|








| |
Journal of Bacteriology, July 2004, p . 4685-4693, Vol . 186,
No . 14
Inactivation of sll1556 in Synechocystis Strain PCC 6803 Impairs
Isoprenoid Biosynthesis from Pentose Phosphate Cycle Substrates In Vitro
Kelly Poliquin,1,
Yuri V . Ershov,2,
Francis X . Cunningham Jr.,1 Tinsay T . Woreta,1 R . Raymond
Gantt,1 and Elisabeth Gantt1*
Department of Cell Biology and Molecular Genetics, University of Maryland,
College Park, Maryland 20742,1 A . N . Bakh Institute of Biochemistry,
Russian Academy of Sciences, Moscow, Russia2
Received 6 February 2004/ Accepted 19 April 2004
In cyanobacteria many compounds, including chlorophylls, carotenoids,
and hopanoids, are synthesized from the isoprenoid precursors
isopentenyl diphosphate (IPP) and dimethylallyl diphosphate .
Isoprenoid biosynthesis in extracts of the cyanobacterium Synechocystis
strain PCC 6803 grown under photosynthetic conditions, stimulated
by pentose phosphate cycle substrates, does not appear to require
methylerythritol phosphate pathway intermediates . The sll1556
gene, distantly related to type 2 IPP isomerase genes, was disrupted
by insertion of a Kanr cassette . The mutant was fully viable
under photosynthetic conditions although impaired in the utilization
of pentose phosphate cycle substrates . Compared to the parental
strain the
sll1556
mutant (i) is deficient in isoprenoid biosynthesis in vitro with
substrates including glyceraldehyde-3-phosphate,
fructose-6-phosphate, and glucose-6-phosphate; (ii) has smaller cells
(diameter ca . 13% less); (iii) has fewer thylakoids (ca . 30% less);
and (iv) has a more extensive fibrous outer wall layer . Isoprenoid
biosynthesis is restored with pentose phosphate cycle substrates plus
the recombinant Sll1556 protein in the
sll1556
supernatant fraction . IPP isomerase activity could not be
demonstrated for the purified Sll1556 protein under our in vitro
conditions . The reduction of thylakoid area and the effect on outer
wall layer components are consistent with an impairment of isoprenoid
biosynthesis in the mutant, possibly via hopanoid biosynthesis . Our
findings are consistent with an alternate metabolic shunt for
biosynthesis of isoprenoids .
Isoprenoids are required for many cell processes including photosynthesis,
membrane stability, electron transport, and the cellular production
of carotenoids, rubber, and fragrances . More than 30,000 isoprenoid
compounds have been described . Synthesis of the essential 5-carbon
building blocks of isoprenoids, isopentenyl diphosphate (IPP)
and dimethylallyl diphosphate (DMAPP), can be attributed to one of
two pathways . The mevalonic acid pathway, the sole pathway in animals
and in many bacteria, also occurs in the cytoplasm of plant cells,
where it is responsible for synthesis of sterols and ubiquinones (18,
20) . The 2-C-methyl-D-erythritol-4-phosphate
(MEP) pathway occurs in Escherichia coli and many other bacteria
as well as in cyanobacteria . It is also present in chloroplasts,
where it provides substrates for the synthesis of carotenoids,
chlorophylls, and quinones . This pathway is believed important for
cyanobacterial photosynthetic pigment biosynthesis including that of
carotenoids and the phytolation of chlorophyll and in hopanoid
synthesis of bacterial and cyanobacterial cell walls and membranes (8,
20, 24) . Most of the MEP pathway genes
have been functionally verified in the gram-negative heterotrophic
bacterium E . coli (reviewed in references 4,
14, 18, and 20),
and this bacterium has thus become the standard for defining
the MEP pathway in other organisms . The MEP pathway is typically
represented as a linear sequence of reactions commencing with
pyruvate (PYR) and glyceraldehyde-3-phosphate (GA3P) as substrates
with a condensation to 1-deoxy-D-xylulose-5-phosphate
(DXP), leading to the synthesis of IPP and DMAPP, and is usually
assumed to involve an IPP isomerase for IPP and DMAPP interconversion
(4, 14, 18,
20) .
Our studies have concentrated on the photosynthetic prokaryote
Synechocystis strain PCC 6803, which possesses homologs of all
the essential genes for the MEP pathway (10) . These recent
studies (5, 6) provided evidence
that isoprenoid biosynthesis in cells grown photoautotrophically
exhibits some major differences from the pathway predicted from E .
coli as summarized in Fig . 1 . This
cyanobacterium does not utilize the predicted MEP pathway substrates
PYR and DXP in vitro . Instead it utilizes products of photosynthesis
as substrates . In addition it was shown that isoprenoid biosynthesis
in cultures of Synechocystis strain PCC 6803 was not affected
in vivo or in vitro by fosmidomycin (6), the
inhibitor of the key MEP enzyme deoxyxylulose phosphate
reductoisomerase . Collectively, these results strongly suggest that
alternate substrate paths are used in isoprenoid biosynthesis . In
accordance with our data, we proposed that in this cyanobacterium the
linear MEP pathway as defined for E . coli is not the sole
pathway by which isoprenoids are synthesized under photosynthetic
conditions but rather that products of the pentose phosphate cycle
serve as substrates, and it was hypothesized that they could
subsequently enter the MEP pathway downstream of MEP (Fig .
1; also Fig . 6 of reference 6) .
It was previously found that LytB, which is at the branch point of
IPP and DMAPP synthesis, is essential for the survival of
Synechocystis strain PCC 6803 (3) and therefore
is likely required for the formation of IPP and/or DMAPP . It is
generally expected that an IPP isomerase is involved in DMAPP
production from IPP (13, 14,
16) . However, in our previous work with
Synechocystis strain PCC 6803 we were unable to demonstrate IPP
isomerase activity consonant with a lack of the type 1 IPP isomerase
gene (10), and it was suggested that DMAPP and IPP
are separately generated (5, 6), which had
been independently also suggested for plant cell cultures (1) .
