first report of a DNA restriction activity specific for a single (methylated) base . Modification in this system is the absence of cytosine methylating activity . A restriction-deficient variant of strain JA1, which retains the JA1 modification phenotype, was isolated, indicating that JA1 cells have a gene product with restriction specificity for DNA containing 5-methylcytosine. J Bacteriol, 1986 Jan, 165(1), 107 - 15 fii, a bacterial locus required for filamentous phage infection and its relation to colicin-tolerant tolA and tolB; Sun TP et al.; We describe mutations in a new bacterial locus, designated fii, which do not allow the filamentous bacteriophage f1 to infect bacteria harboring the F plasmid . Mutations at this locus do not affect the ability of F plasmid-containing bacteria to undergo conjugation or be infected by the F plasmid-specific RNA phage f2 . The filamentous phage can still adsorb to the F sex pilus, but the DNA is unable to enter the bacteria . All fii mutants become tolerant to colicins E1, E2, and E3 . Strains with amber mutations in fii also are unable to plaque P1, even though they can be infected with this phage . Mutations in fii also prevent infection of bacteria harboring the N plasmid by the filamentous bacteriophage IKe . The fii locus maps adjacent to tolA, mutants of which demonstrate tolerance to high levels of the E and K colicins . The three genes tolA, tolB, and fii are shown to reside on a 4.3-kilobase fragment of the Escherichia coli chromosome . Each gene has been cloned into a chimeric plasmid and shown to complement, in trans, mutations at the corresponding chromosomal locus . Studies in maxicells show that the product of fii appears to be a 24-kilodalton protein which copurifies with the cell envelope . The product of tolA has been identified tentatively as a 51-kilodalton protein . Data from cloning, Tn5 mutagenesis, and P1 transduction studies are consistent with the gene order sucA-fii-tolA-tolB-aroG near 17 min on the E . coli map. Gene, 1986, 49(2), 273 - 82 Localization of the gam gene of bacteriophage mu and characterisation of the gene product; Akroyd J et al.; Using cloning techniques in conjunction with an in vitro assay for activity of the gam-coded protein (pgam), the gam gene has been located on a 930-bp fragment immediately to the right of an AccI site situated 5.75 kb from the left-hand end of the phage Mu genome . An analysis of the properties of pgam obtained from an overproducing clone indicates that it is a non-specific DNA-binding protein which interacts with linear duplex plasmid DNA having a variety of different termini and confers protection against exonuclease action (Gam function) . It also stimulates the frequency with which linear plasmid DNA transforms Escherichia coli to antibiotic resistance (Sot function) . The preliminary results reported here suggest that pgam is potentially a useful 'tool' in molecular biology, although the molecular details of pgam activity require further clarification. Gene, 1986, 49(2), 263 - 71 Factors which equalize the representation of genome segments in recombinant libraries; Wyman AR et al.; Genomic segments which contain inverted repetitions longer than 300 bp are frequently lost from recombinant libraries grown on rec+ hosts . We have found that 9% of phage lambda clones that contain 15-20-kb insertions of human or Drosophila DNA are inhibited on rec+ hosts and as a result will become under-represented in amplified genomic libraries . We have therefore examined several factors of both host and vector origin which affect the fidelity of representation of genomic sequences in recombinant DNA libraries constructed in bacteriophage lambda vectors . This loss may be diminished if the vector carries either a chi element or a functional gam gene . The most successful approach, however, involves using a host with mutations in recB, recC, and sbcB, or in recD . We have shown that recombinant clones which require such mutant hosts for growth are somewhat more likely to contain DNA derived from loci in the genome which are polymorphic than are clones recovered on conventional hosts. Gene, 1986, 47(2-3), 221 - 30 Gene fusion in vivo using transductional cointegrates; Struck DK et al.; A method is described which allows the efficient construction of hybrids between homologous genes . The technique is based on the phenomenon of cointegrate transduction in which the homology between cloned sequences present on a bacteriophage lambda vector and a plasmid vector is exploited to allow the packaging of a plasmid-phage recombinant . The size of the cointegrate molecule can be far beyond the normal packaging limit of lambda and still allow the transduction of plasmid-borne drug-resistance markers . This method allows the exchange of the 5' and 3' ends of the participating genes as well as the exchange of sequences residing between the end-points of homology between the two genes . Hybrids of either type were constructed between a sea urchin and a Drosophila actin gene using the transductional cointegrate method in vivo . This approach does not require the use of specialized phage or plasmid vectors and can also be used to screen plasmid libraries with a bacteriophage lambda probe. Gene, 1986, 46(2-3), 171 - 80 Repression of a mutant derivative of the pRE promoter of bacteriophage lambda by its activator, CII; Gussin GN et al.; A 2-bp insertion between the -10 and -35 regions of the pRE promoter of bacteriophage lambda reverses the effect of the activator protein, CII, on transcription from pRE in vitro . The mutant promoter is weakly constitutive in the absence of cII protein and repressed in its presence . This is in sharp contrast to wild-type pRE which is inactive in the absence of cII protein and stimulated at least 1000-fold in its presence (Shih and Gussin, 1984a; McClure and Hoopes, 1985) . These effects are explained by the creation of a new -35 region with weak homology to the -35 consensus sequence for Escherichia coli promoters, and by the altered spatial relationship between the -35 region and the CII-binding site . This interpretation was confirmed by analysis of double mutants containing known cy (pRE) mutations together with the 2-bp insertion . Insertion of 4 bp or deletion of 2 bp completely inactivates pRE in the presence or absence of cII protein, again indicating that activation is dependent upon proper spacing between the -35 region and the transcription start point. Gene, 1986, 43(3), 255 - 63 Selective inhibition of Escherichia coli recBC activities by plasmid-encoded GamS function of phage lambda; Friedman SA et al.; The gam locus of bacteriophage lambda encompasses two coding sequences with the same reading frame and translational stop, one corresponding to an Mr 11646 polypeptide (gamS gene), the other to an Mr 16349 polypeptide (gamL gene) . A DNA segment encoding gamS but not gamL was placed under lambda pR promoter control (regulated by the cIts857-coded repressor) on a multicopy plasmid, and an insertion mutation (gamS201) was constructed . Expression of gamS+, but not gamS201, inhibited Escherichia coli RecBC nuclease in vivo; the criteria were inhibition of chromosomal DNA degradation after UV irradiation and plating of T4 gene 2- phages . The recB+ C+ bacteria expressing gamS+ were completely or partially similar to recC- mutants with respect to certain phenotypes: defective plating of phages P1 and P2, ability to plate (in a recA- background) lambda red- gam- phages, reduced resistance to UV irradiation, defective SOS induction, decreased colony-forming ability. Gene, 1986, 42(3), 345 - 9 Use of the lysis gene of bacteriophage phi X174 for the construction of a positive selection vector; Henrich B et al.; DNA fragments generated by a variety of restriction enzymes can easily be cloned in the small (3.2-kb) positive-selection vector pUH84, which contains the modified lysis gene of bacteriophage phi X174 under transcriptional control of the lac promoter . Plasmid pUH84 does not yield transformants after introduction into Escherichia coli unless the lysis gene is inactivated by insertion of foreign DNA into one of the unique PstI, SalI, AccI, HincII, BamHI, or EcoRI sites . This highly efficient positive selection of recombinants requires neither the use of a distinct host strain nor a special induction of the lysis function . Transcription of fragments cloned into pUH84 may be effectively regulated by the lac promoter provided the host cells are cotransformed with the newly constructed plasmid pUH7 which carries the IQ allele of the lac repressor gene. Biosci Rep, 1986 Jan, 6(1), 103 - 12 The FI gene product of bacterial virus Lambda is related to the E . coli chromosomal protein NS2 and is involved in intracellular DNA organization; Witkiewicz H et al.; A likely function of the Lambda FI gene product (gpFI) is condensation of developmental forms of the bacteriophage DNA in the host cell . Several characteristics of gpFI support this hypothesis: it is similar in its structure and properties to E . coli NS proteins whose involvement in the bacterial DNA condensation has been established and it comigrates with DNA during fractionation of host cell lysate through a sucrose gradient. C R Acad Sci III, 1986, 302(1), 1 - 6 {Constraints acting on the base sequence in a polynucleotide . II . Distribution of complementary tetranucleotides in genes of Escherichia coli and bacteriophages lambda and T7}; Vigier P et al.; The complementary tetranucleotides tend to be equally favoured or avoid in E . coli, lambda and T7 genes . Constraints exist that act equally on nucleotide sequence of each one of both strings of DNA molecule, without any relation with the lecture phase. Proc Natl Acad Sci U S A, 1986 Jan, 83(1), 135 - 9 Cloning an expressed gene shared by the human sex chromosomes; Darling SM et al.; The existence of genes shared by mammalian sex chromosomes has been predicted on both evolutionary and functional grounds . However, the only experimental evidence for such genes in humans is the cell-surface antigen encoded by loci on the X and Y chromosomes (MIC2X and MIC2Y, respectively), which is recognized by the monoclonal antibody 12E7 . Using the bacteriophage lambda gt11 expression system in Escherichia coli and immunoscreening techniques, we have isolated a cDNA clone whose primary product is recognized by 12E7 . Southern blot analysis using somatic cell hybrids containing only the human X or Y chromosomes shows that the sequences reacting with the cDNA clone are localized to the sex chromosomes . In addition, the clone hybridizes to DNAs isolated from mouse cells that have been transfected with human DNA and selected for 12E7 expression on the fluorescence-activated cell sorter . We conclude that the cDNA clone encodes the 12E7 antigen, which is the primary product of the MIC2 loci . The clone was used to explore sequence homology between MIC2X and MIC2Y; these loci are closely related, if not identical. J Bacteriol, 1986 Jan, 165(1), 167 - 74 Translation initiation of bacteriophage lambda gene cII requires integration host factor; Mahajna J et al.; Escherichia coli integration host factor (IHF), a DNA-binding protein, positively regulates expression of the lambda cII gene . Purified IHF stimulates cII protein synthesis in vitro, suggesting a direct role for host factor in cII expression . Further evidence for a direct role for IHF was obtained with operon and gene fusions between cII and lacZ or cII and galE . Analysis of these fusions in vivo demonstrated that IHF is essential for the initiation of cII translation . Replacement of the entire cII coding sequence with lacZ yielded a gene fusion which was still IHF dependent . However, a cII-galE fusion carrying a hybrid ribosome binding region expressed galE in IHF mutants . These results indicate that sequences which make cII translation IHF dependent lie between the ribosome binding region and the initiating codon of cII . Failure to translate cII activates a transcription terminator located within cII and results in polar effects on downstream transcription . This polarity is suppressed by the lambda N antitermination function . When cloned into another context, the terminator is active in both wild-type and IHF mutant strains . The amino terminus of cII is located near an IHF binding site in a region with considerable dyad symmetry . The role of IHF in cII translation may be to prevent formation of an RNA-RNA duplex that sequesters the ribosome binding site of cII . The binding of IHF might influence RNA structure by altering the rate of the dissociation of RNA from the DNA template. Gene, 1986, 48(2-3), 183 - 93 A plasmid vector for cloning and expression of gene segments: expression of an HTLV-I envelope gene segment; Sisk WP et al.; We describe a cloning-expression vector system for selecting DNA fragments containing open reading frames (ORFs) and expressing them as beta-galactosidase (beta Gal) hybrid fusion proteins . The plasmid vector, pWS50, utilizes the very strong and easily regulated bacteriophage lambda promoter pL, and the efficient translation initiation signals of the N-terminal segment of the lambda cII gene . Fused distally to and out of translational phase with cII is the E . coli lacZ gene, lacking its own transcriptional and translational initiating signals . A unique restriction enzyme site (NruI) is located between the upstream regulatory sequences and the lacZ gene, which provides a cloning site for the insertion of blunt ended DNA fragments . In addition, there are two other unique restriction sites (NheI and BamHI) located in this region which can also be used as closing sites . If a DNA fragment does not contain any translation termination codons (i.e., an ORF), and is inserted correctly into the vector, the translational reading frame between cII and lacZ can be restored . Colonies containing these recombinants can be easily screened as LacZ+ on lactose indicator media . The beta-galactosidase fusion proteins produced from the LacZ+ recombinants are identified on sodium dodecyl sulfate polyacrylamide gels by their large size and high level of production . To test the ORF cloning-expression system, a segment of the human T-cell lymphotrophic virus type I envelope gene was cloned and expressed at high levels . The envelope-beta Gal fusion protein was recognized by antibodies in serum from a patient with adult T-cell leukemia. Gene, 1986, 41(2-3), 241 - 7 Synthesis of maize chloroplast ATP-synthase beta-subunit fusion proteins in Escherichia coli and binding to the inner membrane; Gatenby AA et al.; The maize chloroplast gene for the beta subunit (atpB) of the chloroplast CF1 component of ATPase from maize, when fused to either the lacZ or ral genes in the vectors pMC1403 or pHUB4, is expressed in Escherichia coli as a fusion protein with beta-galactosidase or with bacteriophage lambda Ral sequences . Some of the fusion proteins are converted to a membrane-bound form, as determined by differential and sucrose-gradient centrifugation . The specificity of membrane binding has been examined using E . coli unc mutants that are defective in binding of the F1 ATPase component to the F0 receptor site on the membrane, and by the use of two different length maize atpB::lacZ gene fusions . We show that the first 365 N-terminal amino acids (aa) of the maize beta subunit are involved in binding to the E . coli inner membrane, and that this binding is probably mediated by the bacterial F0 receptor. J Virol, 1986 Jan, 57(1), 258 - 66 Effects of bacteriophage fd infection on Escherichia coli HB11 envelope: a morphological and biochemical study; Bayer ME et al.; Phage fd-infected host bacteria revealed three characteristic changes in their envelope . (i) The preferred cleavage plane during freeze-fracturing shifted from the inner to the outer membrane (OM) . (ii) The total lipids of the OM of the infected cells increased by 25% without major alterations in the relative concentration of phospholipids . We propose that such an increase would to some extent contribute to the change in the freeze-fracture behavior of the OM; however, additional factors will have to play a role in the apparent fracture resistance of the inner membrane . (iii) Ultrathin sectioning and immunolabeling methods revealed that extrusion of fd phages takes place at membrane adhesion sites of the infected cells. Basic Life Sci, 1986, 38, 281 - 6 The repair of pyrimidine dimers via a DNA-glycosylase mechanism; Grafstrom RH; The "UV endonuclease" isolated either from M . luteus or bacteriophage T4 infected E . coli (the denV gene product) consists of two enzymatic activities on a single polypeptide chain: a pyrimidine dimer-DNA glycosylase and an AP endonuclease . The repair of pyrimidine dimers by this enzyme is initiated by the cleavage of the N-glycosylic bond of the 5' pyrimidine of the dimer that leaves the cyclobutane dimer still attached to the DNA through the N-glycosylic bond of the 3' pyrimidine of the dimer . This reaction results in the formation of an apyrimidinic site in the DNA . The second step in this repair pathway is the endonucleolytic cleavage of the DNA 3' to the AP site by the associated AP endonuclease . As a result, the nicked DNA contains DNA damage on both sides of the incision site: an apyrimidinic moiety on the 3' end and a thymine-thymidylate dimer on the 5' end . The enzymes prefer double stranded DNA over single stranded DNA, and thymine over cytosine at the 5' position of the dimer . The AP endonuclease activity prefers the AP site created by the pyrimidine dimer-DNA glycosylase on UV irradiated DNA over either apurinic or apyrimidinic DNA . This repair mechanism appears to be operative in vivo since DNA intermediates containing thymine-thymidylate dimer sites have been detected in UV irradiated T4 infected E . coli and in UV irradiated M . luteus . The cloned denV gene partially complements the UV repair deficient uvr A, B, C strains of E . coli. Gene, 1986, 41(1), 93 - 102 RNA splicing and in vivo expression of the intron-containing td gene of bacteriophage T4; Belfort M et al.; The splice junction sequence of td mRNA from T4-infected cells has been determined (5'....GGU-CUA....3') and shown to be identical to that of the RNA ligation product encoded by the cloned gene {Belfort et al . Cell 41 (1985) 375-382} . The RNA processing functions, T4 RNA ligase, T4 polynucleotide kinase, and the host prr gene product appear not to be essential for exon ligation; neither are the host endoribonucleases RNase III, RNase P and RNase E required for intron excision . While these results are consistent with the autocatalytic splicing mechanism demonstrated in vitro {Chu et al . J . Biol . Chem . 260 (1985) 10680-10688}, they leave unanswered the question of which protein(s), if any, might stimulate the in vivo reaction . Analysis of the products of the cloned td gene has led to identification of two td-encoded polypeptides, namely a polypeptide corresponding to the exon-I-coding sequence (NH2-TS), and the catalytically active thymidylate synthase (TS) . Kinetic and nucleotide sequence data provide evidence that NH2-TS is the product of the primary transcript and that TS is encoded by spliced mRNA . These results suggest that splicing may provide a switch controlling the relative expression of NH2-TS and TS, two proteins with markedly different temporal appearances despite their identical transcriptional and translational start sites. J Mol Biol, 1985 Dec 20, 186(4), 707 - 13 Structure-function relationship in allosteric aspartate carbamoyltransferase from Escherichia coli . I . Primary structure of a pyrI gene encoding a modified regulatory subunit; Cunin R et al.; In a previous article, we have identified a lambda bacteriophage directing the synthesis of a modified aspartate carbamoyltransferase lacking substrate-co-operative interactions and insensitive to the feedback inhibitor CTP . These abnormal properties were ascribed to a mutation in the gene pyrI encoding the regulatory polypeptide chain of the enzyme . We now report the sequence of the mutated pyrI and show that, during the generation of this pyrBI-bearing phage, six codons from lambda DNA have been substituted for the eight terminal codons of the wild-type gene . A model is presented for the formation of this modified pyrI gene during the integrative recombination of the parental lambda phage with the Escherichia coli chromosome . An accompanying paper emphasizes the importance of the carboxy-terminal end of the regulatory chain for the homotropic and heterotropic interactions of aspartate carbamoyltransferase. J Mol Biol, 1985 Dec 20, 186(4), 759 - 71 Processive action of terminase during sequential packaging of bacteriophage lambda chromosomes; Feiss M et al.; Bacteriophage lambda chromosomes are packaged in a polarized, sequential fashion from a multimeric DNA substrate . Mature chromosomes are generated when terminase introduces staggered nicks in the cohesive end sites (cos sites) bounding a chromosome . Packaging is polarized, to the initial and terminal cos sites for packaging a chromosome can be defined . To initiate packaging, terminase binds to cos at cosB, and subsequently cuts at cosN . To terminate packaging of a chromosome, a functional cosB is not required at the terminal cos . To explain this finding, it was proposed earlier that terminase scans for the terminal cosN, rather than any subsequent cosB, during packaging . In the work described here we performed helper packaging experiments to see whether processive action of terminase occurs during sequential packaging of lambda chromosomes . The helper packaging experiments involve trilysogens; strains carrying three prophages in tandem . Infection by a hetero-immune helper phage results in packaging of the repressed prophage chromosomes, since the prophage structure is analogous to the normal DNA substrate . Two chromosomes can be packaged from between the three cos sites of the prophages of a trilysogen . Both chromosomes are packaged even when the central cos is cosB- . Our interpretation of these data is that terminase is brought to the central cos by packaging; following cleavage of the central cos, the terminase remains bound to the distal chromosome; and terminase acts to begin packaging of the distal chromosome . The frequency at which terminase reads across the central cos to initiate packaging of the distal chromosome is in the range from 0.3 to 0.5 in our experiments . Reading across cos was found not to be greatly dependent on the state of cosB, indicating that cosB binding is only needed for packaging the first chromosome in a packaging series . A multilysogen was constructed in which the initial cos was cos+ and the distal cos sites were all cosB- . The initial and downstream chromosomes were found to be packaged . This result indicates that terminase that is brought to the central cos by packaging is not only able to initiate packaging of a downstream chromosome, but can also scan and terminate packaging of the downstream chromosome . A model is presented in which processive action of terminase is the basis for sequential packaging of lambda chromosomes. J Biol Chem, 1985 Dec 15, 260(29), 15907 - 13 Isolation of mutants in M13 coat protein that affect its synthesis, processing, and assembly into phage; Kuhn A et al.; The major coat protein (gene 8 protein) of bacteriophage M13 has been studied intensively as a model of membrane assembly, protein packing, and protein-DNA interactions . Because this protein is essential for assembly of the phage, very few mutants have been isolated . We have therefore cloned the gene 8 into a plasmid under control of the araB promoter . In the presence of arabinose, the cloned gene is expressed at a rate comparable to that in an M13-infected cell . Plasmid-derived procoat is inserted across the plasma membrane and processed to coat at a normal rate . The coat can support plaque formation by a defective M13 virus (M13am8) with an amber mutation in its procoat gene . This complementation assay was used to screen the mutagenized, cloned gene 8 for mutants which fail to make fully functional coat . Mutants were obtained which fail to synthesize procoat, which do not convert procoat to mature coat protein, or in which the coat protein is incapable of assembling into infectious virions. J Biol Chem, 1985 Dec 15, 260(29), 15914 - 8 Conserved residues of the leader peptide are essential for cleavage by leader peptidase; Kuhn A et al.; Gene 8 of bacteriophage M13 codes for procoat, the precursor of its major coat protein . Gene 8 has been cloned into a plasmid and mutagenized . We have isolated mutants of this gene in which procoat is synthesized but is not processed to coat protein . We now describe mutants in the leader region of procoat, at positions -6, -3, and -1 with respect to the leader peptidase cleavage site . These positions are quite conserved among the leader peptides of various pre-proteins . Each of these mutant procoats is synthesized at a normal rate and inserts correctly into the plasma membrane, as judged by its accessibility to protease in intact spheroplasts . Procoat accumulates, largely in its transmembrane form, and is not cleaved to coat . In detergent extracts, the mutant procoats are very poor substrates for added leader peptidase . We conclude that these 3 residues are not conserved for insertion across the membrane but are part of an essential recognition site for the leader peptidase. J Biol Chem, 1985 Dec 15, 260(29), 15863 - 72 The structure and organization of a proline-rich protein gene of a mouse multigene family; Ann DK et al.; One gene of the mouse proline-rich protein multigene family was cloned on a 3.6-kilobase pair EcoRI/BglII DNA fragment from a (partial) Sau3A bacteriophage library of CD-1 mouse chromosomal DNA . Phage harboring the gene were identified by plaque hybridization using 32P-labeled proline-rich protein cDNA inserts from clones pRP33 and pMP1 obtained from rat and mouse, respectively . The transcriptional unit includes three exonic sequences separated by 1434 base pairs (intron I) and 450 base pairs (intron II) . The complete primary structure of the gene and the 5' and 3' flanking regions (3595 base pairs) were determined by the Maxam and Gilbert (Maxam, A.M., and Gilbert, W . (1980) Methods Enzymol . 