Journal of Bacteriology, March 2004, p . 1297-1303, Vol . 186, No . 5

Chitinase B of "Microbulbifer degradans" 2-40 Contains Two Catalytic Domains with Different Chitinolytic Activities

Michael B . Howard,¹ Nathan A . Ekborg,¹ Larry E . Taylor II,¹ Ronald M . Weiner,^1,2 and Steven W . Hutcheson^1*

Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, Maryland 20742,¹ National Science Foundation, Division of Molecular and Cellular Biosciences, Arlington, Virginia 22230²

Received 25 September 2003/ Accepted 24 November 2003

 
Chitinase B of "Microbulbifer degradans" 2-40 is a modular protein that is predicted to contain two glycoside hydrolase family18 [GH18] catalytic domains, two polyserine domains, and anacidic repeat domain . Each of the GH18 domains was shown tobe catalytically active against chitin . Activity assays revealthat the amino-terminal catalytic domain [GH18_N] releases methylumbelliferonefrom 4'-methylumbelliferyl-N,N'-diacetylchitobiose 13.6-fold faster than the carboxy-terminal catalytic domain [GH18_C] and releases chitobiose from the nonreducing end of chitooligosaccharides, therefore functioning as an exochitinase . GH18_C releases methylumbelliferonefrom 4'-methylumbelliferyl-N,N',N"-triacetylchitotriose 2.7-foldfaster than GH18_N and cleaves chitooligosaccharides at multiplebonds, consistent with endochitinolytic activity . Each domainwas maximally active from 30 to 37°C and from pH 7.2 to8.0 and was not affected by Mg²⁺, Mn²⁺, Ca²⁺, K⁺, EDTA, EGTA,or 1.0 M NaCl . The activity of each domain was moderately inhibitedby Ni²⁺, Sr²⁺, and Cu²⁺, while Hg²⁺ completely abolished activity.When the specific activities of various recombinant portionsof ChiB were calculated by using native chitin as a substrate,the polypeptide containing the endo-acting domain was twofoldmore active on native chitin than the other containing the exo-actingdomain . The presence of both domains in a single reaction increasedthe amount of reducing sugars released from native chitin to140% above the theoretical combined rate, indicating that the domains function cooperatively to degrade chitin . These data demonstrate that the GH18 domains of ChiB have different activities on the same substrate and function cooperatively to enhancechitin depolymerization.

 
Chitin, a homopolymer of ß-1,4-linked N-acetylglucosamine,is the second most abundant polymer in the biome [15] . Chitin is a difficult substrate for microbial degradation because it is usually crystalline and complexed with protein, salts, andother carbohydrates . However, many microorganisms have developedefficient strategies for the depolymerization, transport, andmetabolism of chitin and its derivatives . These systems involvemultiple enzyme activities, usually encoded on separate polypeptides. Pseudoalteromonas sp . strain S91 [24], Serratia marcescens [22],and Streptomyces coelicolor A3 [2, 20], for example, secreteseveral chitin-depolymerizing enzymes in the presence of chitin.Endo- and exochitinases that function cooperatively to depolymerizechitin have been described [3, 6, 22] . Endochitinases randomly cleave glycosidic linkages, generating free ends and long chitooligosaccharides. These are then acted upon by exochitinases that release chitobiose from the nonreducing ends of each . While exo- and endochitinases are able to depolymerize chitin alone, the presence of both activities significantly increases the efficiency of chitinolytic systems.

The glycoside hydrolase family 18 [GH18] domain is the mostcommon catalytic domain of microbial chitin depolymerases [7]. Despite sharing a consensus sequence and a conserved catalytic glutamic acid residue, GH18 domains may differ in their activity toward polymeric chitin and chitooligosaccharides [i.e., endo-versus exo- activity] [19] . Chitodextrinases, which depolymerize chitooligosaccharides but not chitin, also contain GH18 domains [11] . Chitinolytic enzymes with GH18 domains have been isolatedfrom organisms as diverse as psychrophilic eubacteria [12] andhyperthermophilic archaeons [23], demonstrating the wide rangeof conditions to which these domains have adapted . Because conservedresidues are found in GH18 domains with divergent optima andsubstrate specificities, sequence analysis is insufficient todetermine the enzymatic specificities of newly discovered chitinases.

