Journal of Bacteriology, March 2004, p . 1249-1257, Vol . 186, No . 5

Capsule Shields the Function of Short Bacterial Adhesins

Mark A . Schembri,¹ Dorte Dalsgaard,¹ and Per Klemm^1*

Microbial Adhesion Group, BioCentrum-DTU, Technical University of Denmark, DK-2800 Lyngby, Denmark¹

Received 26 September 2003/ Accepted 26 November 2003

 
Bacterial surface structures such as capsules and adhesins are generally regarded as important virulence factors . Here we demonstrate that capsules block the function of the self-recognizing protein antigen 43 through physical shielding . The phenomenon is not restricted to Escherichia coli but can occur in other gram-negative bacteria . Likewise, we show that other short adhesins exemplified by the AIDA-I protein are blocked by the presence of a capsule. The results support the notion that capsule polysaccharides sterically prevent receptor-target recognition of short bacterial adhesins . This negative interference has important biological consequences, such as affecting the ability of bacteria to form biofilms.

 
All members of the Enterobacteriaceae are able to elaboratea layer of surface-associated polysaccharides called the capsule.The composition of these capsular polysaccharides is very muchstrain dependent . In Escherichia coli it may be one of the 80 distinct polysaccharides [designated the K antigens] or a polymer derived from the 170 different O antigens . In effect, whereasall polysaccharide K antigens form a capsule structure, theinverse is not always true: not all capsules are composed ofK antigens [53].

Capsule polysaccharides provide protection against desiccationand attack from phages, however, they are first and foremostrecognized virulence determinants . It has been known for yearsthat some capsular antigens, notably K1 and certain types ofO antigen, are strongly associated with extraintestinal infectionssuch as septicemia, meningitis, and urinary tract infection[UTI] [19, 25, 28, 32, 46] . E . coli strains of serotype K1 represent 80% of all E . coli strains isolated from cases of newborn meningitisand sepsis in humans . Also, K1 strains are often implicatedin UTI . The K1 capsule is a linear homopolymer of sialic acidresidues . The capsule is identical to the polysialic acid found on certain human cells and is poorly immunogenic due to molecular mimicry of host structures [49] . Strains causing UTI, meningitis,and sepsis are generally resistant to the bactericidal actionof human serum [reviewed in references 34, 53] . Furthermore,K1 capsules are antiphagocytic, arguably a trait that wouldbe helpful to a bacterium for survival in blood and tissue.

Another group of virulence factors is constituted by the bacterial adhesins, protein structures that recognize a wide range ofmolecular motifs and provide targeting of the bacteria to specifictissue surfaces in the host [for a recent review, see reference 24] . While most adhesins recognize nonself targets present in the environment [e.g., a specific saccharide], some mediate self-recognition.

Antigen 43 [Ag43] is exceptional in being such a self-recognizing adhesin [15, 21] . Ag43 is a surface protein that confers bacterialcell-to-cell aggregation, a trait that can be visualized macroscopicallyas flocculation and settling of cells from static liquid suspensions;hence, the gene name flu was originally coined for the correspondinggenetic locus [12] . In an independent study, a major E . coliouter membrane protein antigen was investigated by virtue ofits aggregative properties and termed Ag43 [29] . Only laterwas Ag43 identified as the product of the flu gene [15, 18].In line with the gene product name Ag43, the term agn43 is alsofrequently used for the corresponding gene instead of flu . Ag43expression confers a characteristic frizzy colony morphology[16] . Expression is phase variable with switching rates of 10^-3 per cell per generation under normal growth conditions due to the concerted action of the Dam methylase [positive regulation]and the OxyR redox sensor [negative regulation] [18, 38, 41,52] . Ag43 is an autotransporter protein, and all informationrequired for traverse of the bacterial membrane system and finalrouting to the surface resides in the protein itself . This isalso supported by the fact that Ag43 can be expressed in a widerange of gram-negative bacteria [20, 21] . In E . coli, Ag43 ispresent in 50,000 copies per cell [30] . It is processed intotwo subunits, and ß, each constituting about halfof the protein . The ß subunit is an outer membranecomponent that presumably forms a pore through which Ag43 gainsaccess to the surface . The subunit remains attached to thecell surface via interaction with the ß subunit butcan be detached by brief heat treatment [18].