It should be noted that a possible homolog of a type 2 IPP isomerase
in Synechocystis, similar to the Streptomyces type 2 IPP
isomerase (9), was suggested from sequence identity
(32%) from the sll1556 open reading frame (ORF) . To test this
possibility, we created the knockout mutant
sll1556
and examined the recombinant protein from this ORF for IPP isomerase
activity .
|
FIG . 1 . The isoprenoid biosynthetic MEP pathway as determined for E .
coli beginning with PYR plus GA3P leading to the formation of MEP
from DXP and through subsequent steps via the LytB enzyme to IPP and
DMAPP (3, 14, 17,
18, 19, 20,
30) . Fosmidomycin (white arrow) inhibits the
synthesis of MEP and blocks the growth of the bacterium . Asterisks
denote differences in Synechocystis strain PCC 6803 where PYR,
DXP, and MEP do not serve as substrates in vitro; where IPP isomerase
activity has not been observed; and where fosmidomycin does not inhibit
isoprenoid biosynthesis or growth in the cyanobacterium (6),
and the triangle indicates where pentose phosphate cycle substrates may
possibly enter downstream of MEP.
|
|
|
FIG . 6 . Scanning electron micrographs of Synechocystis strain PCC
6803 WT (A) and
sll1556
mutant (B) cells from log-phase cultures (as is evident from several new
daughter cells that are kidney shaped) . The WT cells have a relatively
smoother outer surface than do the mutant cells, and the mutant cell
surfaces have greater fibrous extensions, shown at greater magnification
in panel C, than do the WT cells . Bars, 2 (A and B) and 0.15 (C) µm.
|
|
In the present work we report that Sll1556 is not essential but that
the nonlethal Synechocystis strain PCC 6803 mutant was
impaired in the utilization of pentose phosphate cycle substrates for
isoprenoid biosynthesis in vitro . The impairment is correlated with a
significant reduction of thylakoid membranes in the mutant and an
increase in outer wall components . We suggest that DMAPP and IPP
biosynthesis may occur by more than one metabolic path leading to
isoprenoid biosynthesis .
Cell culture and fractionation. Liquid cultures of the
glucose-tolerant Synechocystis strain PCC 6803 (obtained from
Wim Vermaas, Arizona State University) were routinely grown at ca .
30°C in continuous light (15 to 20 µmol/m2/s) with
continuous shaking and slow bubbling of 5% CO2 in air . The
parental strain (wild type [WT]) of Synechocystis, referred to
throughout the paper as WT, is the widely used glucose-tolerant
strain (29) . The culture medium BG-11 was supplemented with
5 mM potassium-TES [N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic
acid, pH 8.3] .
For in vitro assays Synechocystis strain PCC 6803 cells were
harvested in the log phase of growth . Cells pelleted by centrifugation
were quickly rinsed in 100 mM HEPES-KOH (pH 7.7) and 1 mM dithiothreitol
(DTT), treated with lysozyme (10 mg/ml, 60 min, 37°C), rinsed
in the same buffer, and broken in a French pressure cell (20,000
lb/in2, 4°C) . The supernatant fraction (3 to 5.5 mg of protein
per ml), after centrifugation at 60,000 x
g for 1 h, was stored at –80°C for use within less than 3
weeks . An alternate improvement in the procedure was to prepare the
60,000 x g supernatant
directly from pelleted frozen cells (–80°C; 0.7 ml), previously
rinsed in 100 mM HEPES-1 mM DTT (pH 7.7) and broken (for 30 s with
intermittent cooling, four times) in buffer with a Mini-Bead beater
(Biospec Products Inc., Bartlesville, Okla.) . Also, the reaction
mixture was preincubated with unlabeled IPP for 20 min (37°C) before
addition of [14C]IPP and further incubation and assayed
from 0 to 60 min . The preincubation served to deplete any residual
DMAPP that might have been present in the cells extracts . It should
be noted that the results were essentially the same as with the
previous procedure (6), except that variation in
activity with time of stored supernatant was eliminated, as was a
small stimulation from residual MEP previously observed (as in Fig.
3 of reference 6) .
|
FIG . 3 . Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of
His-tagged recombinant proteins purified on Ni-NTA columns and stained
with Coomassie blue . (A) Sll1556 protein (ca . 41.6 kDa) of
Synechocystis strain PCC 6803; (B) type 2 IPP isomerase (37 kDa) of
Streptomyces sp . strain CL190 . The molecular mass range is as
indicated on the left.
|
|
Isoprenoid biosynthesis with radiolabeled IPP incorporation.
The incorporation of [14C]IPP into the acid-labile fraction
of a petroleum ether extract (6) was used as an indirect
assay for DMAPP synthesis in extracts of Synechocystis strain
PCC 6803 cells . The reaction mixture was composed of the cell-free
supernatant fraction (60,000 x g)
with 100 mM HEPES-KOH (pH 7.7), 5 mM glutathione, 5 mM MgCl2,
2.5 mM MnCl2, 500 µM ATP, 250 µM CTP, 100 µM thiamine-PP,
10 µM coenzyme B12 (5'-deoxyadenosyl-cobalamine), 1 mM
NADPH, 500 µM NADP, and 1 mM flavin adenine dinucleotide (FAD) . Each
incubation was carried out in a total volume of 1 ml with a
final concentration of 8.5 µM [1-14C]IPP (Amersham) (and
8.25 x 105 dpm/ml) at 37°C .
Following a 20-min preincubation with 3.0 µM IPP, [14C]IPP
and compounds tested were added individually or in combination: DMAPP
(2 µM), DXP (500 µM) (Echelon Research Labs Inc., Salt Lake City,
Utah), GA3P (1 mM), fructose-6-phosphate (FR6P; 500 µM), glucose-6
phosphate (GL6P; 500 µM), MEP (500 µM) (Echelon Research Labs .
Inc.), and PYR (500 µM) . Aliquots of 0.2 ml (0.2 to 0.46 mg of
protein) were assayed for radioactivity .