65, 499-560) sequencing method . The DNA on the 5' side of exon I contains several sequences that may be involved in the induction and expression of this mouse gene . These sequences include putative regulatory sites such as those considered to be inducible by cAMP and steroids, Z-DNA and enhancer sequences and the expected TATAA and CAAT boxes . The mature protein coding region, exon II, is not interrupted with intron sequences . Exon III is located in the nontranslated region and contains the poly(A) addition site . The deduced amino acid sequence showed that the protein encoded by this gene contains 13 tandemly repeat regions, each 14 amino acids in length, with the prototype sequence PPPPGGPQPRPPQG . Each amino acid within the repeat has a favored codon . The consensus DNA sequence for each repeat is CCA CCA CCA CCA GGA GGC CCA CAG CCG AGA CCC CCT CAA GGC . The high degree of conservation of both nucleotide and amino acid sequences within the repeat region suggests that proline-rich protein genes likely evolved by gene duplication of a 42-base pair internal repeat. Science, 1985 Dec 13, 230(4731), 1237 - 42 Expression of the Rous sarcoma virus pol gene by ribosomal frameshifting; Jacks T et al.; The pol gene of Rous sarcoma virus is positioned downstream of the gag gene in a different, briefly overlapping reading frame; nevertheless, the primary translation product of pol is a gag-pol fusion protein . Two mechanisms, ribosomal frameshifting and RNA splicing, have been considered to explain this phenomenon . The frameshifting model is supported by synthesis of both gag protein and gag-pol fusion protein in a cell-free mammalian translation system programmed by a single RNA species that was synthesized from cloned viral DNA with a bacteriophage RNA polymerase . Under these conditions, the ratio of the gag protein to the fusion protein (about 20 to 1) is similar to that previously observed in infected cells, the frameshifting is specific for the gag-pol junction, and it is unaffected by large deletions in gag . In addition, synthesis of the fusion protein is ten times less efficient in an Escherichia coli cell-free translation system and cannot be explained by transcriptional errors or in vitro modification of the RNA . Ribosomal frameshifting may affect production of other proteins in higher eukaryotes, including proteins encoded by several retroviruses and transposable elements. Nucleic Acids Res, 1985 Dec 9, 13(23), 8323 - 37 The nucleotide sequence of the DNA ligase gene (CDC9) from Saccharomyces cerevisiae: a gene which is cell-cycle regulated and induced in response to DNA damage; Barker DG et al.; The CDC9 gene of Saccharomyces cerevisiae encodes a DNA ligase, and we have determined the nucleotide sequence of a 3.85 kb fragment of DNA which encompasses the convergently transcribed CDC9 and CDC36 genes . S1 nuclease mapping has revealed a major 5' end for the CDC9 mRNA, and one major and one minor site for 3' polyadenylation . These two sites lie within the C-terminal coding region of the CDC36 gene, implying that these two genes are transcribed from overlapping sequences . An interesting structural feature of the CDC9 gene is a series of 6 hexanucleotide repeats (ATGATT) which occur within the 650 bp immediately upstream from the site of transcription initiation . These repeat elements may be implicated in the cell division cycle regulated expression of CDC9 . Comparison of the predicted amino acid sequence of the yeast DNA ligase (Mr 84,806) with the sequences of the T4 and T7 bacteriophage DNA ligases reveals little similarity except for a stretch of approximately 45 amino acids, comprising 3 short homologous segments . This region may represent an ATP-binding domain common to polynucleotide ligases. J Mol Biol, 1985 Dec 5, 186(3), 505 - 14 Structure-function studies of the bacteriophage T4 DNA polymerase . Isolation of a novel suppressor mutant; Reha-Krantz LJ et al.; We describe here our first attempt in using suppressor mutations to study structure-function relationships of the bacteriophage T4 DNA polymerase . One intragenic suppressor mutation, J5(43) degrees, was isolated that suppresses the temperature sensitivity but not the mutator activity of tsM19, a DNA polymerase mutant . Thus, the substituted amino acid induced by the tsM19 lesion decreases DNA polymerase fidelity, even if the temperature sensitivity has been corrected by a second amino acid substitution in the DNA polymerase polypeptide . The isolation, mapping and characterization of the J5(43) degrees mutation as well as the purification and characterization of the tsM19-J5(43) degrees mutant DNA polymerase are presented . The suppressor isolation procedure has general applicability for the selection of suppressor mutations of other T4 DNA polymerase mutator mutants. J Mol Biol, 1985 Dec 5, 186(3), 665 - 7 Determination of the cleavage site of the phage T4 prohead protease in gene product 68 . Influence of protein secondary structure on cleavage specificity; Keller B et al.; The cleavage site of the T4 prohead protease in gene product 68 of bacteriophage T4 has been determined by direct protein sequencing . It is located close to the carboxy-terminal end of a predicted alpha-helix in the sequence Asn-Val-Glu-Ala between the Glu and Ala residues . Secondary structure seems to be more important in determining cleavage than the presence of an aliphatic amino acid three residues before the cleavage site that was proposed earlier . In this case, that position is occupied by Asn, a hydrophilic residue . A second potentially cleavable Glu-Ala is found five residues after the cleaved sequence and this is preceded by an Ile at the -3 position . Despite this, the sequences of the amino and carboxyl termini of the uncleaved protein are identical to those previously proposed from an analysis of the DNA sequence of the gene. Biochemistry, 1985 Dec 3, 24(25), 7446 - 9 A stereochemical study of the mechanism of activation of donor oligonucleotides by RNA ligase from bacteriophage T4 infected Escherichia coli; Harnett SP et al.; RNA ligase from bacteriophage T4 infected Escherichia coli catalyzes the activation of adenosine 3',5'-bisphosphate (representing the donor oligonucleotide) by adenosine 5'-{(S)-alpha-17O,alpha,alpha-18O2}triphosphate with retention of configuration at P alpha . Since single-step enzyme-catalyzed nucleotidyl transfer reactions proceed with inversion, this stereochemical result provides support for a double displacement mechanism involving an adenylyl-enzyme intermediate as proposed previously from isotope exchange experiments. Eur J Biochem, 1985 Dec 2, 153(2), 355 - 9 Antitermination is required for readthrough transcription of the maize rbcL gene by a bacteriophage promoter in Escherichia coli; Gatenby AA et al.; Sequences upstream of the 5' end of the rbcL gene in maize chloroplast fragment Bam 9, have a polar effect on the expression of rbcL from an external upstream bacteriophage PL promoter in Escherichia coli . This polarity can be suppressed by the bacteriophage transcription antitermination protein N or Q . The requirement for transcription antitermination is abolished if DNA upstream of rbcL is removed by a deletion . We have also investigated the ability of RNA polymerase initiating transcription at PL in the presence of N to transcribe through the normal rbcL transcription terminator and into sequences beyond . RNA polymerase initiating at PL can traverse rbcL and its 5' and 3'-flanking regions in the presence of N. Mol Gen Mikrobiol Virusol, 1985 Dec, (12), 36 - 8 {Hybrid plasmid with bacterial and fungal markers carrying the denV gene of T4 phage and restoring the UV-resistance of E . coli uvrA}; Bekker ML et al.; The hybrid plasmid pYBP2 with bacterial (ampR), yeast (LEU2) and bacteriophage T4 (denV) genes has been constructed . The plasmid transformed Escherichia coli CSR603 uvrA recA ampS leuA phr- to ampicillin resistance, leucine independence, UV-resistance similar to the one of uvrA+ recA strain . Cell-free extracts of transformed Escherichia coli cells contain low level of ultraviolet-endonuclease activity in contrast to nontransformed cells containing no enzyme. Mol Gen Mikrobiol Virusol, 1985 Dec, (12), 19 - 25 {Specific modification of DNA at E . coli RNA-polymerase binding sites}; Petrenko VA et al.; Specific modification of promoter regions of DNA has been studied . Plasmid pK56B1 DNA has been used as a model to test RNA-polymerase binding with DNA under various conditions . RNA-polymerase is shown to form specific complexes with DNA which are stable in solutions with a moderate ionic strength (0.1-0.2 M NaCl), under pH 5-8 in the presence of 0.5 M O-methylhydroxylamine of O-delta-aminooxybutylhydroxylamine . Escherichia coli JM103 cells have been transfected with DNAs treated with 0.5 M O-methylhydroxylamine at 37 degrees C, pH 5.2 . The inactivation effects of the mutagen on single-stranded DNA of bacteriophage M13 m p1, double-stranded form of this bacteriophage (replicative form-RF) and on the complex of RNA-polymerase with RF DNA have been compared . The obtained data confirmed the specificity of reagent action with DNA sites binding with the enzyme . Selectivity of promoters modification has been confirmed also by the analysis of M13 m p1 DNA mutations induced in lacZ' gene by delta-aminooxybutylhydroxylamine effect on the DNA complex with DNA-polymerase. J Biochem (Tokyo), 1985 Dec, 98(6), 1473 - 85 Purification of bacteriophage T7 DNA-membrane complex and its application to the in vitro recombination reaction; Shimizu K et al.; In order to construct an in vitro recombination system of T7 DNA, the reaction products of which resemble those in vivo in structure, T7 DNA-membrane complex which is free from concomitant DNase activity was purified from T7 phage-infected cells . T7-infected cells were lysed with T4 lysozyme/Brij58, and T7 DNA-membrane complex was purified through three successive density gradient centrifugations . The properties of the complex on exposure to defined nucleases and observation of the complex by electron microscopy revealed that in T7 DNA-membrane complex, both ends of a linear T7 DNA are bound with membrane components . A mixture of 32P-labeled T7 DNA-membrane complex and BU-labeled T7 DNA-membrane complex was incubated with T7 exonuclease and T7 DNA-binding protein, and the reaction products with intermediate density were purified . Most of the products were found to have structures similar to that of the recombination intermediate found in T7-infected cells upon electron microscopic examination. EMBO J, 1985 Dec 1, 4(12), 3315 - 20 The amino terminal half of the MS2-coded lysis protein is dispensable for function: implications for our understanding of coding region overlaps; Berkhout B et al.; We have asked whether genetic overlaps only evolve to provide extra coding capacity in genomes of restricted size . As a model system we have used the lysis gene of the RNA bacteriophage MS2 . This gene overlaps with the distal part of the coat protein gene and with the proximal part of the replicase gene . Using recombinant DNA procedures we have determined whether either of the two overlaps codes for amino acids that are not essential for the function of the 75 amino acid long lysis protein . We find that the first 40 amino acids of the lysis protein are dispensable for function . Thus all of the genetic information essential to the synthesis of the active C-terminal peptide lies within the overlap with the replicase gene, whereas all dispensable residues are encoded in the overlap with the coat protein gene and in the intercistronic region . This suggests that the overlap with the coat protein gene is not required for extra coding capacity but serves to regulate the expression of the lysis gene . Comparative sequence analysis is consistent with this idea. Proc Natl Acad Sci U S A, 1985 Dec, 82(24), 8602 - 5 Biological effects of background radiation: mutagenicity of 40K; Gevertz D et al.; The naturally occurring radioactive isotope 40K is the single largest contributor to the internal background radiation dose in living organisms . We examined cell growth and mutation rate or frequency in several strains of Escherichia coli in (i) media containing the natural content of 40K, (ii) media containing potassium from which essentially all of the 40K had been removed by isotope separation, and (iii) media highly enriched in 40K . Growth rates (doubling times) were identical in the present or absence of 40K . In more than 40 chemostat experiments, we were unable to detect any significant differences in mutation rate to bacteriophage T5 resistance or in mutation frequency to valine resistance or tryptophan prototrophy attributable to 40K . We conclude that, in the bacterial systems we have studied, 40K does not make a significant contribution to spontaneous mutation. Virology, 1985 Dec, 147(2), 459 - 61 Role of the gene 17 protein of bacteriophage T4; Kawai Y et al.; Head-related particles of bacteriophage T4 were examined by using heat leakage scanning calorimetry . The 17- particles showed two endothermic peaks on thermograms during their thermal transition process, while 49- particles gave only a single sharp endothermic peak . Thermograms of 17- particles treated with 23- defective lysate were different from those of nontreated 17- particles, and closely resembled thermograms of 49- particles . The 31- defective lysate was also capable of converting thermal properties of 17- particles . These results suggest that there is a structural difference between 17- particles and 49- particles, and that the product gene 17 of bacteriophage T4 is involved in the structural conversion of prohead to a more completed structure. Proc Natl Acad Sci U S A, 1985 Dec, 82(23), 7960 - 4 Ion etching bacteriophage T4: support for a spiral-fold model of packaged DNA; Black LW et al.; Ion etching of bacteriophage T4 erodes virus components progressively from the outside to the inside while preserving the overall structure . The terminal portion of the T4 DNA molecule packaged can be specifically radiolabeled and was found to be eroded more rapidly than the remainder of the DNA . This strongly suggests that the first DNA to enter the prohead is condensed in the center of the capsid and is therefore shielded from the ion beam by the surrounding last packaged DNA . The results support a "spiral-fold" model for the arrangement of DNA within the icosahedral bacteriophage head . According to this model, phage T4 DNA strands run parallel to the long axis of the phage, with sharp (180 degrees) bends at the top and bottom of the capsid . The folds themselves are arranged radially about the long axis of the head in spirally organized shells. Mol Cell Biol, 1985 Dec, 5(12), 3621 - 4 Can ACG serve as an initiation codon for protein synthesis in eucaryotic cells? Anderson CW, Buzash-Pollert E. An ACG codon, which replaces the AUG codon used to initiate the synthesis of bacteriophage T7 gene 0.3 protein, was shown to function as a low-efficiency initiation codon in a wheat germ cell-free protein-synthesizing system. J Hyg (Lond), 1985 Dec, 95(3), 611 - 8 Escherichia coli as a genetic tool; Datta N; The study of Escherichia coli and its plasmids and bacteriophages has provided a vast body of genetical information, much of it relevant to the whole of biology . This was true even before the development of the new techniques, for cloning and analysing DNA, that have revolutionized biological research during the past decade . Thousands of millions of dollars are now invested in industrial uses of these techniques, which all depend on discoveries made in the course of academic research on E . coli . Much of the background of knowledge necessary for the cloning and expression of genetically engineered information, as well as the techniques themselves, came from work with this organism. Appl Environ Microbiol, 1985 Dec, 50(6), 1502 - 4 Concentration of viruses from water by using cellulose filters modified by in situ precipitation of ferric and aluminum hydroxides; Farrah SR et al.; Untreated cellulose filters adsorbed only small amounts of poliovirus 1, echovirus 5, coxsackievirus B5, or bacteriophage MS2 that were added to tap water or to solutions of imidazole-glycine buffer at pH 5 to 7 . Modification of filters by in situ flocculation of ferric and aluminum hydroxides greatly increased the ability of the filters to adsorb viruses . Viruses adsorbed to the modified filters could be recovered by treating the filters with 3% beef extract (pH 9.5) . Greater than 60% of the enteroviruses and greater than 55% of the MS2 added to tap water or buffer could be recovered in the beef extract eluate. Proc Natl Acad Sci U S A, 1985 Dec, 82(24), 8424 - 8 In vitro synthesis of infectious poliovirus RNA; Kaplan G et al.; Replication of the infectious RNA genome of poliovirus is accomplished in cells by the viral RNA polymerase through negative-strand RNA intermediates . Full-length negative-strand poliovirus RNA was synthesized in vitro by transcription of infectious poliovirus cDNA with bacteriophage SP6 DNA-dependent RNA polymerase . When provided with this negative-strand RNA as template, the poliovirus RNA-dependent RNA polymerase synthesized full-length positive-strand molecules . The positive-strand RNAs synthesized in vitro were infectious when transfected into HeLa cells . In contrast, positive-strand copies of poliovirus RNA synthesized in vitro by SP6 polymerase, using a poliovirus cDNA template, were not infectious . Production of infectious positive-strand RNA by the poliovirus polymerase was not observed when magnesium or negative-strand RNA template was omitted from the reaction mixture . Infectivity of the product RNA was not destroyed by DNase treatment . The specific infectivity in HeLa cells of in vitro-synthesized positive-strand RNA was 4 X 10(4) plaque-forming units/micrograms of RNA. Cell, 1985 Dec, 43(2 Pt 1), 461 - 9 The stability of bacteriophage T4 gene 32 mRNA: a 5' leader sequence that can stabilize mRNA transcripts; Gorski K et al.; In T4-infected cells, the gene 32 monocistronic mRNA is very stable . To study the molecular basis for this stability, we have constructed chimeric plasmids containing the monocistronic promoter and the gene 32 translation initiation sequence fused to either most of the E . coli lac operon or only a segment of the lacZ gene, followed by the gene 32 transcription terminator . The resulting hybrid transcripts are unstable in uninfected cells . In phage-infected cells, however, the hybrid mRNAs are at least as stable as gene 32 mRNA itself . Analysis of other plasmid constructs indicates that the sequences on the gene 32 mRNA from its 5' end to slightly beyond the initiation codon suffice to stabilize these hybrids . Studies with a series of deletions of the gene 32 leader sequence suggest that an RNA sequence near the gene 32 initiation codon is involved . Various models to explain this mRNA stabilization are discussed. Virology, 1985 Dec, 147(2), 349 - 53 Nucleotide sequence of bacteriophage T4 uvsY gene; Takahashi H et al.; We have determined the nucleotide sequence of a 1001-bp region comprising the uvsY gene of bacteriophage T4 . An open reading frame of 420 base pairs was found to encode the uvsY gene product . The uvsY gene comprised a 140-amino acid protein with ATG (methionine) as the initiation codon, which is consistent with the molecular weight determined by SDS-polyacrylamide gel electrophoresis . The uvsY gene was oriented in the direction of the early genes and a sequence common to the middle promoter consensus was found in the 5'-upstream region. Mol Cell Biol, 1985 Dec, 5(12), 3634 - 9 Structure of the rat alpha 1-acid glycoprotein gene; Liao YC et al.; The complete nucleotide sequence of the rat alpha 1-acid glycoprotein gene has been determined from an isolated lambda recombinant bacteriophage . Southern blot analysis and DNA sequencing indicate that there is only one gene per genome; it contains six exons and is located within a 3,200-base-pair fragment starting from a TATA box and extending to the polyadenylation signal AATAAA . Transcription starts 37 base pairs upstream from the beginning of the translation codon ATG . The TATA box (TATAAA) lies 26 base pairs upstream from this site . The gene contains several potential glucocorticoid receptor-binding sites, both inside and outside the structural gene. Arch Biochem Biophys, 1985 Dec, 243(2), 332 - 7 Isolation and crystallization of lambda exonuclease; van Oostrum J et al.; lambda Exonuclease is a deoxyribonuclease induced by bacteriophage lambda . Mutations in the structural gene for the protein affect general recombination and indicate a possible function for the enzyme . A large scale isolation procedure was employed to purify enough enzyme from a heat-induced lambda lysogen for X-ray crystallographic analysis . Analytical ultracentrifugation and SDS-polyacrylamide electrophoresis revealed that lambda exonuclease is a tetramer with molecular mass 107,000 Da . Crystallization trials produced morphologically perfect crystals of a size suitable for X-ray diffraction studies . Cubic crystallographic symmetry was indicated by the lack of birefringence when the crystals were inspected with polarized light . X-ray precession photographs indicated that lambda exonuclease crystallizes in a space group of P4(1)32, or its enantiomorph P4(3)32, with 24 tetramers in the unit cell of edge 210 A. J Immunol, 1985 Dec, 135(6), 4100 - 7 Influence of genetically inherited complement deficiencies on humoral immune response in guinea pigs; Bottger EC et al.; To assess the role of complement in the induction of the humoral immune response, we studied the antibody response of guinea pigs genetically deficient in the second component of the classical complement pathway (C2D-GP) to bacteriophage phi X 174--a T cell-dependent antigen--in comparison with normal guinea pigs and C4D-GP, for which a disturbance in induction of antibody response has been described . We were able to establish a clear dose-response relationship: with low doses of antigen (1 X 10(9) PFU/kg), the antibody response of both complement-deficient strains was grossly impaired as compared with normal guinea pigs . After primary immunization, the peak antibody titer was diminished (1 log10) and declined rapidly; after secondary immunization, the diminution became even more distinct . Both complement-deficient strains had unusual secondary antibody responses almost identical to their primary ones, and amplification of antibody titer, as well as regular isotype switch from IgM to IgG, was absent . By increasing the antigen dose (2 X 10(9) PFU/kg), the antibody responses of the complement-deficient guinea pigs tend to normalize, and when high doses of antigen (1 X 10(10) PFU/kg) were used, the behavior of the complement-deficient animals was nearly indistinguishable from that of normal animals . Partial restoration of the immune response was seen when substituting the genetic complement deficiency by giving serum as source of the missing complement component . The important contribution of the C2 deficiency is given by the now compelling evidence that it is not the missing individual component itself, but rather the common block in sequential activation of C3 via the classical pathway in both complement deficiencies, that is responsible for the impaired humoral immune response, especially at low antigen doses . We therefore postulate that an intact classical pathway contributes to reaching a normal humoral immune response. Science, 1985 Nov 22, 230(4728), 906 - 11 Control of directionality in lambda site specific recombination; Bushman W et al.; The simple relation between the substrates and products of site-specific recombination raises questions about the control of directionality often observed in this class of DNA transactions . For bacteriophage lambda, viral integration and excision proceed by discrete pathways, and DNA substrates with the intrinsic property of recombining in only one direction can be constructed . These pathways display an asymmetric reliance on a complex array of protein binding sites, and they respond differently to changes in the concentrations of the relevant proteins . The Escherichia coli protein integration host factor (IHF) differentially affects integrative and excisive recombination, thereby influencing directionality . A four- to eightfold increase in intracellular IHF coincides with the transition from exponential to stationary phase; this provides a mechanism for growth phase-dependent regulation of recombination that makes the cellular physiology an intrinsic part of the recombination reaction. J Mol Biol, 1985 Nov 20, 186(2), 283 - 93 Genetic mapping and DNA sequence analysis of mutations in the polA gene of Escherichia coli; Joyce CM et al.; DNA polymerase I of Escherichia coli provides an excellent model for the study of template-directed enzymatic synthesis of DNA because it is a single subunit enzyme, it can be obtained in large quantities and the three-dimensional structure of the polymerizing domain (the Klenow fragment) has recently been determined (Ollis et al., 1985) . One approach to assigning functions to particular portions of the structure is to correlate the altered enzymatic behavior of mutant forms of DNA polymerase I with the change in the primary sequence of the protein . Towards this end we have developed a rapid procedure for mapping any polA mutation to a region no larger than 300 base-pairs within the polA gene . Two series of polA deletion mutants with defined end-points were constructed in vitro and cloned into bacteriophage lambda . These phages can then be used to map precisely E . coli polA mutants . Twelve polA- alleles have been mapped in this way and for nine of them the nature of the mutational change has been determined by DNA sequence analysis . Two of the mutations, polA5 and polA6, which affect the enzyme-DNA interaction, provide evidence for the location of the DNA binding region on the polymerase three-dimensional structure. J Mol Biol, 1985 Nov 20, 186(2), 267 - 74 Formation of delta tra F' plasmids: specific recombination at oriT; Horowitz B et al.; Delta tra F' plasmids can be isolated from matings between Hfr donors and recA- recipients, with selection for transfer of proximal chromosomal genes . Previous experiments indicate that F DNA from the neighborhood of the transfer origin up to the proximal junction with the chromosomal DNA is present on these plasmids, together with chromosomal segments, some of which belong to distinct size classes . We have sequenced across the novel joints contained in five delta tra FproA+ plasmids and in five delta tra FpurE+ plasmids, and we have compared these with the F sequence near oriT and with a chromosomal site near purE . The previously reported specificity in formation of some of these classes is confirmed at the nucleotide sequence level . The F DNA in nine of these novel joints extended beyond the nicking sites identified by others in lambda oriT+ bacteriophages up to a position between two sequenced oriT- mutations . Small plasmids containing these novel joints are mobilized in trans by pOX38 at frequencies less than 5 X 10(-7) times the mobilization frequencies for similar plasmids that contain oriT . The relations of these findings to the location of the nicking site at oriT are discussed. FEBS Lett, 1985 Nov 18, 192(2), 299 - 302 The nucleotide sequence of bacteriophage T5 leucine tRNA; Shlyapnikov MG et al.; Uniformly 32P-labeled bacteriophage T5 leucine tRNA has been isolated by two-dimensional gel electrophoresis from phage-infected E . coli cells . Its nucleotide sequence has been determined by conventional techniques using TLC on cellulose for oligonucleotide fractionation: pGGGGCUAUGCUGGAACDGmGDAGACAAUACGGCCUUAGm6AU psi CCGUAGCUUAAAUGCGUGGGAGT psi CGAGUCUCCCUAGCCCCACCAoh . This tRNA has anticodon sequence UAG, which can presumably recognize all the four leucine-specific codons (CUN) . The main feature of T5 tRNALeu is the absence of the A10-C25 and C31-psi 39 pairing in the D and anticodon stems, respectively. Nucleic Acids Res, 1985 Nov 11, 13(21), 7687 - 701 Localisation and characterization of a new rho-dependent transcription terminator from bacteriophage T5; Brunel F et al.; Relatively few rho-dependent terminators have been described in the literature . This manuscript describes another such terminator, isolated from phage T5 . Functional analysis, involving the generation of deletion subclones, has permitted the localization of the terminator on a 413 bp fragment . Attempts to further reduce the size of this fragment resulted in loss of terminator activity . DNA sequence analysis of the terminator region supports the model whereby a rho-dependent terminator is composed of a long region of non-translated unstructured DNA, which permits rho binding, followed by RNA polymerase pausing sites where termination (in the presence of rho) may occur . The results agree with the currently held hypothesis that, despite the many similarities found between various rho dependent termination sequences, no consensus can be defined for either the rho binding or the rho termination sites (1,2). Nucleic Acids Res, 1985 Nov 11, 13(21), 7569 - 78 Direct cloning of specific genomic DNA sequences in plasmid libraries following fragment enrichment; Nicholls RD et al.; We describe a simple method to directly clone any DNA fragment for which a flanking restriction enzyme map is known . Genomic DNA is digested with multiple