Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us


J Hosp Infect, 1995 Dec, 31(4), 247 - 52
Sequential emergence of multi-resistant Klebsiella pneumoniae in Bahrain; Wallace MR et al.; During the mid-1980s, nosocomial infections due to aminoglycoside-resistant Klebsiella pneumonia were prevalent in the intensive care unit (ICU) of the Salamanya Medical Centre, Bahrain . In an attempt to control the spread of such organisms, the third-generation cephalosporins were introduced in early 1987 . Subsequently there was a marked increase in the incidence of cephalosporin resistance among Klebsiella spp . isolated in the ICU . In 1990, over 60% of Klebsiella isolates were resistant to both cephalosporins and aminoglycosides . Cephalosporin resistance was due to production of extended-spectrum beta-lactamases encoded on the same plasmid as aminoglycoside resistance . The incidence of cephalosporin resistance declined during 1991-1992, which was coincident with severe restrictions on the use of third-generation cephalosporins and the preferential use of ciprofloxacin and imipenem for nosocomial klebsiella infections . Sequential overuse of aminoglycosides and cephalosporins for nosocomial klebsiella infection may select for organisms resistant to both classes of antibiotics.

Clin Infect Dis, 1995 Dec, 21(6), 1501 - 3
An outbreak of infusion-related Klebsiella pneumoniae bacteremia in a liver transplantation unit; Goetz AM et al.; Over a 1-month period, there were five episodes of infusion-related Klebsiella pneumoniae bacteremia in four liver transplantation patients housed in the same ward . Investigation of nursing practices revealed that a common normal-saline bag, to which intravenous (iv) tubing and a stopcock were attached, was used to flush iv catheters . The iv tubing and stopcock were changed at sporadic intervals . Cultures of the normal saline and iv equipment yielded K . pneumoniae, which had the same susceptibility pattern as the patients' isolates . Isolates recovered during the outbreak from the patients and from the iv saline/equipment were of the same strain, as determined by pulsed-field electrophoresis of Xba I-digested genomic DNA . Termination of the practice of flushing iv catheters with a common normal-saline bag halted the outbreak.

Eur J Nucl Med, 1995 Dec, 22(12), 1411 - 5
Imaging of pulmonary disease in rheumatoid arthritis using J001X scintigraphy: preliminary results; Goupille P et al.; The purpose of this study was to determine the ability of technetium-99m J001X scintigraphy to image active pulmonary involvement in patients suffering from rheumatoid arthritis (RA) . J001X is a fully characterized acylated poly(1,3)galactoside, isolated from Klebsiella membranes, which is able to bind recruited macrophages after aerosol administration . J001X scintigraphy was compared with high-resolution computed tomography (HRCT), pulmonary function tests (PFTs) and bronchoalveolar lavage (BAL) in 15 patients suffering from RA . Patients were considered to have pulmonary involvement when they had an interstitial syndrome on HRCT and a decrease of 20% in TCO/VE (transfer coefficient) on PFTs and/or an abnormal BAL (lymphocytosis higher than 20% and/or percentage of neutrophils higher than 10%) . Pulmonary involvement was present in eight patients, and absent in seven . Of the eight patients with pulmonary involvement, all had abnormal BAL, two had an interstitial syndrome on HRCT, two had decreased TCO/VE and three had positive J001X scintigraphy . Of the seven patients without pulmonary involvement, six had normal BAL (not available in one), two had an interstitial syndrome on HRCT, one had decreased TCO/VE and two had positive J001X scintigraphy . According to our gold standard of pulmonary involvement, the sensitivity of J001X scintigraphy for the detection of pulmonary involvement in RA was 37.5%, the specificity was 71.4% and the positive predictive value was 60% . The ability of J001X scintigraphy to detect active pulmonary involvement during RA appears unclear in this study but it may detect processes unnoticed by the other modalities . These patients will be followed 12 and 24 months later and the changes in J001X scintigraphy, HRCT and PFTs will be compared to demonstrate whether J001X scintigraphy is able to assess an active process in the pulmonary involvement during RA and to specify its predictive value.

J Formos Med Assoc, 1995 Dec, 94(12), 713 - 8
Bacteremia in acute pancreatitis of different etiologies; Chang KK et al.; To evaluate the rationale of using antibiotics in acute pancreatitis and to determine whether the indication for their use depends upon the etiology of the pancreatitis, the records of 202 patients with acute pancreatitis were retrospectively reviewed . The incidence of abnormal body temperature, leukocytosis, bacteremia and the results of biochemistry tests in different etiologies of the disease were investigated . Pancreatitis was found to be alcohol-related (47 patients), gallstone-related (105 patients), idiopathic (26 patients) and miscellaneous (24 patients) . On admission, 83 patients had abnormal body temperature and 146 patients showed leukocytosis . Bacteremia occurred in 20 patients . Of these, 15 had gallstone-related pancreatitis, two had pancreatic cancers and one developed bacteremia after endoscopic retrograde cholangio-pancreatography (ERCP) . These 18 patients had abnormal biochemistry results (including high serum levels of direct bilirubin, alkaline phosphatase and gamma-glutamyltransferase) and dilated bile ducts on imaging studies, indicating biliary infections . The remaining two patients with bacteremia included one alcoholic patient and one patient with idiopathic pancreatitis . The most commonly involved pathogens were Escherichia coli and Klebsiella pneumoniae . In addition, eight patients (4%) developed secondary pancreatic infections during hospitalization; the blood cultures of seven of these patients were negative on admission . Although fever and leukocytosis are not good predictors of infection in acute pancreatitis our results showed that bacteremia is common in patients whose pancreatitis is related to gallstones, ERCP or pancreatic malignancy with obstructive jaundice . We recommend that antibiotics be used only in this subset of acute pancreatitis patients.

Appl Environ Microbiol, 1995 Dec, 61(12), 4167 - 71
Polymer production by Klebsiella pneumoniae 4-hydroxyphenylacetic acid hydroxylase genes cloned in Escherichia coli; Gibello A et al.; The expression of Klebsiella pneumoniae hpaA and hpaH genes, which code for 4-hydroxyphenylacetic acid hydroxylase in Escherichia coli K-12 derivative strains, is associated with the production of a dark brown pigment in the cultures . This pigment has been identified as a polymer which shows several of the characteristics reported for microbial melanins and results from the oxidative activity of 4-hydroxyphenylacetic acid hydroxylase on some dihydroxylated compounds to form o-quinones . A dibenzoquinone is formed from the oxidation of different mono- or dihydroxylated aromatic compounds by the enzyme prior to polymerization . We report a hydroxylase activity, other than tyrosinase, that is associated with the synthesis of a bacterial melanin.

Gene, 1995 Dec 1, 166(1), 11 - 7
A new gene, cbl, encoding a member of the LysR family of transcriptional regulators belongs to Escherichia coli cys regulon; Iwanicka-Nowicka R et al.; The cbl (cysB-like) gene has been identified in Escherichia coli . The analysis of the cloned cbl sequence revealed strict homology to an ORF of unknown function found initially in Klebsiella aerogenes {Schwacha and Bender, J . Bacteriol . 175 (1993) 2107-2115} . The predicted Cbl protein has structural features of the LysR family of transcriptional activators . It is also strongly similar to the CysB protein, the activator of the cys regulon . The position of cbl on the Ec physical map has been established at a 2070-kb (43.5 min) region between asnU and asnV . The gene is expressed in vivo as a 1-kb monocistronic transcript starting from one major transcription start point . Unexpectedly, the in vivo expression of cbl has shown dependence on CysB, belonging to the same family of proteins . The promoter region of cbl binds purified CysB protein in a manner similar to other CysB-responsive promoters . A cbl disruption mutant was constructed by insertion of a KmR gene cartridge into the ORF on the chromosome . Phenotypes related to cbl expression suggest the involvement of the gene in an accessory regulatory circuit within the cys regulon engaging, in the last step, the function of the cysM gene encoding O-acetylserine (thiol)-lyase B.

Carbohydr Res, 1995 Nov 30, 278(1), 103 - 11
Synthesis of the tetrasaccharide repeating unit of the antigen from Klebsiella type 2; Misra AK et al.; The disaccharide ethyl 2,4,6-tri-O-acetyl-3-O-(2,3,4,6-tetra-O-benzyl-alpha- D-glucopyranosyl)-1-thio-beta-D-glucopyranoside (6) and methyl 2,6-di-O-benzyl-3-O-(methyl 2,3,4-tri-O-benzyl-alpha-D- glucopyranosyluronate)-beta-D-mannopyranoside (21) have been synthesized and condensed in the presence of methyl triflate to afford a tetrasaccharide derivative . Removal of protecting groups gave methyl 3-O-(methyl alpha-D-glucopyranosyluronate)-4-O-(3-O-alpha-D- glucopyranosyl-beta-D-glucopyranosyl)-beta-D-mannopyranoside (23), the repeating unit of the antigen from Klebsiella type 2, in the form of its methyl ester methyl glycoside.

Mol Microbiol, 1995 Nov, 18(3), 579 - 91
nasST, two genes involved in the induction of the assimilatory nitrite-nitrate reductase operon (nasAB) of Azotobacter vinelandii; Gutierrez JC et al.; An operon including two new genes (nasS and nasT) has been defined, cloned and sequenced . The deduced NASS protein is homologous to NRTA from Synechococcus sp . and to NASF from Klebsiella pneumoniae, two proteins involved in nitrate uptake . The predicted NAST polypeptide is homologous to the regulator proteins of the two-component regulatory systems . NASS plays a negative regulatory role in the synthesis of the nitrate and nitrite reductase . NAST is required for the expression of the nitrite-nitrate reductase operon (nasAB) . Expression of the nasST operon is not under the control of the NTR system and is not regulated by the nitrogen source . A Phi(nasA-lacZ) fusion has been used to analyse expression of the nasAB operon in three different genetic backgrounds with altered nitrate reductase activity . Beta-galactosidase activity in two of them was independent of nitrate but in a mutant unable to reduce nitrate, nas-4, it was normally induced by nitrate.

Mol Microbiol, 1995 Nov, 18(3), 533 - 46
Regulation of anaerobic citrate metabolism in Klebsiella pneumoniae; Bott M et al.; Three enzymes are specifically required for uptake and catabolism of citrate by Klebsiella pneumoniae under anaerobic conditions: a Na+ -dependent citrate carrier (CitS), citrate lyase (CitDEF), and the Na+ pump oxaloacetate decarboxylase (OadGAB) . The corresponding genes are clustered on the chromosome, with the citCDEFG genes located upstream and divergent to the citS-oadGAB genes . We found that expression of citS from its native promoter in Escherichia coli requires the DNA region downstream of oadB . Nucleotide sequence analysis of this region revealed the presence of two adjacent genes, citA and citB . By sequence similarity, the predicted CitA and CitB proteins were identified as members of the two-component regulatory systems . The sensor kinase CitA contained, in the N-terminal half, two putative transmembrane helices which enclosed a presumably periplasmic domain of about 130 amino acids . The C-terminal half of the response regulator CitB harboured a helix-turn-helix motif typical of DNA-binding proteins . K . pneumoniae citB null mutants were unable to grow anaerobically with citrate as the sole carbon and energy source (Cit- phenotype) . When cultivated anaerobically with citrate plus glycerol, all of the citrate-specific fermentation enzymes were synthesized in the wild type, but not in the citB mutants . This showed that citS, oadGAB and citDEF required the CitB protein for expression and therefore are part of a regulon . In the wild type, synthesis of CitS, oxaloacetate decarboxylase and citrate lyase was dependent on the presence of citrate, sodium ions and a low oxygen tension . In a citA null mutant which expressed citB constitutively at high levels, none of these signals was required for the formation of the citrate fermentation enzymes . This result suggested that citrate, Na+, and oxygen exerted their regulatory effects via the CitA/CitB system . In the presence of these signals, the citAB gene products induced their own synthesis . The positive autoregulation occurred via co-transcription of citAB with citS and oadGAB.

Proteins, 1995 Nov, 23(3), 370 - 5
Assessment of a protein fold recognition method that takes into account four physicochemical properties: side-chain packing, solvation, hydrogen-bonding, and local conformation; Matsuo Y et al.; A protein fold recognition method was tested by the blind prediction of the structures of a set of proteins . The method evaluates the compatibility of an amino acid sequence with a three-dimensional structure using the four evaluation functions: side-chain packing, solvation, hydrogen-bonding, and local conformation functions . The structures of 14 proteins containing 19 sequences were predicted . The predictions were compared with the experimental structures . The experimental results showed that 9 of the 19 target sequences have known folds or portions of known folds . Among them, the folds of Klebsiella aerogenes urease beta subunit (KAUB) and pyruvate phosphate dikinase domain 4 (PPDK4) were successfully recognized; our method predicted that KAUB and PPDK4 would adopt the folds of macromomycin (Ig-fold) and phosphoribosylanthranilate isomerase:indoleglycerol-phosphate synthase (TIM barrel), respectively, and the experimental structure revealed that they actually adopt the predicted folds . The predictions for the other targets were not successful, but they often gave secondary structural patterns similar to those of the experimental structures.

Infection, 1995 Nov-Dec, 23(6), 371 - 7
Salicylate-enhanced exposure of Klebsiella pneumoniae subcapsular components; Salo RJ et al.; The capsular polysaccharide (CPS) of Klebsiella pneumoniae is an important virulence factor . Salicylate, which inhibits CPS production, was used to expose subcapsular antigens and components that may play an important role in host defense . Salicylate treatment greatly increased phagocytosis of five O1 serotypes by human polymorphonuclear leukocytes with normal rabbit serum and rabbit antisera against purified O1 lipopolysaccharide (O1LPS) as opsonins (p < 0.01 or < 0.05) . Similar results were obtained with rabbit antiserum against a non-encapsulated isogenic strain . To further determine how salicylate increases susceptibility to phagocytosis, the binding of monoclonal antibodies against O1LPS or the LPS core and the binding of complement component C3b were measured by ELISA . The data indicate that salicylate reduced the barrier of CPS in serotypes O1:K1, O1:K10, and O1:K16 and unmasked subcapsular antigenic components in serotypes O1:K2 and O1:K66 so that bound opsonins could react with receptors on phagocytes . Serum bactericidal assays supported this conclusion . Therefore, decapsulating agents such as salicylate accentuate phagocytosis of K . pneumoniae by making subcapsular antigens and components accessible to immune and nonimmune host defences and vaccination with subcapsular antigens may exhibit optimal protection against lethal infection when combined with salicylate therapy.

Vet Microbiol, 1995 Nov, 47(1-2), 9 - 15
Plasmid profiles of Klebsiella pneumoniae isolated from bovine mastitis; Kikuchi N et al.; Plasmids of Klebsiella pneumoniae strains isolated from mastitic milk of cows were detected, and the epidemiological significance of their profiles was investigated . Of 47 K . pneumoniae isolates, 41 (87.2%) possessed plasmid(s) . Although the molecular size of the plasmids ranged from 1.9 to 140 megadaltons (Md), the 125 Md plasmid was predominant (31/41, 75.6%) . There was a great diversity in the plasmid profiles, however, no correlation was found between the plasmid profiles and capsular types of Klebsiella or the source of strains (dairy farms), except for one farm . All isolates obtained from cows on that farm possessed the 125 Md plasmid and their capsular type was 9.

Appl Microbiol Biotechnol, 1995 Nov, 43(6), 985 - 8
Microbial production of specifically ring-13C-labelled 4-hydroxybenzoic acid; Muller R et al.; When transformed with a recombinant vector carrying the ubiC gene (encoding chorismate pyruvate-lyase, EC 4.1.3.27) the triple mutant (Phe-, Trp-, Tyr-) Klebsiella pneumoniae 62-1 excretes 4-hydroxybenzoic acid instead of chorismic acid . The recombinant strain can be used to produce in high yield specifically ring-labelled 4-hydroxybenzoic acid from isotopically labelled glucose.

J Hosp Infect, 1995 Nov, 31(3), 177 - 87
Klebsiella pneumoniae infections in Greek hospitals . Dissemination of plasmids encoding an SHV-5 type beta-lactamase; Legakis NJ et al.; A total of 160 Klebsiella pneumoniae clinical strains consecutively isolated in 14 Greek hospitals in a three-month period was examined . Application of capsular typing using 72 monovalent antisera combined with phage-typing using a set of 15 Klebsiella-specific phages showed the absence of epidemic strains . However, 41% of the isolates examined displayed high level resistance to ceftazidime and aztreonam and, in most of the cases, to more than one aminoglycoside as well as to other antibacterial drugs . Nearly all of these multi-resistant strains were epidemiologically distinct on the basis of their capsular serotype and phage reactivity . After examination of 14 distinct strains, it was found that in nine cases, the resistance characters were readily transferred to Escherichia coli recipients through large self-transmissible plasmids (15-100 MDa) . Six of the nine plasmids had equal molecular weight (60 MDa) and displayed similar fragment profiles upon digestion with restriction endonuclease EcoRI . Isoelectric focusing and hydrolytic studies showed that the prominent beta-lactamase produced by the transconjugants harbouring the 60 MDa plasmids and the respective K . pneumoniae parent strains, was an extended-spectrum beta-lactamase of the SHV-5 type . It appears that among K . pneumoniae strains isolated in Greek hospitals a significant resistance rate to both newer beta-lactams and amino-glycosides has been established through the acquisition of promiscuous multi-resistant plasmids which share a high degree of similarity.

J Bacteriol, 1995 Nov, 177(22), 6352 - 61
Lethality and survival of Klebsiella oxytoca evoked by conjugative IncN group plasmids; Rodriguez M et al.; The transmission of plasmid pCU1 (or other IncN group plasmid) into a population of Klebsiella oxytoca cells reduces the viability of the population . A 2,400-bp region adjacent to traA is responsible for this phenotype and includes two regions, called kikA and kikC . Klebsiella cells which received this region and survived were found to acquire a chromosomal mutation which renders them immune to killing even after the plasmid is cured from the cells . To obtain insight into the mode of this apparent lethality, an appropriate pCU1lacZ derivative was constructed . It could be introduced with high efficiency into Klebsiella cells . Analyses of the resultant colonies indicate that the loss of viability is not a consequence of the death of plasmid-free segregants . On the contrary and unlike postsegregational killing by plasmids, cells survived by losing the plasmid or by acquiring, secondarily, a chromosomal mutation which confers immunity to killing.

Infect Immun, 1995 Nov, 63(11), 4336 - 44
Molecular characterization and adhesive properties of CF29K, an adhesin of Klebsiella pneumoniae strains involved in nosocomial infections; Di Martino P et al.; We previously described a CS31A-related protein, CF29K, expressed by Klebsiella pneumoniae strains involved in nosocomial infections . In this study, we cloned and sequenced cf29A, the structural gene of the CF29K protein, and showed that CF29K is an antigenic subtype of CS31A . The CF29K protein was found to be identical to the CS31A-L protein on the basis of biochemical and immunological properties . In contrast, the CS31A-H protein presented a different apparent molecular mass during sodium dodecyl sulfate-polyacrylamide gel electrophoresis, a different limited degradation pattern with endopeptidase V8, and a specific conformational epitope . We cloned and sequenced the CS31A-L structural gene and confirmed that CF29K and CS31A-L are identical, but their major subunits differ from ClpG (the CS31A-H subtype major subunit) by one amino acid at position 89 of the mature protein, which is a lysine in CF29K instead of the asparagine in ClpG . Site-directed mutagenesis experiments demonstrated that the biochemical and immunological differences between CS31A-H and CF29K or CS31A-L were dependent only on the amino acid at position 89 of the mature protein . To study the adhesive properties of CS31A-H and CF29K in the same Escherichia coli reference strain, we performed transcomplementation experiments with the cloned CS31A major-subunit structural genes or cloned cf29A gene and the clp accessory genes of the CS31A operon . We showed that CS31A-L, CF29K, and CS31A-H were involved in adhesion to Caco-2 and Int-407 cells but not to HEp-2 cells . Nevertheless, K . pneumoniae strains and corresponding E . coli transconjugants producing CF29K adhered to cultured Caco-2, Int-407, and HEp-2 cells, indicating the expression of another R-plasmid-encoded adhesin that mediated adhesion to HEp-2 cells . The carbohydrate part of the eucaryotic receptor of CF29K and CS31A-H adhesins was investigated by adhesion inhibition experiments with Int-407 cells . Although CS31A and CF29K belong to the K88 adhesin family, the receptor does not contain N-acetyl-D-galactosamine residues but contains N-acetylneuraminic acid and N-acetyl-D-glucosamine.

Gene, 1995 Oct 16, 164(1), 89 - 94
A Klebsiella aerogenes moaEF operon is controlled by the positive MoaR regulator of the monoamine regulon; Azakami H et al.; A 30-kDa protein accumulated upon induction by a high concentration of tyramine or dopamine in cells of Klebsiella aerogenes (Ka) . These cells carried a plasmid (pAS123) that included the arylsulfatase operon (atsBA) . Deletion analysis showed that the region essential for induction of the 30-kDa protein was located within a 2.0-kb cloned segment downstream of the atsBA operon . The nucleotide (nt) sequence of the 2.0-kb fragment revealed two open reading frames (ORFs), moaE and moaF . Transcription from a putative promoter of moaE was induced by the addition of tyramine, and the moaF gene was co-transcribed from this monoamine-inducible Ka promoter . The deduced Ka MoaE protein was homologous to insect-type alcohol dehydrogenase . The sequence of the 18 amino acids from the N-terminus of the purified 30-kDa protein agreed with that deduced from the nt sequence of moaF . Using a Ka strain with a mutant moaR gene, we found that MoaR, that acts as the positive regulator of the monoamine regulon, also acts as the positive regulator of the moaEF operon.

Carbohydr Res, 1995 Oct 2, 275(2), 371 - 9
The structure of the acidic exopolysaccharide produced by Pseudomonas "gingeri" strain Pf9; Cescutti P et al.; The structure of the acidic exopolysaccharide produced by the mushroom pathogen Pseudomonas "gingeri" strain Pf9, a bacterium which causes ginger blotch, was investigated by chemical analysis, mass spectrometry and 1D and 2D NMR spectroscopy . The polysaccharide consists of the linear trisaccharide repeating unit {formula: see text} where the cyclic pyruvic acetal groups at O-4 and O-6 of the mannopyranosyl residues have the S-configuration . Methylation analysis under neutral conditions and NMR data showed that the mannose residues are acetylated at O-2 . This exopolysaccharide has the same structure as the E . coli K55 capsular polysaccharide and differs from the Klebsiella K5 capsular polysaccharide only in the position of acetylation (C-2 of the glucopyranose residue).

J Chemother, 1995 Oct, 7(5), 406 - 13
Effects of sub-minimal inhibitory concentrations of antimicrobial agents on the cell surface of Klebsiella pneumoniae and phagocytic killing activity; Nomura S et al.; Changes in the phagocytic killing activity, capsule structure, and physicochemical properties such as the hydrophobicity and charge of the cell surface were studied in Klebsiella pneumoniae treated with sub-minimal inhibitory concentrations (MICs) of various antimicrobial agents . The phagocytic killing activity of macrophages was enhanced by penicillins, cephems, and monobactam in the absence of antibodies specific to the capsule or complement . No enhancement was observed with new quinolones, aminoglycosides, macrolide, or carbapenem . The thickness of the capsule structure was considerably reduced after the treatment with penicillins, cephems, and monobactam compared with the untreated control, and it was slightly reduced by new quinolones . No changes were observed in the capsule structure with aminoglycosides, macrolide, and carbapenem . The hydrophobicity on the cell surface of the bacteria was considerably increased after the treatment with penicillins, cephems, and monobactam compared with the control, slightly increased with new quinolones and carbapenem, and not changed with aminoglycosides and macrolide . The negative charge of the cell surface of the bacteria was reduced by penicillins, cephems, and monobactam compared with the control . It was slightly reduced by new quinolones and carbapenem but was not reduced by aminoglycosides and macrolide . These findings suggest that sub-MIC beta-lactam drugs such as penicillins, cephems, and monobactams cause thinning of the capsule of K . pneumoniae with increases in the hydrophobicity and decreases in the negative charge of the cell surface, which reduces the physical repulsion between the K . pneumoniae and phagocytes and enhances the sensitivity of the bacteria to phagocytic killing activity.

Lupus, 1995 Oct, 4(5), 375 - 89
Analysis of three new idiotypes on human monoclonal autoantibodies; Kalsi JK et al.; We have identified and characterised three new idiotypes on human IgM McAbs generated from the splenocytes of a SLE patient with active disease . RT-6, which binds H1 and Sm/RNP, expresses essentially a private Id . Its expression is limited to a small number of human McAbs and the sera from patients with infectious diseases . In contrast RT-72Id and RT-84Id, expressed on McAbs which are polyreactive for two or more antigens, have a public distribution . RT-72Id and RT-84Id are found on McAbs from murine and human adult, and foetal tissues . In sera, significant numbers of SLE, RA and patients with other autoimmune diseases are positive for both Ids . RT-84Id is also elevated in SLE relatives and spouses, and in patients with Klebsiella infection . No correlation with disease activity, IgM or IgG levels was observed with either Id . However, RT-72Id was significantly associated with anti-ssDNA antibodies and RhF . RT-6Id and RT-72Id are located on the framework regions of the mu heavy chain, whereas RT-84Id is present on the kappa light chain, within the binding site . The McAbs are encoded by mainly germline genes: heavy chains of RT-6, RT-72 and RT-84 are encoded by the genes VH26, VH4.22 and VH4.21, respectively, and the light chain sequences of RT-6 and RT-72 are derived from DPL11 and HK102 . Immunofluorescent staining revealed the presence of RT-72Id and RT-84Id positive immunoglobulin deposits in 18% and 45%, respectively, of the lupus renal sections compared with none in the disease control group, suggesting that these Ids may contribute to the pathology of the disease.

Br J Haematol, 1995 Oct, 91(2), 471 - 3
The use of an anti-beta 2-glycoprotein-I assay for discrimination between anticardiolipin antibodies associated with infection and increased risk of thrombosis; McNally T et al.; Antiphospholipid antibodies (aPAs), occurring in association with infection, are not generally associated with an increased risk of thrombosis . Anticardiolipin antibodies (aCL) from patients with infection, unlike those from patients with SLE, do not have the beta 2GPI cofactor requirements . Antibodies to beta 2GPI (alpha beta 2GPI) are more closely associated with a previous history of thrombosis than aCL in patients with SLE . In the present study we have investigated the reactivity of the alpha beta 2GPI assay for aPAs associated with infection . Serum from 114 patients with infections including syphilis (n = 11), tuberculosis (n = 63) and Klebsiella (n = 42) were assayed for alpha beta 2GPI and aCL antibodies . The incidence of aCL in serum of patients with tuberculosis . Klebsiella infection and syphilis was 6.0%, 5.0% and 64.0%, respectively, but all patients were negative for alpha beta 2GPI . These results indicate that the alpha beta 2GPI assay is negative in patients with transiently positive aCL assays associated with infection.

Protein Sci, 1995 Oct, 4(10), 2234 - 6
Urease activity in the crystalline state; Moncrief MB et al.; Crystalline Klebsiella aerogenes urease was found to have less than 0.05% of the activity observed for the soluble enzyme under standard assay conditions . Li2SO4, present in the crystal storage buffer at 2 M concentration, was shown to inhibit soluble urease by a mixed inhibition mechanism (Ki's of 0.38 +/- 0.05 M for the free enzyme and 0.13 +/- 0.02 M for the enzyme-urea complex) . However, the activity of crystals was less than 0.5% of the expected value, suggesting that salt inhibition does not account for the near absence of crystalline activity . Dissolution of crystals resulted in approximately 43% recovery of the soluble enzyme activity, demonstrating that protein denaturation during crystal growth does not cause the dramatic diminishment in the catalytic rate . Finally, crushed crystals exhibited only a three-fold increase in activity over that of intact crystals, indicating that the rate of substrate diffusion into the crystals does not significantly limit the enzyme activity . We conclude that urease is effectively inactive in this crystal form, possibly due to conformational restrictions associated with a lid covering the active site, and propose that the small amounts of activity observed arise from limited enzyme activity at the crystal surfaces or trace levels of enzyme dissolution into the crystal storage buffer.

Biosci Biotechnol Biochem, 1995 Oct, 59(10), 1987 - 90
Molecular cloning and nucleotide sequence of purine nucleoside phosphorylase and uridine phosphorylase genes from Klebsiella sp; Takehara M et al.; Klebsiella sp . LF 1202 was isolated as a bacterium that can assimilate adenosine as a sole source of carbon and nitrogen {F . Ling et al., Agric . Biol . Chem., 55, 573-575 (1991)} from a soil sample . Both the purine nucleoside phosphorylase (PNPase) and uridine phosphorylase (UPase) of this bacterium were induced simultaneously when the bacterium was cultured in a medium containing adenosine or uridine as a sole source of carbon and nitrogen . This induction profile is different from that of Escherichia coli . Here we cloned and sequenced the gene corresponding to each enzyme . The open reading frame (ORF) of the PNPase gene consisted of 717 bp that encoded a polypeptide of 239 amino acids with a molecular weight of 26,198 . The ORF of the UPase gene consisted of 834 bp that encoded a polypeptide of 278 amino acids with a molecular weight of 28,912.

J Bacteriol, 1995 Oct, 177(19), 5535 - 8
Repression of the Klebsiella aerogenes nac promoter; Feng J et al.; Transcription of the nitrogen-regulated nac promoter of Klebsiella aerogenes requires sigma54 RNA polymerase, is activated by the phosphorylated form of the transcription factor nitrogen regulator I (NRI) (NtrC), and is repressed by the product of the nac gene, Nac . Nac protects a large portion of the nac control region, extending from positions -130 to -70, from digestion by DNase I . This site(s) lies immediately upstream from the site at which sigma 54 RNA polymerase binds, is downstream of a high-affinity binding site for the transcriptional activator NRI approximately P, and partially overlaps a low-affinity NRI approximately P-binding site . Binding of Nac to the DNA resulted in bending of the DNA but did not interfere with the binding of sigma 54 RNA polymerase to the promoter or with the binding of NRI approximately P to either the high-affinity site or low-affinity site . Furthermore, transcription assays with various wild-type and mutant templates suggested that Nac did not exclude NRI approximately P from either the low- or high-affinity sites, nor did Nac interfere with the ability of the polymerase to form the open complex when the binding sites for NRI approximately P were moved to different locations upstream from the promoter . Rather, Nac seemed to repress by an antiactivation mechanism in which the interaction of the NRI approximately P, bound at its normal sites, with sigma 54 RNA polymerase, bound to the promoter, was prevented.

J Bacteriol, 1995 Oct, 177(19), 5523 - 34
Activation of transcription initiation from the nac promoter of Klebsiella aerogenes; Feng J et al.; The nac gene of Klebsiella aerogenes encodes a bifunctional transcription factor that activates or represses the expression of several operons under conditions of nitrogen limitation . In experiments with purified components, transcription from the nac promoter was initiated by sigma 54 RNA polymerase and was activated by the phosphorylated form of nitrogen regulator I (NRI) (NtrC) . The activation of the nac promoter required a higher concentration of NRI approximately P than did the activation of the Escherichia coli glnAp2 promoter, and both the promoter and upstream enhancer element contributed to this difference . The nac promoter had a lower affinity for sigma 54 RNA polymerase than did glnAp2, and uninitiated competitor-resistant transcription complexes formed at the nac promoter decayed to competitor-sensitive complexes at a greater rate than did similar complexes formed at the glnAp2 promoter . The nac enhancer, consisting of a single high-affinity NRI-binding site and an adjacent site with low affinity for NRI, was less efficient in stimulating transcription than was the glnA enhancer, which consists of two adjacent high-affinity NRI-binding sites . When these binding sites were exchanged, transcription from the nac promoter was increased and transcription from the glnAp2 promoter was decreased at low concentrations of NRI approximately P . Another indication of the difference in the efficiency of these enhancers is that although activation of a nac promoter construct containing the glnA enhancer was relatively insensitive to subtle alterations in the position of these sites relative to the position of the promoter, activation of the natural nac promoter or a nac promoter construct containing only a single high-affinity NRI approximately P binding site was strongly affected by subtle alterations in the position of the NRI approximately P binding site(s), indicating a face-of-the-helix dependency for activation.

Biol Pharm Bull, 1995 Sep, 18(9), 1259 - 63
Decrease in surface charge density of Klebsiella pneumoniae treated with cefodizime and enhancement of the phagocytic function of human polymorphonuclear leucocytes stimulated by the drug-treated bacteria; Muratsugu M et al.; Treatment of Klebsiella pneumoniae 109 with cefodizime, ceftazidime, cefbuperazone, cefotaxime or flomoxef at a sub-minimum inhibitory concentration (sub-MIC) (1/4 MIC) for 1 h altered its morphology . The bacteria treated with cefodizime at sub-MICs (1/8, 1/4 MIC) enhanced the chemiluminescencence (CL) of human polymorphonuclear leucocytes (PMNs), implying an increase in the production of active oxygen species in association with phagocytosis, whereas the cells treated with other cephalosporins at the same sub-MICs did not . Furthermore, a significant decrease in electrophoretic mobility was induced by the bacteria treated with cefodizime at sub-MICs (1/8, 1/4 MIC), but other cephalosporins neither increased nor decreased the electrophoretic mobility significantly . These findings suggested that cefodizime caused a morphological change, with a decrease in negative surface charge density of K . pneumoniae, more easily than ceftazidime, cefbuperazone, cefotaxime or flomoxef, followed by an increase in the phagocytic activity of PMNs.

Zhonghua Min Guo Xiao Er Ke Yi Xue Hui Za Zhi, 1995 Sep-Oct, 36(5), 336 - 41
Ultrasound-guided percutaneous drainage of liver abscess in children; Ni YH et al.; This study's purpose was to investigate the effectiveness of ultrasound-guided percutaneous drainage (US-PD) as treatment modality for pediatric pyogenic liver abscess when compared with other modalities . Ten consecutive patients, aged from 2 months to 22 years, were enrolled in this study . In addition to antibiotics, US-PD was attempted in each case unless the procedure was judged unsuitable . Six patients were treated with US-PD while four were not, for various reasons . US-PD was performed under an intravenous anesthesia and with the aid of real-time sonography . An indwelling pigtail catheter was usually inserted during US-PD . Fever subsided within one to six days, but the abscess cavity closed later . Failure to respond to US-PD may relate to the huge size of abscess cavity; surgical drainage provides an option . A trend toward a shorter hospital stay and defervescence day was found in the US-PD group than in the non-US-PD group . Prognosis was generally good and none in this series died of this disease or the procedure . Klebsiella pneumoniae was the pathogen most frequently encountered . Seven of the ten patients had underlying disease, and hemoglobinopathy was frequently associated . In conclusion, adequate drainage is recommended as the most effective treatment modality for pediatric liver abscess, and US-PD is the first choice.

Fundam Appl Toxicol, 1995 Sep, 27(2), 177 - 84
Local versus systemic immunotoxicity of isobutyl nitrite following subchronic inhalation exposure of female B6C3F1 mice; Ratajczak HV et al.; Female B6C3F1 mice were exposed to isobutyl nitrite (IBN) by inhalation at 0, 37.5, 75, or 150 ppm for 6 hr per day, 5 days per week for 15 weeks . The potential of this compound to induce immunotoxicity was assessed during the 3rd, 13th, 14th, and 15th week of exposure and after 2 weeks of recovery following the 15 weeks of exposure . Both systemic and lung immune functions were examined, including body and lymphoid organs weights, pulmonary macrophage function and host defense, expression of splenic lymphocyte cell-surface markers, natural killer cell function, mixed lymphocyte reaction, and induction of specific antibody to a T-cell-dependent antigen . There was a dose-related suppression of T-cell-dependent antibody-forming cell responses in the spleen following IBN exposure; however, other measures of T-cell and nonspecific immunity were not significantly affected . A dose-related increase of H202 production by alveolar macrophages was present after 12 but not after 68 exposures to IBN . In contrast, pulmonary host defense mechanisms against Klebsiella pneumoniae were unaffected . These results suggest that in the absence of changes in host resistance, IBN may have selective and partially reversible effects on the immune system.

J Bacteriol, 1995 Sep, 177(18), 5261 - 9
Identification of the transcriptional activator controlling the butanediol fermentation pathway in Klebsiella terrigena; Mayer D et al.; The gene budR, whose product is responsible for induction of the butanediol formation pathway under fermentative growth conditions in Klebsiella terrigena, has been cloned and sequenced . This gene is separated from the budABC operon by a nontranslated region of 106 bp and transcribed in the opposite direction . budR codes for a protein of molecular weight 32,124, the sequence of which exhibits characteristics of regulators belonging to the LysR family . When transferred into the heterologous host Escherichia coli, budR activates expression of budA'-lacZ transcriptional and translational fusions with a regulatory pattern identical to that in K . terrigena, namely, induction by acetate, low pH, and anaerobiosis . Induction by acetate was specific, indicating that it is the physiological inducer . Primer extension analysis located the start site of transcription to two positions, 23 and 24 bp upstream of the budR initiation codon, and also showed that BudR strongly autoregulates its own expression . The products of fhlA, arcA, hip, ntrA, and katF did not influence expression of the bud operon . A mutation in fnr, however, led to a threefold increase in expression, indicating that Fnr acts as a repressor . The results support the notion that BudR coordinates the activity of the energy-conserving, nonreductive, but acidifying acetate formation pathway with the expression of the non-energy-conserving, reductive, but nonacidifying butanediol pathway.