The incorporation of [14C]IPP into allylic prenols was verified
by extraction into petroleum ether (boiling point, 55 to 110°C)
after hydrolysis (0.5 N HCl, 37°C, 20 min) as in the work of Ershov
et al . (5, 6), and each extracted sample was
counted in 10 ml of ScintiSafe Econo 2 cocktail (Fisher Scientific) .
Verification that [14C]IPP was incorporated into isoprenoids
had been previously established by reversed-phase column chromatography
(5) . Each 0.5-ml sample of the petroleum ether extract
was applied to a silica gel 6, RP-18 (EM Industries) column (24 by 1
cm), previously equilibrated in and then eluted with 100%
acetonitrile . The following alcohols served as calibration standards:
isopentenyl alcohol (C5), geraniol (C10),
linalool (C10), farnesol (C15), nerolidol (C15),
and geranyl geraniol (C20) (Aldrich) . Controls for
phosphatase activity showed that the petroleum ether extract had very
few counts without acid hydrolysis, indicating little or no
phosphatase activity . Furthermore, the 14C incorporation
into isoprenoids was time course dependent, where longer chains,
i.e., >C10, became predominant with increased time of incubation
(data not shown) .
Cloning and disruption of Synechocystis strain PCC 6803 gene
sll1556. The nucleotide sequence of Synechocystis strain
PCC 6803 ORF sll1556 (10) was obtained at
Cyanobase (http://www.kazusa.or.jp/cyanobase/) .
Oligonucleotide primers sll1556N (GAGAGGATCCATGGATAGCACCCCCCACCGTAAG;
the initiation codon is underlined) and sll1556C (TCGTCAACCAGAGCAAAATGTC)
were designed, with the assistance of the program Primer3 (21),
to amplify the entire ORF and introduce NcoI and BamHI sites at
the N terminus . Genomic DNA was extracted from a Synechocystis
strain as earlier described (29) . The PCR was performed using
an MJ Research (Waltham, Mass.) PTC-150-25 MiniCycler with a
heated lid . The Advantage-HF2 PCR kit (Clontech Laboratories, Inc.)
was used in a reaction volume of 50 µl in 100-µl thin-walled tubes .
After an initial denaturation for 1 min at 94°C, amplification was
for 30 cycles at 94, 60, and 68°C for 10, 60, and 150 s,
respectively, with a final extension for 10 min at 68°C . The
amplified sll1556 PCR product was purified by extraction with
phenol-chloroform, precipitated with sodium acetate and ethanol,
washed with 70% ethanol, dried, and resuspended in Tris-EDTA (TE)
buffer (23) . After digestion with BamHI, a 1.1-kb
fragment containing sll1556 was purified by gel
electrophoresis (1% agarose), recovered using the Geneclean kit (Bio
101, Inc., Carlsbad, Calif.), and cloned in frame in the BglII and
PvuII sites of plasmid vector pBAD/His-B (Invitrogen) to give plasmid
pBAD/His-sll1556 . The sll1556 insert was sequenced to confirm
the reading frame and the absence of mutations introduced by PCR .
A kanamycin resistance gene, originally obtained from Tn903,
was excised as a 1.3-kb EcoRV-EcoRV fragment and cloned into
the MscI site within sll1556 (Fig . 2) to give plasmid
pBAD/His-sll1556Kan . This plasmid was linearized by digestion with
EcoRI (a site present in the multiple cloning site of the vector) and
then extracted with phenol-chloroform, precipitated, and resuspended
in TE as described above . This linearized plasmid preparation
was used to transform Synechocystis strain PCC 6803 essentially
as described by Williams (29) . Segregation of the
sll1556::Kanr ( sll1556)
mutant was confirmed by PCR (Fig . 2) with the primers
and reaction conditions described above .
|
FIG . 2 . (Top) Schematic illustration of Synechocystis strain PCC
6803 genomic DNA encompassing gene sll1556 (gray arrow) . A
kanamycin-resistance gene (Kanr; white arrow) was inserted in
the MscI site to inactivate the gene . (Bottom) Agarose gel
electrophoresis of PCR products obtained using genomic DNA from the WT
strain (WT) and mutant sll1556::Kanr indicates
complete segregation of the mutant (i.e., all gene copies have been
inactivated).
|
|
Expression and purification of proteins. E . coli strain
Rosetta (Novagen) containing plasmid pBAD/His-sll1556 (see above) was
grown in Luria-Bertani medium supplemented with ampicillin (150
µg/ml) at 30°C at 300 cycles of shaking/min until the culture reached
an A600 of approximately 0.5 . At this point 20%
arabinose was added to give a final concentration of 0.2% . After 16 h
of further growth at 20°C, the culture flask was chilled in ice water
and cells were harvested at 500 x
g for 10 min at 4°C . Well-drained cell pellets were frozen at
–80°C . The recombinant protein was also produced using growth at 30°C
with 3 h of induction in Top10 cells (Invitrogen) .
For production of recombinant Streptomyces type 2 IPP isomerase,
conditions were the same except that isopropyl-ß-D-thiogalactopyranoside
(IPTG; 2 mM final concentration) was used as the inducer, with
cells being grown at 20°C for 16 h before harvest . Cells contained
the plasmid pQCLD41 (9) .
Recombinant proteins were purified after cell breakage by sonication
and eluted from a Ni-nitrilotriacetic acid (NTA) column with
100 mM imidazole-Tris-HCl, pH 8.0 . Alternatively, cells were
extracted with the B-PER bacterial protein extraction reagent (Pierce
Biotechnology Co.) and the recombinant protein was purified on Ni-NTA
minicolumns (Qiagen, Chatsworth, Calif.) by elution with buffered 125
mM imidazole (50 mM phosphate, 300 mM NaCl, 1 mM DTT, pH 8.0) . In
Fig . 3 are shown the purified proteins on sodium
dodecyl sulfate-polyacrylamide gels after Coomassie blue staining .
The size estimates of 41.6 kDa for Sll1556 of Synechocystis
sp . strain PCC 6803 and of 37 kDa for the type 2 IPP isomerase of
Streptomyces sp . strain CL190, with the use of molecular mass
markers (Low Range) from Bio-Rad Laboratories, are consistent with
the expected molecular masses (including the His tag) .
