Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us

Journal of Bacteriology, March 2004, p . 1304-1310, Vol . 186, No . 5

In Vivo Effect of NusB and NusG on rRNA Transcription Antitermination

Martha Torres,1 Joan-Miquel Balada,2 Malcolm Zellars,3 Craig Squires,2 and Catherine L . Squires2*

King Faisal Specialist Hospital and Research Centre, Radiation Biology Laboratory, Biomedical Physics Department, Riyadh 11211, Saudi Arabia,1 Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, Massachusetts 02111,2 Department of Biology, Georgia State University, Atlanta, Georgia 303033

Received 29 August 2003/ Accepted 24 November 2003


 

  ABSTRACT

 
Similarities between lambda and rRNA transcription antitermination have led to suggestions that they involve the same Nus factors. However, direct in vivo confirmation that rRNA antitermination requires all of the lambda Nus factors is lacking . We have therefore analyzed the in vivo role of NusB and NusG in rRNA transcription antitermination and have established that both are essentialfor it . We used a plasmid test system in which reporter genemRNA was measured to monitor rRNA antiterminator-dependent bypassof a Rho-dependent terminator . A comparison of terminator read-throughin a wild-type Escherichia coli strain and that in a nusB::IS10 mutant strain determined the requirement for NusB . In the absence of NusB, antiterminator-dependent terminator read-through was not detected, showing that NusB is necessary for rRNA transcription antitermination . The requirement for NusG was determined bycomparing rRNA antiterminator-dependent terminator read-throughin a strain overexpressing NusG with that in a strain depletedof NusG . In NusG-depleted cells, termination levels were unchangedin the presence or absence of the antiterminator, demonstratingthat NusG, like NusB, is necessary for rRNA transcription antitermination.These results imply that NusB and NusG are likely to be partof an RNA-protein complex formed with RNA polymerase duringtranscription of the rRNA antiterminator sequences that is requiredfor rRNA antiterminator-dependent terminator read-through.


 

  INTRODUCTION

 
All rRNA operons in Escherichia coli have antiterminator sequences in their leader and spacer regions that allow RNA polymerase, modified with protein factors, to transcribe through Rho-dependent terminators of rRNA operons [1, 2, 5, 21] . The identities ofall of the protein factors have not yet been established, butthe RNA sequences required have been determined [5, 37] . TherRNA leader region antiterminator features include a region of dyad symmetry, referred to as boxB, and conserved sequences, boxA and boxC [21] . The spacer regions do not contain the boxCfeature [5] . Studies with an entire rRNA operon on a plasmidshow that leader region boxA mutations result in a 20 to 25%decrease in the amount of 16S and 23S rRNA [14] . Spacer boxA mutations result in an additional 15% decrease of 50S subunits[28] . These studies suggest that as a consequence of improperrRNA transcription antitermination [rRNA-AT], there is an increasein Rho-dependent termination that in turn results in a decreaseof 16S and 23S rRNA . Mutational studies of the three rRNA antiterminator features, boxB, boxA, and boxC, identified boxA as the essentialregion for transcription antitermination and boxA alone as sufficientfor in vivo read-through of Rho-dependent terminators [5] . However,the other conserved features may have as-yet-unidentified functionsin vivo . In addition, the boxA feature by itself stimulatesan increase in the RNA polymerase transcription elongation ratefrom 35 to 65 nucleotides per s on the lacZ gene [38] . Althoughthere is no direct evidence, a relationship between an increasein RNA polymerase transcription elongation rate and terminatorread-through may exist . Interestingly, Nus factors A, B, andG are necessary for the boxA-mediated increase in transcriptionelongation rate [37-39].

