Journal of Bacteriology, March 2004, p . 1409-1414, Vol . 186, No . 5

A Dominant-Negative fur Mutation in Bradyrhizobium japonicum

Heather P . Benson,¹ Kristin LeVier,² and Mary Lou Guerinot^1*

Department of Biological Sciences, Dartmouth College, Hanover, New Hampshire 03755,¹ Pfizer Co., Ann Arbor, Michigan 48105²

Received 13 August 2003/ Accepted 14 November 2003

 
In many bacteria, the ferric uptake regulator [Fur] proteinplays a central role in the regulation of iron uptake genes.Because iron figures prominently in the agriculturally importantsymbiosis between soybean and its nitrogen-fixing endosymbiontBradyrhizobium japonicum, we wanted to assess the role of Furin the interaction . We identified a fur mutant by selectingfor manganese resistance . Manganese interacts with the Fur proteinand represses iron uptake genes . In the presence of high levelsof manganese, bacteria with a wild-type copy of the fur gene repress iron uptake systems and starve for iron, whereas fur mutants fail to repress iron uptake systems and survive . TheB . japonicum fur mutant, as expected, fails to repress iron-regulated outer membrane proteins in the presence of iron . Unexpectedly, a wild-type copy of the fur gene cannot complement the fur mutant. Expression of the fur mutant allele in wild-type cells leads to a fur phenotype . Unlike a B . japonicum fur-null mutant, thestrain carrying the dominant-negative fur mutation is unableto form functional, nitrogen-fixing nodules on soybean, mung bean, or cowpea, suggesting a role for a Fur-regulated protein or proteins in the symbiosis.

 
Rhizobia live in the soil or engage in symbiosis with a suitable legume . Each environment presents unique challenges with respectto iron acquisition . As free-living soil microorganisms, rhizobiamust have a way to solubilize iron as well as a way to competefor this nutrient with other organisms present in the rhizosphere.As endosymbionts, rhizobia must have mechanisms for acquiringiron from the host plant.

In many microbes, including various species of rhizobia, iron deficiency induces a variety of high-affinity iron uptake systems that are involved in the solubilization and sequestration ofFe[III] [6] . These systems are composed of siderophores, high-affinity Fe[III] chelators that are released by cells to scavenge Fe[III], and their specific uptake systems . In gram-negative bacteria, siderophore uptake requires a TonB-dependent outer membraneprotein, a periplasmic binding protein, and a cytoplasmic membraneATP-binding cassette [ABC] transporter system . Both siderophorebiosynthetic genes and the genes for Fe[III]-siderophore uptakesystems are only expressed under iron-limiting conditions andhave been shown to be negatively controlled by the Fur repressorprotein [reviewed in reference 16] . Fur regulation appears tobe highly conserved among most bacterial species . fur geneshave been identified in numerous gram-positive or gram-negativebacteria, including Bradyrhizobium japonicum [14] and Rhizobiumleguminosarum [5].

Although originally identified as a repressor of iron transport and siderophore biosynthesis, fur has also been reported to regulate genes involved in a wide variety of functions, including oxidative stress, energy metabolism, and virulence, suggestingthat defects in Fur regulation could have serious consequencesfor a microorganism [16] . Indeed, attempts to obtain fur mutantsby gene replacement have been unsuccessful in a number of species,including Pseudomonas aeruginosa [33], Neisseria gonorrhoeae[4], and Vibrio anguillarum [39] . However, it is possible to select for fur mutants by using manganese [8, 17, 24, 27] . Manganese mimics iron by binding to the Fur protein and repressing iron uptake genes . As a result, bacteria with a wild-type copy ofthe fur gene repress iron uptake systems and starve for ironin the presence of manganese, whereas fur mutants fail to repress iron uptake systems and survive . The Fur protein from such mutantsis thought to retain some function, which is why this particularclass of mutations is not lethal.

Here we report on a fur mutant of B . japonicum selected for resistance to manganese and contrast its symbiotic phenotype with that of a B . japonicum fur-null mutant that had previously been shown to be derepressed for iron uptake in culture [14]. The fur-null mutant forms an effective symbiosis, whereas the manganese-resistant fur mutant strain is unable to form functional, nitrogen-fixing nodules on soybean, mung bean, or cowpea, suggesting a role for a Fur-regulated protein or proteins in the symbiosis.

 
Materials. Restriction enzymes and the Klenow fragment of DNA polymerasewere purchased from New England Biolabs [Beverly, Mass] . AmpliTaq DNA polymerase was obtained from Perkin-Elmer [Foster City,Calif.] . T4 DNA ligase and calf intestinal alkaline phosphatase[CIAP] were purchased from GIBCO-BRL [Gaithersburg, Md.] . Allother chemicals were purchased from Sigma Chemical Co . [St. Louis . Mo.] unless otherwise stated.

