Journal of Bacteriology, March 2004, p . 1415-1422, Vol . 186, No . 5

VirB1 Orthologs from Brucella suis and pKM101 Complement Defects of the Lytic Transglycosylase Required for Efficient Type IV Secretion from Agrobacterium tumefaciens

Christoph Höppner,¹ Zhenying Liu,² Natalie Domke,¹ Andrew N . Binns,² and Christian Baron^1,3*

Bereich Mikrobiologie, Department Biologie I, Ludwig-Maximilians-Universität München, D-80638 Munich, Germany,¹ Department of Biology, University of Pennsylvania, Philadelphia, Pennsylvania 19104-6018,² Department of Biology, McMaster University, Hamilton, Ontario L8S 4K1, Canada³

Received 24 July 2003/ Accepted 13 November 2003

 
Type IV secretion systems mediate conjugative plasmid transferas well as the translocation of virulence factors from various gram-negative pathogens to eukaryotic host cells . The translocation apparatus consists of 9 to 12 components, and the componentsfrom different organisms are believed to have similar functions.However, orthologs to proteins of the prototypical type IV system,VirB of Agrobacterium tumefaciens, typically share only 15 to30% identical amino acids, and functional complementation between components of different type IV secretion systems has not been achieved . We here report a heterologous complementation in thecase of A . tumefaciens virB1 defects with its orthologs from Brucella suis [VirB1s] and the IncN plasmid pKM101 [TraL] . In contrast, expression of the genes encoding the VirB1 orthologsfrom the IncF plasmid [open reading frame 169] and from the Helicobacter pylori cag pathogenicity island [HP0523] did not complement VirB1 functions . The complementation of VirB1 activitywas assessed by T-pilus formation, by tumor formation on woundedplants, by IncQ plasmid transfer, and by IncQ plasmid recipientassay . Replacement of the key active-site Glu residue by Alaabolished the complementation by VirB1 from B . suis and by TraL, demonstrating that heterologous complementation requires anintact lytic transglycosylase active site . In contrast, theVirB1 active-site mutant from A . tumefaciens retained considerable residual activity in various activity assays, implying thatthis protein exerts additional effects during the type IV secretion process.

 
Type IV secretion systems [T4SS] mediate the translocation of macromolecules across the envelope of gram-negative bacteria.These systems were initially discovered to be essential forthe conjugative transfer of plasmids of different incompatibilitygroups [F, H, N, P, and W] [22, 56] . In addition to the plasmidDNA, proteins are translocated, suggesting that those may carrythe recognition signals for T4SS translocation [34, 36] . Thisnotion was further supported by the discovery that the VirB/D4system from Agrobacterium tumefaciens, which shares significantsequence similarities with plasmid-encoded T4SS, translocatesseveral proteins in addition to its T-DNA substrate [52] . Subsequently,T4SS were found to mediate the translocation of proteinaceouseffector molecules from several bacterial pathogens [3, 11, 12, 20, 36].

Compared to other T4SS, the T-DNA translocation system fromA . tumefaciens has been studied in the greatest detail [3, 11].Its 12 components [VirB1 to VirB11 and VirD4] localize to theinner and the outer membrane, and different lines of evidencesuggest that this complex spans the periplasm . Biochemical experimentssuggested that VirB7, VirB8, VirB9, and VirB10, which are mostlyexposed to the periplasm but anchored to the membranes, constitutethe core complex required for the stabilization of many othermembrane-bound VirB proteins [1, 4, 7, 14, 18, 19, 29] . Protein-protein interactions between VirB7 to VirB10 were also detected with the yeast two-hybrid system [13, 14] . VirB8 and VirB10 containN-terminal hydrophobic domains and are likely anchored to theinner membrane . In contrast, the lipoprotein VirB7 predominantlylocalizes to the outer membrane together with covalently linkedVirB9 . The T4SS core likely links the surface-exposed T-piluscomponents VirB2 and VirB5 to the cell, and VirB6 and VirB7play a key role during that process [17, 25, 27, 29, 32, 45].The mechanism of T4SS assembly is unknown, and energy providedby one or more of the nucleotide triphosphatases VirB4, VirB11,and VirD4 is believed to energize this process [30, 43].

The murein layer imposes a barrier to the assembly of trans-envelope structures, and VirB1 likely exerts its effect here [5, 15,16, 28] . VirB1 is required for efficient T4SS function, butvirB1 deletion strains of A . tumefaciens were reported to retain between 1 and 10% residual virulence [8, 39] . Similarly, inthe absence of VirB1 ortholog P19, plasmid R1 conjugation andR17 phage infection were reduced to 10% of the wild-type leveland traL mutants of pKM101 had 5% residual activity [5, 54].The finding that VirB1 is not essential was attributed to itsputative function as a lytic transglycosylase, which may facilitateT4SS assembly by localized lysis of the peptidoglycan [39].The relatively thin murein layer of gram-negative bacteria maypermit a reduced level of T4SS assembly even in the absenceof VirB1 orthologs [28] . Alternatively, cellular enzymes maypartly substitute for its function [26] . Direct evidence for the transglycosylase activity has not been presented, but VirB1 derivatives with alterations in the putative active sites had strongly reduced virulence [39] . Overproduction of the VirB1 ortholog P19 from plasmid R1 led to cell lysis, implying a role in murein metabolism [6] . In addition to its suggested functionas a transglycosylase, there may be an additional contributionof VirB1 to T4SS functionality . VirB1 undergoes C-terminal processingafter export into the periplasm, resulting in an N-terminaltransglycosylase domain and the 14-kDa C-terminal processingproduct VirB1*, which is partly secreted across the outer membrane[2] . Both domains partly complemented a virB1 deletion mutant,implying that they independently contribute to virulence [37].Cross-linking experiments showed that VirB1* localizes in closeproximity to VirB9, and this interaction may be required forT4SS function [2] . A role of VirB1 in T4SS assembly via interactionswith other proteins was further supported by the results oftwo-hybrid experiments and by its impact on the localizationof VirB10 in the cell [35, 53].