Expression of Ag43 dramatically enhances biofilm formation in bacteria [9, 21, 22, 23], and Ag43 expression in E . coli is specifically correlated with the biofilm mode of growth [39]. Conversely, lesions in the flu gene causing abolishment of Ag43 expression in many cases result in cells with a very limited ability to form a biofilm [9, 22, 39] . Biofilm formation isoften correlated with bacterial virulence [8, 37] . Expression of Ag43 was recently reported to be correlated with biofilm formation by uropathogenic E . coli during infection of bladder cells [1] . Furthermore, Ag43-mediated cell aggregation was foundto protect bacteria against killing agents like hydrogen peroxide[38] . Ag43 is widespread in E . coli, and it is expressed inmany pathogenic strains . A survey of enteropathogenic and UTIstrains showed that 77 and 60%, respectively, of these werecapable of Ag43 expression [31] . Also, many strains possessduplex or multiple copies of the gene, as seems to be the casewith enteropathogenic and enterohemorrhagic subtypes [23, 35, 48] . Ag43 exhibits significant homology to several other membersof the autotransporter protein family; for example, the primarystructure of the AIDA-I adhesin, involved in diffuse adherenceof enteropathogenic E . coli strains, shows 31% identity to Ag43[5].

Both Ag43 and capsules seem to play important roles in bacterial survival and pathogenicity . However, while Ag43 protrudes 10 nm beyond the outer membrane [23], the capsule may extend 0.2to 1.0 µm from the bacterial surface, depending on its type and composition . On one hand, the capsule constitutes a somewhat ephemeral structure that might not interfere with theclose cellular contact required for intercellular Ag43 contact.On the other hand, it could be that the presence of a capsulewould sterically shield Ag43 and abolish Ag43-Ag43-mediatedcell aggregation . To resolve this apparent paradox, we investigated possible interference between Ag43 and capsule.

 
Bacterial strains and growth conditions. The strains and plasmids used in this study are listed in Table1 . Cells were grown at 37°C on solid or in liquid Luria-Bertani[LB] medium supplemented with the appropriate antibiotics unlessotherwise stated.

 
Construction of an oxyR::kan mutant. An E . coli MG1655 oxyR::kan mutant was constructed by using the Red recombinase gene replacement system [10] . Briefly, the kanamycin gene from plasmid pKD4 was amplified by primers containing 40-nucleotide oxyR homology extensions [288, 5'-GGCTGAACACCGCCATTTTCGGCGTGCGGCAGATTCCTGCGTGTAGGCTGGAGCTGCTTC,and 289, 5'-CGCGGATGGCCTCTGCCAGCTGCTCATAGCGGCTGCGCAGCATATGAATATCCTCCTTAG]. This product was digested with DpnI and transformed into MG1655[pKD46],and kanamycin-resistant colonies were selected . The correctdouble-crossover and recombination event was confirmed by PCR and Southern blotting . The Red helper plasmid pKD46 was curedby growth at 37°C, and the subsequent strain was designatedMS641.

DNA manipulations. Isolation of plasmid DNA was carried out with the QIAprep Spinminiprep kit [Qiagen] . Restriction endonucleases were used accordingto the manufacturer's specifications [Biolabs] . PCRs were madeas previously described [44] . Amplified products were sequencedto ensure fidelity of the PCR by using the ABI PRISM BigDyeTerminator cycle sequencing ready reaction kit [PE Applied Biosystems].Samples were run on an ABI PRISM 310 genetic analyzer [PE AppliedBiosystems] as described in the manufacturer's specifications.

Immunofluorescence microscopy. Surface presentation of Ag43 was assessed by immunofluorescencemicroscopy employing a polyclonal rabbit antiserum raised againstthe subunit of Ag43 . A fluorescein isothiocyanate-labeled anti-rabbit serum was used as a secondary antibody [Sigma] . Cell fixation, immunolabeling, and microscopy were carried out as previously described [16].

Colony morphology. Colony morphology was assayed by employing a Carl Zeiss Axioplanepifluorescence microscope, and digital images were capturedwith a 12-bit cooled slow-scan charge-coupled device camera[KAF 1400 chip; Photometrics, Tucson, Ariz.] controlled by thePMIS software [Photometrics].

Biofilm assay. Biofilm formation on plastic surfaces was monitored in 96-wellpolystyrene microtiter plates . Cells were grown statically for24 h in LB medium at 37°C, washed to remove unbound cells,and stained with crystal violet as previously reported [40]. Quantification of bound cells was performed by addition of acetone-ethanol [20:80] and measurement of the dissolved crystal violet at an optical density of 600 nm.