J Bacteriol, 1995 Sep, 177(17), 5088 - 98
Synthesis of pyrroloquinoline quinone in vivo and in vitro and detection of an intermediate in the biosynthetic pathway; Velterop JS et al.; In Klebsiella pneumoniae, six genes, constituting the pqqABCDEF operon, which are required for the synthesis of the cofactor pyrroloquinoline quinone (PQQ) have been identified . The role of each of these K . pneumoniae Pqq proteins was examined by expression of the cloned pqq genes in Escherichia coli, which cannot synthesize PQQ . All six pqq genes were required for PQQ biosynthesis and excretion into the medium in sufficient amounts to allow growth of E . coli on glucose via the PQQ-dependent glucose dehydrogenase . Mutants lacking the PqqB or PqqF protein synthesized small amounts of PQQ, however . PQQ synthesis was also studied in cell extracts . Extracts made from cells containing all Pqq proteins contained PQQ . Lack of each of the Pqq proteins except PqqB resulted in the absence of PQQ . Extracts lacking PqqB synthesized PQQ slowly . Complementation studies with extracts containing different Pqq proteins showed that an extract lacking PqqC synthesized an intermediate which was also detected in the culture medium of pqqC mutants . It is proposed that PqqC catalyzes the last step in PQQ biosynthesis . Studies with cells lacking PqqB suggest that the same intermediate might be accumulated in these mutants . By using pqq-lacZ protein fusions, it was shown that the expression of the putative precursor of PQQ, the small PqqA polypeptide, was much higher than that of the other Pqq proteins . Synthesis of PQQ most likely requires molecular oxygen, since PQQ was not synthesized under anaerobic conditions, although the pqq genes were expressed.

J Bacteriol, 1995 Sep, 177(17), 5078 - 87
The C-terminal domain of NifL is sufficient to inhibit NifA activity; Narberhaus F et al.; In Klebsiella pneumoniae, transcription of all nif (nitrogen fixation) operons except the regulatory nifLA operon itself is regulated by the proteins NifA and NifL . NifA, an enhancer-binding protein, activates transcription by RNA polymerase containing the alternative sigma factor sigma 54 . The central catalytic domain of NifA is sufficient for transcriptional activation, which can occur from solution . In vivo, NifL antagonizes the action of NifA in the presence of molecular oxygen or combined nitrogen . Inhibition has also been shown in vitro, but it was not responsive to environmental signals . Assuming a two-domain structure of NifL, we localized inhibition by NifL to its carboxy (C)-terminal domain, which is more soluble than the intact protein . The first line of evidence for this is that internal deletions of NifL containing an intact C-terminal domain were able to inhibit transcriptional activation by NifA in a coupled transcription-translation system . The second line of evidence is that the isolated C-terminal domain of NifL (assayed as a fusion to the soluble maltose-binding protein {MBP}) was sufficient to inhibit transcriptional activation by the central domain of NifA in a purified transcription system . The final line of evidence is that an MBP fusion to the C-terminal domain of NifL inhibited transcriptional activation by NifA in vivo . On the basis of these data, we postulate that the inhibitory function of NifL lies in its C-terminal domain and hence infer that this domain is responsible for interaction with NifA . Gel filtration experiments with MBP-NifL fusion derivatives lacking portions of the N- or C-terminal domain of the protein revealed that the C-terminal domain is the most soluble part of NifL . Up to 50% of two MBP-NifL truncations containing only the C-terminal domain appeared to be in a defined dimeric state.

Kansenshogaku Zasshi, 1995 Sep, 69(9), 1017 - 20
{A case of gas-containing liver abscess with multiple metastatic lesions}; Higashi T et al.; A 63-year-old male was admitted to our hospital because of high fever and delirium . He had been diagnosed as diabetes mellitus five years before but not treated at all . An abdominal CT scan showed gas-containing abscess in the right lobe of the liver . Klebsiella pneumoniae and Bacteroides distasonis were cultured both from the punctured specimen of the abscess and from arterial blood . Catheter drainage was carried out percutaneously under guidance with ultrasonography and antibiotics was administered intravenously . He was diagnosed as purulent meningitis by lumbar puncture on admission and as endophthalmitis because of swelling of the left eyeball on hospital day 4 . CT scan also showed multiple metastatic lesions in the cerebrum and in the lung . After three months, he was discharged from the hospital in good condition, except for loss of vision of the left eye.

Arthritis Rheum, 1995 Sep, 38(9), 1277 - 82
Klebsiella pneumoniae-reactive T cells in blood and synovial fluid of patients with ankylosing spondylitis . Comparison with HLA-B27+ healthy control subjects in a limiting dilution study and determination of the specificity of synovial fluid T cell clones; Hermann E et al.; OBJECTIVE . To study the frequency of Klebsiella pneumoniae-responsive T cells in the peripheral blood (PB) of ankylosing spondylitis (AS) patients compared with that in healthy HLA-B27+ donors, and to examine T lymphocyte clones (TLC) derived from AS patient synovial fluid (SF) for the presence of Klebsiella reactivity . METHODS . Limiting dilution analysis of PB T cells in 8 patients with active AS and in 8 HLA-B27+ healthy subjects was used to determine the frequency of PB T cells responsive to K pneumoniae and Escherichia coli GroEL . SF T cells from a patient with active AS were cloned, and 125 TLC were characterized in proliferation assays . RESULTS . There were fewer T cells in the PB of AS patients that reacted with K pneumoniae than in the PB of healthy HLA-B27+ subjects . The frequencies of E coli GroEL-responsive T cells were approximately 5-10 times lower in all subjects tested (healthy donors and AS patients), but without significant differences between the 2 groups . Two CD4+ TLC that recognized K pneumoniae (1 cross-reactive with E coli) as well as 3 TLC that recognized GroEL (2 CD4+, 1 T cell receptor gamma/delta+) were isolated from the SF of a patient with actige AS . CONCLUSION . Our results indicate that there is a quantitative reduction of K pneumoniae-responsive T cells in the PB of AS patients as compared with healthy controls . This may reflect a defective peripheral T cell defense in the immune response to Klebsiella and may allow bacterial antigens to reach the synovium, where they initiate specific T cell responses.

Epidemiol Mikrobiol Imunol, 1995 Sep, 44(3), 111 - 4
{Occurrence of Klebsiella pneumonia strains resistant to third-generation cephalosporins at the Pediatric Clinic of the Medical School Hospital in Olomouc}; Kolar M et al.; The authors describe the high incidence of strains of Klebsiella pneumoniae resistant to cephalosporins of the IIIrd generation at the department of pathological neonates of the Paediatric Clinic of the Faculty Hospital in Olomouc . They discuss possible reasons for this adverse situation and the way how to resolve it . They emphasize the necessity of rational administration of antibiotics and continuous monitoring of resistance in the most frequent causal agents of bacterial infections.

Am J Vet Res, 1995 Sep, 56(9), 1213 - 8
Effect of phenylbutazone and flunixin meglumine on acute toxic mastitis in dairy cows; Dascanio JJ et al.; A double-blinded randomized prospective clinical trial was designed to evaluate the effectiveness of flunixin meglumine and phenylbutazone for treatment of acute toxic mastitis in dairy cows . All cows were treated 4 times at 12-hour intervals by intramammary infusion of gentamicin (150 mg) . A total of 45 dairy cows with toxic mastitis were randomly assigned to 1 of 3 treatment groups: group 1 (control), saline solution, IV; group 2, 1 g of flunixin meglumine, IV; or group 3, 4 g of phenylbutazone, IV . Physical examination and udder variables were assessed at initial examination and 24 hours later . Milk production was recorded at regular intervals from 1 week before until 10 weeks after development of mastitis . Rear quarters (34/45) were more commonly affected than front quarters . Thirty-five cows returned to the herd, 9 cows were culled, and 1 cow died . There were no significant differences among treatment groups in the need for further treatment or outcome . Klebsiella spp (18/45) and Escherichia coli (16/45) were the most common pathogens isolated by culture of milk from affected quarters . The overall bacteriologic cure rate on days 7 and 14 was 64 and 75%, respectively . At the time of initial examination, cows of the control group had higher rectal temperature than did cows of the flunixin group . At the examination 24 hours later, the rectal temperature of cows in all treatment groups was lower than the temperature at initial examination; at that time (24 hours), however, there were no significant differences in temperature among the treatment groups.(ABSTRACT TRUNCATED AT 250 WORDS)

Carbohydr Res, 1995 Aug 25, 273(2), 197 - 205
Structure of the capsular polysaccharide from the Klebsiella K8 reference strain 1015; Erbing B et al.; The structure of the capsular polysaccharide from the Klebsiella K8 reference strain 1015 has been elucidated . The structure was deduced from sugar analysis, different methylation analyses, a uronic acid degradation, and NMR spectroscopy . It is concluded that the polysaccharide is composed of pentasaccharide repeating units with the structure: {formula: see text} The structure differs from that of the previously published structure of the capsular polysaccharide from Klebsiella K8, which originates from another strain and has the following structure: {formula: see text} The serological similarity between the two strains is most likely derived from a common tetrasaccharide which is substituted in different ways in the two strains . Since the strain in the present investigation originates from the Klebsiella K reference strain collection of the International Escherichia and Klebsiella Centre, Copenhagen, Denmark, it is suggested that it should keep the designation K8 . The other polysaccharide with Klebsiella K8 specificity should be renamed as K8,52,59 based on the cross-reactivity of the strain (I . Orskov, unpublished).

Carbohydr Res, 1995 Aug 22, 273(1), 53 - 62
Structural studies of the capsular polysaccharide from Klebsiella type 7; Kjellberg A et al.; The structure of the capsular polysaccharide elaborated by Klebsiella type 7 has been investigated . NMR spectroscopy together with sugar and methylation analysis have been the main methods used . A uronic acid degradation was also employed . The polysaccharide consists of hexasaccharide repeating units having the following structure . {formula: see text}

FEBS Lett, 1995 Aug 7, 369(2-3), 243 - 8
Molecular mimicry and ankylosing spondylitis: possible role of a novel sequence in pullulanase of Klebsiella pneumoniae; Fielder M et al.; Molecular mimicry has been shown between two sequences of Klebsiella pneumoniae pulD secretion protein (DRDE) with HLA-B27 (DRED) and pulA (pullulanase) enzyme (Gly-X-Pro) with types I, III and IV collagen respectively . IgG antibody levels in AS patients were elevated against 16mer synthetic peptides of HLA-B27 and pulD by enzyme immunosorbent assay (ELISA) compared to controls (P < 0.001) . ELISA assays against K . pneumoniae grown in the absence and presence of pullulan demonstrated significant levels of IgA antibody in AS patients compared to controls (P < 0.001) . Increased IgA and IgG antibody levels to pulA and types I and IV collagen were observed in AS patients compared to controls (P < 0.001) . These observations could be relevant in the sequence of molecular events in AS.

Indian J Med Res, 1995 Aug, 102, 53 - 5
Ceftazidime resistance among Klebsiella pneumoniae in south India; Abigail S et al.; Fifteen strains of K . pneumoniae resistant to ceftazidime were tested for extended spectrum beta lactamase (ESBL) production by double disc diffusion synergy test using ceftazidime and augmentin, and by testing for reduction in minimum inhibitory concentration of ceftazidime in combination with clavulanic acid . All strains were found to produce ESBL . We document the presence of ESBL producing strains in south India . There is a possibility of the spread of this resistance to other bacteria because the resistance could be transferred to recipient Escherichia coli from two strains.

J Chir (Paris), 1995 Aug-Sep, 132(8-9), 342 - 5
{Chronic osteomyelitis caused by Klebsiella pneumoniae with a 50 year course . Medicosurgical management}; Sarfati F et al.; The 50-year clinical course of a case of osteomyelitis of the left tibia is reported . Surgical specimens were positive for Klebsiella pneumoniae allowing treatment with certriaxone and ciprofloxacine . After antibiotic therapy, regional skin expansion was possible with excision and simultaneous closure of a wide area of damaged skin resulting from the long-term infection.

Biol Pharm Bull, 1995 Aug, 18(8), 1089 - 93
Time-dependent changes in the pharmacokinetics and renal excretion of xanthine derivative enprofylline induced by bacterial endotoxin in rats; Nadai M et al.; Time-dependent changes in the pharmacokinetics and renal handling of enprofylline induced by bacterial endotoxin (Klebsiella pneumoniae LPS) were investigated in rats . To evaluate the early effect of LPS on kidney functions and the renal excretion of enprofylline, which is an organic anion drug excreted primarily by an active tubular secretion, LPS (250 micrograms/kg) was infused for 5 min under constant infusion at rates of 2.3 and 23 micrograms/min/kg for inulin and enprofylline, respectively . LPS caused a drop in the glomerular filtration rate (GFR), estimated as the renal clearance of inulin, to 65-75% of that observed in the control rats within 30 min after the LPS treatment . The renal clearance (CLr) of enprofylline decreased in conjunction with GFR, while the percentage of decrease in the CLr was slightly greater than that in GFR . LPS-induced decreases in the CLr for enprofylline and GFR continued over the testing period of 120 min . The time-dependent effect of LPS on the pharmacokinetics of enprofylline was examined by a single injection of enprofylline (2.5 mg/kg) to rats pretreated 2, 10 or 24 h earlier with or without LPS . The pharmacokinetic parameters of enprofylline were determined by a model-independent method . Significant changes in the systemic clearance for enprofylline were observed in rats pretreated 2 and 10 h earlier with LPS, but no such changes were observed in rats pretreated 24 h earlier with LPS . These findings indicate the existence of a time-dependent effect of LPS on the pharmacokinetics of enprofylline, and suggest that LPS at a dose of 250 micrograms/kg, at least, does not induce cytotoxicity to kidney cells.

Cent Eur J Public Health, 1995 Aug, 3(3), 129 - 31
An outbreak of gentamicin-resistant Klebsiella pneumoniae in a neonatal ward; Shamseldin el Shafie S et al.; Gentamicin-resistant Klebsiella pneumoniae (GRKP) was isolated from nineteen patients in the neonatal ward of Sultan Qaboos University Hospital (SQUH) in Oman . Thirteen cases were infected and six were colonized . Two infected patients died due to septicaemia, eight cases occurred within SQUH and eleven cases were imported from other hospitals . Sixteen isolates were of the same serotype (K25), three were non typeable . Referred patients from peripheral hospitals were the source of the organism and hand carriage the probable vehicle of transmission . The first strain of gentamicin-sensitive Kleb . pneumoniae was isolated five months after combating the outbreak.

Ann Rheum Dis, 1995 Aug, 54(8), 631 - 5
IgA1 and IgA2 subclass antibodies against Klebsiella pneumoniae in the sera of patients with peripheral and axial types of ankylosing spondylitis; Maki-Ikola O et al.; OBJECTIVE--To study further the Klebsiella specific serum antibody response in patients with axial and peripheral types of ankylosing spondylitis (AS) . METHODS--IgA1 and IgA2 subclass antibodies to Klebsiella pneumoniae were measured by enzyme linked immunosorbent assay in the sera of 171 patients with axial or peripheral type AS, and in sera of 100 healthy controls . The effect of 26 weeks of sulphasalazine treatment on the antibody levels in the two types of AS was also analysed . RESULTS--K pneumoniae specific antibody levels of both IgA1 and IgA2 subclasses were increased in the sera of patients with AS compared with healthy controls . The increased levels were present in patients with axial and with peripheral AS, and there were no statistically significant differences in the antibody levels between these two groups . Sulphasalazine treatment decreased the Klebsiella specific antibody level of IgA1 subclass in patients with axial AS, but there were no statistically significant changes in the IgA2 subclass, or in the patients with peripheral type AS . CONCLUSIONS--These results agree with earlier published findings suggesting that IgA (especially Klebsiella specific IgA) may have a role in the pathogenetic mechanisms of both peripheral and axial types of AS . In addition, it seems that both IgA1 and IgA2 subclasses are involved in the disease process.

Eur J Biochem, 1995 Aug 1, 231(3), 790 - 801
Synthesis of the oxaloacetate decarboxylase Na+ pump and its individual subunits in Escherichia coli and analysis of their function; Di Berardino M et al.; The oadGAB genes encoding the gamma, alpha and beta-subunits of the oxaloacetate decarboxylase Na+ pump in Klebsiella pneumoniae have been cloned on plasmid pSK-GAB and expressed in Escherichia coli . The membranes of the recombinant E . coli clone contained about three times as much catalytically active oxaloacetate decarboxylase (3 mg protein/2 g wet cells) as those of the K . pneumoniae strain from which the genes were derived . The enzyme was solubilised from the membranes with Triton X-100 and purified . Its Na+ transport function was demonstrated after reconstitution into proteoliposomes . Proteoliposomes containing only the membrane-bound subunits beta and gamma (not the peripheral alpha-subunit) were unable to catalyse Na+ translocation in response to a transmembrane Na+ (delta pNa+) or electrical gradient (delta psi) . Individual subunits of oxaloacetate decarboxylase and combinations of two subunits were expressed from appropriate derivatives of plasmid pSK-GAB . The hydrophobic subunits beta and beta gamma were membrane-bound as expected . Interestingly, the alpha-subunit was located in the cytoplasm if expressed separately or together with beta, but became membrane-bound if expressed together with gamma . A gamma alpha complex was isolated from such membranes by avidin-Sepharose affinity chromatography . Interactions of the gamma-subunit with the water-soluble alpha-subunit and with the membrane-bound beta-subunit are therefore required to form the oxaloacetate decarboxylase complex . The combinations of separately expressed subunits gamma alpha + beta and beta gamma+alpha were shown to yield the catalytically active enzyme . The alpha or the beta-subunit and the combinations of these subunits with the gamma-subunit were therefore expressed in E . coli in a catalytically competent state . Functional expression of the separate gamma-subunit, however, could not be demonstrated . The alpha-subunit was strongly overexpressed from a pT7-7 derived plasmid, but was only partially biotinylated under these conditions . On coexpression of the birA gene encoding biotin ligase the major part (80-100%) of the overexpressed alpha-subunit was biotinylated . Highly purified alpha-subunit was obtained by fractionated precipitation of the soluble cell fraction with ammonium sulfate . Incubation of the alpha-subunit with oxaloacetate led to a CO2 transfer to its prosthetic biotin group with the formation of stoichiometric amounts of pyruvate . The velocity of the CO2 transfer to the biotin on the alpha-subunit was about three orders of magnitude too low to account for the rate of the overall reaction . The carboxyltransfer reaction was significantly accelerated if the gamma-subunit was additionally present.(ABSTRACT TRUNCATED AT 400 WORDS)

J Bacteriol, 1995 Aug, 177(16), 4820 - 4
Activation of the Escherichia coli lacZ promoter by the Klebsiella aerogenes nitrogen assimilation control protein (NAC), a LysR family transcription factor; Pomposiello PJ et al.; A chimeric promoter with the nitrogen assimilation control protein binding site from hutUp of Klebsiella aerogenes fused to the lacZ core promoter from Escherichia coli was built and cloned in a lacZ reporter plasmid . This construct showed a 14-fold increase of beta-galactosidase activity upon nitrogen limitation . Primer extension experiments showed that the nitrogen assimilation control protein activates lacZp1 in a position-dependent manner.

Laryngoscope, 1995 Aug, 105(8 Pt 1), 854 - 6
Rhinoscleroma treated with ciprofloxacin: a case report; Avery RK et al.; Rhinoscleroma, a chronic progressive infection of the nose and associated structures caused by Klebsiella rhinoscleromatis, has posed a therapeutic dilemma since its identification in the late 1800s . Although a number of antibiotics have been found to be effective in this relapsing disorder, the lengthy duration of treatment can lead to problems with adverse effects and compliance, especially with the traditional therapies of streptomycin and tetracycline . We report on a patient with extensive nasal rhinoscleroma who achieved pathologic and bacteriologic resolution during treatment with oral ciprofloxacin after previous courses of tetracycline and trimethoprim-sulfamethoxazole . Ciprofloxacin may prove to be useful in the therapy of rhinoscleroma because it is convenient for oral administration, achieves good tissue levels, is concentrated in macrophages, and is generally well tolerated as long-term therapy . As mentioned in a recent review of patients with rhinoscleroma at the Mayo Clinic, the fluoroquinolones deserve further study as potentially highly effective agents for this uncommon but significant infectious condition.

Dtsch Med Wochenschr, 1995 Jul 28, 120(30), 1040 - 4
{Vaso-occlusive crises in sickle-cell anemia}; Lang SM et al.; HISTORY AND FINDINGS: Severe pain suddenly occurred in the shaft of the right thigh in a 21-year-old patient of Turkish descent with known homozygotic sickle cell anaemia . He also had marked scleral jaundice and anaemia (haemoglobin 9.1 g/dl) . An X-ray film of the lower leg pointed to a bone infarct . Type of pain, partial pressure of oxygen in blood (70 mm Hg), concentration of lactate dehydrogenase and the bilirubin level (4,5 mg/dl) as signs of haemolysis, as well as the fall in haemoglobin, indicated a vascular occlusive crisis in sickle cell anaemia . TREATMENT AND COURSE: The symptoms regressed within 8 days of the patient receiving fluids, analgesics and oxygenation by nasal tube . A few weeks later he developed a fever, productive cough and severe pain in joints and abdomen . Blood p02 was 54 mm Hg . Pneumonia in the right lung base was the cause of this renewed life-threatening crisis, which was again associated with haemolysis . Klebsiella having been found in sputum he was treated with cefotaxim (1 g twice daily intravenously) and oxygen insufflation via nasal tube (7 l/min) . His condition quickly improved . CONCLUSIONS: In patients with sickle cell anaemia it is important (1) to regard crises as potentially life-threatening conditions, (2) to detect and treat infections as possible causes early and (3) to provide sufficient oxygen insufflation quickly, especially in pulmonary infections.

J Immunol, 1995 Jul 15, 155(2), 722 - 9
Neutralization of IL-10 increases survival in a murine model of Klebsiella pneumonia; Greenberger MJ et al.; Effective host defense against bacterial infection is dependent upon the vigorous recruitment and activation of neutrophils and macrophages . We hypothesized that IL-10 is produced in the setting of bacterial pneumonia, and this cytokine may attenuate host defense by inhibiting the expression of important activating and chemotactic cytokines . CD-1 mice were challenged with either 30 microliters of saline or saline containing 10(3) CFUs of Klebsiella pneumoniae intratracheally (i.t.) and lungs were harvested at 8, 24, and 48 h . The i.t . inoculation with K . pneumoniae resulted in a 13-, 14-, and 8-fold increase in lung homogenate TNF, macrophage inflammatory protein-2 (MIP-2), and macrophage inflammatory protein-1 alpha (MIP-1 alpha) levels, respectively, as compared with control animals . In addition, we observed an increase in IL-10 mRNA and protein levels in lung homogenates, maximal at 48 h postinoculation . To establish the biologic relevance of IL-10 in Klebsiella pneumonia, we passively immunized CD-1 mice with 0.5 ml of rabbit anti-murine IL-10 serum or preimmune serum i.p . 2 h before i.t . administration of K . pneumoniae . Treatment of animals with anti-IL-10 serum resulted in increased levels of TNF, MIP-2, and MIP-1 alpha, respectively, within lung homogenates at 24 and 48 h, as compared with preimmune-treated animals . Furthermore, neutralization of IL-10 resulted in a significant decrease in K . pneumoniae CFU in both lung homogenates and plasma harvested at 48 h, as well as a significant increase in survival in these animals . Our studies indicate that 1) IL-10 is produced during Klebsiella pneumonia; and 2) inhibition of IL-10 bioactivity in vivo results in enhanced bacterial clearance, increased expression of proinflammatory cytokines, and prolonged survival.

FEMS Microbiol Lett, 1995 Jul 15, 130(1), 51 - 7
Virulence factors (aerobactin and mucoid phenotype) in Klebsiella pneumoniae and Escherichia coli blood culture isolates; Vernet V et al.; We examined the presence of two virulence factors in 241 blood isolates of Klebsiella pneumoniae from patients hospitalized during 1989 and 1990 in 7 French hospitals, and 125 blood isolates of Escherichia coli from one hospital . Aerobactin was scored phenotypically and genotypically with an intragenic DNA probe of 2 kb . The mucoid phenotype was assessed by culture on trypticase soy agar and by genotypic analysis (intragenic DNA probe of 235 bp) . Only 6% K . pneumoniae isolates were aerobactin-positive with no significant variation according to geographical location while 20% of K . pneumoniae isolates displayed the mucoid phenotype, with a significant variation according to hospital . Aerobactin was always associated with the mucoid phenotype . The frequency of aerobactin production but not mucoid phenotype (14%) was higher among E . coli isolates (48%) . They harbored two types of large plasmids . Intraperitoneal injection into mice of 10(3) cfu of K . pneumoniae producing both virulence factors demonstrated that capsular serotype K2 was the more virulent K23 and K28.

Carbohydr Res, 1995 Jul 11, 271(2), 177 - 83
Synthesis of the tetrasaccharide repeating unit of the antigen from Klebsiella type 20; Das SK et al.; Starting from D-mannose, D-galactose and D-glucuronolactone, two disaccharide blocks, namely methyl 4,6-di-O-benzyl-2-O-(2,3,4,6-tetra-O-benzyl-beta-D-galactopyranosyl)- alpha-D-mannopyranoside, acting as acceptor, and ethyl 4,6-di-O-acetyl-2-O-allyl-3-O-(methyl 2,3,4-tri-O-acetyl-beta-D-gluco-pyranosyluronate)-1-thio-beta-D- galactopyranoside, acting as donor, were synthesised . The two disaccharides were then allowed to react to give, after deprotection, methyl 2-O-beta-D-galactopyranosyl-3-O-(3-O-beta-D-glucopyranosyluronic acid-alpha-D-galactopyranosyl)-alpha-D-mannopyranoside which is the methyl glycoside of the tetrasaccharide repeating unit of the said antigen.

Orv Hetil, 1995 Jul 2, 136(27), 1447 - 9
{Vertical transmission causing hepatitis C in a newborn infant}; Grasselly M et al.; There is a case report of an intrauterine growth retarded infant who was suffering of sepsis caused by Klebsiella pneumoniae . An exchange transfusion was carried out because of hyperbilirubinaemia on the 5th day of life . 10 days later high bilirubin concentration was observed again parallel to the liver enzyme abnormalities . HCV-related antibodies were detectable in the sera of the newborn and his mother as well . The results of analysis of HCV RNA with the polymerase chain reaction in the infant and his mother suggest vertical transmission of HCV infection . This is the first case of HCV infection in the newborn caused by vertical transmission in Hungary.

J Antimicrob Chemother, 1995 Jul, 36(1), 241 - 6
Bactericidal effect of beta-lactams and amikacin alone or in association against Klebsiella pneumoniae producing extended spectrum beta-lactamase; Roussel-Delvallez M et al.; Ten extended spectrum beta-lactamases producing strains of Klebsiella pneumoniae characterized by analytical isoelectric focusing and studied for their susceptibility to beta-lactam antibiotics, either alone or in combination with a beta-lactamase inhibitor (clavulanic acid and sulbactam) and in association with amikacin . The extended spectrum beta-lactamases were derived from either TEM (CTX-1 = TEM-3) or SHV (CAZ-4 = SHV-5) . Killing curves were studied with antibiotics at clinical by achievable concentrations, at MIC and MIC x 4 . At MIC, cefotetan, cefotaxime and ceftazidime lacked bactericidal activity . Imipenem was more rapidly bactericidal than meropenem or co-amoxiclav . At MIC x 4, cefotetan and cefotaxime exhibited bactericidal effect but this was less than for imipenem which gave a reduction of 4 log10 of the inoculum . Cefotaxime plus sulbactam gave no bactericidal effect compared with cefotaxime plus co-amoxiclav . A bactericidal effect with cefotaxime plus sulbactam was seen with the addition of amikacin . At clinical concentrations cefotaxime plus co-amoxiclav +/- amikacin was as efficient as imipenem +/- amikacin with a rapid bactericidal effect (5-6 log10 in 30-60 min) . We proposed that cefotaxime+co-amoxiclav might be considered as an alternative to imipenem for the treatment of extended spectrum beta-lactamase associated K . pneumoniae injections.

Chemotherapy, 1995 Jul-Aug, 41(4), 267 - 75
Mechanism of enhancement of bactericidal activity of phagocytes against Klebsiella pneumoniae treated with subminimal inhibitory concentrations of cefodizime; Nomura S et al.; The effects of a sub-MIC of cefodizime on the morphology of the capsular structures and on the surface physicochemical properties, such as hydrophobicity and charge, of encapsulated Klebsiella pneumoniae were studied . The enhancement of bactericidal activity of macrophages against bacteria treated with sub-MICs of antibiotics was evaluated as the killing index . Cefodizime treatment gave the highest value of 32 . Electron microscope observations revealed that the capsular material layer of cefodizime-treated K . pneumoniae was markedly thinner (32 nm) than that of untreated bacteria (160 nm) or bacteria treated with other antibiotics (75-90 nm) . Contact angle measurement revealed that the surface of cefodizime-treated K . pneumoniae was more hydrophobic than that of untreated bacteria or bacteria treated with other antibiotics . Furthermore, the negative charge of the surface of K . pneumoniae decreased significantly with cefodizime treatment compared with the surface of untreated bacteria . These findings suggest that the treatment of K . pneumoniae with a sub-MIC of cefodizime reduced the thickness of the capsular material layer and that these changes increased the surface hydrophobicity of the bacteria and decreased the negative charge of the bacterial surface to render K . pneumoniae more susceptible to phagocytic activity by reducing the physical repulsion between the bacteria and phagocytes.

Infect Immun, 1995 Jul, 63(7), 2537 - 40
Binding of mannose-binding protein to Klebsiella O3 lipopolysaccharide possessing the mannose homopolysaccharide as the O-specific polysaccharide and its relation to complement activation; Jiang GZ et al.; Lipopolysaccharide from Klebsiella pneumoniae O3, which possesses the mannose homopolysaccharide as the O-specific polysaccharide, exhibits an extraordinarily high ability to activate the human complement system . We isolated the mannose-binding protein with a Klebsiella O3 lipopolysaccharide affinity column . The protein isolated had a molecular mass of much higher than 200 kDa, and it consisted of subunits with an apparent molecular mass of 32 kDa . The NH2-terminal sequence of the 32-kDa subunits was completely consistent with a part of the amino acid sequence of human serum mannose-binding protein . In immunoblotting, an anti-mannose-binding protein monoclonal antibody was definitely reactive with the isolated protein with the higher molecular mass . The protein isolated was bound exclusively to lipopolysaccharides possessing the mannose homopolysaccharide, not to lipopolysaccharide possessing the heteropolysaccharides . Klebsiella O3 lipopolysaccharide did not exhibit a high anticomplement activity in the serum from which the mannose-binding protein was depleted . It was concluded that the serum factor that bound to Klebsiella O3 lipopolysaccharide may be mannose-binding protein and that it may play a crucial role in the strong complement activation by Klebsiella O3 lipopolysaccharide.

Rinsho Shinkeigaku, 1995 Jun, 35(6), 667 - 9
{A case of thrombocytopenia due to heparin therapy for a progressing ischemic stroke}; Arai M et al.; A 44-year-old man was admitted, complaining of weakness of his left limbs . On admission, he was oriented and cooperative . He showed positive Barre sign only on the left leg . Deep tendon reflexes were unremarkable; pathological reflexes were negative . There was no cerebellar ataxia or sensory deficit . Immediately after admission, monoplegia of the left leg progressed . He was started on heparin infusion therapy . His paralysis had been resolved by the 5th day . MRI of the brain demonstrated an infarction involving the body of the corpus callosum, the right cingulate gyrus, and the right paracentral lobule . Neuropsychologic examination demonstrated a disturbance of interhemispheric transfer of position . On the 10th day he developed Klebsiella ozaenae bacteremia . On the 11th day, platelet count was 9.2 x 10(4)/microliter . Antithrombin III, thrombin antithrombin III complex, D-dimer, and FDP levels were unremarkable, which is quite atypical for DIC associated with bacterial infection . Platelet factor 4 and beta-thromboglobulin levels were remarkably high, suggesting activated platelet aggregation . We made a diagnosis of heparin-induced thrombocytopenia and discontinued heparin infusion . Three days later, platelet count began to increase and creatinine levels returned normal . All patients receiving heparin should be monitored for platelet count.

J Bacteriol, 1995 Jun, 177(12), 3546 - 55
The nitrogen assimilation control protein, NAC, is a DNA binding transcription activator in Klebsiella aerogenes; Goss TJ et al.; A 32-kDa polypeptide corresponding to NAC, the product of the Klebsiella aerogenes nac gene, was overexpressed from a plasmid carrying a tac'-'nac operon fusion and purified to near homogeneity by taking advantage of its unusual solubility properties . NAC was able to shift the electrophoretic migration of DNA fragments carrying the NAC-sensitive promoters hutUp, putPp1, and ureDp . The interaction between NAC and hutUp was localized to a 26-bp region centered approximately 64 bp upstream of the hutUp transcription initiation site . Moreover, NAC protected this region from DNase I digestion . Mobility shift and DNase I protection studies utilizing the putP and ureD promoter regions identified NAC-binding regions of sizes and locations similar to those found in hutUp . Comparison of the DNA sequences which were protected from DNase I digestion by NAC suggests a minimal NAC-binding consensus sequence: 5'-ATA-N9-TAT-3' . In vitro transcription assays demonstrated that NAC was capable of activating the transcription of hutUp by sigma 70-RNA polymerase holoenzyme when this promoter was presented as either a linear or supercoiled DNA molecule . Thus, NAC displays the in vitro DNA-binding and transcription activation properties which have been predicted for the product of the nac gene.

Yakugaku Zasshi, 1995 Jun, 115(6), 446 - 59
{A stereoselective synthesis of tilivalline and its analogs utilizing a new Mannich type intramolecular cyclization}; Aoyama T et al.; Tilivalline (1a), a metabolite isolated from Klebsiella pneumoniae var . oxytoca, belongs to a group of pyrrolo{2,1-c}{1,4}benzodiazepines, a characteristic skeleton of anthramycin-type antitumor antibiotics . We have accomplished a completely stereoselective, efficient and convenient synthesis of 1a utilizing a new Mannich type intramolecular cyclization as a key step . Further, a computational chemical analysis clarified the effect of zinc chloride on the high stereoselectivity in the tilivalline synthesis . To aim both the extension of the scope of the new Mannich type intramolecular cyclization and the studies on the structure-biological activity relationship, we further extended the method to the synthesis of tilivalline derivatives and 2-(3'-indolyl)-1,4-benzodiazepines (50) . Investigation on the cytotoxicity of 1a and its analogs has revealed that 1a shows the strong cytotoxicity toward mouse leukemia L 1210 cells and the replacement of the indole function of 1a with cyano one increases the cytotoxicity of 1a about 100 times (IC50 = 0.05 microgram/ml).

Antimicrob Agents Chemother, 1995 Jun, 39(6), 1365 - 8
Point mutation in the pribnow box, the molecular basis of beta-lactamase overproduction in Klebsiella oxytoca; Fournier B et al.; Klebsiella oxytoca mutants resistant to a variety of beta-lactams were obtained in vitro on aztreonam . Constitutive beta-lactamase production was much higher in the mutants than in the susceptible strains (75-fold) . The only difference observed in these mutants compared with the susceptible strains were point mutations in the Pribnow box: a transversion (G-->T) in the first base for one mutant or a transition (G-->A) in the fifth base of the -10 consensus sequence for the other three mutants . The transcriptional output of the beta-lactamase gene (blaOXY) from the mutants was significantly higher than that of the blaOXY gene from the susceptible strains.

Rhinology, 1995 Jun, 33(2), 57 - 60
Successful treatment of ozena with ciprofloxacin; Nielsen BC et al.; Rhinitis chronica foetida, or ozena, is a rare chronic inflammatory disease . The aetiology and pathogenesis are still not satisfactory explained . For many years various medical and surgical methods for the treatment of this slowly progressive and disabling disease have been tried without permanent success so far . The new fluoroquinolones with excellent effect on gram-negative bacteria and high suitability for oral use offer a potentially attractive treatment for ozena . We review our experience in the treatment of 10 patients with ciprofloxacin in a daily dose of 500-750 mg b.i.d . for 1-3 months . The patients have been followed regularly for up to 26-74 months after treatment and in all of them we registered permanent disappearance of odour, crusting, and growth of Klebsiella ozenae . We conclude that ciprofloxacin provides a step towards better conservative therapy for patients with ozena.

Intern Med, 1995 Jun, 34(6), 554 - 8
Magnetic resonance imaging of multiple brain abscesses of the bilateral basal ganglia; Nagase T et al.; A 64-year-old woman developed multiple brain abscesses of the basal ganglia associated with Klebsiella pneumoniae septicemia . Magnetic resonance (MR) images showed three different stages of the brain abscesses . The images of early cerebritis of this site mimicked lacunar infarctions or dilated Virchow-Robin spaces . The differentiation of the brain abscess from lacunae and dilated Virchow-Robin spaces is discussed, together with the evolution of the brain abscesses on MR images.

Int J Cancer, 1995 May 29, 61(5), 716 - 21
Liposomal doxorubicin-induced toxicity: depletion and impairment of phagocytic activity of liver macrophages; Daemen T et al.; Doxorubicin entrapped within conventional liposomes (200 nm in diameter; lip-Dox) has major toxic effects on liver macrophages of the rat for a considerable period of time following i.v . administration, with respect to both specific phagocytic capacity and cell numbers . At different time-points after injection of lip-Dox or free doxorubicin, radiolabeled, negatively charged, "empty" test liposomes were injected . Phagocytic capacity was determined by isolating the liver macrophages and measuring the amount of macrophage-associated radioactivity . Four subfractions of liver macrophages of different cell-size and with intrinsically different phagocytic capacity were isolated . Twenty-four hours after injection of lip-Dox, the phagocytic capacity of the larger-sized liver macrophages was strongly decreased . The relatively low intrinsic phagocytic capacity of the smaller-sized macrophages was only slightly impaired . Phagocytic capacity after injection of lip-Dox was nearly restored to control values after 14 days . Blood clearance of Klebsiella pneumoniae bacteria after pre-treatment with lip-Dox was strongly decreased . Pre-treatment with the free drug and/or placebo liposomes had no effect on phagocytic and bacterial blood-clearance capacity . A major depletion of the liver macrophage population was observed, as revealed by both macrophage isolation and histology . Only 2 weeks after injection of lip-Dox, the number of cells had returned to that seen in control animals . In view of the important host-defense functions of the liver macrophages, especially in the control of tumor growth and infection, the findings reported here should be taken into consideration when lip-Dox is to be administered in anti-tumor therapy.