We present here a detailed analysis of the consequences of a mutational alteration of the active site of VirB1, showing thatit contributes to efficient gene transfer from A . tumefaciensbut it is not required for processing of VirB1 and secretionof the C-terminal VirB1* product . In addition, our data stronglysuggest that the protein contributes a transglycosylase-independentfunction to the type IV secretion process . Functional complementationwith VirB1 orthologs from some other T4SS was achieved, suggestingthat the requirement for transglycosylase activity is conservedamong T4SS.

 
Bacteria, plasmid constructions, and mutagenesis. Strains and plasmids used in this study are given in Table 1. Cultures of Escherichia coli for cloning experiments were grown at 37°C in Luria-Bertani medium [1% peptone, 0.5% yeast extract, 0.5% NaCl], and DNA manipulations followed standard procedures [38] . Antibiotics were added for plasmid propagationas appropriate [spectinomycin [SPC], 50 µg/ml; streptomycin,50 µg/ml; carbenicillin [CAR], 100 µg/ml].

 
For complementation analysis, vector pTrc200 was cleaved withNcoI and SmaI treated with alkaline phosphatase followed by ligation with PCR fragments of genes encoding VirB1 orthologsas follows . Similar PCR conditions were used in all cases [1ng of plasmid template; cycle conditions: 2 min at 95°Cfor denaturation [one time]; 44°C for 1 min, 72°C for2 min, and 95°C for 30 s for cycling [30 times]; 44°Cfor 1 min and 72°C for 5 min for strand completion [onetime]; and termination at 4°C].

Brucella suis virB1 was amplified from pUCvirB [oligonucleotides BsB1-5', 5'-GGACCATGGTGCCATTCCTTGTCCTCGCGC-3', and BsB1-3', 5'-GCTAGTACTTAGAAAACAACTACGCCGTCCGTATTATCCTTC-3'] . TraL was amplified from pKM101 [oligonucleotides TraL5, 5'-GGGGCCATGGGTAAACATCCAAAACTCC-3', and TraL3', 5'-GAAAGTACTCATTCCCCCTTCG-3'] [41] . Open readingframe [ORF] 169 was amplified from the F plasmid [oligonucleotides169-N1, 5'-GGGGCCATGGCAAAATGGATGTTAGCCATCTGCCT-3', and 169-C,5'-CCCAGTACTTAATTGTTCTGCACGCTGTTAATTTC-3'] [22] . The readingframe of HP0523 was amplified from Helicobacter pylori 26695chromosomal DNA [oligonucleotides Cag4-5, 5'-GGGGCCATGGTCGAGAAATGGATTGGTCT-3', and Cag4-3, 5'-CCCAGTACTACTCGTTATATCGCACTTG-3'] [49] . The fragmentswere cleaved with NcoI and ScaI [underlined in oligonucleotidesequences above] followed by ligation to similarly cut pTrc200and sequencing with an ABI 310 sequencer, resulting in pTrcB1s,pTrcTraL, pTrc169, and pTrc523.

The codons determining active-site Glu residues were changedto Ala in pTrcB1 [Glu⁶⁰], pTrcB1s [Glu²⁷], and pTrcTraL [Glu⁵³] by site-directed mutagenesis by using the Gene editor in vitro site-directed mutagenesis system [Promega] according to the supplier's description . The genes encoding VirB1 and its orthologs were subcloned and subjected to mutagenesis as follows . ThevirB1 gene from pTrcB1 was excised with Eco32I/HindIII and ligated into similarly cut pBAD18 followed by mutagenesis with oligonucleotide B1M5 [GCAGCGATCGCTCAGGTCGCTAGCCGCTTTGATCCGCTTGCT] . The virB1 gene from pTrcB1s was excised with NcoI/HindIII and ligated into similarly cut pT7-7 followed by mutagenesis with oligonucleotide B1suisM5 [GCAGCAATCGTGCAGGTCGCTAGCGGCTTCAATCCTTATGCA] . The traL gene from pTrcTraL was excised with NcoI/HindIII and ligated into similarly cut pT7-7 followed by mutagenesis with oligonucleotide TraLM5 [GCGTACATCGTCGGCCATGCTAGCTCAAATGGACCGTACAGG] . Mutations were identified by restriction analysis with NheI [underlined above] and confirmed by sequencing.