enzymes cutting outside the fragment to be cloned, selected by electroelution from an agarose gel, and cloned directly into a plasmid vector . It is only necessary to screen 10-1000 colonies and recombinant DNA is ready for immediate molecular analysis without further subcloning . The use of this technique is demonstrated for the cloning of a sequence from within the human alpha-globin complex that was previously shown to be "unclonable" in bacteriophage and cosmid vectors and which is a multiallelic general genetic marker, as well as both beta-globin alleles from an individual with beta-thalassaemia. Nucleic Acids Res, 1985 Nov 11, 13(21), 7551 - 68 T4-induced alpha- and beta-glucosyltransferase: cloning of the genes and a comparison of their products based on sequencing data; Tomaschewski J et al.; Bacteriophage T4 alpha- and beta-glucosyltransferases link glucosyl units to the 5-HMdC residues of its DNA . The monoglucosyl group in alpha-linkage predominates over the one in beta linkage . Having recently reported on the nucleotide sequence of gene alpha gt (1) we now determined the nucleotide sequence of gene beta gt . The genes were each cloned on a high expression vector under the control of the lambda pL promoter . After thermo-induction the proteins were isolated and purified to homogeneity . To verify that the translational starting sites and the proposed reading frames are effective in vivo the sequence of the first 31 amino acid residues from gp alpha gt and the first 30 amino acid residues from gp beta gt were determined by Edman degradation . The primary structures of the two proteins seem to have only limited structural similarities . The results are discussed comparing secondary structure predictions and homologies with other proteins from the protein sequence database of the Protein Identification Resource. Eur J Biochem, 1985 Nov 4, 152(3), 691 - 7 Role of the Arg158 residue of the outer membrane PhoE pore protein of Escherichia coli K 12 in bacteriophage TC45 recognition and in channel characteristics; Korteland J et al.; In order to study the structure-function relationship of the PhoE protein pore we have isolated five independent, TC45-resistant, phoE mutants all of which appeared to produce normal amounts of an electrophoretically altered PhoE protein, designated as PhoE* protein . Nucleotide sequence analysis of the DNA fragments carrying the mutations showed that the mutations all correspond to a G.C to A.T transition at the same place within the phoE gene resulting in a deduced change of amino acid residue arginine 158 into histidine . This result shows that the arginine 158 residue plays an important role in the interaction of the PhoE protein pore with phage TC45 . Moreover, studies on the channel properties of the PhoE* protein showed that the PhoE channel has lost part of its preference for negatively charged solutes, as a result of the arginine to histidine change . The results are discussed in terms of the structure-function relationship of PhoE protein as well as in terms of the topological organization of the protein channel in the outer membrane. Biochem J, 1985 Nov 1, 231(3), 789 - 92 Target size of neurotoxic esterase and acetylcholinesterase as determined by radiation inactivation; Carrington CD et al.; The target size of neurotoxic esterase (NTE), the putative target site for the initiation of organophosphorus-compound-induced delayed neurotoxicity, and acetylcholinesterase (AChE) from hen brain were examined by determining the rate at which the activities of the esterases were destroyed by ionizing irradiation . Samples of hen brain were prepared by slowly drying a microsomal preparation under vacuum . The dried samples were then irradiated with electrons from a 1 MeV Van de Graaff generator . The doses ranged from 0 to 28 Mrad . The radiation doses were calibrated by the rate of inactivation of T1-bacteriophage plaque induction . Following the irradiation procedure, the samples were resuspended in buffer and enzymic activity was measured . The target size of NTE from hen brain was determined to be about 105 kDa, whereas hen brain AChE was found to have a target size of about 53 kDa . The target size of NTE was found to be similar in experiments with rat brain and cat brain . In addition, commercial preparations of electric-eel electric-organ AChE and horse serum butyrylcholinesterase were found to have target sizes that were identical with each other, and also were very similar to that of AChE from hen brain. Anal Biochem, 1985 Nov 1, 150(2), 258 - 63 A lysoplate assay for Escherichia coli cell wall-active enzymes; Becktel WJ et al.; A benchtop assay based upon digestion of purified Escherichia coli peptidoglycan suspended in an agarose gel matrix is described . Enzymes for which these cell walls are substrates are applied to wells in the gel and diffuse into the gel . Activity is measured visually by the size of clear disks formed around the wells as the peptidoglycan is digested . Using this assay, it is possible to screen large numbers of cell wall-active enzymes for sensitivity to pH, ionic strength, denaturant, temperature, or other factors without interference from endogenous autolytic enzymes . Data are presented to show the limits of detection and linearity of the assay . For an assay time of 14 h, as little as 1 nmol per liter of bacteriophage T4 lysozyme and 200 nmol per liter of hen egg white lysozyme were detected . Longer assay times decrease these limits by as much as an order of magnitude . The salt dependence of T4 lysozyme and several of its temperature-sensitive mutants was also determined . Finally, an example of the use of the assay during lysozyme purification to determine active column fractions is presented. Mol Biol (Mosk), 1985 Nov-Dec, 19(6), 1661 - 8 {Kinetics of DNA-dependent RNA synthesis: couple synthesis of di-, tri- and tetranucleotides in the presence of a limited set of substrates}; Smirnov SV et al.; The qualitative and quantitative characteristics of the short oligonucleotides synthesis by Escherichia coli RNA polymerase on A1 promoter of the bacteriophage T7 in the presence if incomplete set of nucleoside triphosphates were studied . The binding of the fourth substrate with enzyme-template complex was shown to occur after binding of the third substrate only . The curves of di-, tri- and tetranucleotide synthesis as the function of CTP and GTP concentration were constructed . The empiric formulas for the rates of the coupled synthesis if tri- and tetranucleotides were derived from these curves . A kinetic scheme describing the experimental data was proposed. Cell, 1985 Nov, 43(1), 369 - 77 Isolation of the gene encoding yeast DNA polymerase I; Johnson LM et al.; A yeast genomic DNA expression library in lambda gt11 antibody prepared against yeast DNA polymerase I were used to isolate the gene encoding DNA polymerase I . The identity of the DNA polymerase I gene was determined by several criteria . First, the clone-encoded protein is immunologically related to DNA polymerase I . Second, cells containing the gene cloned in the high copy number plasmid YEp24 overproduce the polymerase activity 4- to 5-fold as measured in yeast extracts . Finally, insertion of the gene downstream from a bacteriophage T7 promoter allows synthesis of yeast DNA polymerase I in Escherichia coli . Gene disruption and Southern hybridization experiments show that the polymerase is encoded by an essential, single copy gene . Examination of the germinated spores containing the disrupted gene reveals a defect in nuclear division and a terminal phenotype typical of replication mutants. Proc Natl Acad Sci U S A, 1985 Nov, 82(21), 7247 - 51 Partial purification of an enzyme from Saccharomyces cerevisiae that cleaves Holliday junctions; Symington LS et al.; An enzyme from Saccharomyces cerevisiae that cleaves Holliday junctions was partially purified approximately 500- to 1000-fold by DEAE-cellulose chromatography, gel filtration on Sephacryl S300, and chromatography on single-stranded DNA-cellulose . The partially purified enzyme did not have any detectable nuclease activity when tested with single-stranded or double-stranded bacteriophage T7 substrate DNA and did not have detectable endonuclease activity when tested with bacteriophage M13 viral DNA or plasmid pBR322 covalently closed circular DNA . Analysis of the products of the cruciform cleavage reaction by electrophoresis on polyacrylamide gels under denaturing conditions revealed that the cruciform structure was cleaved at either of two sites present in the stem of the cruciform and was not cleaved at the end of the stem . The cruciform cleavage enzyme was able to cleave the Holliday junction present in bacteriophage G4 figure-8 molecules . Eighty percent of these Holliday junctions were cleaved in the proper orientation to generate intact chromosomes during genetic recombination. J Virol, 1985 Nov, 56(2), 644 - 6 Mutagenesis of bacteriophage T7 and T7 DNA by alkylation damage; Masker WE et al.; We have developed a new assay for in vitro mutagenesis of bacteriophage T7 DNA that measures the generation of mutations in the specific T7 gene that codes for the phage ligase . This assay was used to examine mutagenesis caused by in vitro DNA synthesis in the presence of O6-methylguanosine triphosphate . Reversion of one of the newly generated ligase mutants by ethyl methanesulfonate was also tested. J Bacteriol, 1985 Nov, 164(2), 932 - 7 Common evolutionary origin of the phage T4 dam and host Escherichia coli dam DNA-adenine methyltransferase genes; Hattman S et al.; We compared the known DNA nucleotide and encoded amino acid sequences of the Escherichia coli and bacteriophage T4 dam (DNA-adenine methyltransferase) genes . Despite the absence of any DNA sequence homology, there were four regions (11 to 33 residues long) of amino acid sequence homology containing 45 to 64% identity . These results suggest that the genes for these two enzymes have a common evolutionary origin. J Bacteriol, 1985 Nov, 164(2), 731 - 40 Evidence for transcription antitermination control of tryptophanase operon expression in Escherichia coli K-12; Stewart V et al.; Tryptophanase, encoded by the gene tnaA, is a catabolic enzyme distinct from the enzymes of tryptophan biosynthesis . Tryptophanase synthesis is induced by tryptophan and is subject to catabolite repression . We studied the mechanism of tna operon induction . Mutants with altered rho factor were partially constitutive for tna expression, implicating rho-dependent transcription termination in the control of tna expression . Measurements of mRNA synthesis from the transcribed leader region preceeding the tna operon suggested that the tna promoter was constitutive and that in the absence of inducer, transcription terminated in the leader region . Upon induction, this transcription termination was relieved . Cis-acting constitutive mutants had genetic alterations in the tna leader region . These lesions defined a site that is homologous to the bacteriophage lambda boxA sequence, which is thought to play a role in antitermination control of lambda lytic gene expression . We propose that tna expression is subject to transcription antitermination control . We hypothesize that a tryptophan-activated antiterminator protein mediates induction by suppressing the rho-dependent termination sites in the leader region, thus allowing transcription to proceed into the tna operon structural gene region. J Bacteriol, 1985 Nov, 164(2), 539 - 43 Bacteriophage receptor area of outer membrane protein OmpA of Escherichia coli K-12; Morona R et al.; A number of T-even-like bacteriophages use the outer membrane protein OmpA of Escherichia coli as a receptor . We had previously analyzed a series of ompA mutants which are resistant to such phages and which still produce the OmpA protein (R . Morona, M . Klose, and U . Henning, J . Bacteriol . 159:570-578, 1984) . Mutational alterations were found near or at residues 70, 110 and 154 . Based on these and other results a model was proposed showing the amino-terminal half of the 325-residue protein crossing the outer membrane repeatedly and being cell surface exposed near residues 25, 70, 110, and 154 . We characterized, by DNA sequence analysis, an additional 14 independently isolated phage-resistant ompA mutants which still synthesize the protein . Six of the mutants had alterations identical to the ones described before . The other eight mutants possessed seven new alterations: Ile-24----Asn, Gly-28----Val, deletion of Glu-68, Gly-70----Cys, Ser-108----Phe, Ser-108----Pro, and Gly-154----Asp (two isolates) . Only the latter alteration resulted in a conjugation-deficient phenotype . The substitutions at Ile-24 and Gly-28 confirmed the expectation that this area of the protein also participates in its phage receptor region . It is unlikely that still other such sites of the protein are involved in the binding of phage, and it appears that the phage receptor area of the protein has now been characterized completely. Mol Biol (Mosk), 1985 Nov-Dec, 19(6), 1610 - 9 {Proteins of the basal plate of bacteriophage T4 participating in the contractile impulse}; Turkin AI et al.; Reversible linking of proteins with Cu2+ and Ni2+ ions was used to study the topography of the structural proteins of bacteriophage T4 basal plate . Gene products (GP) 9 and 10 were found to directly contact the proximal part of long fibrils (GP34) . GP27, GP54 and GP5 interact with the lower disk of the contractive sheath (GP18), while GP48 and GP54 are in contact with the core (GP19) . The proteins of the sheath (GP18) and the core (GP19) were found to have contact over the whole tail length. Proc Natl Acad Sci U S A, 1985 Nov, 82(22), 7631 - 5 Chromosomal location of the gene encoding the neural cell adhesion molecule (N-CAM) in the mouse; D'Eustachio P et al.; The gene encoding the neural cell adhesion molecule, N-CAM, has been localized on mouse chromosome 9 . A BALB/cJ mouse genomic library prepared in lambda bacteriophage EMBL4 was screened by using a cDNA probe, pEC204, that corresponds to the coding region of the chicken N-CAM gene . Four weakly reactive and one strongly reactive recombinant phage were isolated . A region of the latter that was strongly homologous to pEC204 was subcloned to yield a new probe, pEC501 . RNA transfer blots and nucleotide sequencing indicated that pEC501 encoded part of the mouse N-CAM gene . This probe defined a unique genetic locus, Ncam, associated with a restriction fragment length polymorphism that allowed the definition of two alleles . The locus could be provisionally assigned either to chromosome 9 or to chromosome 10 by correlating the presence or absence of mouse-specific DNA fragments reactive with the probe in a panel of somatic hybrid cell lines with the presence or absence of the various mouse chromosomes . Analysis of the inheritance of the Ncam-associated DNA polymorphism in recombinant inbred strains of mice revealed close linkage between Ncam and the Lap-1, Sep-1, and Thy-1 loci on chromosome 9 . This result suggests an additional linkage between Ncam and the locus for the cerebellar mutation staggerer (sg) . The Ncam locus provides an important reference point for mapping the genes for additional cell adhesion molecules as well as genes for other molecules involved in neural development and function. Proc Natl Acad Sci U S A, 1985 Nov, 82(22), 7570 - 4 A defined system for the DNA strand-transfer reaction at the initiation of bacteriophage Mu transposition: protein and DNA substrate requirements; Craigie R et al.; An early step in the transposition of bacteriophage Mu DNA in vitro is a DNA strand-transfer reaction that generates an intermediate DNA structure in which the Mu donor DNA and the target DNA are covalently joined . DNA replication, initiated at the DNA forks in this intermediate, generates a cointegrate product; simple insert products can also be formed from the same intermediate by degradation of a specific segment of the structure, followed by gap repair . This DNA strand-transfer reaction requires ATP, magnesium, the Mu A and Mu B proteins, and a factor supplied by an Escherichia coli cell extract . We have now shown that the host protein factor requirement can be satisfied by purified protein HU . The defined system has been used to determine the DNA substrate requirements for the reaction . The reaction requires the two Mu ends, located on the same DNA molecule, in the same relative orientation to one another as in the phage Mu genome . To participate in the strand-transfer reaction efficiently the mini-Mu plasmid, used as the transposon donor, must be supercoiled; the target DNA molecule may be supercoiled, relaxed circular, or linear. EMBO J, 1985 Nov, 4(11), 3031 - 7 The cloning and characterization of the bacteriophage D108 regulatory DNA-binding protein ner; Tolias PP et al.; From the transposable Mu-like bacteriophage D108 we have cloned the ner gene under the control of the lac UV5 promoter in the expression vector pOP95-15 . The recombinant plasmid, pPT011, overproduced the 8-kd D108 ner protein (visualized by in vitro-coupled transcription-translation) and served as a substrate for DNA sequencing of the D108 ner gene . The ner protein of D108 was found to be 48% homologous to the Mu ner protein, though the DNA sequences that encode these proteins are quite divergent . We used the retardation of migration of 32P-labelled DNA restriction fragments by ner-containing crude protein extracts in polyacrylamide gels (band competition assay) to determine which DNA restriction fragment(s) contained the ner-binding sites . DNA footprinting using crude extracts physically identified the 47-bp DNA sequence that the ner protein was interacting with in the D108 early gene regulatory region . This sequence is located 10 bp downstream from the presumed D108 early gene transcription initiation site . Therefore, by binding strongly to this 47-bp DNA sequence, the D108 ner protein can regulate D108 early gene transcription. Proc Natl Acad Sci U S A, 1985 Nov, 82(21), 7173 - 7 uvrA and recA mutations inhibit a site-specific transition produced by a single O6-methylguanine in gene G of bacteriophage phi X174; Chambers RW et al.; Using site-specific mutagenesis, we have examined the mutagenic activity in vivo of O6-methylguanine or O6-n-butylguanine located at a preselected site in gene G of bacteriophage phi X174 . The experiments were designed so that the phage mutant produced by a targeted transition from either of these alkylated derivatives would be recognizable by a simple plaque assay . Spheroplasts derived from normal and repair-deficient cells were transfected, and the lysates were screened for mutant virus . In cells with normal repair, DNA carrying the methylguanine produced the expected transition in 15% of the total phage; DNA carrying the butylguanine produced the same mutation in 0.3% of the phage . In cells deficient in excision repair (uvrA) the transition frequency went up by a factor of 8 for O6-butylguanine and down by a factor of 40 for O6-methylguanine . In cells deficient in recombination (recA), the transition frequency increased 1.5-fold for butylguanine and decreased by a factor of 8 for methylguanine . The data show that both methyl- and butylguanine produce site-directed transitions in phi X174; the transition occurs in recA cells; the frequency of the transition is influenced by both recA and uvrA mutations; the recA and uvrA mutations alter the transition frequency for methylguanine and butylguanine in opposite directions. Mutat Res, 1985 Nov, 146(3), 229 - 41 The role of specific DNA base damages in the X-ray-induced inactivation of bacteriophage PM2; Moran E et al.; Two types of X-ray-induced base damages, alkali-labile sites and thymine ring saturation products, were quantitated in PM2 DNA irradiated in the phage capsid under oxic and anoxic conditions . The extent of formation of these base damages was compared with the number of single- and double-strand breaks and lethal hits produced under the same conditions . The individual inactivation efficiencies of alkali-labile sites and thymine ring saturation products were determined by selectively inducing each of these damages in isolated PM2 DNA by chemical means in vitro and determining the rate of biological inactivation of the treated DNA by transfection . For each lethal X-ray hit induced in oxic conditions there were 1.06 alkali-labile sites, 0.40 thymine ring saturation products, 2.09 singe-strand breaks and 0.11 double-strand breaks in the PM2 genome . In anoxic conditions, the respective number of lesions was 1.00, 0.19, 1.73 and 0.09 . The individual inactivation efficiencies of thymine ring saturation products and alkali-labile sites were found to be essentially equal, 7-8 lesions per lethal event in the PM2 genome . Alkali-labile sites and thymine ring saturation products together accounted for 15-20% of the biological inactivation of X-irradiated bacteriophage PM2 . The presence or absence of oxygen during irradiation did not affect the contribution to inactivation made by alkali-labile sites, but the contribution by thymine ring saturation products to inactivation was about 2-fold higher in oxic compared with anoxic conditions . With the 4 lesions measured, we have accounted for some 28-34% of the lethal events in X-irradiated PM2 phage, most of the remaining events being caused by as yet unidentified base damages. Z Naturforsch {C}, 1985 Nov-Dec, 40(11-12), 854 - 7 Further observations on periodicities of nucleotide occurrences in natural DNA's; Burr Furlong N et al.; There are non-random features in the occurrences of nucleotides in the DNA's of certain organisms which are detectable by statistical analyses of the entire sequence . Earlier, using the bacteriophage Phi-X 174 DNA sequence, we had reported that the self-information values for one type of dinucleotide association showed a marked periodicity when their autocorrelation coefficients were graphed . A similar, but computationally simpler, analysis has been developed which gives a comparable indication of periodicity . The difference, in average autocorrelation coefficients obtained with this analysis, between the peak values and all others has been used as an index to compare the extent of periodic non-randomness for a series of natural DNA sequences and for various artificial sequences . Calculations show that triplet periodicity, the relationship between dinucleotides separated by a single nucleotide, is characteristic only of the natural sequences of certain filamentous phages and is not found prominently in any other DNA analyzed (including sequences of similar length from plasmids, yeast, bacteria and higher animals) . By shuffling nucleotides in a given sequence or by substituting selected nucleotides to alter various positions in both periodic and aperiodic sequences, we have found that an excess or deficiency of a given nucleotide at one of the three positions in a triplet reading frame can simulate the periodic characteristic . Thus, it appears that this global statistical analysis detects the tendency for single-strand phages to utilize a specific nucleotide, rather than one randomly selected, to constitute codons. Biochem J, 1985 Nov 1, 231(3), 765 - 8 The effect of multivalent ions on the inactivation of bacteriophage phi X174 by lipopolysaccharide from Escherichia coli C; Rowatt E et al.; The inactivation of bacteriophage phi X174 by lipopolysaccharide from Escherichia coli C is promoted by multivalent metal ions and by polyamines . The effect of the two types of cation is similar, and the concentration causing 50% inactivation varies inversely with the charge on the cation, although quadrivalent amines are less active than expected . The increase in activity as the charge rises suggests that electrostatic binding is overwhelmingly important. J Bacteriol, 1985 Nov, 164(2), 960 - 3 Identification of a temperature-sensitive mutation in the htpR (rpoH) gene of Escherichia coli K-12; Waghorne C et al.; A new mutation in the htpR (rpoH) gene of Escherichia coli K-12 was identified . The mutation resulted in a temperature-sensitive phenotype in terms of cell growth and bacteriophage lambda development . As in the case of the classical htpR tsn-165 mutation, synthesis of heat shock polypeptides was not induced in strains carrying the mutation described here. J Biol Chem, 1985 Oct 25, 260(24), 13053 - 9 Bacteriophage T4 regA protein . Purification of a translational repressor; Miller ES et al.; The bacteriophage T4 regA protein translationally regulates its own synthesis and the synthesis of several other T4 early proteins . In order to study the mechanism of translational regulation, we have purified the regA protein . Initially a mutant protein, incapable of autogenous repression, was placed under lambda PL transcriptional control and amplified to approximately 10% of total cell protein . The membrane-associated mutant protein was extracted with organic solvent mixtures and purified by reverse phase-high performance liquid chromatography . Polyclonal antibodies prepared against the mutant protein were used in Western blot assays to monitor purification of the wild-type protein from T4-infected cells . Phosphocellulose and poly(U)-agarose chromatography were important steps in its purification . The binding properties of regA protein to polyribonucleotides are discussed in relation to the mechanism by which the protein recognizes its mRNA targets. J Biol Chem, 1985 Oct 25, 260(24), 13013 - 7 Exons of the human pancreatic polypeptide gene define functional domains of the precursor; Leiter AB et al.; Pancreatic polypeptide is a 36-amino acid peptide which inhibits pancreatic exocrine function . We have previously determined from the nucleotide sequence of a cDNA that pancreatic polypeptide is derived from a 95-amino acid precursor, prepropancreatic polypeptide . Pulse-chase studies have suggested that the precursor is cleaved to produce three peptides: pancreatic polypeptide, an icosapeptide, and a smaller peptide . In the present study, we have used the cloned cDNA as a hybridization probe to isolate the pancreatic polypeptide gene from a human bacteriophage genomic library . The nucleotide sequence of 2.8 kilobases of DNA representing the entire human pancreatic polypeptide gene was determined . The gene contains four exons and three introns . Exon 1 encodes the 5'-untranslated region of the mRNA, exon 2 encodes the signal sequence and the sequence of pancreatic polypeptide, exon 3 encodes the icosapeptide, and exon 4 encodes a carboxyl-terminal heptapeptide and the 3'-untranslated region of the mRNA . By Southern blot analysis, the gene detected in a pancreatic polypeptide-producing islet cell tumor was indistinguishable from that in normal human leukocytes . The structure of the human pancreatic polypeptide gene is consistent with the hypothesis that prepropancreatic polypeptide generates three distinct peptides, each encoded by a separate exon . Increased expression of pancreatic polypeptide in the islet cell tumor does not appear to be correlated with major alterations in pancreatic polypeptide gene structure. Nucleic Acids Res, 1985 Oct 25, 13(20), 7473 - 81 Sequence of the T4 recombination gene, uvsX, and its comparison with that of the recA gene of Escherichia coli; Fujisawa H et al.; We have determined the nucleotide sequence of the uvsX gene of bacteriophage T4 which is involved in DNA recombination and damage repair, and whose product catalyzes in vitro reactions related to recombination process in analogous manners to E . coli recA gene product . The coding region consisted of 1170 nucleotides directing the synthesis of a polypeptide of 390 amino acids in length with a calculated molecular weight of 43,760 . Amino acid composition, the sequence of seven NH2-terminal amino acids and molecular weight of the protein deduced from the nucleotide sequence were consistent with the data from the analysis of the purified uvsX protein . The nucleotide sequence and the deduced amino acid sequence were compared with those of the recA gene . Although a significant homology was not found in the nucleotide sequences, the amino acid sequences included 23% of identical and 15% of conservatively substituted residues. FEBS Lett, 1985 Oct 21, 191(1), 136 - 40 Agarose gel electrophoretic evidence for domains of nuclear DNA linked with bonds cleavable with sulfhydryl molecules; Tas S et al.; Complexes of intact nuclear DNA with proteins undissociable by 2.0 M NaCl and nonionic detergents were analyzed by agarose gel electrophoresis following physical or enzymatic fragmentation . Sulfhydryl molecules converted these DNAs (but not the bacteriophage lambda DNA) into smaller-Mr forms . Following limited restriction endonuclease digestion of complexes with PstI most of the nuclear DNA formed a high-molecular-mass band in the 60-110 kbp range . These 60-110 kbp fragments, releasable from the rest of nuclei by sulfhydryl molecules, have similar sizes to nuclear DNA loops detected by other techniques and may derive from supranucleosomal organizational units in the chromatin complex. Virology, 1985 Oct 15, 146(1), 50 - 68 Virulent mutants of bacteriophage phi80; Reyes O; We have characterized a collection of 11 phi80 mutants that develop in wild-type lysogenic hosts ("virulent" phenotype) . All these carry gross DNA rearrangements affecting the right arm of the phi80 chromosome . Our results are consistent with the notion that phi80 development is negatively controlled by the ineA gene product, encoded by one of a cluster of genes (phi80 immunity) located between the phi80 replication and recombination genes . We describe and assign positions for ineA and other genes within the immunity region. J Biol Chem, 1985 Oct 15, 260(23), 12858 - 65 Bacteriophage T4 DNA replication protein 61 . Cloning of the gene and purification of the expressed protein; Hinton DM et al.; In vitro, a bacteriophage T4 primase composed of T4 61 and 41 proteins, catalyzes the formation of pentaribonucleotides used to initiate DNA synthesis on single-stranded DNA . We have determined that cells containing a plasmid with the T4 DNA from 18.68 to 15.05 map units express an activity that substitutes for authentic 61 protein in vitro in catalyzing primer-dependent DNA synthesis with six other T4 DNA replication proteins . This result establishes that this region, genetically assigned to gene 61, is the structural gene for the priming protein . Cells containing a plasmid with gene 61 downstream of the strong phage lambda promoter PL and the antitermination site nutL produce 100-fold more 61 protein than T4-infected cells . We have developed an improved purification procedure which yields 100 mg of homogeneous, active protein from 178 g of these cells . In the plasmid, the T4 DNA downstream of gene 61 expresses a protein of 30,000 daltons . This protein may be the T4 DNA adenine methylase (dam) gene product, since Schlagman and Hattman (Schlagman, S . L . and Hattman, S . (1983) Gene 22, 139-156) have shown that this activity is expressed by plasmids containing T4 DNA from this region . In the PL, nutL vector, the expression of both the 30,000-dalton and 61 proteins is enhanced up to 20-fold by the presence of the phage lambda N protein, a transcription antitermination protein, suggesting that expression of the T4 DNA in the plasmid may be regulated transcriptionally . In addition, in both N+ and N- cells, the level of 61 protein, whose gene is proximal to PL on the plasmid, is lower than that of the product of the promoter distal 30,000-dalton protein gene . This result suggests that, at least in the plasmid construction, the expression of 61 protein may also be regulated after transcription. J Biol Chem, 1985 Oct 15, 260(23), 12851 - 7 Bacteriophage T4 DNA replication protein 41 . Cloning of the gene and purification of the expressed protein; Hinton DM et al.; The bacteriophage T4 primase, composed of the T4 proteins 41 and 61, synthesizes pentaribonucleotides used to prime DNA synthesis on single-stranded DNA in vitro . 