Science, 1995 May 19, 268(5213), 998 - 1004
The crystal structure of urease from Klebsiella aerogenes; Jabri E et al.; The crystal structure of urease from Klebsiella aerogenes has been determined at 2.2 A resolution and refined to an R factor of 18.2 percent . The enzyme contains four structural domains: three with novel folds playing structural roles, and an (alpha beta)8 barrel domain, which contains the bi-nickel center . The two active site nickels are 3.5 A apart . One nickel ion is coordinated by three ligands (with low occupancy of a fourth ligand) and the second is coordinated by five ligands . A carbamylated lysine provides an oxygen ligand to each nickel, explaining why carbon dioxide is required for the activation of urease apoenzyme . The structure is compatible with a catalytic mechanism whereby urea ligates Ni-1 to complete its tetrahedral coordination and a hydroxide ligand of Ni-2 attacks the carbonyl carbon . A surprisingly high structural similarity between the urease catalytic domain and that of the zinc-dependent adenosine deaminase reveals a remarkable example of active site divergence.

J Mol Biol, 1995 May 12, 248(4), 781 - 803
Core RNA polymerase and promoter DNA interactions of purified domains of sigma N: bipartite functions; Cannon W et al.; The sigma N class of sigma factors confer upon RNA polymerase the requirement for enhancer-binding activator proteins . The sigma-N (sigma N) protein of Klebsiella pneumoniae was analysed by the assay of purified peptides comprising domains or regions of sigma N defined by proteolysis or by homology alignment, respectively . The NH2-terminal Region I is required for the correct interaction of holoenzyme with the promoter, and promoter complexes forming with a truncated sigma N lacking Region I are not activatable . The complexes lack the DNA structure believed to represent nucleated strand separation but still make close contacts with this promoter part . Determinants of specific DNA recognition by sigma N were shown to reside in a C-terminal 16 kDa peptide, and core RNA polymerase binding determinants in an adjacent peptide . The latter contacts and appears to pack against the DNA-binding domain . Thus the DNA-binding and core-binding domains are bipartite in function, consistent with core functioning as an allosteric effector of the sigma DNA-binding activity . The DNA-binding and core-binding domains together include Region III of sigma N . Although not the primary determinant of core or DNA recognition, the acidic Region II of sigma N influenced both activities . Regions I and II in combination with core RNA polymerase thus appear to control the activity of C-terminal DNA contacting surfaces to allow formation of a closed promoter complex that is susceptible to activation.

Lett Appl Microbiol, 1995 May, 20(5), 303 - 7
Comparison of selective agars for the isolation and identification of Klebsiella oxytoca and Escherichia coli from environmental drinking water samples; Packer PJ et al.; Various selective media were assessed for their ability to detect and differentiate Klebsiella oxytoca and Escherichia coli in environmental water samples . Only two, Membrane Lauryl Sulphate agar and Deoxycholate Agar, could differentiate the two coliforms from each other and from the 'background' heterotrophs in water and this was a consequence of E . coli's ability to grow at 44 degrees C and 37 degrees C whereas Kl . oxytoca could only grow at 37 degrees C . Modified M-FC medium effectively differentiated Kl . oxytoca but not E . coli in environmental samples . Other media characterized the different coliforms in pure culture but failed to do likewise in environmental samples . For example, pure cultures of E . coli fluoresced when MUG was added to the medium but single colonies on a mixed species plate failed to do so . MT7 agar distinguished the two coliforms from water heterotrophs but not from each other.

Am J Gastroenterol, 1995 May, 90(5), 767 - 70
Rupture of pyogenic liver abscess; Chou FF et al.; OBJECTIVE: Our objective was to study the clinical manifestations, course, treatment, and results obtained in 23 patients with ruptured pyogenic liver abscess and compare these findings with those of nonruptured cases . METHODS: Four hundred twenty-four patients with clinical diagnoses of pyogenic liver abscess were enrolled in the study . Among these, 23 patients had ruptured pyogenic liver abscess . The clinical manifestations, incidence of septic shock, laboratory findings, concurrent diabetes mellitus, etiology of abscess, and results of the treatment were recorded . Qualitative data were analyzed by chi 2 test, and quantitative data were analyzed by Student's t test . RESULTS: Except for abdominal pain and septic shock, other symptoms, such as fever, chills, and jaundice, were similar in ruptured and nonruptured groups . Laboratory findings indicated that the group with ruptured liver abscess had higher levels of bilirubin, blood glucose, and aspartate aminotransferase than the non-ruptured group . Of the patients with ruptured abscess, 14 (60.9%) had diabetes mellitus and 15 (65.2%) were cryptogenic . Klebsiella pneumoniae was the bacteria most often isolated in both blood cultures and liver aspirates . Surgical intervention--draining the abscess and cleaning the abdominal cavity--was the only means of saving the patients' lives . The overall mortality rate was higher in this group (43.5%) than in the nonruptured group (15.5%) . CONCLUSIONS: Ruptured pyogenic liver abscess should be suspected if septic shock and diffuse abdominal pain are found in a patient with pyogenic liver abscess, concurrent with high levels of bilirubin, aspartate aminotransferase, and blood glucose . Surgery is the only treatment for this condition.

Infect Immun, 1995 May, 63(5), 2026 - 32
Adherence properties of an mrkD-negative mutant of Klebsiella pneumoniae; Hornick DB et al.; The role of the mrkD gene in attachment by a type 3 fimbriate Klebsiella pneumoniae strain was further characterized . A clinical isolate, K . pneumoniae IA565, was found to contain two copies of the gene encoding the fimbrial subunit, mrkA, and one copy of the gene encoding the adhesin subunit, mrkD . One copy of mrkA was located on the bacterial chromosome, and the other copy was associated with mrkD and located on a plasmid . The plasmid-borne mrk gene cluster was lost when K . pneumoniae IA565 was subcultured serially in broth at 44 degrees C . The resulting mrkD-negative strain, designated K . pneumoniae IApc35, did not exhibit the following adherence characteristics associated with K . pneumoniae possessing MrkD-positive fimbriae: agglutination of tannic acid-treated human erythrocytes and attachment to trypsinized human buccal cells . However, K . pneumoniae IApc35 produced type 3 fimbriae that were composed of the characteristic 21.5-kDa major fimbrial subunit, were reactive with specific serum, and were visualized specifically by immunoelectron microscopy . K . pneumoniae IApc35 retained a copy of the mrkA gene on its chromosome . This mrkA-containing gene cluster could be complemented by a recombinant plasmid carrying only the mrkD gene, resulting in restoration of the K . pneumoniae IA565-like adhesive phenotype and demonstration of type 3 filament-associated MrkD subunits by using colloidal gold labeling and immunoelectron microscopy . These data indicate that K . pneumoniae may contain multiple copies of the mrk genes which may be present simultaneously on both plasmid and chromosomal DNAs and which may encode fimbriae with different binding specificities.

Chemotherapy, 1995 May-Jun, 41(3), 178 - 86
In vitro and in vivo enhancement of bactericidal activity of phagocytes against Klebsiella pneumoniae treated with subminimal inhibitory concentrations of cefodizime; Nomura S et al.; The effects of a subminimal inhibitory concentration (sub-MIC) of cefodizime on the bactericidal activity of phagocytes against encapsulated Klebsiella pneumoniae were studied in an in vitro system using an established mouse macrophage cell line, and in an in vivo system using mice in which many phagocytes were induced in the peritoneal cavity . In the in vitro system, the bactericidal activity of mouse macrophages against K . pneumoniae treated with a sub-MIC of cefodizime was significantly enhanced, and was greater than that of cefotaxime or cefoperazone . Significantly more bacteria treated with a sub-MIC of cefodizime were killed by serum complement than those treated with cefotaxime or cefoperazone . In the in vivo system, cefodizime-treated bacteria were phagocytosed and killed by phagocytes in the mouse peritoneal cavity, whereas, cefotaxime- and cefoperazone-treated and untreated bacteria were hardly phagocytosed at all or killed by phagocytes in the mouse peritoneal cavity, and bacterial regrowth was observed 24 h after bacterial challenge . Furthermore, the virulence of K . pneumoniae in mice was reduced more by treatment with cefodizime than with cefotaxime or cefoperazone . These findings indicate that K . pneumoniae treated with a sub-MIC of cefodizime become more susceptible to the bactericidal activity of phagocytes both in vitro and in vivo . This provides evidence that cefodizime at a sub-MIC may act together with the phagocytes against bacterial infections.

Antimicrob Agents Chemother, 1995 May, 39(5), 1187 - 90
In vitro activities of various beta-lactam antimicrobial agents against clinical isolates of Escherichia coli and Klebsiella spp . resistant to oxyimino cephalosporins; Jett BD et al.; Broth microdilution testing was used to study the activity of several beta-lactam antimicrobial agents, including piperacillin-tazobactam and cefepime, against 108 clinically derived Escherichia coli and Klebsiella sp . strains resistant to oxyimino cephalosporins (i.e., putative extended-spectrum beta-lactamase producers) . On the basis of the percentage of susceptible strains, imipenem (100%), cefotetan (> or = 92%), and piperacillin-tazobactam (> or = 86%) were the most active agents . Cefepime activity (52 to 64% susceptible) was comparable to that of cefotaxime (40 to 63% susceptible) and aztreonam (20 to 63% susceptible) . Among all beta-lactams tested, imipenem and cefotetan demonstrated the highest and most consistent level of activity and were the least affected by challenges with increased sizes of inocula of these resistant organisms.

Antimicrob Agents Chemother, 1995 May, 39(5), 1093 - 6
Effects of MICs and sub-MICs of antibiotics on production of capsular polysaccharide of Klebsiella pneumoniae; Held TK et al.; In the present study, we examined whether MICs and sub-MICs of antimicrobial agents belonging to two different classes, ciprofloxacin and ceftazidime, were able to influence the production and release of cell-associated and soluble (extracellular) capsular polysaccharide (CPS), respectively, in a heavily encapsulated strain of Klebsiella pneumoniae (B5055) . Using a CPS-specific enzyme-linked immunosorbent assay, we found that the amount of cell-associated CPS increased in a dose-dependent manner by more than 10-fold under the influence of the MIC of ceftazidime and by more than 100-fold under the influence of the MIC of ciprofloxacin . The largest amounts of CPS were measured by using the MIC of either antibiotic substance . Electron microscopic studies showed that the diameter of the capsule was significantly increased compared with the diameter for untreated controls . Thus, both antimicrobial agents genuinely stimulated CPS production.

J Formos Med Assoc, 1995 May, 94(5), 232 - 7
Comparison of pyogenic liver abscesses caused by Klebsiella pneumoniae and non-K . pneumoniae pathogens; Chang FY et al.; A retrospective study on patients with pyogenic liver abscesses was conducted to clarify the different clinical presentations among patients with Klebsiella pneumoniae abscesses and those with non-K . pneumoniae abscesses . From 1981 to 1993, the medical records of 146 adults with culture-confirmed pyogenic liver abscesses who attended Tri-Service General Hospital in Taipei were studied . Abscesses due to K . pneumoniae accounted for 114 (78%) of pyogenic liver abscesses . When compared to patients with non-K . pneumoniae abscesses, patients with K . pneumoniae liver abscesses had significantly higher proportions of monomicrobial infections, unknown sources of infection and solitary abscesses . Patients with K . pneumoniae liver abscesses were found to have diabetes mellitus more often than patients with non-K . pneumoniae liver abscesses (66% vs 19%) . Septicemia was found more frequently in patients with K . pneumoniae liver abscesses than in patients with non-K . pneumoniae liver abscesses (50% vs 27%) . The clinical presentations among the two groups were, otherwise, not significantly different . Regardless of the microbial etiology, patients with diabetes mellitus had longer periods of fever after treatment and hospitalization than patients without diabetes . The reason for the high relative frequency of liver abscesses in Taiwan and its more frequent occurrence in diabetes mellitus remains unclear.

Microbiol Res, 1995 May, 150(2), 167 - 72
Antibacterial, antidermatophytic and antitoxigenic activities of onion (Allium cepa L.) oil; Zohri AN et al.; The inhibitory effect of onion oil against the growth of various isolates of bacteria representing Gram-positive (4 isolates) and Gram-negative (4 isolates) species were studied . Results show that onion oil was highly active against all Gram-positive bacteria tested and only one isolate (Klebsiella pneumoniae) of Gram-negative bacteria . The inhibitory effect of onion oil against nine different species of dermatophytic fungi were also studied . Onion oil (200 ppm) completely inhibited the growth of Microsporum canis, M . gypseum and Trichophyton simii while the growth of both, Chrysosporium queenslandicum and Trichophyton mentagrophytes was completely inhibited by 500 ppm of onion oil . The growth of four other species of dermatophytic fungi was gradually reduced by increasing the concentrations of onion oil . The inhibitory effect of onion oil was also tested against four toxigenic isolates of fungi . Onion oil at different concentrations (100, 200 and 500 ppm) tested gradually reduced fungal growth and aflatoxin production by Aspergillus flavus IMI 89,717 and A . parasiticus var . globosus IMI 120,920 . Fungal growth and production of sterigmatocystin and rubratoxin A by A . versicolor IMI 16,139 and Penicillium rubrum IMI 136,127 were completely inhibited by the addition of 200 ppm onion oil.

Infection, 1995 May-Jun, 23(3), 163 - 7
Klebsiella oxytoca meningitis: frequent association with neurosurgical procedures; Tang LM et al.; Klebsiella oxytoca meningitis is a rare condition . Nine patients were diagnosed between 1981 and 1993 at our institution . These accounted for 2.3% of 393 patients with blood and/or cerebrospinal fluid culture-proven bacterial meningitis . K . oxytoca was noted in both community-acquired meningitis and nosocomial meningitis . Eight of the nine cases were patients who had undergone neurosurgical procedures . Four were mixed bacterial meningitis . All K . oxytoca isolates were susceptible to third-generation cephalosporins and all but one to chloramphenicol . Antibiotic therapy was successful in eight patients but failed in one.

Mol Gen Genet, 1995 Apr 20, 247(2), 189 - 98
The role of uridylyltransferase in the control of Klebsiella pneumoniae nif gene regulation; Edwards R et al.; The glnD gene in enteric bacteria encodes a uridylyltransferase/uridylyl-removing enzyme which acts as the primary nitrogen sensor in the nitrogen regulation (Ntr) system . We have investigated the role of this enzyme in transcriptional regulation of nitrogen fixation genes in Klebsiella pneumoniae by cloning glnD from this organism and constructing a null mutant by insertional inactivation of the chromosomal gene using the omega interposon . K . pneumoniae glnD encodes a 102.3 kDa polypeptide which is highly homologous to the predicted products of both Escherichia coli glnD and Azotobacter vinelandii nfrX . The glnD-omega mutant was unable to uridylylate PII and was altered in adenylylation/deadenylylation of glutamine synthetase . Uridylyltransferase was required for derepression of ntr-regulated promoters such as glnAp2 and pnifL but was not involved in the nif-specific response to changes in nitrogen status mediated by the nifL product . We conclude that a separate, as yet uncharacterised, nitrogen control system may be responsible for nitrogen sensing by NifL.

Infect Immun, 1995 Apr, 63(4), 1318 - 28
Aggregative adherence of Klebsiella pneumoniae to human intestine-407 cells; Favre-Bonte S et al.; Aggregative adhesion of Klebsiella pneumoniae LM3 to Intestine-407 (Int-407) cells was studied . Adhesive capacities were affected by the bacterial growth phase (with a maximum of adherence obtained during the exponential phase), temperature, multiplicity of infection, and length of incubation with Int-407 cells . Adhesion occurred through a cytochalasin D-sensitive process and was greatly reduced after treatment of Int-407 with cycloheximide, indicating that aggregative adhesion requires active participation of Int-407 cells . Transmission electron microscopy revealed that adherent bacteria were surrounded by a capsule-like material, apparently involved in both bacterium-Int-407 cell and bacterium-bacterium adherence . Examination with a scanning electron microscope showed interactions of intestinal cell microvilli with bacteria and formation in 3 h of a fibrous network within and around the bacterial clusters . We speculate that aggregative adhesion of K . pneumoniae mediated by a capsule-like extracellular material might explain the persistence of these strains inside the host gastrointestinal tract.

J Am Vet Med Assoc, 1995 Apr 1, 206(7), 1018 - 21
Septic cholangiohepatitis and cholangiocarcinoma in a horse; Durando MM et al.; Septic cholangiohepatitis was diagnosed in an 11-year-old Warmblood gelding with a history of intermittent colic and fever . Klebsiella pneumoniae, susceptible to gentamicin, was cultured from the biopsy specimen . However, treatment with gentamicin was unsuccessful, and histologic examination and bacteriologic culture of a biopsy specimen obtained 3 weeks later revealed progression of the hepatic inflammation and yielded growth of gentamicin-resistant K pneumoniae . At this time, several discrete hyperechoic structures, suggestive of biliary calculi, were seen ultrasonographically . A change in antibiotic treatment was associated with gradual resolution of clinical signs . Five months after initial examination, the horse had a sudden onset of severe right forelimb lameness . The horse responded to treatment with antibiotics and phenylbutazone, but lameness and fever that was unresponsive to treatment recurred 7 months later, and the horse was euthanatized . Necropsy revealed nodules throughout the liver and a mass associated with the right metacarpophalangeal joint . Histologic and immunohistochemical examination revealed carcinomatous infiltration of the liver and metacarpophalangeal joint . The tumor was probably of biliary origin . Carcinoma should be considered in cases of septic cholangiohepatitis unresponsive to antibiotic treatment.

J Bacteriol, 1995 Apr, 177(8), 1947 - 51
Evidence for the presence of urease apoprotein complexes containing UreD, UreF, and UreG in cells that are competent for in vivo enzyme activation; Park IS et al.; In vivo activation of Klebsiella aerogenes urease, a nickel-containing enzyme, requires the presence of functional UreD, UreF, and UreG accessory proteins and is further facilitated by UreE . These accessory proteins are proposed to be involved in metallocenter assembly (M . H . Lee, S . B . Mulrooney, M . J . Renner, Y . Markowicz, and R . P . Hausinger, J . Bacteriol . 174:4324-4330, 1992) . A series of three UreD-urease apoprotein complexes are present in cells that express ureD at high levels, and these complexes are thought to be essential for in vivo activation of the enzyme (I.-S . Park, M . B . Carr, and R . P . Hausinger, Proc . Natl . Acad . Sci . USA 91:3233-3237, 1994) . In this study, we describe the effect of accessory gene deletions on urease complex formation . The ureE, ureF, and ureG gene products were found not to be required for formation of the UreD-urease complexes; however, the complexes from the ureF deletion mutant exhibited delayed elution during size exclusion chromatography . Because these last complexes were of typical UreD-urease sizes according to native gel electrophoretic analysis, we propose that UreF alters the conformation of the UreD-urease complexes . The same studies revealed the presence of an additional series of urease apoprotein complexes present only in cells containing ureD, ureF, and ureG, along with the urease subunit genes . These new complexes were shown to contain urease, UreD, UreF, and UreG . We propose that the UreD-UreF-UreG-urease apoprotein complexes represent the activation-competent form of urease apoprotein in the cell.

Arch Surg, 1995 Apr, 130(4), 401 - 5; discussion 406
The comparison of clinical course and results of treatment between gas-forming and non-gas-forming pyogenic liver abscess; Chou FF et al.; OBJECTIVES: To study and review the clinical manifestations, courses, and results of treatment in 83 cases of verified gas-forming pyogenic liver abscess . DESIGN: Case series . SETTING: Both primary and referral hospital care . PATIENTS: Four hundred twenty-four patients with clinical diagnosis of pyogenic liver abscess were enrolled in the study . Eighty-three patients had gas-forming abscesses and 341 had non-gas-forming abscesses . The clinical manifestations, duration of symptoms, incidence of septic shock, laboratory findings, concurrent diabetes mellitus, cause of abscess, size of abscess, and results of treatment were recorded . MAIN OUTCOME MEASURES: A chi 2 test for qualitative data and Student's test for quantitative data . RESULTS: Duration of symptoms were shorter (mean +/- SD, 5.2 +/- 5.3 vs 7.6 +/- 10 days) (P < .005) and the incidence of septic shock was higher in the gas-forming than in the non-gas-forming group (32.5% vs 11.7%) (P < .01) . Laboratory findings revealed high levels of blood glucose, aspartate aminotransferase, alkaline phosphatase, and serum urea nitrogen in the gas-forming group . The size of abscess was usually bigger (> 5 cm) in this group . In the gas-forming group, 71 patients (85.5%) had diabetes mellitus and 65 patients (78.3%) had conditions of cryptogenic origin . Klebsiella pneumoniae was the main bacteria, in blood culture and liver aspirates, especially in gas-forming liver abscess . Medical treatment and/or aspiration carried a high mortality rate (44.4%) in the gas-forming group; also, the overall mortality rate was higher in this group than in the non-gas-forming group (27.7% vs 14.4%) (P < .01) . CONCLUSIONS: The gas-forming liver abscess may be a disease of wide spectrum of severity and may run a fulminating course . Strong antibiotics with early adequate drainage are mandatory . Surgery should not be delayed if necessary.

J Infect Dis, 1995 Apr, 171(4), 938 - 47
Efficacy of gentamicin or ceftazidime entrapped in liposomes with prolonged blood circulation and enhanced localization in Klebsiella pneumoniae-infected lung tissue; Bakker-Woudenberg IA et al.; Polymer (PEG-PE)-coated liposomes exhibit prolonged circulation time in blood and substantial localization in Klebsiella pneumoniae-infected lung tissue in rats . Therefore, to determine the therapeutic effect, gentamicin and ceftazidime were entrapped in these liposomes and administered to rats experimentally infected with pneumonia: Relatively high and sustained concentrations of liposome-associated antibiotic in blood were observed . Compared with antibiotics alone, one dose of liposome-entrapped gentamicin or ceftazidime increased the therapeutic effect of the drugs, survival of rats, and bacterial killing in lungs . One dose of liposome-entrapped ceftazidime was as effective as a continuous 2-day infusion of nonentrapped ceftazidime . Since antibiotic-containing liposomes are stable during circulation and liposome-entrapped ceftazidime and gentamicin have low bactericidal activity in vitro, the superior therapeutic effect of the liposome-encapsulated antibiotics results from localization and subsequent degradation of liposomes and the resulting release of entrapped antibiotic at the infection site.

J Med Assoc Thai, 1995 Apr, 78(4), 210 - 6
Liver abscess in polycystic liver disease; Assantachai P et al.; A case of an elderly female whose clinical manifestations were atypical in view of physiologic aging changes and multiple pathology commonly found in the geriatric group . The liver abscess had presented clinically and radiologically like a hepatic malignancy and pus was obtained during the process of liver biopsy . Even though anchovy-like pus suggested amebic in origin, the microscopic exam showed numerous polymorphonuclear leucocyte and the culture both from the blood and pus grew Klebsiella spp . as well as the study for E . histolytica antibody was also negative . Pyogenic liver abscess was the working diagnosis and indicated for surgical drainage . Adult polycystic liver disease was found intraoperatively and the liver pathology did reveal the presence of many amebae in the cavity of the right lobe of the liver . After the administration of ceftriaxone and metronidazole as well as the surgical drainage, the patient recovered uneventfully within sixteen days of admission.

Nippon Ronen Igakkai Zasshi, 1995 Apr, 32(4), 266 - 9
{Evaluation of respiratory tract disease accompanying malignant lymphoma in the elderly}; Niitsu N et al.; We studied the usefulness of bronchoscopy in the diagnosis of pulmonary complications in elderly patients with non-Hodgkin's lymphoma (NHL) . The subjects were 12 patients 65 or older with NHL . Two of these patients underwent transbronchial lung biopsies (TBLB), all of them underwent bronchiolavage (BAL) and 2 with tumors underwent transbronchial biopsies of the tumors . Diagnosis was obtained in 8 out of 12 patients (66.7%) . Two patients showed infiltration of lymphoma cells, 2 had cytomegalovirus (CMV) infection, 1 had pneumocystosis (P . carinii), 2 had fungal infections and 1 had a bacterial infection . TBLB was performed in 2 patients with platelet counts of over 5 x 10(4)/microliters . Lymphoma cell infiltration was diagnosed in one of these patients and a fungal infection in the other . BAL was performed on all patients . CMV was detected in 2 cases by the PCR method, P . carinii was detected in 1 case and aspergillus in 1 case . Klebsiella pneumonia was diagnosed in 1 patient . Since respiratory tract complications are often serious in NHL and the prognosis depends on early diagnosis and treatment, it is important to perform bronchoscopy on elderly patients and obtain a definitive diagnosis.

Eur J Pediatr, 1995 Apr, 154(4), 299 - 303
Effect of nutritional and HIV status on bacteraemia in Zimbabwean children who died at home; Wolf BH et al.; From July 1992 to May 1993 a study was performed of the relationship between bacteraemia, nutritional status and HIV status in 212 out of 334 consecutive infants and children aged 0-5 years, who had died at home in Bulawayo, Zimbabwe . The remaining 122 children were excluded because the time period between death and arrival at the hospital was over 3 h . A pathogen was isolated from 92 (43%) children and Klebsiella species were most commonly isolated . A positive HIV-1 serology was found in 122 (58%) children and 110 (52%) children were malnourished . Malnutrition was significantly associated with bacteraemia at death after adjustment for the confounding effect of age and HIV status (odds ratio 4.28; 95% CI 2.27-8.07; P < 0.001) . No association was found between either HIV serostatus or proven HIV infection and bacteraemia, which could not be attributed to nutritional status . Conclusion . Bacteraemia, in particular with Gram-negative bacteria, is an important cause of death in malnourished children in Zimbabwe regardless of their HIV-1 antibody status.

J Biol Chem, 1995 Mar 31, 270(13), 7142 - 8
Molecular cloning, sequencing, and expression of the genes encoding adenosylcobalamin-dependent diol dehydrase of Klebsiella oxytoca; Tobimatsu T et al.; The pdd genes encoding adenosylcobalamin-dependent diol dehydrase of Klebsiella oxytoca were cloned by using a synthetic oligodeoxyribonucleotide as a hybridization probe followed by measuring the enzyme activity of each clone . Five clones of Escherichia coli exhibited diol dehydrase activity . At least one of them was shown to express diol dehydrase genes under control of their own promoter . Sequence analysis of the DNA fragments found in common in the inserts of these five clones and the flanking regions revealed four open reading frames separated by 10-18 base pairs . The sequential three open reading frames from the second to the fourth (pddA, pddB, and pddC genes) encoded polypeptides of 554, 224, and 173 amino acid residues with predicted molecular weights of 60,348 (alpha), 24,113 (beta), and 19,173 (gamma), respectively . Overexpression of these three genes in E . coli produced more than 50-fold higher level of functional apodiol dehydrase than that in K . oxytoca . The recombinant enzyme was indistinguishable from the wild-type one of K . oxytoca by the criteria of polyacrylamide gel electrophoretic and immunochemical properties . It was thus concluded that these three gene products are the subunits of functional diol dehydrase . Comparisons of the deduced amino acid sequences of the three subunits with other proteins failed to reveal any apparent homology.

J Comput Assist Tomogr, 1995 Mar-Apr, 19(2), 176 - 81
Complications of Klebsiella pneumonia: CT evaluation; Moon WK et al.; OBJECTIVE: To evaluate the CT features of complicated Klebsiella pneumonia . MATERIALS AND METHODS: We retrospectively reviewed 15 CT examinations from 11 consecutive patients with complicated Klebsiella pneumonia with special attention to internal architecture of pneumonic consolidation and its changes on follow-up CT . On plain radiography, abscess or cavitation was suspected in all patients . The diagnosis was established by isolation of Klebsiella pneumoniae from blood in six patients, from sputum in two, and from both in three . Five patients underwent follow-up CT due to progression (one) or incomplete resolution (four) of the disease despite antimicrobial therapy . RESULTS: In all patients pneumonic consolidation was composed of two intermingled components: enhancing homogeneous areas and poorly marginated low-density areas with multiple small air cavities, suggesting necrotizing pneumonia . In nine patients scattered enhancing structures probably due to atelectatic lung and pulmonary vessels were noted within necrotic areas of consolidated lung . In eight patients pleural complications such as effusion (all) or diffuse pleural enhancement (five) were seen . In two patients with multilobar disease and delayed treatment, multiple small abscess cavities coalesced to form a large cavity with sloughing of lung tissue, suggesting pulmonary gangrene and lung abscess formation on 18 and 45 day follow-up CT, respectively . In three other patients necrotizing pneumonia resolved slowly from the periphery to the center with residual fibrosis on follow-up CT at 2-3 months . CONCLUSION: The most common CT manifestation of complicated Klebsiella pneumonia was necrotizing pneumonia associated with pleural abnormalities . In extensive cases, pulmonary gangrene or lung abscess was a rare complication.

J Bacteriol, 1995 Mar, 177(5), 1186 - 95
Transcriptional activation of the nitrogenase promoter in vitro: adenosine nucleotides are required for inhibition of NIFA activity by NIFL; Eydmann T et al.; The enhancer-binding protein NIFA is required for transcriptional activation of nif promoters by the alternative holoenzyme form of RNA polymerase, which contains the sigma factor sigma 54 (sigma N) . NIFA hydrolyzes nucleoside triphosphates to catalyze the isomerization of closed promoter complexes to transcriptionally competent open complexes . The activity of NIFA is antagonized by the regulatory protein NIFL in response to oxygen and fixed nitrogen in vivo . We have investigated the requirement for nucleotides in the formation and stability of open promoter complexes by NIFA and inhibition of its activity by NIFL at the Klebsiella pneumoniae nifH promoter . Open complexes formed by sigma 54-containing RNA polymerase are considerably more stable to heparin challenge in the presence of GTP than in the presence of ATP . This differential stability is most probably a consequence of GTP being the initiating nucleotide at this promoter . Adenosine nucleosides are specifically required for Azotobacter vinelandii NIFL to inhibit open complex formation by native NIFA, and the nucleoside triphosphatase activity of NIFA is strongly inhibited by NIFL under these conditions . We propose a model in which NIFL modulates the activity of NIFA via an adenosine nucleotide switch.

Infect Immun, 1995 Mar, 63(3), 847 - 52
Relationships among capsular structure, phagocytosis, and mouse virulence in Klebsiella pneumoniae; Kabha K et al.; Klebsiella pneumoniae strains of the K2 capsular serotype are usually highly virulent in mice, which is in contrast to the low virulence of most other serotypes . Here we used a genetic approach to examine the relative contribution of capsule type to the virulence of K . pneumoniae in mice . We used wild-type strains expressing capsular polysaccharide (CPS) serotypes K2 (strain KPA1) and K21a (strains KPB1 and KPC1), which were then used to construct capsule-switched derivatives . The close proximity of the cps gene cluster to selectable his markers made it possible to mobilize the cps genes by conjugation from one serotype (donor) to another (recipient) and to obtain recombinants in which interserotype switching had occurred by reciprocal recombination . Each capsule-switched derivative examined of the KPA and KPC strain backgrounds produced a CPS that was immunologically and structurally identical to that of the donor . Strain background was confirmed by demonstrating restriction fragment length polymorphism patterns identical to those of the respective recipients . The parent strains were then compared with capsule-switched recombinants for phenotypic properties associated with virulence . Clearance from the bloodstreams of mice was rapid in serotype K21a strains of either wild-type or recombinant origin, whereas K2 strains remained viable in the blood during the period examined . These differences appeared to be dependent upon the CPS type but independent of strain background . Binding to macrophages was higher in K21a strains than in those with the K2 capsule and was also independent of the strain background . Both blood clearance and macrophage-binding activities were completely inhibited by yeast mannan, suggesting that they were mediated via the macrophage mannose receptor . The K2 parent strain was highly virulent to mice (50% lethal dose {LD50}, 3 x 10(3)), while the K21a parent strains demonstrated low virulence (LD50, > 2 x 10(8)) . Interestingly, the virulence of recombinant KPC10(cpsK2), originally of the KPC1(cpsK21a) background, was intermediate (LD50, 4 x 10(5)) . In contrast, both cpsK21a recombinants of the originally virulent KPA1 (cpsK2) background became nearly avirulent (LD50, > 2 x 10(8)) . Six additional serotypes (K12, K24, K32, K55, K62, and K67) were examined, and all showed a positive correlation between the ability of the Klebsiella serotype to interact with a human mannose receptor, as expressed by Cos I cell recombinants, and the LD50 of the serotype . These results suggest that expression of a capsule which is recognized by the mannose receptor markedly affects the interaction with macrophages and blood clearance.(ABSTRACT TRUNCATED AT 400 WORDS)

Scand J Gastroenterol, 1995 Mar, 30(3), 272 - 5
Septic acute cholecystitis; Kuo CH et al.; BACKGROUND: Bacteremia occurs frequently in cholangitis, but the incidence of bacteremia in acute cholecystitis has not previously been examined . METHODS: Seventy-eight cases (46 men and 32 women; mean age, 63 +/- 10 years) of acute cholecystitis with positive blood cultures were analyzed for clinical manifestation, bacteriology, and what consequences ensued . Seventy-eight non-bacteremic cholecystitis patients, matched for age and sex, served as the control group . RESULTS: The prevalence of bacteremia in acute cholecystitis was 7.65% (78 of 1020) . A single microorganism was isolated from the blood and bile in 87.2% and 27.3%, respectively . The commonest organisms were Escherichia coli and Klebsiella pneumoniae . The source of bacteremia could be identified from the infected bile in 80% of cases . Compared with the non-bacteremia group, significant increases in liver biochemical test results (aspartate and alanine aminotransferases and bilirubin, and so forth), more complications (acute renal failure and septic shock), and higher mortality (9.0%) were found in the bacteremic group . CONCLUSION: Acute cholecystitis is not often complicated by bacteremia, but when bacteremia is present, morbidity and death more consistently ensue.

Anal Biochem, 1995 Mar 1, 225(2), 321 - 7
A nondegradative route for the removal of endotoxin from exopolysaccharides; Adam O et al.; The potentiality of the Triton X-114 phase separation technique for the removal of lipopolysaccharide (LPS, endotoxin) from Klebsiella sp . I-714 exopolysaccharide (EPS) has been investigated . Classical purification and chemical detoxification methods were evaluated for their effectiveness in removing residual LPS, while preserving structural and functional integrity of EPS . Ultracentrifugation, Detoxi-Gel, and ion-exchange chromatography did not remove endotoxin, except gel filtration chromatography performed at 60 degrees C in sodium deoxycholate buffer . In this case, the bioactivity of the purified EPS fraction was significantly lowered, as was seen after alkaline hydrolysis treatment . Moreover, the acetic acid detoxification procedure hydrolyzed EPS . As an alternative, phase partitioning of EPS in Triton X-114 at low temperature provided a fast, mild, and efficient method for the removal of LPS as shown by a 100-fold reduction in Limulus amebocyte lysate (LAL) activity and only a 2-fold reduction in bioactivity . Gel filtration chromatography performed at 4 degrees C with Triton X-114 buffer and phase partitioning with the more hydrophilic Triton X-100 nonionic detergent at 75 degrees C led to a similar decrease in LAL activity . This novel application of Triton X-114 partitioning is a nondegradative alternative to the chemical detoxification of gram-negative bacterial EPS for vaccine production . Purification of endotoxin-contaminated polysaccharides prior to screening for biological activity should also benefit from this technique . The extraction scheme using Triton X-114 can be easily used in large-scale purification processes.

J Clin Microbiol, 1995 Mar, 33(3), 713 - 7
Random amplified polymorphic DNA and plasmid analyses used in investigation of an outbreak of multiresistant Klebsiella pneumoniae; Eisen D et al.; Multiresistant Klebsiella pneumoniae strains with plasmid-borne extended-spectrum beta-lactamases (ESBL) are increasingly frequent nosocomial pathogens . A major outbreak of clinical infections, mainly involving patients in the Newborn Services Unit with limited spread to adult patients, occurred at our hospital . This epidemic was investigated by typing the isolates phenotypically and with random amplified polymorphic DNA analysis (RAPD) and plasmid analysis . Forty-eight isolates, consisting of 44 consecutive clinical isolates and 4 selected surveillance isolates, were studied . A single decamer primer was used for the RAPD, and this was effective in demonstrating that the majority of isolates (45 of 48) had the same profile . Three other isolates had different RAPD patterns identifying them as nonepidemic strains . Plasmids were extracted by alkaline lysis with Magic-miniprep kits from 10 isolates selected to represent the epidemic and nonepidemic strains . This method produced small (< 20-kb) plasmids; larger ESBL-carrying plasmids were not produced, but the small plasmids nonetheless allowed strain differentiation . Antibiotic susceptibility patterns alone were not reliable as strain indicators, since some isolates with the RAPD pattern characteristic of the epidemic strains did not express ESBL and therefore were susceptible to extended-spectrum cephalosporins . The investigation showed the predominance of a single epidemic strain that was transmitted between patients in the Newborn Services Unit . RAPD was the best of the methods used for detecting strain differences, and its speed and ability to type a wide variety of species suggest that it will be an increasingly useful molecular epidemiologic tool.

FEMS Microbiol Lett, 1995 Mar 1, 126(3), 283 - 90
Purification and characterization of the 3-hydroxybenzoate-6-hydroxylase from Klebsiella pneumoniae; Suarez M et al.; We isolated 3-hydroxybenzoate-6-hydroxylase (E.C.1.14.13.), an inducible enzyme that catalyzed the para-hydroxylation of 3-hydroxybenzoate (3-HBA) to 2,5-dihydroxybenzoate, from Klebsiella pneumoniae . Although the enzyme was found to be mainly induced by its substrate, a coordinated induction of 3-hydroxybenzoate hydroxylase and gentisate dioxygenase was also observed in the presence of the product of the reaction . The purified enzyme was a monomer with a molecular mass of 42,000 . It contained FAD as a prosthetic group, utilized NADH or NADPH with similar efficiencies and its activity was inhibited by Cu2+, Fe2+ and Hg2+ . Other properties, such as induction mechanism and kinetic parameters were also studied . Moreover, for the first time the amino acid composition of a 3-hydroxybenzoate-6-hydroxylase was determined.