Present models suggest that the rRNA antiterminator is a site where RNA polymerase and protein factors interact, resultingin a transcription complex with altered terminator recognitionand altered transcription elongation properties . Possible interactingfactors at the rRNA antiterminator include those required forlambda N/nut antitermination, NusA, NusB, NusE [S10], and NusG,as well as ribosomal protein S4 [22, 38; for reviews, see references9, 10, 27, and 29] . Studies demonstrating a direct role forNusA in rRNA-AT used a nusA cold-sensitive mutant strain andfound rRNA boxA-mediated changes in RNA polymerase activitiesto be defective [38] . In vivo experiments demonstrating faultyrRNA expression in a nusB5 mutant strain also suggest a requirementfor NusB in rRNA transcription [31] . Additionally, in vitro experiments show that rRNA-AT activities fail in a NusB-depleted system [34] . Although a direct role for NusE has not been described,a NusB-NusE heterodimer can bind rRNA boxA in vitro, implicatingNusE in rRNA-AT [23, 25] . NusG, as well as NusB, has been isolatedfrom rRNA antiterminated complexes in vitro [19]; however, there are no experimental data demonstrating the importance of NusG in rRNA-AT in vivo . NusG, an essential cellular protein, isknown to be involved in multiple aspects of transcription, including influencing the activity of some Rho-dependent terminators andbeing required for lambda N/nut antitermination [11, 12, 19,20, 35] . The importance of NusG in Rho-dependent termination has been revealed by studies of the lac operon . There are two intragenic Rho-dependent terminators in lacZ . In the absence of NusG, Rho is virtually inactive at one terminator, whilethe other terminator is not significantly affected [7] . Through interactions between NusG and Rho or RNA polymerase, NusG may modulate either Rho, RNA polymerase, or both to cause terminationor antitermination [8, 19, 20, 35] . These activities of NusGprovide a logical need for its presence in the rRNA-AT system,a system that embraces both antitermination and Rho-dependenttermination.

As described above, several lines of evidence suggest a rolefor all lambda Nus factors in rRNA-AT in E . coli, but up tonow strong support for this suggestion has been lacking in vivo.In this work, we present direct evidence demonstrating an essentialrole for NusB and NusG in rRNA-AT in vivo by using a plasmid-bornereporter gene system to assess the role of these factors interminator bypass . This assessment was done by examining therRNA antiterminator-dependent read-through of a Rho-dependentterminator in the presence and absence of NusB and under conditionsof NusG excess and depletion in vivo . We found that E . colicells with nusB mutations or depleted of NusG had lost the abilityto bypass terminators.


 

  MATERIALS AND METHODS

 
Bacterial strains and plasmids. E . coli MC4100 [araD139 {Delta}[argF-lac]U169 rpsL150 relA1 flbB3501deoC1 ptsF25 rbsR] [33] is the parent strain of the nusB-inactivatedstrain, IQ527 [MC4100 nusB::IS10 zba-525::Tn10] . The nusB mutation is also called ssyB63 [32, 36] . This strain generates larger,faster-growing colonies that have likely lost the insertionelement and must be monitored carefully during use . The constructionof plasmids pSL102, pSL103, pSL115, and pSL133 has been describedpreviously [21] . The pGB2[NusB] plasmid is a pGB2 derivativewith a cloned 2.5-kb fragment containing the nusB gene [13].Plasmids pGB2 and pGB2[NusB] were a gift from D . Friedman . StrainRARNGT [RAR4100 nusG::kn F'[lacIq lacZ::Tn10 proAB+] pNG33]contains an insertion in the nusG gene and the plasmid pNG33,expressing the nusG gene from the arabinose operon promoter,PBAD [30, 39].

mRNA measurements of terminator read-through. Overnight cultures of either MC4100 or IQ527 containing plasmidpSL102, pSL103, or pSL115 were grown at 37°C in Luria-Bertani[LB] medium with ampicillin [100 µg/ml] . These strainscontaining an additional compatible plasmid, pGB2[NusB], weregrown in LB medium with ampicillin [100 µg/ml] and spectinomycin[40 µg/ml] . Cultures were inoculated at an optical densityat 600 nm [OD600] of 0.04 and were grown to an OD600 of 0.6.Total cellular RNA was isolated and subjected to slot blot analysis[39] . For the analysis, triplicate 0.25-µg amounts ofeach sample of denatured total RNA were used . These experimentswere repeated at least three times.

For the NusB experiments, the following end-labeled oligonucleotide probes were used . Probe cat#1 [5' TGCCATTGGGATATATCAACGGTGG3'] is located at nucleotides 26 to 50 of the cat gene coding sequence and was used to detect transcripts beyond the Rho-dependent terminator . Probe bla#1 [5' GGGAATAAGGGCGACACGGAAATG 3'] islocated at nucleotides 13 to 36 of the bla gene coding sequenceand was used to detect bla transcripts . The bla gene transcript was used to correct cat mRNA levels for incomplete cell disruption and possible variations in plasmid copy number [17].