"Microbulbifer degradans" 2-40, a marine -subgroup proteobacteriumisolated from the Chesapeake Bay watershed in coastal Virginia,is able to degrade 10 complex polysaccharides, including chitin[2] . The chitinolytic system of 2-40 has recently been shownto include three chitin depolymerases [ChiA, ChiB, and ChiC],a noncatalytic chitin-binding protein [CbpA], a chitodextrinase[CdxA], and three N-acetylglucosaminidases [HexA, HexB, andHexC] [9] . ChiA and ChiB include long polyserine domains thatappear to separate functional groups . One of the chitin depolymerases,ChiB, was selected for further study in this work because ofits unusual structural features.

ChiB is a modular, 1,271-amino-acid enzyme with a calculated molecular mass of 136.1 kDa [9] . The amino terminus is predictedto contain a secretion signal that is separated from the remainderof the protein by a polyserine domain of 148 amino acids, 99of which are serine residues . ChiB is predicted to include two complete GH18 domains [amino-terminal domain GH18_N and carboxy-terminaldomain GH18_C] separated by a 180-amino-acid linker domain whichincludes an acidic region consisting of TE-[ET]₁₀ and anotherpolyserine domain containing 39 serine residues . Here we reportthat both GH18 domains of ChiB are catalytically active butdifferentially cleave glycosidic linkages, depending on theirlocation within the chitin polymer . In addition, it was shownthat chitin depolymerization is enhanced by the presence ofboth domains . The implications and advantages of encoding twocatalytic domains on a single polypeptide are discussed.

 
Chemicals and reagents. Standard reagents, chitooligosaccharides, methylumbelliferone[MUF] substrates, and chitin were obtained from Sigma [St . Louis,Mo.] . Ethylene glycol chitin was purchased from Fisher Scientific[Pittsburgh, Pa.] . Ni-nitrilotriacetic acid [Ni-NTA] agarosewas obtained from Qiagen [Valencia, Calif.] . Restriction enzymesand T4 DNA ligase were purchased from New England Biolabs [Beverly,Mass.] . Bugbuster NT and pETBlue2 were obtained from Novagen[Madison, Wis.].

Cloning and expression of GH18_N and GH18_C. Oligonucleotide primers were designed to amplify the nucleotide sequence corresponding to each catalytic domain by PCR withpurified "M . degradans" genomic DNA as a template . Primer sequences were as follows: GH18_N-F [468], CTTGGCGCGCCATGGTGTAGATGCCGAATTG; GH18_N-R [1924], CCGGGTACCGTTGTCTTCGTAATTGCCTTC; GH18_C-F [2512],CTTGGCGCGCCATGGCGAAACAGATTTAG; and GH18_C-R [3800], CCGGGTACCCTGCTTTTCGTTGCCGAA[restriction sites are underlined, and the relative positionof the 5' nucleotide start of each primer within the chiB sequenceis shown in parentheses] . GH18_N+C was created by using primersGH18_N-F [468] and GH18_C-R [3800] . Each amplified fragment wasthen digested with the appropriate restriction enzymes and ligatedinto the protein expression vector pETBlue2 by using T4 DNAligase . Expression constructs were verified by sequencing andtransformed into E . coli Tuner DE3[pLacI] cells . Protein expressionwas performed according to the manufacturer's protocol . Cellswere lysed with Bugbuster NT lysis buffer and centrifuged, andthe supernatant was collected . Supernatants containing recombinantenzymes were applied to an Ni-NTA agarose column and purifiedaccording to the manufacturer's protocol for native proteinpurification . Purified enzyme samples were quantified by usinga bovine serum albumin protein quantification kit [Pierce, Rockford,Ill.].

Glycol chitin zymography. Ethylene glycol chitin was incorporated into the separatingportion of a sodium dodecyl sulfate-polyacrylamide gel to afinal concentration of 0.01% . After fractionation of the proteins,the zymogram was incubated in refolding buffer [50 mM Tris-Cl,1 mM EDTA, 5 mM 2-mercaptoethanol [pH 7.5]] overnight at 4°Cand subsequently analyzed for chitin depolymerase activity asdescribed elsewhere [8, 25].