West J Med, 1995 Mar, 162(3), 220 - 4
Review of hepatic abscess from Klebsiella pneumoniae . An association with diabetes mellitus and septic endophthalmitis; Han SH; I present the only comprehensive review of hepatic abscess from Klebsiella pneumoniae . The world literature contains 46 individually reported cases and 3 large studies of K pneumoniae liver abscess . The source of the abscesses frequently was not found . Diabetes mellitus was a frequent underlying condition and may predispose patients to the development of liver abscess with this organism . The exact mechanism is unclear, and further investigation is necessary . In addition, extrahepatic metastases, such as septic endophthalmitis, often occurred with serious complications, particularly in patients with diabetes . The association between K pneumoniae liver abscess and diabetes is so close that a search for underlying diabetes mellitus is warranted in all patients with K pneumoniae liver abscess . Fortunately, earlier diagnoses and better treatment modalities have improved the outcome for these patients.

Zhonghua Nei Ke Za Zhi, 1995 Mar, 34(3), 193 - 5
{Serum anti-subtypical Klebsiella pneumoniae antibodies in ankylosing spondylitis}; Yuan G et al.; This study was performed in order to probe the possible pathogenesis of Klebsiella pneumoniae (KP) in ankylosing spondylitis (AS) . 34 anti-KP antibody positive serum samples, including 26 patients with AS, 5 patients with rheumatoid arthritis (RA) and 2 healthy individuals, were selected to detect anti-subtypical KP antibodies by using an immunoblotting technique . The results showed that the number of antigenic bands to KP on nitrocellulose membrane was higher in AS patients than in RA patients and healthy individuals . Patients with AS had common antibodies response to KP components weight 64,600 (80.7%), 48,200 (61.5%) and 36,000 (65.4%), patients with RA and healthy individuals had anti-36,000 (75%) and anti-30,000 (50%) antibodies . Human anti-HLA-B27 serum and rabbit antisera against KP-derived synthetic peptide containing the hexapeptide sequence shared by HLA-B27 were able to cross react with 64,600 and 48,200 KP components . Our findings suggest that KP might play a role in the pathogenesis of AS by molecular mimicry between it and HLA-B27.

Klin Lab Diagn, 1995 Mar-Apr, (2), 45 - 6
{A synthetic nutrient medium for isolating Klebsiella pneumoniae}; Pogorelova NP; Synthetic nitrate saccharose (NS) nutrient media are offered to be used for Klebsiella pneumoniae . NS medium of the following composition is suggested for studies of substrates moderately contaminated with microorganisms: 20 g agar-agar, 1 g potassium nitrate, 2 g disubstituted potassium phosphate, monopotassium phosphate, 20 g saccharose, and 1 1 distilled water . NSK medium is offered for the isolation of Klebsiella from material abundantly contaminated with various bacteria; this medium includes, in addition to the said recipe, 10 ng/1 carbenicillin . Experiments and analysis of material from the patients demonstrated high sensitivity and inhibitory properties of NS media.

Science, 1995 Feb 24, 267(5201), 1156 - 8
Requirement of carbon dioxide for in vitro assembly of the urease nickel metallocenter; Park IS et al.; Assembly of protein metallocenters is not well understood . Urease offers a tractable system for examination of this process . Formation of the urease metallocenter in vivo is known to require four accessory proteins: UreD, postulated to be a urease-specific molecular chaperone; UreE, a nickel(II)-binding protein; and UreF and UreG, of unknown function . Activation of purified Klebsiella aerogenes urease apoprotein was accomplished in vitro by providing carbon dioxide (half-maximal activation at approximately 0.2 percent carbon dioxide) in addition to nickel ion . Activation coincided with carbon dioxide incorporation into urease in a pH-dependent reaction (pKa > or = 9, where Ka is the acid constant) . The concentration of carbon dioxide also affected the amount of activation of UreD-urease apoprotein complexes . These results suggest that carbon dioxide binding to urease apoprotein generates a ligand that facilitates productive nickel binding.

J Biol Chem, 1995 Feb 17, 270(7), 3147 - 53
The methionine salvage pathway in Klebsiella pneumoniae and rat liver . Identification and characterization of two novel dioxygenases; Wray JW et al.; The 5-methylthio-D-ribose moiety of 5'-(methylthio)-adenosine is converted to methionine in a wide variety of organisms . 1,2-Dihydroxy-3-keto-5-methylthiopentene anion (an aci-reductone) is an advanced intermediate in the methionine salvage pathway present in the Gram-negative bacterium Klebsiella pneumoniae and rat liver . This metabolite is oxidized spontaneously in air to formate and 2-keto-4-methylthiobutyric acid (the alpha-keto acid precursor of methionine) . Previously, we had purified an enzyme (E2) from Klebsiella which catalyzes the oxidative degradation of the aci-reductone to formate, CO, and methylthiopropionic acid . To further characterize the reactions of the aci-reductone we used its desthio analog, 1-2-dihydroxy-3-ketohexene anion (III), which was described previously . This molecule undergoes the analogous enzymatic and non-enzymatic reactions of the natural substrate, namely the formation of formate, CO, and butyrate from III . Experiments with 18O2 show that E2 is a dioxygenase which incorporates one molecule of 18O into formate and butyric acid . No cofactor has been identified . We were unable to find an enzyme which catalyzes the conversion of 1,2-dihydroxy-3-keto-5-methylthiopentane to a keto acid precursor of methionine . The keto acid is probably produced non-enzymically in Klebsiella . We have, however, identified and purified an enzyme (E3) from rat liver, which catalyzes the formation of formate and 2-oxopentanoic acid from III . This enzyme has a monomeric molecular mass of 28,000 daltons, and no chromophoric cofactor has been identified . Experiments with 18O2 show that E3 is a dioxygenase which incorporates an 18O molecule into formate and the alpha-keto acid . In rat liver CO formation was not detected.

J Infect Dis, 1995 Feb, 171(2), 385 - 92
Modulation of nonspecific antimicrobial resistance of mice to Klebsiella pneumoniae septicemia by liposome-encapsulated muramyl tripeptide phosphatidylethanolamine and interferon-gamma alone or combined; ten Hagen TL et al.; Activation of the host defense system in a nonspecific way might provide tools to support failing antibiotic treatment in certain infectious diseases . The antimicrobial effect was investigated of liposome-encapsulated muramyl tripeptide phosphatidylethanolamine (MTPPE) and interferon (IFN)-gamma and liposome-coencapsulated MTPPE and IFN-gamma on Klebsiella pneumoniae septicemia in mice . Prophylactic treatment of mice with five doses of liposomal MTPPE or IFN-gamma increased survival from 0 to 65% . Administration of MTPPE and IFN-gamma coencapsulated in liposome resulted in 100% survival . In vitro, peritoneal macrophages by themselves were stimulated by these agents but were unable to kill K . pneumoniae . However, production of both oxygen and nitrogen intermediates increased when immunomodulators were added to macrophages . These results indicate that effective prophylactic treatment of septicemia due to K . pneumoniae with coencapsulated MTPPE and IFN-gamma is not solely due to activation of the resident macrophages.

Zhonghua Yi Xue Za Zhi, 1995 Feb, 75(2), 88 - 91, 126
{Bacterial resistance in clinical isolates of Klebsiella pneumoniae}; Wang YQ et al.; Ninety-four percent of 336 strains of Klebsiella pneumoniae were resistant to ampicillin, while less than 10% were resistant to cefotaxine and ceftazidine . Among all the aminoglycosides tested, amikacin had the strongest activity on K . pneumoniae . The resistant rate of nosocomial strains was higher than that of community strains . The results of susceptibility test showed that 42% (119/280) of K . pneumoniae strains were gentamicin-resistant . Based on the resistant pattern of K . pneumoniae, the aminoglycoside-modifying enzymes produced by the organisms were inferred . Among them 90% of 119 strains produced aminoglycosides-modifying enzymes AAC (3)-V, 8% (10/119) AAC (3)-V together with AAC (6')-Ib, AAC (6')-V or ANT (2") . The resistance of two strains was assumed to be permeability change . Besides, 58% (161/280) were sensitive strains without producing any aminoglycoside-modifying enzymes . Bacteria typing done by phage typing or Klebcin in 27 strains showed that most strains were from different origins with few exceptions . The results show the significance for controlling the nosocomial infections and reasonable use of antibiotics.

J Vet Med Sci, 1995 Feb, 57(1), 113 - 5
Plasmid profiles of Klebsiella pneumoniae isolated from horses; Kikuchi N et al.; Plasmid profiles of Klebsiella pneumoniae isolated from horses were examined . Thirty-nine strains of K . pneumoniae capsular type 1 (K1) isolated from cervical swabs of mares suffering from metritis, and from semen of stallions showed similar plasmid profile patterns, and all strains possessed a 125 megadaltons (Md) plasmid . There was no difference in plasmid profiles between the heavily-encapsulated and the less heavily-encapsulated strains of K . pneumoniae K1 . Non-capsulated variants derived from the strains of K1 showed the same plasmid profile pattern as the parent strains . Plasmid profiles of K . pneumoniae other than K1 were various, and none of these strains possessed the 125 Md plasmid.

Arch Microbiol, 1995 Feb, 163(2), 143 - 7
Energy-dispersive X-ray analysis of the extracellular cadmium sulfide crystallites of Klebsiella aerogenes; Holmes JD et al.; Klebsiella aerogenes forms electron-dense particles on the cell surface in response to the presence of cadmium ions in the growth medium . These particles ranged from 20 to 200 nm in size, and quantitative energy dispersive X-ray analysis established that they comprise cadmium and sulfur in a 1:1 ratio . This observation leads to the conclusion that the particles are cadmium sulfide crystallites . A combination of atomic absorption spectroscopy, inductively coupled plasma mass spectrometry, and acid-labile sulfide analysis revealed that the total intracellular and bound extracellular cadmium:sulfur ratio is also 1:1, which suggests tha the bulk of the cadmium is fixed as extracellular cadmium sulfide . The tolerance of K . aerogenes to cadmium ions and the formation of the cadmium sulfide crystallites were dependent on the buffer composition of the growth medium . The addition of cadmium ions to phosphate-buffered media resulted in cadmium phosphate precipitates that remove the potentially toxic cadmium ions from the growth medium . Electron-dense particles formed on the surfaces of bacteria grown under these conditions were a combination of cadmium sulfide and cadmium phosphates . The specific bacterial growth rate in the exponential phase of batch cultures was not affected by up to 2mM cadmium in Tricine-buffered medium, but formation of cadmium sulfide crystallites was maximal during the stationary phase of batch culture . Cadmium tolerance was much lower (10 to 150 microM) in growth media buffered with Tris, Bistris propane, Bes, Tes, or Hepes . These results illustrate the importance of considering medium composition when comparing levels of bacterial cadmium tolerance.

J Chemother, 1995 Feb, 7(1), 16 - 20
Transferable resistance to cefotaxime in nosocomial Klebsiella pneumoniae and Escherichia coli strains due to their production of extended-spectrum beta-lactamase in Slovakia; Hupkova M et al.; Transferable resistance to cefotaxime was demonstrated in 21 nosocomial strains of Klebsiella pneumoniae and Escherichia coli subsequently isolated from patients in two large University clinics . Using the double-disk diffusion test, we could detect, in each such strain, as well as in E . coli 3110 K-12 transconjugants after the transfer, the production of an Extended Spectrum Beta-Lactamase (ESBL) . Ceftibuten was demonstrated to be effective against the majority of strains studied.

Vaccine, 1995 Feb, 13(2), 179 - 84
Polysaccharide-iron-regulated cell surface protein conjugate vaccine: its role in protection against Klebsiella pneumoniae-induced lobar pneumonia; Chhibber S et al.; Klebsiella pneumoniae has become an important cause of both community-acquired and nosocomial infections . In this study an attempt was made to study the immunogenicity of iron-regulated cell surface proteins (IRCSP) alone or in conjunction with the polysaccharide moiety of lipopolysaccharide (LPS) of K . pneumoniae . The polysaccharide-iron-regulated cell surface protein conjugate (PS-IRCSP) was non-toxic and non-pyrogenic . It was found to be immunogenic and the protection afforded by the conjugate against the challenge strain was observed in a rat lobar pneumonia model . The protection observed with the conjugate was higher than that observed with polysaccharide or IRCSP alone . The conjugate elicited both agglutinating and bactericidal antibodies . Enhanced phagocytosis was observed for the alveolar macrophages obtained from the lungs of animals treated with conjugate compared with macrophages obtained from animals treated with other antigenic preparations.

Antibiot Khimioter, 1995 Feb, 40(2), 22 - 6
{Drug resistance of hospital strains of Klebsiella pneumoniae and their role in the rise of intrahospital infections}; Mucina LT et al.; Microbiological monitoring of intrahospital infections in obstetric and surgical institutions revealed the role of Klebsiella pneumoniae in the etiology of purulent septic diseases in various groups of the patients . The level and spectra of resistance in the pathogens were fixed with respect to 17 drugs . It was shown that the clinical polyresistant strains of K . pneumoniae including those resistant to at least 5 antibiotics were more frequent in the patients of the surgical departments than in the newborns and puerpera . The isolates of K . pneumoniae responsible for the intrahospital complications in the surgical patients as compared to those in the newborns and puerpera were mainly resistant to ampicillin, carbenicillin, cephalothin, gentamicin and tobramycin.

Int J Tissue React, 1995, 17(5-6), 199 - 203
Effect of ticarcillin and ticarcillin/clavulanic acid on the in-vitro activity of human granulocytes against beta-lactamase-producing Klebsiella pneumoniae; Cuffini AM et al.; Clavulanic acid is an effective inhibitor of a broad range of clinically important beta-lactamases and its combination with some beta-lactam antibiotics such as ticarcillin has been shown to extend the inhibition spectrum of the beta-lactams . The activity of ticarcillin, both alone and in combination with clavulanic acid, upon PMN phagocytosis and bactericidal activity towards Klebsiella pneumoniae was investigated . The results indicate that a combination of ticarcillin with clavulanic acid is more active than ticarcillin alone against a beta-lactamase-producing strain of K . pneumoniae, and hence may significantly increase the bacterial vulnerability to phagocyte functions.

Zhonghua Er Bi Yan Hou Ke Za Zhi, 1995, 30(3), 154 - 6
{Laboratory diagnosis of autoimmune sensorineural hearing loss with modified western blotting method}; Zou J et al.; Anti-membranous labyrinth proteins antibody were tested in suspectable autoimmune sensorineural hearing loss (ASNHL) with a modified western blotting method . 5 strongly positive bands (including 68,000) existed in at most 18 of 25 cases (72%) . This method was found to be more sensitive than the routine one (40%) . Anti-membranous proteins of Klebsiella pneumoniae antibodies were also found in 7 of 9 tested patients.

Annu Rev Microbiol, 1995, 49, 239 - 76
Nonopsonic phagocytosis of microorganisms; Ofek I et al.; Nonopsonic phagocytosis mediated by phagocyte receptors that recognize corresponding adhesins on microbial surfaces has attracted increasing interest as a potential host defense mechanism against extracellular pathogens and as a means of survival in the host for intracellular pathogens . Three types of nonopsonic phagocytosis involving carbohydrate-protein interactions (also termed lectinophagocytosis), protein-protein interactions, and hydrophobic interactions are discussed . A prominent receptor on phagocytic cells involved in recognizing pathogens belongs to the CD11/CD18 integrins . It mediates both opsonophagocytosis and nonopsonic phagocytosis and exhibits multiple specificity for different microbial adhesins . In other cases, similar specificity toward a microbial ligand (e.g . the Klebsiella pneumoniae capsule) is shared by dual molecules, one of which (e.g . the mannose-binding protein in serum) mediates opsonophagocytosis and the other (e.g . the macrophage mannose receptor) mediates nonopsonic phagocytosis of the microorganisms . In addition, we discuss how nonopsonic phagocytosis can trigger the phagocytes to release inflammatory agents and cause tissue injury . Further studies of the molecular mechanisms of nonopsonic phagocytosis, in particular those underlying the up-regulation of the phagocytic receptors by various agents, should lead to the development of new approaches for the prevention of infectious diseases.

Am J Nephrol, 1995, 15(1), 1 - 4
An outbreak of gram-negative bloodstream infections in chronic hemodialysis patients; Welbel SF et al.; Six chronic hemodialysis patients acquired bloodstream infections (BSIs) with Klebsiella pneumoniae of the same serotype and similar plasmid profile during an 11-day period . The 6 case-patients were more likely than noncase-patients to have received dialysis during the fourth shift (p < 0.05) and to have their dialyzers reprocessed for reuse after those of the noncase-patients (p = 0.05) . Investigation identified a patient during the same shift with an arteriovenous fistula infected with K . pneumoniae . The dialyzer reprocessing technician did not change gloves between contacting patients and their dialyzers in the treatment area and reprocessing the case-patients' dialyzers at the end of the fourth shift . We conclude that the outbreak of BSIs was caused by cross-contamination of the case-patients' dialyzers with bacteria from the gloves of the reprocessing technician and by inadequate dialyzer disinfection . After revised dialyzer reprocessing techniques and glove-changing policies were instituted, no further clusters of BSIs occurred.

Chest, 1995 Jan, 107(1), 214 - 7
Rapidly fatal outcome of bacteremic Klebsiella pneumoniae pneumonia in alcoholics; Jong GM et al.; Twenty-eight alcoholic patients with community-acquired pneumonia who were admitted to a referral medical center during a 3-year period were reviewed . All were men and with few exceptions were heavy smokers . The overall mortality was 64.3% . The most dramatic group was that of 11 patients (39.3%) with bacteremic Klebsiella pneumoniae pneumonia (BKPP), which had high mortality rate (100%), short onset of illness before hospital admission (42.6 +/- 8.2 h, mean +/- SD), and short survival time after the admission (24.6 +/- 7.9 h) . All these 11 patients needed intensive care unit (ICU) management and ventilatory support . ARterial blood gas values showed marked hypoxemia and metabolic acidosis in most of these 11 patients, and presence of shock at arrival in the hospital was noted in 8 patients . Acute renal failure and disseminated intravascular coagulation developed in six patients . Chest radiographs showed pleural effusion and radiographic spread in nearly 50% of patients . Combination chemotherapy consisting of one aminoglycoside and one second- or third-generation cephalosporin was initiated in all patients . The rapidly fatal outcome of these 11 patients with BKPP despite management with adequate antibiotics and intensive care indicated the fulminant nature of this disease . High virulence of the microorganism, altered immune response, and increased susceptibility to infection may all have contributed to the fulminancy in this group of patients . The disease continues to present many difficulties in management.

Rev Latinoam Microbiol, 1995 Jan-Mar, 37(1), 11 - 7
{Classification of Klebsiella strains with lectins}; Rodriguez-Sanchez L et al.; Fourteen different plant seeds were used to obtain lectins which in turn were used to agglutinate 72 different serological strains of Klebsiella . The results were used to design a scheme which distinguishes 62 serotypes (91.6%) with a unique agglutination pattern with lectins . Two pairs of strains as well as two sets of three strains gave the same patterns . This procedure is useful as an alternative in the identification of strains for epidemiological purposes.

Appl Microbiol Biotechnol, 1995 Jan, 42(5), 763 - 8
Utilization of chlorinated s-triazines by a new strain of Klebsiella pneumoniae; Ernst C et al.; A bacterium utilizing 2-chloro-4,6-diamino-s-triazine (CAAT) as sole nitrogen source was isolated under a N2-free atmosphere and identified as Klebsiella pneumoniae . Concomitant to CAAT degradation the protein content increased and chloride was released into the medium . Under air and a N2-atmosphere no reduction of CAAT degradation resulted, though this strain is able to fix molecular nitrogen, but the decomposition accelerated under anaerobic conditions . The degradation rate increased continuously with increasing CAAT concentration . A continuous CAAT degradation without CAAT accumulation was possible up to a influx rate of 4.8 mumol.l-1h-1 (dilution rate = 0.007 h-1) . K . pneumoniae A2 was also able to utilize deethylsimazine (CEAT) and deethylatrazine (CIAT) as nitrogen source . Both under aerobic and anaerobic conditions CEAT could be degraded faster than CIAT . The degradation sequence of mixed s-triazines was cyanuric acid < CAAT < CEAT < CIAT, which was reflected by the degradation times of single compounds . Complete degradation was assumed for all investigated s-triazine derivatives.

Cah Anesthesiol, 1995, 43(2), 191 - 4
{Infection after long lasting procedure in neurosurgery}; Frebet E et al.; A retrospective study was performed to appreciate the frequency of infectious complications following long duration neurosurgical procedure with or without antibiotic prophylaxis . Among the 6,702 surgical procedures studied 87 lasted more than 6 hours . The frequency of wound infections of those 87 patients was 13.8% whereas it was only 1.43% for the whole group . There was no significant statistical difference between patients who were treated with antibiotics and those who were not . The high frequency of infection by Klebsiella (25% of the identified germs) was caused by a contamination of the intensive care unit . Duration of the surgical procedure, synthetic material and repetitive procedures are important points to analyse when comparing the different publications . If any antibiotic prophylaxis is to be used, it must be adapted to the microbial environment of each care unit.

Fundam Clin Pharmacol, 1995, 9(2), 202 - 4
Endotoxins modify muscle fatigue characteristics; Goubel F et al.; To test the hypothesis that endotoxins can directly modify muscle fatigue characteristics, in vitro experiments were performed on rat muscles 48 hours after injection of lipopolysaccharides (LPS) from Klebsiella pneumoniae . Resistance to fatigue was quantified by measuring tension production during repetitive electrical stimulation of the isolated epitrochlearis muscle . LPS treatment did not significantly modify initial force production whereas fatigability of the muscle was increased . This in vitro preparation should be used for testing antifatigue drugs.

Zhonghua Yi Xue Za Zhi, 1995 Jan, 75(1), 15 - 8, 60-1
{Drug resistant mechanism of clinical isolates of Klebsiella pneumoniae}; Wang F et al.; Plasmid conjugation experiments of 34 gentamicin-resistant strains of K . Pneumoniae were done . The resistant genes of 31 strains (91%) were transferred partially or completely with a frequency of 10(-4)-10(-6) . The results of plasmid analysis in 63 strains of K . Pneumoniae showed that 85kb and 58kb plasmids carrying resistant genes were responsible for bacterial resistance . 13kb plasmids or the smaller ones were not related to bacterial resistance . In spite of the aminoglycoside modifying enzyme, The profiles were different, but the plasmid patterns were almost the same.

Zhonghua Er Bi Yan Hou Ke Za Zhi, 1995, 30(1), 13 - 6
{Analysis of antigenity of membranous labyrinth proteins of guinea pigs}; Zou J et al.; An electrophoretic dot immunobinding assay and a modified western blotting method were established . The components and antigenity of the membranous labyrinth proteins of guinea pigs were analysed . There are the same epitopes between some components of the antigen, between the antigen and extractives of acoustic nerve, cochlear nuclei, kidney and Klebsiella pneumoniae . The antigen distributes in stria vascularis, spiral ligament, spiral ganglion, the organ of Corti and Reissner's membrane etc.

Gac Med Mex, 1995 Jan-Feb, 131(1), 14 - 22
{Phosphatidylcholine induces an increase in the production of interleukin-6 and improves survival of rats with neonatal sepsis caused by Klebsiella pneumoniae}; Mancilla-Ramirez J et al.; Infections by gram-negative bacteria are one of the major causes of death in newborns . Bacterial clearance is deficient in septic neonates, which seems to increase their susceptibility to infections . In this study, we observed a significant improvement in clearance of Klebsiella pneumoniae in newborn wistar rats inoculated by intraperitoneal via with 800 mg k soybean phosphatidylcholine (PC), compared to the control group injected with PBS (p 0.05) . The overall survival rate was improved (p 0.05) and the white blood cell counts showed a greater leukocytosis and neutrophilia during the peak of bacteremia in the PC treated animals . Circulating levels of interleukin-6 were greater in the PC group, which developed an intense splenic hematopoiesis of the granulocyte (p 0.05) and megakariocyte series (p 0.01) . No significant changes were observed in bone marrow granulocyte deposits in both study groups . The improvement in survival rate, the changes in leukocyte counts and the splenic hematopoiesis may be associated with the increased production of IL-6 . These results suggest that IL-6 plays a role in the protection mechanism induced by PC in this experimental model of newborn septicemia . PC seems to be an immunomodulator of the acute response to gram-negative bacterial infection.

Epidemiol Infect, 1994 Dec, 113(3), 445 - 54
Randomly amplified polymorphic DNA typing: a useful tool for rapid epidemiological typing of Klebsiella pneumoniae; Wong NA et al.; Discriminatory typing methods are invaluable in the investigation of outbreaks of infectious diseases . Single primers were used to generate randomly amplified polymorphic DNA (RAPD) profiles from Klebsiella pneumoniae isolates of various serotype and K . pneumoniae isolates from cases of sepsis at a Malaysian hospital and two English hospitals . RAPD profiles of acceptable reproducibility, a maximum of three minor band variations, were produced using a rapid DNA extraction method . RAPD typing of K . pneumoniae was shown to be as discriminatory as restriction fragment length polymorphism analysis using pulsed field gel electrophoresis yet quicker and less costly . The findings suggest that RAPD typing may be a useful tool for the epidemiological typing of K . pneumoniae.

J Med Microbiol, 1994 Dec, 41(6), 423 - 9
The use of bacteriophages to differentiate serologically cross-reactive isolates of Klebsiella pneumoniae; Pieroni P et al.; In serological typing of Klebsiella pneumoniae strains from human, equine and environmental sources, the capsular identity of many isolates could not be determined because of serological cross-reactivity . A panel of 91 bacteriophages able to lyse each of the 77 capsular serotypes of K . pneumoniae was isolated and tested for the ability to distinguish between strains in a collection of 17 clinical isolates of K . pneumoniae which exhibited cross-reactivity with two or more capsular type sera . Most isolates could be assigned a capsular type by performing a simple streak test with bacteriophage, although some required the application of an efficiency of plating analysis to discern capsular type . Bacteriophage typing was found to be an effective, inexpensive and clinically practical adjunct to serotyping in distinguishing serologically cross-reactive K . pneumoniae isolates, irrespective of their origin.

J Biochem (Tokyo), 1994 Dec, 116(6), 1264 - 8
Comparison of the binding of beta-cyclodextrin and alpha- and gamma-cyclodextrins with pullulanase from Klebsiella pneumoniae as studied by equilibrium and kinetic fluorometry; Iwamoto H et al.; The change in fluorescence spectra of crystalline pullulanase from Klebsiella pneumoniae caused by the addition of alpha-, beta-, and gamma-cyclodextrins and 6-O-alpha-glucosyl-alpha-cyclodextrin and 6-O-alpha-glucosyl-beta-cyclodextrin was investigated at 25 degrees C and pH 5.6 . The fluorescence intensity at around 325 nm (excitation at 280 nm) was increased by the addition of all the cyclodextrins studied . The dissociation constant, Kd, of the enzyme-cyclodextrin complex was evaluated by fluorometric titration for each cyclodextrin, and was consistent with the inhibitor constant, Ki, obtained previously {Iwamoto et al . (1993) J . Biochem . 113, 93-96} . The Kd values of beta-cyclodextrin and 6-O-alpha-glucosyl-beta-cyclodextrin were approximately two orders of magnitude smaller than those of alpha- and gamma-cyclodextrins . Fluorescence titration of a cyclodextrin in the presence of another cyclodextrin revealed competition among alpha-, beta-, and gamma-cyclodextrins for binding with the enzyme, which indicates that the binding region of beta-cyclodextrin overlaps those of alpha- and gamma-cyclodextrins . On the other hand, with excitation at 295 nm, a fluorescence spectral change similar to that excited at 280 nm was observed for alpha- and gamma-cyclodextrins and 6-O-alpha-glucosyl-alpha-cyclodextrin, whereas beta-cyclodextrin and 6-O-alpha-glucosyl-beta-cyclodextrin did not show any such change . These results suggest that the binding site or the binding mode of beta-cyclodextrin is slightly different from those of alpha- and gamma-cyclodextrins.(ABSTRACT TRUNCATED AT 250 WORDS)

J Biochem (Tokyo), 1994 Dec, 116(6), 1233 - 40
Random mutagenesis of pullulanase from Klebsiella aerogenes for studies of the structure and function of the enzyme; Yamashita M et al.; To study the structure and function of pullulanase from Klebsiella aerogenes, a method involving random mutagenesis of the entire gene for pullulanase was used . Out of 50,000 clones screened at high temperature, seven genes for mutant proteins were identified by DNA sequencing . The amino acid substitutions in the seven mutant proteins were clustered on the NH2-terminal side of the four conserved regions found in alpha-amylases . These mutant pullulanases were classified into two types: those whose catalytic activity was altered and those whose thermal stability was increased . The results presented here and in previous reports suggest that pullulanase from K . aerogenes has similar active sites to those of alpha-amylases with the four conserved regions, as well as another substrate-binding site closer to the NH2-terminus . The plate assay method used for isolation of thermostable variants may be applicable to the generation of useful variants of other enzymes.

Nucl Med Biol, 1994 Nov, 21(8), 1093 - 100
Evaluation of possible interference of anti-inflammatory drugs upon scintigraphic imaging with macrophage targeting 99mTc-J001X: effects of methylprednisolone, dexamethasone, indomethacin and methotrexate; Perin F et al.; J001X, an acylated poly-(1,3)-galactoside isolated from Klebsiella pneumoniae proteoglycan, has been developed to target cells from the monocyte-macrophage lineage . Recent experimental work and initial clinical trials have proved the potential of this molecule labeled with 99mTc for the scintigraphy of inflammatory foci . In a model of radiation-induced inflammation in pigs, the scintigraphic contrast was observed to be very sensitive to a single injection of methylprednisolone given 12 h before scintigraphy . The present study was undertaken to confirm this effect and to estimate the possible interference of various anti-inflammatory agents on the in vivo targeting of macrophages by J001X . Methylprednisolone, dexamethasone, indomethacin and methotrexate used at an immunosuppressive dose were tested to assess the possible risk of false-negative examinations in patients thus treated . Analysis of the results indicated that among the four drugs tested, only methylprednisolone at 0.5-1 mg/kg could interfere with J001X scintigraphy.

Br J Rheumatol, 1994 Nov, 33(11), 1025 - 9
IgM, IgA and IgG class serum antibodies against Klebsiella pneumoniae and Escherichia coli lipopolysaccharides in patients with ankylosing spondylitis; Maki-Ikola O et al.; Igm, IgA and IgG class serum antibodies against Klebsiella pneumoniae and Escherichia coli lipopolysaccharides (LPS) were studied by ELISA in two separate AS patient populations of 99 and 81 subjects and in 102 healthy blood donors . In the first patient population increased levels of IgM and IgG class antibodies against K . pneumoniae LPS were observed in patients with active AS . In the population with active AS, increased levels of IgM, IgA and IgG class antibodies against K . pneumoniae LPS and IgA class antibodies against E . coli LPS were observed . Sulphasalazine treatment decreased IgM and IgA class antibody levels significantly against K . pneumoniae LPS and IgM class antibodies against E . coli LPS . These findings suggest that a significant part of the anti-Klebsiella antibodies found in AS patients is directed against the LPS component of Klebsiella.

Antimicrob Agents Chemother, 1994 Nov, 38(11), 2663 - 4
In vivo efficacies of beta-lactam-beta-lactamase inhibitor combinations against a TEM-26-producing strain of Klebsiella pneumoniae; Rice LB et al.; We examined the efficacies of the beta-lactam-beta-lactamase inhibitor combinations ampicillin-sulbactam and piperacillin-tazobactam in the treatment of intra-abdominal abscesses caused by a TEM-26-producing strain of Klebsiella pneumoniae . At lower doses, both combinations reduced abscess colony counts by more than 3 log10 CFU/g from that of untreated controls, but treatment with these drugs was inferior to treatment with imipenem . Increasing the doses of the combinations resulted in a further decrease in abscess CFU to a level where both were similar to imipenem in efficacy . These results suggest that the beta-lactam-beta-lactamase inhibitor combinations ampicillin-sulbactam and piperacillin-tazobactam may be viable alternatives for the treatment of serious infections caused by susceptible extended-spectrum beta-lactamase-producing strains of K . pneumoniae.

Thorax, 1994 Nov, 49(11), 1134 - 8
Concentration of amoxycillin and clavulanate in lung compartments in adults without pulmonary infection; Cook PJ et al.; BACKGROUND--The efficacy of an antibiotic is usually predicted from serum levels and MIC90 values for likely pathogens, but in the lung tissue concentrations may be more informative . This study compares concentrations of amoxycillin and clavulanate in serum, epithelial lining fluid (ELF), alveolar macrophages, and bronchial mucosa in 15 adults . METHODS--Amoxycillin 500 mg and clavulanic acid 250 mg were given 1-2 hours before diagnostic bronchoscopy for haemoptysis or radiological abnormality . Mucosal biopsy samples were taken from macroscopically normal sites, alveolar macrophages harvested by lavage, and ELF volume derived from urea concentrations in bronchial lavage fluid and blood . Amoxycillin was assayed by inhibition of growth of Micrococcus lutea, and clavulanate (in serum, ELF, and bronchial mucosa) by inhibition of growth of Klebsiella pneumoniae; in macrophages clavulanate was measured by high performance liquid chromatography . RESULTS--The median concentrations in serum were 6.90 mg/l for amoxycillin and 5.25 mg/l for clavulanate . The median bronchial mucosal concentration of amoxycillin was 2.99 mg/l and of clavulanate was 1.65 mg/l; the median concentrations in ELF were 0.89 and 0.96 mg/l, and in macrophages 0 and 0.76 mg/l, respectively . In macrophages amoxycillin levels were undetectable in 10 of 14 subjects (71%); by contrast, only 6 of 14 subjects (43%) had no detectable clavulanate . CONCLUSIONS--Clavulanate levels exceeded quoted MIC90 values (around 0.25 mg/l) for Legionella pneumophila both in ELF and in macrophages . Amoxycillin-clavulanate may therefore have a clinical role in infections with Legionella pneumophila.

Curr Microbiol, 1994 Nov, 29(5), 249 - 54
Identification of a new transposon Tn5403 in a Klebsiella pneumoniae strain isolated from a polluted aquatic environment; Rinkel M et al.; A Klebsiella pneumoniae strain having mobilization "helper" potential has been isolated from the river Rhine . Analysis of the transconjugants resulting from the mobilization of non-conjugative pBR-type plasmids and RSF1010 derivatives showed that the transfer-helper capacity of the K . pneumoniae strain is related to the presence of a Tn3-like transposable element, Tn5403 . This element has been identified and localized in a plasmid.

Mol Microbiol, 1994 Nov, 14(3), 505 - 19
Identification of an ATP-binding cassette transport system required for translocation of lipopolysaccharide O-antigen side-chains across the cytoplasmic membrane of Klebsiella pneumoniae serotype O1; Bronner D et al.; The rfbKpO1 gene cluster of Klebsiella pneumoniae O1 directs synthesis of the D-galactan I component of the lipopolysaccharide O-antigen . The first two genes in the rfbKpO1 cluster encode RfbAKpO1 and RfbBKpO1, with predicted sizes of 29.5 or 30.0 kDa and 27.4 kDa, respectively . RfbBKpO1 contains a consensus ATP-binding domain and shares homology with several proteins which function as ATP-binding components of cell surface polysaccharide transporters . RfbAKpO1 is predicted to be an integral membrane protein with five putative membrane-spanning domains and its transmembrane topology was confirmed by TnphoA mutagenesis . The hydropathy plot of RfbAKpO1 resembles KpsM, the transcytoplasmic membrane component of the capsular polysaccharide transporter from Escherichia coli K-1 and K-5 . These relationships suggest that RfbAKpO1 and RfbBKpO1 belong to a family of two-component ABC (ATP-binding cassette) transporters . E . coli K-12 containing a plasmid carrying an rfbKpO1 gene cluster deleted in rfbAKpO1 and rfbBKpO1 expresses rough lipopolysaccharide molecules on its surface and accumulates cytoplasmic O-antigen . When RfbAKpO1 and RfbBKpO1 are supplied in trans by a compatible plasmid, O-polysaccharide transport is restored and smooth D-galactan I-substituted lipopolysaccharide is produced . RfbAKpO1 and RfbBKpO1 are, therefore, proposed to constitute a system required for transport of D-galactan I across the cytoplasmic membrane, where RfbAKpO1 represents the membrane-spanning translocator and RfbBKpO1 couples the energy of ATP hydrolysis ot the transport process.

Biochim Biophys Acta, 1994 Oct 19, 1208(2), 348 - 51
Sequence of the sor-operon for L-sorbose utilization from Klebsiella pneumoniae KAY2026; Wehmeier UF et al.; We have sequenced the complete sor-operon of Klebsiella pneumoniae KAY2026 . The operon has been mapped at 91 min on the Klebsiella gene-map . It comprises seven open reading frames for the genes sorCDFBAME, which are expressed from the single promotor sorCP . The gene sorC codes for a regulator protein that positively and negatively regulates the expression of the operon; sorD encodes a D-glucitol-6-phosphate dehydrogenase, the genes sorFBAM encode four proteins of a phosphoenolpyruvate-dependent L-sorbose-phosphotransferase system and sorE, finally, an L-sorbose-1-phosphate-reductase.