Enzymatic activity tests . (i) IPP isomerase assay. For the
type 2 IPP isomerase assay we used the procedure developed by Kaneda
et al . (9) . Assays were conducted with FAD with and
without NADPH or with flavin mononucleotide (FMN) with and without
NADPH . We thus confirmed the requirement for FAD (or FMN) and NADPH .
Briefly, the activity was measured by [14C]IPP incorporation
into the petroleum ether layer, dependent on the acid lability
of DMAPP as described above . Each reaction mixture at 37°C (0.5-ml
final volume) contained 8.5 µM [14C]IPP, 100 mM HEPES (pH
7.7), 2 mM DTT, 5 mM MgCl2, 5 mM MnCl2, 1 mM NADPH,
1 mM FAD (or FMN), and recombinant protein (over a range of 0.1
to 50 µg/0.5 ml) . We also used the standard assay developed for the
type 1 IPP isomerase according to the work of Spurgeon et al . (25)
to ascertain activity of the recombinant proteins with and without
cell supernatants .
(ii) Glycolate oxidase. The Sll1556 protein was tested for
glycolate oxidase activity by two separate methods . The first was
according to the work of Zelitch (33), involving
the loss of color at 620 nm of 2,6-dichlorophenylindophenol (DCPIP) .
The oxidase assay in 1.0 ml (final volume) contained 30 mM potassium
phosphate buffer (pH 8.0), 0.003% DCPIP, with or without 5 mM FMN, 42
mM imidazole, 30 mM potassium cyanide, and Sll1556 protein (ca . 3
µg) . After a 20-min incubation the validity of the glycolate oxidase
assay was verified by addition of spinach glycolate oxidase (EC
1.1.2.15) (ca . 5 µg) . Phenylhydrazone formation was used for the
second assay by measuring the increased optical density at 324 nm .
Reaction conditions were as described above, except that 3 mM
phenylhydrazine replaced DCPIP and cyanide, and the assay validity
was verified by addition of glyoxylic acid .
(iii) Lactate dehydrogenase. The Sll1556 protein was tested
for lactate dehydrogenase activity by the decrease of optical density
at 340 nm by modifying the procedure in reference 12 .
A 1.0-ml incubation mixture contained 30 mM Tris-HCl, 5 mM MgCl2,
with or without 5 mM FMN, 50 mM pyruvic acid, 1 mM NADH (or NADPH), 1
mM DTT, and Sll1556 protein (ca . 3 µg) . Lactate dehydrogenase in NADH
(rabbit muscle EC 1.1.1.27) was added to validate the incubation
conditions .
Protein concentrations were determined as in the work of Ershov et
al . (5) by the bicinchoninic acid assay and the Micro BCA
protein assay (Pierce Biotechnology Co.) with bovine serum albumin
as the standard . Except where otherwise indicated, the chemicals
used in this study were purchased from Sigma Chemical Co .
Electron microscopy. Cells from the log phase of growth,
rinsed in 0.25 M phosphate buffer (pH 7.0), were fixed in 2.0%
phosphate-buffered glutaraldehyde (2 h) and rinsed several times in
buffer . The secondary fixation in 1% OsO4 (2 h) was also
followed by several phosphate buffer rinses . For transmission
electron microscopy cells were dehydrated in ethanol and propylene
oxide before embedment in Epon resin . Sections were stained with 1%
uranyl acetate and lead citrate and examined in a Zeiss EM10 CA
microscope .
For scanning electron microscopy cells were fixed in glutaraldehyde
as described above and were then collected on a Nuclepore
(0.5-µm-pore-size) filter, dehydrated in ethanol (75 to 100%) for
critical point drying, and shadowed with gold-palladium in a Denton
Vacuum DCP-1 apparatus for examination with a Hitachi S-4700 scanning
electron microscope .
Multiple sequence alignment and construction of neighbor-joining
tree. The predicted amino acid sequences of bacterial type 2 IPP
isomerases and polypeptides of undetermined function related to these
enzymes were aligned using the program Clustal X (27)
with the Blosum series weight matrix . All parameters were set at
their default values . A neighbor-joining tree (22)
was constructed from the alignment, with gaps excluded from the
analysis and correction made for multiple substitutions (11) .
One thousand bootstrap trials were carried out with a random number
generator seed of 111 . The tree was displayed using the program
NJplot (15) .
Sll1556 and IPP isomerase activity in vitro. The gene
sll1556 of Synechocystis strain PCC 6803 was identified as
a probable type 2 IPP isomerase based on 32% amino acid sequence
identity with a homologous gene of Streptomyces (9) . In
fact, Kaneda et al . (9) were the first to identify
the FMN- or FAD-plus-NADPH-requiring novel type 2 IPP isomerase,
which lacks homology with the well-characterized IPP isomerase (type
1) (7, 16, 25) . The type
2 IPP isomerase activity has also been shown in Bacillus subtilis
(26) and in Staphylococcus aureus (9)
(Table 1) . In several protein databases the ORF
sll1556 is annotated as IPP isomerase type 2 or as FMN-dependent
lactate dehydrogenase . Genes related to sll1556 of Synechocystis
strain PCC 6803 are also found in a number of other cyanobacteria .
However, notably absent are predicted homologs in three strains
of Prochlorococcus marinus (SS 120, MED 4, and MIT 9313) as
well as in Synechococcus sp . strain WH 8102 and "Gloeobacter
violaceus" PCC 742 (Table 1) . To our knowledge,
activity for neither IPP isomerase (type 2) nor lactate dehydrogenase
has been functionally demonstrated for Sll1556 nor for a related
protein in any of the cyanobacteria listed in Table 1 .
This prompted us to first assay the IPP isomerase activity of the
expressed Sll1556 recombinant protein of Synechocystis and to
examine the consequences of inactivating this gene .
| TABLE 1 . Demonstrated IPP isomerase function in bacteria and genes (by
gene bank identification numbers) related to IPP isomerase in
cyanobacteria
|
|
IPP isomerase activity could not be demonstrated (Fig . 4) with
the recombinant Sll1556 protein purified on Ni-NTA columns (Fig .