Strains, plasmids, bacteria, phage, and bacterial growth conditions. All strains and plasmids used in this study are listed in Table 1 . Escherichia coli cultures were grown in Luria-Bertani brothat 37°C supplemented with ampicillin at 50 µg/ml, tetracycline at 20 µg/ml, or kanamycin at 30 µg/mlwhen necessary . E . coli cells grown for phage lambda platingwere supplemented with maltose [0.2% final concentration] andMgSO₄ [10 mM final concentration], and phage infections wereperformed by standard procedures [2] . B . japonicum cells were grown at 30°C in arabinose-gluconate [AG] medium [34], yeastextract-mannitol [YEM] [41], or minimal medium [12] . Media weresupplemented with 40 mM MnCl₂, 200-µg/ml tetracycline,or 30-µg/ml rifampin as needed . The pH of both YEM andminimal medium was adjusted to 6.8 before autoclaving . Cellswere cultured initially in YEM or AG medium and then dilutedinto iron-free minimal medium . After 1 cycle of growth in minimalmedium, cells were again diluted into iron-free minimal medium.Precautions were taken to minimize the iron content of boththe culture vessels and the medium . Glassware was washed with 1 N HCl and then rinsed with double-distilled water . Plasmids were transferred to B . japonicum by using the helper plasmid pRK2013 [7].

 
Cloning the fur gene. Degenerate primers Rfur1 [GA[A/G]GA[T/C]CA[T/C]CCIGA[T/C]GTIGA]and Rfur3rev [TCIATIA[A/G][A/G]TG[A/G]TC[A/G]TG[A/G]TG] wereconstructed to conserved regions of the fur gene . A fragmentof 157 bp was amplified and cloned into pBluescriptSK- . Thefragment was used as a probe to screen a Lambda Zap II genomiclibrary of B . japonicum 61A152 . The library was constructedby digesting genomic DNA with Tsp509 and then cloning the DNAfragments into an EcoRI site of the Zap II lambda vector [Stratagene].A full-length copy of the fur gene was isolated from the libraryand sequenced . The mutant copy of the fur gene was PCR amplifiedfrom genomic DNA by using HLPfor [CGTGACTTGTCGTAACATTG] andHLPrev [CGACAGGAGATCACCTCGCTGT] primers . In order to isolateDNA sequence upstream of the fur gene carried by the Mn^r mutant, a subgenomic DNA library was constructed . Genomic DNA from theMn^r mutant was isolated and digested with EcoRI and subclonedinto CIAP-treated pBluescriptSK+ . Probing colony lifts witha wild-type fur gene isolated a clone of 2.5 kb that containedthe fur gene from the Mn^r mutant.

Selection for Mn^r Mutants. Manganese selection was based on the protocol of Hantke [17],with the following modifications . Minimal medium with 15 g ofagar per liter was used . Mannitol [0.2%], dipyridyl [0.1 mM],and various concentrations of MnCl₂ were added as filter-sterilized stocks after autoclaving . Wild-type B . japonicum cells were diluted in 0.1% Tween 80 and spread plated onto selective plates containing 40 mM MnCl₂ . Growth of wild-type 61A152 cells was completely inhibited by 40 mM MnCl₂ . Only fresh plates were used as described by Silver et al . [35].

Protein preparation and SDS-PAGE. Outer membrane proteins [OMPs] were isolated as described byLeVier and Guerinot [25] . Twenty-five micrograms of proteinper lane was run on 8.6% polyacrylamide sodium dodecyl sulfate-polyacrylamidegel electrophoresis [SDS-PAGE] gels for separation of OMPs.Fifteen percent polyacrylamide SDS-PAGE gels were used to separatetotal bacterial proteins for Fur Western blots . Total bacterialprotein was isolated from mid-log-phase cultures, and 1 ml ofculture was pelleted and resuspended in 1x sample buffer andboiled for 5 min . All gels were run with the following running buffer: 3.03 g of Tris, 14.26 g of glycine, and 1 g of SDS per liter [pH 8.3], at 200 V with prestained protein molecular weight standards [Bio-Rad or GIBCO-BRL] . After electrophoresis, gelswere stained with Coomassie blue, destained, photographed, andstored between sheets of cellophane [Ann Arbor Plastics, Inc.,Ann Arbor, Mich.] . Protein concentrations were determined withthe bicinchoninic acid assay [Pierce, Rockford, Ill.] usingbovine serum albumin as a standard.