J Biol Chem, 1994 Oct 14, 269(41), 25419 - 25
Geometry of the process of transcription activation at the sigma 54-dependent nifH promoter of Klebsiella pneumoniae; Molina-Lopez JA et al.; The Klebsiella pneumoniae nifH promoter is very strictly controlled by nitrogen availability and highly dependent on sigma 54 and integration host factor (IHF) for expression . This promoter region has been used to examine the role of IHF in the activation of transcription from sigma 54-dependent promoters and to analyze the positional restrictions which may exist for an activation mechanism from distant sites such as this one . By functionally replacing the binding site of IHF by sequence-directed curved DNA fragments, it has been shown that the role of IHF in stimulating transcription is structural; it brings the molecules directly involved in the process into close proximity . Unlike other promoter regions with an activation mechanism at a distance, this IHF-dependent promoter requires a precise geometry for efficient transcription . In this sense, it resembles an activation mechanism from near sites . However, alternative functional structures which are very different from the native one can be isolated.

J Bacteriol, 1994 Oct, 176(19), 6050 - 8
Two divergent MET10 genes, one from Saccharomyces cerevisiae and one from Saccharomyces carlsbergensis, encode the alpha subunit of sulfite reductase and specify potential binding sites for FAD and NADPH; Hansen J et al.; The yeast assimilatory sulfate reductase is a complex enzyme that is responsible for conversion of sulfite into sulfide . To obtain information on the nature of this enzyme, we isolated and sequenced the MET10 gene of Saccharomyces cerevisiae and a divergent MET10 allele from Saccharomyces carlsbergensis . The polypeptides deduced from the identically sized open reading frames (1,035 amino acids) of both MET10 genes have molecular masses of around 115 kDa and are 88% identical to each other . The transcript of S . cerevisiae MET10 has a size comparable to that of the open reading frame and is transcriptionally repressed by methionine in a way similar to that seen for other MET genes of S . cerevisiae . Distinct homology was found between the putative MET10-encoded polypeptide and flavin-interacting parts of the sulfite reductase flavoprotein subunit (encoded by cysJ) from Escherichia coli and several other flavoproteins . A significant N-terminal homology to pyruvate flavodoxin oxidoreductase (encoded by nifJ) from Klebsiella pneumoniae, together with a lack of obvious flavin mononucleotide-binding motifs in the MET10 deduced amino acid sequence, suggests that the yeast assimilatory sulfite reductase is a distinct type of sulfite reductase.

Infect Immun, 1994 Oct, 62(10), 4495 - 9
Polysaccharide capsule-mediated resistance to opsonophagocytosis in Klebsiella pneumoniae; Domenico P et al.; The polysaccharide capsule of Klebsiella pneumoniae is an important virulence factor that confers resistance to phagocytosis . The treatment of encapsulated bacteria with salicylate to inhibit capsule expression was found to enhance the phagocytosis of encapsulated bacteria by human neutrophils only in the presence of cell surface-specific antibodies . Both type-specific rabbit antisera and anticapsular human hyperimmune globulin were employed as opsonins . Salicylate significantly enhanced phagocytosis with homologous, but not heterologous, whole-cell antisera . Antisera, diluted 1:40, no longer opsonized fully encapsulated bacteria but promoted the uptake of multiple salicylate-treated bacteria in > 90% of neutrophils . Salicylate (0.25 to 1.0 mM) also enhanced opsonization with globulin against homologous bacteria . Higher salicylate levels (1 to 2.5 mM) enhanced the opsonization of heterologous serotypes with human globulin . The nature of antibody attachment to encapsulated bacteria was determined by immunofluorescence . Even after the addition of purified capsular polysaccharide to prevent phagocytosis, K-specific antibodies attached in large amounts to bacteria . K-specific antibodies reacted with antigens throughout the capsule and showed a predilection for a denser inner layer of the capsule, indicating that many of the K-specific antibodies may be masked underneath the capsule surface . K-specific antibodies can also be rendered nonfunctional by soluble, cell-free capsular antigen . In culture, large quantities of soluble capsular polysaccharide extrude from bacteria after overnight growth . The reduction in capsule expression caused by salicylate largely affected the soluble, cell-free fraction . Purified capsular polysaccharide was shown to retard the opsonophagocytosis of salicylate-treated bacteria in a concentration-dependent manner . However, extensive washing of encapsulated bacteria to remove loosely attached capsular material did not significantly enhance opsonophagocytosis . In conclusion, cell-free capsule and cell-associated capsule are antiphagocytic; both act to neutralize K-specific antibodies by binding or concealment . Salicylate-mediated inhibition of capsule expression, particularly of the cell-free fraction, improved K-specific opsonization dramatically.

Infect Immun, 1994 Oct, 62(10), 4186 - 91
The type 3 fimbrial adhesin gene (mrkD) of Klebsiella species is not conserved among all fimbriate strains; Schurtz TA et al.; The type 3 fimbriae of enteric bacteria mediate agglutination, in vitro, of erythrocytes treated with tannic acid . The gene encoding the polypeptide, MrkD, that mediates this agglutination reaction was placed downstream of an inducible promoter, and the ability of MrkD alone to facilitate hemagglutination was determined . Although Escherichia coli transformants could be shown to produce the MrkD protein, hemagglutination did not occur in the absence of other mrk gene products . In addition, the MrkD polypeptide did not cross the bacterial outer membrane unless a fimbrial chaperone protein was also present . Analysis of the frequency of the mrkD gene within the genus Klebsiella indicated that this gene is conserved in strains of Klebsiella oxytoca but not in other fimbriate Klebsiella species . In the small number of strains of Klebsiella pneumoniae that do possess a related mrkD gene, this determinant could be found on a plasmid in one strain . The ability of type 3 fimbriate bacteria to adhere to type V collagen was found to be a function of a specific MrkD polypeptide . This adhesin is frequently found in strains of K . oxytoca but is rarely associated with the type 3 fimbriae of K . pneumoniae.

Clin Exp Immunol, 1994 Oct, 98(1), 145 - 50
Autoantibodies to cerebroside sulphate (sulphatide) in leprosy; Wheeler PR et al.; Sera from 40 leprosy patients were screened for autoantibodies to cerebroside sulphate (sulphatide) . Anti-sulphatide IgM in groups of patients with lepromatous (LL) and borderline (BL + BB + BT), but not with tuberculoid (TT) disease, were significantly elevated above the levels found in endemic control subjects . Eight-six percent (18 out of 21; mean 1.59 OD units) of LL, 33% (four out of 12; mean 1.08 OD units) of borderline and 13% (one out of eight; mean 0.69 OD units) of tuberculoid patients had anti-sulphatide IgM in their sera above a cut-off value of 2 s.d . above the mean value (0.66 OD units) for control sera . Elevated anti-sulphatide IgG was detected in only one patient's serum, an individual with LL disease . The level of anti-sulphatide IgM was strongly correlated to expression of the TH3 idiotype, an idiotype previously defined by a human MoAb that bound Mycobacterium leprae phenolic glycolipid, Klebsiella capsular polysaccharide, polynucleotides and human tissues . The purified, TH3 MoAb was found in this study to bind sulphatide, but not cholesterol-3-sulphate or cerebroside . It is suggested that anti-sulphatide IgM is elevated in leprosy, in relation to the bacterial load . Anti-sulphatide IgM fell at the onset of erythema nodosum leprosum (ENL) reaction, consistent with the deposition of serum antibodies, and thus may play a part in pathology during periods of inflammation, particularly in multibacillary patients.

Eur J Epidemiol, 1994 Oct, 10(5), 533 - 40
Extended-spectrum beta-lactamases from Klebsiella pneumoniae strains isolated at an Italian hospital; Pagani L et al.; Eighteen strains of Klebsiella pneumoniae recently isolated from hospitalized patients were resistant or moderately resistant to oxyimino-cephalosporins (ceftazidime and/or cefotaxime), aztreonam, cefoxitin and all but one were susceptible to imipenem . Analysis of enzymes produced by these clinical isolates revealed a wide pattern of extended-spectrum beta-lactamases . All isolates produced one or more beta-lactamases that were characterized preliminarily by their isoelectric point . Strains isolated early were from patients in the Intensive Care Unit and produced an ES beta-lactamase with an apparent pI of 7.6, whereas the later isolates were from surgical and medical wards of the same hospital and produced ES beta-lactamases with apparent pI of 8.2 and 8.4, respectively . This suggests the emergence of SHV-5 and MIR-1 beta-lactamases in our hospital . Agarose gel electrophoresis of plasmid DNA revealed the presence of a similar plasmid of approximate size 60 Kb in all isolates.

Pol Arch Med Wewn, 1994 Oct, 92(4), 357 - 60
{Spurious macrocytosis associated with cold agglutinins: report of two cases}; Zdziarska B et al.; Two rare cases of spurious macrocytosis are reported: in a patient with lymphocytic lymphoma and in another patient with pneumonia caused by Klebsiella pneumoniae . High blood titer of cold agglutinins resulted in appearing of microagglutination in vitro and false erythrocyte indices as measured by automatic blood cell counting.

Mol Microbiol, 1994 Oct, 14(2), 347 - 56
Klebsiella pneumoniae genes for citrate lyase and citrate lyase ligase: localization, sequencing, and expression; Bott M et al.; In the course of studies on anaerobic citrate metabolism in Klebsiella pneumoniae, the DNA region upstream of the gene for the sodium-dependent citrate carrier (citS) was investigated . Nucleotide sequence analysis revealed a cluster of five new genes that were oriented inversely to citS and probably form an operon . The genes were named citCDEFG . Based on known protein sequence data, the gene products derived from citD, citE and citF could be identified as the gamma-, beta-, and alpha-subunits of citrate lyase, respectively . This enzyme catalyses the cleavage of citrate to oxaloacetate and acetate . The gene product derived from citC (calculated M(r) 38,476) exhibited no obvious similarity to other proteins . In the presence of acetate and ATP, cell extracts from a citC-expressing Escherichia coli strain were able to reactivate purified citrate lyase from K . pneumoniae that had been inactivated by chemical deacetylation of the prosthetic group . This represents 5-phosphoribosyl-dephospho-acetyl-coenzyme A which is covalently bound to serine-14 of the acyl carrier protein (gamma-subunit) . CitC was thus identified as acetate:SH-citrate lyase ligase . The function of the gene product derived from citG (M(r) 32,645) has not yet been identified . Expression of the citCDEFG gene cluster in E . coli led to the formation of citrate lyase which was active only in the presence of acetyl-coenzyme A, a compound known to substitute for the prosthetic group . These and other data strongly indicated that the enzyme synthesized in E . coli lacked its prosthetic group . Thus, additional genes besides citCDEFG appear to be required for the formation of holo-citrate lyase.

J Clin Microbiol, 1994 Oct, 32(10), 2625 - 7
Clonal outbreaks of extended-spectrum beta-lactamase-producing strains of Klebsiella pneumoniae demonstrated by antibiotic susceptibility testing, beta-lactamase typing, and multilocus enzyme electrophoresis; Nouvellon M et al.; Nineteen extended-spectrum beta-lactamase (ESBla)-producing Klebsiella pneumoniae isolates from Rouen Hospital were investigated for their implication in nosocomial outbreaks: in addition to antibiotic susceptibility testing, the ESBlas were characterized by isoelectric focusing, and the genetic relationships between the strains were analyzed by multilocus enzyme electrophoresis using a combined polyacrylamide electrophoresis-electrophoretic transfer technique . Four isoelectric focusing beta-lactamase patterns and 11 enzyme electrophoretic types (ETs) among the strains tested were described . Three strains isolated in the same neurological unit over a 7-day period exhibited an SHV 3 beta-lactamase (pI 7.0) and were assigned to a common ET . Three of five strains isolated from patients in a rehabilitation center over a 6-week period harbored an SHV 4 beta-lactamase (pI 7.8) and exhibited the same ET . These results differentiate nosocomial transmission from sporadic cases and provide evidence that multilocus enzyme electrophoresis is a potential tool for studying genetic relationships between strains harboring a common ESBla.

J Clin Microbiol, 1994 Oct, 32(10), 2553 - 8
Molecular epidemiology of Klebsiella pneumoniae strains that produce SHV-4 beta-lactamase and which were isolated in 14 French hospitals; Arlet G et al.; Preliminary results suggested that the diffusion in France of the SHV-4 extended-spectrum beta-lactamase was probably due to the spread of one single epidemic strain of Klebsiella pneumoniae . In this study, we tested various phenotypic and genotypic markers to compare K . pneumoniae strains producing this enzyme isolated in 14 French hospitals between 1987 and 1989 . All of the strains were of the same capsule serotype, K25 . Twelve of them were of the same biotype: weak urease activity and no sucrose fermentation . Among the six plasmid profiles observed, one accounted for eight strains . Large plasmids of 170 kb encoding SHV-4 beta-lactamase were present in all strains of K . pneumoniae and could be transferred by conjugation with high frequency to Escherichia coli J53-2 or HB101 from all except one strain . Plasmid EcoRI restriction patterns suggested that these plasmids were closely related and similar to pUD18 encoding SHV-3 beta-lactamase, originally described in France and differing from SHV-4 by one amino acid substitution . Ribotyping with EcoRI and HindIII and genomic fingerprinting with XbaI by pulsed-field gel electrophoresis were concordant and suggested that 12 of the isolates recovered from the 14 hospitals were probably the same strain . Dissemination in France of the SHV-4 extended-spectrum beta-lactamase was thus essentially due to the diffusion of a single K . pneumoniae clone.

J Clin Invest, 1994 Sep, 94(3), 1026 - 36
Autoimmune myocarditis induced in mice by cardiac C-protein . Cloning of complementary DNA encoding murine cardiac C-protein and partial characterization of the antigenic peptides; Kasahara H et al.; Autoimmune myocarditis is considered to play a major role in the pathogenesis of dilated cardiomyopathy . A new autoimmune myocarditis model was attained by repeated immunization using murine cardiac C-protein with the immunological adjuvant, Klebsiella pneumoniae O3 lipopolysaccharide . For further analysis of a pathological epitope, the cDNA encoding C-protein was isolated; a fusion protein encoded by part of this cDNA induced myocarditis in SMA mice as well as in three other strains: DBA/1J (H-2q), O20/A (H-2pz1), and SJL (H-2s) . The nucleotide sequence and its deduced amino acid analysis revealed that this protein had immunoglobulin-like and fibronectin-like repeats . This study provides a new animal model of autoimmune myocarditis which may shed light on the pathogenesis of dilated cardiomyopathy.

J Bacteriol, 1994 Sep, 176(17), 5525 - 9
Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis; Osuna R et al.; Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC . Multiple copies of the hutUH promoter region {hut(P)} present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC) . Thus, the hut(P) region contains a specific binding site for HutC . To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region . Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor . Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.

J Bacteriol, 1994 Sep, 176(17), 5513 - 24
Roles of catabolite activator protein sites centered at -81.5 and -41.5 in the activation of the Klebsiella aerogenes histidine utilization operon hutUH; Osuna R et al.; The Klebsiella aerogenes hutUH operon is preceded by a promoter region, hut(P), that contains two divergent promoters (hutUp and Pc) which overlap and are alternately expressed . In the absence of the catabolite gene activator protein-cyclic AMP (CAP-cAMP) complex, Pc is predominantly expressed while hutUp is largely repressed . CAP-cAMP has the dual effect of repressing transcription from Pc while simultaneously activating transcription from hutUp . DNA deletion mutations in this region were used to identify DNA sequences required for transcription of these two promoters . We showed that inactivation of Pc by DNA deletion did not result in activation of hutUp in vitro or in vivo . In addition, Escherichia coli CAP mutants that are known to bind and bend DNA normally but are unable to activate various CAP-dependent promoters were also unable to activate hutUp in vivo . These results invalidate an indirect activation model by which CAP-mediated repression of Pc in itself would led to activation of hutUp . Gel retardation asays with various deletion mutations of hut(P) and DNase I protection analyses revealed a high-affinity CAP binding site (CAP site 1) centered at -81.5 relative to the hutUp start of transcription and a second low-affinity CAP site (CAP site 2) centered at about -41.5 . CAP site 1 is essential for activation of hutUp . Although CAP site 2 by itself is unable to activate hutUp in vivo under catabolite-activating conditions, it appears to be required for maximal transcription from a site centered at -41.5, does not activate hutUp suggests that the role of CAP-cAMP at the weaker CAP site may be different from that of other promoters containing a similarly positioned site . We propose that CAP directly stimulates the activity of RNA polymerase at hutUp and that this reaction is completely dependent on a naturally occurring CAP site centered at -81.5 and also involves a second CAP site centered at about -41.5 for maximal activation.

J Appl Bacteriol, 1994 Sep, 77(3), 296 - 302
Analytical procedure for use of conductance measurement to estimate Escherichia coli in shellfish; Dupont J et al.; Assays were performed with a Malthus AT Microbiological Analyzer to define an analytical procedure to estimate Escherichia coli counts in live bivalve shellfish by conductance measurement . The growth conditions used (Malthus Coliform Broth at 44 degrees C) were selective for E . coli, and interference was noted only when Klebsiella pneumoniae were at least 100 times as numerous as E . coli . Different sample preparation procedures and seeding conditions were tested to obtain good quality conductance curves . The best results were observed when: (a) meat and shell liquor were diluted 1:3 with tryptone salt water and homogenized in a Waring blender for 1 min at 15,000 rev min-1; and (b) the inoculum was taken from the liquid phase of the homogenate 20 min after blending and mixed immediately with the culture medium . Detection parameter threshold values were adjusted (first difference 1.5 microS for the baseline and 3.5 microS for detection, second difference 0.2 microS) to improve detection time reliability . The repeatability of conductance measurements was very good (S.D . as % response mean ranged from 1.9 to 3.3) with the protocol used.

Br J Surg, 1994 Sep, 81(9), 1309 - 11
Improved survival in simulated surgical infection with combined cytokine, antibiotic and immunostimulant therapy; Gaar E et al.; A study was performed to find an ideal combination and sequence of cytokines, antibiotics and immunorestorative agents to enhance survival from serious infection . The effects of combinations of granulocyte-macrophage colony-stimulating factor (GM-CSF), tumour necrosis factor (TNF) alpha, the immune adjuvant muramyl dipeptide (MDP) and two systemic antibiotics were studied in a validated murine model of surgical infection . A single cotton suture containing absorbed Klebsiella pneumoniae was placed into the thighs of mice to produce local and systemic infection . Control mice received a volume of subcutaneous saline equal to that of the therapeutic agent; only 18 per cent survived 9 days after infection . The survival time of mice treated with any single agent was similar to that of controls . The group given maximal combined therapy (65 mice) received GM-CSF, TNF-alpha, MDP, and ampicillin-sulbactam or cefoxitin for 6 days . The survival rate in this group 9 days after the introduction of infection was 84-90 per cent (P < 0.0001), suggesting that specific combinations of cytokines, immunostimulants and antibiotics may be useful in combating lethal infection.

Microbiology, 1994 Sep, 140 ( Pt 9), 2451 - 8
The physiological function of periplasmic glucose oxidation in phosphate-limited chemostat cultures of Klebsiella pneumoniae NCTC 418; Buurman ET et al.; Periplasmic oxidation of glucose into gluconate and 2-ketogluconate in Klebsiella pneumoniae occurs via glucose dehydrogenase (GDH) and gluconate dehydrogenase (GaDH), respectively . Since, as is shown here, in the presence of glucose, gluconate and 2-ketogluconate are not further metabolized intracellularly the physiological function of this periplasmic route was studied . It was found that periplasmic oxidation of glucose could function as an alternative production route of ATP equivalents . Instantaneous activation of either GDH or GaDH reduced the rate of degradation of glucose via glycolysis and the tricarboxylic acid (TCA) cycle in vivo . Furthermore, aerobic, magnesium- and phosphate-limited chemostat cultures with glucose as the carbon source showed high GDH plus GaDH activities in contrast to nitrogen- and sulphate-limited cultures . However, when fructose, which is not degraded by GDH, was the carbon source, specific oxygen consumption rates under these four conditions were essentially the same . The latter observation suggests that high transmembrane phosphate gradients which are supposedly present under phosphate-limited conditions do not cause high energetic demands due to futile cycling of phosphate ions . In addition, dissipation of the transmembrane phosphate gradient of phosphate-limited cells immediately increased the rate of intracellular glucose degradation . It is concluded that under phosphate-limited conditions (i) extensive futile cycling of phosphate ions is absent and (ii) low concentrations of phosphate ions limit intracellular degradation of glucose.(ABSTRACT TRUNCATED AT 250 WORDS)

Zhonghua Min Guo Xiao Er Ke Yi Xue Hui Za Zhi, 1994 Sep-Oct, 35(5), 466 - 70
Pyogenic liver abscess in beta-thalassemia major--report of two cases; Hwang CF et al.; Pyogenic liver abscess, which may lead to devastating consequences, is an uncommon medical problem in pediatrics and has generally been reported in compromised hosts . This article describes two patients with beta-thalassemia major and hemochromatosis complicated by Klebsiella pneumoniae liver abscess . One of the patients had severe complications, including subphrenic abscess, pleural effusion and meningitis . To present knowledge, the occurrence of K . pneumoniae liver abscess in patients with beta-thalassemia major has never before been reported in the literature.

Zh Mikrobiol Epidemiol Immunobiol, 1994 Sep-Oct, (5), 67 - 71
{The clinico-immunological characteristics and treatment of an intestinal infection of Klebsiella etiology}; Frolov VM et al.; The examination of 265 patients with the diagnosis of acute enteric infection (AEI) of Klebsiella revealed that the disease took a mild course in 40%, a moderate course in 45.3% and a severe course in 14.7% of the patients . The clinical syndromes of acute gastritis, gastroenteritis, enteritis were observed; in cases of the severe course of AEI the hemolytic {correction of hemocolitic} syndrome was present . Immune shifts were characterized by T lymphopenia, a decrease in the number of T helpers/inductors (CD 4), the immunoregulatory indices (CD 4/CD 8), an increase in the level of circulating immune complexes . These levels reached their maximum in case of the severe course of Klebsiella infection and were retained till the patient was discharged from the hospital and, if any concomitant pathology was present, even for 1-3 months after discharge.

Biosci Biotechnol Biochem, 1994 Sep, 58(9), 1652 - 6
Purification, characterization, and crystallization of monoamine oxidase from Escherichia coli K-12; Roh JH et al.; The gene for monoamine oxidase (MAO) was cloned from an Escherichia coli genomic library and MAO was overproduced in the periplasmic space . The enzyme was purified to homogeneity by preparation of a periplasmic fraction, followed by ammonium sulfate fractionation and DEAE-cellulose column chromatography . Crystals were obtained by the hanging drop method using sodium citrate as a precipitant . The enzyme was found to be a dimer of identical subunits with a molecular weight of 80,000, and showed the highest activity at pH 7.5 and 45 degrees C . The enzyme was inhibited by a MAO specific inhibitor, hydroxylamine, hydrazine, phenelzine, isoniazid, and tranycpromine . The enzyme oxidized tyramine, phenethylamine, and tryptamine at higher rates, but not oxidized diamine and polyamines such as putrescine and spermine . The antibody against E . coli MAO cross-reacted with purified MAO A from Klebsiella aerogenes.

J Biol Chem, 1994 Aug 19, 269(33), 20905 - 12
A light-repressed transcript found in Synechococcus PCC 7002 is similar to a chloroplast-specific small subunit ribosomal protein and to a transcription modulator protein associated with sigma 54; Tan X et al.; The gene encoding a novel light-repressed transcript (lrtA) contained within a 2.7-kbp EcoRI fragment has been cloned and sequenced from the unicellular cyanobacterium, Synechococcus PCC 7002 . Northern analysis indicates that this transcript is synthesized rapidly in the dark, but upon 20 min of illumination, transcript levels fall below detectable limits . An open reading frame was located 378 bases from the start of the transcript which encodes a 21-kDa protein with significant homology to two hitherto different proteins . The protein sequence LrtA showed 37% sequence identity and 58% sequence similarity to the chloroplast-specific small subunit ribosomal protein, S30, and 37% sequence identity and 60% sequence identity and 60% sequence similarity to the reported transcription modulator protein of sigma 54 found in Klebsiella pneumonia and Azotobacter vinelandii . Expression of the lrtA gene product is not detectable within 1 h after placing the cells in the dark, however, within 2.5 min of illumination, {35S}methionine incorporated into a 21-kDa protein . To a lessor extent, {35S}methionine incorporation into a 17- and a 14-kDa protein was also seen which was followed by two other recognizable waves of translation at 5 and 10 min . This incorporation was not blocked by rifampicin added to dark-adapted cells prior to illumination . {35S}Methionine pulsed-labeling experiments suggested that the translation of lrtA occurred only during the first 10 min of reillumination of dark-adapted cells . The loss of initial {35S}methionine labeling in the light of the 21-kDa protein in a kanamycin-interrupted lrtA gene mutant suggests that the lrtA codes for the 21-kDa protein.

Tidsskr Nor Laegeforen, 1994 Aug 10, 114(18), 2102 - 6
{Bacteremia at a medium-sized Norwegian hospital}; Hallan S et al.; This report, which is based on laboratory reports and patient records, covers the epidemiology, etiology and antibiotic susceptibility of all bacteremic episodes at a community hospital during 1988-90 . The overall incidence was eight episodes per 1000 patient admissions, though this figure varied considerably between departments and between age groups . Most organisms were community acquired, and we had few Klebsiella spp., Pseudomonas spp., anaerobic bacteria, fungi and polymicrobial episodes . There were fewer antibiotic resistant strains than reported from outside Scandinavia . The combination of benzylpenicillin and aminoglycoside (plus metronidazole in surgical wards) has a broad enough spectrum of activity for 95% of our patients with sepsis of unknown origin . Thus, our rather "old-fashioned" prescribing policy, with the new and broadspectrum cephalosporins and betalactam drugs constituting only a minor part, is still good practice . The study also shows that cumulative reports issued by the local microbiological laboratory bring awareness to these issues and affect the prescribing pattern in a positive way.

Carbohydr Res, 1994 Aug 3, 261(1), 111 - 8
Structural studies of the capsular polysaccharide from Klebsiella type 38: a reinvestigation; Jansson PE et al.; The structure of the capsular polysaccharide from Klebsiella type K38 has been reinvestigated . It is composed of pentasaccharide repeating units of the structure given below . In this structure, Sug stands for a 4-deoxy-threo-hex-4-enopyranosyluronic acid group, most probably having the beta-L configuration . 1H NMR studies further indicate that this group assumes the 1H2 conformation . {formula: see text}

Appl Environ Microbiol, 1994 Aug, 60(8), 3027 - 9
Azoreductase activity in bacteria associated with the greening of instant chocolate puddings; Dykes GA et al.; Pseudomonas sp . strain AZR1 and Klebsiella sp . strain AZR2 were isolated from reconstituted instant chocolate puddings that had turned green and were found to have azoreductase activity . This activity was inducible and NADH dependent . Differences in dye reduction rates between the two strains were apparent, and substrate specificity related to dye structure was observed.

J Am Coll Surg, 1994 Aug, 179(2), 139 - 44
Late complications after excisional operation in patients with choledochal cyst; Chijiiwa K et al.; BACKGROUND: The follow-up results of 28 patients with choledochal cysts, 16 type I (solitary extrahepatic cyst) and 12 type IVA (extra and intrahepatic cysts), after excision of extrahepatic dilated bile duct were analyzed to evaluate detailed late complications . STUDY DESIGN: Hepaticojejunostomy with a wide opening (10 to 30 mm) was created using hepaticoplasty, if necessary, in a Roux-en-Y manner . The mean follow-up period after excisional procedure was 8 +/- 5 (standard error of the mean) years, ranging from one to 18 years . RESULTS: All patients were alive and carcinoma was not observed . Three patients (two with type I and one with type IVA cysts) had intrahepatic calculi . However, they had no evidence of anastomotic stricture on direct cholangiogram, although all bile cultures infected, mainly with Klebsiella and Escherichia coli . Intrahepatic gallstones were successfully treated with percutaneous transhepatic cholangioscopy and reoperation was not required . Thus, intrahepatic calculi associated with cholangitis, but not with anastomotic stricture, were found in 10.7 percent of the patients after excision of choledochal cyst . CONCLUSIONS: Long-term follow-up evaluation is necessary, with special attention being given to intrahepatic calculi, even in the absence of an anastomotic stricture.

Microbiology, 1994 Aug, 140 ( Pt 8), 1917 - 25
Autoregulation of nitrogenase expression in Klebsiella pneumoniae; Hill S et al.; An investigation into the influence of N2 on the expression of Klebsiella pneumoniae nitrogenase has led to a reassessment of the role of the nitrogenase MoFe protein in autoregulation . Anaerobic derepression of nitrogenase (C2H2-reducing) activity, of NifD and K polypeptides, and of nifH-lac expression, following the removal of excess NH+4, were greater under N2 than Ar . This enhancement occurred in Nif+ but not in Nif- strains, and in Nif+ strains was prevented by C2H2, an inhibitor of N2 fixation . Thus N2 fixation is important for maintaining derepression . Derepression of nifH-lac under Ar in various Nif+ and Nif- strains (including NifH-, NifD-, NifB- and NifL- mutants) and of wild-type lac under N2 or Ar in a Nif+ strain were measured to investigate the regulation . The mechanism regulating the enhancement under N2 neither involved the MoFe protein of nitrogenase, as proposed by Dixon et al . (1980, Nature 286, 128-132), nor the nifL product, but was probably due to a general upgrading of the N status . Moreover, during batch growth limited by a non-repressing fixed N source, the levels of nifH-lac expression in the Nif+ and Nif- strains suggested that the nifH gene product (or Fe protein) may have a positive autoregulatory function.

Zh Mikrobiol Epidemiol Immunobiol, 1994 Aug-Sep, Suppl 1, 104 - 6
{The factors in Klebsiella persistence}; Surikova EV; The data on the study of antilysozyme and anti-interferon properties of 375 Klebsiella strains are presented . The heterogeneity of strains with respect to their antilysozyme and anti-interferon activity is described . As revealed in this study, these properties occur more frequently and considerably to a greater extent in strains isolated from patients with Klebsiella infections and from carriers . Strains, incapable of inhibiting lysozyme and interferon or capable to digest them poorly, prevail among strains isolated from healthy persons . The data on the relationship between the level of the persistence factors of Klebsiella and the source of their isolation are presented.

Mikrobiol Z, 1994 Jul-Sep, 56(4), 20 - 5
{The content of mimicry antigens in bacteria of the genus Klebsiella when they are cultured in plant tissue}; Turianitsa AI et al.; Bacteria of genus Klebsiella were found to possess group-specific antigens of ABO system . Representatives of conditionally pathogenic species, K . rhinoscleromatis, K . pneumoniae, K . ozaenae, K . oxytoca, contain 9.4 to 38% of the antigens . In the process of interaction of plant organisms and Klebsiella, which passed three times in green tomato fruits, the latter have been found to influence some biological features of the bacteria which is manifested in the loss of the mimicry antigens by a considerable part of the strains as well as in developing capsules by some capsule-free variants of klebsiellae.

J Mol Evol, 1994 Jul, 39(1), 101 - 4
On the evolution of arginases and related enzymes; Ouzounis CA et al.; Sequence analysis of the arginase/agmatine ureohydrolase family, important enzymes in arginine/agmatine metabolism and the urea cycle, reveals the similarity of arginases to formiminoglutamate hydrolase (hutG) in Klebsiella aerogenes and to a previously unidentified open reading frame adjacent to the HMf locus of the archaebacterium Methanothermus fervidus . The gene structure and distribution of these homologous proteins across primary kingdoms suggest that this family is another example of a primordial enzyme possibly present in the universal common ancestor and that can be used as phylogenetic marker.

Biochem J, 1994 Jul 1, 301 ( Pt 1), 145 - 50
3,4-Dihydroxyphenylacetate 2,3-dioxygenase from Klebsiella pneumoniae, a Mg(2+)-containing dioxygenase involved in aromatic catabolism; Gibello A et al.; 3,4-Dihydroxyphenylacetate 2,3-dioxygenase, an extradiol-ring-cleavage dioxygenase, has been purified from Klebsiella pneumoniae to homogeneity . The enzyme has an M(r) of 102,000 in its tetrameric form with an M(r) of 25,500 for each subunit . Unlike most other dioxygenases, the enzyme reported here contains Mg2+, as determined by atomic-absorption spectrophotometry and plasma emission metal analysis . The enzyme was shown to contain approx . 1 g-atom of Mg2+/mol of protein and we suggest an alpha 4 Mg2+ quaternary structure . This is the first report of a dioxygenase containing Mg2+ in its structure.

Infect Immun, 1994 Jul, 62(7), 2865 - 73
Self-transmissible R plasmids encoding CS31A among human Escherichia coli strains isolated from diarrheal stools; Jallat C et al.; The CS31A antigen was first described for septicemic and enterotoxigenic bovine E . coli strains . In our study, of 597 human Escherichia coli strains isolated from diarrheagenic stools of hospitalized patients, 30 (5%) hybridized with the CS31A DNA probe . These CS31A-positive E . coli strains diffusely adhered to Caco-2 and/or HEp-2 cells and produced a major surface protein of either 30 or 30.5 kDa according to the strain . These proteins were antigenically related to the two forms of the CS31A antigen, namely, CS31A-L and CS31A-H . Genes encoding CS31A were located on 140-kb conjugative R plasmids . E . coli transconjugants expressed major surface proteins similar to those of the wild-type strains and adhered to Caco-2 and/or HEp-2 cells . An association of CS31A and another adhesive factor of the Dr family was found in 70% of wild-type strains, since 21 strains hybridized with the diffuse adhesion DNA probe corresponding to the accessory gene (daaC) of the F1845 adhesin . Comparison of the restriction patterns of the 140-kb R plasmids of the CS31A-positive E . coli strains showed these plasmids to be similar . Hybridization experiments indicated that the genes encoding CS31A and resistance to penicillin were located together on either of two 20- or 27-kb EcoRI restriction fragments in four E . coli strains . We reported a similar linkage between these genes in Klebsiella pneumoniae strains which produced CF29K, a CS31A-like antigen . These results suggest a horizontal transfer between E . coli and K . pneumoniae strains.

J Infect, 1994 Jul, 29(1), 53 - 66
Influence of cytostatic agents on the pulmonary defence of mice infected with Klebsiella pneumoniae and on the efficacy of treatment with ceftriaxone; Calame W et al.; The effect of cytostatic treatment on the cellular defence and the efficacy of treatment with ceftriaxone in Klebsiella pneumoniae pneumonia was studied . Mice, made monocytopenic and granulocytopenic by cyclophosphamide or monocytopenic by etoposide, were infected intratracheally with K . pneumoniae (approximately 10(4) CFU) and then treated with ceftriaxone . At various intervals, the numbers of bacteria in the broncho-alveolar lavage (BAL) fluid and in lungs homogenised after lavage were determined . Cyclophosphamide reduced the numbers of granulocytes in the BAL fluid significantly but reduced only slightly the number of alveolar macrophages at the time of inoculation, 12 and 15 h later . The number of CFU in cyclophosphamide-treated mice was higher than that in controls, being significant in the homogenised lungs at 15 h after infection . In etoposide-treated mice, the numbers of alveolar phagocytes in BAL did not differ from those in control mice, whereas the number of bacteria was lower (only significantly in BAL fluid at 15 h after infection) than that in the controls . In this short experimental infection cytostatic treatment did not affect the outgrowth of Klebsiella pneumoniae substantially or the efficacy of treatment with ceftriaxone.

Bioorg Med Chem, 1994 Jul, 2(7), 681 - 90
Biocatalytic desulfurization of arylsulfonates; Dudley MW et al.; A microbial strain, Klebsiella oxytoca KS3D, has been isolated which is capable of exploiting arylsulfonates as a sole source of sulfur during growth . The desulfurization catalyzed by intact K . oxytoca KS3D results in the conversion of arylsulfonates into the corresponding phenols . Even arylsulfonates carrying substituents which significantly alter steric and electronic characteristics are substrates . Only a single regioisomer is produced from substituted arylsulfonates . Based on the products formed from the biocatalytic desulfurizations and incorporation of isotopic oxygen in phenolic product when the desulfurization is run under 18O-enriched oxygen, hydrolysis mechanisms can be eliminated from consideration . Two reaction types which might mimic the chemistry occurring during microbial desulfurization of arylsulfonates were examined . The first reaction involved conversion of appropriately substituted arylsulfonates into phenols by single electron reduction followed by reaction of the radical anions with molecular oxygen . A second reaction using intramolecular reaction of arylsulfonates and arylsulfones with alkoxy radicals failed to achieve desulfurization . In addition to mechanistic evaluation, desulfurization of arylsulfonates catalyzed by K . oxytoca KS3D is examined from the perspective of its relevance to desulfurization of the organosulfur components of coal and its possible use for industrial manufacture of phenols.

Antibiot Khimioter, 1994 Jul, 39(7), 42 - 6
{Clinico-pathogenetic substantiation of comprehensive therapy of Klebsiella infection with the syndrome of water diarrhea in infants}; Kashuba EA et al.; The data on the examination of 70 infants with Klebsiella infection are presented . The patho-chemical disorders in the intestine under the action of Klebsiella were followed up in the time course and the adequacy of the pathogenetic therapy of the antiinflammatory and membrane protective destination was substantiated . The efficacies of the comprehensive therapy with the use of indomethacin, essential and dimephosphone and the therapy with antibacterial drugs such as monomycin, kanamycin, polymyxin and gentamicin administered orally were compared . The laboratory investigations, pharmaco-immunologic tests and clinical time course observations demonstrated the preference of the pathogenetic therapy of the patients with Klebsiella infection at the early stages of the watery diarrhea syndrome, when the functional disorders at the cellular level prevailed over the structural-and-morphological ones . In cases with complications the combined use of the pathogenetic and antibacterial drugs was more efficient.

Avian Dis, 1994 Jul-Sep, 38(3), 679 - 81
Hepatic hemosiderosis and Klebsiella bacteremia in a green aracari (Pteroglossus viridis); Wilson RB; A green aracari (Pteroglossus viridis) was presented for necropsy after being found dead; no previous clinical signs had been noted . Microscopic examination revealed multifocal necrosis of the liver, spleen, and lung compatible with an acute bacteremia . Klebsiella pneumoniae was isolated from the liver, kidney, and intestine . Histopathological and toxicological findings also reflected a concurrent hepatopathy due to excess iron accumulation . Hepatic hemosiderosis has been reported in mynahs, birds of paradise, and quetzals but has not previously been reported in the green aracari.