Cell adhesion assay. Adherence of bacteria to mammalian HT29 colon cancer cells wasperformed as follows . A monolayer of cells was grown to 95%confluence in standard tissue culture medium . Exponentiallygrowing bacterial cells were harvested, washed, and resuspendedin phosphate-buffered saline [containing 0.5% methyl--D-mannopyranoside to rule out any contribution from type 1 fimbriae] at a concentration of 10⁸ cells per ml . Bacteria were incubated together with the HT29 cells for 2 h at 37°C, and afterwards, nonadhered bacteria were removed by extensive washing with phosphate-buffered saline.The cells were then fixed with 70% ice-cold methanol for 15min and examined by phase-contrast microscopy.

 
Ag43 function is inhibited in a wild-type encapsulated uropathogenic E . coli strain. Expression of Ag43 is positively regulated by Dam methyltransferase.We have previously found that the presence of type 1 fimbriaesterically blocks intercellular Ag43-Ag43 interaction [15] andalso affects its expression [41, 42] . Accordingly, when theE . coli K-12 strain MS428, a fim derivative of the K-12 referencestrain MG1655, was transformed with the high-copy-number plasmidpFHC2235 [encoding the dam methyltransferase gene] we expectedit to produce high levels of Ag43 by virtue of the enhancedlevel of the Dam protein . In line with this tenet, the MS428[pFHC2235] transformant produced colonies with a frizzy morphology and aggregating cells that settled from static liquid solutions,i.e., traits that were indicative of high levels of Ag43 production[Fig. 1].

 
The uropathogenic E . coli strain 1177 of serotype O1:K1:H7 was previously studied, and a derivative, CN1016, deficient in expression of type 1 fimbriae was constructed [7] . Strain 1177 has at leastone copy of the flu gene on the chromosome [our unpublisheddata] . When the pFHC2235 plasmid was introduced into these strains,we expected it to induce production of high levels of Ag43 inline with the K-12 control . However, the frizzy colony morphology,aggregation, and cell settling profiles we expected [at leastin the case of the Fim-negative CN1016[pFHC2235] strain] were not observed [Fig . 1] . We therefore speculated whether a surfacefeature other than type 1 fimbriae could interfere with the expression or function of Ag43 . Although this strain is also able to produce P-fimbriae, overexpression of the Dam protein prevents transition from the phase on to the phase off state[6], and we observed that only a small proportion [less than5%] of the colonies produced these organelles . A good candidatetherefore seemed to be the K1 capsule of 1177 and derivatives.

Ag43 function is blocked upon capsule expression in E . coli K-12. Unlike many wild-type strains, E . coli K-12 strains are normallyincapable of producing extended surface-associated polysaccharidesand produce rough colonies; the polysaccharide has a completecore but no O antigen due to the insertion of an IS5 elementin the rfb gene cluster controlling O antigen biosynthesis [27].This makes K-12 a perfect test bed for monitoring potentialinterference of capsular polysaccharides with Ag43 . When plasmidscarrying the gene cluster required for either K1 or K5 capsuleproduction were introduced in strain MG1655, colonies with acharacteristic smooth appearance resulted [Fig. 1] . It shouldbe noted that we also used a version of MG1655 [i.e., strainMS427] where the flu gene was deleted from the chromosome [33].Such cells do not aggregate or settle from liquid suspension.Meanwhile, expression of Ag43 in MS427 resulted in cells whichformed frizzy colonies, aggregated, and settled from staticliquid suspensions [Fig. 2] . When cells were forced to concomitantlyexpress both surface factors, i.e., capsule and Ag43, the capsulephenotype was dominant and the cells were unable to aggregate.This could either be due to sterical shielding of Ag43 by thecapsule or capsule production somehow interfering with synthesisor transport of Ag43 to the cell surface . To differentiate betweenthese possibilities, immunofluorescence microscopy was employed[Fig . 2] . This demonstrated that the cells did express Ag43on the surface and that the signal strengths in capsulated andnoncapsulated pairs of strains were similar, indicative of similarlevels of Ag43 on the surface [Fig . 2] . Western blotting ofwhole-cell lysates also indicated that similar amounts of Ag43were present irrespective of encapsulation [data not shown].When settling assays were performed with these cells, they wereincapable of aggregation [data not shown] . Taken together, theresults suggest that a capsule blocks the close cell contactneeded for intercellular Ag43-Ag43 interaction.