Enzyme assays with chitin analogs. Solutions of 4'-methylumbelliferyl-N,N'-diacetylchitobiose [MUF-diNAG] and 4'-methylumbelliferyl-N,N',N"-triacetylchitotriose [MUF-triNAG]were prepared in 50 mM sodium phosphate buffer [pH 7.0] . Reactionmixtures contained 2 µg of purified enzyme and 30 µM analog solution . After incubation for 5 to 10 min at 37°Cfor GH18_N or for 5 to 20 min at 30°C for GH18_C, reactions were stopped by submersion in an ice water bath . Liberated methylumbelliferonewas detected with a Hoefer TKO-100 fluorometer . The reactionwas measured at multiple time points between 5 and 20 min andwas found to be linear, with less than 10% of the substrate being degraded.

Oligosaccharide electrophoresis. Labeling and electrophoresis of chitooligosaccharides were performedas described previously [8] . Briefly, the reactions were incubated with 2 volumes of labeling solution [1.0 M sodium cyanoborohydride, 0.2 M 2-aminobenzoic acid] and dried under vacuum . Each sample was mixed with standard 2x sodium dodecyl sulfate-polyacrylamidegel electrophoresis loading buffer and fractionated in a 15%polyacrylamide gel at a 45-mA constant current . Labeled oligosaccharideswere visualized under UV light.

Determination of reaction optima for each domain. MUF-diNAG or MUF-triNAG was added to 20 µg of purifiedenzyme and incubated at a given pH or temperature, and activitywas detected as described above . The buffers used were sodiumacetate [pH 4.0 to 5.5], MES [morpholineethanesulfonic acid][pH 5.5 to 6.5], PIPES [piperazine-N,N'-bis[2-ethanesulfonic acid]] [pH 6.5 to 7.0], HEPES [pH 7.0 to 8.0], and Tris base [pH 8.0 to 9.5] . For a given enzyme, the activity under reaction conditions that permitted maximum activity was assigned a valueof 100% . Where indicated, EDTA, EGTA, KCl, NiCl₂, SrCl₂, MgCl₂, MnCl₂, CuCl₂, CaCl₂, or HgCl₂ was added to reaction mixturesto a final concentration of 10 mM; NaCl was added at concentrationsof up to 1.0 M . Reaction mixtures containing metal ions contained200 pmol of enzyme and were incubated for 10 min at 37°Cfor GH18_N or for 20 min at 30°C for GH18_C.

Enzyme assays with chitin and chitin derivatives. Purified enzyme and substrate [2 mg of chitin or 10 nmol of chitooligosaccharide] were added to 50 mM HEPES [pH 7.5] and incubated at 30°C . The amount of reducing sugar generatedwas determined by the dinitrosalicylic acid assay as describedelsewhere [14] . Specific enzyme activity was estimated by comparison to a standard curve.

Protein sequence analysis. Analysis of protein domains was performed with the Simple ModularArchitecture Research Tool [21] . Similarity between proteinsand protein domains was determined by the BLAST algorithm [1].The lipoprotein-anchoring site within ChiB was identified byusing the database of bacterial lipoproteins [13].

Nucleotide sequence accession number. The nucleotide and protein sequences of ChiB have been placedin GenBank under accession number BK001042.

 
ChiB is predicted to contain two catalytic domains and a lipoprotein acylation site. ChiB was previously predicted to contain two catalytic sites[9] . The first catalytic site, GH18_N, was identified in theamino-terminal region of ChiB [residues 221 to 605] [Fig . 1].It consists of 385 amino acids and is most similar to the GH18domain of the exochitinase ChiB of S . marcescens [S52422] [55%identity and 69% similarity] . A second predicted catalytic site,GH18_C, was present in the carboxy-terminal domain of ChiB [residues860 to 1254] . This domain is composed of 395 amino acids andis most similar to a chitinase from Vibrio sp . strain 5SM-1[AAL46648] [49% identity and 66% similarity] . The two GH18 domainsof ChiB share only 29% identity and 42% similarity when alignedat the amino acid level . GH18_N and GH18_C include the motifsSVGGWAESN-X₃₃-FDGIDIDWEYP and SIGGWTMSTPF-X₂₆-FDGVDIDWEYP, respectively. These sequences are nearly identical to the consensus sequencethat characterizes a GH18 domain, and each also includes thekey catalytic Glu residue [underlined] [19].