FEBS Lett, 1994 Jun 20, 347(1), 37 - 41
Purification of two active fusion proteins of the Na(+)-dependent citrate carrier of Klebsiella pneumoniae; Pos KM et al.; The sodium-ion-dependent citrate carrier of Klebsiella pneumoniae (CitS) was purified by means of bioengineerical methods . By fusing the biotin acceptor domain of the alpha-subunit of the oxaloacetate decarboxylase of K . pneumoniae to the C-terminus of CitS, purification of the carrier was achieved by use of a monomeric avidin-Sepharose column . Additionally, we were able to purify a CitS-protein with an N-terminal histidine-tag by immobilized metal chelate affinity chromatography (with Ni2(+)-nitrilotriacetic acid-(NTA-) resin) . Both purified fusion proteins showed citrate transport activity after reconstitution into liposomes by the freeze/thaw/sonication procedure.

FEMS Microbiol Lett, 1994 Jun 15, 119(3), 389 - 94
Overexpression, phosphorylation, and growth effects of ORF162, a Klebsiella pneumoniae protein that is encoded by a gene linked to rpoN, the gene encoding sigma 54; Begley GS et al.; The product of a Klebsiella pneumoniae gene, orf162, may regulate sigma 54-dependent transcription and has sequence similarity to proteins of the phosphoenolpyruvate-dependent phosphotransferase system (PTS) . We have overproduced the product of orf162 and demonstrated its PTS-dependent phosphorylation in Escherichia coli extracts . We have also observed moderate growth inhibition of a wild-type, but not a sigma 54-mutant, strain by overexpression of orf162 . These results are consistent with the hypothesis that the product of orf162 could be a regulatory link between the PTS and sigma 54 activity in bacteria.

J Bacteriol, 1994 Jun, 176(12), 3527 - 35
Acetoin catabolic system of Klebsiella pneumoniae CG43: sequence, expression, and organization of the aco operon; Deng WL et al.; A cosmid clone which was capable of depleting acetoin in vivo was isolated from a library of Klebsiella pneumoniae CG43 cosmids . The smallest functional subclone contained a 3.9-kb DNA fragment of the cosmid clone . Sequencing of the DNA fragment revealed three open reading frames (ORFs A, B, and C) encoding polypeptides of 34, 36, and 52 kDa, respectively . The presence of these proteins was demonstrated by expression of the recombinant DNA clone in Escherichia coli . Considerable similarities between the deduced amino acid sequences of the ORFs and those of the following enzymes were found: acetoin dissimilation enzymes, pyruvate dehydrogenase complex, 2-oxoglutarate dehydrogenase complex, and branched-chain 2-oxo acid dehydrogenase complex of various origins . Activities of these enzymes, including acetoin-dependent dichlorophenolin-dohenol oxidoreductase and dihydrolipoamide acetyltransferase, were detected in the extracts of E . coli harboring the genes encoding products of the three ORFs . Although not required for acetoin depletion in vivo, a possible fourth ORF (ORF D), located 39 nucleotides downstream of ORF C, was also identified . The deduced N-terminal sequence of the ORF D product was highly homologous to the dihydrolipoamide dehydrogenases of several organisms . Primer extension analysis identified the transcriptional start of the operon as an A residue 72 nucleotides upstream of ORF A.

Ann Surg, 1994 Jun, 219(6), 632 - 40; discussion 640-2
Pneumonia in the surgical intensive care unit . Immunologic keys to the silent epidemic; Naziri W et al.; OBJECTIVE: The authors undertook a prospective study of trauma victims in the intensive care unit (ICU) to investigate the clinical course of pneumonia and the local and systemic immune responses to the pneumonia . SUMMARY BACKGROUND DATA: The silent epidemic of pneumonia has been an "unappreciated killer" in terms of being overlooked in surgical ICUs for the past 5 years, and specifically, the most common major infection after severe trauma . Little is known about the immune response to an acute pulmonary infection . METHODS: The authors studied 50 consecutive, critically ill trauma patients, with a mean injury severity score of 28 +/- 2, who developed pneumonia while ventilated mechanically . Patients were observed clinically, and specific immunologic parameters, including major histocompatibility antigen HLA-DR, complement receptor (CR3), and Fc receptor (FcRIII), were measured in circulating and local alveolar leukocytes for up to 30 days . Eleven patients provided unique clinical data via bronchoscopy for unilateral pneumonia, with collection of bronchoalveolar lavage (BAL) fluid from both the infected and uninfected sides . RESULTS: Patients developed clinical pneumonia 5.3 +/- 0.4 days after admission to the ICU . At diagnosis, mean temperature was 101.4 F, white blood cell count was 16,000/mm3, arterial oxygen tension was 104 +/- 14, fraction of inspired oxygen was 0.47, and positive end-expiratory pressure was 5 . Thirty patients (Group A) recovered relatively promptly; 20 patients had prolonged illnesses (Group B), 15 of whom ultimately survived, and five of whom died . Patients with poor outcomes had greater leukocytosis (p < 0.05) and temperature elevation (p < 0.05) after 5 days of pneumonia . Immunologically, peripheral leukocyte expression of HLA-DR, FcRIII, and CR3 was equivalent in both groups . However, the expression of all three antigens on local alveolar leukocytes was decreased to a greater extent in the poor outcome group compared to the good outcome group, evident before any clinical differentiation between the two outcome groups . CONCLUSIONS: Pneumonia prolonged duration of mechanical ventilation, ICU and hospital stay, and overall infectious morbidity . Although immune suppression has been recognized as a result of initial injury, the development of pneumonia coincided with the nadir of immune function . Poor outcome patients were clinically identifiable 5 days after pneumonia and immunologically identifiable within 2 days . Moreover, there was localized suppression of pulmonary leukocytes at the site of the infiltrate compared to the uninfected lobes . This same alteration was noted in experimental Klebsiella pneumoniae pneumonia . This evidence suggests that there is active immune participation within the respiratory system . It also suggests that there are predispositions to pulmonary infections, and it may allow immune modulation targeted to pulmonary leukocytes to hasten clinical recovery and minimize pulmonary dysfunction.

J Infect Dis, 1994 Jun, 169(6), 1318 - 24
Activity of isepamicin and selection of permeability mutants to beta-lactams during aminoglycoside therapy of experimental endocarditis due to Klebsiella pneumoniae CF104 producing an aminoglycoside acetyltransferase 6' modifying enzyme and a TEM-3 beta-lactamase; Mainardi JL et al.; The pharmacokinetics and efficacy of isepamicin were compared with those of amikacin and gentamicin in a rabbit model of endocarditis due to Klebsiella pneumoniae CF104 producing beta-lactamase TEM-3 and aminoglycoside acetyltransferase AAC(6')-IV . Only isepamicin and gentamicin, alone or combined with ceftriaxone, were effective as determined by titration of viable bacteria in vegetations . Variants highly resistant to ceftriaxone without change in MICs of aminoglycosides were isolated at the end of each therapeutic regimen except with the most effective one (ceftriaxone plus gentamicin) . Examination of the bacterial outer membrane proteins as well as the 50% inhibition of the beta-lactamase activity in intact and sonified cells suggested a permeability defect as being responsible for the increased MICs of ceftriaxone . The activity of isepamicin was superior to that of amikacin against the TEM-3-AAC(6')-IV-producing strain . The combination of gentamicin plus ceftriaxone was the most effective regimen in terms of efficacy and prevention of emergence of resistant strains . Suboptimal aminoglycoside monotherapy might be responsible for selection of permeability mutants to beta-lactams.

Epidemiol Infect, 1994 Jun, 112(3), 473 - 80
Apramycin-resistant Escherichia coli isolated from pigs and a stockman; Hunter JE et al.; Escherichia coli serotype O147:K89:K88a,c was found to be associated with outbreaks of diarrhoea in preweaner pigs of up to 4 weeks of age on a pig unit . Resistance to apramycin, gentamicin, netilmicin, tobramycin and other antibiotics was associated with conjugative plasmids of approximately 62 kb . The presence of a gene which encoded for the aminoglycoside acetyltransferase enzyme AAC(3)IV was confirmed by DNA hybridization . Samples collected during the following 12 months revealed widespread dissemination of these resistance plasmids in non-serotypable, non-haemolytic E . coli throughout the farm . Apramycin-resistant E . coli were also isolated from a stockman and it appeared from plasmid profile analysis and antibiotic sensitivity testing that the human isolates carried the same plasmid as that carried by the porcine E . coli . Klebsiella pneumoniae, with a slightly smaller conjugative plasmid and similar resistance pattern, was isolated from the stockman's wife.

Thromb Haemost, 1994 Jun, 71(6), 768 - 72
Combination of antibiotic treatment with the thrombin inhibitor recombinant hirudin for the therapy of experimental Klebsiella pneumoniae sepsis; Dickneite G et al.; Rats which were infected with the gramnegative pathogen Klebsiella pneumoniae develop disseminated intravascular coagulation (DIC), multi-organ failure (MOF) and finally die in a septic shock . We investigated the therapeutic effect of antibiotic (tobramycin) treatment combined with the infusion of the highly specific thrombin inhibitor rec . hirudin . Although administration of 2 mg/kg tobramycin alone leads to a decrease of the bacterial burden, DIC could not be prevented . Infusion of rec . hirudin (0.25 mg/kg x h) for 4 h (start of treatment 1 h post infection), in addition to a bolus administration of tobramycin, led to an amelioration of DIC parameters as fibrinogen, thrombin-antithrombin complex (TAT) and platelets . Serum transaminase levels (GOT, GPT) as a marker of MOF were significantly improved by rec . hirudin, the T50 value increased from 17 h in the tobramycin group to 42 h in the tobramycin+rec . hirudin group, mortality rates were 90% or 60%, respectively . Combination of heparin (100 U/kg x h) and tobramycin was not effective on survival.

Eur J Clin Microbiol Infect Dis, 1994 Jun, 13(6), 468 - 74
Beta-lactam resistance among Escherichia coli and Klebsiella species blood culture isolates in Finnish hospitals . Finnish Study Group for Antimicrobial Resistance; Arstila T et al.; The aim of this study was to investigate beta-lactam resistance in Escherichia coli and Klebsiella spp . blood culture isolates in Finland . Special attention was given to extended-spectrum beta-lactamases . A total of 566 Escherichia coli and 108 Klebsiella spp . blood culture isolates were collected from hospitals throughout Finland and their susceptibility to beta-lactam antibiotics studied . Twenty percent of Escherichia coli and 69% of Klebsiella spp . strains were resistant to ampicillin . The mechanisms of resistance were studied by hybridization, isoelectric focusing and the clavulanate double-disk potentiation test . Of the ampicillin-resistant Escherichia coli strains, 83% produced TEM-1 . Of the ampicillin-resistant Klebsiella spp . strains, 43% produced SHV-1 . Only nine Escherichia coli and three Klebsiella spp . isolates were resistant to cefuroxime (MIC > or = 32 micrograms/ml), and none were resistant to third-generation cephalosporins . These data were compared with cefuroxime and third-generation cephalosporin consumption levels in Finnish hospitals . Although the use of cephalosporins is far more extensive in Finland than in other Scandinavian countries, none of the isolates produced extended-spectrum beta-lactamases . In conclusion, resistance to cefuroxime has remained rare in Finland, and cefuroxime is still an alternative to third-generation cephalosporins in the treatment of septicemia.

Gene, 1994 May 27, 143(1), 61 - 6
Alginate lyase from Klebsiella pneumoniae, subsp . aerogenes: gene cloning, sequence analysis and high-level production in Escherichia coli; Baron AJ et al.; The alyA gene, encoding a secreted guluronate-specific alginate lyase (Aly) from Klebsiella pneumoniae subsp . aerogenes type 25, has been cloned . DNA sequence analysis reveals two possible translation start sites for the precursor form of Aly and a long open reading frame (ORF) predicted to encode a 287-amino-acid (aa) mature form of Aly, in agreement with N-terminal aa sequence analysis of the protein . Aly has a calculated molecular mass of 31.4 kDa, in good agreement with SDS-PAGE analysis, and a calculated pI of 9.39 . Comparison of the deduced aa sequence with a mannuronate-specific lyase from a marine bacterium reveals 19.3% identity and 28.8% similarity with a 9-aa conserved region close to the C terminus, probably of functional or structural significance . There is no obvious sequence similarity with pectate lyases which also catalyse a beta-elimination reaction . Heterologous expression of K . pneumoniae alyA in Escherichia coli yields 10 mg of Aly per litre of culture supernatant, apparently due to non-specific release from the periplasm.

J Biol Chem, 1994 May 13, 269(19), 14003 - 6
Chaperonins as potential gene regulatory factors . In vitro interaction and solubilization of NifA, the nif transcriptional activator, with GroEL; Govezensky D et al.; A previous study (Govezensky, D., Greener, T., and Zamir, A . (1991) J . Bacteriol . 20, 6339-6346) indicated that the chaperonin GroEL was required for maximal expression from nif promoters in Klebsiella pneumoniae and nif-transformed Escherichia coli . That this requirement stemmed from the ability of GroEL to properly fold NifA, the nif transcriptional activator, was first supported by co-immunoprecipitation of NifA in K . pneumoniae extracts with anti-GroEL antibodies . In the present in vitro study, NifA, partially purified from E . coli overexpressing the protein, was diluted from a 6 M urea solution into a refolding buffer in the presence or absence of GroEL . Dilution in the absence of GroEL caused the complete precipitation of NifA . When present in the dilution buffer, GroEL bound NifA and maintained it in a soluble state . GroEL was also found to bind NifA newly synthesized in an in vitro translation system . For both NifA preparations, cochaperonin GroES and ATP promoted release of NifA from GroEL . These results provide evidence for the association of NifA with GroEL and for the role of both GroEL and GroES in the solubilization and thereby folding of the nif transcriptional activator.

Arthritis Rheum, 1994 May, 37(5), 754 - 9
Serum antibodies to Klebsiella capsular polysaccharides in ankylosing spondylitis; Sahly H et al.; OBJECTIVE . To measure antibodies to Klebsiella capsular polysaccharides in the sera of HLA-B27 positive patients with ankylosing spondylitis (AS), compared with HLA-B27 positive and HLA-B27 negative healthy control subjects . METHODS . Antibodies were detected by means of an enzyme-linked immunosorbent assay specific for each of the 77 known Klebsiella serotypes . RESULTS . Significantly elevated frequencies and titers of antibodies to capsular polysaccharides K26, K36, and K50 were detected in sera from AS patients, compared with controls . CONCLUSION . These results suggest the predominance of Klebsiella serotypes K26, K36, and K50 in patients with AS.

J Bacteriol, 1994 May, 176(9), 2551 - 9
The nasFEDCBA operon for nitrate and nitrite assimilation in Klebsiella pneumoniae M5al; Lin JT et al.; Klebsiella pneumoniae can use nitrate and nitrite as sole nitrogen sources through the nitrate assimilation pathway . We previously identified structural genes for assimilatory nitrate and nitrite reductases, nasA and nasB, respectively . We report here our further identification of four genes, nasFEDC, upstream of the nasBA genes . The nasFEDCBA genes probably form an operon . Mutational and complementation analyses indicated that both the nasC and nasA genes are required for nitrate assimilation . The predicted NASC protein is homologous to a variety of NADH-dependent oxidoreductases . Thus, the NASC protein probably mediates electron transfer from NADH to the NASA protein, which contains the active site for nitrate reduction . The deduced NASF, NASE, and NASD proteins are homologous to the NRTA, NRTB, and NRTD proteins, respectively, that are involved in nitrate uptake in Synechococcus sp . (T . Omata, X . Andriesse, and A . Hirano, Mol . Gen . Genet . 236:193-202, 1993) . Mutational and complementation studies indicated that the nasD gene is required for nitrate but not nitrite assimilation . By analogy with the Synechococcus nrt genes, we propose that the nasFED genes are involved in nitrate transport in K . pneumoniae.

Acta Otolaryngol, 1994 May, 114(3), 341 - 7
A critical look at the treatment of maxillary sinusitis with long-term draining tubes; Laurikainen E et al.; Long-term draining tubes (LTD) have become a common treatment in complicated and prolonged forms of maxillary sinus empyema . Since not all patients show good recovery with this treatment we used sinus-manometry, mathematical calculations, and scanning electron microscopy (SEM) to critically analyze 6 cases with a prolonged history of the disease . Five out of the 6 patients recovered quickly after removal of the LTDs, normally performed sinus punctures, and an appropriate antibacterial treatment . One patient underwent functional endoscopic sinus surgery . Two of the 6 patients had uncommon bacterial cultures (Pseudomonas mirabilis, Klebsiella oxytoga) in their sinus secreta . Two of the removed LTDs were examined with SEM . The porous polyethylene was shown to have absorbed bacterial plague which, besides narrowing the lumen, can cause recurrent infections . In 5 other patients, the draining pressure (DP) was 0.9 +/- 0.16(M +/- SD) kg/cm2, as measured during irrigation with a No . 2 Lichtwitz needle (1.8 mm, i.d) . Mathematical calculation using the Hagen-Boisseouille equation indicated that with our LTDs (0.7 mm, i.d.) the DP needs to be 40 times greater than the DP when using an ordinary Lichtwitz needle to get equal flushing capacity . We recommend i) LTD treatment of maxillary sinus empyema be closely followed up ii) that, in prolonged cases, the LTDs should be removed and the sinuses repeatedly irrigated with an ordinary needle or antrostomy, and iii) that a more suitable tubing material and insertion system (to allow a larger radius of the tube) be developed.

Antimicrob Agents Chemother, 1994 May, 38(5), 1157 - 60
Susceptibility testing of Dientamoeba fragilis ATCC 30948 with iodoquinol, paromomycin, tetracycline, and metronidazole; Chan FT et al.; Susceptibility testing was performed on Dientamoeba fragilis ATCC 30948 in a dixenic culture with Klebsiella pneumoniae and Bacteroides vulgatus . D . fragilis was cocultured with the bacteria in TYGM-9 medium (ATCC medium 1171) . The activities of antiparasitic drugs were assessed by counting viable D . fragilis trophozoites with a hemacytometer by trypan blue exclusion . The minimal amebicidal concentrations of the following four drugs were determined: iodoquinol at 128 micrograms/ml, paromomycin at 16 micrograms/ml, tetracycline (questionably) at 32 micrograms/ml, and metronidazole at 32 micrograms/ml.

Antimicrob Agents Chemother, 1994 May, 38(5), 1017 - 22
Influence of antimicrobial therapy on kinetics of tumor necrosis factor levels in experimental endocarditis caused by Klebsiella pneumoniae; Mohler J et al.; The kinetics of tumor necrosis factor (TNF) levels in serum during therapy with cell wall-active agents (ceftriaxone, imipenem) and gentamicin were investigated in rabbits with experimental endocarditis caused by an isogenic pair of Klebsiella pneumoniae strains: a TEM-3 beta-lactamase-producing strain (KpR) or its susceptible variant (KpS) . In vitro, KpR was resistant to ceftriaxone and was susceptible to gentamicin and imipenem, while KpS was susceptible to all three antibiotics . Serum TNF levels were determined in control rabbits hourly after bacterial inoculation and then daily; they were determined in treated animals hourly after the first antibiotic injection and then daily during a 4-day therapy with either imipenem (60 mg/kg of body weight four times daily), ceftriaxone (75 mg/kg once daily), or gentamicin (4 mg/kg once daily) alone or in combination with ceftriaxone . After a transient peak (10.2 +/- 3.1 ng/ml) at 90 min following bacterial challenge, serum TNF levels remained low and stable in control animals . The peak in the serum TNF levels occurred 4 h after the first antibiotic injection and with ceftriaxone was significantly higher (P < 0.05) against KpS (1.99 +/- 0.52 ng/ml) than against KpR (1.40 +/- 0.17 ng/ml) . Against the KpR strain, the levels observed with ceftriaxone were significantly higher (P < 0.05) than those obtained with the other therapeutic regimens (0.70 to 0.80 ng/ml) . On the day of sacrifice, effective regimens were associated with low TNF levels . We concluded that TNF production depends on (i) the antiobiotic's mechanism of action and the susceptibility of the strain at the early phase of therapy, without any effect of the rapidity of bacterial killing, and (ii) the final reduction of the bacterial count at a later stage of therapy.

Thorax, 1994 May, 49(5), 504 - 8
Imaging of pulmonary disease in scleroderma with J001X scintigraphy; Diot P et al.; BACKGROUND--J001X is an acylated poly-galactoside isolated from the membrane of Klebsiella and able to interact with macrophages, mainly in their activated state . The aim of the present study was to determine the ability of 99m-labelled technetium (99mTc)-J001X scintigraphy to image pulmonary disease, defined by high resolution computed tomographic scanning and pulmonary function tests, in patients suffering from scleroderma . METHODS--Patients were considered to have pulmonary disease when they had at least two positive signs on high resolution computed tomography, or a decrease in lung volume and single breath carbon monoxide transfer, or both, with no disease process other than scleroderma in their medical history . Positive J001X scintigraphic imaging was defined by symmetrical bilateral pulmonary fixation three and five hours after inhalation of 99mTc-J001X . J001X scintigraphic results were compared with disease activity as indicated by bronchoalveolar lavage (BAL) fluid lymphocytosis . RESULTS--Seventeen patients were studied, in 12 of whom J001X scintigraphy was positive . There was no correlation between BAL lymphocytosis and J001X scintigraphic findings, nor between BAL and pulmonary scleroderma . This was not surprising because of the high specificity of macrophage targeting by J001X . CONCLUSIONS--Follow up of a larger population over a longer period is needed to establish whether there is a prognostic value for positive J001X scintigraphic findings in scleroderma.

J Appl Bacteriol, 1994 May, 76(5), 424 - 30
Continuous culture studies on the synthesis of capsular polysaccharide by Klebsiella pneumoniae K1; Mengistu Y et al.; The synthesis of capsular polysaccharide by Klebsiella pneumoniae K1 was investigated in a minimal salts medium by continuous culture . The organism produced larger amounts of polysaccharide under nitrogen-limited conditions than under carbon-limited conditions . The synthesis of polysaccharide was dependent not only on the availability of excess carbon, but also on growth rate . The rate of polysaccharide synthesis was greatest at low dilutions, low temperature (30 degrees C) and at neutral pH . Prolonged growth in nitrogen-limited culture resulted in the development of non-mucoid variants, possibly due to a selective growth advantage over mucoid cells . The non-mucoid isolate was more susceptible to some bacteriophages, possibly due to the reduction nor absence of capsular polysaccharide.

Mikrobiologiia, 1994 May-Jun, 63(3), 489 - 94
{Mechanism of specific chromogenic reaction by Klebsiella spp . on nutrient medium with 5-aminosalicylic acid}; Sivolodskii EP et al.; The nature of the factor and the mechanism of color reaction with 5-aminosalicylic acid (5-ASA) inherent in bacteria of the genus Klebsiella were investigated . The color reaction was shown to proceed in two stages . During the first stage, occurring in aerobic and anaerobic conditions, the tested strains of Klebsiella decarboxylize 5-ASA yielding CO2 and p-aminophenol, which is a colorless product . During the next strictly aerobic stage which proceeds without participation of bacteria or their exoenzymes, p-aminophenol is oxidized by the air oxygen forming the dark-brown polymers . The color reaction shows high substrate specificity . It is suggested that the color reaction is realized by a previously unknown lyase-type enzyme 5-aminosalicylate decarboxylase (5-aminosalicylate-carboxy-lyase) localized inside the Klebsiella cells.

Int J Immunopharmacol, 1994 May-Jun, 16(5-6), 413 - 7
Binding to leukocytes and induction of TNF alpha production involve different sites within the lipid-A region of LPS-like molecules; Mey A et al.; The induction of TNF alpha synthesis in whole blood culture assay and isolated peripheral blood mononuclear cells was investigated, using LPS from Klebsiella pneumoniae and two water-soluble 34 kDa derivatives designed as acylpolygalactoside (APG) and EFA-APG, an APG molecule bearing two additional ester-linked fatty acids . Both APG and EFA-APG bind to monocytes by specific ligand receptor interaction but only EFA-APG could induce TNF alpha synthesis . It is concluded that ester-linked fatty acids are not involved in LPS binding to the cell surface, but play a critical role in the triggering of cellular responses.

Infection, 1994 May-Jun, 22(3), 210 - 2
Ventriculitis caused by Klebsiella pneumoniae successfully treated with pefloxacin in a neonate; Linder N et al.; Pefloxacin was applied to a newborn suffering from ventriculitis caused by Klebsiella pneumoniae after failure of routine antibiotics . Treatment was successful . Blood and CSF levels were high, thus documenting good CSF penetration . In addition to this case report, a review of the literature regarding seven neonates with CNS infection treated with fluoroquinolones and from whom CSF levels were obtained, is presented . In conclusion, due to their excellent activity against gram-negative microorganisms, fluoroquinolones may be considered in the treatment of neonatal CNS infections if the pathogen is resistant to routinely used antibiotics . Only limited experience is available with fluoroquinolones in pediatric patients given their potential for cartilage toxicity in young animals.

Pathol Biol (Paris), 1994 May, 42(5), 419 - 24
{Post-antibiotic effect of three aminoglycosides against Klebsiella pneumoniae}; de Montclos M et al.; This paper introduces a new method to quantify post antibiotic effect . This method was applied to the study of the effect of three aminoglycosides antibiotics on seven strains of Klebsiella pneumoniae . The antimicrobial was removed by filtration, washing with peptone broth and neutralization by heparin . Growth curves were monitored by automated measurement of optical density with Urimat-ATB (bioMerieux) . The inoculum fluctuation bias was eliminated with the help of a mathematical analysis of results . Absence of carry-over was controlled for each bacteria-antibiotic combination . A significant post antibiotic effect was observed with the three antibiotics after 2 hours exposure to a concentration equivalent to 2 x MIC . There was no significant difference between the 3 aminoglycosides tested.

Carbohydr Res, 1994 Apr 16, 257(1), 107 - 15
The structure of the capsular polysaccharide from Klebsiella K43; Edebrink P et al.; The structure of the capsular polysaccharide from Klebsiella type K43 has been investigated using sugar and methylation analysis, uronic acid degradation, and NMR spectroscopy on the native and the O-deacetylated polysaccharide . It is concluded that the polysaccharide is composed of pentasaccharide repeating units with the structure {formula: see text} The polysaccharide contains approximately 0.4 equiv of O-acetyl group per repeating unit, located at a primary position.

Proc Natl Acad Sci U S A, 1994 Apr 12, 91(8), 3233 - 7
In vitro activation of urease apoprotein and role of UreD as a chaperone required for nickel metallocenter assembly; Park IS et al.; The formation of active urease in Klebsiella aerogenes requires the presence of three structural genes for the apoprotein (ureA, ureB, and ureC), as well as four accessory genes (ureD, ureE, ureF, and ureG) that are involved in functional assembly of the metallocenter in this nickel-containing enzyme . Slow and partial activation of urease apoprotein was observed after addition of nickel ion to extracts of Escherichia coli cells bearing a plasmid containing the K . aerogenes urease gene cluster or derivatives of this plasmid with deletions in ureE, ureF, or ureG . In contrast, extracts of cells containing a ureD deletion derivative failed to generate active urease, thus highlighting a key role for UreD in the metallocenter assembly process . Site-directed mutagenesis methods were used to overexpress ureD in the presence of the other urease genes, and the UreD protein was found to copurify with urease . A molecule of native urease apoprotein is capable of binding 0, 1, 2, or 3 molecules of UreD, consistent with a trimeric structure of urease catalytic units . The UreD-urease apoprotein complexes are competent for activation by nickel, with the level of activity obtained being directly related to the number of UreD molecules bound per urease molecule . Activation of the UreD-urease complexes is rapid and accompanied by UreD dissociation . We propose that UreD is a chaperone protein which stabilizes a urease apoprotein conformation that is competent for nickel incorporation.

Biol Pharm Bull, 1994 Apr, 17(4), 543 - 5
Kinetic studies on a sulfotransferase from Klebsiella K-36, a rat intestinal bacterium; Kim DH et al.; Sulfotransferase purified from Klebsiella K-36, a rat intestinal bacterium, stoichiometrically catalyzed the transfer of a sulfate group of phenylsulfate esters to phenolic compounds . One of the reaction products, p-nitrophenol (PNP), non-competitively inhibited the enzyme as to p-nitrophenylsulfate (PNS), a donor substrate, but competitively inhibited the enzyme as to an acceptor substrate, alpha-naphthol . The other reaction product, alpha-naphthol-O-sulfate, non-competitively inhibited the enzyme with regard to both these substrates . These kinetic data suggest that the sulfotransferase reaction proceeds according to an ordered bi bi reaction mechanism . The natural phenolic substances, gallic acid, quercetin, tannic acid, and serotonin were good substrates of K-36 sulfotransferase.

East Afr Med J, 1994 Apr, 71(4), 271 - 2
An outbreak of intravenous cannulae associated nosocomial septicaemia due to multidrug-resistant Klebsiella pneumoniae; Murphy SA et al.; We present the clinical course of four children involved in an outbreak of intravenous cannulae associated nosocomial septicaemia due to multidrug-resistant Klebsiella pneumoniae . The patients involved, two of whom died became bacteraemic within a three week period, and evidence for an environmental source of the organism was obtained.

Mol Microbiol, 1994 Apr, 12(2), 287 - 99
Molecular characterization of PulE, a protein required for pullulanase secretion; Possot O et al.; pulE, one of 14 genes specifically required for pullulanase secretion in Klebsiella oxytoca, codes for a putative nucleotide-binding protein . Subcellular fractionation indicated that the majority of PulE in Escherichia coli cells expressing all 14 secretion genes is mainly associated with the cytoplasmic membrane through both hydrophobic and non-hydrophobic interactions . Mutational analysis revealed that one of the two regions of PulE that are conserved in many nucleotide-binding proteins (Walker box A) is essential for pullulanase secretion . Likewise, mutations that removed aspartate residues from each of two regions immediately downstream from the Walker box A also reduced secretion . These aspartate-rich regions are highly conserved in all 16 known PulE homologues but not in any other nucleotide-binding proteins . Altogether, these results indicate that PulE might belong to a new family of nucleotide-binding proteins . The protein could not be cross-linked to the photoactivatable ATP analogue azido-ATP, however . Most pulE point or deletion mutations which prevented pullulanase secretion exhibited transdominance when expressed at high levels in cells producing wild-type PulE protein . Evidence presented suggests that PulE might be a homodimer.

J Antimicrob Chemother, 1994 Apr, 33(4), 707 - 20
Convergent evolution of TEM-26, a beta-lactamase with extended-spectrum activity; Hibbert-Rogers LC et al.; TEM-26, an extended-spectrum beta-lactamase has been characterized in clinical isolates of Klebsiella pneumoniae and Escherichia coli derived from patients on the Paediatric Oncology Unit of St James's University Hospital, Leeds . The nucleotide sequence of this beta-lactamase gene (blaTEM26b) was determined, and compared with the nucleotide sequences of other TEM-type beta-lactamases . The blaTEM26b gene was found to differ from blaTEM12b by a single nucleotide . This difference causes the substitution of glutamic acid in blaTEM12b for lysine in blaTEM26b at position 102 in the predicted amino acid sequence . The blaTEM12b gene was first described in an isolate of Klebsiella oxytoca from a patient nursed on the same unit that yielded the strains that carry blaTEM26b . However, the blaTEM26b gene differs at no less than six nucleotides from the nucleotide sequence encoding the TEM-26 beta-lactamase that was first described in isolates from cancer patients nursed in the Children's Hospital, Stanford, California, USA . This indicates that the genes encoding TEM-26 have evolved from different progenitors.

Circ Shock, 1994 Apr, 42(4), 183 - 9
Formation of fibrin monomers in experimental disseminated intravascular coagulation and its inhibition by recombinant hirudin; Dickneite G et al.; An experimental disseminated intravascular coagulation (DIC) was induced in female CD rats by the intravenous administration of living bacteria (9.5 x 10(7) cfu Klebsiella pneumoniae), sublethal (5 mg/kg) or lethal (50 mg/kg) lipopolysaccharide (LPS), or tissue factor (1.5 micrograms/kg i.v . bolus or 0.4 micrograms/kg x hr i.v . infusion) . We used a new fibrin monomer (FM) assay to follow the course of DIC . FM were detected by their ability to stimulate the tissue-type (t-PA) plasminogen activator dependent conversion of plasminogen to plasmin by a chromogenic assay . Miniplasminogen was used instead of plasminogen to avoid interference of the assay by alpha 2-antiplasmin . As a marker of DIC, elevated levels of FM were observed with all DIC-inducing agents (plasma levels were up to 90 micrograms/ml) . The kinetics of FM formation were similar to the course of thrombin-antithrombin III (TAT) levels (maximal plasma levels 70 ng/ml); however, in the bacterial infection group, both parameters rose after a lag phase of about 1 hr . A 4 hr infusion of the highly specific thrombin inhibitor recombinant (rec.) hirudin (0.125 mg/kg x hr) resulted in a decrease of FM levels from 89.2 +/- 14.4 micrograms/ml in the LPS group (n = 10) to 27.4 +/- 11.2 micrograms/ml in the rec . hirudin group (n = 10; P < 0.001) . The respective values for TAT levels were 73.1 +/- 19.7 micrograms/ml in the LPS group and 52.7 +/- 15.7 ng/ml in the rec . hirudin group (P < 0.001) . Other coagulation parameters, such as platelets, fibrinogen, and fibrin(ogen) degradation products, were ameliorated accordingly.(ABSTRACT TRUNCATED AT 250 WORDS)

Antimicrob Agents Chemother, 1994 Apr, 38(4), 761 - 6
Multiply resistant Klebsiella pneumoniae strains from two Chicago hospitals: identification of the extended-spectrum TEM-12 and TEM-10 ceftazidime-hydrolyzing beta-lactamases in a single isolate; Bradford PA et al.; Ceftazidime-resistant Klebsiella pneumoniae strains began to appear when ceftazidime usage was increased in two unrelated Chicago hospitals . These strains produced a beta-lactamase with an isoelectric point of 5.6 (RP-5.6) and strong hydrolyzing activity against ceftazidime . Two different restriction digest profiles were associated with the ceftazidime resistance plasmids . A second beta-lactamase with a pI of 5.2 (RP-5.2) was coproduced in two representative strains . The second beta-lactamase hydrolyzed ceftazidime, cefotaxime, and aztreonam with relative hydrolysis rates of < 8% of that observed for benzylpenicillin . Both enzymes were inhibited by clavulanic acid and tazobactam . Nucleotide sequencing of the genes coding for RP-5.2 and RP-5.6 revealed sequences identical to those of the TEM-12 and TEM-10 beta-lactamase genes, respectively . Both genes were derived from a TEM-1 sequence related to that of the gene encoded on the Tn2 transposon . Single point mutations are required to progress from TEM-1 to TEM-12 and from TEM-12 to TEM-10 . Extracts from broths grown from single cell isolates of the strain producing TEM-12 and TEM-10 were shown to contain both enzymes . Transconjugants producing either the TEM-12 or the TEM-10 beta-lactamase were obtained . A significant finding was that both enzymes were encoded by plasmids with identical restriction digest patterns . These studies show that mutations leading to extended-spectrum beta-lactamases can occur sequentially in the same organism, with the genes encoding both enzymes maintained stably.

J Clin Microbiol, 1994 Apr, 32(4), 1121 - 2
Method for differentiating Klebsiella planticola and Klebsiella terrigena from other Klebsiella species; Monnet D et al.; Conventional methods usually fail to identify Klebsiella planticola and Klebsiella terrigena, which represent up to 19% of clinical Klebsiella isolates . By combining four carbon substrate assimilation tests and two conventional tests, the method identified these species with a specificity and a sensitivity of 100% . Overall, sensitivity for Klebsiella identification was 94.7%.

Int J Biol Macromol, 1994 Apr, 16(2), 65 - 70
Solution properties of the capsular polysaccharide produced by Klebsiella pneumoniae K40; Flaibani A et al.; This paper reports some physicochemical properties of the capsular polysaccharide produced by Klebsiella pneumoniae serotype K40 (K40-CPS) in aqueous solution . The polymer has a linear hexasaccharide repeating unit containing one glucuronic acid residue as the only ionizable group . Potentiometric, viscometric, chiro-optical and rheological measurements have been carried out over a range of ionic strength, pH and temperature, with the aim of characterizing the conformational state of the polysaccharide in aqueous solution . All the data reported indicate that the K40-CPS does not undergo a cooperative conformational transition under the investigated experimental conditions . Furthermore, the viscosity data and the viscoelastic spectra suggest that the K40-CPS is rather flexible and adopts a random coil conformation in solution.

J Rheumatol, 1994 Apr, 21(4), 670 - 4
Tolerance to the HLA-B27 and Klebsiella pneumoniae crossreactive epitope in mice transgenic for HLA-B2705 and human beta 2-microglobulin; Singh B et al.; OBJECTIVE . To determine whether immunization of HLA-B27 transgenic mice with a peptide containing the crossreactive QTDRED sequence found in B2705 and Klebsiella nitrogenase induces a detectable immune response . METHODS . Mice were immunized with a synthesized peptide corresponding to the 65-84 region of HLA-B2705 in Freund's complete adjuvant (FCA) . Mice were bled for antibody assays 10 days after the last injection . Popliteal lymph node cells for T cell proliferation assays were obtained 10 days after foot pad inoculation . RESULTS . The healthy control mice responded well to the peptide in both humoral and cellular assays . The transgenic mice carrying HLA-B2705 did not, although they did respond as expected to the FCA . CONCLUSION . Our data suggest that the homologous epitopes present in HLA-B2705 and Klebsiella do not induce a crossreactive immune response in animals naturally tolerant to the HLA antigen.