41 protein is also a DNA helicase that opens DNA in the same direction as the growing replication fork . Previously, Mattson et al . (Mattson, T., Van Houwe, G., Bolle, A., Selzer, G., and Epstein, R . (1977) Mol . Gen . Genet . 154, 319-326) located part of gene 41 on a 3400-base pair EcoRI fragment of T4 DNA (map units 24.3 to 21.15) . In this paper, we report the cloning of T4 DNA representing map units 24.3 to 20.06 in a multicopy plasmid vector . Extracts of cells containing this plasmid complement gene 41- extracts in a DNA synthesis assay, indicating that this region contains all the information necessary for the expression of active 41 protein . We located gene 41 more precisely between T4 map units 22.01 to 20.06 since our cloning of this region downstream of the strong lambda promoter PL results in the production of active 41 protein at a level 100-fold greater than after T4 infection . We have purified 133 mg of homogeneous 41 protein from 27 g of these cells . Like the 41 protein from T4 infected cells, the purified 41 protein in conjunction with the T4 gene 61 priming protein catalyzes primer formation (assayed by RNA primer-dependent DNA synthesis with T4 polymerase, the genes 44/62 and 45 polymerase accessory proteins, and the gene 32 helix-destabilizing protein) and is a helicase whose activity is stimulated by T4 61 protein. Virology, 1985 Oct 15, 146(1), 22 - 6 Purification and characterization of gene 17 product of bacteriophage T3; Kato H et al.; Tail fiber proteins of bacteriophage T3 are encoded by gene 17 . By using in vitro complementation for phage assembly as an assay, the product of gene 17 (gp17) was purified to near homogeneity from cells infected with a double mutant of T3 defective in DNA synthesis and head assembly . The purified gp17 consists of a single polypeptide having a molecular weight of 67,000 . Electron microscopy of the purified gp17 showed a fiber structure similar to the tail fiber in a virion . The subunit structure of the purified, native gp17 was analyzed by using a crosslinking agent, dimethyl suberimidate . The results indicate that native gp17 is a trimer of gp17 monomer. Virology, 1985 Oct 15, 146(1), 12 - 21 Genetic analysis of subunit assembly of the tail fiber of bacteriophage T3; Kato H et al.; Bacteriophage T3 virions have six tail fibers composed of the product of gene 17 (gp17) . Each tail fiber is a trimer of gp17 polypeptide . To characterize the assembly process of the tail fiber, temperature-sensitive (ts) mutants of gene 17 (ts17) were analyzed by SDS-polyacrylamide gel electrophoresis and by extract complementation . Newly synthesized gp17 polypeptide chains matured to SDS-resistant native trimers with a half time of about 7.5 min at 30 degrees . Although all ts17 mutants had similar plating efficiencies at restrictive temperature (41.5 degrees or 42 degrees), they showed different phenotypes . tsNG75, whose mutation was located in the carboxyl-terminal region of gene 17, was defective in trimer assembly at 41.5 degrees . The ts tail fibers formed at 30 degrees lost the ability to attach to the tail upon treatment at 41.5 degrees . There was a change in temperature sensitivity of tsNG75 tail fibers upon attachment to the tail, suggesting that the tail fiber may change conformation after attachment to the tail . tsNG215 and tsNG169, whose mutation sites were located in the amino-terminal region of gene 17, were not defective in the trimer assembly and attachment to the tail at the restrictive temperature . tsNG215 tail fibers formed at 41.5 degrees appear to be aberrant because they were not active in extract complementation and their attachment to fiberless particles resulted in production of noninfectious phage . Tail fibers produced by cells infected with tsNG169 at the restrictive temperature were active in extract complementation . Phage particles were formed in tsNG169-infected cells at the restrictive temperature . These particles were infectious at the permissive temperature and the mutant was non-infectious only if infection was continued at the restrictive temperature . These phenotypic differences exhibited by different gene 17 mutants may indicate the regions within the gene 17 polypeptide that play a role(s) in the folding and assembly of gp17 and in the biological activity of the mature tail fiber. Nucleic Acids Res, 1985 Oct 11, 13(19), 6955 - 67 Mechanism of translational coupling between coat protein and replicase genes of RNA bacteriophage MS2; Berkhout B et al.; We have analyzed the molecular mechanism that makes translation of the MS2 replicase cistron dependent on the translation of the upstream coat cistron . Deletion mapping on cloned cDNA of the phage shows that the ribosomal binding site of the replicase cistron is masked by a long distance basepairing to an internal coat cistron region . Removal of the internal coat cistron region leads to uncoupled replicase synthesis . Our results confirm the model as originally proposed by Min Jou et al . (1) . Activation of the replicase start is sensitive to the frequency of upstream translation, but never reaches the level of uncoupled replicase synthesis. Nucleic Acids Res, 1985 Oct 11, 13(19), 6833 - 46 Nucleotide sequence of a gene from chromosome 1D of wheat encoding a HMW-glutenin subunit; Thompson RD et al.; A high molecular weight glutenin gene in hexaploid wheat has been isolated by cloning in bacteriophage lambda and characterized . The gene corresponds to polypeptide 12 encoded by chromosome 1D in the variety "Chinese Spring" . The coding sequence predicted contains seven cysteine residues six of which flank a central repetitive region comprising more than 70% of the polypeptide . These findings are related to the role of high molecular weight subunits in the viscoelastic theory of gluten structure. Biochemistry, 1985 Oct 8, 24(21), 5716 - 23 Transcription from bacteriophage T7 and SP6 RNA polymerase promoters in the presence of 3'-deoxyribonucleoside 5'-triphosphate chain terminators; Axelrod VD et al.; RNA synthesis by T7 RNA polymerase or SP6 RNA polymerase is 100-1000 times more sensitive to the presence of the 3'-deoxyribonucleoside 5'-triphosphate chain terminators than is RNA synthesis by Escherichia coli RNA polymerase or Q beta replicase . These ribonucleotide analogues do not alter the specificity of each polymerase for its own promoters nor do they alter the site at which synthesis is initiated . Transcription by T7 RNA polymerase or SP6 RNA polymerase in the presence of relatively low concentrations of these chain terminators offers a useful route for determining the nucleotide sequence of any DNA segment that is inserted immediately downstream from a homologous bacteriophage promoter . This sequencing procedure was used to explore the effects that different dinucleotides have on the specificity of initiation at two different T7 RNA polymerase promoters. J Mol Biol, 1985 Oct 5, 185(3), 565 - 78 DNA packaging of bacteriophage T4 proheads in vitro . Evidence that prohead expansion is not coupled to DNA packaging; Rao VB et al.; We developed a system for DNA packaging of isolated bacteriophage T4 proheads in vitro and studied the role of prohead expansion in DNA packaging . Biologically active proheads have been purified from a number of packaging-deficient mutant extracts . The cleaved mature prohead is the active structural precursor for the DNA packaging reaction . Packaging of proheads requires ATP, Mg2+ and spermidine, and is stimulated by polyethylene glycol and dextran . Predominantly expanded proheads (ELPs) are produced at 37 degrees C and predominantly unexpanded proheads (ESPs) are produced at 20 degrees C . Both the expanded and unexpanded proheads are active in DNA packaging in vitro . This is based on the observations that (1) both ESPs and ELPs purified by chromatography on DEAE-Sephacel showed DNA packaging activity; (2) apparently homogeneous ELPs prepared by treatment with sodium dodecyl sulfate (which dissociates ESPs) retained significant biological activity; (3) specific precipitation of ELPs with anti-hoc immunoglobulin G resulted in loss of DNA packaging activity; and (4) ESPs upon expansion in vitro to ELPs retained packaging activity . Therefore, contrary to the models that couple DNA packaging to head expansion, in T4 the expansion and packaging appear to be independent, since the already expanded DNA-free proheads can be packaged in vitro . We therefore propose that the unexpanded to expanded prohead transition has evolved to stabilize the capsid and to reorganize the prohead shell functionally from a core-interacting to a DNA-interacting inner surface. J Mol Biol, 1985 Oct 5, 185(3), 545 - 63 Sequence organization and control of transcription in the bacteriophage T4 tRNA region; Broida J et al.; Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function . These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map . To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region . The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins . We have used subclones of the region to investigate the kinetics of transcription in vivo . The results show that transcription in this region consists of overlapping early, middle and late transcripts . Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters . This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail. J Biol Chem, 1985 Oct 5, 260(22), 12124 - 9 The bacteriophage P22 arc and mnt repressors . Overproduction, purification, and properties; Vershon AK et al.; The arc and mnt genes of bacteriophage P22 encode small repressor proteins . We have cloned these genes onto plasmids that overproduce Arc and Mnt to greater than 1% of the soluble cellular protein . Both proteins were purified to greater than 95% homogeneity, and N-terminal sequences and amino acid compositions were determined . These data, in combination with previously determined gene sequences, establish the complete protein sequences for Arc (53 residues) and Mnt (82 residues) . Both proteins have melting temperatures between 45 and 55 degrees C and can be renatured to a fully active species . Arc is a dimer in solution and Mnt is a tetramer. Nature, 1985 Oct 3-9, 317(6036), 451 - 3 Sequence-induced DNA curvature at the bacteriophage lambda origin of replication; Zahn K et al.; DNA replication in bacteriophage lambda begins at a unique origin between residues 39,000 and 39,200 of the lambda genome . This segment of DNA serves a dual function since it also lies within the coding sequence of the lambda replication initiator protein O which binds origin DNA . The lambda origin sequence contains four 19-base-pair (bp) segments (iterons) which have dyad symmetry, followed by a 40-bp A + T-rich zone of highly asymmetrical base composition . It was noted earlier that lambda origin DNA exhibits an anomalous electrophoretic mobility on gels; that is, the length of DNA as determined by DNA sequencing is approximately 20% less than is predicted from electrophoretic mobility . Recent studies of kinetoplast minicircle DNA (K-DNA) from the protozoan Leishmania tarentolae have led to the proposal that sequence-induced DNA curvature could account for such electrophoretic anomalies by alteration of the shape of the DNA molecule . We now present evidence that the lambda origin contains a static curve. Biochim Biophys Acta, 1985 Oct 3, 826(1), 30 - 7 Isolation and construction of mutants of the G4 minus strand origin: analysis of their in vivo activity; Sakai H et al.; An active, rifampicin-resistant primase-dependent bacteriophage G4 origin of complementary DNA strand synthesis has been cloned as a 274 bp fragment into the filamentous phase M13 and its secondary structure altered by deletion and insertion . It has been found that the entire 136 bp G4 intergenic region containing the secondary structure loops I and III is necessary for rifampicin-resistant conversion of SS----RF DNA in vivo . The secondary structures, however, can be widely separated by insertion between them of both random DNA sequences, and sequences that form strong additional secondary structure configurations and the origins still retain activity . Primase therefore probably recognises two DNA domains on loops I and III, the physical separation of which is not important. Appl Environ Microbiol, 1985 Oct, 50(4), 1007 - 13 Determination of the molecular mass of bacterial genomic DNA and plasmid copy number by high-pressure liquid chromatography; Genthner FJ et al.; Relatively rapid methods for the determination of relative genome molecular mass (Mr) and the estimation of plasmid copy number have been developed . These methods are based on the ability of the Bio-Rad high-pressure liquid chromatography hydroxylapatite column to separate and quantify single-stranded DNA, double-stranded DNA, and plasmid DNA . Genome Mr values were calculated from reassociation kinetics of single-stranded DNA as measured with the hydroxylapatite column . Bacteriophage T4 DNA was used to establish a C0t (moles of nucleotides times seconds per liter), or standard reassociation value . From this C0t value, C0t values for Escherichia coli B, Beggiatoa alba B18LD, and Streptomyces coelicolor were determined by comparative calculations . From those calculated C0t values, the Mr values of 1.96 X 10(9) for E . coli, 2.02 X 10(9) for B . alba, and 3.28 X 10(9) for S . coelicolor were estimated . Plasmid concentration was determined from cleared lysates by comparing the integrated area under the phosphate buffer-eluted plasmid peak to values obtained with known amounts of plasmid . The plasmid copy number was estimated by multiplying the ratio between the amounts of plasmid and chromosomal DNA by the ratio between the Mr values of the chromosome and the plasmid . A copy number of 29 was obtained from a culture of E . coli HB101 harboring pBR322 grown to a culture density of 1.6 X 10(9) CFU . ml-1. Can J Biochem Cell Biol, 1985 Oct, 63(10), 1064 - 70 The ribosomal RNA genes of Locusta migratoria: copy number and evidence for underreplication in a polyploid tissue; Oishi M et al.; From libraries of Locusta migratoria genomic DNA in bacteriophage lambda, clones have been isolated that hybridize with one or both of the 18S and 28S components of locust rRNA . Six clones studied show common patterns of restriction sites in the coding sequences and some include an intron in the 28S region . Subcloned sequences from within the 18S and 28S coding regions were used as probes in dot hybridization assays of the rRNA gene copy number in DNA prepared from several locust tissues and stages . The 18S and 28S probes gave similar results, showing about 4000 copies/haploid genome in testis, embryo, and fat body from larvae and immature adults of both sexes . This is by far the greatest rRNA gene copy number yet reported for any insect . DNA from reproductively mature adult female fat body showed a consistent reduction in the copy number by about one-third . Mature adult male fat body DNA showed no significant reduction in the copy number . It therefore appears that the final round of DNA replication in the adult female fat body, which produces 8-ploid and 16-ploid cells active in vitellogenin synthesis, involves underreplication of rDNA. DNA, 1985 Oct, 4(5), 333 - 49 Characterization of the polypeptide composition of human factor VIII:C and the nucleotide sequence and expression of the human kidney cDNA; Truett MA et al.; Human coagulation factor VIII:C has been purified approximately 5000-fold from commercial preparations with an average activity yield of 35% . Proteins of 92 kD and 77-80 kD enriched during purification are precipitated by a human serum polyclonal antibody which inhibits factor VIII:C activity . Evidence suggests that these polypeptides are linked by a calcium ion bridge . Partial amino acid sequence information from these proteins has been obtained from the intact polypeptides and from products of digestion with thrombin, endoproteinase lysC, or trypsin after citraconylation . An oligonucleotide probe designed from one of the amino acid sequences was used to isolate a partial genomic clone from a human 4X chromosome library in bacteriophage lambda . The genomic segment was used to isolate two cDNA molecules encompassing the entire human kidney factor VIII:C mRNA . Biologically active factor VIII:C has been produced in a mammalian cell line utilizing a complete cDNA construction. Genetics, 1985 Oct, 111(2), 197 - 218 Escherichia coli Rho factor is involved in lysis of bacteriophage T4-infected cells; Linder CH et al.; A Rid (Rho interaction deficient) phenotype of bacteriophage T4 mutants was defined by cold-sensitive restriction (lack of plaque formation) on rho+ hosts carrying additional polar mutations in unrelated genes, coupled to suppression (plaque formation) in otherwise isogenic strains carrying either a polarity-suppressing rho or a multicopy plasmid expressing the rho+ allele . This suggests that the restriction may be due to lower levels of Rho than what is available to T4 in the suppressing strains.--Rid394 X 4 was isolated upon hydroxylamine mutagenesis and mapped in the t gene; other t mutants (and mot, as well as dda dexA double mutants) also showed a Rid phenotype . In liquid culture in strains that restricted plaque formation Rid394 X 4 showed strong lysis inhibition (a known t- phenotype) but no prolonged phage production (another well-known t- phenotype) . This implies that when Rho is limiting the t mutant shuts off phage production at the normal time . Lysis inhibition was partially relieved, and phage production prolonged to varying extents depending on growth conditions in strains that allowed plaque formation . No significant effect on early gene expression were found . Apparently, both mutant (polarity-suppressing) and wild-type Rho can function in prolonging phage production and partially relieving lysis inhibition of Rid394 X 4 when present at a sufficiently high level, and Rho may play other role(s) in T4 development than in early gene regulation. J Bacteriol, 1985 Oct, 164(1), 70 - 7 Promoters recognized by Escherichia coli RNA polymerase selected by function: highly efficient promoters from bacteriophage T5; Gentz R et al.; Highly efficient promoters of coliphage T5 were identified by selecting for functional properties . Eleven such promoters belonging to all three expression classes of the phage were analyzed . Their average AT content was 75% and reached 83% in subregions of the sequences . Besides the well-known conserved sequences around -10 and -33, they exhibited homologies outside the region commonly considered to be essential for promoter function . Interestingly, the consensus hexamers around -10 (TAT AAT) and -35 (TTG ACA) were never found simultaneously within the sequence of highly efficient promoters . Several of these promoters compete extremely well for Escherichia coli RNA polymerase and can be used for the efficient in vitro synthesis of defined RNA species . In addition, some of these promoters accept 7-mGpppA as the starting dinucleotide, thus producing capped mRNA in vitro which can be utilized in various eucaryotic translation systems. J Virol, 1985 Oct, 56(1), 245 - 9 Identification by immunobinding assay of the polypeptide coded by the DNA polymerase gene of bacteriophage T5 and its amber mutants and the direction of transcription of the gene; Schneider SS et al.; We identified by immunobinding assay the polypeptides synthesized as the result of amber mutations in the DNA polymerase gene of bacteriophage T5 . Comparison of the size of such polypeptides revealed the order of mutagenic loci of these mutations and the direction of transcription of the gene . Extracts of cells infected with wild-type T5 and with five amber mutants of the polymerase gene (D7, D8, D9, am1, and am6) were prepared, and the proteins were resolved by sodium dodecyl sulfate-polyacrylamide slab gel electrophoresis . After transfer of the proteins to a nitrocellulose sheet, a radioimmunolabeling technique was used to identify the T5 DNA polymerase and its amber mutant polypeptides . Based on the relative sizes of the polypeptides, the transcription of the T5 DNA polymerase gene was determined to proceed in the order D7, D8, am1, D9, and am6 . The molecular weights of the DNA polymerase polypeptides coded by D8, am1, D9, am6, and T5+ were 23,000, 45,000, 75,000, 83,000, and 96,000, respectively . The D7-coded polypeptide was not detectable . These data suggest that the carboxyl-terminal region of the enzyme is essential for the polymerase function. Proc Natl Acad Sci U S A, 1985 Oct, 82(19), 6404 - 8 Replication of phage phi 29 DNA with purified terminal protein and DNA polymerase: synthesis of full-length phi 29 DNA; Blanco L et al.; A system that replicates bacteriophage phi 29 DNA with protein p3 covalently attached to the two 5' ends, using as the only proteins the phi 29 DNA polymerase and the terminal protein, is described . Restriction analysis of the 32P-labeled DNA synthesized in vitro showed that all phi 29 DNA fragments were labeled . Analysis by alkaline sucrose gradient centrifugation of the DNA labeled during a 10-min pulse showed that, after a 20-min chase, about half of the DNA molecules had reached apparently full-length phi 29 DNA (approximately equal to 18,000 nucleotides) . Ammonium ions strongly stimulated phi 29 DNA-protein p3 replication, the effect being due to stimulation of the initiation reaction . ATP was not required for phi 29 DNA-protein p3 replication, either in the initiation or elongation steps . The results show that the phi 29 DNA polymerase functions, not only in the formation of the p3-dAMP covalent initiation complex but also in the elongation of the latter, as the only DNA polymerase to produce full-length phi 29 DNA. Proc Natl Acad Sci U S A, 1985 Oct, 82(20), 6783 - 7 Bacteriophage T7 DNA polymerase: cloning and high-level expression; Reutimann H et al.; Phage T7 DNA polymerase consists of a 1:1 complex of the viral T7 gene 5 protein and the host cell thioredoxin . A 3.25-kilobase T7 DNA fragment containing the complete coding sequence of gene 5, and the nearby genes 4.7 and 5.3, was cloned in the BamHI site of the plasmid pBR322 . Transformation of the thioredoxin-negative (trxA-) Escherichia coli strain BH215 with the recombinant plasmid pRS101 resulted in large overproduction of gene 5 protein corresponding to a level about 60-fold higher than in T7-infected cells . Transcription of gene 5 probably originates from a previously unknown E . coli RNA polymerase promoter located immediately upstream of the structural gene . Contrary to expectation, pRS101 could be maintained also in E . coli trxA+ cells despite the in vivo formation of active T7 DNA polymerase . However, the expression of gene 5 was lower by a factor of 5-10 than in trxA- cells . Since the plasmid copy number in the two strains was the same, a gene dosage effect can be excluded . The observed difference suggests an autoregulatory interaction of T7 DNA polymerase holoenzyme on the expression of T7 gene 5 . The trxA- strain BH215/pRS101 is an excellent source of gene 5 protein and T7 DNA polymerase . After in vitro reconstitution of holoenzyme by addition of excess thioredoxin, highly active T7 DNA polymerase was purified to homogeneity by a simple antithioredoxin immunoadsorbent chromatography technique. J Virol, 1985 Oct, 56(1), 240 - 4 Biologically active proviral clone of myeloblastosis-associated virus type 1: implications for the genesis of avian myeloblastosis virus; Perbal B et al.; A biologically active myeloblastosis-associated virus (MAV) provirus was cloned from a bacteriophage recombinant library constructed from leukemic chicken myeloblast DNA . The restriction endonuclease map of this clone was consistent with that