Cultivation of A . tumefaciens and analysis of exocellular fractions. Overnight cultures of A . tumefaciens were grown in YEB medium[0.5% beef extract, 0.5% peptone, 0.1% yeast extract, 0.5% sucrose,2 mM MgSO₄] in the absence of antibiotics [wild-type strains]or with SPC [300 µg/ml] and streptomycin [100 µg/ml]for the propagation of pTrc200 derivatives . For propagation of pLS1, CAR was added at 150 µg/ml, and for the selectionof UIA143[pTiA6] pLS1 transconjugants, erythromycin [ERY] wasadded at 150 µg/ml in addition to CAR . Further, the cellswere inoculated to an optical density at 600 nm of 0.1 in liquidAB medium [10 g of glucose/liter, 4 g of MES [morpholineethanesulfonicacid]/liter, 0.3 g of MgSO₄ · 7 H₂O/liter, 0.15 g ofKCl/liter, 0.01 g of CaCl₂/liter, 0.0025 g of FeSO₄ ·7H₂O/liter, and 1 mM potassium phosphate [pH 5.5]] and grownfor 5 h at 20°C followed by specific procedures dependingon the assay used . First, for the analysis of VirB1* secretionin liquid cultures, cells were grown at 20°C for 18 h with0.5 mM isopropyl-ß-D-thiogalactopyranoside [IPTG]for the induction of the trc promoter with or without 200 µMacetosyringone [AS] for virulence gene induction . VirB1* was precipitated from cell-free culture supernatants with acetone as described followed by sodium dodecyl sulfate-polyacrylamidegel electrophoresis [SDS-PAGE] and Western blot analysis [2]. Second, for the isolation of surface-exposed T-pili, 1 ml of cells was plated per large [15 cm²] AB medium plate [20 g of agar/liter] with or without 200 µM AS and the plates were further incubated at 20°C for 4 days . T-pili were isolatedfrom the cells grown on 4 plates each with and without AS byshearing and ultracentrifugation as described previously [45]. Third, for plant infection experiments, leaf squares [4 by 4mm] of Nicotiana tabacum cv . Havana 425 were cocultivated withthe bacteria in the presence of 0.5 mM IPTG and 300 µMAS on hormone-free Murashige-Skoog medium for 2 days at 25°C,rinsed with Luria-Bertani plus 200 µg of vancomycin/mland 200 µg of timentin/ml, and then cultivated on hormone-freeMurashige-Skoog medium plus 200 µg of vancomycin/ml and200 µg of timentin/ml at 25°C in the dark [35] . Tumorformation was scored 12 days after the start of the cocultivation.Fourth, for the analysis of pLS1 donor activity, A348 and PC1001carrying pTrc200 with and without VirB1 ortholog-encoding geneswere cocultivated with UIA143[pTiA6] recipient cells in a 1:5 ratio for 3 days on AB minimal medium agar containing 500 µMAS and 500 µM IPTG followed by plating on selective agarmedia [CAR, 150 µg/ml; ERY, 150 µg/ml] and quantitationof recipient and donor cells as described previously [9] . Fifth,for the analysis of pLS1 recipient activity, donor A348 pLS1cells were cocultivated with PC1001 recipient cells carryingpTrc200 with and without VirB1 ortholog-encoding genes in a5:1 ratio for 2 days on AB induction medium plus 500 µMAS and 500 µg of IPTG/ml followed by plating on Luria-Bertaniagar plus antibiotics [150 µg of CAR/ml and/or 100 µgof SPC/ml] as necessary for quantitation of donors, recipients,and transconjugants as described previously [35].

SDS-PAGE and Western blotting. Cells and exocellular fractions were incubated in Laemmli samplebuffer for 5 min at 100°C followed by SDS-PAGE accordingto the method of Laemmli [VirB1 and VirB8] [31] or Schäggerand von Jagow [VirB2] [44], and Western blotting was performedin a tank blot apparatus . Detection was performed with a chemiluminescence-basedsystem [NEN] with A . tumefaciens strain C58 VirB protein-specificantisera.

 
Choice and cloning of VirB1 orthologs. We assessed the hypothesis that VirB1 orthologs may be exchangeablebetween different T4SS . Complementation of the virB1 deletionmutant A . tumefaciens strain A348 [PC1001] was performed withVirB1 from A . tumefaciens strain C58 and its orthologs fromB . suis [VirB1s] and pKM101 [TraL] . Similar to other T4SS components,these proteins share relatively limited sequence similarities.They were identified based on their location in virB-like operonsand their putative active-site signatures [Fig . 1] . The sequence similarity to the ORF169 from the F plasmid protein is even smaller, but different lines of evidence suggest that this protein may be a lytic transglycosylase [5, 6] . In addition, we analyzedthe HP0523 [cag4] gene product from H . pylori strain 26692.This protein had not been identified as a VirB1 ortholog initially[49], but a recent publication shows suggestive evidence fora role in T4SS complex assembly [42] . The transglycosylase active-site signature sequence was identified by visual inspection of gene products from the cag pathogenicity island . Similar to ORF169, the similarity to VirB1 is limited, but the putative active-site residues are well conserved [Fig . 1B] and the gene is necessaryfor virulence [21] . The genes encoding the different VirB1 orthologswere PCR amplified, cloned into broad-host-range vector pTrc200,and transformed into strain PC1001 [virB1] for analysis of theirbiological activities . In addition, the genes encoding VirB1,VirB1s, and TraL were modified by site-directed mutagenesisto change the essential active-site Glu residues of their respectiveproducts.

 
The VirB1 content of cell lysates and of culture supernatantswas monitored by SDS-PAGE and Western blotting to assess theimpact of the active-site mutation . Equal levels of the full-lengthprotein and of VirB1* were detected in samples from PC1001 carryingpTrcB1 and pTrcB1^EA [Fig . 2], demonstrating that the putativeactive site is not required for stability, processing, and secretion. Different assays were conducted to assess the complementationof the A . tumefaciens virB1 defect.