For the NusG experiments, the following end-labeled oligonucleotide probes were used . Probe cat#2 [5' CGAAGCTCGGCGGATTTGTCCTAC 3'] is located before the cat gene . Probe bla#2 [5' GCCCGGCGTCAACACGGGATAATAC 3'] is located downstream of bla#1 at nucleotides 100 to 124of the coding sequence . These new probes were used because pNG33has the cat gene and part of the bla gene . The probes were end-labeled with [{gamma}-32P]ATP [7,000 Ci/mmol; ICN, Costa Mesa, Calif.] andT4 polynucleotide kinase [New England, Biolabs, Beverly, Mass.].The membranes were prehybridized, hybridized, washed accordingto the procedure of Angelini et al . [4], scanned, and quantifiedwith a Storm PhosphorImager [Amersham Biosciences Corp., Piscataway,N.J.] and the Image-Quant program.

Depletion of NusG from the cell. Strain RARNGT containing pSL102, pSL103, or pSL115 was grownovernight at 37°C in LB medium containing 0.2% arabinose,kanamycin [50 µg/ml], and ampicillin [100 µg/ml].Cells were washed in LB medium to remove any arabinose and theninoculated at an OD600 of 0.02 in LB medium containing either0.2% D-fucose, 0.2% D-glucose, kanamycin, and ampicillin [-Ara condition] or 0.2% arabinose, kanamycin, and ampicillin [+Ara condition] . To maintain exponential growth, the cultures werediluted 1:10 after 3 and 5 h with the same fresh media . At 6and 7 h, cultures with arabinose were diluted 1:10 and 1:5,respectively, with fresh media . Cell samples were removed atthe indicated times for RNA preparation and Western analysis.

Western analysis. The protocol described by Bollag and Edelstein [6] was followed.After sampling, cells were spun, resuspended in 3x sodium dodecyl sulfate [SDS]-loading dye, and boiled for 5 to 10 min . Samples prepared from 0.5 x 108 cells were loaded onto an SDS-12% polyacrylamidegel electrophoresis gel and subjected to electrophoresis for45 min at 100 to 200 V . The proteins were then transferred ontoa polyvinylidene difluoride membrane according to the manufacturer'sinstructions [Bio-Rad, Hercules, Calif.] . The membrane was blockedfor 1 h at room temperature by using 5% nonfat dry milk preparedin 1x TBS [30 mM Tris-Cl [pH 7.4], 150 mM NaCl] . A 1:2,000 dilutionof anti-NusG rabbit serum [a generous gift from Barbara Stitt]in blocking solution was added to the membrane . It was incubatedfor 1 h at room temperature and then washed with 1x TBSTT [1xTBS plus 0.05% Tween 20 and 0.2% Triton X-100] three times for10 to 15 min . A 1:10,000 dilution of the secondary antibody,goat anti-rabbit immunoglobulin G conjugated with horseradishperoxidase [Promega, Madison, Wis.] in blocking solution, wasadded to the membrane and incubated for 1 h at room temperature.The membrane was washed as before and then rinsed in 1x TBSfor 5 min . The chemiluminescence substrate [Amersham Life Science,Arlington Heights, Ill.] was incubated with the membrane for1 min, and then the membrane was exposed to X-ray film . To quantitatethe amount of NusG detected in the cell lysates, 12.5, 25, and50 ng of purified NusG were loaded on the same gel . After Westernblotting and developing, the films were scanned with a densitometer[Amersham Biosciences], and the amount of NusG was quantitatedwith the Image-Quant program.


 

  RESULTS

 
The basic protocol followed to measure rRNA-AT activity in the absence of Nus factors B and G was to comparatively examinemRNA transcript levels from three separate plasmid constructs[Fig. 1] . The first construct contained a promoter gene and a reporter gene, the second also contained a terminator, and the third contained the terminator as well as the rRNA-AT sequences. Quantitation of reporter gene mRNA from all three constructsallowed a determination of terminator efficiency or bypass.


 

 FIG . 1 . rRNA antiterminator test system . Details of the construction of these plasmids can be found in a report by Li et al . [21] . Open boxes refer to the cat and bla genes . Arrows indicate the beginning and direction of transcription . Broken lines represent transcripts either starting at the P2 promoter and extending through the cat gene or starting at the bla promoter and extending through the bla gene . The short horizontal bars below the broken lines represent the cat#1 and bla#1 probes used for the NusB studies . The short horizontal double bars represent the cat#2 and bla#2 probes used for the NusG depletion studies . The P2 promoter is from the rrnG operon . Terminators t1 and t1 t2 are from the rrnB operon . pSL103 has an insertion of a Rho-dependent terminator [Rho-ter], a 567-bp HindIII fragment of the 16S rRNA gene from the rrnB operon cloned in the reverse orientation that fortuitously has Rho-dependent termination activity [21] . pSL115 has an insertion of the antiterminator [AT] and the Rho-dependent terminator . The antiterminator is the 67-bp FnuDII-TaqI fragment from the leader region of the rrnG operon located between P2 and the 16S rRNA gene . It contains rRNA boxB, boxA, and boxC sequences [21].