 
ChiB was found to contain a predicted lipobox within amino acid residues 16 to 19, composed of L-S-A-C . In addition, two positively charged residues are found within the first five amino acids[N at position 2 and K at position 5] and are separated fromthe lipobox by a hydrophobic stretch of 10 amino acids . Thesecharacteristics satisfy the major criteria required for a lipoproteinsecretion signal and acylation site [10, 13].

GH18_N and GH18_C independently depolymerize chitin. To determine whether the GH18 domains of ChiB are catalytically active against chitin, the sequence corresponding to each domain [GH18_N, codons 156 to 641; GH18_C, codons 837 to 1266] was amplifiedby PCR and ligated into pETBlue2 to create carboxy-terminalHis₆ fusions . The polypeptides were expressed in Escherichiacoli and purified on Ni-NTA agarose columns . The chitinolyticactivity of each GH18 domain was tested by using a glycol chitinzymogram . Consistent with their conserved sequence features,the ability of each catalytic domain to independently depolymerizechitin was apparent in zymograms [Fig. 2] . Clear zones indicativeof depolymerization were observed and corresponded to the predictedmasses of the recombinant polypeptides [50.5 kDa for GH18_N and47.7 kDa for GH18_C].

 
GH18_N and GH18_C differentially degrade chitin analogs. One possible explanation for the presence of two catalytic domainswithin ChiB is that each has a different role in the degradationof chitin, as was observed in an archaeal chitinase from Thermococcuskodakaraensis KOD1 [23] . The chitin analogs MUF-diNAG and MUF-triNAGconsist of chitobiose or chitotriose linked to an MUF moietyat the reducing end that fluoresces under UV light only whencleaved from the saccharide [16] . In theory, both exochitinasesand endochitinases will hydrolyze the second glycosidic linkagefrom the nonreducing end of MUF-diNAG, thus releasing fluorescentMUF . Exochitinase activity on MUF-triNAG will result in theformation of chitobiose and nonfluorescent MUF-GlcNAc, whileendochitinolytic activity can hydrolyze both the second and third glycosidic linkages of MUF-triNAG, thus releasing MUF.

Purified enzyme samples were added to solutions of either analog, and the release of MUF was monitored fluorometrically duringthe period of linear accumulation of product . When incubatedwith MUF-diNAG, the rate of MUF release by GH18_N was 13.6-fold higher than that observed when GH18_C was utilized . However, when GH18_C was incubated with MUF-triNAG, the rate of MUF releasewas 2.7-fold higher than when it was incubated with GH18_N [Table1] . These results suggest that GH18_N may have exochitinase activitywhereas GH18_C may have endochitinase activity.

 
The GH18 domains have similar reaction optima. The presence of two catalytic domains for the same substratewithin a single polypeptide of an enzyme is rare . If the dualdomains of ChiB act together to degrade chitin, it would followthat these domains are most active under similar physical conditions.Ionic, pH, and temperature optima were determined for each domain.Purified samples of each enzyme were incubated with the optimalMUF substrate as identified above . GH18_N had a pH optimum ofbetween 7.2 and 8.0, while GH18_C was most active from pH 7.2to 7.8 [Fig . 3, top panel] . The temperature optimum of GH18_N was determined to be 37°C, with retention of 80% of its activity at 30°C . GH18_C was most active at 30°C and retained only 67% of its activity at 37°C [Fig . 3, bottom panel] . A significant loss of activity was observed for each domain at temperatures of above 40°C . Each domain was mostactive on its optimal MUF substrate regardless of temperatureor pH [data not shown].

 
To examine the effect of ionic conditions on each domain, various chloride salts were added to reaction mixtures . The additionof Mg²⁺, Mn²⁺, Ca²⁺, K⁺, EDTA, and EGTA to 10 mM, and NaCl upto 1.0 M had no effect on the activity of either domain . The activity of GH18N was reduced 36% by Ni²⁺, 8% by Sr²⁺, and 41%by Cu²⁺, while the activity of GH18C was reduced 14% by Ni²⁺,5% by Sr²⁺, and 53% by Cu²⁺ . Hg²⁺ completely inhibited the activitiesof both domains [data not shown].