 
Complementation of T-pilus formation. VirB1 was previously shown to be required for T-pilus formationin A . tumefaciens strain A348, demonstrating that it is requiredfor T4SS assembly [33, 45] . To test the complementation, theA348 wild type and strain PC1001 [virB1] carrying pTrc200 withor without virB1 ortholog-carrying genes were grown on AB agarplates under virulence gene-inducing conditions followed bysubcellular fractionation and analysis of VirB protein content.Analysis of cell lysates with VirB2- and VirB8-specific antiserashowed that the accumulation of the major T-pilus component as well as of the T4SS core component VirB8 were not affected by the absence of VirB1 [Fig . 3A] . Surface-exposed high-molecular-massstructures were removed from the cells by shearing and ultracentrifugation,and as previously described, significant amounts of VirB2 werenot detected in exocellular fractions from strain PC1001 [Fig.3B] . The introduction of pTrcB1 and of pTrcB1s restored T-pilusformation almost to wild-type levels . In two of three experiments,pTrcTraL showed weak complementing activity, but pTrc169 andpTrc523 never restored T-pilus formation . Similarly, plasmidsdirecting the production of active site variants of VirB1, VirB1s,and TraL did not reproducibly complement T-pilus formation,demonstrating that the putative active site is required . SinceT-pilus formation it is not readily amenable to quantitation,low degrees of complementation are difficult to monitor andit does not permit conclusions on substrate translocation.

 
Complementation of tumor formation. To test the efficiency of substrate translocation, we next assessedthe efficiency of tumor formation by strain A348 and by PC1001carrying pTrc200 with and without virB1 orthologous genes . Freshlycut N . tabacum leaf squares were dipped into bacterial cultures,cocultivated for 2 days, and then incubated on plant mediumplus antibiotics to eliminate the bacteria . These assays [Fig.4] demonstrated that strain PC1001 initiated 5 to 10% of tumorscompared to A348, similar to previous observations [39] . The introduction of pTrcB1 into PC1001 restored tumor formationto 40% of the level of the wild type, and similar results wereobtained by the introduction of pTrcB1s [Fig . 4] . The introduction of pTrcTraL led to a more modest increase of tumor formationto 20% of the level of the wild type, whereas pTrc169 did not significantly increase the ability of PC1001 to incite tumors. Surprisingly, the introduction of pTrcB1^EA, which directs theproduction of an active-site variant of VirB1, significantlyincreased bacterial virulence to 30% of the level of the wildtype, whereas the introduction of pTrcB1s^EA and pTrcTraL^EA didnot cause significant effects . The results of the tumor formation assays are similar to those of the pilus formation assay, but the strong effect of pTrcTraL and the partial restoration oftumor formation by an active-site variant of VirB1 constitutea marked difference . However, the relatively low complementationby pTrcB1, which could be caused by inefficient promoter inductionby IPTG in the wound, complicates the interpretation . We thereforenext chose IncQ plasmid transfer as a more quantitative assayof substrate translocation.

 
Complementation of IncQ plasmid transfer. VirB/D4-mediated translocation of IncQ plasmids relies on therecognition of relaxosome complexes by the A . tumefaciens T4SS[47] . The transfer of IncQ plasmids between agrobacteria canbe readily quantitated, and since the mating is being performedon agar media, the induction of pTrc200-borne genes with IPTGcan be easily controlled . The IncQ plasmid pLS1 [Car^r] was introduced into strains A348 and PC1001 carrying pTrc200 with and without virB1 orthologous genes . The strains were mated with the recipient UIA143[pTiA6] [Ery^r], followed by the quantitation of plasmid transfer on selective media [ERY and CAR] . Similar to previous observations [9], the plasmid transfer ability of PC1001 was reduced to about 10% of the wild-type level . The introduction of pTrcB1 conferred almost full complementation, and pTrcB1s increased pLS1 transfer to 50% of the wild-type level [Fig. 5] . The presence of pTrcTraL led to a smaller increase of pLS1 transfer efficiency [20% of the wild-type level], whereas the presence of pTrc169 and pTrc523 did not significantly increase transfer . Among the plasmids encoding active-site derivatives,only pTrcB1^EA increased pLS1 transfer, and the stimulation wasmodest but significant [20% of the wild-type level, comparableto TraL] . Those results are qualitatively similar to those obtainedin tumor formation assays.

 
The production of VirB proteins on the recipient side also stimulated conjugative transfer of IncQ plasmids [9, 35] . The mechanismis unknown, but VirB1 is a key factor because its deletion hasstronger negative impacts than on the donor side [9] . Comparedto the wild type, the recipient activity of PC1001 was reducedto 3% and the introduction of pTrcB1 restored plasmid transferto 67% of that of strain A348 [Fig . 6] . The introduction ofpTrcB1s led to an even stronger increase than that of pTrcB1[80% of the wild-type level], whereas the introduction of pTrcTraLonly modestly increased plasmid recipient activity to 10% andpTrc169 showed no effect . Surprisingly, PC1001 producing the active-site mutant of VirB1 showed 45% of the IncQ plasmid recipient activity compared to that of the wild type, whereas the active-site mutants of VirB1s and TraL had no stimulating effect [Fig . 6]. These results are in accord with those of the tumor formation and pLS1 donor assays, suggesting that in addition to its likely function as transglycosylase, VirB1 contributes a second functionto T4SS secretion.