Infect Immun, 1994 Apr, 62(4), 1282 - 8
A murine monoclonal antibody defines a unique epitope shared by Klebsiella lipopolysaccharides; Trautmann M et al.; A hybridoma secreting a monoclonal antibody (MAb) directed against Klebsiella lipopolysaccharide (LPS) was derived from spleen cells of mice immunized a smooth, nonencapsulated Klebsiella strain (Friedlander 201; serogroup O1) . The MAb, called V/9-5 (immunoglobulin G2a), cross-reacted with LPS preparations produced from reference strains for the Klebsiella O serogroups O1, O2ab, O2ac, O3, O4, O5, and O12 . Furthermore, the MAb reacted with LPSs from serogroup reference strains O6/O8, O9, and O11, which are regarded as being identical to O1, O2, and O4, respectively . When testing the supernatant of clinically isolated Klebsiella strains by means of an inhibition enzyme-linked immunosorbent assay, we found that 86 (92.4%) of 93 Klebsiella pneumoniae subsp . pneumoniae isolates and 24 (96.0%) of 25 K . oxytoca isolates harbored the cross-reactive epitope . By contrast, two laboratory strains of K . pneumoniae subsp . rhinoscleromatis did not react with MAb V/9-5 . The MAb proved to be specific for the genus Klebsiella, since it did not react with any of a total of 73 strains belonging to other gram-negative bacterial genera . In conjunction with other LPS-specific MAbs, MAb V/9-5 might become a useful reagent for rapid identification of klebsiellae in clinical specimens . Furthermore, the epitope recognized by MAb V/9-5 might serve as a target epitope for the production of human MAbs for immunotherapeutic purposes.

Infect Control Hosp Epidemiol, 1994 Mar, 15(3), 163 - 70
Factors affecting mortality outcome and risk of developing nosocomial bloodstream infection; Jamulitrat S et al.; OBJECTIVES: To identify factors associated with developing nosocomial bloodstream infection (NBI) and to identify factors associated with fatal outcome of NBI . DESIGN: Prospective matched and unmatched case-control studies . SETTING: Songklanagarind Hospital, a 640-bed medical school and referral center in Songkla, Thailand . PATIENTS: During a two-year study period, 277 patients of 17,829 total admissions in the hospital services of medicine, surgery, pediatrics, and orthopedics acquired bloodstream infections during hospitalization . For the purpose of identifying factors associated with mortality attributed to NBI, patients who died from NBI were assigned as cases; patients who survived the infections were assigned as controls . For the purpose of identifying risk factors for acquisition of NBI, patients with NBI were considered as cases; patients with the same primary diagnosis as a case but without NBI were eligible to be case-matched controls . RESULTS: Case fatality rate was 37.2% based on deaths attributed specifically to bloodstream infection . Patients who died from NBI, compared with those who survived such infections, were associated with inappropriate antibiotic treatment, infection caused by Klebsiella pneumoniae, and the medicine service . When comparison was made between 239 patients with bloodstream infections and 598 diagnosis-matched controls with no bloodstream infection, infection was found to be associated with old age, number of comorbidities, number of prior infections, neutropenia, duration of immunosuppressive drugs, and duration of indwelling intravenous catheter . CONCLUSION: Awareness of the factors pre-disposing to NBI may permit better surveillance and better care . Although most of the factors associated with development of NBI or death from NBI are not subject to control, some factors are duration of immunosuppressive drugs, duration of indwelling intravenous lines, and choice of antibiotic treatment.

J Clin Microbiol, 1994 Mar, 32(3), 691 - 6
Detection of Klebsiella pneumoniae and Escherichia coli strains producing extended-spectrum beta-lactamases; Katsanis GP et al.; Plasmids encoding extended-spectrum beta-lactamases of the TEM, SHV, and AmpC families were introduced into common Escherichia coli and Klebsiella pneumoniae hosts to create a homogeneous panel for evaluating the abilities of five test systems to detect resistance to eight beta-lactam antibiotics . Although MICs, as determined by agar dilution or E test strips, were increased and disk diffusion zone diameters were diminished, breakpoints for resistance were often not reached, and neither approach was sensitive in detecting resistance to oxyimino-beta-lactams . The MicroScan 18-h microdilution or Vitek rapid automated procedures were similarly insensitive . Ceftazidime was the best single test antibiotic for detecting extended-spectrum beta-lactamase production . beta-Lactamases TEM-7 and TEM-12 were particularly difficult to detect . Because of such difficulties, the prevalence of extended-spectrum beta-lactamases is likely to be greater than is currently appreciated.

Eur J Biochem, 1994 Mar 1, 220(2), 469 - 75
Transport of citrate catalyzed by the sodium-dependent citrate carrier of Klebsiella pneumoniae is obligatorily coupled to the transport of two sodium ions; Lolkema JS et al.; Aerobically grown Escherichia coli GM48 harboring plasmid pKScitS that codes for the sodium-dependent citrate carrier from Klebsiella pneumoniae (CitS) allows initial-rate measurements of citrate uptake in whole cells . The cation stoichiometry and selectivity of CitS was studied using this experimental system . The relationship between the initial rate of uptake of citrate and the Na+ concentration was sigmoidal at pH values between 5 and 7 suggesting a Na+ stoichiometry higher than 1 . Rates of uptake increased quadratically in a range of non-saturating Na+ concentrations showing that two Na+ are translocated/catalytic cycle . Symport of Na+ is absolutely required in the range pH 5-7 because no uptake could be detected in the absence of Na+ . Protons cannot replace Na+ in the translocation step but the decrease in apparent affinity for Na+ towards lower pH suggests that protons can compete with Na+ for the cation-binding sites . Li+ can replace Na+ in the symport reaction but it takes about a 200-fold higher concentration of Li+ over Na+ to achieve the same rate of uptake, showing that the affinity of CitS for Li+ is much lower than for Na+ . Though high Li+ concentrations have an inhibitory effect on citrate uptake, the data suggest that the Li+ stoichiometry is also 2.

J Biochem (Tokyo), 1994 Mar, 115(3), 409 - 14
Nucleotide sequence and expression in Escherichia coli of the Klebsiella pneumoniae deaD gene; Peng HL et al.; The deaD gene of Klebsiella pneumoniae was isolated and its nucleotide sequence determined . The K . pneumoniae gene is highly homologous with the Escherichia coli analog throughout most of the coding region . The deduced primary sequence of the K . pneumoniae deaD gene product is 659 amino acids in length, in contrast with the 571 amino acids of the E . coli deaD product published previously . Sequence comparison revealed several differences near the 3' end of the deaD genes which result in the frame-shift effect . The 3' end sequence of the E . coli deaD gene was therefore analyzed to verify the discrepancy . Our result indicates that the E . coli deaD gene encodes a product of comparable size to the K . pneumoniae DeaD protein, and the carboxyl terminal sequences of the two proteins are highly homologous . In vivo expression of the K . pneumoniae deaD gene in E . coli yielded a 65-kDa protein . Primer extension analysis of the mRNA from K . pneumoniae identified a major transcription start site at an A residue 44 nt upstream of the first in-frame ATG codon.

Mol Immunol, 1994 Mar, 31(4), 269 - 77
Sequence analysis and fine specificity of two human monoclonal antibodies to histone H1; Tuaillon N et al.; Two human IgM lambda monoclonal antibodies (MAb) derived from the splenic lymphocytes of patients with idiopathic thrombocytopenia (Ben) and systemic lupus erythematosus (Wri) were studied . BEN-27 and WRI-170 hybridoma supernatants were screened for binding to ssDNA, dsDNA, poly (ADP-ribose), cardiolipin, histone subclasses and Klebsiella K30 cell wall antigen . Of this panel of antigens, BEN-27 and WRI-170 antibodies reacted only with histone H1 . Their fine specificity was defined by direct and inhibition ELISA with synthetic peptides of the major human H1b variant . Antibody WRI-170 was shown to bind to both the N- and C-terminal peptides encompassing residues 1-16 and 204-218 of H1b whereas BEN-27 reacted only with peptide 204-218 . To analyse the genetic origin of these autoantibodies, we determined the nucleotide sequence of the heavy (H) and light (L) chain variable regions of these two hybridomas . BEN-27 and WRI-170 MAbs were found to use VH1-DN1-JH4/V lambda 3-J lambda 2 and VH3-DIR2-D21/9-JH1/V lambda 2-J lambda 2 gene segment combinations respectively . Between 70 and 95% homology was demonstrated when the mRNA sequences for BEN-27 and WRI-170 were compared with published VH and V lambda germline sequences . This finding suggests that BEN-27 heavy and light chains and WRI-170 light chain use unidentified VH and V lambda germline gene segments whereas WRI-170 heavy chain derives from a VH gene segment recently identified . It is noteworthy that the CDRs of the two MAbs contain several negatively charged amino acids which are assumed to be of critical importance in antigen binding . Moreover, striking similarities are observed between BEN-27 heavy chain CDR2 and a previously described murine anti-H1 Ab heavy chain CDR2.

Biochem Biophys Res Commun, 1994 Feb 15, 198(3), 928 - 32
Evidence for a nicotinamide nucleotide transhydrogenase in Klebsiella pneumoniae; Fristedt U et al.; Bacterial membranes from Klebsiella pneumoniae were investigated for the presence of a nicotinamide nucleotide transhydrogenase activity . Inverted membrane vesicles derived from these cells catalyzed a reduction of NAD+ or 3-acetylpyridine-NAD+ by NADPH, which showed a maximal activity of about 260 nmoles/minute per milligram protein at pH 7-8 . In the presence of a protonic uncoupler the specific activity was stimulated about two-fold in this pH range . The presence of detergents did not further increase the specific activity of enzyme . The Klebsiella pneumoniae transhydrogenase activity was sensitive to phenylarsine oxide and palmityl-Coenzyme A, both of which are agents known to inhibit the mammalian enzyme . The Ki-value for palmityl-Coenzyme A with respect to NADPH was about 1.25 microM . Antibodies raised against beef heart transhydrogenase crossreacted with a 54 kD protein in the Klebsiella pneumonia membrane.

Biochem Biophys Res Commun, 1994 Feb 15, 198(3), 1128 - 34
On the specificity of a bacteriophage-borne endoglycanase for the native capsular polysaccharide produced by Klebsiella pneumoniae SK1 and its derived polymers; Cescutti P et al.; The specificity of the endoglycanase associated with the bacteriophage phi SK1 particles was tested on the native capsular polysaccharide produced by Klebsiella pneumoniae serotype SK1 and on three chemically modified polymers derived from it . The primary structure of the SK1 capsular polysaccharide is: {formula: see text} and the beta 1-3 linkage between the glucose and the galactose residues is the one cleaved by the phage enzyme . The enzyme activity was assayed on the deacetylated polysaccharide and on two derivatives obtained by removal of both the side-chain sugars and of only the alpha-D-galactosyl unit, respectively . The endoglycanase was more active on the deacetylated polysaccharide than on the native one, suggesting that the presence of the acetyl groups interferes with the enzyme-polysaccharide interaction . A possible role of the acetyl groups in the control of the polysaccharide chain length and hence on the rheological behaviour of the capsule cannot be ruled out, as already indicated for other bacterial polysaccharides . On the contrary, the removal of the side chains, either complete or selective, caused the modification of the recognition site in such a way that the enzymatic depolymerization no longer occurred . Therefore, it can be inferred that the phi SK1 endoglycanase requires the presence of both the side chain sugars to exhibit its cleaving activity, although this latter is in the main chain.

Antimicrob Agents Chemother, 1994 Feb, 38(2), 392 - 5
Identification of TEM-26 beta-lactamase responsible for a major outbreak of ceftazidime-resistant Klebsiella pneumoniae; Urban C et al.; An epidemic of nosocomial ceftazidime-resistant Klebsiella pneumoniae was correlated with production of a ceftazidime-hydrolyzing enzyme with an isoelectric point of 5.6 (BMH-1) . BMH-1 was encoded on a large transferable plasmid conferring multiple antibiotic resistance . The gene that encodes BMH-1 was identical to the gene that encodes the TEM-26 extended-spectrum beta-lactamase.

Antimicrob Agents Chemother, 1994 Feb, 38(2), 195 - 9
Different ratios of the piperacillin-tazobactam combination for treatment of experimental meningitis due to Klebsiella pneumoniae producing the TEM-3 extended-spectrum beta-lactamase; Leleu G et al.; We evaluated the pharmacokinetics and therapeutic efficacies of piperacillin and tazobactam, a beta-lactamase inhibitor, given either alone or in different combinations (80:10, 200:10, and 80:25 mg/kg/h), in experimental meningitis due to a strain of Klebsiella pneumoniae producing the TEM-3 extended-spectrum beta-lactamase . Treatment was administered intravenously as a 7-h constant infusion preceded by a bolus of 20% of the total dose . The mean (+/- standard deviation) rates of penetration into the cerebrospinal fluid (CSF) of infected animals were 6.7 +/- 3.9% for piperacillin given alone and 36.3 +/- 21.9% for tazobactam given alone . Combination treatment significantly magnified the concentration of either drug in CSF . Concentrations of bacteria in CSF increased throughout therapy in animals given either drug alone, even at high dosages . In animals given the combination at dosages of 80:10 and 200/10 mg/kg/h, only a suboptimal reduction of CSF bacterial titers was obtained in vivo, i.e . -0.49 +/- 0.34 and -0.73 +/- 0.49 log CFU/ml/h, respectively . An increase in the tazobactam dosage within the combination (80:25 mg/kg/h) was required in order to obtain a significantly faster elimination of viable organisms from the CSF (-0.97 +/- 0.35 log CFU/ml/h) . The study shows that tazobactam is able to provide effective protection against piperacillin hydrolysis by the TEM-3 enzyme within the CSF . Appropriate dosage regimens of various beta-lactam-tazobactam combinations may deserve comparative studies in experimental meningitis caused by organisms producing extended-spectrum beta-lactamases.

Graefes Arch Clin Exp Ophthalmol, 1994 Feb, 232(2), 127 - 31
Murine experimental autoimmune uveoretinitis induced by interphotoreceptor retinoid-binding protein and Klebsiella pneumoniae 03 lipopolysaccharide (K03-LPS): a relation between H-2 haplotype and EAU induction; Ando K et al.; The pathogenicity of interphotoreceptor retinoid-binding protein (IRBP) in the mouse and H-2 restriction of IRBP-induced experimental autoimmune uveoretinitis (EAU) was tested by repeated immunization using Klebsiella pneumoniae 03 lipopolysaccharide (K03-LPS) as an adjuvant . It was shown that IRBP had a greater capacity to induce EAU than S-antigen . Based on the incidence of EAU induction using B10 congenic mice and other strains, the susceptibility to EAU was, at least in part, controlled by the I-Ak haplotype of the H-2 subregion . The results also indicated that non-major histocompatibility complex (MHC) genes play some role in disease susceptibility.

J Clin Microbiol, 1994 Feb, 32(2), 301 - 5
Epidemiological study by pulsed-field gel electrophoresis of an outbreak of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae in a geriatric hospital; Gouby A et al.; Twelve cases of infections caused by extended-spectrum beta-lactamase (ESBla)-producing Klebsiella pneumoniae were reported between August 1991 and March 1993 in the Geriatric Department of the Nimes University Hospital, where these bacterial had not been previously isolated . Restriction profiles of total genomic DNAs cleaved by XbaI and SpeI were compared by pulsed-field gel electrophoresis . The strains that were tested included the 12 isolates from K . pneumoniae-infected patients, strains recovered from rectal swabs of asymptomatic patients in the same ward, and strains isolated in other hospitals in Nimes at the same time . The restriction profiles of the 12 isolates and those recovered from asymptomatic patients in the same ward were very similar . Over a period of more than 1 year, extended-spectrum beta-lactamases were not detected in K . pneumoniae isolates with restriction patterns different from that of the epidemic strain . It seems, therefore, that there was no transfer of a plasmid or a gene coding for ESBla to strains of K . pneumoniae that were different from the epidemic strain . At the same time, ESBla-producing K . pneumoniae isolates exhibiting restriction endonuclease profiles very different from that of the epidemic strain were isolated from other hospitals in Nimes . None of these strains caused an outbreak . Pulsed-field gel electrophoresis, which allows precise characterization of strains beyond the species level, is a useful tool for studying the ESBla-producing K . pneumoniae strains involved in nosocomial outbreaks.

FEMS Microbiol Lett, 1994 Feb 1, 116(1), 31 - 6
Klebsiella oxytoca: resistance to aztreonam by overproduction of the chromosomally encoded beta-lactamase; Fournier B et al.; Aztreonam-resistant Klebsiella oxytoca strain SL7811 was selected on agar containing 1 microgram of aztreonam per ml from a susceptible strain SL781 . The MICs for the resistant mutant towards penicillins, aztreonam and ceftriaxone were much higher, to cefotaxime slightly higher and to ceftazidime unchanged . Synthesis of beta-lactamase was 223-fold greater in the mutant compared with the susceptible strain . SL781 and its resistant mutant SL7811 produced beta-lactamase with the same isoelectric point and substrate profile . The beta-lactamase genes from SL781 and SL7811 were cloned in plasmid pBGS18 giving pBOF-1 and pBOF-4 respectively . The sequences of the two putative promoters indicated two modifications in the resistant plasmid pBOF-4: a transversion (G-->T) in the first base of the -10 consensus sequence and a deletion of one C residue four base pairs upstream of the -10 hexamer.

J Mol Biol, 1994 Jan 21, 235(3), 1159 - 61
Crystallization of a DNA and N-acetylserine binding fragment (residues 1 to 233) of Klebsiella aerogenes CysB protein, a member of the LysR family; Tyrrell R et al.; CysB protein is a positive regulator of transcription of genes involved in cysteine biosynthesis in bacteria and a member of the LysR family of DNA binding proteins . A 233-residue N-terminal chymotryptic fragment of the protein, with DNA and N-acetylserine binding activity, has been crystallized in the presence of monomethyl-polyethylene glycol 750 . The crystals diffract to 2.5 A (1 A = 0.1 nm) spacing on a rotating copper anode X-ray source and to 2.1 A spacing using synchrotron radiation and are suitable for structural studies . The space group is P2(1)2(1)2 with unit cell dimensions of a = 68.8 A, b = 109.9 A and c = 33.5 A . On the assumption that the asymmetric unit comprises one monomer, the crystals have a solvent content of approximately 50%.

Biochem J, 1994 Jan 15, 297 ( Pt 2), 373 - 8
Electron-paramagnetic-resonance and magnetic-circular-dichroism studies of the binding of cyanide and thiols to the thiols to the iron-molybdenum cofactor from Klebsiella pneumoniae nitrogenase; Richards AJ et al.; FeMoco, a low-M(r) metal cluster of probable composition Fe7MoS9 complexed with homocitrate, has been extracted with N-methylformamide from the MoFe protein of the nitrogenase enzyme from Klebsiella pneumoniae . The binding of cyanide and thiols to the FeMoco cluster in its paramagnetic S = 3/2 oxidation level has been studied by low-temperature e.p.r . and magnetic-circular-dichroism (m.c.d.) spectroscopies . Cyanide binds to isolated FeMoco at more than one site, and causes changes in the g values form g = 4.6, 3.2, 2.0 to g = 4.29, 3.82, 2.02 E.p.r . competition studies indicate that one cyanide can be displaced by thiolate from one type of site . The form of the low-temperature m.c.d . spectrum is little changed by ligand binding, thus the basic cluster structure remains intact . However, when benzenethiol is bound, a new intense band (lambda 387 nm) is observed, indicating the generation of an increased ligand-to-cluster charge-transfer interaction.

Biochem J, 1994 Jan 15, 297 ( Pt 2), 261 - 4
Nitrogenase of Klebsiella pneumoniae: electron nuclear double resonance (ENDOR) studies on the substrate reduction site; Howes BD et al.; Proton electron nuclear double resonance (ENDOR) spectra from the iron-molybdenum cofactor (FeMoco) of Klebsiella pneumoniae nitrogenase bound to the enzyme show that a wide variety of substrates and inhibitors, including dinitrogen, acetylene and cyanide, do not bind at or close to FeMoco in the dithionite-reduced state of the free MoFe protein, in agreement with our previous kinetic studies . Therefore models for substrate binding to FeMoco must consider structures at a more reduced level than that described by Kim and Rees {(1992) Science 257, 1677-1682} . After the enzyme has turned over in the presence of 2H2O, an additional set of protons are potentially available for exchange, namely those that can give rise to dihydrogen during enzyme turnover or generate the hydridic dinitrogen binding site; such exchangeable protons were not observed . They cannot therefore be proposed in order to explain the unusual geometry of the 'trigonal iron atoms' observed in the structure of FeMoco.

J Biol Chem, 1994 Jan 14, 269(2), 1063 - 7
Replacement of alanine 58 by asparagine enables the melibiose carrier of Klebsiella pneumoniae to couple sugar transport to Na+; Hama H et al.; The melibiose carrier of Klebsiella pneumoniae couples sugar transport to H+ and Li+, while that of Escherichia coli uses Na+ besides the other two cation species (Hama and Wilson, 1992) . We have shown that the K . pneumoniae melibiose carrier is capable of recognizing Na+ when the amino-terminal 81 residues are replaced by the corresponding region of the E . coli melibiose carrier (Hama and Wilson, 1993) . In this amino-terminal region there are 5 residues that are not conserved between the two carriers . In this study, we changed each of the 5 residues of the K . pneumoniae carrier to the one in the E . coli carrier . The substitutions are Ile-36-->Val, Val-43-->Leu, Leu-54-->Trp, Ala-58-->Asn, and Cys-68-->Ala . With four of the five mutants, Ile-36-->Val, Val-43-->Leu, Leu-54-->Trp, and Cys-68-->Ala, sugar accumulation was not affected by Na+ . In striking contrast, melibiose and methyl-1-thio-beta-D-galactopyranoside accumulation was greatly stimulated by Na+ with the Ala-58-->Asn mutant . Furthermore, Na+ uptake coupled to downhill melibiose transport was observed with the Ala-58-->Asn mutant . These results indicate that the Ala-58-->Asn substitution enables the K . pneumoniae melibiose carrier to couple sugar transport to Na+ . It is clear that the Asn-58 residue (Asn-54 in the E . coli carrier) is involved in Na+ recognition.

Proc Natl Acad Sci U S A, 1994 Jan 4, 91(1), 103 - 7
The isolated catalytic domain of NIFA, a bacterial enhancer-binding protein, activates transcription in vitro: activation is inhibited by NIFL; Berger DK et al.; The NIFA protein of Klebsiella pneumoniae is required for transcription of all nif (nitrogen fixation) operons except the regulatory nifLA operon itself . NIFA activates transcription of nif operons by the alternative holoenzyme form of RNA polymerase, sigma 54-holoenzyme, in a nucleoside triphosphate (NTP)-dependent manner . NIFL antagonizes the action of NIFA in the presence of molecular oxygen or combined nitrogen . The NIFA protein of K . pneumoniae is composed of three domains: an N-terminal domain with unclear function, a central catalytic domain, and a C-terminal DNA-binding domain . We report that the isolated central domain of NIFA activates transcription in vitro and that this activation requires NTP with a hydrolyzable beta-gamma bond, as does activation by intact NIFA . Transcriptional activation by the isolated central domain has the heat lability characteristic of intact NIFA and is inhibited by NIFL . The central domain has an NTPase activity that is also heat-labile but is not inhibited by NIFL . Taken together, these results imply that NIFL interferes with contact between NIFA and sigma 54-holoenzyme.

South Med J, 1994 Jan, 87(1), 77 - 80
Dome-shaped lesion on chest radiograph: retroperitoneal abscess dissecting through the posterior chest wall; Poulos J et al.; A 50-year-old man with an 8 x 4 cm mass on the posterior chest was found to have a large retroperitoneal abscess due to Klebsiella pneumoniae . The abscess dissected through the right lower lobe of the lung and the posterior chest wall to produce a subcutaneous mass . The source of the posterior chest wall mass appeared to be a perinephric abscess . A dome-shaped lesion above the right hemidiaphragm on chest radiograph resolved immediately with surgical drainage, suggesting that an abscess should be a prime consideration when one observes such a lesion on a chest film.

Dig Dis Sci, 1994 Jan, 39(1), 157 - 60
Translocation of bacteria due to direct mucosal damage caused by Gastrografin . An experimental study in newborn rats; Feigenberg Z et al.; A study was carried out on 40 newborn rats to determine the effect of Gastrografin (a hyperosmolar solution, 1700 mosm/liter) on the gastrointestinal tract . All the newborns received an inoculum of Klebsiella bacteria to the gastrointestinal tract . Thirty received, in addition to maternal milk, a feeding of Gastrografin twice daily . The Gastrografin was found to cause severe and irreversible damage to the mucosa of the small intestine, causing the death of 24 rats less than a week after start of the experiment . The 10 rats who received no Gastrografin and served as controls showed no signs of disease or damage to the intestinal tract . Cultures taken from the peritoneal cavity after sacrifice were all positive for Klebsiella in the Gastrografin group (30 rats) and negative in the controls (10 rats) . This study has therefore demonstrated that severe damage to the small intestine mucosa will lower the intestinal barrier and lead to transmural translocation of bacteria into the peritoneal cavity.

Infect Immun, 1994 Jan, 62(1), 172 - 7
Enterotoxic activity of Klebsiella oxytoca cytotoxin in rabbit intestinal loops; Minami J et al.; We examined the enterotoxicity of a Klebsiella oxytoca cytotoxin which is produced by K . oxytoca OK-1, a strain from a patient with antibiotic-associated hemorrhagic colitis . Injection of the cytotoxin into ligated ileal and colonic loops in rabbits caused the accumulation of fluid in the loops . The fluid was bloody in the ileal loops but not in the colonic ones . Histological examination revealed intense mucosal hemorrhage with erosion in the ileum, whereas no microscopic change was noted in the colon . The fluid accumulation was shown to be a dose-dependent response in both ileal and colonic loops . The amounts of the cytotoxin required for maximal fluid accumulation in ileal and colonic loops were 60 and 10 micrograms, respectively . Fluid accumulation was first noticeable in ileal loops 12 h and in colonic ones 5 h after the injection of these doses of the cytotoxin and then proceeded with time . When K . oxytoca OK-1, a cytotoxin-producing strain, was inoculated into the loops at doses of 1 x 10(8) and 5 x 10(9) CFU, similar fluid accumulation was observed . However, inoculation of K . oxytoca ATCC 13182, a non-cytotoxin-producing strain, at the same doses did not cause any change . These results suggest that the cytotoxin-producing strain of K . oxytoca is the causative organism of antibiotic-associated hemorrhagic colitis and that the toxin is the factor responsible for pathogenesis.

Scand J Infect Dis, 1994, 26(1), 95 - 102
Klebsiella pneumoniae meningitis: prognostic factors; Tang LM et al.; All 42 cases of Klebsiella pneumoniae meningitis diagnosed between 1981 and 1991 were evaluated . These accounted for 13% of patients with blood and/or cerebrospinal fluid culture-proven bacterial meningitis . There was an increased incidence of K . pneumoniae meningitis from the first 6 years of study (7%) to the last 5 years (16%) . K . pneumoniae became increasingly important not only in community-acquired meningitis but also in nosocomial meningitis . 12/13 nosocomial cases were patients who had undergone neurosurgical procedures . The overall mortality rate was 43% . The mortality rate in patients with spontaneous meningitis was higher than that in patients with post-traumatic or postoperative meningitis . Factors that adversely affected mortality were age over 60, diabetes mellitus, and severe neurological deficits on admission . The use of third-generation cephalosporins did not reduce the mortality rate.

Infection, 1994 Jan-Feb, 22(1), 58 - 61
Klebsiella ozaenae meningitis: report of two cases and review of the literature; Tang LM et al.; Meningitis is rarely caused by Klebsiella ozaenae, a colonizer of the oral and nasopharyngeal mucosa . We describe two patients with K . ozaenae meningitis . Both patients suffered from a primary disease of the nasopharyngeal pathway; one had nasopharyngeal carcinoma and the other ozena . Review of the English-language literature from 1966 to the present revealed only two cases of K . ozaenae meningitis; pneumonia and hyperglycemia were noted in one patient and otitis media, sinusitis and diabetes mellitus in the other . All these four patients were over 50 years old . Of the four patients, two treated with third-generation cephalosporins recovered whereas one of the two treated with chloramphenicol died . One patient who died had a positive blood culture for K . ozaenae . Blood culture was positive in only one of the three survivors . Whether chloramphenicol should be replaced by a third-generation cephalosporin and whether blood culture indicates a poor prognosis in K . ozaenae meningitis remain to be determined.

Int J Fertil Menopausal Stud, 1994 Jan-Feb, 39(1), 39 - 44
Laparoscopically assisted myomectomy: a report of a new technique in 57 cases; Nezhat C et al.; OBJECTIVE--This study was undertaken to assess the efficacy of a combined operative laparoscopy and minilaparotomy technique to remove single and multiple large leiomyomas . PROCEDURE--Laparoscopy was used to treat associated pelvic pathology, to identify the leiomyoma(s) and bring it to a minilaparotomy incision and to remove by irrigation blood clots and debris at the end of the procedure . Through this incision, the leiomyoma(s) is grasped, shelled, morcellated, and the uterine defect is repaired in layers . RESULTS--We retrospectively evaluated the records of 57 women who underwent this procedure . The uteri ranged from 8 to 26 weeks' gestational size . The weight of the leiomyomas ranged from 28 g to 998 g (mean, 247 g); operative time ranged from 40 to 285 minutes (mean 127 minutes) and blood loss from 50 mL to 1,600 mL (mean, 267 mL) . All procedures were completed without full laparotomy . Complications included one case of Klebsiella pneumonia requiring several days of antibiotics, and an incisional hernia at the minilaparotomy site . Forty-one patients were discharged on or before the first postoperative day, 12 on day 2, and four after 72 hours . Most women resumed normal activity within 3 weeks . CONCLUSION--We found laparoscopically assisted myomectomy to be a safe alternative to myomectomy by laparotomy . It is technically less difficult than laparoscopic myomectomy, allows better closure of the uterine defect, and may require less time to perform.

Zentralbl Bakteriol, 1994 Jan, 280(3), 312 - 8
Use of small fragment restriction endonuclease analysis (SF-REA) for epidemiological fingerprinting of Klebsiella oxytoca; Haertl R et al.; A group of infections caused by Klebsiella oxytoca was observed among preterm neonates in a neonatal intensive care unit (NICU) of a pediatric hospital in Osnabruck, Germany . The presence of unique antimicrobial susceptibility patterns among the bacterial isolates prompted an investigation to determine whether a limited spread of one single strain existed . All 4 K . oxytoca isolates from the NICU and, in addition, 50 epidemiologically non-related strains were fingerprinted by small fragment restriction endonuclease analysis (SF-REA) . From an analysis of silver-strained EcoR I-generated restriction fragment patterns of whole-cell DNA in polyacrylamide gels, it was evident that the 4 NICU isolates were closely related, whereas all epidemiologically unrelated strains exhibited different patterns . From the results of this study, DNA fingerprinting by SF-REA is proposed as a useful tool for investigating the epidemiological relatedness of K . oxytoca strains of clinical and environmental origin.

FEMS Immunol Med Microbiol, 1994 Jan, 8(1), 69 - 75
Protective effects of orally administered, Klebsiella-containing bacterial lysates in mice; Kuenen JD et al.; The efficacy, as oral vaccines, of hepta- and mono-valent, Klebsiella-containing bacterial lysates and a number of control preparations was tested in mice . The preparations were administered during two periods of four days each, interrupted by an interval of 3 days . Fourteen days after the first dose, the animals were challenged either intraperitoneally (i.p.; peritonitis/sepsis model) or intranasally (i.n.; pneumonia model) . Animals treated with low doses of Klebsiella lysate, in the form of either a 7-valent lysate or a Klebsiella monolysate, showed enhanced survival in both the peritonitis/sepsis and the pneumonia models . Hexa- and tetra-valent preparations without Klebsiella were not protective in the models tested . Furthermore, it was found that the protection is accompanied by priming for Klebsiella-specific IgG responsiveness (probably at the T cell level) and by significant IgA anti-Klebsiella serum antibody levels in about one third of the animals . The oral efficacy of Klebsiella-containing lysates suggests the presence of an adjacent component that directs Klebsiella antigen(s) to follow a selective intestinal pathway which renders them immunogenic . The identity of this component is under investigation.

Antimicrob Agents Chemother, 1994 Jan, 38(1), 147 - 50
Treatment of Klebsiella pneumoniae septicemia in normal and leukopenic mice by liposome-encapsulated muramyl tripeptide phosphatidylethanolamide; Melissen PM et al.; The effect of free muramyl tripeptide phosphatidylethanolamide (MTPPE) and liposome-encapsulated MTPPE (LE-MTPPE) on Klebsiella pneumoniae septicemia resulting from intraperitoneal bacterial inoculation was investigated in mice . When administering a single prophylactic dose at 24 h before bacterial inoculation, the percentage survival was 55% (MTPPE) or 40% (LE-MTPPE), whereas untreated control mice died . Only repeated prophylactic treatment with LE-MTPPE could further increase survival up to 85%.

FEMS Microbiol Lett, 1994 Jan 1, 115(1), 57 - 62
Control of nifH transcription in Azospirillum brasilense: involvement of NifA and of cis-acting sequences; Fancelli S et al.; The regulatory sequences of Azospirillum brasilense Sp7 nifH gene were fused with the cam reporter gene and used for studying the factors controlling nifH transcription . A DNA sequence, downstream the ATG codon of nifH, that could be involved in the negative regulation of nifH transcription, was identified . The effect of 1 and 2 mM of ammonium on the transcription of the A . brasilense nifH gene and on the nitrogenase activity, in the presence of the Klebsiella pneumoniae NifA protein, was examined.

Scand J Rheumatol, 1994, 23(3), 119 - 23
Serum IgA anti-Klebsiella antibodies in ankylosing spondylitis patients from Catalonia; Collado A et al.; IgA antibodies against Klebsiella pneumoniae were measured by immunofluorescence in 84 Catalan patients with ankylosing spondylitis (AS), 41 patients with non-inflammatory arthropathies (NIA) and 22 patients with rheumatoid arthritis (RA) . Patients with AS showed higher levels of anti-klebsiella IgA antibodies (IgA-Kp) than NIA and RA patients (4.7 +/- 1.6 U vs 3.7 +/- 1.5 U and 3.1 +/- 1.4 U respectively, p = 0.001) . In AS patients a significant correlation between IgA-Kp and levels of C-reactive protein was observed . Although no clear correlation was found between IgA anti-klebsiella and total serum IgA levels, a significant correlation between IgA anti-klebsiella and serum levels of secretory IgA was detected (r: 0.43, p = 0.003) . In conclusion, some patients with AS disclosed raised levels of Klebsiella antibodies in sera and this is related to an increase of secretory IgA level . Analysis about the relationship between response to klebsiella and the presence of gut inflammation in AS patients could be of interest.

Appl Biochem Biotechnol, 1994 Spring, 45-46, 697 - 707
Ethanol from lignocellulosic wastes with utilization of recombinant bacteria; Katzen R et al.; This article presents the advanced technology that has been developed by BioEnergy International of Gainesville, Florida, utilizing novel recombinant strains of bacteria developed by Lonnie Ingram of the University of Florida . The first commercial applications of these unique fermenting organisms convert 5-carbon sugars, as well as 6-carbon sugars, and oligomers of cellulose (e.g., cellobiose and cellotriose) directly to ethanol . The proposed systems that will be utilized for conversion of agricultural wastes, mixed waste papers, and pulp and paper mill waste in forthcoming commercial installations are now under design . This involves the extensive experience of Raphael Katzen Associates International, Inc . in acid hydrolysis, enzyme production, enzymatic hydrolysis, large-scale fermentation engineering, and distillation/dehydration . Specific examples of this advanced technology will be presented in different applications, namely: 1 . Conversion of the hemicellulose content of sugar cane bagasse to 5-carbon sugars by mild-acid prehydrolysis, followed by fermentation of the 5-carbon sugar extract with recombinant Escherichia coli in a commercial installation soon to be under construction in Brazil . This unique process utilizes the surplus hemicellulose fraction of bagasse not required for steam and power generation to produce ethanol, additional to that from the original can juice, which has been converted by conventional sucrose fermentation to ethanol . The process also recovers and converts to ethanol the majority of sucrose normally lost with the bagasse fibers . Resultant beer is enriched in an innovative process to eliminate the need for incremental rectification capacity . 2 . Application of this technology to mixed waste paper in Florida, with a moderate loading of newsprint (85% mechanical wood fiber), will involve a mild-acid prehydrolysis, the partial extraction of the 5-carbon sugars produced from hemicellulose as a feedstock for propagation of the recombinant Klebsiella oxytoca bacterium . Included is a facility providing for in-house production of cellulase enzyme, as an active whole broth for direct use in simultaneous saccharification and fermentation (SSF) of the remaining cellulose and residual 5-carbon sugars to ethanol . This is followed by distillation and dehydration in the advanced commercially available low-energy recovery system . 3 . Another potential application of this unique technology involves utilization of a variety of wastes from several pulp and paper mills in close proximity, permitting collection of these wastes at low cost and reducing the considerable cost encountered in disposing of such low-energy wet waste.(ABSTRACT TRUNCATED AT 400 WORDS)

Crit Rev Biotechnol, 1994, 14(3), 225 - 49
Biosynthesis of the iron-molybdenum cofactor of nitrogenase; Allen RM et al.; The iron-molybdenum cofactor (FeMo-co) of nitrogenase is a unique molybdenum-containing prosthetic group that has been proposed to form an integral part of the active site of dinitrogenase . In Klebsiella pneumoniae, at least six nif (nitrogen fixation) gene products are required for the biosynthesis of FeMo-co, including NIFB, NIFNE, NIFH, NIFQ, and NIFV . An in vitro system for the synthesis of FeMo-co, which requires MgATP, molybdate, homocitrate, and at least the products of nifN, E, B, and H, has provided an enzymatic assay for the purification of many of the gene products required for FeMo-co biosynthesis . Although the structure of the cofactor has been solved recently, much about the biosynthetic pathway remains unknown . This article reviews what is known about the various components required for FeMo-co biosynthesis.