of a type 1 MAV (MAV-1) . Interference assays of virus recovered from cultured chicken embryo fibroblasts after DNA transfection established that the provirus was infectious and confirmed that it belonged to avian retrovirus subgroup A (type 1) . Antipeptide antibodies raised against the env-encoded carboxyl terminus of p48myb, the transforming protein of avian myeloblastosis virus, specifically immunoprecipitated the gp37env from quail cells transfected with MAV-1 proviral DNA but not from cells infected with MAV-2 . This suggests that MAV-1 rather than MAV-2 is the progenitor helper virus from which avian myeloblastosis virus arose by the transduction of cellular proto-oncogene sequences. Mol Gen Mikrobiol Virusol, 1985 Oct, (10), 29 - 34 {The role of genes of the system of mismatched base correction in genetic recombination of Escherichia coli}; Karimova GA et al.; A genetic system was elaborated to study intramolecular recombination of bacteriophages lambda and phi 80 . Practically, the ideal complementation of nucleotide sequences in recombining DNA molecules is required to obtain recombinants resulting from RecA-dependent recombination in Escherichia coli cells . a hypothesis is proposed to which the correction of mismatched bases hinders recombinant formation during recombination of fully homologous DNAs . The increased yields of hybrid molecules during interaction of the same DNA in the cells with deficient genes for correction support the hypothesis as well as independent demonstration of mutation in a gene for correction according to the effect of the increased yield of recombinants . A series of Escherichia coli cells mutants with increased formation of recombinant clones has been obtained. Environ Health Perspect, 1985 Oct, 62, 157 - 61 Sequence specificity of mutagenesis in the cI gene of bacteriophage lambda; Skopek TR et al.; Studies of DNA base sequence alterations have shown that for every agent the mutagenic process is specific with respect to the types of base changes induced and the location of the changes in the DNA . Analysis of the types of mutations produced by mutagenic agents can provide insight into the mechanism of mutation and can suggest which DNA lesions may be involved in the actual mutagenic event . We have developed a system for the analysis of chemically induced base sequence alterations in the cI repressor gene of bacteriophage lambda using DNA sequencing techniques . To illustrate the utility of this type of analysis, we present the results obtained with ultraviolet light (UV) . Irradiation of target DNA with UV alone, or UV followed by photoreactivating light (which removes dimers), produces mostly transitions at pyrimidine-pyrimidine sites . Conversely, irradiation with 313 nm light plus acetophenone (which produces only thymine dimers) produces mostly transversions at low efficiency . This and other evidence suggests that the actual premutagenic UV lesion in E . coli may not be pyrimidine-pyrimidine dimers, but rather pyr(6-4)pyo photoproducts. Proc Natl Acad Sci U S A, 1985 Oct, 82(19), 6394 - 8 Cloning and characterization of two cDNAs coding for human von Willebrand factor; Sadler JE et al.; A cDNA library was prepared in lambda gt11 bacteriophage from poly(A)+ RNA isolated from primary cultures of endothelial cells from human umbilical vein . Approximately 2.5 million independent recombinants were screened and 2 of those were found to synthesize a fusion protein with beta-galactosidase that reacted with rabbit antibody against human von Willebrand factor . Comparison of the amino acid sequence translated from the cDNA insert of the two clones with the amino acid sequence determined by Edman degradation of the protein established that both phage isolates code for von Willebrand factor . The first clone (lambda HvWF1) contained an insert of 404 nucleotides that corresponded to amino acid residues 1-110 in the mature protein circulating in blood, in addition to a portion (24 amino acids) of a prepro leader sequence . The second cDNA clone (lambda HvWF3) contained an insert of 4.9 kilobases that coded for the carboxyl-terminal 1525 amino acids of von Willebrand factor, a stop codon of TGA, 134 nucleotides of 3' noncoding sequence, and a poly(A) tail of 150 nucleotides . The two clones together code for greater than 80% of the molecule circulating in blood . The same carboxyl-terminal lysine residue was identified in the mature protein as well as in the cDNA, indicating that all of the proteolytic processing that occurs during the biosynthesis and assembly of von Willebrand factor is associated with the amino-terminal portion of the precursor protein . The amino acid sequence of von Willebrand factor indicates the presence of two different internal gene duplications and one triplication . These repetitive amino acid sequences account for about one-half of the amino acids present in the mature protein . The tetrapeptide sequence of Arg-Gly-Asp-Ser, which mediates the cell attachment and platelet binding activity of fibronectin, was also identified in the carboxyl-terminal portion of von Willebrand factor. J Biomol Struct Dyn, 1985 Oct, 3(2), 227 - 47 Specificity of the binding of bacteriophage M13 encoded gene-5 protein to DNA and RNA studied by means of fluorescence titrations; Bulsink H et al.; The fluorescence quenching of the bacteriophage M13 encoded gene-5 protein was used to study its binding characteristics to different polynucleotides . Experiments were performed at different salt concentrations and in some instances at different temperatures . The affinity of the protein depends on the base and sugar composition of the polynucleotides involved and may differ appreciably, i.e . by orders of magnitude . The salt dependence of binding is within experimental accuracy equal for all single stranded polynucleotides . A method is presented to estimate values of the cooperativity constant from salt titration curves . These values are systematically higher than those obtained from titration experiments in which protein is added to a polynucleotide solution . A comparison is made between the binding constants of the gene-5 protein and the gene-32 protein encoded by the T4 phage . Possible implications of the binding characteristics of the gene-5 protein for an understanding of its role in vivo are discussed. J Biochem Biophys Methods, 1985 Oct, 11(4-5), 203 - 12 A generally applicable improved method for preparation of single stranded cDNA probes from clones constructed in M13 vectors; Antoniou M et al.; A generally applicable simplified procedure for the preparation of radiolabeled cDNA hybridization probes from cDNA clones in M13 (M13mp8) bacteriophage vectors is described . A cDNA copy of the insert DNA is synthesized by controlled reaction with the Klenow fragment of E . coli DNA polymerase I, primed with oligo-dT or sequencing primer . The cDNA is separated from the recombinant phage DNA template by alkaline gel electrophoresis . Sensitivity of the cDNAs was tested by quantitative measurement of specific mRNAs in solution hybridization under RNA (R0t analysis) or cDNA (RNA titration) excess conditions . The procedure permits measurement of mRNA levels as small as 0.00001-0.00006% in total RNA preparation . Cellular accumulation of hormone-induced mRNAs for the milk proteins, whey acidic protein and epsilon-casein was also measured using the cDNAs. Nucleic Acids Res, 1985 Sep 25, 13(18), 6753 - 66 Sequence and analysis of the gene for bacteriophage T3 RNA polymerase; McGraw NJ et al.; The RNA polymerases encoded by bacteriophages T3 and T7 have similar structures, but exhibit nearly exclusive template specificities . We have determined the nucleotide sequence of the region of T3 DNA that encodes the T3 RNA polymerase (the gene 1.0 region), and have compared this sequence with the corresponding region of T7 DNA . The predicted amino acid sequence of the T3 RNA polymerase exhibits very few changes when compared to the T7 enzyme (82% of the residues are identical) . Significant differences appear to cluster in three distinct regions in the amino-terminal half of the protein . Analysis of the data from both enzymes suggests features that may be important for polymerase function . In particular, a region that differs between the T3 and T7 enzymes exhibits significant homology to the bi-helical domain that is common to many sequence-specific DNA binding proteins . The region that flanks the structural gene contains a number of regulatory elements including: a promoter for the E . coli RNA polymerase, a potential processing site for RNase III and a promoter for the T3 polymerase . The promoter for the T3 RNA polymerase is located only 12 base pairs distal to the stop codon for the structural gene. Nucleic Acids Res, 1985 Sep 25, 13(18), 6695 - 702 Knotting of DNA molecules isolated from deletion mutants of intact bacteriophage P4; Wolfson JS et al.; DNA molecules isolated from tailless phage particles (capsids) of bacteriophage P4 virl del10 are known to be knotted . We have found by electron microscopy that 80% of DNA molecules isolated from intact phage particles of P4 virl del10 also contained knots . This observation indicates that the predominant form of P4 virl del10 DNA within the intact phage particle is either knotted or in a configuration that permits knotting upon isolation . In comparison to P4 virl del10 (deleted 1000 basepairs), DNA molecules isolated from intact P4 virl del2 (deleted 650 basepairs) and P4 virl (non-deleted) contained 50% and 15% knots respectively, showing an association of decreased size of deletion of DNA with a decreased fraction of knotted genomes. J Biol Chem, 1985 Sep 25, 260(21), 11838 - 44 Characterization of a third, cII-dependent, coordinately activated promoter on phage lambda involved in lysogenic development; Ho YS et al.; Lysogenic development by bacteriophage lambda is known to require the coordinate expression of two phage operons . Coordinate control is achieved by a positive regulatory mechanism which activates transcription from the promoters of these operons, PRE and PI . The positive effector is the phage regulatory protein cII . We now identify and characterize a third cII-dependent transcription unit on phage lambda, which is positioned in the middle of the Q regulatory gene and has an anti-Q orientation . We demonstrate the cII-dependent function of this promoter and precisely map its 5' transcription start-site both in vitro and in vivo . Most importantly, we show that cII binding and transcription activation at PaQ occur at essentially the same cII levels as those required for PRE and PI activation, and that all three promoters respond to cII at the same time following phage infection . In addition, DNase protection studies demonstrate that cII selectively interacts with the same TTGCN6TTGC DNA sequence repeat in the -35 region of PaQ which cII interacts with at both PRE and PI . We find that cII also binds other TTGCN6TTGC repeat sequences on lambda but binding at these sites does not lead to productive transcription . We conclude that PaQ functions in concert with PRE and PI to regulate the lysogenic growth response of phage lambda . We presume that the PaQ directed anti-sense Q RNA transcript functions to down-regulate the expression of the Q gene, which is needed for the expression of all phage late genes during lytic growth. Biochemistry, 1985 Sep 24, 24(20), 5672 - 7 Cloning, expression, and purification of gene 3 endonuclease from bacteriophage T7; Pham TT et al.; The structural gene for the single-stranded endonuclease coded for by gene 3 of bacteriophage T7 has been cloned in pGW7, a derivative of the plasmid pBR322, which contains the lambda PL promoter and the gene for the temperature-sensitive lambda repressor, cI857 . The complete gene 3 DNA sequence has been placed downstream of the PL promoter, and the endonuclease is overproduced by temperature induction at mid-log phase of Escherichia coli carrying the recombinant plasmid pTP2 . Despite the fact that cell growth rapidly declines due to toxic effects of the excess endonuclease, significant amounts of the enzyme can be isolated in nearly homogeneous form from the induced cells . An assay of nuclease activity has been devised using gel electrophoresis of the product DNA fragments from DNA substrates . These assays show the enzyme to have an absolute requirement for Mg(II) (10 mM), a broad pH optimum near pH 7, but significant activity from pH 3 to pH 9, and a 10-100-fold preference for single-stranded DNA (ssDNA) . The enzyme is readily inactivated by ethylenediaminetetraacetic acid or high salt . The differential activity in favor of ssDNA can be exploited to map small single-stranded regions in double-stranded DNAs as shown by cleavage of the melted region of an open complex of T7 RNA polymerase and its promoter. Biochemistry, 1985 Sep 24, 24(20), 5494 - 9 Sequence of the cDNA and gene for angiogenin, a human angiogenesis factor; Kurachi K et al.; Human cDNAs coding for angiogenin, a human tumor derived angiogenesis factor, were isolated from a cDNA library prepared from human liver poly(A) mRNA employing a synthetic oligonucleotide as a hybridization probe . The largest cDNA insert (697 base pairs) contained a short 5'-noncoding sequence followed by a sequence coding for a signal peptide of 24 (or 22) amino acids, 369 nucleotides coding for the mature protein of 123 amino acids, a stop codon, a 3'-noncoding sequence of 175 nucleotides, and a poly(A) tail . The gene coding for human angiogenin was then isolated from a genomic lambda Charon 4A bacteriophage library employing the cDNA as a probe . The nucleotide sequence of the gene and the adjacent 5'- and 3'-flanking regions (4688 base pairs) was then determined . The coding and 3'-noncoding regions of the gene for human angiogenin were found to be free of introns, and the DNA sequence for the gene agreed well with that of the cDNA . The gene contained a potential TATA box in the 5' end in addition to two Alu repetitive sequences immediately flanking the 5' and 3' ends of the gene . The third Alu sequence was also found about 500 nucleotides downstream from the Alu sequence at the 3' end of the gene . The amino acid sequence of human angiogenin as predicted from the gene sequence was in complete agreement with that determined by amino acid sequence analysis . It is about 35% homologous with human pancreatic ribonuclease, and the amino acid residues that are essential for the activity of ribonuclease are also conserved in angiogenin . This provocative finding is thought to have important physiological implications. J Biol Chem, 1985 Sep 15, 260(20), 11223 - 30 Isolation and characterization of the human tissue-type plasminogen activator structural gene including its 5' flanking region; Fisher R et al.; mRNA specific for tissue type plasminogen activator (t-PA) is induced in HeLa cells by the tumor promoter phorbol myristate acetate (Waller, E.K., and Schleuning, W.D . (1985) J . Biol . Chem . 260, 6354-6360) . To study the underlying mechanism, a cDNA library was constructed from phorbol myristate acetate stimulated HeLa cell mRNA and screened with two t-PA mRNA specific oligonucleotides (Edlund, T., Ny, T., Ranby, M., Heden, L.-O., Palm, G., Holmgren, E., and Josephson, S . (1983) Proc . Natl . Acad . Sci . U.S.A . 80, 349-352) . Two nearly full length double-stranded cDNA clones were obtained . Suitable restriction fragments from the cDNA were employed as probes for the isolation of three recombinant bacteriophages, containing overlapping fragments of the t-PA gene . By restriction analysis, heteroduplex mapping, and DNA sequencing it was determined that the three overlapping fragments contain the complete t-PA structural gene and that the 2658 bases long t-PA mRNA is encoded by a gene of approximately 29 kilobases overall length, which is interrupted by 13 introns . To characterize the presumptive control region, a subcloned gene fragment, containing the 5' sequence of the cDNA, was sequenced, and the transcription initiation site was identified by nuclease S1 protection experiments . The putative transcription start site is located 24 base pairs (bp) downstream of a typical TATA consensus sequence . Two additional TATA motifs with hitherto unknown functions are found 93 and 226 bp upstream of the putative cap site . A recombinant plasmid was constructed, which accommodates the cap site including 475 bp of upstream sequences, fused to a double-stranded cDNA of t-PA mRNA which contains the complete translated and parts of the 5' and 3' untranslated regions . This plasmid directs t-PA biosynthesis in Xenopus laevis oocytes after microinjection into the germinal vesicle. J Biol Chem, 1985 Sep 15, 260(20), 11033 - 8 Effects of genome size on bacteriophage phi X174 DNA packaging in vitro; Aoyama A et al.; Effects of the size of template DNA on the DNA packaging reaction of bacteriophage phi X174 were studied using plasmids of various sizes which contain the phi X174 origin of DNA replication and the in vitro phage synthesizing system (Aoyama, A., Hamatake, R . K., and Hayashi, M . (1983) Proc . Natl . Acad . Sci . U.S.A . 80, 4195-4199) . DNA between 78.5% and 101% of the length of phi X174 DNA produced infectious particles efficiently . Packaging of DNA smaller or larger than this range produced uninfectious defective particles . Although these particles contained circular single-stranded DNA, they suffered structural changes which altered the sedimentation properties or the ability to adsorb to the cells . Mutant phage were found from the packaging reaction of DNA larger than 101% of phi X174 DNA . These mutants deleted the termination region of DNA, suggesting that they were produced by early termination of the phage synthesizing reaction. J Mol Biol, 1985 Sep 5, 185(1), 83 - 91 Initiation of transcription by bacteriophage T4-modified RNA polymerase independently of host sigma factor; Malik S et al.; After infection of Escherichia coli with bacteriophage T4 a series of modifications of RNA polymerase takes place including the association of several small polypeptides . We isolated RNA polymerase from cells abortively infected with a series of T4 mutants which arrest phage development at different stages and found that different sets of associated proteins are present in RNA polymerase in each case . The patterns of associated polypeptides seem to correlate with DNA content in the infected cells, suggesting that some of them can be involved both in DNA replication and in the transcription apparatus . One of the modified forms of RNA polymerase contains stoichiometric amounts of a protein with Mr = 25,000 (25K protein), which remains associated with the core enzyme after the removal of sigma factor by chromatography on phosphocellulose . The 25K protein was purified to homogeneity and its effect on transcription selectivity was analyzed in an in vitro system using fragments of T4 DNA as templates . The 25K protein exists in two functional forms which direct core RNA polymerase to utilize two different types of transcription start sites (class I and class II promoters) . Both activities do not require host sigma factor . The two forms of 25K protein seem to compete with each other for the core enzyme . The isolated 25K protein can form stable dimers, suggesting that its two activities are associated with the dimeric and monomeric forms . Class I (but not class II) promoters can also be utilized in response to the host sigma factor.(ABSTRACT TRUNCATED AT 250 WORDS) Clin Lab Med, 1985 Sep, 5(3), 513 - 29 Nucleic acid hybridization in the diagnosis of viral infections; Landry ML et al.; Recombinant DNA technology, including molecular cloning and nucleic acid hybridization, is now being applied to problems in clinical virology . Although viral isolation in cell culture remains the most sensitive and specific diagnostic test for many viruses, for some viruses, isolation in cell culture is lengthy or difficult or has not yet been achieved . Utilization of hybridization techniques has already resulted in important new information concerning the pathogenesis of a number of viruses, such as Epstein-Barr virus, hepatitis B virus, and human papillomavirus . In addition, time to diagnosis for viruses such as cytomegalovirus, Epstein-Barr virus, and varicella-zoster virus can be significantly shortened to 36 to 48 hours, a great improvement over standard isolation with obvious importance for patient management . Hybridization techniques have also been applied to screening of antiviral agents . Although results of studies to date have been encouraging, significant problems remain to be solved before these techniques can be applied in a routine diagnostic laboratory . First, more sensitive assays must be developed . One approach is the generation of probes with higher specific activities . Synthesis of single-stranded probes using recombinant M13 bacteriophage as a template results in probes of higher specific activities that also cannot re-anneal to themselves because they are not complementary . Thus, more probe is available to anneal to sample DNA . Synthesis of cRNA probes that form more stable hybrids with DNA is another approach that is receiving attention . A second problem is reagent safety and stability . The most sensitive and commonly used label in the studies reviewed in this article has been 32P . With its half-life of 2 weeks, potential hazards to personnel, and disposal problems, it is probably not suitable for clinical laboratories . A major step in the development of nonradioactive, stable probes has been synthesis of biotinylated nucleotide analogues that can be efficiently incorporated into DNA or RNA . Biotinylated probes are stable for 1 to 2 years at -20 degrees C, and their use obviates the need for autoradiography, thus shortening reaction times . In addition, very high concentrations of probes can be used without the background problems encountered with radiolabels . To date, biotinylated probes have been significantly less sensitive than those labeled with 32P, but continued efforts to improve sensitivity have yielded promising results.(ABSTRACT TRUNCATED AT 400 WORDS) J Bacteriol, 1985 Sep, 163(3), 900 - 5 fipB and fipC: two bacterial loci required for morphogenesis of the filamentous bacteriophage f1; Lopez J et al.; We describe the identification of two mutations in bacterial genes, designated as fipB and fipC, which resulted in temperature-sensitive morphogenesis of bacteriophage f1 . These mutations mapped at separate loci but had to be present simultaneously to block f1 production at 41.5 degrees C . One mutation defined the locus fipB at 85.3 min on the Escherichia coli linkage map; the other defined the locus fipC, which mapped very close to rpsL at 73 min . Since these mutations did not appear to affect phage DNA replication, gene expression, or protein localization, they probably interfered with the its life cycle at the level of assembly . fipB mutants were partially deficient in adsorption of bacteriophage lambda, and fipB and fipC mutants leaked beta-lactamase into the medium, suggesting that the mutations affect outer-membrane structure or function. J Bacteriol, 1985 Sep, 163(3), 1290 - 2 Plasmid-dependent inhibition of growth of bacteriophage T4 ndd mutants; Snustad DP et al.; Mutants of bacteriophage T4 that fail to induce nuclear disruption (ndd mutants) are unable to grow in the wild-type Escherichia coli strain CT447 . This inhibition of the growth of ndd mutants occurs only in the presence of a large (ca . 80-megadalton) plasmid resident in CT447 cells. J Bacteriol, 1985 Sep, 163(3), 1270 - 4 Assembly site of bacteriophage f1 corresponds to adhesion zones between the inner and outer membranes of the host cell; Lopez J et al.; Morphogenesis of the filamentous bacteriophage f1 occurred at adhesion zones between the inner and outer membranes of the host cell . Quantitation of adhesion zones in cells infected with mutant phage strains suggested that the phage gene I protein may be involved in the formation of adhesion zones for phage assembly. Clin Immunol Immunopathol, 1985 Sep, 36(3), 330 - 7 Antibody deficiency with normal immunoglobulins in a child with hypoplastic anemia; Knutsen AP et al.; We report a young child with hypoplastic anemia and antibody deficiency with normal serum immunoglobulin levels . Studies of antibody responses to bacteriophage phi X 174 revealed an amnestic response but was predominantly limited to IgM . A similar response was observed following booster tetanus toxoid immunization . Analysis of in vitro pokeweed mitogen-induced immunoglobulin synthesis by the patient's B cells suggested an intrinsic B-cell defect. EMBO J, 1985 Sep, 4(9), 2343 - 6 The receptor specificity of bacteriophages can be determined by a tail fiber modifying protein; Riede I et al.; T-Even type bacteriophages recognize their cellular receptors with the distal ends of their long tail fibers . The distal part of these fibers consists of a dimer of gene product (gp) 37 . The assembly of this gp to a functional dimer requires the action of two other proteins, gp57 and gp38 . Genes (g) 38 have been cloned from five T-even type phages which use the Escherichia coli outer membrane protein OmpA as a receptor . The phages used differ in their ability to infect a series of ompA mutants producing altered OmpA proteins, i.e., each phage has a specific host range for these mutants . The cloned genes 38 complemented g38 amber mutants of phage T2, which uses the outer membrane protein OmpF as a receptor . The complemented phages had become phenotypically OmpA-dependent and, with one exception, OmpF-independent, but regained the host range of T2 upon growth in a host lacking the cloned g38 . The host range of the complemented phages, as determined on the ompA mutants, was identical to, similar to, or different from that of the phage, from which the cloned g38 originated . The results presented show that gp38 from one phage can phenotypically 'imprint', in a finely-tuned manner, a host range onto gp37 of another phage with a different host specificity . In view of the extreme diversity of host ranges observed, it is suggested that gp38 of T2 and of the OmpA-specific phages may remain attached to gp37 in the phage particle and in cooperation with gp37 determine the host range. Am J Hum Genet, 1985 Sep, 37(5), 839 - 52 Deletion mapping of human chromosome 5 using chromosome-specific DNA probes; Carlock LR et al.; A complete genomic DNA library was prepared from a Chinese hamster-human cell hybrid that contains human chromosome 5 as its only human DNA . Unique or low-copy DNA fragments, isolated form recombinant bacteriophage that contained human DNA inserts, were regionally mapped on chromosome 5 using Southern blot analysis of genomic DNA from a series of hybrid cell lines that were selected as having deletions of various portions of 5q . The chromosome 5-specific DNA library, together with a genetic selective procedure allowing the isolation of hybrid cell lines with deletions of virtually any portion of 5q, will provide a means to construct very accurate physical and recombinational maps of this human chromosome . This system represents an excellent opportunity to examine very precisely the relationship between physical and genetic distances for many loci along the length of this autosome. Mutat Res, 1985 Sep, 146(2), 135 - 41 Uvr-independent repair of 8-methoxypsoralen crosslinks in Escherichia coli: evidence for a recombinational process; Cupido M et al.; On the basis of survival data, repair of 8-methoxypsoralen DNA crosslinks in Escherichia coli strains lacking a functional uvrABC endonuclease, is shown to require the products of the recA, recB, recF and recN genes . Bacteria, grown under conditions where most cells contain only a single genome, show no evidence of crosslink repair . Similarly, bacteriophage lambda shows evidence of crosslink repair only in