 
Lytic transglycosylases play a role in murein metabolism, andthe active-site residues were defined based on the crystal structureof the soluble lytic transglycosylase Slt70 from E . coli [16]. Analysis of the crystal structures of the soluble lytic transglycosylases Slt35 and Slt70 in complexes with their substrates further substantiated the picture of the active-site requirements [50, 51] . The existenceof a clearly defined active-site signature with three characteristicregions led to the identification of putative transglycosylasesin a variety of macromolecular secretion systems [5, 28] . Directevidence for transglycosylase activity is still missing, but different types of evidence indicate a function of these proteins as murein-metabolizing enzymes . The most direct observationwas that overproduction of P19, the putative lytic transglycosylasefrom the IncP plasmid R1, led to perforation of the bacterialcell envelope [6] . In addition, mutational alterations of the active-site Glu residues of P19 and VirB1 essentially abolished their abilities to complement the defects in their respectiveT4SS [6, 39] . Finally, in contrast to all other T4SS components, VirB1 orthologs are generally not essential, and the reasonmay be that other murein-metabolizing enzymes partly substitutefor their function.

This led to the hypothesis that in contrast to other T4SS components [10, 25, 46], exchange between different VirB1 orthologs maybe possible [28] . We directly tested this hypothesis here andfound that VirB1s from B . suis and TraL from pKM101 partly complementedthe virB1 defect of A . tumefaciens strain PC1001 . A varietyof different assay systems were employed to substantiate thisfinding, such as T-pilus formation, tumor formation, and IncQplasmid donor and IncQ plasmid recipient activity, and the resultsof all assays were qualitatively similar . In spite of the limiteddegree of sequence similarity, VirB1s complemented the virB1defect to a similar level as VirB1 from A . tumefaciens. In contrast,the complementation by TraL, which has approximately the samesequence similarity to VirB1 as VirB1s, was reduced but stillsignificant . In addition to the previously assigned VirB1 orthologs,we identified the H . pylori HP0523 gene product as a putative transglycosylase . HP0523 and the F plasmid-encoded ORF169 gene product are significantly smaller than VirB1, VirB1s, and TraL,and the overall sequence identities to VirB1 are below 20%.These proteins essentially comprise the N-terminal domain ofVirB1, which partly complements virB1 defects [37] . The putative active-site residues are well conserved, suggesting a function of these proteins as lytic transglycosylases . The facts thatthe HP0523 gene product is essential for the virulence of H.pylori [21, 42] and that P19 of plasmid R1, which is almostidentical to ORF169, is required for efficient conjugative transfer[5], support a role for these proteins in T4SS assembly . Whilewe did not observe complementation of the A . tumefaciens virB1defect, which may be due to low protein levels in the cell,the results of an independent study support a role for HP0523in T4SS assembly in the cell envelope [42].

An obvious difference between the virB1 complementing and noncomplementingorthologs is the length of the proteins . VirB1, VirB1s, andTraL share a C-terminal extension, which is processed and secretedin the case of VirB1 . Production of the C-terminal processingproduct VirB1* alone partly complemented virB1 defects of A.tumefaciens, implying that this part of the protein may exertan effect during the type IV secretion process independent ofthe N-terminal domain [37] . VirB1* was cross-linked to VirB9in vivo [2], and mutational alterations of different residuesN- and C-terminal to the processing site negatively affectedprocessing and complementation [C . Höppner and C . Baron,unpublished data] . Thus, the interactions of the C-terminalprocessing product with other components of the T4SS machinerymay determine the outcome of complementation experiments, andthis may explain our inability to achieve complementation withthe ORF169 and HP0523 gene products . One possibility to testthis hypothesis would be to study the complementation by fusionproteins of ORF169 and HP0523 with the VirB1* domain.

Based on results obtained with the yeast two-hybrid system,it was recently suggested that VirB1 may interact with severalVirB proteins, such as VirB4, VirB8, VirB9, VirB10, and VirB11[53] . Supporting this hypothesis are recent data demonstratingthat VirB1, VirB2, and VirB3 impact the subcellular localizationof VirB10 [35] . To distinguish between the contribution of thetransglycosylase and other activities of the proteins, we investigatedthe complementation by active-site mutants of VirB1, VirB1s,and TraL . Exchange of the active-site Glu residue by Ala didnot affect the processing of VirB1 and the secretion of VirB1*,showing that these processes do not require the transglycosylaseactive site . In a previous study, a similar alteration of theactive site of VirB1 abolished its ability to complement tumorformation on Kalanchoė diagremontiana leaves [39] . In contrastto that, we found that the alteration of the active-site Gluresidue by Ala reduced the activity of the modified gene productbut did not lead to a loss of complementation . The differenceto previous results may be explained by the higher expressionfrom the trc promoter used in this work and by the choice ofassay system . Mushegian et al . did not monitor the level ofVirB1 and used the K . diagremontiana leaf puncture assay [39],which is inherently difficult to quantify, whereas we chosea variety of different assay systems . In contrast to the resultsobtained with VirB1^EA, VirB1s^EA and TraL^EA did not complementthe virB1 defect in PC1001 . Thus, the orthologs can exclusivelysubstitute for the activity of VirB1 from the putative transglycosylaseactive site . The complementation by the wild-type genes maybe efficient due to the strong expression from the trc promoter,but since specific antisera were not available, we could notdirectly monitor protein levels . In contrast, VirB1 may interactwith other VirB proteins [35, 53], and due to the limited sequencesimilarity, VirB1s and TraL may not be able to fulfill these transglycosylase-independent function[s] . The substantial residual activity of VirB1^EA is in accord with the hypothesis that VirB1may have additional functions, and previous work from othergroups lends further support to this notion [37, 53] . Further studies are required to dissect the different contributionsof VirB1 transglycosylase activity and VirB protein interactionsto T4SS function[s].