Trop Geogr Med, 1994, 46(3), 151 - 3
Outbreak of neonatal Klebsiella septicaemia at the University College Hospital, Ibadan, Nigeria . Appraisal of predisposing factors and preventive measures; Akindele JA et al.; The report concerns an outbreak of neonatal Klebsiella septicaemia at the University College Hospital, Ibadan, Nigeria, between October and November 1991 . Mortality, 35.7%, was higher in the preterm babies than in the term babies (p < 0.05) . The important predisposing factors to infection identified were birth asphyxia, necessitating active resuscitation, prematurity, prolonged rupture of the membranes and maternal intrapartum pyrexia . The Klebsiella species isolated from the babies and the hospital environment during the outbreak were of the multiple drug resistant type . Preventive measures and the need for a continual bacteriological surveillance are highlighted.

Drugs Exp Clin Res, 1994, 20(2), 49 - 54
Interactions of ceftibuten with extended-spectrum beta-lactamases: a bacteriological and enzymatic analysis; Thabaut A et al.; The authors analysed the antibacterial activity of ceftibuten, cefotaxime, ceftazidime and aztreonam against Klebsiella pneumoniae strains, including those which produced novel extended-spectrum beta-lactamases . These molecules were also tested for their susceptibility to cell-free extracts of the corresponding beta-lactamases . Both approaches showed that ceftibuten was not hydrolysed by the CTX-1/TEM-3, SHV-2 and SHV-3 beta-lactamases, while cefotaxime, ceftazidime and aztreonam were hydrolysed . Nevertheless all compounds were substrates for the SHV-4 and SHV-5 beta-lactamases, and the organisms which produced these beta-lactamases showed increased MICs.

J Formos Med Assoc, 1994 Jan, 93(1), 45 - 50
Pyogenic liver abscess in children; Kong MS et al.; Our center's experience with 15 pyogenic liver abscesses in 14 children from 1979 to 1992 showed an incidence of 20 per 100,000 pediatric hospital admissions . Eight of the 15 liver abscesses were cryptogenic in origin . The clinical features and laboratory findings were non-specific . Improved imaging techniques such as real time sonography and computed tomography made early diagnosis feasible . Klebsiella pneumoniae was the most common pathogen in this study . Drainage combined with antibiotics provides the most important treatment for this disease . Before 1986, surgery was frequently used, but now percutaneous drainage is preferred . Surgery may be reserved for those who respond poorly to percutaneous drainage and medical treatment . One of the 14 patients in this study died.

Microbiol Immunol, 1994, 38(11), 901 - 3
Increased phosphodiesters in lipopolysaccharide prepared from the polymyxin B-resistant isolate of Klebsiella pneumoniae; Yokochi T et al.; A polymyxin B (PXB)-resistant mutant of Klebsiella pneumoniae O3 was isolated . Lipopolysaccharide (LPS) extracted from the PXB-resistant isolate bound little PXB, although LPS from the parental strain did . The 31P nuclear magnetic resonance (NMR) spectrum of PXB-resistant type LPS showed that it contained much less of the phosphomonoesters and the pyrophosphate esters, and an increased amount of the phosphodiesters, compared to the parental type LPS . The decrease in the binding of PXB might be due to altered phosphate groups on the PXB-resistant type LPS, suggesting that it might explain the PXB-resistance of the mutant.

Antonie Van Leeuwenhoek, 1994, 65(4), 381 - 95
Bacterial sodium ion-coupled energetics; Dimroth P; For many bacteria Na+ bioenergetics is important as a link between exergonic and endergonic reactions in the membrane . This article focusses on two primary Na+ pumps in bacteria, the Na(+)-translocating oxaloacetate decarboxylase of Klebsiella pneumoniae and the Na(+)-translocating F1Fo ATPase of Propionigenium modestum . Oxaloacetate decarboxylase is an essential enzyme of the citrate fermentation pathway and has the additional function to conserve the free energy of decarboxylation by conversion into a Na+ gradient . Oxaloacetate decarboxylase is composed of three different subunits and the related methylmalonyl-CoA decarboxylase consists of five different subunits . The genes encoding these enzymes have been cloned and sequenced . Remarkable are large areas of complete sequence identity in the integral membrane-bound beta-subunits including two conserved aspartates that may be important for Na+ translocation . The coupling ratio of the decarboxylase Na+ pumps depended on delta muNa+ and decreased from two to zero Na+ uptake per decarboxylation event as delta mu Na+ increased from zero to the steady state level . In P . modestum, delta mu Na+ is generated in the course of succinate fermentation to propionate and CO2 . This delta mu Na+ is used by a unique Na(+)-translocating F1Fo ATPase for ATP synthesis . The enzyme is related to H(+)-translocating F1Fo ATPases . The Fo part is entirely responsible for the coupling of ion specificity . A hybrid ATPase formed by in vivo complementation of an Escherichia coli deletion mutant was completely functional as a Na(+)-ATP synthase conferring the E . coli strain the ability of Na(+)-dependent growth on succinate . The hybrid consisted of subunits a, c, b, delta and part of alpha from P . modestum and of the remaining subunits from E . coli . Studies on Na+ translocation through the Fo part of the P . modestum ATPase revealed typical transporter-like properties . Sodium ions specifically protected the ATPase from the modification of glutamate-65 in subunit c by dicyclohexylcarbodiimide in a pH-dependent manner indicating that the Na+ binding site is at this highly conserved acidic amino acid residue of subunit c within the middle of the membrane.

Eur J Clin Microbiol Infect Dis, 1994, 13 Suppl 1, S39 - 42
Clinical significance of extended-spectrum beta-lactamases; Quinn JP; Extended-spectrum beta-lactamases (ESBLs) have now been described in many hospitals worldwide . While they have been detected in many pathogenic gram-negative bacteria, they are particularly prevalent in Klebsiella isolates . Known risk factors for colonization and/or infection with organisms harboring these enzymes include admission to an intensive care unit, recent surgery, instrumentation, prolonged hospital stay and antibiotic exposure, especially exposure to extended-spectrum beta-lactam agents . In this report three recent epidemics from the USA will be described in which the role of selective antibiotic pressure seems clear . Data from two hospital epidemics, one from New York and another from Stanford, California, will be reviewed briefly . In addition, recent studies describing the spread of extended-spectrum beta-lactamases among nursing home patients in Chicago, Illinois, will be outlined . The limited data available on treatment options for patients infected with ESBL-containing strains will be reviewed, focusing on the activity of piperacillin/tazobactam and imipenem against these otherwise broadly resistant strains . Lastly, attempts to control these organisms, including infection control measures and selective bowel decontamination, will be reviewed.

Arch Med Res, 1994 Autumn, 25(3), 321 - 4
Comparative analysis of plasmids from nosocomial Klebsiella pneumoniae strains isolated from two hospitals; Espinosa de los Monteros LE et al.; A total of 46 clinical isolates of Klebsiella pneumoniae were studied . Of these, 33 were from "Hospital Infantil de Mexico" (HIM) and 13 from "Hospital General de Mexico" (HGM) . The susceptibility of these strains to five antibiotics, as well as the plasmid DNA profiles, were determined for each group . Antibiotic susceptibility profiles were very similar in strains from both hospitals; however, most of the strains analyzed exhibited heterogeneous plasmid DNA profiles . Results showed that strains isolated in the two hospitals did not differ regarding morphology, biochemical profiles, antibiotic susceptibility or plasmid populations, and these characteristics may not be used as markers to differentiate Klebsiella pneumoniae strains from different hospitals.

Antonie Van Leeuwenhoek, 1994, 66(4), 343 - 50
Anaerobic degradation of malonate via malonyl-CoA by Sporomusa malonica, Klebsiella oxytoca, and Rhodobacter capsulatus; Dehning I et al.; Anaerobic decarboxylation of malonate to acetate was studied with Sporomusa malonica, Klebsiella oxytoca, and Rhodobacter capsulatus . Whereas S . malonica could grow with malonate as sole substrate (Y = 2.0 g.mol-1), malonate decarboxylation by K . oxytoca was coupled with anaerobic growth only in the presence of a cosubstrate, e.g . sucrose or yeast extract (Ys = 1.1-1.8 g.mol malonate-1) . R . capsulatus used malonate anaerobically only in the light, and growth yields with acetate and malonate were identical . Malonate decarboxylation in cell-free extracts of all three bacteria was stimulated by catalytic amounts of malonyl-CoA, acetyl-CoA, or Coenzyme A plus ATP, indicating that actually malonyl-CoA was the substrate of decarboxylation . Less than 5% of malonyl-CoA decarboxylase activity was found associated with the cytoplasmic membrane . Avidin (except for K . oxytoca) and hydroxylamine inhibited the enzyme completely, EDTA inhibited partially . In S . malonica and K . oxytoca, malonyl-CoA decarboxylase was active only after growth with malonate; malonyl-CoA: acetate CoA transferase was found as well . These results indicate that malonate fermentation by these bacteria proceeds via malonyl-CoA mediated by a CoA transferase and that subsequent decarboxylation to acetyl-CoA is catalyzed, at least with S . malonica and R . capsulatus, by a biotin enzyme.

Rev Chil Obstet Ginecol, 1994, 59(4), 301 - 5; discussion 305-6
{Premature rupture of fetal membranes in the midtrimester (II): Antibiotic treatment in a case of intraamniotic infection prior to fetal viability}; Mondion M et al.; A case of a 33 year old woman G7P6A1, with preterm premature rupture of membranes at 20 weeks of gestation and asymptomatic intramniotic infection is reported . At admission, the presence of Klebsiella oxytoca in amniotic fluid was demonstrated by amniocentesis . Parenteral antibiotics were administered with a following demonstration of aseptic fluid . The patient delivered at 29 1/2 weeks of pregnancy . A newborn weighing 1520 with an Apgar score of 8-8 was obtained . The mother had a normal puerperal period without any evidence of infectious morbidity . A clinical sepsis was demonstrated in the newborn with appropriate response to antibiotic therapy . No further complications were observed.

Gene, 1993 Dec 31, 137(2), 237 - 42
Cloning, sequence and characterization of the polyphosphate kinase-encoding gene (ppk) of Klebsiella aerogenes; Kato J et al.; Polyphosphate kinase (PPK) catalyzes the formation of polyphosphate (polyP) . The PPK-encoding gene (ppk) has been cloned from Klebsiella aerogenes ATCC9621 . The gene possessed an open reading frame of 2055 bp capable of encoding a putative polypeptide with a deduced M(r) of 80,157 . This polypeptide showed 93% similarity to the Escherichia coli PPK . The nucleotide sequence of the promoter region of K . aerogenes ppk differed from that of the previously sequenced E . coli ppk . A putative pho box sequence was found in the promoter region of K . aerogenes ppk . The expression of lacZ from the ppk promoter was increased in E . coli MV1184 under conditions of phosphate (Pi) limitation, but not in E . coli ANCS3 (phoB-), indicating that the ppk promoter is regulated by the phoB product . Increased levels of specific PPK activity were shown by expressing the cloned ppk at high levels, resulting in increased accumulation of polyP in E . coli.

Int J Exp Pathol, 1993 Dec, 74(6), 573 - 82
A murine model of experimental autoimmune lens-induced uveitis using Klebsiella O3 lipopolysaccharide as a potent immunological adjuvant; Yokochi T et al.; Experimental autoimmune uveitis and finally panophthalmitis could be produced in mice by repeated immunization of syngeneic eyeball extract mixed with Klebsiella O3 lipopolysaccharide (KO3 LPS) as a powerful immunological adjuvant . No ocular lesions were produced in mice given eyeball extract emulsified in complete Freund's adjuvant (CFA), KO3 LPS alone or eyeball extract alone . Histopathological changes in the ocular lesions at the early stage after the second or tertiary immunization were characterized by infiltration with inflammatory cells in the ciliary body and iris . The iridocyclitis was followed by extensive infiltration of polymorphonuclear leucocytes (PMN) into the cornea, lens and the surrounding tissues after repeated immunization . Finally, these areas were replaced by granulomatous tissues infiltrated with mononuclear cells . On the other hand, the structure of the retina and sclera was partially preserved . Those mice exhibited production of autoantibodies and development of the delayed-type hypersensitivity (DTH) to syngeneic eyeball extract . Moreover, ocular lesions could be produced in normal recipient mice by transfer of sensitized lymphocytes from hyperimmunized mice . Therefore, it was suggested that the ocular lesions produced by repeated immunization with the mixture of eyeball extract and KO3 LPS were due to the autoimmune mechanism . This might be useful to model immunological phenomena in the pathogenesis of human phacoantigenic uveitis.

FEMS Microbiol Lett, 1993 Dec 1, 114(2), 191 - 4
Genetic analysis of the regulatory putP region (coding for proline permease) in Klebsiella pneumoniae M5a1: evidence for regulation by the nac system; Suhr M et al.; During a search for nitrogen-controlled promoters on the Klebsiella pneumoniae M5a1 chromosome, the regulatory region of putP (coding for proline permease) was cloned, sequenced and analyzed . The region contained a weak sigma 70-dependent promoter and putative binding sites for the cAMP-CAP complex and the Nac regulatory protein, the latter probably providing a link with the nitrogen regulation (Ntr) system . Using a lacZ gene fusion, evidence for control of putP transcription by both Nac and Ntr was obtained.

J Bacteriol, 1993 Dec, 175(23), 7683 - 8
In vitro activity of NifL, a signal transduction protein for biological nitrogen fixation; Lee HS et al.; In the free-living diazotroph Klebsiella pneumoniae, the NifA protein is required for transcription of all nif (nitrogen fixation) operons except the regulatory nifLA operon itself . NifA activates transcription of nif operons by the alternative holoenzyme form of RNA polymerase, sigma 54 holoenzyme . In vivo, NifL is known to antagonize the action of NifA in the presence of molecular oxygen or combined nitrogen . We now demonstrate inhibition by NifL in vitro in both a coupled transcription-translation system and a purified transcription system . Crude cell extracts containing NifL inhibit NifA activity in the coupled system, as does NifL that has been solubilized with urea and allowed to refold . Inhibition is specific to NifA in that it does not affect activation by NtrC, a transcriptional activator homologous to NifA, or transcription by sigma 70 holoenzyme . Renatured NifL also inhibits transcriptional activation by a maltose-binding protein fusion to NifA in a purified transcription system, indicating that no protein factor other than NifL is required . Since inhibition in the purified system persists anaerobically, our NifL preparation does not sense molecular oxygen directly.

Eur J Pediatr, 1993 Dec, 152(12), 1004 - 5
Neonatal suppurative parotitis: a vanishing disease?
Coban A, Ince Z, Ucsel R, Ozgeneci A, Can G.
A case of neonatal suppurative parotitis due to Klebsiella pneumoniae is described . This is the first case reported in the last 20 years . Infection with unusual microorganisms should be taken into account when planning antibiotic treatment, especially in hospital acquired infections of the salivary glands in the newborn.

J Biol Chem, 1993 Nov 25, 268(33), 24792 - 5
Appendix . Cloning and sequence of the gene encoding enzyme E-1 from the methionine salvage pathway of Klebsiella oxytoca; Balakrishnan R et al.; The methionine salvage pathway converts the methylthioribose moiety of 5'-(methylthio)-adenosine to methionine via a series of biochemical steps . One enzyme active in this pathway, a bifunctional enolase-phosphatase called E-1 that promotes oxidative cleavage of the synthetic substrate 2,3-diketo-1-phosphohexane to 2-keto-pentanoate, has been purified from Klebsiella pneumoniae and is characterized in the preceding paper (Myers, R., Wray, J., Fish, S., and Abeles, R . H . (1993) J . Biol . Chem . 268, 24785-24791) . We synthesized degenerate oligonucleotides corresponding to portions of the amino terminus of E-1 . These oligonucleotides were used as polymerase chain reaction primers on whole genomic DNA from Klebsiella oxytoca . This resulted in an 82-base pair DNA fragment that was used as a hybridization probe to obtain a clone of the E-1 gene from a K . oxytoca gene library . The DNA sequence of the E-1 coding region was determined, and the amino acid sequence of E-1 was deduced . E-1 appears to represent a novel class of enzymes since no homology to known enzymes was found . Cloning the gene from K . oxytoca on a multicopy plasmid leads to overproduction of E-1 enzyme that has properties indistinguishable from those of the enzyme from K . pneumoniae.

J Biol Chem, 1993 Nov 25, 268(33), 24785 - 91
Purification and characterization of an enzyme involved in oxidative carbon-carbon bond cleavage reactions in the methionine salvage pathway of Klebsiella pneumoniae; Myers RW et al.; The 5-methylthio-D-ribose moiety of 5'-(methylthio)-adenosine is converted to methionine in a wide variety of organisms . 2,3-Diketo-5-methylthio-1-phosphopentane is an advanced intermediate in the methionine recycling pathway present in the Gram-negative bacterium Klebsiella pneumoniae . This unusual metabolite is oxidatively cleaved to yield formate (from C-1), 2-keto-4-methylthiobutyrate (the transamination product of methionine), and 3-methylthiopropionate . To further characterize this oxidative conversion, the desthio analog of the naturally occurring diketone, namely 2,3-diketo-1-phosphohexane I, was synthesized . If the metabolism of I is analogous to that of 2,3-diketo-5-methylthio-1-phosphopentane it should be converted to formate, 2-ketopentanoate, and butyrate . An enzyme (E-1), which mediates the oxidative conversion of I to formate and 2-ketopentanoate, was isolated from extracts of K . pneumoniae . E-1 was purified 100-fold to homogeneity in 10% yield . The native enzyme is a monomeric protein of M(r) 27,000 . The activity of E-1 requires magnesium ion as a cofactor . No other prosthetic groups were detected . Incubation of the enzyme with I, under anaerobic conditions, led to the discovery of two intermediates . These species have been identified by 1H and 13C NMR, UV-visible spectroscopy, and model chemistry studies as 2-hydroxy-3-keto-1-phospho-1-hexene II, generated by enolization of I; and 1,2-dihydroxy-3-keto-1-hexene III, generated by enzymatic dephosphorylation of II . Intermediates II and III are released from the active site of the enzyme; III accumulates under anaerobic conditions . Under aerobic conditions, III is non-enzymically oxidized to 2-ketopentanoate, formate, and other products . Compound II was also generated by heating I at pH 7.5 for 7 min . Action of alkaline phosphatase on II produces III.

J Biol Chem, 1993 Nov 25, 268(33), 24564 - 71
Sequence of the sodium ion pump methylmalonyl-CoA decarboxylase from Veillonella parvula; Huder JB et al.; The genes encoding methylmalonyl-CoA decarboxylase from Veillonella parvula were cloned on plasmids using oligonucleotides derived from N-terminal amino acid sequences as specific probes . The entire DNA sequence of the methylmalonyl-CoA decarboxylase genes together with upstream and downstream regions was determined . The genes encoding subunits alpha (mmdA), delta (mmdD), epsilon (mmdE), gamma (mmdC), and beta (mmdB) of the decarboxylase were clustered on the chromosome in the given order . The previously unnoted epsilon-chain (M(r) 5,888) was clearly shown to be a subunit of the decarboxylase by correspondence of the N-terminal amino acid sequence with that deduced from the DNA sequence of mmdE . The alpha-subunit was 60% identical with the carboxyltransferase domain of rat liver propionyl-CoA carboxylase, the beta-subunit showed 61% sequence identity with the beta-subunit of oxaloacetate decarboxylase from Klebsiella pneumoniae, and the biotin-containing gamma-subunit was 29-39% identical with biotin-domains of other biotin enzymes . The delta-subunit of methylmalonyl-CoA decarboxylase and the gamma-subunit of oxaloacetate decarboxylase did not show significant sequence homology . The gross structure of both proteins, however, was similar, consisting of a hydrophobic membrane anchor near the N terminus, a proline/alanine linker, and a remarkable accumulation of charged amino acids in the C-terminal part . The sequence of the small epsilon-subunit could be aligned to the C-terminal region of the delta-subunit downstream of the proline/alanine linker, where the two subunits were 47% identical . Of considerable interest for the mechanism of Na+ transport are the long stretches of complete sequence identity between the hydrophobic beta-subunits of methylmalonyl-CoA decarboxylase and oxaloacetate decarboxylase and the presence of two conserved aspartic acid residues within putative membrane-spanning helices.

FEMS Microbiol Lett, 1993 Nov 15, 114(1), 9 - 16
Two different types of fosfomycin resistance in clinical isolates of Klebsiella pneumoniae; O'Hara K; The fosfomycin susceptibility of 100 clinical isolates of Klebsiella pneumoniae and the resistance mechanisms utilized by resistant strains were examined . Washed cells prepared from the strains demonstrating MICs of more than 8 micrograms ml-1 of fosfomycin inactivated the drug . A crude extract from strain Tf129B, highly resistant to fosfomycin, was used to study the enzymatic properties of the drug-inactivating enzyme . The optimum pH for inactivation was 7.8 and the optimum temperature of the reaction was 37 degrees C . Glutathione was shown to be effective as a cofactor in the inactivation . It was suggested that the inactivating enzyme of Klebsiella pneumoniae was fosfomycin: glutathione-S-transferase, a constitutive enzyme located in the periplasmic space . A good correlation was found between the specific activities of this enzyme and the MIC levels; however, certain strains showed a low level of fosfomycin:glutathione-S-transferase activity which could not account for the increased MIC . Strains Tf129B and Tf408E, both demonstrating MICs of more than 1024 micrograms ml-1 of fosfomycin carried a transferable resistance plasmid . In strain Tf129B, the mechanism of fosfomycin resistance was due to a high level of enzymic activity . In strain Tf408E, it was determined to be mainly due to the reduced permeability of the cell membrane.

J Immunol, 1993 Nov 15, 151(10), 5440 - 9
Role of acyl residues in polyclonal murine B cell activation by acylpoly(1,3)galactosides from Klebsiella pneumoniae; Hmama Z et al.; Several components of Klebsiella pneumoniae including a membrane proteoglycan (Kp-MPG) were reported to activate macrophages and to induce T-independent polyclonal activation of mouse B cells . Chemically defined derivatives of Kp-MPG were prepared and characterized, enabling us to approach the molecular substructures involved in the binding to lymphocytes and the activation of B cells . Five derivatives were characterized: (i) an acylpoly(1,3)galactoside containing ester-linked fatty acids (EFA-APG) which was obtained by mild alkaline hydrolysis, (ii) a polymer of EFA-APG (APG pol1), (iii) a preparation obtained by drastic alkaline hydrolysis and delipidation which removed the esterified fatty acids (APG), (iv) a polymer of the latter compound (APG pol2), and (v) an APG preparation submitted to mild acid hydrolysis which removed all fatty acids but left the galactose chain of APG (GC-APG) intact . The derivatives were studied for their capacity to bind to and to activate mouse splenocytes . Binding was investigated on BALB/c and C3H/HeJ splenocytes by indirect immunofluorescence using biotinylated F(ab')2 of anti-Kp-MPG antibodies and the streptavidin-phycoerythrin amplification system in flow cytometry and by competition of unlabeled APG with biotinylated APG . Activation was studied by measuring (i) {3H}thymidine incorporation into spleen cells from BALB/c, C3H/HeJ, nude (nu+/nu+) mouse strains, and purified B cells of BALB/c; (ii) immunoglobulin secretion in culture supernatants; and (iii) blastogenesis . The results demonstrate a specific uptake of EFA-APG and APG by T cells as well as by B cells and exclude a contribution of the polygalactose part of the APG molecule (GC-APG) to the binding to spleen lymphocytes . Unlike LPS from the same strain of K . pneumoniae, APG pol1 stimulated B cell activation in the LPS-resistant C3H/HeJ strain as well as in BALB/c mice . The compounds did not activate T cells and were T-independent B cell activators, stimulating nu+/nu+ spleen cells and inducing primarily IgM and IgG3 synthesis . Polymers were more potent activators than monomers and removal of ester-linked fatty acids completely abrogated B cell-activating properties . The monomer APG antagonized B cell activation by Kp-MPG, LPS from K . pneumoniae, and APG pol1 . The data indicate that within the EFA-APG molecule, distinct substructures are required for binding and for triggering B cell response.

Immunology, 1993 Nov, 80(3), 488 - 92
Characterization of a thyroiditis-inducing thyroglobulin-specific T-cell clone restricted by the H-2 molecule of a low responder mouse strain; Hiyama Y et al.; We established a thyroglobulin (Tg)-specific, thyroiditis-inducing T-cell clone, B12G, from B6C3F1 mice by the immunization of mouse Tg with lipopolysaccharide (LPS) from Klebsiella strain LEN (O3:K1) . B12G was Thy-1.2+, CD3+, CD4+, CD18+, and CD8-, and could transfer thyroiditis to recipient mice after in vitro stimulation with mouse or bovine Tg . Histological examination showed severe thyroiditis with predominant infiltrations of polymorphonuclear cells; few mononuclear cells were observed . B12G proliferated in response to bovine, mouse, porcine, and rat Tg in the presence of irradiated spleen cells, but did not respond to chicken or human Tg . H-2b, a low-responder haplotype of experimental autoimmune thyroiditis, governed the response of the clone to Tg . B12G produced interleukin-4 (IL-4) and IL-6, but not IL-2 or interferon-gamma (IFN-gamma), on stimulation with mouse Tg . These findings were different from characteristics of previously reported Tg-specific T-cell clones from high-responder mice in terms of epitope specificity and cytokine production pattern, raising the possibility that the specificities and functions of T cells involved in the development of autoimmune thyroiditis in low-responder mice differ from those in high responders.

Neurosurgery, 1993 Nov, 33(5), 858 - 62
Ventriculoperitoneal shunt infections with gram-negative bacteria; Stamos JK et al.; Infection causes major morbidity and mortality in patients with cerebrospinal fluid (CSF) shunts . The prognosis of CSF shunt infections caused by Gram-negative bacteria (GNB) has been thought to be particularly poor . The authors reviewed all GNB shunt infections treated at Children's Memorial Hospital from January 1986 to January 1990 (n = 23) . Of these infections 20 (87%) occurred within 4 weeks after shunt revision (median, 10 days) . The most frequent symptoms were fever, lethargy, and irritability; the illness was not severe in the majority of these patients . Escherichia coli was isolated from 12 of 23 patients (52%), Klebsiella pneumoniae from 5 (22%), and mixed GNB from 3 (13%) patients . Initial treatment always included immediate shunt removal, externalized ventricular drainage, and intravenous antibiotics . Extraventricular drainage revision and/or intraventricular antibiotics were required in four patients whose CSF cultures were persistently positive for GNB . At admission, these patients had CSF glucose levels of < 10 mg/dl and CSF positive for GNB by Gram's stain . The overall cure rate was 100%, and no recurrence was observed; however, a subsequent infection with a different organism developed in four patients . Only 2 of 19 patients (11%) who were followed up suffered apparent CNS damage . One patient died of unrelated causes shortly after treatment . Our findings indicate that 1) patients with GNB CSF shunt infections often appear relatively well at presentation; 2) CSF positive for GNB by Gram's stain and very low CSF glucose levels predict continued positive CSF cultures, despite appropriate antibiotic therapy; and 3) GNB CSF shunt infections can be successfully treated by prompt shunt removal, extraventricular drainage, and intravenous antibiotics.(ABSTRACT TRUNCATED AT 250 WORDS)

Am J Gastroenterol, 1993 Nov, 88(11), 1911 - 5
Pyogenic liver abscess in Taiwan: emphasis on gas-forming liver abscess in diabetics; Yang CC et al.; Ninety-seven cases of pyogenic liver abscesses in a 4-yr period were studied: 27.8% (27 cases) were associated with biliary tract stone, 5.2% (five cases) were associated with biliary tract cancer, and there were two cases of diabetes (2.1%) associated with anal infection, but 63.9% (63 cases) were diagnosed as cryptogenic . Forty patients (64.5%) in the cryptogenic group had diabetes mellitus, and 23 of them (23/40, 57.5%) had gas-forming infection . All patients received parenteral antibiotics therapy, percutaneous aspiration, drainage, or operation . The overall mortality was 16.5% . Diabetes mellitus alone, without demonstrable infectious foci, was an important predisposing factor for pyogenic liver infection . Furthermore, to evaluate the clinical importance of gas-forming pyogenic liver infections, we separated these 42 diabetic patients into gas-forming and non-gas-forming groups, after sonography and CT scan . Klebsiella pneumoniae was the major pathogen in both groups . There was no significant difference in the clinical manifestations, complication, bacterial culture, or laboratory data between these two groups, except that the AST level was higher in the gas-forming group . However, the gas-forming group had higher mortality rate (30.4% vs . 5.3%) . Gas-forming liver abscesses were common among the diabetics . Early and adequate drainage for pyogenic liver abscesses with parenteral antibiotics are crucial in their management.

J Bacteriol, 1993 Nov, 175(21), 6775 - 80
Purification and properties of a nif-specific flavodoxin from the photosynthetic bacterium Rhodobacter capsulatus; Yakunin AF et al.; A flavodoxin was isolated from iron-sufficient, nitrogen-limited cultures of the photosynthetic bacterium Rhodobacter capsulatus . Its molecular properties, molecular weight, UV-visible absorption spectrum, and amino acid composition suggest that it is similar to the nif-specific flavodoxin, NifF, of Klebsiella pneumoniae . The results of immunoblotting showed that R . capsulatus flavodoxin is nif specific, since it is absent from ammonia-replete cultures and is not synthesized by the mutant strain J61, which lacks a nif-specific regulator (NifR1) . Growth of cultures under iron-deficient conditions causes a small amount of flavodoxin to be synthesized under ammonia-replete conditions and increases its synthesis under N2-fixing conditions, suggesting that its synthesis is under a dual system of control with respect to iron and fixed nitrogen availability . Here we show that flavodoxin, when supplemented with catalytic amounts of methyl viologen, is capable of efficiently reducing nitrogenase in an illuminated chloroplast system . Thus, this nif-specific flavodoxin is a potential in vivo electron carrier to nitrogenase; however, its role in the nitrogen fixation process remains to be established.

J Indian Med Assoc, 1993 Nov, 91(11), 283 - 5
Omphalitis neonatorum; Faridi MM et al.; Clinicobacteriological profile of omphalitis neonatorum was analysed in this prospective study which comprised 4776 neonates (4410 hospital-born, 366 deliveries at home) . The incidence of omphalitis in the hospital-born babies was 2.3% . About 21.3% babies delivered at home were admitted for neonatal sepsis, meningitis, birth asphyxia, etc . They were found to be concomitantly suffering from omphalitis . Improper severing of the umbilical cord, application of oily substances on the umbilical stump and unhygienic rearing practices during neonatal period were some of the important predisposing factors . The fall of the umbilical stump and the diagnosis of omphalitis neonatorum was made significantly earlier (p < 0.001) in the hospital-born babies and none of them developed sepsis . The institution of therapy for umbilical sepsis was considerably delayed in the babies delivered at home and the omphalitis was the probable cause of sepsis in 46.6% cases . The Gram-negative organisms were responsible for omphalitis in 57.1% cases . Klebsiella was the commonest Gram-negative organism . Its incidence was more among the babies delivered at home signifying a potentially infective environment in the community . Gram's stain was a reliable and easy method for grossly identifying the organism in the umbilical smear.

Infection, 1993 Nov-Dec, 21(6), 403 - 6
A case of rhinoscleroma cured with ciprofloxacin; Trautmann M et al.; The diagnosis of rhinoscleroma was confirmed in a 17-year-old female patient from Tehran, Iran, suffering from a roundish tumour of the nose . Prior treatment with streptomycin and tetracycline had been unsuccessful . A three-month course of high-dose oral ciprofloxacin (750 mg b.i.d.) led to prompt cessation of the growth of the granuloma which was removed later by plastic surgery . Although serology alone appeared to have little value for the specific diagnosis of rhinoscleroma, a significant increase of IgG antibodies during treatment with ciprofloxacin confirmed infection by Klebsiella rhinoscleromatis in this case.

J Antimicrob Chemother, 1993 Nov, 32(5), 685 - 94
A statistical evaluation of the bactericidal effects of ceftibuten in combination with aminoglycosides and ciprofloxacin; Guerillot F et al.; The bactericidal effects of ceftibuten in combination with netilmicin, isepamicin or ciprofloxacin against two strains of Escherichia coli and three of Klebsiella pneumoniae were studied by the killing curve method . Interpretation of the results was made on a statistical basis by comparing the bactericidal effects observed when the antibiotics were tested alone with those when they were tested in combination . The results were also assessed by survival probabilities according to the ratio of the number of viable bacteria at time t(N(t)) to the initial number of viable bacteria (N(0)) . The effects of the combinations were defined in terms of antagonism, indifference, single agonism, addition and synergy by taking account of the confidence intervals of the survival probabilities . All of the combinations exhibited bactericidal activities which were time-dependent . Synergy was demonstrated when ceftibuten was combined with the aminoglycosides, except against the two extended-spectrum beta-lactamase-producing strains of K . pneumoniae, but not when ceftibuten and ciprofloxacin were combined . Antagonism was not demonstrated with any of the combinations.

Zentralbl Hyg Umweltmed, 1993 Nov, 195(1), 22 - 6
Bacteriocin typing of environmental Klebsiella isolates; Podschun R et al.; A total of 88 environmental Klebsiella pneumoniae and K . oxytoca isolates were typed according to their bacteriocin susceptibility patterns . Bacteriocin typing was performed by a modification of the scrape-and-point method, using a set of 8 producer strains . This method proved to be very applicable to environmental strains of both species; all but one strain could be typed . Twenty-one different patterns were observed . Type 1-3456-8 was most common in both species . In contrast to K . pneumoniae, more than half of the K . oxytoca strains fell into only two bacteriocin susceptibility patterns . Bacteriocin types 1 and 3 showed a very broad spectrum, more than 95% of the isolates being sensitive to one of these bacteriocins.

Mol Microbiol, 1993 Nov, 10(3), 665 - 74
The general secretory pathway of Klebsiella oxytoca: no evidence for relocalization or assembly of pilin-like PulG protein into a multiprotein complex; Pugsley AP et al.; It has been proposed that the four type IV pilin-like proteins that are required for extracellular protein secretion by the general secretory pathway (GSP) might assemble into a trans-periplasm complex resembling a type IV pilus . To test this idea, we examined the subcellular distribution and oligomeric state of PulG, one of the type IV pilin-like proteins required for pullulanase secretion in Klebsiella oxytoca . Fractionation of Escherichia coli cells carrying a single copy of each pul gene showed that PulG protein was located in two distinct envelope fractions corresponding to the outer and cytoplasmic membranes . The protein was partially released by treating the membranes with Triton X-100 + EDTA or at high pH, but not by Triton X-100 alone or by 8 M urea, 6 M guanidine hydrochloride or 1 M NaCl . Like type IV pilins, non-sedimentable PulG that had been released from the membranes at high pH could be sedimented by centrifugation when the pH was lowered . Treatment of whole cells, sphaeroplasts or isolated membranes with a cleavable cross-linking agent produced mainly PulG homodimers . Previous studies showed that both PulO, which cleaves and N-methylates the PulG precursor, and PulE, a putative ATP-binding protein, share extensive sequence identity with proteins known to be required for type IV pilus processing and assembly . However, mutations which disrupted either pulE or pulO, or indeed the complete absence of all other components of the pullulanase secretion apparatus, had little or no effect on any of the properties of PulG protein described above . We conclude that there is no evidence that PulG protein assembles into a stable multiprotein complex or that processing of the PulG precursor causes a detectable change in its subcellular distribution.

Mol Microbiol, 1993 Nov, 10(4), 813 - 21
Construction of chimeric proteins from the sigma N-associated transcriptional activators VnfA and AnfA of Azotobacter vinelandii shows that the determinants of promoter specificity lie outside the 'recognition' helix of the HTH motif in the C-terminal domain; Jacob J et al.; Functional chimeras have been generated from the transcriptional activators VnfA and AnfA, which control expression of the alternative nitrogenases in Azotobacter vinelandii . The activation profiles of the native and chimeric proteins have been determined using lacZ fusions to A . vinelandii anf and vnf promoters in Klebsiella pneumoniae . Replacing the C-terminal domain of AnfA with that of VnfA gives a protein with the promoter specificity of VnfA, confirming that the C-terminal domain contains the determinants of promoter specificity . However, substituting the VnfA sequence from the turn in the helix-turn-helix motif to the C-terminus does not alter the promoter specificity of AnfA . These changes in promoter specificity were reflected in changes in affinity for a VnfA-binding site, as measured by an in vivo repression assay using a lacZ fusion to a synthetic promoter . This supports the assumption that promoter recognition is determined by activator binding to enhancer--like sequences, and shows that the principal determinants of specific DNA-binding lie outside the 'recognition' helix . This may be a general feature of transcriptional activators dependent on sigma N (sigma 54) . The chimera with the promoter specificity of VnfA retained the dependence on nitrogenase Fe protein characteristic of AnfA, indicating that this property is not related to particular promoter sequences, but is a function of the central or N-terminal domains of AnfA.






What Is Cell Biology?, What Is Listeria Monocytogenes?, What Is Salmonella?, What Is Molecular Biology?, What Is Water Purification?, e, Bacterium, e, Bacteria, e, Bacteriology, i, Microorganisms, o, Microbes, s, Rhizobacter, i, Microorganisms, a, Bacillus, s, Geobacilli, e, Escherichia coli, c, S. cerevisiae, a, Yeasts, o, Yeasts, i, Fermentations, n, Yeasts, s, Clostridia, s, Yeasts, i, Antibiotic resistance, a, Rhizobacter, n, Microorganisms, r, Staphylococcus aureus, r, Bacillus, r, Escherichia coli, s, Escherichia coli broth, o, Escherichia coli, s, Neisseria




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005