Immunoblotting. Electrophoretic transfer of proteins to polyvinylidene difluoridemembrane [0.45-µm pore size; Gelman Sciences, Ann Arbor,Mich.] was performed according to the manufacturer's instructions.The transfer was performed at constant voltage [20 V] for 25min, using a semidry electroblotting device [Bio-Rad, Hercules,Calif.] . After completion of the transfer, the blots were blockedin phosphate-buffered saline-Tween [PBST] with 5% nonfat drymilk, incubated overnight at 4°C with rabbit immunoglobulinG polyclonal antibodies directed against the E . coli Fur protein,and processed for detection with horseradish peroxidase-conjugatedgoat antirabbit secondary antibodies from the NEN chemiluminescencekit [NEN, Boston, Mass.].

Elemental analysis. Wild-type B . japonicum 61A152 and the Mn^r mutant strain weregrown in YEM medium and then diluted 1:100 into iron-free minimalmedium . After 1 cycle of growth, the cells were again diluted1:100 into either iron-free minimal medium or minimal mediumsupplemented with iron . Cells were pelleted, and the proteinconcentration was determined . Three hundred micrograms of cellularprotein was dried and then digested in HNO₃, and elemental analysisby inductively coupled plasma spectrometry [ICP] was performedwith an inductively coupled plasma atomic emission spectroscope[Vista; Varian] . The analysis was performed at The Scripps ResearchInstitute . Yttrium was used as an internal standard.

H₂O₂ sensitivity assays. Bacteria were grown to mid-log phase in AG medium . Cells [100µl] were spread plated onto AG plates, AG plates supplementedwith 40 mM MnCl₂, or AG plates supplemented with 50 µgof tetracycline per ml for the transconjugants . Sterile 0.5-in.filters [no . 740-E; Schleicher & Schuell] were impregnatedwith 10 µl of 3% H₂O₂ and placed in the center of theplates, and zones of inhibition were recorded after 4 days ofgrowth at 30°C.

Plant assays. Glycine max soybeans [yellow butterbeans; Johnny's SelectedSeeds, Albion, Maine], mung bean [Vermont Bean Seed Co., FairHaven, Vt.], and cowpea [Pea Brown Crowder Miss Silver; VermontBean Seed Co.] seeds were inoculated with B . japonicum strain61A152, the Mn^r mutant, strain I110, or GEM4 as described byGuerinot and Chlem [11] . Soybeans, cowpea, and mung bean plantswere grown in modified Leonard jars with N-free medium . Soybeanswere placed in a greenhouse with supplemental lighting . Cowpeaand mung bean were grown in growth chambers at a temperaturerange of 25 to 28°C . Soybean plants were harvested 4, 5,6, 7, and 8 weeks after germination . Mung bean and cowpea plantswere harvested 5, 6, and 7 weeks postgermination . At each timepoint, the shoots and roots were separated, and the fresh weightof the shoots was determined . Acetylene reduction assays were conducted as described by Guerinot and Chelm [11] . Chlorophyllextraction assays were performed with fresh leaf tissue . Theprotocol was adapted from Liscum et al . [26] . Briefly, 0.1 gof fresh leaf tissue was collected, ethanol was added, and thetissue was ground, vortexed, and centrifuged . This extraction was repeated, the isolated supernatants were combined with ethanol and acetone, and the A₆₆₄ and A₆₄₇ were measured . Total chlorophyllwas determined as described by Grann and Ort [10].

Nucleotide sequence accession number. The nucleotide sequence of the B . japonicum 61A152 fur genehas been deposited in GenBank under accession no. AY357585.

 
Isolation of the fur mutant. An Mn^r strain of B . japonicum strain 61A152 was isolated onAG medium supplemented with 40 mM MnCl₂ . [Wild-type B . japonicum is unable to grow on 20 mM MnCl₂.] In order to verify that this strain of B . japonicum contained a mutation in the fur gene, it was necessary to clone and sequence both the wild-type fur gene and the fur gene from the Mn^r strain . We cloned the furgene of B . japonicum strain 61A152 by degenerate PCR . The furDNA fragment was then used as a probe to screen a lambda ZapII genomic library of B . japonicum 61A152 . The mutant fur genewas isolated by creating a subgenomic library of the Mn^r mutantand using the wild-type fur gene as a probe.

Figure 1 shows the amino acid alignment of the wild-type furprotein from B . japonicum 61A152 and the proteins from the manganese-resistantfur mutant and B . japonicum I110 . There are 18 amino acid changesin the mutant fur protein relative to wild type; of these, 9are conserved substitutions . Single point mutations and smallinsertions have been reported for other manganese-resistantfur mutants . Funahashi et al . [8] isolated Mn^r fur mutants in Vibrio parahaemolyticus and identified four different point mutations that caused amino acid changes and altered protein function . Lam et al . [24] described point mutations and a smallinsertion in the Mn^r fur gene of V . cholerae; the mutants containa single point mutation in either of the conserved regions,the iron-binding domain or the helix-turn-helix domain, resultingin a nonfunctional Fur protein . Our mutant fur allele has manyamino acid changes, yet the putative iron-binding domain andthe helix-turn-helix domains are intact . The majority of themutations are clustered at the N- and C-terminal regions ofthe protein . Due to the number and variety of mutations in theB . japonicum fur gene carried by the Mn^r mutant, the rrn andsdh genes from the mutant were PCR amplified and sequenced todetermine if other genes were also mutated in this strain . Therrn and sdh gene sequences were identical to wild-type sequences,suggesting that it is unlikely that we have isolated a mutatorstrain.