 
We are indebted to David O'Callaghan [Nīmes, France] andAugust Böck [Munich, Germany] for continued support anddiscussions . We thank Günter Koraimann [Graz, Austria]for discussions and for the communication of results prior topublication.

This work was supported by grants from the DAAD/Procope, the Deutsche Forschungsgemeinschaft DFG [Ba 1416-2/2], and the European Union Frame Programme 5 [contract QLK2-CT-2001-01200] to C.B.and by an NSF grant [MCB9817149] to A.N.B.

 
* Corresponding author . Mailing address: Department of Biology, McMaster University, Life Sciences Bldg., 1280 Main St . West, Hamilton, Ontario L8S 4K1, Canada . Phone: [905] 525-9140, ext . 26692 . Fax: [905] 522-6066 . E-mail: baronc@mcmaster.ca .

1. Anderson, L . B., A . Vogel Hertzel, and A . Das. 1996 . Agrobacterium tumefaciens VirB7 and VirB9 form a disulfide-linked protein complex . Proc . Natl . Acad . Sci . USA 93:8889-8894 .
2. Baron, C., M . Llosa, S . Zhou, and P . C . Zambryski. 1997 . C-terminal processing and cellular localization of VirB1, a component of the T-complex transfer machinery of Agrobacterium tumefaciens. J . Bacteriol . 179:1203-1210.
3. Baron, C., D . O'Callaghan, and E . Lanka. 2002 . Bacterial secrets of secretion: EuroConference on the biology of type IV secretion processes . Mol . Microbiol . 43:1359-1366.
4. Baron, C., Y . R . Thorstenson, and P . C . Zambryski. 1997 . Biochemical analysis of the complex between the lipoprotein VirB7 and VirB9 in the membranes of Agrobacterium tumefaciens. J . Bacteriol . 179:1211-1218.
5. Bayer, M., R . Eferl, G . Zellnig, K . Terferle, A . Dijkstra, G . Koraimann, and G . Högenauer. 1995 . Gene 19 of plasmid R1 is required for both efficient conjugative DNA transfer and bacteriophage R17 infection . J . Bacteriol . 177:4279-4288.
6. Bayer, M., R . Iberer, K . Bischof, E . Rassi, E . Stabentheiner, G . Zellnig, and G . Koraimann. 2001 . Functional and mutational analysis of P19, a DNA transfer protein with muramidase activity . J . Bacteriol . 183:3176-3183 .
7. Beaupré, C . E., J . Bohne, E . M . Dale, and A . N . Binns. 1997 . Interactions between VirB9 and VirB10 membrane proteins involved in movement of DNA from Agrobacterium tumefaciens into plant cells . J . Bacteriol . 179:78-89.
8. Berger, B . R., and P . J . Christie. 1994 . Genetic complementation analysis of the Agrobacterium tumefaciens virB operon: virB2 through virB11 are essential virulence genes . J . Bacteriol . 176:3646-3660.
9. Bohne, J., A . Yim, and A . N . Binns. 1998 . The Ti plasmid increases the efficiency of Agrobacterium tumefaciens as a recipient in virB-mediated conjugal transfer of an IncQ plasmid . Proc . Natl . Acad . Sci . USA 95:7057-7062 .
10. Cellini, C., V . S . Kalogeraki, and S . C . Winans. 1997 . The hydrophobic TraM protein of pKM101 is required for conjugal transfer and sensitivity to donor-specific bacteriophage . Plasmid 37:181-188.
11. Christie, P . J. 2001 . Type IV secretion: intercellular transfer of macromolecules by systems ancestrally related to conjugation machines . Mol . Microbiol . 40:294-305.
12. Covacci, A., J . L . Telford, G . Del Giudice, J . Parsonnet, and R . Rappuoli. 1999 . Helicobacter pylori virulence and genetic geography . Science 284:1328-1333 .
13. Das, A., L . B . Anderson, and Y.-H . Xie. 1997 . Delineation of the interaction domains of Agrobacterium tumefaciens VirB7 and VirB9 by use of the yeast two-hybrid assay . J . Bacteriol . 179:3404-3409.
14. Das, A., and Y.-H . Xie. 2000 . The Agrobacterium T-DNA transport pore proteins VirB8, VirB9, and VirB10 interact with one another . J . Bacteriol . 182:758-763 .
15. Dijkstra, A . J., and W . Keck. 1996 . Peptidoglycan as a barrier to transenvelope transport . J . Bacteriol . 178:5555-5562.
16. Dijkstra, B . W., and A.-M . W . H . Thunnissen. 1994 . Holy proteins II: the soluble lytic transglycosylase . Curr . Opin . Struct . Biol . 8:810-813.
17. Eisenbrandt, R., M . Kalkum, R . Lurz, and E . Lanka. 2000 . Maturation of IncP pilin precursors resembles the catalytic dyad-like mechanism of leader peptidases . J . Bacteriol . 182:6751-6761 .
18. Fernandez, D., T . A . T . Dang, G . M . Spudich, X.-R . Zhou, B . R . Berger, and P . J . Christie. 1996 . The Agrobacterium tumefaciens virB7 gene product, a proposed component of the T-complex transport apparatus, is a membrane-associated lipoprotein exposed at the periplasmic surface . J . Bacteriol . 178:3156-3167.