 
In vivo role of NusB in rRNA-AT. Previous measurements of rRNA levels in a nusB5 mutant strainshowed a decrease in 16S and 23S rRNA levels relative to thosein leader region transcripts, and it was concluded that thereduction was due to a defect in transcription antitermination[31] . However, a direct link between antitermination and rRNAlevels was not established . In the present work, we directlyaddressed the role of NusB in antitermination by using a definedrRNA-AT system and examining terminator bypass in the completeabsence of NusB . We used a strain, IQ527, containing an insertionalinactivation of the nusB gene [32, 36] . By Western blot analysis,we confirmed the reported absence of the NusB protein in IQ527[data not shown] . We used this strain and a plasmid-borne reportergene system described previously [2, 5, 21] . Linear representations of the plasmids are shown in Fig . 1 . The cat and bla mRNA levelswere measured for each strain, and cat/bla ratios were determined.The cat/bla mRNA ratio for pSL102 reflects the amount of nonterminatedtranscription and was designated 100% . Rho-dependent terminatorefficiency was determined by comparing the relative cat/blamRNA transcription levels from pSL102 and pSL103 . Likewise,terminator read-through was determined by comparing the cat/blamRNA ratios for pSL103 and pSL115.

We measured the amount of terminator read-through in the nusB::IS10 strain and its parent [MC4100] in the presence or absence ofa plasmid carrying the nusB gene, pGB2[NusB] [13] . In the absenceof NusB, the levels of terminator read-through were very lowand similar with and without the rRNA-AT sequence [3 and 5%, respectively] [Table 1 and Fig . 2; compare P2 [rrnG operon P2promoter]-Ter [a fragment of 16S RNA in the reverse orientationthat contains an efficient Rho-dependent terminator] to P2-AT[a 67-bp fragment from the rrnG leader region containing rRNAantiterminator boxB, boxA, and boxC features]-Ter in the absenceof NusB] . Similarly, the presence or absence of NusB had nosignificant effect on terminator activity [3 or 4% in each case][Table 1] . However, in the presence of NusB and the antiterminator,terminator read-through was restored from 5 to 108% [Table 1]. Because, in the absence of NusB, rRNA-AT-dependent terminatorbypass was abolished, these results directly demonstrate theessential nature of NusB in rRNA-AT in vivo.


 

TABLE 1 . Role of NusB in rRNA-AT

 

 

 FIG . 2 . Effect of nusB inactivation on rRNA-AT . Shown are PhosphorImager scans of two duplicate mRNA slot blot membranes hybridized with either the cat#1 or the bla#1 probe . RNA samples are from strain IQ527 containing either pSL102, pSL103, or pSL115 and either pGB2 [-NusB] or pGB2[NusB] [+NusB] . This figure shows one example of at least three experiments done with these strains . Triplicate amounts of each sample were loaded.

 
In vivo role of NusG in rRNA-AT. To address the question of whether or not NusG is required forrRNA-AT, we used a strain in which NusG could be depleted fromthe cell [35, 39] . The strain used, RARNGT, contains a kanamycin resistance cassette inserted into the chromosomal copy of thenusG gene [35] and carries a plasmid expressing NusG from the arabinose promoter PBAD [39] . Expression of the nusG gene inthese cells requires the presence of arabinose in the media.Cells were isolated after 1 to 9 h of growth and analyzed forthe presence of the NusG protein by Western blot analysis [Fig.3A and B] . As a control, we showed that the addition of arabinosehad no effect on the expression of NusG in the parent strain[RAR4100] of RARNGT [Fig . 3C] . The normal number of NusG moleculesper cell in E . coli is 1 x 104 to 2 x 104 [20] . In our strains,after 1 h of growth in the presence or absence of arabinose,there was approximately 1.5 x 104 molecules of NusG per cell,in good agreement with the level reported previously [Fig . 3A and B].After 3 h of growth in the presence of arabinose, therewas an approximately two- to threefold increase in the amountof NusG [Fig . 3B] . In the absence of arabinose, the cells weredepleted of NusG after 3 h of growth [Fig . 3A] . Quantitationof NusG after 8 or 9 h of growth without arabinose showed thatthere were only 300 to 600 molecules of NusG per cell [quantitationdata not shown] . The PBAD promoter may not be off entirely,even with the addition of glucose and fucose to the medium [seeMaterials and Methods], allowing this basal level of NusG tobe produced.