 
Characterization of a dominant-negative allele of fur from B . japonicum 61A152. In order to begin characterization of the fur mutant, a wild-typeclone of the fur gene was moved into the fur mutant by triparentalmating . We anticipated that the plasmid-borne fur gene wouldcomplement the mutant and restore sensitivity to manganese.However, the resulting colonies were manganese resistant, indicatingthat the mutation may be dominant negative . To determine ifthe mutation was indeed dominant negative, the reciprocal experimentwas performed . We introduced a copy of the mutant fur gene intothe wild-type B . japonicum 61A152 strain and scored for manganeseresistance . The resulting transconjugants were manganese resistant,suggesting that the mutant allele of the fur gene is dominantnegative . In order to show that the mutated plasmid copy ofthe fur gene had not undergone further changes, the plasmidwas prepared from B . japonicum 61A152 and used to transformE . coli DH5 cells . The plasmid copy of the fur gene was thensequenced . There were no additional mutations or reversionsin the plasmid copy of the mutant fur gene [data not shown].

The fact that the fur allele from the mutant is dominant over the wild-type allele suggests that the Fur protein must be expressed. In order to demonstrate this, we performed a Western blot with anti-E . coli Fur serum . Total cellular protein was extracted from B . japonicum 61A152, the MLG100 fur mutant, and wild-type 61A152 carrying the Mn^r fur gene on a plasmid, as well as proteinfrom the wild type and a fur deletion mutant in E . coli as positiveand negative controls . As expected, Fur is expressed in thewild-type E . coli and is absent in the deletion strain . Furis also expressed in the Mn^r fur mutant [data not shown].

Deregulation of the iron-regulated OMPs. Having verified that the Mn^r mutant did indeed carry a mutantversion of the fur gene, we went on to examine some of the phenotypes normally associated with fur mutants . Wild-type B . japonicum and MLG100 were grown under iron-deficient and iron-sufficient conditions, and OMPs were isolated . The wild-type strain expresses certain OMPs only under iron-deficient growth conditions [Fig. 2] . In MLG100, however, the OMPs are expressed under iron-sufficientand iron-deficient growth conditions, suggesting that the mutationin fur is causing the deregulation of the OMPs . Under iron-sufficientconditions, the wild-type strain of B . japonicum carrying theplasmid-borne Mn^r fur allele also shows deregulation of theOMPs . One of the iron-regulated OMPs in B . japonicum 61A152is a putative heme receptor with 60% similarity to hmuR [Fig.2, 61A3] . In the manganese-resistant fur mutant, the putativeheme receptor, like the other iron-regulated OMPs, is deregulated, suggesting that fur is regulating expression of this gene . Nienaber et al . [30] had previously reported that expression of hmuR,the gene encoding the outer membrane receptor for heme, wasnot deregulated in a fur-null mutant . However, their resultsare based on an hmuR-lacZ fusion; protein levels were not examined.Wexler et al . [43] reported that both a tonB-lacZ fusion andan hmuS-lacZ fusion are iron regulated, but that these genesare not regulated by fur in R . leguminosarum . Instead, thesegenes are thought to be regulated by RirA . Interestingly, thereis no RirA homolg in B . japonicum.

 
Oxidative stress. E . coli and P . aeruginosa fur mutants have been shown to bemore sensitive to oxidative stress, presumably due to an increasein intracellular iron [18, 31] . In order to test sensitivityto oxidative stress, cultures of wild-type and mutant B . japonicumstrains were grown and spread plated, and filters with eithersterile, distilled water or 3% H₂O₂ were added to the plates. Zones of inhibition were measured after 4 days . The resultsof four independent experiments showed that MLG100 [37 ±1 mm] and 61A152 with pmrfur in trans [39 ± 0.8 mm] are significantly less sensitive to H₂O₂ than wild-type bacteria[51 ± 2 mm] [P < 0.05] . There is no statistical differencebetween the zones of inhibition seen with the transconjugantand the MLG100 fur mutant.