19. Fernandez, D., G . M . Spudich, X.-R . Zhou, and P . J . Christie. 1996 . The Agrobacterium tumefaciens virB7 lipoprotein is required for stabilization of VirB proteins during assembly of the T-complex transport apparatus . J . Bacteriol . 178:3168-3176.
20. Fischer, W., R . Haas, and S . Odenbreit. 2002 . Type IV secretion systems in pathogenic bacteria . Int . J . Med . Microbiol . 292:159-168.
21. Fischer, W., J . Püls, R . Buhrdorf, B . Gebert, S . Odenbreit, and R . Haas. 2001 . Systematic mutagenesis of the Helicobacter pylori cag pathogenicity island: essential genes for CagA translocation in host cells and induction of interleukin-8 . Mol . Microbiol . 42:1337-1348.
22. Frost, L . S., K . Ippen-Ihler, and R . A . Skurray. 1994 . Analysis of the sequence and gene products of the transfer region of the F sex factor . Microbiol . Rev . 58:162-210.
23. Garfinkel, D . J., R . B . Simpson, L . W . Ream, F . F . White, M . P . Gordon, and E . W . Nester. 1981 . Genetic analysis of crown gall: fine structure map of the T-DNA by site-directed mutagenesis . Cell 27:143-153.
24. Guzman, L . M., D . Belin, M . J . Carson, and J . Beckwith. 1995 . Tight regulation, modulation, and high-level expression by vectors containing the arabinose pBAD promoter . J . Bacteriol . 177:4121-4130.
25. Hapfelmeier, S., N . Domke, P . C . Zambryski, and C . Baron. 2000 . VirB6 is required for stabilization of VirB5 and VirB3 and formation of VirB7 homodimers in Agrobacterium tumefaciens. J . Bacteriol . 182:4505-4511 .
26. Höltje, J . V. 1998 . Growth of the stress-bearing and shape-maintaining murein sacculus of Escherichia coli. Microbiol . Mol . Biol . Rev . 62:181-203 .
27. Jakubowski, S . J., V . Krishnamoorthy, and P . J . Christie. 2003 . Agrobacterium tumefaciens VirB6 protein participates in formation of VirB7 and VirB9 complexes required for type IV secretion . J . Bacteriol . 185:2867-2878 .
28. Koraimann, G. 2003 . Cell wall degrading enzymes in macromolecular transport systems of Gram-negative bacteria . Cell . Mol . Life Sci . 60:2371-2378.
29. Krall, L., U . Wiedemann, G . Unsin, S . Weiss, N . Domke, and C . Baron. 2002 . Detergent extraction identifies different VirB protein subassemblies of the type IV secretion machinery in the membranes of Agrobacterium tumefaciens. Proc . Natl . Acad . Sci . USA 99:11405-11410 .
30. Kumar, R . B., and A . Das. 2002 . Polar location and functional domains of the Agrobacterium tumefaciens DNA transfer protein VirD4 . Mol . Microbiol . 43:1523-1532.
31. Laemmli, U . K. 1970 . Cleavage of structural proteins during the assembly of the head of bacteriophage T4 . Nature 227:680-685.
32. Lai, E.-M., and C . I . Kado. 1998 . Processed VirB2 is the major subunit of the promiscuous pilus of Agrobacterium tumefaciens. J . Bacteriol . 180:2711-2717 .
33. Lai, E.-M., and C . I . Kado. 2000 . The T-pilus of Agrobacterium tumefaciens. Trends Microbiol . 8:361-369.
34. Lessl, M., and E . Lanka. 1994 . Common mechanisms in bacterial conjugation and Ti-mediated T-DNA transfer to plant cells . Cell 77:321-324.
35. Liu, Z., and A . N . Binns. 2003 . Functional subsets of the VirB type IV transport complex proteins involved in the capacity of Agrobacterium tumefaciens to serve as a recipient in virB-mediated conjugal transfer of plasmid RSF1010 . J . Bacteriol . 185:3259-3269 .
36. Llosa, M., F . X . Gomis-Ruth, M . Coll, and F . de la Cruz. 2002 . Bacterial conjugation: a two-step mechanism for DNA transport . Mol . Microbiol . 45:1-8.
37. Llosa, M., J . Zupan, C . Baron, and P . C . Zambryski. 2000 . The N- and C-terminal portions of the Agrobacterium VirB1 protein independently enhance tumorigenesis . J . Bacteriol . 182:3437-3445 .
38. Maniatis, T . A., E . F . Fritsch, and J . Sambrook. 1982 . Molecular cloning: a laboratory manual . Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
39. Mushegian, A . R., K . J . Fullner, E . V . Koonin, and E . W . Nester. 1996 . A family of lysozyme-like virulence factors in bacterial pathogens . Proc . Natl . Acad . Sci . USA 93:7321-7326 .
40. O'Callaghan, D., C . Cazevieille, A . Allardet-Servent, M . L . Boschiroli, G . Bourg, V . Foulongne, P . Frutus, Y . Kulakov, and M . Ramuz. 1999 . A homologue of the Agrobacterium tumefaciens VirB and Bordetella pertussis Ptl type IV secretion systems is essential for intracellular survival of Brucella suis. Mol . Microbiol . 33:1210-1220.