 
We also performed the same experiments with an MG1655 oxyR::kan host . In this host, transcription of the flu gene is driven from its natural promoter and the absence of OxyR causes constitutive Ag43 expression . The results indicated that Ag43 was produced but that its function was blocked by the capsule [Fig . 3] . Arguably,unless OxyR is involved, capsule production does not seem toinfluence transcription of the flu gene and transport of Ag43to the cell surface . The data support the notion that a capsule sterically shields Ag43-Ag43 interaction.

 
Ag43 function can be restored by capsule loss in Klebsiella pneumonia. The vast majority of K . pneumoniae strains express a large polysaccharide capsule . However, noncapsulated variants [NCVs] arise spontaneously. An isogenic pair of K . pneumoniae strain C105 clones, differing only in their ability to express K35 capsule antigen, was recently characterized [45] . When this C105/C105NCV pair was transformedwith plasmid pHHA147, harboring a constitutively expressed flugene, a characteristic frizzy colony morphology resulted inthe case of strain C105NCV[pHHA147], whereas little or no differencein colony morphology was seen in strain C105[pHHA147] [Fig.4] . Microscopic observation of C105NCV[pHHA147] revealed thepresence of cell aggregates, whereas no aggregates were observedwith C105[pHHA147] cells [Fig . 4] . Additionally, we introducedAg43-expressing plasmids into a number of other gram-negativebacteria from the institute strain collection with a known abilityto produce capsules, viz., Enterobacter cloacae, Serratia liquefaciens, Burkholderia cepacia, and Pseudomonas aeruginosa . Although Ag43 was expressed on the cell surface, none of the transformed strains were capable of aggregating or settling from standing overnight cultures [data not shown] . These observations further bolsterthe notion of negative interference between capsule and Ag43;they also take it from being a phenomenon restricted to E . colito being a general phenomenon valid in a range of gram-negativebacteria.

 
Biofilm aspects. We and others have demonstrated that Ag43 expression confersexcellent biofilm forming properties upon a variety of bacteria[9, 21, 22, 23, 38, 39] . Since we have demonstrated here thatthe presence of a capsule virtually abolishes Ag43 functionality,we surmised that encapsulated cells expressing both capsuleand Ag43 would be impaired in biofilm formation compared tononcapsulated cells . To test this hypothesis, a set of strainsdiffering in their ability to produce capsule and Ag43 wereinvestigated for their ability to form biofilms on an abioticsurface [in this case polystyrene microtiter plates] . Our resultsrevealed that in capsulated cells expression of Ag43 did notimprove biofilm formation, whereas in a noncapsulated straina significant improvement was observed when Ag43 was expressed[Fig . 5] . It should also be noted that when the capsulated and noncapsulated pair of strains were compared, the noncapsulated variant appeared to be a slightly better biofilm former . Thisis probably due to capsule shielding of other [non-Ag43] factorsthat improve biofilm formation.

 
The action of other autotransporter adhesins similar to Ag43 is abolished by capsule shielding. The AIDA-I autotransporter is a potent adhesin involved in theadherence of enteropathogenic E . coli strains to various mammaliancells [4, 5] . The AIDA-I adhesin and Ag43 are predicted to have the same overall tertiary structure . We speculated that, since capsulation obstructs the activity of Ag43, it might also interfere with the activity of similar-sized proteins such as AIDA-I.To test this, we introduced a plasmid, pIB264, encoding theAIDA-I locus [4] into a pair of host cells differing in theirability to produce a capsule, viz., C105 and C105 NCV . The abilityof these strains to adhere to human intestinal cell line cells[HT29 cells] was assayed . Bacteria producing both AIDA-I andcapsule were unable to adhere, whereas bacteria producing AIDA-I,but not capsule, bound in large numbers [Fig . 6].

 
Bacteria express a number of surface structures that enablethem to interact with the environment, e.g., flagella for swimmingand adhesins for attachment . These surface structures have ahighly diverse size spectrum, and it must be implicit that sometimesthey must interfere physically with each other in such a waythat the function of some will be obstructed by the presenceof other [more extended] structures . As an example, it was previouslydemonstrated that fimbriae, which extend 1 µm from thebacterial surface, physically block the action of the much shorterAg43 in bacteria [15] . Based on this observation, we predictthat fimbriae will also block the action of other adhesins similarin size to Ag43 . Such surface structure interference must haveimportant consequences for the interplay of bacteria with theenvironment . Here, we have studied the interference betweennonfimbrial adhesins and capsule.