Nunoshiba et al . [31] suggest that the increased sensitivityto oxidative stress found in an E . coli fur mutant is due toa 2.5-fold increase in the amount of intracellular iron . Thisexcess iron is thought to participate in Fenton chemistry, catalyzingthe formation of damaging hydroxyl radicals in the presenceof hydrogen peroxide . However, there have been conflicting reportsabout the levels of iron in fur mutants in E . coli . Abdul-Tehraniet al . [1] described an E . coli fur mutant that has 2.5-foldless iron than the wild-type parental strain . The discrepanciesmay be due to the form of iron measured in different experiments[40] . We wondered if the intracellular levels of iron were increasedin the Mn^r fur mutant because the siderophore receptors arenot repressed under iron-sufficient conditions . However, themutant is resistant to oxidative stress, suggesting that theintracellular iron levels may be lower than those in the wildtype . We examined the intracellular levels of iron in the wild-type,fur mutant, and transconjugant strains by ICP analysis . ICPanalysis showed that the MLG100 fur mutant [1.8-fold increase]and 61A152 with pmrfur in trans [1.2-fold increase] had modestincreases in iron content compared to the wild-type strain.Interestingly, the manganese-resistant fur mutant and 61A152with pmrfur in trans each contain more manganese than the wild-type strain . Recent studies have suggested that manganese accumulationmay play a role in peroxide and superoxide defense in bacteria[20] . Perhaps the accumulation of manganese renders these strainsmore resistant to oxidative stress.

Symbiotic phenotype of the fur mutant. Perhaps the most dramatic phenotype of the dominant-negativefur mutant is the symbiotic defect . The Mn^r fur mutant is not able to form an effective symbiosis with soybean, cowpea, ormung bean plants . Cowpea and mung bean plants did not developnodules when the plants were inoculated with MLG100 . However,plants inoculated with the wild-type bacteria developed functional,effective nodules by week 4 [data not shown] . Soybean plantsinoculated with MLG100 showed two different phenotypes . Someof the plants developed small, white, ineffective nodules onthe lower lateral roots, while other soybean plants did notdevelop nodules . Six weeks postgermination, the nodules wereimmature or absent, and there was no nitrogen fixation, as determinedby the acetylene reduction assay . Plants inoculated with MLG100contained less chlorophyll, had fewer nodules, and had a smallernodule biomass than plants inoculated with wild-type bacteria[Fig . 3] . Results with the dominant-negative, manganese-resistantfur mutant are in stark contrast to those with the B . japonicumfur-null strain GEM4 . GEM4 did not show any significant differencesfrom the wild-type strain, I110, in terms of numbers of nodules,nodule weight, shoot weight, or nitrogen fixation when thesestrains were inoculated on soybeans [data not shown] . The fur-nullstrain is able to form an effective symbiosis despite the factthat the Fur protein is not expressed . These data suggest thatthe mutant Fur protein is either negatively or positively affectinga gene or genes necessary in the symbiosis.

 
We wondered if strain variations between 61A152 and I110 might explain some of the differences in the fur phenotypes . In order to address this concern, we expressed the manganese resistant fur allele from strain MLG100 in trans in the I110 wild-type strain . The resulting transconjugant strain was able to growon higher levels of manganese than wild type [50 mM versus 20mM for wild type] . These data suggest that the Mn^r fur mutation behaves as a dominant-negative mutation in strain I110 as well as in 61A152 . Interestingly, GEM4 is able to grow at 20 mM manganese, but it does not grow at higher levels of manganese . We alsotested the I110 fur-null mutant GEM4 and GEM4 with the 61A152fur gene in trans by using a swarm plate assay . A Bacillus subtilis fur mutant was reported to have an altered swarm phenotype on low-agar plates [John Helmann, personal communication] . We wondered if GEM4 and the Mn^r fur mutant MLG100 also showed altered motilityphenotypes relative to the wild type on low-agar plates . Bothstrains have very small swarms [GEM4, 6.1 ± 0.6 mm; and MLG100, 4.9 ± 0.2 mm] . Complementing GEM4 with the wild-type 61A152 fur gene in trans resulted in a strain with a wild-type swarm phenotype [20 ± 2.1 mm compared with 18.1 ±0.2 mm for 61A152 and 15.3 ± 0.6 for I110] . These resultssuggest that the 61A152 fur gene can complement a fur mutationin strain USDA I110.