41. Pohlman, R . F., H . D . Genetti, and S . C . Winans. 1994 . Common ancestry between IncN conjugal transfer genes and macromolecular export systems of plant and animal pathogens . Mol . Microbiol . 14:655-668.
42. Rohde, M., J . Püls, R . Buhrdorf, W . Fischer, and R . Haas. 2003 . A novel sheathed surface organelle of the Helicobacter pylori type IV secretion system . Mol . Microbiol . 49:219-234.
43. Sagulenko, E., V . Sagulenko, J . Chen, and P . J . Christie. 2001 . Role of Agrobacterium VirB11 ATPase in T-pilus assembly and substrate selection . J . Bacteriol . 183:5813-5825 .
44. Schägger, H., and G . von Jagow. 1987 . Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range of 1 to 100 kDa . Anal . Biochem . 166:368-379.
45. Schmidt-Eisenlohr, H., N . Domke, C . Angerer, G . Wanner, P . C . Zambryski, and C . Baron. 1999 . Vir proteins stabilize VirB5 and mediate its association with the T pilus of Agrobacterium tumefaciens. J . Bacteriol . 181:7485-7492 .
46. Schmidt-Eisenlohr, H., N . Domke, and C . Baron. 1999 . TraC of IncN plasmid pKM101 associates with membranes and extracellular high molecular weight structures in Escherichia coli. J . Bacteriol . 181:5563-5571 .
47. Stahl, L . E., A . Jacobs, and A . N . Binns. 1998 . The conjugal intermediate of plasmid RSF1010 inhibits Agrobacterium tumefaciens virulence and VirB-dependent export of VirE2 . J . Bacteriol . 180:3933-3939 .
48. Tabor, S., and C . Richardson. 1985 . A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes . Proc . Natl . Acad . Sci . USA 82:1074-1078.
49. Tomb, J . F., O . White, A . R . Kerlavage, R . A . Clayton, G . G . Sutton, R . D . Fleischmann, K . A . Ketchum, H . P . Klenk, S . Gill, B . A . Dougherty, K . Nelson, J . Quackenbush, L . Zhou, E . F . Kirkness, S . Peterson, B . Loftus, D . Richardson, R . Dodson, H . G . Khalak, A . Glodek, K . McKenney, L . M . Fitzegerald, N . Lee, M . D . Adams, and J . C . Venter. 1997 . The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388:539-547.
50. van Asselt, E . J., K . H . Kalk, and B . W . Dijkstra. 2000 . Crystallographic studies of the interactions of Escherichia coli lytic transglycosylase Slt35 with peptidoglycan . Biochemistry 39:1924-1934.
51. van Asselt, E . J., A . M . Thunissen, and B . W . Dijkstra. 1999 . High resolution crystal structures of the Escherichia coli lytic transglycosylase Slt70 and its complex with a peptidoglycan fragment . J . Mol . Biol . 291:877-898.
52. Vergunst, A . C., B . Schrammeijer, A . den Dulk-Ras, C . M . de Vlaam, T . J . Regensburg-Tuink, and P . J . Hooykaas. 2000 . VirB/D4-dependent protein translocation from Agrobacterium into plant cells . Science 290:979-982 .
53. Ward, D., O . Draper, J . R . Zupan, and P . C . Zambryski. 2002 . Peptide linkage mapping of the A . tumefaciens vir-encoded type IV secretion system reveals novel protein subassemblies . Proc . Natl . Acad . Sci . USA 99:11493-11500 .
54. Winans, S . C., and G . C . Walker. 1985 . Conjugal transfer system of the N incompatibility plasmid pKM101 . J . Bacteriol . 161:402-410.
55. Yanisch-Perron, C., J . Viera, and J . Messing. 1985 . Improved M13 phage cloning vectors and host strains: nucleotide sequence of the M13mp18 and pUC18 vectors . Gene 33:103-119.
56. Zechner, E . L., F . de la Cruz, R . Eisenbrandt, A . M . Grahn, G . Koraimann, E . Lanka, G . Muth, W . Pansegrau, C . M . Thomas, B . M . Wilkins, and M . Zatyka. 2000 . Conjugative DNA transfer processes . Harwood Academic Publishers, Amsterdam, The Netherlands.

Free Online Full-text Article

What Is Yeast?, What Is Molecular Biology?, What Is Cell Biology?, What Is Rhizobia?, What Is Growth Medium?, s, Microbes, s, Microorganisms, i, Bacteria, i, Microbe, o, Microbiology, a, Corynebacter, a, Vibriosis, n, Antibiotics, r, Proteus, c, Paracocci, n, Staphylococcus, o, Bacteriological, s, Escherichia coli, r, Fermentations, c, Escherichia coli, n, Pseudomonas aeruginosa, a, Paracocci, n, Salmonella, e, Escherichia coli, r, Shigella, n, Escherichia coli, c, Nitrifying, o, Serratia, i, Escherichia coli, n, Microorganisms, o, Agrobacterium




 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005