The GH18 domains have different activities on chitooligosaccharides. The products formed from the activities of GH18_N and GH18_C onnative chitooligosaccharides were determined . Native chitooligosaccharides[GlcNAc₄, GlcNAc₅, and GlcNAc₆] were incubated with purifiedsamples of each polypeptide, and degradation products were labeledwith 2-aminobenzoic acid and fractionated by gel electrophoresis. Consistent with exochitinase activity, the sole degradationproduct of GH18_N activity on GlcNAc₄ was chitobiose [Fig. 4A].Further, GH18_N released chitobiose primarily from GlcNAc₅, andGlcNAc₄ was not observed [Fig . 4B] . When incubated with GlcNAc₆, GH18_N produced chitobiose and GlcNAc₄ but did not produce GlcNAc₃or GlcNAc₅ [Fig . 4C] . In contrast, GH18_C produced a mixtureof chitooligosaccharides when acting on GlcNAc_4, GlcNAc_5, and GlcNAc₆ [Fig . 4], consistent with the ability of an endochitinaseto cleave a chitooligosaccharide at any glycosidic linkage afterthe first bond at the nonreducing end . When incubated with 2-aminobenzoicacid-labeled chitohexose, GH18_N produced an increasing amountof labeled chitobiose over time, consistent with degradationfrom the nonreducing end . GH18_C activity on prelabeled chitohexoseproduced labeled GlcNAc₂, GlcNAc₃, and GlcNAc₄ [data not shown].The absence of labeled GlcNAc₅ suggests that the first glycosidic bond at the nonreducing end cannot be cleaved by this enzyme.

 
GH18_N and GH18_C function cooperatively to degrade native chitin. The impact of the differential activities in a single reactionmixture, both when the catalytic domains are linked on a singlepolypeptide and when they are expressed as separate enzymes, was examined . Equivalent amounts [250 pmol] of GH18_N or GH18_C were added individually to native chitin to determine the rate at which each could release reducing sugars, an indication of depolymerization . GH18_N released 0.0158 µmol of reducing sugar/min when added to native chitin, whereas GH18_C released 0.0340 µmol/min [Table 2] . A similar rate was measured at multiple time points during the initial 30 min of each reaction.

 
To determine if the active domains function cooperatively todegrade chitin, equivalent amounts of each polypeptide wereadded to native chitin in a single reaction . If the domainsact independently of each other, the theoretical combined rateof degradation should be greater than the sum of the two independentactivities calculated above, i.e., 0.0498 µmol of reducingsugar/min/500 pmol of total protein . Consistent with the proposedendo- and exo- activities of each domain, the actual rate was140% higher than the theoretical rate [Table 2].

Because in their native state the domains are linked on a single polypeptide, the rate of depolymerization was also measuredwhen both catalytic domains were present and attached with theirnative linkage [Fig . 1] . Full-length enzyme could not be usedin these experiments because of difficulties in expressing thecomplete protein, possibly due to the serine-rich, 150-residuelinker region at the amino terminus . The truncated form of ChiBlacking the postulated lipoprotein-anchoring site and linkerregion, GH18_N+C, was used instead [residues 156 to 1266] . GH18_N+Creleased 0.0645 µmol of reducing sugar/min when 250 pmolof polypeptide [and therefore 250 pmol of each active domain]was added, an increase of 23% over the theoretical combinedrate.

 
"M . degradans" strain 2-40 is known to efficiently metabolize chitin and many other insoluble complex polysaccharides [4]. Analysis of the chitinolytic system of 2-40 revealed an unusual chitin depolymerase, ChiB, which appeared to include two catalytic domains . One of the catalytic domains of ChiB was shown hereto function as an endochitinase, while the other functions asan exochitinase . ChiB is the first eubacterial chitinase demonstratedto contain two functional GH18 catalytic domains [9] . The lack of carbohydrate binding domains and typical accessory domains [e.g., fibronectin type III domains or polycystic kidney disease domains] [19], coupled with the discrete activities of each catalytic domain, emphasizes the novelty of this enzyme.