Several lines of evidence indicated that Ag43 function was sterically blocked by extended polysaccharides . In a uropathogenic E . coli strain of serotype K1, Ag43 could be expressed but it was inactive. In E . coli K-12 strains expressing Ag43, aggregation was abolished when these strains were made to express either K1 or K5 capsules. Furthermore, in a well-characterized strain set of K . pneumoniae, differing only in capsulation, Ag43 activity was only observed in the NCV . In line with this, Ag43 activity was blocked ina range of bacterial strains, arguably due to capsule interference.All phenotypic traits associated with Ag43 were affected: cell aggregation, settling from static liquid suspension, biofilm formation, and in most cases, colony morphology . The interference between capsule and Ag43 was physical in nature rather thanby genetic cross talk . Negative interference between capsuleand Ag43 seemed to be a general phenomenon in a range of gram-negative bacteria and was not isolated to E . coli . Bacterial capsules might provide various degrees of blockage depending on their thickness and quantity and perhaps also on their charge.

An important aspect of this study was the finding that capsulation not only interfered with the function of Ag43 but also shieldedand blocked the action of another autotransporter adhesin, namelyAIDA-I . Both adhesins have been predicted to protrude 10 nmfrom the bacterial surface . The implications of these findings are far-ranging because it means that an entire class of short nonorganelle bacterial adhesins and invasins are nonfunctionalin the presence of a capsule . This class encompasses not onlythe autotransporter adhesins and invasins such as TibA, AIDA-I,and Ag43 from enterics but also autotransporters from a widespectrum of bacteria, including pertactin P.69 and TcfA fromBordetella, Hsf from Haemophilus influenzae, and UspA1 fromMoraxella catarrhalis [for a review, see reference 17] . Additionally,there are numerous other nonfimbrial adhesins and invasins exemplifiedby Afa-I and intimin [reviewed in references 24 and 43], whichwould be candidates for capsule shielding . In line with ourdata, several other studies have actually reported that capsulatedbacteria adhere poorly to epithelial cells and exhibit severereductions in their abilities to invade compared to their capsulatedcounterparts [14, 36] . In Neisseria meningitidis, the adhesive Opc protein was reported to be active only in acapsulated strains [51] . A study of E . coli P-fimbrial adhesins expressed in anonorganelle context revealed their activity could be blockedby extensive O antigens [50] . Finally, the synthesis of lipopolysaccharideby enterohemorrhagic E . coli O157:H7 was shown to interferewith adherence to HeLa cells in vitro [47].

The capsule shielding concept leaves the bacteria with an obvious dilemma . They cannot adhere or invade without the assistanceof adhesin proteins, but at the same time, the capsule provides protection against many of the countermeasures at the disposalof a mammalian host such as phagocytosis or complement, etc.Arguably, bacteria that use short adhesins and invasins wouldhave to coordinate their expression with that of capsules . Analternative solution would be to express adhesins that can penetrateand reach beyond the capsule, viz., fimbriae.

At present, it is hard to say whether bacteria actually coordinate production of capsules and nonorganelle adhesins, and to ourbest knowledge, no reports to this end are available from theliterature . The regulation of capsule gene expression is complex,with overlapping regulatory circuits . Capsule expression hasin many cases been reported to be phase variable, for example,in Bacteroides fragilis [26], N . meningitidis [11], and Campylobacter[3] . In K . pneumoniae, some types of capsule production werereported to be influenced by environmental conditions [14].Arguably, differential expression of capsules will intermittentlyresult in a noncapsulated state where nonorganelle adhesinslike Ag43 and AIDA-I would be exposed.

Ag43 promotes bacterial biofilm formation and aggregation, bothof which are traits closely associated with bacterial virulence[1, 8] . Capsulation protects bacteria that live in close associationwith a mammalian host against several defense mechanisms . Thefuture challenge is to decipher how the bacteria orchestrate the expression of these two important types of surface structures to make use of their full survival and virulence capabilities.

 
We thank Birthe Jul Jorgensen and Louise Hjerrild for technical assistance, Ian Roberts, University of Manchester, for providing plasmids pKT274 and pIR100, Alexander Schmidt, Westfälische Wilhelms-Universität, for providing plasmid pIB264, andKaren Krogfelt, Statens Serum Institut Denmark, for providingKlebsiella strains C105 and C105 NCV.

This work was supported by the Danish Natural Sciences [grants 21-01-0296 and 51-00-0291] and the Danish Technical [26-02-0183] Research Councils.

 
* Corresponding author . Mailing address: Section of Molecular Microbiology, BioCentrum-DTU, Bldg . 301, Technical University of Denmark, DK-2800 Lyngby, Denmark . Phone: 45 45 25 25 06 . Fax: 45 45 93 28 09 . E-mail: pkl@biocentrum.dtu.dk.