SOS-induced cells, and only at multiplicities of infection greater than 1 . The requirement for rec+ genes may be partly ascribed to the need for a functional SOS response, but taken together, the results suggest a recombinational step involving a homologous region of DNA may occur during uvr-independent crosslink repair. J Bacteriol, 1985 Sep, 163(3), 965 - 72 Phage-mediated cloning of bldA, a region involved in Streptomyces coelicolor morphological development, and its analysis by genetic complementation; Piret JM et al.; Streptomyces coelicolor bald (bld) mutants form colonies of vegetative substrate mycelium, but do not develop aerial hyphae or spore chains . The bldA strains form none of the four antibiotics known to be produced by the parent strain . With a vector derived from the temperate bacteriophage phi C31, a 5.6-kilobase fragment of wildtype DNA was cloned which restored sporulation to five independent bldA mutants when lysogenized with the recombinant phage . The cloned gene(s) was dominant over the mutant alleles . Phage integration by recombination of the cloned bldA+ DNA with the bldA region of each mutant produced mainly sporulating colonies, presumably heterozygous bldA+/bldA partial diploids for the insert DNA . However, a minority of these primary transductants were bald and were apparently homozygous bldA/bldA mutant partial diploids, formed by some homogenetization process . The phages released from the bald lysogens carried bldA mutations and were used to show that bldA+ sequences had been cloned and that fine mapping of the region could be performed. J Bacteriol, 1985 Sep, 163(3), 832 - 6 Presence of DNA, encoding parts of bacteriophage tail fiber genes, in the chromosome of Escherichia coli K-12; Riede I et al.; The classical T-even bacteriophages recognize host cells with their long tail fibers . Gene products 35, 36, and 37 constitute the distal moiety of these fibers . The free ends of the tail fibers, which are formed by the CO2H terminus of gene product 37, possess the host range determinants . It was found that 4 out of 10 different strains of Escherichia coli K-12 contained regions of chromosomal DNA which hybridized with a probe consisting of genes 35, 36, and 37 of the T-even phage K3 . From one strain this homologous DNA, which was associated with an EcoRI fragment of about 5 kilobases, was cloned into plasmid pUC8 . Two independently recovered hybrid plasmids had undergone a peculiar rearrangement which resulted in the loss of about 3 kilobases of cloned DNA and a duplication of both the vector and the remaining chromosomal DNA . The mechanisms causing this duplication-deletion may be related to that of transposases . The cloned DNA was capable of recombination with phage T4 gene 36 and a phage T2 gene 37 amber mutant . DNA sequencing revealed the existence of regions of identity between the cloned DNA and genes 36 and 37 of phage T2 . In addition, after growth of a derivative of phage K3 on a strain harboring T2 DNA, it was found that this phage contained the same parts of the T2 tail fiber genes which had been recovered from the bacterial chromosome . There appears to be little doubt that the phage had picked up this DNA from the host . The possibility is considered that a repertoire of parts of genes 36 and 37 of various T-even-type phages is present in their hosts, allowing the former to change their host ranges. Mol Gen Mikrobiol Virusol, 1985 Sep, (9), 15 - 9 {DNA structure in the particles of 5 bacteriophages from the data of circular dichroism}; Karasev AV et al.; DNA optical activities in situ were studied in the particles of five medium sized bacteriophages (SB1, F15; IRA, SD and T7) . Delta epsilon in the CD spectrum of intraphage DNA is not shown to correlate with the sizes of phage heads or with the light scattering characteristics of phage suspension . Bacteriophage SB1, studied for the first time, has the amplitude of CD spectrum in the 260-300 nm region higher, than the CD spectrum of its free phage DNA . CD magnitude in the 260-300 nm region is different for varying phages while the red shift of the positive band in the CD spectrum takes place for all phages studied . The dense packing of DNA is suggested to be a common factor for the red shift being observed for all phages . The different delta epsilon in the 260-300 nm region might reflect the different nature in changes of helical DNA geometry inside phage particles as compared with the changes in solutions . The increase in melting temperatures for intraphage DNA as compared with the temperature for free DNA was not shown to correlate with the CD spectrum difference of intraphage DNAs . This property of intraphage DNAs is supposed to be connected with the dense packing of DNA in bacteriophage deoxyribonucleoprotein. J Bacteriol, 1985 Sep, 163(3), 1229 - 36 N conjugative transfer system of plasmid pCU1; Thatte V et al.; The mating and plasmid DNA transfer functions in Escherichia coli K-12 strains that are determined by the IncN group plasmid pCU1 are specified by a single 19.4-kilobase (kb) segment of the 39-kb plasmid . Analysis of this tra region by transposon Tn5 mutagenesis and by complementation tests indicated that a subset of tra comprising six complementation groups (presumably transcription units) determines sensitivity to the N pilus-specific bacteriophages IKe and PRD1 . Deletion derivatives and molecular clones that contained only this part of tra conferred sensitivity to IKe and PRD1 and the ability to produce N pili without conferring the Tra phenotype . The entire tra region contained two other complementation groups . If the 19.4-kb tra region is interrupted by DNA that is irrelevant to the Tra phenotype, such DNA must be less than 2 kb long . There are two regions within tra where this is a possibility . These observations are compared with those obtained recently with a related plasmid. Cancer Res, 1985 Sep, 45(9 Suppl), 4568s - 4573s Production of oncogene-specific proteins and human T-cell leukemia (lymphotropic) retrovirus (HTLV-I) envelope protein in bacteria and its potential for use in human cancers and seroepidemiological surveys; Papas TS et al.; The oncogenes coding for the Harvey murine sarcoma virus p21ras protein as well as those coding for myc, myb, and mht products were fused to the amino-terminal portion of the bacteriophage lambda cII gene on the expression vector pJL6 . In addition two regions of the gene for the human T-cell leukemia virus subgroup I (HTLV-I) envelope were expressed in our bacterial system . Each of 11 human sera tested that had been shown to contain antibodies to HTLV-I or -II by an enzyme-linked immunosorbent assay recognized the bacterially synthesized envelope proteins . No reaction was detected when 17 control sera were tested . This system will be useful for large-scale seroepidemiological surveys for HTLV-I and related human retroviruses . The other oncogene products expressed in our bacterial vector system also demonstrated specific immunoreactivities . In addition to this feature the bacterial ras protein was seen to bind guanosine diphosphate and was capable of autophosphorylation . Taken together these data suggest that the proteins produced with high efficiency by the bacterial expression system can be immunologically recognized as antigens and can in part perform some of their associated biochemical functions. Mol Biol (Mosk), 1985 Sep-Oct, 19(5), 1216 - 22 {Principles of selective inactivation of the virus genome . IV . The effect of UV-irradiation of phage MS2 on its binding with anti-MS2-immunoglobulins}; Budovskii EI et al.; Ultraviolet (254 nm) irradiation of the bacteriophage MS2 results in the decrease of the number of antigenic determinants exposed on the virion surface . The cross-section of the decrease, as measured by the number of anti-MS2 IgG molecules bound per virion, is 10(-16) mm2 per photon . The decrease of the phage-antibody binding proceeds after irradiation with a rate constant of about 5 x 10(-3) min-1 . Since the antigenic determinants of the phage MS2 coat protein does not contain photoreactive amino acid residues, the irradiation-induced decrease of the phage antibody binding is determined, most probably, by the shielding of the antigenic determinants . Such shielding could be caused by rearrangement of coat protein molecules and/or of the capsid induced by photomodification of non-antigenic fragments of coat protein and/or of intraphage RNA. EMBO J, 1985 Sep, 4(9), 2337 - 42 E . coli NusA protein binds in vitro to an RNA sequence immediately upstream of the boxA signal of bacteriophage lambda; Tsugawa A et al.; The NusA protein of Escherichia coli is a factor which mediates termination of transcription . In this paper, we demonstrate that the NusA protein can bind in vitro to a specific site on the mRNA of bacteriophage lambda . Several RNAs were synthesized by in vitro transcription of truncated lambda DNA templates, and the activity of NusA binding to these RNAs was examined by a Millipore filter-binding assay . RNAs containing the sequence immediately upstream of the boxA site were trapped on the filter by association with the NusA protein, but those lacking the site were not . Anti-NusA antibody inhibits this binding . To determine the binding site precisely, we developed a new method which we have named 'reverse-transcriptase mapping' . The RNA transcribed from the pL promoter was incubated with 32P-labelled DNA primer and NusA, and the primer-extension reaction was started by adding the reverse transcriptase . In this way, the primer extension was blocked at the position G of the boxA RNA sequence (5'CGCUCUUA 3'), indicating that the NusA-protection site is immediately upstream of boxA and includes the 5'-end C . The NusA protein purified from a temperature-sensitive nusA mutant defective in transcription termination showed reduced and thermolabile RNA-binding activity, suggesting that the RNA-binding activity is related to the physiological function of NusA. J Cell Biol, 1985 Sep, 101(3), 1094 - 9 Translation of mRNA injected into Xenopus oocytes is specifically inhibited by antisense RNA; Harland R et al.; The bacteriophage SP6 promoter and RNA polymerase were used to synthesize sense and antisense RNAs coding for the enzymes thymidine kinase (TK) and chloramphenicol acetyl transferase (CAT) . Injection of antisense CAT RNA into frog oocytes inhibited expression of sense CAT mRNA . Similarly, antisense TK RNA inhibited expression of sense TK mRNA . Antisense RNAs were stable in oocytes and had no detectable effect on either the expression of endogenous proteins or on the expression of nonhomologous RNA transcripts . CAT activity expressed from a plasmid transcribed in the oocyte nucleus was also inhibited by antisense RNA injected into the oocyte cytoplasm . The data suggest that antisense RNA will be useful in identifying the function of specific mRNA sequences during early development of the frog. Nucleic Acids Res, 1985 Aug 26, 13(16), 5937 - 48 Cloned DNA sequences that determine mRNA stability of bacteriophage phi X174 in vivo are functional; Hayashi MN et al.; The stability of two species of phi X174 polycistronic mRNA in vivo can be altered by mutating sequences existing immediately upstream of a termination site . The wild type phage contains an mRNA stabilizing sequence ((+) sequence), while the same sequence mutated by insertion ((-) sequence) reduces the stability of the mRNAs . These two sequences were cloned at the 3' ends of gene D or gene B of phi X174 in a pBR322 derivative plasmid . The cloned sequences were functional . The (+) sequence stabilized gene B or gene D mRNA; half-lives of these mRNAs were 7 to 8 min . When the (+) sequence is eliminated ((o) sequence) or replaced with the (-) sequence, the half-lives of the mRNA were reduced to about 1 to 2 min . The stabilization of mRNAs caused an increased production of these proteins. J Mol Biol, 1985 Aug 20, 184(4), 739 - 41 Structure of phage P22 gene 19 lysozyme inferred from its homology with phage T4 lysozyme . Implications for lysozyme evolution; Weaver LH et al.; The amino acid sequence of the lysozyme from phage P22 is shown to be homologous (26% identity) with the lysozyme from bacteriophage T4 . The sequence correspondence suggests that the structure of P22 lysozyme is similar to the known structure of T4 lysozyme within the "core" of the molecule, including the active site cleft . However, P22 lysozyme appears to lack two surface loops present in T4 lysozyme . It is possible that P22 lysozyme may provide an "evolutionary link" between the phage-type lysozymes and the goose-type lysozymes. Biochem Biophys Res Commun, 1985 Aug 15, 130(3), 1093 - 101 The energetics of the injection process of bacteriophage lambda DNA and the role of the ptsM/pel-encoded protein; Filali Maltouf AK et al.; We have examined the nature of the role played in the process of phage lambda DNA injection by the bacterial protein coded by the ptsM/pel gene . Neither the specific inhibition of the activity of the PtsM protein, nor the addition of inhibitors of phosphotransferase system modified the efficiency of lambda DNA penetration . Thus, the PtsM/Pel protein does not seem to play a role through its transport function, although we have confirmed that it must be present for a successful lambda DNA injection . Moreover, the presence of various metabolic inhibitors (uncouplers, cyanide, arsenate) separately or together, or even harsher methods of energy depletion did not prevent lambda DNA penetration, suggesting that DNA is entering the cell cytoplasm by diffusion. J Biol Chem, 1985 Aug 15, 260(17), 9608 - 12 Intron structure of the human antithrombin III gene differs from that of other members of the serine protease inhibitor superfamily; Prochownik EV et al.; Antithrombin III (ATIII) plays an integral role in the coagulation system by inhibiting thrombin and several other activated clotting factors . Inherited deficiency of ATIII is quite common and can result in life-threatening thrombotic complications . In order to understand the basis of ATIII deficiency, we have isolated and characterized the normal human ATIII gene from a recombinant Charon 4A bacteriophage genomic library . The ATIII gene contains six exons and five introns distributed over approximately 19 kilobases of DNA . The positions of introns in the ATIII gene were compared with other members of the serine protease inhibitor family which share 17-31% amino acid homology . When aligned to achieve maximal protein homology, only one of the ATIII introns corresponded to the four introns of rat angiotensinogen or human alpha 1-antitrypsin . Similarly, only one ATIII intron was homologous to the seven introns of chicken ovalbumin . We present two testable models to explain the discrepancy in intron positions among members of the serine protease inhibitor superfamily of genes. Biochemistry, 1985 Aug 13, 24(17), 4553 - 62 1H NMR studies of lambda cro repressor . 2 . Sequential resonance assignments of the 1H NMR spectrum; Weber PL et al.; The cro repressor protein from bacteriophage lambda has been studied in solution by two-dimensional nuclear magnetic resonance spectroscopy (2D NMR) . Following the approach of Wuthrich and co-workers {Wuthrich, K., Wider, G., Wagner, G., & Braun, W . (1982) J . Mol . Biol . 155, 311-319}, individual spin systems were identified by J-correlated spectroscopy (COSY) supplemented, where necessary, by relayed coherence transfer spectroscopy (RELAY) . Nuclear Overhauser effect spectroscopy (NOESY) was used to obtain sequence-specific assignments . From the two-dimensional spectra, the peptide backbone resonances (NH and C alpha H) for 65 of the 66 amino acids were assigned, as well as most of the side chain resonances . The chemical shifts for the assigned protons are reported at 35 degrees C in 10 mM potassium phosphate, pH 6.8, and in 10 mM potassium phosphate, pH 4.6, 0.2 M KCl, and 0.1 mM EDTA . Small shifts were observed for some resonances upon addition of salt, but no major changes in the spectrum were seen, indicating that no global structural change occurs between these ionic strengths . NOE patterns characteristic of alpha-helices, beta-strands, and turns are seen in various regions of the primary sequence . From the location of these regions the secondary structure of cro in solution appears to be virtually identical with the crystal structure {Anderson, W . F., Ohlendorf, D . H., Takeda, Y., & Matthews, B . W . (1981) Nature (London) 290, 754-758} . Missing assignments include the Pro-59 resonances and the peripheral protons of the eight lysine, the three arginine, and three of the five isoleucine residues. J Biol Chem, 1985 Aug 5, 260(16), 9412 - 8 Interaction of rho factor with bacteriophage lambda cro gene transcripts; Ceruzzi MA et al.; Rho protein is responsible for termination of transcription of the cro gene of bacteriophage lambda . Since rho is known to interact with the RNA whose synthesis is being terminated, we measured the specificity and strength of binding of rho to isolated cro transcripts, using a nitrocellulose filter retention assay . The association constant (K alpha) for the binding of rho to a 372-nucleotide cro transcript was determined to be 7 +/- 2 X 10(8) M-1 at 37 degrees C and about 20-fold less at 4 degrees C . Although NTP cleavage is required for rho activity, the presence of ATP did not alter the K alpha . Rho bound less tightly (K alpha less than 10(8) M-1) to partial cro transcripts smaller than 290 nucleotides and had very little affinity (K alpha less than 10(6) M-1) for lambda 4 S RNA, lambda 6 S RNA, and partial cro transcripts smaller than 160 nucleotides . In contrast, cro transcripts as short as 100 nucleotides bound if guanosine residues were replaced with inosine . In addition, rho bound readily to 3' fragments of cro RNA that had 85 or more residues . A common feature of the RNA molecules that bind tightly to rho protein is that they have a stretch of at least 85 nucleotides with relatively few (less than 14%) guanosine residues . Such a segment is thus likely to be largely single-stranded . These results suggest that the binding of rho to lambda cro mRNA is dependent on a 3' terminal segment that has those properties. J Biochem (Tokyo), 1985 Aug, 98(2), 427 - 33 Arabinosylnucleoside 5'-triphosphate inhibits DNA primase of calf thymus; Yoshida S et al.; It has been shown that DNA primase activity is tightly associated with 10S DNA polymerase alpha from calf thymus and that the ribonucleotide-dependent DNA synthesis is more sensitive to araCTP than DNA-primed DNA synthesis (Yoshida, S., et al . (1983) Biochim . Biophys . Acta 741, 348-357) . Here we measured DNA primase activity using poly(dT) template or M13 bacteriophage single-stranded DNA template and primer RNA synthesis was coupled to the reaction by Escherichia coli DNA polymerase I Klenow fragment . By this method, the primer RNA synthesis can be measured independently of the associating DNA polymerase alpha . Using poly(dT) template, it was found that arabinosyladenine 5'-triphosphate (araATP) strongly inhibited DNA primase in competition with rATP . The apparent Ki for araATP was 21 microM and the ratio of Ki/Km (for rATP) was as low as 0.015 . With poly(dI, dT) or M13 DNA, it was shown that araCTP also inhibited DNA primase in the similar manner . Product analysis using {alpha-32P}rATP showed that araATP inhibited the elongation of primer RNA . However, it is not likely that arabinosylnucleotides act as chain-terminators, since incubation of primer RNA with araATP did not abolish its priming activity . From these results, it is suggested that arabinosylnucleotide inhibits the initiation as well as elongation of Okazaki fragments in mammalian cells. Mol Gen Mikrobiol Virusol, 1985 Aug, (8), 38 - 44 {Isolation of mutant genes for human leukocyte alpha2-interferon by a method of localized mutagenesis}; Petrenko VA et al.; An efficient method to obtain the mutant genes for human leucocyte alpha 2-interferon (IFN) has been elaborated.The technique includes the following main stages: cloning of interferon gene in M13mp8 DNA; isolation of double-stranded hybrid DNA complex, containing IFN gene as a single-stranded fragment; selective modification of a single-stranded hybrid DNA by sodium bisulphite; the repair of hybrid DNA by DNA polymerase I from Escherichia coli, transformation of Escherichia coli JN103 cells by double-stranded circular DNA, containing the selectively modified gene IFN . The technique is based on the protection of bacteriophage M13 genome from mutagen induced damage by means of converting phage DNA into the double-stranded structure leaving the single-stranded fragment to be mutagenized prone to mutagen action . This is achieved by reannealing of single-stranded M13mpB DNA hydrolyzed by restriction endonuclease BamHI . The technique preserves the infectiousness of vector DNA under the conditions permitting modification of up to 10% cytosine residues in IFN gene . Every clone resulting from transformation of Escherichia coli by modified DNA carried mutations in IFN gene, identified by sequencing after Sanger. Proc Natl Acad Sci U S A, 1985 Aug, 82(16), 5550 - 4 Mass distribution of a probable tail-length-determining protein in bacteriophage T4; Duda RL et al.; Analysis of dark-field scanning transmission electron micrographs of unstained freeze-dried specimens established that the interior of the intact bacteriophage T4 tail tube contains extra density that is missing in tubes artificially emptied by treatment with 3 M guanidine hydrochloride . The mass of the tail tube is 3.1 X 10(6) daltons, and the central channel is 3.2 nm in diameter . Quantitative analysis of the density data is consistent with the presence of up to six strands of a protein molecule in the central channel that could serve as the template or ruler structure that determines the length of the bacteriophage tail and that could be injected into the cell with the phage DNA. Proc Natl Acad Sci U S A, 1985 Aug, 82(16), 5275 - 9 Defective antitermination of rRNA transcription and derepression of rRNA and tRNA synthesis in the nusB5 mutant of Escherichia coli; Sharrock RA et al.; The nusB5 mutant of Escherichia coli was originally selected for reduced ability to support the antitermination of transcription that is mediated by the gene N product of bacteriophage lambda . By analyzing pulse-labeled RNA with an RNA.DNA filter hybridization technique, we have shown that, in the nusB5 mutant, the ratio of promoter-proximal rRNA transcripts to promoter-distal transcripts is increased at least by a factor of 1.6; that is, in the absence of the functional nusB gene product, premature transcription termination takes place within rRNA operons . These results demonstrate that rRNA transcription in E . coli utilizes an antitermination mechanism that has at least one factor in common with the phage lambda system, the nusB gene product . We have also observed that the transcription initiation frequency at rRNA promoters is increased in the nusB5 strain and that this strain accumulates 30S and 50S ribosomal subunits at approximately the same rate as the parent . Thus, it appears that E . coli compensates for premature termination of rRNA transcription by derepressing rRNA operon expression . The increase in rRNA promoter activity in the nusB5 mutant is accompanied by a parallel derepression of synthesis of tRNAs that are not encoded by rRNA operons . These results are consistent with a model for negative feedback regulation of rRNA and tRNA synthesis by products of rRNA operons. J Bacteriol, 1985 Aug, 163(2), 704 - 8 Inhibitory effect of high-level transcription of the bacteriophage lambda nutL region on transcription of rRNA in Escherichia coli; Sharrock RA et al.; Transcription of the bacteriophage lambda nutL region from the PL promoter on a multicopy plasmid in Escherichia coli causes a reduction in growth rate and in transcription of rRNA relative both to total transcription and to transcription of tRNAs that are not encoded in rRNA operons . These observations support the hypothesis, previously based on nut site DNA sequence homology, that the phage lambda and rRNA antitermination systems are related. Mol Gen Mikrobiol Virusol, 1985 Aug, (8), 21 - 6 {Localized mutagenesis of the tetracycline gene in the plasmid pBR322 induced by sodium bisulfite in vitro}; Ugarov VI et al.; The technique of localized in vitro mutagenesis in the cohesive ends of plasmid pBR322 DNA has been elaborated (separately for BamHI and HindIII sites) . Plasmid DNA digested by restriction endonucleases has been treated with sodium bisulphite deaminating cytosine to form uracil in single stranded DNA (cohesive ends of the plasmid) . The mutagenized plasmid DNA, free of mutagen, has been treated with bacteriophage T4 ligase . E . coli C600 cells were subsequently transformed by the ligated DNA preparation . The clones having tetracycline gene mutagenized represented 4.0-11.1% and 1.2-3.1% among HindIII and BamHI mutants, respectively, selected as TcR----TcS transformants . Selection of mutagenized DNA by the second endonuclease restriction has increased the mutant yields up to 55.6-78.0% and 10.0-75.4%, respectively . The yield of TcS mutations in the control DNA treated at all stages of experiment, except for mutagen treatment, has reached 0.06% and 0.2%, respectively. Mol Cell Biol, 1985 Aug, 5(8), 1887 - 93 In vitro expression of human p53 cDNA clones and characterization of the cloned human p53 gene; Wolf D et al.; The human p53 gene was cloned and characterized by using a battery of p53 DNA clones . A series of human cDNA clones of various sizes and relative localizations to the mRNA molecule were isolated by using the human p53-H14 (2.35-kilobase) cDNA probe which we previously cloned . One such isolate, clone p53-H7 (2.65 kilobases), spans the entire human mature p53 mRNA molecule . Construction of the human cDNA clones in the pSP65 RNA transcription vector facilitated the generation of p53 transcripts by the SP6 bacteriophage RNA polymerase . The p53-specific RNA transcripts obtained without further processing were translated into p53 proteins in a cell-free system . By using this rapid in vitro transcription-translation assay, we found that whereas clone p53-H7 (2.65 kilobases) coded for a mature-sized p53 protein, a shorter cDNA clone, p53-H13 (1.8 kilobases), dictated the synthesis of a smaller-sized p53 protein (45 kilodaltons) . The p53 proteins synthesized in vitro immunoprecipitated efficiently with human-specific anti-p53 antibodies . Genomic analysis of human DNA revealed the presence of a single p53 gene residing within two EcoRI fragments . Heteroduplex analysis between the full-length cDNA clone p53-H7 and the cloned p53 gene indicated the presence of seven major exons. Appl Environ Microbiol, 1985 Aug, 50(2), 261 - 4 Inactivation of Norwalk virus in drinking water by chlorine; Keswick BH et al.; Norwalk virus in water was found to be more resistant to chlorine inactivation than poliovirus type 1 (LSc2Ab), human rotavirus (Wa), simian rotavirus (SA11), or f2 bacteriophage . A 3.75 mg/liter dose of chlorine was found to be effective against other viruses but failed to inactivate Norwalk virus . The Norwalk virus inoculum remained infectious for five of eight volunteers, despite the initial presence of free residual chlorine . Infectivity in volunteers was demonstrated by seroconversion to Norwalk virus . Fourteen of 16 subjects receiving untreated inoculum seroconverted to Norwalk virus . Illness was produced in four of the eight volunteers and in 11 of 16 control subjects . A similar Norwalk virus inoculum treated with a 10 mg/liter dose of chlorine produced illness in only one and failed to induce seroconversion in any of eight volunteers . Free chlorine (5 to 6 mg/liter) was measured in the reaction vessel after a 30-minute contact period . Norwalk virus appears to be very