When expressed as separate polypeptides, each GH18 domain ofChiB was able to depolymerize chitin in zymograms and was mostactive under similar temperature, pH, and ionic conditions.GH18_N was more active on MUF-diNAG than on MUF-triNAG and displayeda pattern of activity typical of an exochitinase on chitooligosaccharides. Chitobiose was released from the nonreducing end of GlcNAc₄, GlcNAc₅, and GlcNAc₆ . Conversely, GH18_C released MUF most rapidlyfrom MUF-triNAG and was able to cleave chitooligosaccharidesat multiple linkages, demonstrating endochitinase activity.GH18_C was more than twice as active on native chitin as GH18_N;because native chitin has a paucity of free, exposed ends, exochitinaseshave far fewer sites at which they can act than do random-cuttingendochitinases, which can cleave virtually any glycosidic linkagein the polymer . The synergistic degradation of chitin observedwhen both domains were present further supports their proposedfunction . The presence of both domains on separate polypeptidesincreased the release of reducing sugars 140% over the theoreticalcombined rate calculated if the domains were only to act additively.This synergism would not be observed if both domains had thesame activity.

Carbohydrases with two catalytic domains are rare among prokaryotes. Only a small number have been characterized, mostly from ruminants and thermophiles . For example, Ruminococcus flavefaciens 17 [5] and Fibrobacter succinogenes S85 [17], produce xylanaseswith two catalytic domains, although the latter appears to encodea xylanase with two domains of the same function . Two extremethermophiles, Anaerocellum thermophilum [a -subgroup proteobacterium]and T . kodakaraensis KOD1 [an archaeon], produce enzymes withtwo catalytic domains [23, 26] . A . thermophilum produces a cellulase with separate GH9 and GH48 domains that encode endo- and exoglucanase activities, respectively . A chitinase from T . kodakaraensis, Tk-ChiA, was shown to have an amino-terminal exochitinase domain, while the carboxy terminus contains an endochitinase domain.Unlike ChiB of "M . degradans," this enzyme also contains chitin binding domains and is not predicted to anchor to the cell surface. Further, the exolytic domain of Tk-ChiA is able to weakly cleavethe third glycosidic linkage from the nonreducing ends of freechitin chains [23], an activity not observed in experiments with GH18_N.

The dual catalytic domains of ChiB function cooperatively to degrade chitin to chitobiose . Although maximal depolymerizationwas achieved when the catalytic domains of ChiB were on separate polypeptides, there are clear benefits to their presence asa single unit . First, a single promoter region is able to regulatethe expression of two enzymatic activities . This permits twoessential components of the chitinolytic system to be simultaneouslyregulated from a single locus, much like an operon regulatinggenes encoding a polycistronic mRNA . However, unlike for anoperon, where several individual proteins are produced, a singleenzyme is encoded . The amount of energy and secretion machineryneeded to deliver two enzymatic functions to the exterior ofthe cell is therefore decreased . Second, encoding both activitieson a single polypeptide ensures the proximity of the two domainsduring the in situ depolymerization of chitin . This allows fora synergistic and focused degradation of the polymer . In theenvironment, secreted enzymes may diffuse away from their intendedtargets and not be available to assist other components of adegradative system . This is partially solved by the presenceof carbohydrate binding domains [which appear to be lackingfrom ChiB], but there is no assurance that both endo- and exo-actingenzymes will bind to the same location and have the opportunityto act in concert to achieve the full potential of the systemunless they are linked on a single polypeptide.

When both domains were present on the same polypeptide, the synergism between the domains was less obvious . The activitydetected when the domains are joined was only modestly increasedover the theoretical activity when compared to the activitiesof the two catalytic domains as separate entities . The decreasedactivity of the domains when linked may be the result of thedomains then moving as a single protein as each encounters substrate.For example, as the exolytic domain is cleaving soluble chitooligosaccharides,perhaps away from the insoluble polymer, the endolytic domainis unable to contact, and therefore degrade, its primary substrate.One can envision that the amount of reducing sugars releasedwould increase if the domains were free to act at differentlocations . However, such an arrangement may not be of benefitin nature, where substrate is much more limited and less oftenencountered than in a laboratory reaction.

