Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us

Journal of Bacteriology, November 2002, p . 6081-6083, Vol . 184, No . 21

A Gene Encoding a Homologue of Dolichol Phosphate-ß-D-Mannose Synthase Is Required for Infection of Streptomyces coelicolor A3(2) by Phage {phi}C31

Deborah A . Cowlishaw and Margaret C . M . Smith*

Institute of Genetics, University of Nottingham, Queens Medical Centre, Nottingham NG7 2UH, United Kingdom

Received 3 May 2002/ Accepted 1 August 2002


   ABSTRACT

 
We have shown previously that a gene encoding a homologue to the eukaryotic dolichol-phosphate-D-mannose, protein O-D-mannosyltransferase, was required for {phi}C31 infection of Streptomyces coelicolor . Here we show that a gene encoding the homologue to dolichol-phosphate-mannose synthase is also essential for phage sensitivity . These data confirm the role of glycosylation in the phage receptor for {phi}C31 in S . coelicolor .


   TEXT

 
The temperate phage {phi}C31 has been used to develop phage vectors for genetic manipulation of Streptomyces species, many of which are commercially useful producers of antibiotics and other bioactive secondary metabolites (4, 8) . {phi}C31 has a moderately broad host range and is able to infect around a third of the Streptomyces species tested (9, 18) . The earliest event in phage infection is the recognition by phage tail proteins of some component on the host cell surface (7, 11, 15) . While this initial step is often reversible, at some point a commitment to infection occurs in which a series of molecular changes in the phage results in the injection of DNA into the cell . Studies of the molecules on the cell surface recognized by the {phi}C31 coat proteins will lead to a better understanding of the Streptomyces cell wall and to further development of phage vectors .

We have indicated previously that glycosylation of a Streptomyces coelicolor cell envelope protein is required for infection of the cell by {phi}C31 (5) . Mutants of S . coelicolor strain J1929 ({Delta}pglY and therefore sensitive to {phi}C31 [1]) that are unable to support plaque formation by {phi}C31c{Delta}25, a clear-plaque mutant of {phi}C31, were isolated . The S . coelicolor mutants were unable to form infective centers after contact with phage but could release phage particles after being transfected with phage DNA . These observations indicated that the mutants are blocked early in phage infection, probably at the stage of receptor binding . The S . coelicolor mutants fell into three classes, designated I, II, and III . A gene isolated from the S . coelicolor ordered cosmid library, SCE87.05, complemented the class I mutants but not those of class II or III . SCE87.05 has significant similarity to the eukaryotic dolichol-phosphate-D-mannose (Dol-P-Man), protein O-D-mannosyltransferases (protein mannosyltransferase), suggesting that the receptor for {phi}C31 infection is a glycoprotein generated through an O glycosylation pathway . This suggestion was supported by observations that the plant lectin concanavalin A could inhibit phage infection and that glycoproteins could not be detected by concanavalin A in Western blots of proteins from a mutant defective in SCE87.05 . A mutant phage, {phi}C31hc, could form plaques on class I and class II mutants of S . coelicolor but not on class III mutants . It was proposed that {phi}C31 normally recognizes a cell wall glycoprotein but that {phi}C31hc recognizes the unglycosylated protein . Thus, like the class I mutants, the class II mutants are predicted to be defective in the glycosylation pathway and the class III mutants are predicted to lack the protein target of glycosylation . Here we have tested part of this model with experiments to investigate the role of a gene, SC6D7.16, encoding a homologue of Dol-P-Man synthase, proposed to be required for the protein glycosylation pathway .