 

 FIG . 3 . Western blot analysis: depletion or expression of NusG in the cell . Aliquots of culture were removed at the indicated time, and an extract of 0.5 x 108 lysed cells was loaded on an SDS-polyacrylamide gel electrophoresis gel . Included on the gel were 12.5, 25, and 50 ng of a NusG standard . Quantitation of the NusG standard on a densitometer verified that these levels were in the linear range of the film used . At least three independent blots were used to quantitate the amount of NusG expressed at 1 h . [A] Example of a gel showing depletion of NusG up to 9 h of growth in the absence of arabinose . [B] Example of a gel showing depletion of NusG up to 9 h of growth in the presence of arabinose . [C] Control experiment with wild-type [RAR4100] and nusG::kn strain [RARNGT] cells in the presence or absence of arabinose.

 
Because NusG plays a role in both Rho-dependent terminationand antitermination, we anticipated that NusG depletion mighthave a deleterious effect on the efficiency of the particularterminator used in our system, similar to the results seen withone of the intragenic Rho-dependent terminators in lacZ [7]. The levels of cat/bla mRNA for P2-Ter were measured in the presence of arabinose and at timed intervals after arabinose removal. The results were normalized to mRNA levels from the plasmid containing only P2 and are shown in Table 2 . In the presence of arabinose and with a two- to threefold increase in NusG, terminator read-through went from 14% at 1 h to 5% at 9 h [Table 2, P2-Ter, +Ara] . When the cells grew in the absence of arabinoseand NusG was depleted, terminator read-through followed the opposite trend, going from 12 to 31% [Table 2, P2-Ter, -Ara].These results indicate that NusG was needed for the maximal efficiency of this Rho-dependent terminator, but considerable termination still occurred when it was depleted.


 

TABLE 2 . Effect of NusG depletion on termination and antitermination

 
When the rRNA-AT sequences were added to the plasmid system,there was no difference between the resulting system [P2-AT-Ter]and P2-Ter . After 9 h without arabinose, terminator read-throughlevels were similar for the two constructs, 31 and 33%, respectively[Table 2] . However, in the presence of NusG, terminator read-through remained efficient . These results indicate that when NusG was depleted, the rRNA-AT system was completely unable to facilitate terminator bypass . From these data, we conclude that the rRNA-AT system is dependent on the presence of NusG for its activity.


 

  DISCUSSION

 
Role of NusB in ribosomal antitermination. Nuclear magnetic resonance experiments indicate that the N terminusof NusB likely functions as an rRNA boxA RNA-binding motif,suggesting that NusB may be an important link between the rRNAantiterminator and other factors in forming a stable transcriptionantitermination complex [3, 15] . Previous studies of rRNA expressionin a nusB5 mutant strain of E . coli demonstrated that wild-typeNusB protein was necessary to obtain usual levels of rRNA products[31] . However, direct in vivo demonstration of NusB activityin a defined rRNA-AT system has not previously been described.Using a strain with an insertional disruption of the nusB gene,we showed that rRNA-AT-dependent antitermination of a Rho-dependentterminator did not occur unless NusB was supplied to the cell.Although the nusB::IS10 strain has a prolonged doubling time,is cold sensitive, and has a diminished peptide elongation rate,the fact that it is viable demonstrates that a fully functionaltranscription antitermination system in rrn operons is not requiredfor cell viability [32, 36] . The mechanistic interactions ofNusB resulting in antitermination are unknown . However, becauseNusB and NusE have been shown to bind to rRNA boxA in vitroand NusE has been shown to bind to RNA polymerase, the RNA-NusB/NusE subcomplex may interact with RNA polymerase and other factorsto stabilize a transcription complex that is resistant to Rho-dependent terminators [19, 25, 26].

Role of NusG in ribosomal antitermination. A role for NusG in antitermination was previously suggestedby the identification of NusG in complexes formed in vitro ontemplates containing rRNA boxA [19]; however, no previous invivo experiments to address the requirement for NusG in rRNA-AThave been reported . We showed here that the presence of NusGis crucial for forming a functional rRNA-AT complex.