In E . coli, more than 90 genes have been found to be regulated by Fur and iron [16] . Fur has also been shown to indirectlyregulate iron uptake by regulating other regulators, such asAraC-like regulators, two-component signal transduction regulators,and extracytoplasmic function sigma factors [16] . Fur has alsobeen shown to repress transcription of a small regulatory RNAthat in turn inhibits expression of several genes, includingsodB, the transcription of which initially appeared to be activatedby Fur [28] . In B . japonicum, Fur has been shown to regulateirr, an iron regulator that is involved in regulating the hemebiosynthesis pathway [15] . Interestingly, R . leguminosarum,the pea microsymbiont, has a fur gene, a homolog of irr, anda third iron regulator, rirA [5, 38] . The RirA protein, not Fur, appears to be the major iron regulator in R . leguminosarum [42] . The transcription of iron-responsive genes, such as thoseinvolved in the synthesis and uptake of the siderophore vicibactinand in heme uptake, is unaffected in R . leguminosarum fur mutants.However, these iron-responsive genes are deregulated in a rirAmutant, suggesting that RirA is the primary iron regulator inR . leguminosarum [38] . Thus, there appear to be significantdifferences in regulation of iron-responsive genes between B.japonicum and R . leguminosarum . There is no obvious homologof rirA in the B . japonicum genome . There is a homolog of thefur-like gene zur, which has been shown to be a zinc regulatorin a number of bacterial species, including E . coli [32] andB . subtilis [9].

It is clear from our results that the absence of the Fur protein has a very different effect on downstream targets than doesa dominant-negative mutant Fur protein . We do not, however,know all of the gene targets of the Fur protein or how the mutantprotein may affect these targets . The B . japonicum Fur proteinhas been shown to regulate the hemA gene [13] . There are likely to be many other as yet unidentified targets for the Fur protein. Now that the B . japonicum genome has been sequenced, it will soon be possible to carry out DNA microarray experiments to determine which genes are regulated by Fur or misregulated ineach of the fur mutants [21, 22] . Several recent studies haveused a similar approach to define the fur regulon in a numberof bacterial species, including E . coli, B . subtilis, and Shewanellaoneidensis [3, 29, 37].

 
We would like to thank Justin Genant for help in screening for manganese-resistant mutants, Eric Bonconpagni for PCR amplification of a portion of the fur gene from 61A152, David Westenberg for providing primers specific for the rrn and sdh genes of B . japonicum,Mark O'Brian for providing the fur-null strain GEM4, and MichaelVasil for providing antibodies raised against the E . coli Furprotein . David Eide, Suzanne Clark, and Jeff Harper carriedout the ICP analysis.

This work was supported by USDA grant 99-03686 to M.L.G . H.B.was supported in part by Host-Microbe training grant T32AI07519.

 
* Corresponding author . Mailing address: Department of Biological Sciences, 6044 Gilman, Dartmouth College, Hanover, NH 03755 . Phone: [603] 646-2527 . Fax: [603] 646-1347 . E-mail: guerinot@dartmouth.edu.