Dol-P-Man catalyzes the transfer of mannose from GDP-mannose to Dol-P in fungi and in mammals (10, 17) . Dol-P-Man is then the substrate for the transfer of the mannose to a serine or threonine by the protein glycosyltransferase in the O- glycosylation pathway . The protein sequences of the fungal and mammalian Dol-P-Man synthases were used to search the S . coelicolor genome sequence (http://www.sanger.ac.uk/Projects/S_coelicolor/) . The closest homologue was the predicted product of SC6D7.16 (Fig . 1) . The cosmid SC6D7 was therefore introduced by protoplast transformation into two of the class II phage-resistant mutants, DT1029 and DT2021, and into the S . coelicolor class III mutant, DT2017, isolated previously (5) . Seven individual transformants of each strain were tested for sensitivity to phage by using a plate assay . This was performed by preinoculating one-half of an R1M plate with {phi}C31c{Delta}25 and then streaking spores from the transformants across the plate from the phage-free half to the phage-containing half . SC6D7 conferred sensitivity to phage {phi}C31c{Delta}25 in approximately 50% of the transformants of DT1029 and DT2021 (the class II mutants) . This incomplete complementation appears to be typical of complementation by cosmids, and it is believed that the mutant and wild-type alleles undergo homogenotization (5, 13) . To confirm the complementation, we constructed a plasmid, pDT16, that carried only SC6D7.16 . PCR was used to amplify the open reading frame and flanking DNA from cosmid SC6D7, and the PCR product was inserted into the integrating vector pSET152 (3) . This plasmid was introduced by conjugation into a class I strain, DT1017; the class II strains DT1028, DT1029, DT1035, DT2008, and DT2021; and the class III mutant DT2017 . Seven individual transconjugants from each mating were tested for sensitivity to phage by using the plate assay . Phage sensitivity was restored to all the transconjugants tested from the class II mutants DT1029, DT1035, and DT2021, and this was confirmed in a plaque assay (Fig . 2) . The class II mutants DT1028 and DT2008 remained phage resistant (data not shown) . As expected, pDT16 did not restore phage sensitivity to {phi}C31c{Delta}25 in either the class I or class III mutant .


 FIG . 1 . Alignment of fungal and mammalian Dol-P-Man synthases and SC6D7.16 . The alignment was performed using CLUSTAL W (http://www.ebi.ac.uk/) . Residues are shaded black, dark grey, and light grey to represent positions with 100, 80, and 60% similarity, respectively . Sequences are of M . smegmatis Ppm1 (M.sme/Ppm1, accession number CAC15463), a possible Mycobacterium leprae glycosyl transferase (M.lep/glyc, accession number CAC30390), a putative Sulfolobus tokodaii Dol-P-Man synthase (S.tok/dolP, accession number BAB67446), Homo sapiens Dol-P-Man synthase (H.sap/dolP, accession number CAB53749), Schizosaccharomyces pombe Dol-P-Man synthase (S.pom/dolP, accession number CAB11700), and the predicted products of S . coelicolor SC6D7.16 (S.coe/6D7, accession number CAB61668) and Arabidopsis thaliana F2D10.6 (A.thal/F2D, accession number AAF80640).

 

 FIG . 2 . Complementation of a putative phage receptor mutant, S . coelicolor DT1029, by a plasmid, pDT16, containing SC6D7.16 and generation of a phage-resistant strain, J1929::pDT15, by insertional mutagenesis of SC6D7.16 . DT1029 is a phage-resistant derivative of J1929 ({Delta}pglY [1]) . Plasmid pDT16 was constructed by insertion of a fragment amplified from the cosmid SC6D7 with the primers DT25 (5' GCGTCTAGAGGATCCCGAAGGGCGCCGGGCCCC 3') and DT26 (5' GCGGATATCGAATCCAGTGCCGCATAAGAGGGC 3'), cleaved with BamHI and EcoRV, and inserted into BamHI-EcoRV-cleaved pSET152 (3) . pDT16 was introduced into strains of S . coelicolor by conjugation, and transconjugants were amplified on R2YE media containing apramycin (8) . pDT15 was constructed with primers DT23 (5' GCGAAGCTTGAATTCACGCGTGTGCGCGAGGGC 3') and DT24 (5' CGCTCTAGAGGATCCCTCCACCAGGATGTCGGG 3') to amplify a 615-bp fragment internal to the SC6D7.16 open reading frame, and this fragment was inserted into pSET151 via HindIII and XbaI restriction sites introduced via primer composition (3) . pDT15 was then introduced into J1929 by conjugation, and transconjugants were amplified by growth on R2YE media containing thiostrepton . Spores of DT1017(pDT16), DT1017, J1929, and J1929::pDT15 were plated in soft agar overlays containing yeast tryptone with the clear-plaque phage {phi}C31c{Delta}25 (16) on Difco nutrient agar plates, and the plates were incubated overnight at 29°C . Phage sensitivity similar to that obtained with DT1029(pDT16) was also obtained with DT2021(pDT16) and DT1035(pDT16) . Streptomyces strains and phage stocks were grown and maintained as described by Kieser et al . (8) . Escherichia coli DH5{alpha} was used as the routine cloning host . Conjugations of plasmids into S . coelicolor were performed by using E . coli strain ET12567 (dam, dcm, and hsdM) (pUZ8002) containing either pDT16 or pDT15 as the donor (8) . Cosmid SC6D7 from the M145 cosmid library of S . coelicolor A3 (2) was kindly provided by Helen Kieser (John Innes Centre, Norwich, United Kingdom).