3) under the conditions used for the homologous
Streptomyces gene product . Yet, as seen in Fig . 4,
IPP isomerase activity was obtained with the recombinant protein of
Streptomyces, consistent with the previous report (9) .
Our results confirm the initial observation that the type 2 isomerase
requires FAD (or FMN) and NADPH (data not shown) . The recombinant
enzyme of Streptomyces was very active initially but declined
over time at 0°C (Fig . 4), and its activity was
totally abolished by freezing with or without 50% glycerol . Numerous
alternate purification conditions were also tried in isolating the
protein including breakage of E . coli cells by sonication,
decreasing or omitting DTT, Tris-HCl (pH 7.9) buffer substitution,
FMN presence throughout, and varying the protein concentration, but
definitive IPP isomerase activity could not be demonstrated for the
sll1556 gene product . It was concluded that if this gene
product is an IPP isomerase it must require conditions as yet unknown
or that the protein has a different function .
|
FIG . 4 . [14C]IPP conversion to DMAPP (as described in
Materials and Methods) by IPP isomerase type 2 (of Streptomyces
sp . strain CL190) but not by the Sll1556 protein (of Synechocystis
strain PCC 6803) . Symbols: •, freshly purified recombinant Sll1556
protein of Synechocystis strain PCC 6803 (1.0 µg/500 µl);
,
Streptomyces sp . freshly purified enzyme (0.57 µg/500 µl);
,
Streptomyces sp . freshly purified enzyme stored for 24 h at 0°C
(1.14 µg/500 µl) . The Sll1556 protein lacks IPP isomerase activity,
whereas freshly purified Streptomyces sp . strain CL190 protein is
clearly active, and this activity declined upon storage . The incubation
mixture consisted of 8.5 µM [14C]IPP, 100 mM HEPES, 2 mM DTT,
5 mM MgCl2, 5 mM MnCl2, 1 mM NADPH, and 1 mM FAD,
pH 7.7 (37°C).
|
|
Pentose phosphate cycle substrate stimulation of isoprenoid biosynthesis
is impaired in the
sll1556
mutant. If the sll1556 gene product is involved in isoprenoid
biosynthesis, then this should be reflected in the mutant where the
gene has been inactivated (as in Fig . 2) .
Isoprenoid biosynthesis, requiring both DMAPP and IPP for formation
of compounds of C10 and greater, was measured in vitro for
WT and
sll1556
as in the work of Ershov et al . (6) . Basically, the
[14C]IPP incorporated in the cell supernatant extract
(60,000 x g) is retrieved in the
petroleum ether fraction (after acid hydrolysis) . Analysis by
reverse-phase chromatography verified that the labeled isoprenoids
were compounds of C10 and greater (5)
(data not shown) . This incorporation into isoprenoids larger than C5
indicates DMAPP production . Furthermore, stimulation of isoprenoid
biosynthesis was obtained by the addition of exogenous DMAPP with
both WT and
sll1556
mutant supernatant (Fig . 5A and B, respectively) . Hence,
we equate [14C]IPP uptake with DMAPP production under our
in vitro conditions . Also, in WT supernatant [14C]IPP
stimulation was observed with pentose phosphate cycle intermediates
(Fig . 5A), in addition to stimulation by DMAPP .
Typical MEP pathway intermediates such as MEP, PYR, and DXP (data not
shown) did not stimulate [14C]IPP incorporation above that
obtained with the incubation cofactor mixture alone in WT . Pentose
phosphate cycle intermediates (such as GL6P and FR6P) which may feed
into the MEP pathway downstream (or possibly at alternate sites) were
again active as had been previously shown for the WT (6) .
|
FIG . 5 . (A) [14C]IPP incorporation into the isoprenoid
fraction of the supernatant of WT is stimulated by FR6P and GA3P,
indicating DMAPP production . (B) In the supernatant of the
sll1556
mutant the same substrates failed to stimulate [14C]IPP
incorporation . (C) Reconstitution of activity by addition of Sll1556
protein at an 0.15-µg/ml final concentration in the reaction mixture .
Symbols:
,
FR6P (500 µM);
,
DMAPP (2 µM); x, GA3P (1 mM); •,
GA3P (1 mM) plus PYR (500 µM);
,
MEP (500 µM);
,
incubation cofactor mixture (500 µM ATP, 250 µM CTP, 100 µM thiamine PP,
1 mM NADPH, 500 µM NADP, 1 mM FAD, 5 mM glutathione, 5 mM MgCl2,
2.5 mM MnCl2, 10 µM coenzyme B12, 100 mM
HEPES-KOH, pH 7.7) incubated at 37°C . Incorporation with radiolabeled [14C]IPP
(8.5 µM) followed preincubation with IPP (3 µM) (Materials and Methods).
|
|
However, with the
sll1556
mutant there was no stimulation of isoprenoid synthesis with FR6P,
GA3P, MEP, or GL6P (data not shown) nor with the cofactor mixture
alone (Fig . 5B), indicating a lack of DMAPP
production with these substrates . These results clearly imply that
the missing factor, probably an enzyme, is required for incorporation
of these pentose phosphate cycle components into the formation of a
pool of isoprenoids .
The stimulation of pentose phosphate cycle substrates could be
restored upon addition of the Sll1556 protein to the mutant
sll1556
supernatant as seen in Fig . 5C . The inferred production
of DMAPP, as indicated by [14C]IPP incorporation, occurred with
GA3P, FR6P, and GL6P (data not shown) but not with MEP or the
Sll1556 protein alone . In fact, the restoration of activity with FR6P
under the same experimental conditions was equivalent to, or greater
than, that obtained with the WT (with the addition of 2.0 µM
DMAPP-0.5 mM FR6P) . The Sll1556 protein is likely an enzyme as judged
by the increased activity upon higher Sll1556 concentrations (data
not shown) and because heating of the protein (2 min, 100°C)
destroyed the activity . The nature of this apparent enzyme was
subsequently further investigated .