How NusG functions in rRNA-AT is not clear . Li et al . [19, 20]have suggested a model to explain the function of NusG in Rho-dependentantitermination in the lambda N/nut system . In this model, NusGinteracts with RNA polymerase in the presence of the other antiterminationfactors and the nut sequence . Because NusG also binds to Rho[20], there is a high probability of transcript-bound Rho interactingwith an antiterminating RNA polymerase containing NusG . Thisinteraction could inhibit the translocation of Rho 5' to 3'along the transcript and therefore inhibit Rho-mediated termination,permitting RNA polymerase to continue transcribing [20, 24]. Because rRNA-AT works efficiently to suppress Rho-dependent terminators [2], by analogy to the lambda model, NusG may also serve to inhibit Rho-dependent termination in the rRNA-AT system by interfering with Rho's termination activity.

Nus factors are required for increased transcription elongation rates and rRNA-AT. It is now clear that the modified RNA polymerase capable ofantitermination requires many of the same factors for terminator read-through and for increasing transcription speed . Vogel and Jensen [37] found that the transcription elongation rate of RNA polymerase increases from 45 to 65 nucleotides per s inthe presence of rRNA boxA . They also found that this increaseis dependent upon NusA and that NusA is required for terminator read-through [38] . Zellars and Squires [39] found that NusBand NusG also increase the rate of transcription elongationin an rRNA boxA-dependent fashion . NusB increases the transcriptionelongation rate from 26 to 66 nucleotides per s, and NusG increasesthe rate from 37 to 66 nucleotides per s . The requirement ofNus factors for both rRNA-AT and the increased transcriptionelongation rate suggest that these two processes are intrinsicallyrelated . The speed at which the antiterminated RNA polymerasetranscribes a terminator region may dictate how easily Rho canmediate termination . A model that relates both the read-through of a Rho-dependent terminator and an increase in the transcription elongation rate is supported by experiments studying RNA polymerase mutants with low and high transcription elongation rates and Rho mutants . Jin et al . [16] showed that a mutant RNA polymerasewith a reduced transcription elongation rate can suppress aspecific mutant Rho . They suggested that the ability of Rho to terminate is dependent upon the transcription speed of RNA polymerase . This hypothesis can be applied to rRNA-antiterminatedRNA polymerases, whose increased rate of elongation may facilitate transcription through Rho-dependent terminators in the rRNAoperons.

It is interesting that terminator read-through and an increased RNA polymerase transcription elongation rate may reveal separate facets of the same process . It is possible that the transcription elongation rate of an antiterminated RNA polymerase directlyaffects the level of terminator read-through, although thispossibility has not been directly examined . An increase in thetranscription elongation rate may be necessary for the synchronizationof proper folding of the rRNA as it is being transcribed andthe assembly process of the ribosomal subunits . Lewicki et al.[18] showed that an RNA polymerase with a very high transcription elongation rate, such as T7 RNA polymerase that transcribesfive times faster than E . coli RNA polymerase, results in the formation of inactive ribosomes . These investigators suggestedthat the very rapid transcription of rRNA by T7 RNA polymeraseuncouples the delicate relationship between transcription andribosomal assembly [18] . This result raises the possibility that the twofold antiterminator-dependent increase in the transcription elongation rate is necessary for the proper folding of the rRNA and the subsequent assembly of the ribosomal subunits [38, 40].

 


 

  ACKNOWLEDGMENTS

 
We thank David Friedman for the nusB-containing plasmids, Barbara Stitt for purified NusG protein and antibodies to NusG, andMax Gottesman for the nusG mutant strain SS287 . We are gratefulto Ciaran Condon and Boris Belitsky for helpful comments aboutthe manuscript.

National Institutes of Health grant GM24751 to C.L.S . supported this work.


 

  FOOTNOTES

 
* Corresponding author . Mailing address: Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA 02111 . Phone: [617] 636-6947 . Fax: [617] 636-0337 . E-mail: cathy.squires@tufts.edu.

 


 

  REFERENCES

 