 
To confirm the requirement for SC6D7.16 in phage infection, we constructed an S . coelicolor strain, J1929::pDT15, containing a targeted insertion in SC6D7.16 . A DNA fragment internal to SC6D7.16 was amplified by using primers DT23 and DT24, inserted into the suicide vector pSET151 (3), and introduced into the phage-sensitive strain J1929 (1) by conjugation . Integration of this construct by insert-directed homologous recombination into S . coelicolor J1929 should give rise to a disrupted version of SC6D7.16 . All seven transconjugants tested were resistant to {phi}C31 by the plate assay . Spores were amplified and used for plaque assays with {phi}C31c{Delta}25 and were resistant to infection, although a few very cloudy plaques could be observed at high phage titers (Fig . 2) . As expected, introduction of pDT16 encoding the wild-type allele of SC6D7.16 into J1929::pDT15 resulted in phage sensitivity (data not shown) . In addition, J1929::pDT15 spores could support plaque formation by {phi}C31hc (data not shown) . This phenotype is consistent with a class II phage resistance phenotype (5) .

These observations indicate that the protein product of SC6D7.16 is essential for {phi}C31 infection of S . coelicolor . SC6D7.16 is a homologue of the eukaryotic Dol-P-Man synthases (Fig . 1) . In eukaryotes, Dol-P-Man provides the mannosyl residues in glycosylphosphatidylinositols and in N, O, and C glycosylation . A knockout of the single-copy gene DPM1, which codes for Dol-P-Man synthase, resulted in complete loss of protein mannosylation in Saccharomyces cerevisiae (12) . Prokaryotes do not have dolichol . They contain instead other polyprenols, in particular undecaprenol phosphate (14) . There is little information on the polyprenols in the Streptomyces cell envelope; however, the closely related bacteria Mycobacterium tuberculosis and Mycobacterium smegmatis contain a variety of polyprenol phosphates, which are covalently attached to mannose (Pol-P-Man) (6) . The polyprenol phosphates in M . smegmatis have been shown to be used for several biosynthetic pathways for cell wall components, including mycolic acids, arabinogalactan, arabinomannan, and lipoarabinomannan (2, 6) . Pol-P-Mans in mycobacteria are thought to be synthesized by Ppm1, a functional analogue to the eukaryotic Dol-P-Man synthase and the closest homologue to SC6D7.16 (Fig . 1) .

The data presented here, together with previous findings (5), indicate that SCE87.05 and SC6D7.16, which encode a putative glycosyltransferase and a putative Pol-P-Man synthase, respectively, are required for the synthesis of the {phi}C31 receptor in S . coelicolor . Similar to the roles of equivalent proteins in eukaryotes, these enzymes probably catalyze two steps in a protein glycosylation pathway in S . coelicolor . The observation that not all of the class II mutants are complemented by SC6D7.16 suggests that DT2008 and DT1028 are defective in other genes, possibly those encoding other enzymes in the glycosylation pathway . It is clear from these studies that these proteins are not essential for the growth of S . coelicolor, implying that they are not exclusively required components of cell wall biosynthesis . The role of protein glycosylation is not known either in the mycobacteria or in Streptomyces, but it will hopefully become clearer once the targets for glycosylation have been characterized .

 


   ACKNOWLEDGMENTS

 
We are grateful to Helen Kieser for providing cosmid SC6D7 .

We thank the BBSRC for funding (project grant 42/P09260) .


   FOOTNOTES

 
* Corresponding author . Mailing address: Institute of Genetics, University of Nottingham, Queens Medical Centre, Nottingham NG7 2UH, United Kingdom . Phone: 44 115 9709778 . Fax: 44 115 9709906 . E-mail: Maggie.smith{at}nottingham.ac.uk .


   REFERENCES

 