1. Anderson, G . G., J . J . Palermo, J . D . Schilling, R . Roth, J . Heuser, and S . J . Hultgren. 2003 . Intracellular bacterial biofilm-like pods in urinary tract infections . Science 301:105-107 .
2. Bachmann, B. 1996 . Derivations and genotypes of some mutant derivatives of Escherichia coli K-12, p . 2460-2488 . In F . C . Neidhardt et al . [ed.], Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed . ASM Press, Washington, D.C.
3. Bacon, D . J., C . M . Szymanski, D . H . Burr, R . P . Silver, R . A . Alm, and P . Guerry. 2001 . A phase variable capsule is involved in virulence of Campylobacter jejuni 81-176 . Mol . Microbiol . 40:769-777.
4. Benz, I., and M . A . Schmidt. 1989 . Cloning and expression of an adhesin [AIDA-I] involved in diffuse adherence of enteropathogenic Escherichia coli . Infect . Immun . 57:1506-1511.
5. Benz, I., and M . A . Schmidt. 1992 . AIDA-I, the adhesin involved in diffuse adherence of the diarrhoeagenic Escherichia coli strain 2787 [O126:H27], is synthesized via a precursor molecule . Mol . Microbiol . 6:1539-1546.
6. Blyn, L . B., B . A . Braaten, and D . A . Low. 1990 . Regulation of pap pilin phase variation by a mechanism involving differential dam methylation states . EMBO J . 9:4045-4054.
7. Connell, H., W . Agace, P . Klemm, M . Schembri, S . Mårild, and C . Svanborg. 1996 . Type 1 fimbrial expression enhances Escherichia coli virulence for the urinary tract . Proc . Natl . Acad . Sci . USA 93:9827-9832 .
8. Costerson, J . W., P . S . Stewart, and E . P . Greenberg. 1999 . Bacterial biofilms: a common cause of persistent infections . Science 284:1318-1322 .
9. Danese, P . N., I . A . Pratt, S . Dove, and R . Kolter. 2000 . The outer-membrane protein, Ag43, mediates cell-to-cell interactions within E . coli biofilms . Mol . Microbiol . 37:424-432.
10. Datsenko, K . A., and B . L . Wanner. 2000 . One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products . Proc . Natl . Acad . Sci . USA 97:6640-6645 .
11. de Vries, F . P., A . van der Ende, J . P . van Putten, and J . Dankert. 1996 . Invasion of primary nasopharyngeal epithelial cells by Neisseria meningitidis is controlled by phase variation of multiple surface antigens . Infect . Immun . 64:2998-3006.
12. Diderichsen, B. 1980 . flu, a metastable gene controlling surface properties of Escherichia coli . J . Bacteriol . 141:858-867.
13. Echarti, C., B . Hirschel, G . J . Boulnois, J . M . Varley, F . Waldvogel, and K . N . Timmis. 1983 . Cloning and analysis of the K1 capsule biosynthesis genes of Escherichia coli: lack of homology with Neisseria meningitidis group B DNA sequences . Infect . Immun . 41:54-60.
14. Favre-Bonte, S., T . R . Licht, C . Forestier, and K . A . Krogfelt. 1999 . Klebsiella pneumoniae capsule expression is necessary for colonization of large intestines of streptomycin-treated mice . Infect . Immun . 67:6152-6156 .
15. Hasman, H., T . Chakraborty, and P . Klemm. 1999 . Antigen-43-mediated autoaggregation of Escherichia coli is blocked by fimbriation . J . Bacteriol . 181:4834-4841 .
16. Hasman, H., M . A . Schembri, and P . Klemm. 2000 . Antigen 43 and type 1 fimbriae determine colony morphology of Escherichia coli K-12 . J . Bacteriol . 182:1089-1095 .
17. Henderson, I . R., and J . P . Nataro. 2001 . Virulence functions of autotransporter proteins . Infect . Immun . 69:1231-1243.
18. Henderson, I . R., and P . Owen. 1999 . The major phase-variable outer membrane protein of Escherichia coli structurally resembles the immunoglobulin A1 protease class of exported protein and is regulated by a novel mechanism involving Dam and OxyR . J . Bacteriol . 181:2132-2141 .
19. Jann, B., and K . Jann. 1997 . Capsules of Escherichia coli, p . 113-143 . In M . Sussman [ed.], Mechanisms of virulence . Cambridge University Press, Cambridge, England.