resistant to chlorine which may explain its importance in outbreaks of waterborne disease. Biomed Mass Spectrom, 1985 Aug, 12(8), 393 - 8 Verification of the DNA predicted amino acid sequence of bacteriophage P22 tail protein by mass spectrometry; Beckner CF et al.; Mass spectrometry was used to verify portions of a proposed amino acid sequence of the bacteriophage P22 tail protein which had been inferred from the DNA base sequence . The exopeptidases dipeptidyl aminopeptidase I and IV and dipeptidyl carboxypeptidase were used to hydrolyse intact protein and fragments generated by cyanogen bromide treatment of the tail protein . After partial purification by high performance liquid chromatography, peptides were identified by gas chromatography/mass spectrometry and fast atom bombardment mass spectrometry . The results indicate that the initiation amino acid, N-formylmethionine, has been removed from the N-terminal of the protein and that the protein ends at the termination codon which is 667 amino acids from the N-terminal residue . Nine regions of the protein from 13 to 42 residues in length were verified . All of the sequences checked were in the same DNA reading frame and corresponded to the proposed sequence. J Biomol Struct Dyn, 1985 Aug, 3(1), 173 - 83 Topological comparison of two helix destabilizing proteins: ribonuclease A and the gene 5 DNA binding protein; Brayer GD et al.; A topological comparison of the two helix destabilizing proteins, pancreatic ribonuclease A and the gene 5 DNA binding protein of bacteriophage fd has been completed utilizing the available high resolution tertiary structures of each protein . The results indicate these two proteins are structurally if not also evolutionarily related . Regions of closet topological equivalence occur between beta loops directly involved in nucleotide binding or are required for the maintenance of their respective oligonucleotide binding channels . In addition, there is a similar placement of critical amino acid side chains about the binding site . Further evidence for this structural relationship is obtained by comparison of structural data for the mode of complexation of polynucleotides to each protein . The results of topological comparison suggest the essential property shared by helix destabilizing proteins, whether specialized DNA binding proteins such as G5BP or proteins with other primary functional roles, like ribonuclease A, is the presence of an elongated oligonucleotide binding channel . Although ribonuclease A and G5BP are structurally related, it seems likely any protein with this structural feature will exhibit a helix destabilizing capacity . This conclusion is supported by the diversity of molecular characteristics shown by other proteins having this activity. Virology, 1985 Jul 30, 144(2), 502 - 15 Isolation and characterization of bacteriophage T3/T7 hybrids and their use in studies on molecular basis of DNA-packaging specificity; Yamagishi M et al.; In vitro DNA-packaging systems of bacteriophages T3 and T7 packaged homologous DNA more efficiently than heterologous DNA . Packaging of phage DNA proceeds by way of concatemeric intermediates (H . Fujisawa, J . Miyazaki, and T . Minagawa (1978), Virology 87, 394-400) . The conversion of mature homologous and heterologous DNAs to concatemers was efficient in both the T3- and T7-packaging systems . In vitro complementation experiments indicate that the gene 19 product (gp19) specifies which DNA enters the capsid . To identify DNA regions recognized by the packaging systems, T3/T7 hybrids were constructed and physical maps of the hybrid DNAs were determined by restriction enzyme analysis . By comparing restriction maps and in vitro packaging of hybrid DNAs, it is concluded that the sequence responsible for specificity of DNA packaging is confined within 5% of the ends of the T3 and T7 genomes. Virology, 1985 Jul 30, 144(2), 520 - 2 Mapping of a site for packaging of bacteriophage Mu DNA; Groenen MA et al.; Mini-Mu containing variable DNA sequences at the left end, were tested for their ability to be packaged by a helper Mu phage . It was shown that a packaging site of Mu is situated between nucleotides 35 and 58 of the left end. J Biol Chem, 1985 Jul 25, 260(15), 8973 - 7 Relationship between bacteriophage T4 and T6 DNA topoisomerases . T6 39-protein subunit is equivalent to the combined T4 39- and 60-protein subunits; Huang WM et al.; T6 DNA topoisomerase has been purified from bacteriophage T6 infected Escherichia coli . Unlike the T4 DNA topoisomerase which has three subunits, it consists of two subunits of molecular weights 75,000 and 51,000 . They are the products of T6 genes 39 and 52, respectively . The purified T6 enzyme can stimulate in vitro T6 DNA replication . It has an ATP-dependent DNA relaxation activity similar to the T4 enzyme . Either ATP or dATP can be used in both reactions . Using a "Western blotting" and radioimmuno-detection methods, we show that T6 39 subunit contains protein sequences specified by both the T4 39 and 60 genes . The 52-proteins of both phages appear to be identical . The T4 and T6 topoisomerase genes represent a naturally occurring example of gene separation or fusion. J Mol Biol, 1985 Jul 20, 184(2), 211 - 20 Phage P1 Cre-loxP site-specific recombination . Effects of DNA supercoiling on catenation and knotting of recombinant products; Abremski K et al.; Bacteriophage P1 contains a site-specific recombination system consisting of a site, loxP, and a recombinase protein Cre . We have shown that with purified Cre protein we can carry out recombination between two loxP sites in vitro . When that recombination occurs between two sites in direct orientation on the same DNA molecule, we observed the production of free and catenated circular molecules . In this paper we show that recombination between sites in opposite orientation leads to both knotted and unknotted circular products . We also demonstrate that the production of catenanes and knots is influenced by two factors: (1) supercoiling in the DNA substrate, supercoiled DNA substrates yield significantly more catenated and knotted products than nicked circular substrates; and (2) mutations in the loxP site, a class of mutations have been isolated that carry out recombination but result in a distribution of products in which the ratio of catenanes to free circles is increased over that observed with a wild-type site . A more detailed analysis of the products from recombination between wild-type sites indicates: (1) that the catenanes or knots produced by recombination are both simple and complex; (2) that the ratio of free products to catenanes is independent of the distance between the two directly repeated loxP sites; and (3) that for DNA substrates with four loxP sites significant recombination between non-adjacent sites occurs to give free circular products . These observations provide insights into how two loxP sites are brought together during recombination. Biochemistry, 1985 Jul 16, 24(15), 4250 - 60 Boundary centrifugation in isovolumetric and isokinetic cesium sulfate density gradients: application to cartilage proteoglycans and other macromolecules; Pita JC et al.; A boundary sedimentation methodology is described that avoids plateau dilution and simplifies the calculation of centrifugal parameters . The technique is designed for the preparative ultracentrifuge and uses a newly developed sectorial cell . It is based on previous developments of the transport method and depends on isokinetic or isovolumetric Cs2SO4 density and viscosity gradients . These gradients are prepared with a single-chamber mixing device, and the only two parameters required for their calculations are presented in a tabulated form for general use with most available rotors and cell sizes . Conditions are specified (1) to assure that the density and shape of the sedimenting molecules remain invariant through the selected electrolytic gradient, (2) to monitor the gradient profiles, and (3) to verify attainment of isokinetic or isovolumetric sedimentations . A set of equations is presented to calculate the average and transport sedimentation coefficients and the differential sedimentation coefficient distribution for both the isokinetic and isovolumetric centrifugal regimes . The method was applied to slowly diffusing polydisperse proteoglycan monomers, to a paucidisperse DNA from bacteriophage PM2, and to a diffusible monodisperse system (purified bovine serum albumin) . In all cases, the expected results were obtained. Eur J Biochem, 1985 Jul 15, 150(2), 287 - 96 A model for intracellular complexation between gene-5 protein and bacteriophage fd DNA; Brayer GD et al.; A structural model for the helical intracellular complex formed between the gene-5 DNA-binding protein (G 5 BP; approximately 1274 copies) and bacteriophage fd DNA has been derived by an atomic-contact analysis approach . These studies depended in large part on the recently determined high-resolution structure of the G 5 BP dimer and cross-correlations with physical-chemical data available from other techniques . The approach was to systematically scan the full set of helical complexation parameters involved, based upon observed structural and orientational constraints, to determine those compatible with both the structure of the G 5 BP dimer and the overall dimensions of the full complex . This process was monitored throughout by close scrutiny of dimer-dimer contacts and the use of hard-copy and interactive graphics devices . Instead of the wide variety of possibilities that had been expected from such an approach, only one satisfactory assembly of DNA and G 5 BP dimers could be found . The results indicate that phage DNA will be wound to the outside of the helical protein ribbon that forms the core of intracellular complex at a density of five nucleotides per G 5 BP monomer . Bound DNA strands are positioned in two contiguous binding channels, which form as a consequence of the interactions of complexed G 5 BP dimers . These channels run just inside the outer extended beta loops, composed of residue 20-30, and are separated by approximately 3.2 nm . The DNA phosphate backbone is bound at a substantially smaller radial distance (approximately 3.5 nm) than the maximum radius of the intracellular complex as a whole (approximately 4.5 nm) since bound DNA is embedded within these well-defined binding channels . Our studies also indicate that a number of sterically unacceptable contacts, involving residues 38-42, prevent complexation of otherwise complementary dimer surfaces in the absence of nucleic acids . In the process of binding DNA, these residues change conformation thereby allowing self-assembly of dimer units into a helical structure . We propose that these residues act as a two-position stereochemical switch that allows or disallows complex formation in response to the absence or presence of DNA. Eur J Biochem, 1985 Jul 15, 150(2), 323 - 30 DNA methylation of bacterial viruses T3 and T7 by different DNA methylases in Escherichia coli K12 cells; Kruger DH et al.; We have investigated the susceptibility of the genomes of the related bacteriophages T3 and T7 to the three major DNA methyltransferases (EcoK, dam, dcm) of their host, Escherichia coli K12 . In vivo the EcoK host specificity enzyme only methylates the DNA of ocr- phages . This is due to an inhibition of the enzyme by the phage ocr+ gene product, which had previously been shown to be an inhibitor of the restriction endonuclease . EcoK-specific DNA methylation protects the ocr- viruses after one growth cycle on these host cells against the action of corresponding restriction endonuclease EcoK . Owing to the unique S-adenosyl-L-methionine hydrolase (sam+) activity of the T3-coded ocr+ protein, the T3 DNA is absolutely devoid of the methylated bases 6-methylaminopurine and 5-methylcytosine . In contrast to this, T7 derivatives and sam- derivatives of T3 carry a small number of about 2-4 molecules 6-methylaminopurine and 5-methylcytosine per genome . The presence of 6-methylaminopurine is due to dam methylation, though the majority of dam sites remain unmethylated . In vivo as well as in vitro the ocr+ protein has no influence on the activities of the dam and dcm methylase . The experiments gave some evidence for the existence of a second cytosine methylase in E . coli K12 . Besides dam and dcm recognition sites being undermethylated, their absolute number in T3 and T7 DNAs is far below the expected value . Moreover, one of the two dcm sites present in T7 (Studier strain) is missing in our T7 strain owing to a 1300-base-pair deletion in gene 0.7. J Biol Chem, 1985 Jul 15, 260(14), 8618 - 26 Functional and physical characterization of transcription initiation complexes in the bacteriophage lambda OR region; Hawley DK et al.; We have used transcriptional activity assays and DNase I footprinting techniques to examine in vitro the binding of Escherichia coli RNA polymerase and lambda repressor protein to the bacteriophage lambda rightward promoter-operator region . For the lambda PR promoter, the activity and physical binding results determined at several repressor concentrations correlated very well . Good agreement was also found for repression of PRM, which occurred at higher repressor concentrations; however, our results indicate that at low repressor concentrations, RNA polymerase can physically occupy PRM in a transcriptionally inactive form . These inactive complexes formed with a binding constant similar to that previously measured for "closed complexes" at PRM . A kinetic study of PR open complex formation on an OR2-template in the presence of lambda repressor showed that decreased initiation frequency from this promoter was due largely to a decrease in KB . The kinetically determined inhibition constant for repressor (Ki = 4 nM) was similar to the dissociation constant (Kd approximately 2 nM) determined from the footprinting studies. Nucleic Acids Res, 1985 Jul 11, 13(13), 4645 - 59 S1-sensitive sites in the supercoiled double-stranded form of tomato golden mosaic virus DNA component B: identification of regions of potential alternative secondary structure and regulatory function; Sunter G et al.; The sensitivity of the supercoiled double-stranded form of the DNA of tomato golden mosaic virus (TGMV), a geminivirus, to the single-strand specific enzyme S1 nuclease has been demonstrated . Specific S1 cleavage sites were identified in TGMV DNA component B by cloning into the single-strand bacteriophage vector M13 mp8 and sequencing of the inserted DNA . Analysis of the DNA sequence at the sites of S1 sensitivity in TGMV DNA component B revealed several possible regions of alternative secondary structure which were clustered in an intergenic region upstream of the starts of the two major open reading frames which are in opposite orientations . This region contains putative transcriptional promoter and modulatory sequences and a possible replication origin . The extreme S1 sensitivity of the supercoiled form of TGMV DNA component A precluded its cloning under the conditions employed for selective cleavage of DNA component B. Biofizika, 1985 Jul-Aug, 30(4), 568 - 70 {Laser-induced covalent cross-links in DNA}; Zavil'gel'skii GB et al.; Formation of cross-links and local denaturated sites in double-stranded DNA of bacteriophage CD under picosecond laser UV irradiation was investigated by fluorescent method . It is shown that passing from low-intensity UV irradiation with mercury lamp to high-intensity laser UV irradiation quantum, yield of cross-links formation increases by an order. Mol Biol (Mosk), 1985 Jul-Aug, 19(4), 1139 - 47 {Principles of selective inactivation of the viral genome . III . Kinetics of the inactivation of bacteriophage MS2 infectivity by beta-propiolactone}; Budovskii EI et al.; It is shown that the action of beta-propiolactone on the bacteriophage MS2 under the wide range of conditions (pH, temperature, initial concentration of the reagent) the survival curves could be accurately described, taking into account the reagent consumption during inactivation . The requirements for accurate description of the infectivity inactivation of viruses by the action of any chemical agent were formulated . That allowed rational development of a principal stage in preparation of the killed antiviral vaccines--inactivation of the virus infectivity to the necessary extent by the action of chemical agents. Res Vet Sci, 1985 Jul, 39(1), 95 - 8 Spirochaetes in the equine caecum; Davies ME et al.; Two morphological types of spirochaete were found in the horse caecum measuring 4 to 6 micron by 0.3 to 0.4 micron and 6 to 8 micron by 0.1 to 0.2 micron . Attempts were made to culture the organisms but none survived subculture beyond the primary isolate . Electron microscopy revealed that many of the organisms were infected by bacteriophages. J Virol, 1985 Jul, 55(1), 232 - 7 Heterogeneity of the procapsid of bacteriophage T3; Serwer P et al.; Like other double-stranded DNA bacteriophages, bacteriophage T3 assembles a DNA-free procapsid that subsequently packages the bacteriophage DNA . By agarose gel electrophoresis, it has been found that the T3 procapsid has a negative electrophoretic mobility (mu) that progressively increases in magnitude by as much as 3% after assembly of the procapsid . This increase is (i) caused by an increase in the solid support-free mu (muo) of the procapsid, not a decrease in its radius, and (ii) not prevented by either genetically or chemically (use of proflavine) blocking DNA packaging . However, inhibition of the formation of high-energy compounds with a mixture of cyanide and fluoride ions does block the time-dependent increase in the magnitude of muo . This increase appears to be accompanied by addition of an unidentified T3 protein to the procapsid. Eur J Biochem, 1985 Jul 1, 150(1), 161 - 9 Demonstration of a bacteriophage receptor site on the Escherichia coli K12 outer-membrane protein OmpC by the use of a protease; Morona R et al.; The Escherichia coli K12 outer-membrane proteins OmpA, OmpC, OmpF, PhoE, and LamB (all of transmembrane nature) can serve as phage receptors . We have shown previously that one OmpA-specific phage, Ox2, can give rise to the host range mutants Ox2h10 and Ox2h12, with the latter being derived from the former {Morona, R . & Henning, U . (1984) J . Bacteriol . 159, 579-582} . Unlike Ox2, both host range phages can use the OmpA and OmpC proteins as receptors and Ox2h12 is better adapted to the OmpC protein than Ox2h10 . In a search for the site(s) of OmpC protein involved in phage recognition, it was found that proteinase K is able to cleave all of the proteins mentioned above . OmpC protein (Mr = 38306) could be cleaved from outside the cell by proteinase K resulting in two fragments of Mr approximately equal to 21000 and Mr approximately equal to 17500 . The use of OmpC-PhoE hybrid proteins allowed us to assign the approximately equal to 21000-Mr fragment to the CO2H-terminal moiety of the protein . Proteinase K treatment of intact cells abolished their activity to neutralize the OmpC-specific phage Tulb and reduced this ability towards phage Ox2h12 . The OmpA, OmpF, PhoE and LamB proteins were cleaved by the protease not in intact cells but only when acting on cell envelopes . The sizes of the OmpC protein fragments and the results obtained with the hybrid proteins very strongly suggest that the protein is cleaved from outside the cell at a region involving amino acid residues 150-178 of the 346-residue protein, which shows homology to two regions of the OmpA protein which are involved in its phage receptor site (loc . cit.) . These areas also exhibit some homology to a region of the LamB protein which is thought to be part of this protein's receptor site {Charbit et al . (1984) J . Mol . Biol . 175, 395-401} . This suggests that there is a common denominator for proteinaceous phage receptor site because the LamB-specific phage lambda and phage Tulb are of completely different nature . We conclude that the region of the OmpC protein in question is cell-surface-exposed and acts as a phage receptor site. Proc Natl Acad Sci U S A, 1985 Jul, 82(14), 4768 - 72 Homology requirements for recombination in Escherichia coli; Watt VM et al.; The DNA sequence homology required for recombination in Escherichia coli has been determined by measuring the recombination frequency between insulin DNA in a miniplasmid pi VX and a homologous sequence in a bacteriophage lambda vector . A minimum of approximately equal to 20 base pairs in a completely homologous segment is required for significant recombination . There is an exponential increase in the frequency of recombination when the length of homologous DNA is increased from 20 base pairs to 74 base pairs and an apparently linear increase with longer DNA segments . Mismatches within a homologous segment can dramatically decrease the frequency of recombination . Thus, the process of recombination is sensitive to the length of precisely base-paired segments between recombining homologues. J Bacteriol, 1985 Jul, 163(1), 282 - 90 Host DNA replication forks are not preferred targets for bacteriophage Mu transposition; Nakai H et al.; Bacteriophage Mu DNA integration in Escherichia coli strains infected after alignment of chromosomal replication was analyzed by a sandwich hybridization assay . The results indicated that Mu integrated into chromosomal segments at various distances from oriC with similar kinetics . In an extension of these studies, various Hfr strains were infected after alignment of chromosomal replication, and Mu transposition was shut down early after infection . The positions of integrated Mu copies were inferred from the transfer kinetics of Mu to an F- strain . Our analysis indicated that the location of Mu DNA in the host chromosome was not dependent on the positions of host replication forks at the time of infection . However, the procedure for aligning chromosomal replication affected DNA transfer by various Hfr strains differently, and this effect could account for prior results suggesting preferential integration of Mu at host replication forks. Cell, 1985 Jul, 41(3), 771 - 80 G inversion in bacteriophage Mu DNA is stimulated by a site within the invertase gene and a host factor; Kahmann R et al.; The Gin function of bacteriophage Mu catalyzes inversion of the G DNA segment, thus switching the host range of Mu phage particles . This site-specific recombination event takes place between inverted repeat sequences (IR) that border the G segment . Sequences in the Mu beta region extending approximately from position 118 to 178 are essential for efficient inversion . In cis this region, termed sis, stimulates inversion about 15-fold . Neither the relative orientation of sis with respect to the IR sequences nor the distance to IR substantially influences the stimulatory effect . For full activity purified Gin protein must be supplemented with crude host factor from E . coli K12 . We suggest that, in addition to Gin, a DNA-binding host protein is required for efficient G inversion. Mol Biol (Mosk), 1985 Jul-Aug, 19(4), 936 - 40 {Interaction of the peptide antibiotic bacitracin with DNA and synthetic polynucleotides}; Permogorov VI et al.; The aim of the present paper was to study the specific character of interaction of peptide antibiotic bacitracin with DNA and to estimate the interaction constant . The influence of bacitracin on bacteriophage DNA restriction by HindIII and SmaI endonucleases was studied . The possibility of arranging the polynucleotide template by small ligands was shown. Plasmid, 1985 Jul, 14(1), 28 - 36 Analysis of a region in plasmid R386 containing two functional replicons; Robinson P et al.; A miniplasmid has been obtained from R386 by ligating EcoRI fragments with a fragment carrying a kanamycin-resistance gene . It contains a 6.8-kb Eco fragment of R386 which hybridizes strongly with several IncFI plasmid DNAs but not with the primary or secondary replicons of the F plasmid . This mini-R386 is incompatible with certain IncFI plasmids, and it appears to be one example of a previously unidentified replicon widely distributed in the IncFI group . A region of R386 not closely linked to the 6.8-kb fragment is involved in copy number control of the mini-R386, and a sequence in the same region interacts with mini-F partition functions to cause incompatibility . The 6.8-kb fragment also restricts growth of T7 bacteriophage, and an adjacent fragment restricts phage T4 growth . A further R386 sequence, sharing homology with the F secondary replicon, is capable of autonomous replication . Hence R386, like F, contains at least two functional replicons. Proc Natl Acad Sci U S A, 1985 Jul, 82(14), 4763 - 7 Expression of a cloned denV gene of bacteriophage T4 in Escherichia coli; Valerie K et al.; A 713-base-pair Hae III fragment from bacteriophage T4 encompassing the denV gene with its preceding promoter has been cloned in a pBR322-derived positive-selection vector and introduced into a variety of DNA repair-deficient uvr and rec and uvr,rec Escherichia coli strains . The denV gene was found to be expressed, probably from its own promoter, causing pyrimidine dimer incision-deficient uvrA, uvrB, uvrC strains to be rescued by the denV gene . A uvrD (DNA helicase II) strain was also complemented, but to a lesser extent . A wild-type strain did not seem to be affected at the UV doses tested . Surprisingly, all recA, recB, and recC strains tested also showed an increased UV resistance, perhaps by reinforcement of the intact uvr system in these strains . Complementation of denV- T4 strains and host-cell reactivation of lambda phage was also observed in denV+ E . coli strains . Equilibrium sedimentation showed that DNA repair synthesis occurred in a UV-irradiated uvrA E . coli strain carrying the cloned denV gene . Southern blotting confirmed our earlier results {Valerie, K., Henderson, E . E . & de Riel, J . K . (1984) Nucleic Acids Res . 