Based upon the data presented in this work and on the known properties of chitinases, a model of ChiB activity can be proposed [Fig . 5] . Each catalytic site has been shown to be independentlyactive, so the linkage between the domains may prevent interferencebetween them during the degradation of chitin . The significanceof the repetitive sequence in this region is unclear . The processivecutting nature of exochitinases and random cutting behaviorof endochitinases have been described [18] and can be appliedto the activity model of ChiB . As GH18_C releases chitooligosaccharidesfrom the polymer, they can be immediately acted upon by GH18_N,which processively cleaves chitobiose from the nonreducing end.The lipoprotein acylation site present at the amino terminusof ChiB likely functions to anchor the enzyme to the outer membrane.This notion is strengthened by the observation that chitinaseactivity has been associated with outer membrane preparationsof "M . degradans" [L . A . Whitehead and R . M . Weiner, unpublishedobservations] . The membrane anchorage would keep two criticalenzymatic activities in close proximity to the cell and perhapseliminate the necessity of chitin binding domains . If this isthe case, the importance of the catalytic domain arrangementwithin ChiB becomes apparent; chitooligosaccharides releasedby the activity of the distal GH18_C can be transferred to theexo-acting domain, which is in close proximity to the outermembrane where newly formed chitobiose can be taken up by thecell . The outer membrane localization of ChiB and other carbohydrasesproduced by "M . degradans" is currently being evaluated.

 
This work was funded by grants from the Maryland Sea Grant College [SA7528051E] and the National Science Foundation [DEB0109869].

We thank the Joint Genome Institute of the United States Department of Energy [JGI/DOE] for their efforts in sequencing the "M. degradans" genome and J . Bretz for valuable discussions.

 
* Corresponding author . Mailing address: Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD 20742 . Phone: [301] 405-5498 . Fax: [301] 314-9489 . E-mail: sh53@umail.umd.edu .