20. Kjaergaard, K., H . Hasman, M . A . Schembri, and P . Klemm. 2002 . Antigen 43-mediated autotransporter display, a versatile bacterial cell surface presentation system . J . Bacteriol . 184:4197-4204 .
21. Kjaergaard, K., M . A . Schembri, H . Hasman, and P . Klemm. 2000 . Antigen 43 from Escherichia coli induces inter- and intraspecies cell aggregation and changes in colony morphology of Pseudomonas fluorescens . J . Bacteriol . 182:4789-4796 .
22. Kjaergaard, K., M . A . Schembri, C . Ramos, S . Molin, and P . Klemm. 2000 . Antigen 43 facilitates formation of multispecies biofilms . Environ . Microbiol . 2:695-702.
23. Klemm, P., L . Hjerrild, M . Gjermansen, and M . A . Schembri. 2004 . Structure-function analysis of the self-recognizing antigen 43 autotransporter protein from Escherichia coli . Mol . Microbiol . 51:283-296.
24. Klemm, P., and M . A . Schembri. 2000 . Bacterial adhesins: function and structure . Int . J . Med . Microbiol . 290:27-35.
25. Korhonen, T . K., M . V . Valtonen, J . Parkkinen, V . Väisanen-Rhen, J . Finne, F . Ųrskov, I . Ųrskov, S . B . Svenson, and P . H . Mäkelä. 1985 . Serotypes, hemolysin production, and receptor recognition of Escherichia coli strains associated with neonatal sepsis and meningitis . Infect . Immun . 48:486-491.
26. Krinos, C . M., M . J . Coyne, K . G . Weinacht, A . O . Tzianabos, D . L . Kasper, and L . E . Comstock. 2001 . Extensive surface diversity of a commensal microorganism by multiple DNA inversions . Nature 414:555-558.
27. Liu, D., and P . R . Reeves. 1994 . Escherichia coli K12 regains its O antigen . Microbiology 140:49-57.
28. Ott, M., L . Bender, G . Blum, M . Schmittroth, M . Achtman, H . Tschärpe, and J . Hacker. 1991 . Virulence patterns and long-range genetic mapping of extraintestinal Escherichia coli K1, K5, K100 isolates: use of pulse-field electrophoresis . Infect . Immun . 59:2664-2672.
29. Owen, P. 1983 . Antigens of the Escherichia coli cell envelope, p . 347-373 . In O . J . Bjerrum [ed.], Electroimmunochemical analysis of membrane proteins . Elsevier Science Publishing, Inc., Amsterdam, The Netherlands.
30. Owen, P. 1992 . The gram-negative outer membrane: structure, biochemistry and vaccine potential . Biochem . Soc . Trans . 20:1-6.
31. Owen, P., M . Meehan, H . de Loughry-Doherty, and I . Henderson. 1996 . Phase-variable outer membrane proteins in Escherichia coli . FEMS Immunol . Med . Microbiol . 16:63-76.
32. Podshun, R., D . Sievers, A . Fischer, and U . Ullmann. 1993 . Serotypes, hemagglutinins, siderophore synthesis, and serum resistance of Klebsiella isolates causing human urinary tract infections . J . Infect . Dis . 168:1415-1421.
33. Reisner, A., J . A . J . Haagensen, M . A . Schembri, E . L . Zechner, and S . Molin. 2003 . Development and maturation of Escherichia coli K-12 biofilms . Mol . Microbiol . 48:933-946.
34. Roberts, I . S. 1995 . Bacterial polysaccharides in sickness and in health . Microbiology 141:2023-2031.
35. Roche, A . J., J . P . McFadden, and P . Owen. 2001 . Antigen 43, the major phase-variable protein of the Escherichia coli outer membrane, can exist as a family of proteins encoded by multiple alleles . Microbiology 147:161-169 .
36. Sahly, H., R . Podschun, T . Oelschlaeger, M . Greiwe, H . Parlois, D . L . Hasty, J . Kekow, U . Ullman, I . Ofek, and S . Sela. 2000 . Capsule impedes adhesion to and invasion of epithelial cells by Klebsiella pneumoniae . Infect . Immun . 68:6744-6749 .
37. Schembri, M . A., M . Givskov, and P . Klemm. 2002 . An attractive surface: Gram negative bacterial biofilms . Sci . STKE 132:RE6.
38. Schembri, M . A., L . Hjerrild, M . Gjermansen, and P . Klemm. 2003 . Differential expression of the Escherichia coli autoaggregation factor antigen 43 . J . Bacteriol . 185:2236-2242 .