  1. Bedford, D . J., C . Laity, and M . J . Buttner. 1995 . Two genes involved in the phase-variable {phi}C31 resistance mechanism of Streptomyces coelicolor A3(2) . J . Bacteriol . 177:4681-4689.
  2. Belanger, A . E., and J . M . Inamine. 2000 . Genetics of cell wall biosynthesis, p . 191-202 . In G . F . Hatfull and W . R . Jacobs, Jr . (ed.), Molecular genetics of mycobacteria . ASM Press, Washington, D.C.
  3. Bierman, M., R . Logan, K . O'Brien, E . T . Seno, R . N . Rao, and B . E . Schoner. 1992 . Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp . Gene 116:43-49.
  4. Chater, K . F. 1986 . Streptomyces phages and their applications to Streptomyces genetics, p . 119-157 . In S . W . Queener and L . E . Day (ed.), The bacteria . A treatise on structure and function, vol . 9 . Antibiotic-producing Streptomyces . Academic Press, Inc., Orlando, Fla.
  5. Cowlishaw, D . A., and M . C . M . Smith. 2001 . Glycosylation of a Streptomyces coelicolor A3(2) cell envelope protein is required for infection by bacteriophage {phi}C31 . Mol . Microbiol . 41:601-610.
  6. Crick, D . C., M . C . Schulbach, E . E . Zink, M . Macchia, S . Barontini, G . S . Besra, and P . J . Brennan. 2000 . Polyprenyl phosphate biosynthesis in Mycobacterium tuberculosis and Mycobacterium smegmatis . J . Bacteriol . 182:5771-5778.
  7. Haggård-Ljungquist, E., C . Halling, and R . Calendar. 1992 . DNA sequences of the tail fiber genes of bacteriophage P2: evidence for horizontal transfer of tail fiber genes among unrelated bacteriophages . J . Bacteriol . 174:1462-1477.
  8. Kieser, T., M . J . Bibb, M . J . Buttner, K . F . Chater, and D . A . Hopwood. 2000 . Practical Streptomyces genetics . The John Innes Foundation, Norwich, United Kingdom.
  9. Kobler, L., G . Schwertfirm, H . Schmieger, A . Bolotin, and I . Sladkova. 1991 . Construction and transduction of a shuttle vector bearing the cos site of Streptomyces phage {phi}C31 and determination of its cohesive ends . FEMS Microbiol . Lett . 62:347-353.
  10. Maeda, Y., S . Tanaka, J . Hino, K . Kangawa, and T . Kinoshita. 2000 . Human dolichol-phosphate-mannose synthase consists of three subunits, DPM1, DPM2 and DPM3 . EMBO J . 19:2475-2482.
  11. Montag, D., H . Schwarz, and U . Henning. 1989 . A component of the side tail fiber of Escherichia coli bacteriophage {lambda} can functionally replace the receptor-recognizing part of a long tail fiber protein of the unrelated bacteriophage T4 . J . Bacteriol . 171:4378-4384.
  12. Orlean, P. 1990 . Dolichol phosphate mannose synthase is required in vivo for glycosyl phosphatidylinositol membrane anchoring, O mannosylation, and N glycosylation of protein in Saccharomyces cerevisiae . Mol . Cell . Biol . 10:5796-5805.
  13. Piret, J . M., and K . F . Chater. 1985 . Phage-mediated cloning of bldA, a region involved in Streptomyces coelicolor morphological development, and its analysis by genetic complementation . J . Bacteriol . 163:965-972.
  14. Rick, P . D., and R . P . Silver. 1996 . Enterobacterial common antigen and capsular polysaccharides, p . 104-122 . In F . C . Neidhardt et al . (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol . I . ASM Press, Washington, D.C.
  15. Sandmeier, H. 1994 . Acquisition and rearrangement of sequence motifs in the evolution of bacteriophage tail fibres . Mol . Microbiol . 12:343-350.
  16. Sinclair, R . B., and M . J . Bibb. 1988 . The repressor gene (c) of the Streptomyces temperate phage {phi}C31: nucleotide sequence, analysis and functional cloning . Mol . Gen . Genet . 213:269-277.
  17. Strahl-Bolsinger, S., M . Gentzsch, and W . Tanner. 1999 . Protein O-mannosylation . Biochim . Biophys . Acta 1426:297-307.
  18. Voeykova, T . A., E . V . Slavinskaya, A . V . Orekhov, and N . D . Lomovskaya. 1979 . Identification of restriction and modification systems in Streptomyces strains . Genetika 15:1746-1756.

 

 

 

Free Online Full-text Article

 

 

 

 

What Is Pcr?, What Is Rhizobia?, What Is Protein?, What Is Genome?, What Is Bioremediation?, c, Microbe, e, Bacteria, o, Bacteriology, n, Microorganisms, c, Microbes, n, Bacteriophages, s, Flavobacterium, a, Yeasts, e, Escherichia coli, i, S. cerevisiae, i, Pseudomonas aeruginosa, s, Streptococci, r, Escherichia coli, e, Staphylococcus aureus, o, Escherichia coli, s, Pathogenic bacterium, e, Sepsis, r, Enterobacters, a, Neisseria, r, Antibiotic treatment, s, Salmonella, c, Growth media, a, Escherichia coli, n, Streptococcal, s, Cell suspensions, r, Bacteriophages




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005