Other suggested Sll1556 enzyme functions. There is little
doubt that the Sll1556 protein has activity as evident from the
reconstitution experiments (Fig . 5C), which
suggests that the protein influences another route to DMAPP
production and isoprenoid biosynthesis . A BlastP search suggests that
the sll1556 gene product is functionally similar to FMN-dependent
alpha-hydroxy acid dehydrogenases, as well as IPP isomerase
(type 2) . Glycolate oxidase and lactate dehydrogenase are suggested
albeit with rather low similarities . Hence, their substrate
utilization was assayed by standard procedures (see Materials and
Methods) with enzymes of known function to verify the assay
conditions . We could not confirm glycolate oxidase activity nor
activity for lactate dehydrogenase .
The
sll1556
mutation affects membrane development. A comparison of the cell
morphology of WT Synechocystis strain PCC 6803 and the
sll1556
mutant was made using cultures in the log phase of growth and of
similar cell densities (Table 2) . Cells of the WT,
when grown under moderate-light conditions (20 µmol/m2/s)
are typically coccoid in shape except during division, when the
daughter cells are oblong (Fig . 6) . In scanning
electron micrographs the cell diameter is 1.53 ± 0.12 µm for mutant
cells and 1.75 ± 0.11 µm for WT cells . The outer wall layer of the
mutant is considerably more fibrous than that of the WT . These
fibrous extensions may be elongated stretches of outer wall layers .
They are more coarse than fimbriae (28) but could
be related to some of the coarser pili observed in Synechocystis
strain PCC 6803 (2, 32) . Negatively
stained images of whole mounts of fixed cells did not reveal
pili on either WT or mutants, which does not rule out their presence .
Thylakoid membranes in sectioned cells (Fig . 7) tended
to be peripherally arranged but could also fill the cell center .
Also common were discontinuations of thylakoid membranes near
the cell wall, suggestive of recent cell divisions . In the mutant
there were fewer thylakoids (ca . 6.8) per central cell section than
in WT (ca . 9.4) . Growth over a range of light intensities (ca . 4, 20,
and 200 µmol/m2/s) varied (data not shown), but the mutant
and WT cultures had about the same growth rate at the respective
light intensities, suggesting that the lesser thylakoid content in
the mutant was not a limiting factor .
TABLE 2 . Comparison of Synechocystis strain PCC 6803 WT and
sll1556
mutant
|
|
|
FIG . 7 . Transmission electron micrographs of a Synechocystis
strain PCC 6803 WT cell (A) and a
sll1556
mutant cell (B) . Thylakoid density in
sll1556
mutant cells was typically less than that in WT cells . Bar, 0.3 µm.
|
|
That the Sll1556 protein is an IPP isomerase (type 2) was not
demonstrated under our in vitro conditions, although we were able to
confirm the activity of the Streptomyces homolog (Fig .
4) . With an amino acid identity of only 32% we must consider
that the function of Sll1556 may not be that of an IPP isomerase .
A BlastP analysis together with searches of databases of cyanobacterial
genomes revealed a number of gene sequences related to sll1556
as a putative IPP isomerase type 2 (Table 1), but as
noted above a functional confirmation for purified gene products is
lacking . Activities suggested from gene sequence annotations, such as
glycolate oxidase and FMN-dependent lactate dehydrogenase, were
also not obtained . Sequence comparisons with Sll1556 indicate that
homologous proteins similar to that in Synechocystis strain
PCC 6803 are present in five other cyanobacteria: Anabaena (Nostoc)
strain PCC, "Nostoc punctiforme" PCC 73102, "Synechococcus
elongatus" PCC 7942, "Thermosynechococcus elongatus" BP-1,
and "Trichodesmium erythraeum" BP-1 . For the species listed in
Table 1 and shown in the tree (Fig . 8)
the sll1556-related gene similarities are ca . 30% between
bacteria and cyanobacteria and ca . 50% among cyanobacteria . Many of
these were designated as IPP isomerases in databases, but the
functional annotation can be considered valid only for the three
bacterial species for which type 2 IPP isomerase has been
functionally verified (9, 26) . Even though
a meaningful relatedness is suggested from the tree (Fig . 8),
any functional designation for the Sll1556 protein and its probable
cyanobacterial homologs (ca . 50% similarity) is at this time
premature .
|
FIG . 8 . Neighbor-joining tree of the known bacterial type 2 IPP
isomerases and related polypeptides encoded in cyanobacterial genomes .
Type 2 IPP isomerase has been functionally determined for only the top
group . Bootstrap values greater than 50% (for 1,000 trials) are
indicated . See Table 1 for accession numbers of the
polypeptides.
|
|
A requirement for an IPP isomerase would apply only if an organism
had only one pathway by which IPP and DMAPP are produced, as implied
by a linear pathway as assumed for E . coli (Fig . 1) .
Yet, even for E . coli it has been shown that an IPP isomerase
is not essential (7) . In addition, Kuzuyama and Seto (14)
further reported (cf . reference 14 and Table
1) that a number of bacteria do not possess genes
for either type of IPP isomerase, thus indicating considerable
diversity .
There is little doubt that the sll1556 gene product affects
isoprenoid biosynthesis in vitro . Since the
sll1556
mutant was impaired in inferred DMAPP production by lack of
stimulation by FR6P and other pentose phosphate cycle substrates
(Fig . 5B), it can be assumed that it was deficient
in an alternate path of isoprenoid production . The rather significant
membrane reduction in the mutant implies that this alternate path
could be very significant under certain conditions . These results
require further exploration of pentose phosphate cycle substrates
under varied in vivo and in vitro conditions to clarify the nature
and role of the Sll1556 protein .
The analysis of the WT Synechocystis strain PCC 6803 and the
sll1556
mutant, as summarized in Table 2, reveals some notable
physiological and morphological phenotypical characteristics .
It is well known that hopanoids are present in the membranes
(thylakoids, cell membranes, and wall layers) of cyanobacteria (8,
24) . Hence, a reduction in thylakoid synthesis in the mutant
(Fig . 7) is readily attributable to reduced isoprenoid
biosynthesis, since isoprenoid precursors are essential building
blocks of carotenoids, chlorophylls, and certain quinones required
for construction and assembly of the photosynthetic apparatus .