  1. Aksoy, S., C . L . Squires, and C . Squires. 1984 . Evidence for antitermination in Escherichia coli rRNA transcription . J . Bacteriol . 159:260-264.
  2. Albrechtsen, B., C . L . Squires, S . Li, and C . Squires. 1990 . Antitermination of characterized transcriptional terminators by the Escherichia coli rrnG leader region . J . Mol . Biol . 213:123-134.
  3. Altieri, A . S., M . J . Mazzulla, H . Zhou, N . Costantino, D . L . Court, and R . A . Byrd. 1997 . Sequential assignments and secondary structure of the RNA-binding transcriptional regulator NusB . FEBS Lett . 415:221-226.
  4. Angelini, G., N . Tanigaki, R . Tosi, and G . B . Ferrara. 1986 . Southern blot and microfingerprinting analysis of two DR7 haplotypes . Immunogenetics 24:63-67.
  5. Berg, K., C . Squires, and C . L . Squires. 1989 . Ribosomal RNA operon antitermination . Function of leader and spacer region boxB-boxA sequences and their conservation in diverse micro-organisms . J . Mol . Biol . 209:345-358.
  6. Bollag, D . M., and S . J . Edelstein. 1991 . Protein methods, p . 181-211 . Wiley-Liss, Inc., New York, N.Y.
  7. Burns, C . M., and J . P . Richardson. 1995 . NusG is required to overcome a kinetic limitation to Rho function at an intragenic terminator . Proc . Natl . Acad . Sci . USA 92:4738-4742.
  8. Burns, C . M., L . V . Richardson, and J . P . Richardson. 1998 . Combinatorial effects of NusA and NusG on transcription elongation and Rho-dependent termination in Escherichia coli . J . Mol . Biol . 278:307-316.
  9. Das, A. 1992 . How the phage lambda N gene product suppresses transcription termination: communication of RNA polymerase with regulatory proteins mediated by signals in nascent RNA . J . Bacteriol . 174:6711-6716.
  10. Das, A. 1993 . Control of transcription termination by RNA-binding proteins . Annu . Rev . Biochem . 62:893-930.
  11. DeVito, J., and A . Das. 1994 . Control of transcription processivity in phage {lambda}: Nus factors strengthen the termination resistant state of RNA polymerase induced by N antiterminator . Proc . Natl . Acad . Sci . USA 91:8660-8664.
  12. Downing, W . L., S . L . Sullivan, M . E . Gottesman, and P . O . Dennis. 1990 . Sequence and transcriptional pattern of the essential E . coli secE-nusG operon . J . Bacteriol . 172:1621-1627.
  13. Friedman, D., E . Olson, L . Johnson, D . Alessi, and M . Craven. 1990 . Transcription-dependent competition for a host factor: the function and optimal sequence of the phage boxA transcription antitermination signal . Genes Dev . 4:2210-2222.
  14. Heinrich, T., C . Condon, T . Pfeiffer, and R . K . Hartmann. 1995 . Point mutations in the leader boxA of a plasmid-encoded Escherichia coli rrnB operon cause defective antitermination in vivo . J . Bacteriol . 177:3793-3800.
  15. Huenges, M., C . Rolz, R . Gschwind, R . Peteranderl, F . Berglechner, G . Richter, A . Bacher, H . Kessler, and G . Gemmecker. 1998 . Solution structure of the antitermination protein NusB of Escherichia coli: a novel all-helical fold for an RNA-binding protein . EMBO J . 17:4092-4100 .
  16. Jin, D . J., R . R . Burgess, J . P . Richardson, and C . A . Gross. 1992 . Termination efficiency at rho-dependent terminators depends on kinetic coupling between RNA polymerase and rho . Proc . Natl . Acad . Sci . USA 89:1453-1457.
  17. Klotsky, R . A., and I . Schwartz. 1987 . Measurement of cat expression from growth-rate-regulated promoters employing beta-lactamase activity as an indicator of plasmid copy number . Gene 55:141-146.
  18. Lewicki, B . T . U., T . Margus, J . Remme, and K . H . Nierhaus. 1993 . Coupling of rRNA transcription and ribosome assembly in vivo: formation of active ribosomal subunits in Escherichia coli requires transcription of rRNA genes by host RNA polymerase which cannot be replaced by bacteriophage T7 RNA polymerase . J . Mol . Biol . 231:581-593.
  19. Li, J., R . Horwitz, S . McCracken, and J . Greenblatt. 1992 . NusG, a new E . coli elongation factor required for processive antitermination of transcription by the N protein of phage {lambda} . J . Biol . Chem . 267:6012-6019 .
  20. Li, J., S . W . Mason, and J . Greenblatt. 1993 . Elongation factor NusG interacts with termination factor {rho} to regulate termination and antitermination of transcription . Genes Dev . 7:161-172.