12, 8085-8096} that the denV gene is located at 64 kilobases on the T4 map . Phage T2 (denV-) did not hybridize to a denV-specific probe. Proc Natl Acad Sci U S A, 1985 Jul, 82(14), 4678 - 82 Specialized nucleoprotein structures at the origin of replication of bacteriophage lambda: complexes with lambda O protein and with lambda O, lambda P, and Escherichia coli DnaB proteins; Dodson M et al.; The O protein of bacteriophage lambda is required for initiation of DNA replication at the lambda replicative origin designated ori lambda . The binding sites for O protein are four direct repeats, each of which is an inverted repeat . By means of electron microscopy, we have found that phage lambda O protein utilizes these multiple binding sites to form a specific nucleoprotein structure in which the origin DNA is inferred to be folded or wound . The phage lambda O and P proteins and host DnaB protein interact at ori lambda to generate a larger structure than that formed by O protein alone; P and DnaB proteins fail to form any observable complex when O protein is excluded from the reaction mixture . We conclude that the specialized nucleoprotein structure formed by phage lambda O protein and ori lambda provides for localized initiation of DNA replication by serving as the foundation for the assembly of the initial priming structure . Specialized nucleoprotein structures may be a general means to confer exceptional accuracy on DNA transactions requiring extraordinary precision. J Virol, 1985 Jul, 55(1), 147 - 57 Structure and physical map of Rhodopseudomonas sphaeroides bacteriophage RS1 DNA; Donohue TJ et al.; We analyzed, by restriction endonuclease mapping and electron microscopy, the genome of the lytic Rhodopseudomonas sphaeroides-specific bacteriophage RS1 and characterized it as a linear molecule of approximately 60 to 65 kilobases . When the DNA from purified phage particles was examined by several independent methods, considerable size heterogeneity was apparent in the RS1 DNA . This size heterogeneity was concluded to be of biological origin, was independent of the specific host strain used to propagate virus, and was not due to the presence of host DNA within or nonspecifically associated with purified virions . In addition, treatment of RS1 DNA with either BAL 31 nuclease or DNA polymerase I Klenow fragment revealed that several distinct regions exist within the viral chromosome which contain free 3' hydroxyl groups . A restriction endonuclease map of the RS1 genome was constructed by using the restriction endonucleases EcoRI, ClaI, KpnI, BamHI, MluI, SmaI, and BclI; thereby allowing the positioning of some 40 restriction sites within the viral genome . The results are discussed in terms of the significance and the possible biological origin of the unique features discovered within the phage RS1 DNA. Cell, 1985 Jul, 41(3), 867 - 76 Mechanism of transposition of bacteriophage Mu: structure of a transposition intermediate; Craigie R et al.; Mu transposition works efficiently in vitro and generates both cointegrate and simple insert products . We have examined the reaction products obtained under modified in vitro reaction conditions that do not permit efficient initiation of DNA replication . The major product is precisely the intermediate structure predicted from one of the current models of DNA transposition . Both cointegrates and simple inserts can be made in vitro using this intermediate as the DNA substrate, demonstrating that it is indeed a true transposition intermediate . The requirements for efficient formation of the intermediate include the Mu A protein, the Mu B protein, an unknown number of E . coli host proteins, ATP, and divalent cation . Only E . coli host proteins are required for conversion of the intermediate to cointegrate or simple insert products . Structures resulting from DNA strand transfer at only one end of the transposon are not observed, suggesting that the strand transfers at each end of the transposon are tightly coupled. Cell, 1985 Jul, 41(3), 857 - 65 A truncated form of the bacteriophage Mu B protein promotes conservative integration, but not replicative transposition, of Mu DNA; Chaconas G et al.; The phage-encoded proteins required for conservative integration of infecting bacteriophage Mu DNA were investigated . Our findings show that functional gpA, an essential component of the phage transposition system, is required for integration . The Mu B protein, which greatly enhances replicative transposition of Mu DNA, is also required . Furthermore, a truncated form of gpB lacking 18 amino acids from the carboxy terminus is blocked in replicative transposition, but not conservative integration . Our results point to a more prominent role for gpB than simply a replication enhancer in Mu DNA transposition . The ability of a truncated form of B to function in conservative integration, but not replicative transposition, also suggests a key role for the carboxy-terminal domain of the protein in the replicative reaction . The existence of a shortened form of gpB, which uncouples conservative integration from replicative transposition, should be invaluable for future dissection of Mu DNA transposition. Biochimie, 1985 Jul-Aug, 67(7-8), 745 - 52 Processing of mispaired and unpaired bases in heteroduplex DNA in E . coli; Radman M et al.; Bacteriophage lambda and phi X 174 DNAs, carrying sequenced mutations, have been used to construct in vitro defined species of heteroduplex DNA . Such heteroduplex DNAs were introduced by transfection, as single copies, into E . coli host cells . The progeny of individual heteroduplex molecules from each infective center was analyzed . The effect of the presence of GATC sequences (phi X 174 system) and of their methylation (lambda system) was tested . The following conclusions can be drawn: some mismatched base pairs trigger the process of mismatch repair, causing a localized strand-to-strand information transfer in heteroduplex DNA: transition mismatches G:T and A:C are efficiently repaired, whereas the six transversion mismatches are not always readily recognized and/or repaired . The recognition of transversion mismatches appears to depend on the neighbouring nucleotide sequence; single unpaired bases (frameshift mutation "mismatches") are recognized and repaired, some equally efficiently on both strands (longer and shorter), some more efficiently on the shorter (-1) strand; large non-homologies (about 800 bases) are not repaired by the Mut H, L, S, U system, but some other process repairs the non-homology with a relatively low efficiency; full methylation of GATC sequences inhibits mismatch repair on the methylated strand: this is the chemical basis of strand discrimination (old/new) in mismatch correction; unmethylated GATC sequences appear to improve mismatch repair of a G:T mismatch in phi X 174 DNA, but there may be some residual mismatch repair in GATC-free phi X 174, at least for some mismatches.(ABSTRACT TRUNCATED AT 250 WORDS) J Biol Chem, 1985 Jun 25, 260(12), 7591 - 8 Purification and properties of the dnaJ replication protein of Escherichia coli; Zylicz M et al.; The Escherichia coli dnaJ gene was originally discovered because mutations in it blocked bacteriophage lambda DNA replication . Some of these mutations were subsequently shown to interfere with bacterial growth at high temperature, suggesting that dnaJ is an essential protein for the host as well . The first step in purifying the dnaJ protein was to overproduce it at least 50-fold by subcloning its gene into the pMOB45 runaway plasmid . The second step was the development of an in vitro system to assay for its activity . A Fraction II extract from dnaJ259 mutant bacteria was shown to be unable to replicate lambda dv DNA unless supplemented with an exogenous source of wild-type dnaJ protein . Using this complementation assay we purified the dnaJ protein to homogeneity from the membrane fraction of an overproducing strain of bacteria . The purified dnaJ protein was shown to be a basic (pI 8.5), yet hydrophobic, protein of Mr 37,000 and 76,000 under denaturing and native conditions, respectively, and to exhibit affinity for both single- and double-stranded DNA . Using a partially purified lambda dv replication system dependent on the presence of the lambda O and P initiator proteins and at least the host dnaB, dnaG, dnaJ, dnaK, single-stranded DNA-binding protein, gyrase, RNA polymerase holoenzyme, and DNA polymerase III holoenzyme, we have shown that the dnaJ protein is required at a very early step in the DNA replication process. J Biol Chem, 1985 Jun 25, 260(12), 7533 - 9 Influence of neighboring bases on DNA polymerase insertion and proofreading fidelity; Petruska J et al.; We propose a model to describe the frequencies of site-specific base substitution errors by DNA polymerase . In the model, nucleotide misinsertion frequencies are determined by 5'-nearest-neighbor base stacking and 3'-exonucleolytic proofreading efficiencies are governed by the relative proportions of G . C base pairs in the region surrounding the misinserted nucleotide . The model is used to analyze the frequency of replacing dAMP by 2-aminopurine deoxyribonucleotide with purified bacteriophage T4 L141 antimutator DNA polymerase at 57 sites on phi X174 DNA (Pless, R . C., and Bessman, M.J . (1983) Biochemistry 22, 4905-4915) . A linear least-squares fit yields a correlation coefficient of 0.83 and a standard deviation of 2.8% between predicted and observed results . Four to five base pairs on each side of the 2-aminopurine incorporation site, approximately one double-helical turn, are found to exert a maximal influence on proofreading . Thermal melting data on native and synthetic DNA are used to deduce base-stacking energies for nearest-neighbor doublets including those involving 2-aminopurine . The inclusion of base-stacking energies in the model calculations leads to predictions similar to those based on the use of empirical parameters for individual base pairs. Eur J Biochem, 1985 Jun 18, 149(3), 579 - 84 The complete 30-base-pair origin region of bacteriophage phi X174 in a plasmid is both required and sufficient for in vivo rolling-circle DNA replication and packaging; Fluit AC et al.; The origin of replication of the isometric single-stranded DNA bacteriophages is located in a specific sequence of 30 nucleotides, the origin region, which is highly conserved in these phage genomes . Plasmids harboring this origin region are subject to rolling-circle DNA replication and packaging of single-stranded (ss) plasmid DNA into phage coats in phi X174 or G4-phage-infected cells . This system was used to study the nucleotide sequence requirements for rolling-circle DNA replication and DNA packaging employing plasmids which contain the first 24, 25, 26, 27, 28 and the complete 30-base-pair (bp) origin region of phi X174 . No difference in plasmid ss DNA packaging was observed for plasmids carrying only the 30-bp origin region and plasmids carrying the 30-bp origin region plus surrounding sequences (i.e . plasmids carrying the HaeIII restriction fragment Z6B of phi X174 replicative-form DNA) . This indicates that all signals for DNA replication and phage morphogenesis are contained in the 30-bp origin region and that no contribution is made by sequences which immediately surround the origin region in the phi X174 genome . The efficiency of packaging of plasmid ssDNA for plasmids containing deletions in the right part of the origin region decreases drastically when compared with the plasmid containing the complete 30-bp origin region (for a plasmid carrying the first 28 bp of the origin region to approximately 5% and 0.5% in the phi X174 and G4 systems respectively) . Previous studies {Fluit, A.C., Baas, P.D., van Boom, J.H., Veeneman, G.H . and Jansz, H.S . (1984) Nucleic Acids Res . 12, 6443--6454} have shown that the presence of the first 27 bp of the origin region is necessary as well as sufficient for cleavage of the viral strand in the origin region by phi X174 gene A protein . Moreover, Brown et al . {Brown, D.R., Schmidt-Glenewinkel, T., Reinberg, D . and Hurwitz, J . (1983) J . Biol . Chem . 258, 8402--8412} have shown that omission of the last 2 bp of the origin region does not interfere with phi X174 rolling-circle DNA replication in vitro . Our results therefore suggest that for optimal phage development in vivo, signals in the origin region are utilized which have not yet been noticed by the in vitro systems for phi X174 phage DNA replication and morphogenesis. Nucleic Acids Res, 1985 Jun 11, 13(11), 4143 - 53 Deletion of C-terminal amino acid codons of PhiX174 gene E: effect on its lysis inducing properties; Schuller A et al.; The lysis gene E of bacteriophage PhiX174 has been subjected to deletion and fusion analysis . Deletions of 11 to 90% of gene E specific nucleotides coding for to C-terminal region of the gene product were cloned under transcriptional control of lambda pL . For this purpose plasmid pSU1 was constructed which carries an extended polylinker region downstream of pL . Depending on the number of nucleotides after the last gene E specific codon, various C-terminal segments of protein E were replaced by 4, 5, 53 or 314 unrelated amino acids . Functional analysis for lysis inducing properties of the various gene E mutants revealed that the final 9 codons of the gene could be deleted without loss of function . However, replacements of 19 or more C-terminal codons eliminated gene E activity . Although the functional site of the gene E product is located within the N-terminal half of the polypeptide, the C-terminal part of the protein appears to exhibit severe influence on conformation and/or regulation of the functional site. J Biol Chem, 1985 Jun 10, 260(11), 6618 - 22 Ribonucleoside and deoxyribonucleoside triphosphate pools during 2-aminopurine mutagenesis in T4 mutator-, wild type-, and antimutator-infected Escherichia coli; Hopkins RL et al.; Ribonucleoside and deoxyribonucleoside triphosphate pools have been measured in Escherichia coli infected with bacteriophage T4 DNA polymerase mutator, wild type, and antimutator alleles during mutagenesis by the base analogue 2-aminopurine . ATP and GTP pools expand significantly during mutagenesis, while CTP and UTP pools contract slightly . The DNA polymerase (gene 43) alleles and an rII lesion perturb normal dNTP pools more than does the presence of 2-aminopurine . We find no evidence that 2-aminopurine induces mutations indirectly by causing an imbalance in normal dNTP pools . Rather, it seems likely that, by forming base mispairs with thymine and with cytosine, 2-aminopurine is involved directly in causing bidirectional A.T in equilibrium G.C transitions . The ratios for 2-aminopurine deoxyribonucleoside triphosphate/dATP pools are 5-8% for tsL56 mutator and 1-5% for tsL141 antimutator and 43+ alleles . We conclude that the significant differences observed in the frequencies of induced transition mutations in the three alleles can be attributed primarily to the properties of the DNA polymerases with their associated 3'-exonuclease activities in controlling the frequency of 2-aminopurine.cystosine base mispairs. J Biol Chem, 1985 Jun 10, 260(11), 6999 - 7007 In vitro maturation of circular bacteriophage P2 DNA . Purification of ter components and characterization of the reaction; Bowden DW et al.; The protein components required for generation of cohesive ends in vitro from circular bacteriophage P2 DNA have been purified to near homogeneity . In the presence of ATP, the purified products of P2 genes M and P together with empty phage capsids (comprised primarily of the N protein) mediate site-specific cleavage of circular P2 DNA at the cohesive end site (cos) . This terminase or ter system also utilizes circular DNAs of bacteriophages P4 and 186, introducing site-specific scissions at cos sites within these molecules . The ter reaction exhibits a peculiar requirement for a circular DNA substrate . Substrate activity is greatly reduced when circular P2, P4, or 186 DNAs are linearized by restriction endonuclease hydrolysis . Furthermore, multimeric P4 DNA molecule sites are also essentially inactive in the linear form but are active in the circular state . The dependence of ter action on a circular substrate is not due to inhibition of the system by linear DNA, nor does it appear to reflect a requirement for substrate superhelicity since circular P4 DNA containing single strand scissions is subject to terminase action . The terminase reaction is supported by ATP, dATP, or beta, gamma-imido ATP, but not by other ribonucleoside triphosphates ADP, alpha, beta-methylene ATP, or beta, gamma-methylene ATP . A DNA-dependent ATPase, which hydrolyzes ATP to AMP, copurifies with the P2 P protein and is inactivated with the same kinetics as P activity upon treatment with N-ethylmaleimide . The ATPase does not display specificity for P2 DNA in vitro. J Mol Biol, 1985 Jun 5, 183(3), 353 - 64 Assembly-dependent conformational changes in a viral capsid protein . Calorimetric comparison of successive conformational states of the gp23 surface lattice of bacteriophage T4; Ross PD et al.; Inter- and intra-subunit bonding within the surface lattice of the capsid of bacteriophage T4 has been investigated by differential scanning calorimetry of polyheads, in conjunction with electron microscopy, limited proteolysis and sodium dodecyl sulfate/polyacrylamide gel electrophoresis . The bonding changes corresponding to successive stages of assembly of the major capsid protein gp23, including its maturation cleavage, were similarly characterized . The uncleaved/unexpanded surface lattice exhibits two endothermic transitions . The minor event, at 46 degrees C, does not visibly affect the surface lattice morphology and probably represents denaturation of the N-terminal domain of gp23 . The major endotherm, at 65 degrees C, represents denaturation of the gp23 polymers . Soluble gp23 from dissociated polyheads is extremely unstable and exhibits no endotherm . Cleavage of gp23 to gp23* and the ensuing expansion transformation effects a major stabilization of the surface lattice of polyheads, with single endotherms whose melting temperatures (t*m) range from 73 to 81 degrees C, depending upon the mutant used and the fraction of gp23 that is cleaved to gp23* prior to expansion . Binding of the accessory proteins soc and hoc further modulates the thermograms of cleaved/expanded polyheads, and their effects are additive . hoc binding confers a new minor endotherm at 68 degrees C corresponding to at least partial denaturation of hoc . Denatured hoc nevertheless remains associated with the surface lattice, although in an altered, protease-sensitive state which correlates with delocalization of hoc subunits visualized in filtered images . While hoc binding has little effect on the thermal stability of the gp23* matrix, soc binding further stabilizes the surface lattice (delta Hd approximately +50%; delta t*m = +5.5 degrees C) . It is remarkable that in all states of the surface lattice, the inter- and intra-subunit bonding configurations of gp23 appear to be co-ordinated to be of similar thermal stability . Thermodynamically, the expansion transformation is characterized by delta H much less than 0; delta Cp approximately 0, suggesting enhancement of van der Waals' and/or H-bonding interactions, together with an increased exposure to solvent of hydrophobic residues of gp23* in the expanded state . These findings illuminate hypotheses of capsid assembly based on conformational properties of gp23: inter alia, they indicate a role for the N-terminal portion of gp23 in regulating polymerization, and force a reappraisal of models of capsid swelling based on the swivelling of conserved domains. Eur J Biochem, 1985 Jun 3, 149(2), 337 - 43 Primer-independent abortive initiation by wheat-germ RNA polymerase B (II); Mosig H et al.; Highly purified RNA polymerase B (II) from wheat germ catalyses the formation of dinucleoside tetraphosphates from ribonucleoside triphosphates in the absence of an oligonucleotide primer or additional protein factors . The reaction requires bivalent cations such as Mn2+ or Mg2+ and proceeds linearly for several hours . It is strongly inhibited by 1 microgram/ml alpha-amanitin or 2 micrograms/ml heparin . The reaction strictly depends on the addition of a specific linear or circular DNA template, such as the plasmid pSmaF or a DNA fragment containing the gene for nopaline dehydrogenase . Bacteriophage T7 D111 DNA has almost no template activity . The start sites for dinucleotide synthesis on the template are limited . With the DNA fragment containing the gene for nopaline dehydrogenase only pppApA and pppApU are synthesised substantially whereas pppUpU is formed only in trace amounts . No significant dinucleotide synthesis is observed with other ribonucleoside triphosphates either singly or in a combination of two . The various regions of the DNA fragment differ distinctly in template activity. J Cell Sci, 1985 Jun, 76, 135 - 43 In vivo transcription of ribosomal RNA in relation to the mitotic cycle in Physarum polycephalum; Hunter GJ et al.; We have investigated the transcription of ribosomal RNA in plasmodia of Physarum polycephalum by a combination of pulse-labelling with {3H}uridine and RNA:DNA hybridization . The DNA used for the hybridization was a HindIII restriction fragment (cloned in bacteriophage lambda) of Physarum ribosomal DNA that carries a substantial fraction of the rRNA genes, enabling the ribosomal transcripts in the newly synthesized RNA to be measured . We found that ribosomal RNA constituted about 40% of the pulse-labelled RNA at all times during the synchronous mitotic cycle. Biochem Int, 1985 Jun, 10(6), 945 - 53 Regulation of bacteriophage mu and mini-mu DNA replication in vivo; DuBow MS et al.; To study the regulation of bacteriophage Mu DNA's integrative-replication (transposition) during lytic growth in a cell containing both a Mu and a helper-dependent Mini-Mu (short, internally-deleted Mu genome), we placed "marker" genes (bla, lacZ) within either genome and then measured their encoded enzymes as indicators of the gene dosage . These results, corroborated using DNA-DNA hybridization, show that Mu and Mini-Mu DNA transposition is well regulated, requires both the Mu A and B gene products, and can be readily monitored by measuring beta-galactosidase and beta-lactamase expressed from the lacZ and bla genes, respectively. Cancer Biochem Biophys, 1985 Jun, 8(1), 47 - 59 Agarose gel electrophoretic analysis of damage to supercoiled DNA by adriamycin in the presence of beta-NADH dehydrogenase; Haidle CW et al.; In a cell-free system, the anticancer anthracycline antibiotic adriamycin was able to convert purified covalently closed circular, superhelical, form I bacteriophage PM2 DNA to relaxed circular form II DNA in the presence of either sodium borohydride (NaBH4), NADPH cytochrome P-450 reductase or beta-NADH dehydrogenase isolated from myocardial cells . There was no detectable increase in the amount of form III linear duplex DNA formed during the reaction even at high drug concentrations . Less drug was required for the conversion of form I to form II DNA in the presence of the enzymic reducing agents than in the presence of NaBH4 . Form II DNA, prepared by irradiation using a Cs-137 source, was not degraded to form III linear duplex DNA . However, form I0 DNA, covalently closed circular DNA without superhelical turns, freshly prepared using topoisomerase I, was converted to form II DNA similar to the conversion of superhelical form I to form II DNA . Again, no increase in the amount of form III linear duplex DNA could be detected. J Virol, 1985 Jun, 54(3), 886 - 8 Spontaneous temperature-sensitive mutations in bacteriophage T7; Stone JC et al.; Attempts to recover temperature-sensitive mutations affecting genes 13 and 14 (virion proteins) in bacteriophage T7 by analysis of amber revertants were confounded by the frequent occurrence of spontaneous temperature-sensitive mutations in other genes . These incidental temperature-sensitive mutations are physically distinct from but may be functionally related to genes 13 and 14, as shown by complementation and recombination studies . The possibility that these incidental temperature-sensitive mutations represent secondary-site suppressors of the pseudonormal suppressed amber products is discussed. J Bacteriol, 1985 Jun, 162(3), 1311 - 3 Photodynamic inactivation and mutagenesis by angelicin (isopsoralen) or thiopyronin (methylene red) in wild-type and repair-deficient strains of bacteriophage T4; Drake JW; Photodynamic inactivation of bacteriophage T4 particles, mediated by either angelicin or thiopyronin, is enhanced by defects in the T4 uvsW-uvsX-uvsY postreplication repair system but not by a defect in the denV pyrimidine-dimer-excision system . There was no evidence for functional interactions between the two repair systems . As observed previously with 8-methoxypsoralen, photodynamic mutagenesis with angelicin is abolished by defects in the uvsW-uvsX-uvsY system. Virology, 1985 Jun, 143(2), 485 - 504 Morphogenetic structures present in lysates of amber mutants of bacteriophage Mu; Grundy FJ et al.; The Mu phage particle is structurally similar to that of the T-even phages, consisting of an icosahedral head and contractile tail . This study continues an analysis of the morphogenesis of the Mu phage particle by defining the structural defects resulting from mutations in specific Mu genes . Defective lysates produced by induction of 55 amber mutants, representing 24 essential genes, were examined in the electron microscope and categorized into eight classes based on the observed phage-related structures . (1) Mutations in genes lys, F and G, and some H mutations, did not cause a visible alteration in particle structure . (2) Mutants defective in genes A, B, and C produced no detectable phage structures, consistent with their lack of production of late RNA . (3) Extracts defective in genes L, M, Y, N, P, Q, V, W, and R contained only head structures, and these appeared normal . (4) K-defective mutants accumulated free heads as well as free tails which were longer than normal and variable in length . (5) Tails which appeared normal were the only structures found in T- and some I-defective extracts . (6) Free tails and empty heads accumulated in D-, E-, and some I- and H-defective extracts . These heads were as much as 16% smaller than normal heads . The heads found in some I amber lysates had a protruding neck-like structure and unusually thick shells suggestive of a scaffolding-like structure . (7) Defects in gene J resulted in the accumulation of unattached tails and full heads . (8) Previous analysis of lysates produced by inversion-defective gin mutants fixed in the G(+) orientation demonstrated that S and U mutants produced particles lacking tail fibers (F.J . Grundy and M.M . Howe (1984), Virology 134, 296-317) . In these experiments with Gin+ phages S and U mutants produced apparently normal phage particles . Presumably the tail fiber defects were masked by the production of S' and U' proteins by G(-) phages in the population. Virology, 1985 Jun, 143(2), 422 - 34 Purification of characterization of gene 8 product of bacteriophage T3; Nakasu S et al.; The product of gene 8 (gp8) of T3 phage was purified from proheads, heads, and extract prepared from cells infected with a mutant defective in gene 10 (major head protein) (10- extract) . gp8, when purified by hydrophobic column chromatography from proheads solubilized by guanidine hydrochloride, did not show any ordered structure . gp8 from heads ruptured by sucrose shock sedimented with a sedimentation coefficient of 20 S (20 S assembly) . Electron micrography of 20 S assemblies showed ring structures displaying radial symmetry . When the gp8 in 20 S assemblies was concentrated, it formed two-dimensional crystals . gp8 in 20 S material was detected in 10- extract by sedimentation analysis . gp8 purified from 10- extract by anti-gp8 antibody column chromatography had an ordered structure identical to that of the 20 S assembly from heads . The effect of anti-gp8 serum on the activity of proheads and heads was examined by in vitro complementation . Anti-gp8 serum preabsorbed with 5- X 8- -extracted inactivated proheads and heads . Anti-gp8 serum preabsorbed with proheads inactivated heads but not proheads . Similarly, anti-gp8 serum preabsorbed with phage-inactivated proheads but not heads . From these results, it is concluded that gp8 in proheads and heads is accessible to antibodies and that different antigenic sites of gp8 are exposed in proheads and heads. Genetics, 1985 Jun, 110(2), 159 - 71 Bacteriophage T4 gene 32 participates in excision repair as well as recombinational repair of UV damages; Mosig G; Gene 32 of phage T4 has been shown previously to be involved in recombinational repair of UV damages but, based on a mutant study, was thought not to be required for excision repair . However, a comparison of UV-inactivation curves of several gene 32 mutants grown under conditions permissive for progeny production in wild-type or polA- hosts demonstrates that gene 32 participates in both kinds of repair . Different gene 32 mutations differentially inactivate these repair functions . Under conditions permissive for DNA replication and progeny production, all gene 32 mutants investigated here are partially defective in recombinational repair, whereas only two of them, P7 and P401, are also defective in excision repair . P401 is the only mutant whose final slope of the inactivation curve is significantly steeper than that of wild-type T4 . These results are discussed in terms of interactions of gp32, a single-stranded DNA-binding protein, with DNA and with other proteins.
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||