1. Abdul-Tehrani, H., A . J . Hudson, Y.-S . Chang, A . R . Timms, C . Hawkins, J . M . Williams, P . M . Harrison, J . R . Guest, and S . C . Andrews. 1999 . Ferritin mutants of Escherichia coli are iron deficient and growth impaired, and fur mutants are iron deficient . J . Bacteriol . 181:1415-1428 .
2. Ausubel, F . M., R . Brent, R . E . Kingston, D . D . Moore, J . G . Seidman, J . A . Smith, and K . Struhl. 2003 . Current protocols in molecular biology . Greene Publishing Associates and John Wiley & Sons, Inc., New York.
3. Baichoo, N., T . Wang, R . Ye, and J . Helmann. 2002 . Global analysis of the Bacillus subtilis Fur regulon and the iron starvation stimulon . Mol . Microbiol . 45:1613-1629.
4. Berish, S . A., S . Subbarao, C.-Y . Chen, D . L . Trees, and S . A . Morse. 1993 . Identification and cloning of a fur homolog from Neisseria gonorrhoeae. Infect . Immun . 61:4599-4606.
5. De Luca, N . G., and A . W . B . Johnston. 1998 . Is the fur gene of Rhizobium leguminosarum essential? FEMS Microbiol . Lett . 168:289-295.
6. Faraldo-Gomez, J., and M . Sansom. 2003 . Acquisition of siderophores in gram-negative bacteria . Nat . Rev . 4:105-116.
7. Figurski, D . H., and D . R . Helinski. 1979 . Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc . Natl . Acad . Sci . USA 76:1648-1652.
8. Funahashi, T., C . Fujiwara, M . Okada, S . Miyoshi, S . Shinoda, S . Narimatsu, and S . Yamamoto. 2000 . Characterization of Vibrio parahaemolyticus manganese-resistant mutants in reference to the function of the ferric uptake regulatory protein . Microbiol . Immunol . 44:963-970.
9. Gaballa, A., and J . D . Helmann. 1998 . Identification of a zinc-specific metalloregulatory protein, Zur, controlling zinc transport operons in Bacillus subtilis. J . Bacteriol . 180:5815-5821 .
10. Grann, T., and D . R . Ort. 1984 . Quantitation of the rapid electron donors to P₇₀₀, the functional plastoquinone pool, and the ratio of the photosystems in spinach chloroplasts . J . Biol . Chem . 259:14003-14010 .
11. Guerinot, M . L., and B . K . Chelm. 1986 . Bacterial aminolevulinic acid synthase activity is not essential for leghemoglobin formation in the soybean/Bradyrhizobium japonicum symbiosis . Proc . Natl . Acad . Sci . USA 83:1837-1841.
12. Guerinot, M . L., E . J . Meidl, and O . Plessner. 1990 . Citrate as a siderophore in Bradyrhizobium japonicum. J . Bacteriol . 172:3298-3303.
13. Hamza, I., S . Chauhan, R . Hassett, and M . R . O'Brian. 1998 . The bacterial Irr protein is required for coordination of heme biosynthesis with iron availability . J . Biol . Chem . 273:21669-21674 .
14. Hamza, I., R . Hassett, and M . R . O'Brian. 1999 . Identification of a functional fur gene in Bradyrhizobium japonicum. J . Bacteriol . 181:5843-5846 .
15. Hamza, I., Z . Qi, N . D . King, and M . R . O'Brian. 2000 . Fur-independent regulation of iron metabolism by Irr in Bradyrhizobium japonicum. Microbiology 146:669-676 .
16. Hantke, K. 2001 . Iron and metal regulation in bacteria . Curr . Opin . Microbiol . 4:172-177.
17. Hantke, K. 1987 . Selection procedure for deregulated iron transport mutants [fur] in Escherichia coli K12: fur not only affects iron metabolism . Mol . Gen . Genet . 210:135-139.
18. Hassett, D . J., P . A . Sokol, M . L . Howell, J.-F . Ma, H . T . Schweizer, U . Oschner, and M . L . Vasil. 1996 . Ferric uptake regulator [Fur] mutants of Pseudomonas aeruginosa demonstrate defective siderophore-mediated iron uptake, altered aerobic growth and decreased superoxide dismutase and catalase activities . J . Bacteriol . 178:3996-4003.
19. Holmes, R . P., and R . R . B . Russell. 1972 . Mutations affecting amino sugar metabolism in Escherichia coli K-12 . J . Bacteriol . 111:290-291.
20. Horsburgh, M., S . Wharton, M . Karavolos, and S . Foster. 2002 . Manganese: elemental defence for a life with oxygen? Trends Microbiol. 10:496-501.
21. Kaneko, T., Y . Nakamura, S . Sato, K . Minamisawa, T . Uchiumi, S . Sasamoto, A . Watanabe, K . Idesawa, M . Iriguchi, K . Kawashima, M . Kohara, M . Matsumoto, S . Shimpo, H . Tsuruoka, T . Wada, M . Yamada, and S . Tabata. 2002 . Complete genomic sequence of nitrogen-fixing symbiotic bacterium Bradyrhizobium japonicum USDA110 . DNA Res . 9:189-197.
22. Kaneko, T., Y . Nakamura, S . Sato, K . Minamisawa, T . Uchiumi, S . Sasamoto, A . Watanabe, K . Idesawa, M . Iriguchi, K . Kawashima, M . Kohara, M . Matsumoto, S . Shimpo, H . Tsuruoka, T . Wada, M . Yamada, and S . Tabata. 2002 . Complete genomic sequence of nitrogen-fixing symbiotic bacterium Bradyrhizobium japonicum USDA110 . DNA Res . 9[Suppl.]:225-256.
23. Kuykendall, L . D., and G . H . Elkan. 1976 . Rhizobium japonicum derivatives differing in nitrogen-fixing efficiency and carbohydrate utilization . Appl . Environ . Microbiol . 32:511-519.