1. Altschul, S . F., T . L . Madden, A . A . Schaffer, J . Zhang, Z . Zhang, W . Miller, and D . J . Lipman. 1997 . Gapped BLAST and PSI-BLAST: a new generation of protein database search programs . Nucleic Acids Res . 25:3389-3402 .
2. Andrykovich, G., and I . Marx. 1988 . Isolation of a new polysaccharide digesting bacterium from a salt marsh . Appl . Microbiol . Biotechnol . 54:1061-1062.
3. Brurberg, M . B., I . F . Nes, and V . G . Eijsink. 1996 . Comparative studies of chitinases A and B from Serratia marcescens . Microbiology 142:1581-1589.
4. Ensor, L., S . Stosz, and R . Weiner. 1999 . Expression of multiple complex polysaccharide-degrading enzyme systems by marine bacterium strain 2-40 . J . Ind . Microbiol . Biotechnol . 23:123-126.
5. Flint, H . J., J . Martin, C . A . McPherson, A . S . Daniel, and J . X . Zhang. 1993 . A bifunctional enzyme, with separate xylanase and beta[1, 3-1,4]-glucanase domains, encoded by the xynD gene of Ruminococcus flavefaciens . J . Bacteriol . 175:2943-2951.
6. Gao, J., M . W . Bauer, K . R . Shockley, M . A . Pysz, and R . M . Kelly. 2003 . Growth of hyperthermophilic archaeon Pyrococcus furiosus on chitin involves two family 18 chitinases . Appl . Environ . Microbiol . 69:3119-3128 .
7. Henrissat, B. 1999 . Classification of chitinases modules . EXS 87:137-156.
8. Howard, M., N . Ekborg, R . Weiner, and S . Hutcheson. 2003 . Detection and characterization of chitinases and other chitin modifying enzymes . J . Ind . Microbiol . Biotechnol . 30:627-635.
9. Howard, M . B., N . A . Ekborg, L . E . Taylor, R . M . Weiner, and S . W . Hutcheson. 2003 . Genomic analysis and initial characterization of the chitinolytic system of Microbulbifer degradans strain 2-40 . J . Bacteriol . 185:3352-3360 .
10. Inouye, S., S . Wang, J . Sekizawa, S . Halegoua, and M . Inouye. 1977 . Amino acid sequence for the peptide extension on the prolipoprotein of the Escherichia coli outer membrane . Proc . Natl . Acad . Sci . USA 74:1004-1008.
11. Keyhani, N., and S . Roseman. 1996 . Molecular cloning, isolation, and characterization of a periplasmic chitodextrinase . J . Biol . Chem . 271:33414-33424 .
12. Lonhienne, T., K . Mavromatis, C . E . Vorgias, L . Buchon, C . Gerday, and V . Bouriotis. 2001 . Cloning, sequences, and characterization of two chitinase genes from the Antarctic Arthrobacter sp . strain TAD20: isolation and partial characterization of the enzymes . J . Bacteriol . 183:1773-1779 .
13. Madan Babu, M., and K . Sankaran. 2002 . DOLOP—database of bacterial lipoproteins . Bioinformatics 18:641-643.
14. Miller, G. 1959 . Use of dinitrosalicylic acid reagent for detection of reducing sugar . Anal . Chem . 31:426-428.
15. Muzzarelli, R. 1999 . Native, industrial, and fossil chitins . In P . Jollès and R . A . A . Muzzarelli [ed.], Chitin and chitinases . Birkhauser, Basel, Switzerland.
16. O'Brien, M., and R . R . Colwell. 1987 . A rapid test for chitinase activity that uses 4-methylumbelliferyl-N-acetyl-beta-D-glucosaminide . Appl . Environ . Microbiol . 53:1718-1720.
17. Paradis, F . W., H . Zhu, P . J . Krell, J . P . Phillips, and C . W . Forsberg. 1993 . The xynC gene from Fibrobacter succinogenes S85 codes for a xylanase with two similar catalytic domains . J . Bacteriol . 175:7666-7672.
18. Robbins, P . W., C . Albright, and B . Benfield. 1988 . Cloning and expression of a Streptomyces plicatus chitinase [chitinase-63] in Escherichia coli . J . Biol . Chem . 263:443-447 .
19. Robertus, J . D., and A . F . Monzingo. 1999 . The structure and action of chitinases . EXS 87:125-135.
20. Saito, A., T . Fujii, T . Yoneyama, M . Redenbach, T . Ohno, T . Watanabe, and K . Miyashita. 1999 . High-multiplicity of chitinase genes in Streptomyces coelicolor A3[2] . Biosci . Biotechnol . Biochem . 63:710-718.
21. Schultz, J., R . R . Copley, T . Doerks, C . P . Ponting, and P . Bork. 2000 . SMART: a web-based tool for the study of genetically mobile domains . Nucleic Acids Res . 28:231-234 .
22. Suzuki, K., N . Sugawara, M . Suzuki, T . Uchiyama, F . Katouno, N . Nikaidou, and T . Watanabe. 2002 . Chitinases A, B, and C1 of Serratia marcescens 2170 produced by recombinant Escherichia coli: enzymatic properties and synergism on chitin degradation . Biosci . Biotechnol . Biochem. 66:1075-1083.
23. Tanaka, T., T . Fukui, and T . Imanaka. 2001 . Different cleavage specificities of the dual catalytic domains in chitinase from the hyperthermophilic archaeon Thermococcus kodakaraensis KOD1 . J . Biol . Chem . 276:35629-35635 .
24. Techkarnjanaruk, S., and A . E . Goodman. 1999 . Multiple genes involved in chitin degradation from the marine bacterium Pseudoalteromonas sp . strain S91 . Microbiology 145:925-934.
25. Trudel, J., and A . Asselin. 1989 . Detection of chitinase activity after polyacrylamide gel electrophoresis . Anal . Biochem . 178:362-366.
26. Zverlov, V., S . Mahr, K . Riedel, and K . Bronnenmeier. 1998 . Properties and gene structure of a bifunctional cellulolytic enzyme [CelA] from the extreme thermophile ‘Anaerocellum thermophilum ’ with separate glycosyl hydrolase family 9 and 48 catalytic domains . Microbiology 144:457-465.

Free Online Full-text Article

What Is Pcr?, What Is Fermentation?, What Is Nitrification?, What Is Genetics?, What Is Bioremediation?, s, Microbiology, o, Microorganism, o, Bacteria, a, Bacteriology, s, Microbe, c, Vibriosis, a, Meningococcus, i, Microbial, i, Lactobacillus, s, Multidrug resistant, c, Enterobacters, s, Bacillus subtilis, c, Microbiological, n, Streptococci, s, Salmonella typhimurium, c, Bacillus, e, Cryptococci, o, Lactobacillus, e, Microbial, n, Gram negative, c, Streptococcal, c, Salmonellosis, a, Anaerobic bacteria, r, Enterobacters, o, Anaerobes, r, Haemophilus




 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005