Modifications in normal isoprenoid biosynthesis are also consistent
with alterations of the outer wall layers (glycocalyx or pili?), as
suggested by the greater fibrous appearance of the outer surface in
the mutant (Fig . 6B and C) . It is likely that these
combined effects result from a deficiency, but not absence, of
isoprenoid biosynthesis .
Under normal photosynthetic conditions the Sll1556 protein is
dispensable: the growth of the mutant culture in mineral medium did
not differ significantly from that of the WT (at the same light
intensity) . It is likely that the cells rely more heavily on an
alternate metabolic path . Differences in metabolite utilization can
depend on the organism's environment . For example, recently Yang et
al . (31) analyzed the fluxes of central metabolites
by monitoring the products from [13C]glucose in
Synechocystis strain PCC 6803 under different conditions . They
found significant differences of the flow through the pentose
phosphate pathway and through the glycolytic path between cells grown
heterotrophically and those grown photomixotrophically .
This brings us back to the presumption of a linear isoprenoid
production pathway via MEP in Synechocystis strain PCC 6803 .
For E . coli there is clear support for the proposed MEP pathway
(14, 17, 18,
19, 20, 30) (Fig.
1) for isoprenoid biosynthesis as mentioned in the
introduction . Both organisms have essential genes for the MEP
pathway . However, as noted above for Synechocystis, the MEP
pathway is not the only pathway of isoprenoid biosynthesis under
photosynthetic growth conditions . It was previously shown that
pentose phosphate cycle substrates lead to isoprenoid biosynthesis (6),
which we confirmed here . Furthermore, our present results with the
sll1556
mutant show that in addition to the pentose phosphate cycle
substrates there may yet be another path to DMAPP biosynthesis, and
perhaps also to IPP synthesis . Although we fully recognize the
essential nature of the MEP pathway for the survival of
Synechocystis strain PCC 6803, our previous and present results
lead us to suggest alternate paths .
These studies of the sll1556 mutant have provided further evidence
to suggest that isoprenoid biosynthesis in this photosynthetic
cyanobacterium is more complex than predicted from E . coli . It
appears that biosynthesis of isoprenoids in this organism is not
linear but involves more than one pool of substrates and probably at
least one alternate path to DMAPP biosynthesis . An alternate route to
DMAPP production from pentose phosphate cycle substrates can be
metabolically advantageous for a photosynthetic organism at optimal
growth conditions where an increased supply of isoprenoids would
enhance thylakoid and cell wall synthesis .
The help of T . Maugul, director of the electron microscope facility,
is greatly appreciated . We are grateful to T . Kuzuyama for providing
the pQCLD41 expression plasmid .
Research was supported by DOE grant no . DE-FG02-98ER20302 .
* Corresponding author . Mailing address: Department of Cell
Biology and Molecular Genetics, Microbiology Building, Campus Dr., University of
Maryland, College Park, MD 20742 . Phone: (301) 405-1649 . Fax: (301) 314-9489 .
E-mail: eg37@umail.umd.edu.
K.P . and Y.V.E . contributed equally to this work .
- Arigoni, D., W . Eisenreich, C . Latzel, S . Sagner, T .
Radykewicz, M . H . Zenk, and A . Bacher. 1999 . Dimethylallyl pyrophosphate
is not the committed precursor of isopentenyl pyrophosphate during terpenoid
biosynthesis from 1-deoxyxylulose in higher plants . Proc . Natl . Acad . Sci . USA
96:1309-1314 .
- Bhaya, D., N . R . Bianco, D . Bryant, and A . Grossman.
2000 . Type IV pilus biogenesis and motility in the cyanobacterium
Synechocystis sp . PCC6803 . Mol . Microbiol . 37:1365-2958.
- Cunningham, F . X., T . P . Lafond, and E . Gantt. 2000 .
Evidence of a role for LytB in the nonmevalonate pathway of isoprenoid
biosynthesis . J . Bacteriol . 182:5841-5848 .
- Eisenreich, W., F . Rohdich, and A . Bacher. 2001 .
Deoxyxylulose phosphate pathway to terpenoids . Trends Plant Sci . 6:78-84.
- Ershov, Y., R . R . Gantt, F . X . Cunningham, and E . Gantt.
2000 . Isopentenyl diphosphate isomerase deficiency in Synechocystis sp .
strain PCC6803 . FEBS Lett . 473:337-340.
- Ershov, Y., R . R . Gantt, F . X . Cunningham, and E . Gantt.
2002 . Isoprenoid biosynthesis in Synechocystis sp . strain PCC6803 is
stimulated by compounds of the pentose phosphate cycle but not by pyruvate or
deoxyxylulose-5-phosphate . J . Bacteriol . 184:5045-5051 .
- Hahn, F . M., A . P . Hurlburt, and C . D . Poulter. 1999 .
Escherichia coli open reading frame 696 is idi, a nonessential gene
encoding isopentenyl diphosphate isomerase . J . Bacteriol . 181:4499-4504 .
- Jürgens, U . J., P . Simonin, and M . Rohmer. 1992 .
Localization and distribution of hopanoids in membrane systems of the
cyanobacterium Synechocystis PCC 6714 . FEMS Microbiol . Lett . 92:285-288.
- Kaneda, K., T . Kuzuyama, M . Takagi, Y . Hayakawa, and H . Seto.
2001 . An unusual isopentenyl diphosphate isomerase found in the mevalonate
pathway gene cluster from Streptomyces sp . strain CL190 . Proc . Natl .
Acad . Sci . USA 98:932-937 .
- Kaneko, T., S . Sato, H . Kotani, A . Tanaka, E . Asamizu, Y .
Nakamura, N . Miyajima, M . Hirosawa, N . Sugiura, S . Sasamoto, T . Kimura, T .
Hosouchi, A . Matsuno, A . Muraki, N . Nakazaki, K . Naruo, S . Okumura, S . Shimpo,
C . Takeuchi, T . Wada, A . Watanabe, M . Yamada, M . Yasuda, and S . Tabata.