24. Lam, M . S., C . M . Litwin, P . A . Carroll, and S . B . Calderwood. 1994 . Vibrio cholerae fur mutations associated with loss of repressor activity: implications for the structural-functional relationships of Fur . J . Bacteriol . 176:5108-5115.
25. LeVier, K., and M . L . Guerinot. 1996 . The Bradyrhizobium japonicum fegA gene encodes an iron-regulated outer membrane protein with similarity to hydroxamate-type siderophore receptors . J . Bacteriol . 178:7265-7275.
26. Liscum, E., and R . P . Hangarter. 1991 . Arabidopsis mutants lacking blue light-dependent inhibition of hypocotyl elongation . Plant Cell 3:685-694 .
27. Loprasert, S., R . Sallabhan, W . Whangsuk, and S . Mongkolsuk. 2000 . Characterization and mutagenesis of fur gene from Burkholderia pseudomallei. Gene 254:129-137.
28. Masse, E., and S . Gottesman. 2002 . A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli. Proc . Natl . Acad . Sci . USA 99:4620-4625 .
29. McHugh, J., F . Rodriguez-Quinones, H . Abdul-Tehrani, D . Svistunenko, R . Poole, C . Cooper, and S . Andrews. 2003 . Global iron-dependent gene regulation in Escherichia coli. J . Biol . Chem . 278:29478-29486 .
30. Nienaber, A., H . Hennecke, and H . M . Fischer. 2001 . Discovery of a haem uptake system in the soil bacterium Bradyrhizobium japonicum. Mol . Microbiol . 41:787-800.
31. Nunoshiba, T., F . Obata, A . Boss, S . Oikawa, T . Mori, S . Kawanishi, and K . Yamamoto. 1999 . Role of iron and superoxide for generation of hydroxyl radical oxidative DNA lesions, and mutagenesis in Escherichia coli. J . Biol . Chem . 274:34832-34837 .
32. Patzer, S., and K . Hantke. 2000 . The zinc-responsive regulator Zur and its control of the znu gene cluster encoding the ZnuABC zinc uptake system in Escherichia coli. J . Biol . Chem . 275:24321-24332 .
33. Prince, R . W., C . D . Cox, and M . L . Vasil. 1993 . Coordinate regulation of siderophore and exotoxin A production: molecular cloning and sequencing of the Pseudomonas aeruginosa fur gene . J . Bacteriol . 175:2589-2598.
34. Sadowsky, M . J., R . E . Tully, P . B . Cregan, and H . H . Keyser. 1987 . Genetic diversity in Bradyrhizobium japonicum serogroup 123 and its relation to genotype-specific nodulation of soybean . Appl . Environ . Microbiol . 53:2624-2630.
35. Silver, S., P . Johnseine, E . Whitney, and D . Clark. 1972 . Manganese-resistant mutants of Escherichia coli: physiological and genetic studies . J . Bacteriol . 110:186-195.
36. Staskawicz, B., D . Dahlbeck, N . Keen, and C . Napoli. 1987 . Molecular characterization of cloned avirulence genes from race 0 and race 1 of Pseudomonas syringae pv . glycinea. J . Bacteriol . 169:5789-5794.
37. Thompson, D . K., A . Beliaev, C . Giometti, S . Tollaksen, T . Khare, D . P . Lies, K . H . Nealson, H . Lim, J . Yates III, C . C . Brandt, J . M . Tiedje, and J . Zhou. 2002 . Transcriptional and proteomic analysis of a ferric uptake regulator [fur] mutant of Shewanella oneidensis: possible involvement of Fur in energy metabolism, transcriptional regulation, and oxidative stress . Appl . Environ . Microbiol . 68:881-892 .
38. Todd, J . D., M . Wexler, G . Sawers, K . Yeoman, P . Poole, and A . Johnston. 2002 . RirA, an iron-responsive regulator in the symbiotic bacterium Rhizobium leguminosarum. Microbiology 148:4059-4071 .
39. Tolmasky, M . E., A . M . Wertheimer, L . A . Actis, and J . H . Crosa. 1994 . Characterization of the Vibrio anguillarum fur gene: role in regulation of expression of the FatA outer membrane protein and catechols . J . Bacteriol . 176:213-220.
40. Touati, D. 2000 . Iron and oxidative stress in bacteria . Arch . Biochem . Biophys . 373:1-6.
41. Vincent, J . M. 1970 . A manual for the practical study of root nodule bacteria, vol . 15 . Blackwell Scientific Publications, Oxford, United Kingdom.
42. Wexler, M., J . D . Todd, O . Kolade, D . Bellini, A . Hemmings, G . Sawers, and A . Johnston. 2003 . Fur is not the global regulator of iron uptake genes in Rhizobium leguminosarum. Microbiology 149:1357-1365 .
43. Wexler, M., K . Yeoman, J . Stevens, N . de Luca, G . Sawers, and A . Johnston. 2001 . The Rhizobium leguminosarum tonB gene is required for the uptake of siderophore and haem as sources of iron . Mol . Microbiol . 41:801-816.

Free Online Full-text Article

What Is Growth Medium?, What Is Genetic Engineering?, What is Food Microbiology?, What Is Biofilm?, What Is Dna?, c, Bacterium, i, Microorganisms, s, Bacteria, s, Microbes, s, Microbiology, s, Staphylococcus aureus, n, Bacteroides, c, Botulin, i, Bacillus, i, Fermentations, s, Escherichia coli, a, Halophilic bacterium, n, Bacillus, c, Leuconostoc, o, Bacteria, s, Escherichia coli, i, Lactobacillus, o, Bacteriophage, a, Escherichia coli, s, S. cerevisiae, r, Klebsiella, r, Candida albicans, i, Bacillus, o, MIC, i, Antibiotics, a, Salmonella typhimurium




 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005