  21. Li, S., C . L . Squires, and C . Squires. 1984 . Antitermination of E . coli rRNA transcription is caused by a control region segment containing lambda nut-like sequences . Cell 38:851-860.
  22. Mason, S . W., and J . Greenblatt. 1991 . Assembly of transcription elongation complexes containing the N protein of phage lambda and the Escherichia coli elongation factors NusA, NusB, NusG, and S10 . Genes Dev . 5:1504-1512.
  23. Mason, S . W., J . Li, and J . Greenblatt. 1992 . Direct interaction between two Escherichia coli transcription antitermination factors, NusB and ribosomal protein S10 . J . Mol . Biol . 223:555-566.
  24. Nehrke, K . W., and T . Platt. 1994 . A quaternary transcription termination complex . Reciprocal stabilization by Rho factor and NusG protein . J . Mol . Biol . 243:830-839.
  25. Nodwell, J . R., and J . Greenblatt. 1993 . Recognition of boxA antiterminator RNA by the E . coli antitermination factors NusB and ribosomal protein S10 . Cell 72:261-268.
  26. Nudler, E., E . Avetissova, V . Markovtsov, and A . Goldfarb. 1996 . Transcription processivity: protein-DNA interactions holding together the elongation complex . Science 273:211-217.
  27. Nudler, E., and M . E . Gottesman. 2002 . Transcription termination and anti-termination in E . coli . Genes Cells 7:755-768 .
  28. Pfeiffer, T., and R . K . Hartmann. 1997 . Role of the spacer boxA of Escherichia coli ribosomal RNA operons in efficient 23S rRNA synthesis in vivo. J . Mol . Biol . 265:385-393.
  29. Roberts, J . W. 1993 . RNA and protein elements of E . coli and {lambda} transcription antitermination complexes . Cell 72:653-655.
  30. Sambrook, J., E . F . Fritsch, and T . Maniatis. 1989 . Molecular cloning, 2nd ed., p . 7.76 . Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  31. Sharrock, R . A., R . L . Gourse, and M . Nomura. 1985 . Defective antitermination of rRNA transcription and de-repression of rRNA and tRNA synthesis in the nusB5 mutant of Escherichia coli. Proc . Natl . Acad . Sci . USA 82:5275-5279.
  32. Shiba, K., K . Ito, and T . Yura. 1986 . Suppressors of the secY24 mutation: identification and characterization of additional ssy genes in Escherichia coli . J . Bacteriol . 166:849-856.
  33. Silhavy, T . J., M . L . Berman, and L . W . Enquist. 1984 . Experiments with gene fusions . Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  34. Squires, C . L., J . Greenblatt, J . Li, C . Condon, and C . Squires. 1993 . Ribosomal RNA antitermination in vitro: requirement for Nus factors and one or more unidentified cellular components . Proc . Natl . Acad . Sci . USA 90:970-974.
  35. Sullivan, S . L., and M . Gottesman. 1992 . Requirement for E . coli NusG protein in factor-dependent transcription termination . Cell 68:989-994.
  36. Taura, T., C . Ueguchi, K . Shiba, and K . Ito. 1992 . Insertional disruption of the nusB [ssyB] gene leads to cold-sensitive growth of Escherichia coli and suppression of the secY24 mutation . Mol . Gen . Genet . 234:429-432.
  37. Vogel, U., and K . F . Jensen. 1995 . Effects of the antiterminator BoxA on transcription elongation kinetics and ppGpp inhibition of transcription elongation in Escherichia coli . J . Biol . Chem . 270:18335-18340 .
  38. Vogel, U., and K . F . Jensen. 1997 . NusA is required for ribosomal antitermination and for modulation of the transcription elongation rate of both antiterminated RNA and mRNA . J . Biol . Chem . 272:12265-12271 .
  39. Zellars, M., and C . Squires. 1999 . Antiterminator-dependent modulation of transcription elongation rates by NusB and NusG . Mol . Microbiol . 32:1296-1304.
  40. Zhou, Y., J . J . Filter, D . L . Court, M . E . Gottesman, and D . I . Friedman. 2002 . Requirement for NusG for transcription antitermination in vivo by the lambda N protein . J . Bacteriol . 184:3416-3418 .

 

 

Free Online Full-text Article

 

What Is Rhizobia?, What Is Growth Medium?, What Is Botulism?, What Is Genetic Engineering?, What Is Genetics?, c, Microorganisms, o, Microbe, s, Microbes, r, Bacteriology, n, Bacteria, r, Nitrifying, c, Yeasts, i, Antibiotics, s, Escherichia coli, e, Cell suspensions, r, Petri dish, c, Escherichia coli, r, Escherichia coli, s, Escherichia coli, c, Escherichia coli, c, Brevibacteria, e, Staphylococcus aureus, s, Yeasts, c, Microflora, n, Gram negative, n, Salmonella, i, Antibiotic treatment, r, Escherichia coli, a, Escherichia coli, s, Cholera, e, Microorganism




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005