1996 . Sequence analysis of the genome of the unicellular cyanobacterium
Synechocystis sp . strain PCC6803 . II . Sequence determination of the entire
genome and assignment of potential protein-coding regions . DNA Res . 3:185-209.
- Kimura, M. 1980 . A simple method for estimating
evolutionary rate of base substitutions through comparative studies of
nucleotide sequences . J . Mol . Evol . 16:111-120.
- Kornberg, A. 1955 . Lactic dehydrogenase of muscle .
Methods Enzymol . 1:441-449.
- Koyama, T., and K . Ogura. 1999 . Isopentenyl diphosphate
isomerase and prenyltransferases, p . 69-96 . In D . Barton and K .
Nakanishi (ed.), Comprehensive natural products chemistry . Elsevier Science
Ltd., Oxford, United Kingdom.
- Kuzuyama, T., and H . Seto. 2003 . Diversity of the
biosynthesis of the isoprene units . Nat . Prod . Rep . 20:171-183.
- Perrière, G., and M . Gouy. 1996 . WWW-Query: an on-line
retrieval system for biological sequence banks . Biochimie 78:364-369.
- Ramos-Valdivia, A . C., R . van der Heijden, and R . Verpoorte.
1997 . Isopentenyl diphosphate isomerase: a core enzyme in isoprenoid
biosynthesis . A review of its biochemistry and function . Nat . Prod . Rep .
14:591-603.
- Rodriguez-Concepción, M., N . Campos, L . M . Lois, C .
Maldonado, J . F . Hoeffler, C . Grosdemange-Billiard, M . Rohmer, and A . Boronat.
2000 . Genetic evidence of branching in the isoprenoid pathway for the
production of isopentenyl diphosphate and dimethylallyl diphosphate in
Escherichia coli . FEBS Lett . 473:328-332.
- Rodriguez-Concepción, M., and A . Boronat. 2002 .
Elucidation of the methylerythritol phosphate pathway for isoprenoid
biosynthesis in bacteria and plastids . A metabolic milestone achieved through
genomics . Plant Physiol . 130:1079-1089.
- Rohdich, F., F . Zepeck, P . Adam, S . Hecht, J . Kaiser, R .
Laupitz, T . Gräwert, S . Amslinger, W . Eisenreich, A . Bacher, and D . Arigoni.
2003 . The deoxyxylulose phosphate pathway of isoprenoid biosynthesis: studies
on the mechanisms of the reactions catalyzed by IspG and IspH protein . Proc .
Natl . Acad . Sci . USA 100:1586-1591 .
- Rohmer, M. 1999 . The discovery of a
mevalonate-independent pathway for isoprenoid biosynthesis in bacteria, algae
and higher plants . Nat . Prod . Rep . 16:565-574.
- Rozen, S., and H . J . Skaletsky. 2000 . Primer3 on the WWW
for general users and for biologist programmers, p . 365-386 In S .
Krawetz and S . Misener (ed.), Bioinformatics methods and protocols: methods in
molecular biology . Humana Press, Totowa, N.J.
- Saitou, N., and M . Nei. 1987 . The neighbor-joining
method: a new method for reconstructing phylogenetic trees . Mol . Biol . Evol.
4:406-425.
- Sambrook, J., E . F . Fritsch, and T . Maniatis. 1989 .
Molecular cloning: a laboratory manual, 2nd ed . Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y.
- Simonin, P., U . J . Jürgens, and M . Rohmer. 1996 .
Bacterial triterpenoids of the hopanes series from the prochlorophytes
Prochlorothrix hollandica and their intercellular localization . Eur . J .
Biochem . 241:865-871.
- Spurgeon, S . L., N . Sathyamoorthy, and J . W . Porter.
1984 . Isopentenyl pyrophosphate and prenyltransferases from tomato fruit and
plastids . Arch . Biochem . Biophys . 230:446-454.
- Steinbacher, S., J . Kaiser, S . Gerhardt, W . Eisenreich, R .
Huber, A . Bacher, and F . Rohdich. 2003 . Crystal structure of the type II
isopentenyl diphosphate:dimethylallyl diphosphate isomerase from Bacillus
subtilis . J . Mol . Biol . 329:973-982.
- Thompson, J . D., T . J . Gibson, F . Plewniak, F . Jeanmougin,
and D . G . Higgins. 1997 . The ClustalX windows interface: flexible
strategies for multiple sequence alignment aided by quality analysis tools .
Nucleic Acids Res . 25:4876-4882 .
- Vaara, T., and M . Vaara. 1988 . Cyanobacterial fimbriae .
Methods Enzymol . 167:189-195.
- Williams, J . G . K. 1988 . Construction of specific
mutations in photosystem II photosynthetic reaction center by genetic
engineering methods in Synechocystis 6803 . Methods Enzymol . 167:766-778.
- Wolff, M., M . Seemann, B . Tse Sum Bui, Y . Frapart, D .
Tritsch, A . G . Estrabot, M . Rodriguez-Concepción, A . Boronat, A . Marquet, and
M . Rohmer. 2003 . Isoprenoid biosynthesis via the methylerythritol
phosphate pathway: the (E)-4-hydroxy-3-methylbut-2-enyl diphosphate reductase
(LytB/IspH) from Escherichia coli is a [4Fe-4S] protein . FEBS Lett .
541:115-120.
- Yang, C., Q . Hua, and K . Shimizu. 2002 . Metabolic flux
analysis in Synechocystis using isotope distribution from 13C-labeled
glucose . Metab . Eng . 4:202-216.
- Yoshimura, H., S . Yoshihara, S . Okamoto, M . Ikeuchi, and M .
Ohmori. 2002 . A camp receptor protein, SYCRP1, is responsible for the cell
motility of Synechocystis sp . PCC6803 . Plant Cell Physiol . 43:460-463 .
- Zelitch, I. 1955 . Glycolic acid oxidase and glyoxylic
acid reductase . Methods Enzymol . 1:528-535.
Free Online Full-text Article
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
|