39. Schembri, M . A., K . Kjęrgaard, and P . Klemm. 2003 . Global gene expression in Escherichia coli biofilms . Mol . Microbiol . 48:253-257.
40. Schembri, M . A., and P . Klemm. 2001 . Biofilm formation in a hydrodynamic environment by novel FimH variants and ramifications for virulence . Infect . Immun . 69:1322-1328 .
41. Schembri, M . A., and P . Klemm. 2001 . Coordinate gene regulation by fimbriae-induced signal transduction . EMBO J . 20:3074-3081 .
42. Schembri, M . A., D . W . Ussery, C . Workman, H . Hasman, and P . Klemm. 2002 . DNA microarray analysis of fim mutations in Escherichia coli . Mol . Gen . Genet . 267:721-729.
43. Schmidt, M . A. 1994 . Nonfimbrial adhesins of Escherichia coli, p . 85-96 . In P . Klemm [ed.], Fimbriae adhesin, genetics, biogenesis and vaccines . CRC Press, Boca Raton, Fla.
44. Stentebjerg-Olesen, B., L . Pallesen, L . B . Jensen, G . Christiansen, and P . Klemm. 1997 . Authentic display of a cholera toxin epitope by chimeric type 1 fimbriae: effects of insert position and host background . Microbiology 143:2027-2038.
45. Struve, C., and K . A . Krogfelt. 2003 . Role of capsule in Klebsiella pneumoniae virulence: lack of correlation between in vitro and in vivo studies . FEMS Microbiol . Lett . 218:149-154.
46. Tarkanen, A . M., B . L . Allen, P . H . Williams, M . Kauppi, K . Haahtela, A . Siitonen, I . Orskov, F . Orskov, S . Clegg, and T . K . Korhonen. 1992 . Fimbriation, capsulation, and iron-scavenging systems of Klebsiella strains associated with human urinary tract infection . Infect . Immun . 60:1187-1192.
47. Torres, A . G., and J . B . Kaper. 2003 . Multiple elements controlling adherence of enterohemorrhagic Escherichia coli O157:H7 to HeLa cells . Infect . Immun . 71:4985-4995 .
48. Torres, A . G., N . T . Perna, V . Burland, A . Ruknudin, F . R . Blattner, and J . B . Kaper. 2002 . Characterization of Cah, a calcium-binding and heatextractable autotransporter of enterohemorrhagic Escherichia coli . Mol . Microbiol . 45:951-966.
49. Troy, F . A. 1992 . Polysialylation: from bacteria to brains . Glycobiology 2:5-23.
50. van Die, I., E . Zuidweg, W . Hoekstra, and H . Bergmans. 1986 . The role of fimbriae of uropathogenic Escherichia coli as carrier of the adhesin involved in mannose-resistant hemagglutination . Microb . Pathog. 1:51-56.
51. Virji, M., K . Makepeace, I . R . A . Peak, D . J . P . Ferguson, M . P . Jennings, and E . R . Moxon. 1995 . Opc- and pilus-dependent interactions of meningococci with human endothelial cells: molecular mechanisms and modulation by surface polysaccharides . Mol . Microbiol . 18:741-754.
52. Waldron, D . E., P . Owen, and C . J . Dorman. 2002 . Competitive interaction of the OxyR DNA-binding protein and the Dam methylase at the antigen 43 gene regulatory region in Escherichia coli . Mol . Microbiol . 44:509-520.
53. Whitfield, C., and I . S . Roberts. 1999 . Structure, assembly and regulation of expression of capsules in Escherichia coli . Mol . Microbiol . 31:1307-1319.

Free Online Full-text Article

What Is Biofilm?, What Is Rhizobia?, What Is Botulism?, What Is Amino Acid?, What Is Listeria Monocytogenes?, n, Bacteria, e, Bacteriology, e, Microorganism, o, Microbiology, a, Microorganisms, n, Culture medium, e, Escherichia coli, n, Denitrifying, a, Escherichia coli, c, Antimicrobial, c, Salmonella, i, Streptococcal, s, Microorganism, i, Growth media, c, S. cerevisiae, o, Aeromonades, r, Escherichia coli, n, Escherichia coli, s, Candida albicans, o, Microbiological, r, Growth media, o, Penicillin, o, Botulism, o, Propionibacteria, a, Cell cultures, n, Klebsiella




 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005