|
|
Trans R Soc Trop Med Hyg, 2005 Mar, 99(3), 207 - 14 Campylobacter species and drug resistance in a north Indian rural community; Jain D et al.; Campylobacter species are known as agents of enteritis worldwide . However, rural community-based studies on Campylobacter infections are lacking . We carried out a prospective case-control study from July to December 2002 to investigate the prevalence and socio-epidemiological determinants of Campylobacter infection in a rural community in north India and the drug resistance of Campylobacter strains isolated from the community . Stool specimens from 348 subjects with diarrhoea and 351 age- and gender-matched asymptomatic controls were cultured for Campylobacter, Salmonella and Shigella . All Campylobacter strains were identified and tested for antibiotic susceptibility . Campylobacter species were isolated from 47 (13.5%) subjects with diarrhoea and 2 (0.6%) asymptomatic controls respectively (P<0.001) . Campylobacter infection was significantly higher in children aged less than 5 years, families engaged in agriculture and persons who did not wash their hands with soap after peri-anal washing following defaecation . Campylobacter infections were more frequent than combined Salmonella and Shigella infections (47/348 vs . 15/351; P<0.001) in subjects with diarrhoea . Only two Campylobacter-infected individuals with diarrhoea had bloody stools . Antibiotic resistance of Campylobacter species was as follows: ampicillin 81.6%, ciprofloxacin 71.4%, tetracycline 26.5%, furazolidine 14.3%, gentamicin 10.2% and erythromycin 6.1%; 30.6% of strains were multidrug resistant . Increased quinolone resistance and multidrug resistance pose major risks for treatment failure. J Wildl Dis, 2004 Oct, 40(4), 639 - 59 An annotated checklist of pathogenic microorganisms associated with migratory birds; Hubalek Z; The potential for transport and dissemination of certain pathogenic microorganisms by migratory birds is of concern . Migratory birds might be involved in dispersal of microorganisms as their biological carriers, mechanical carriers, or as carriers of infected hematophagous ecto-parasites (e.g., ixodid ticks) . Many species of microorganisms pathogenic to homeothermic vertebrates including humans have been associated with free-living migratory birds . Migratory birds of diverse species can play significant roles in the ecology and circulation of some arboviruses (e.g., eastern and western equine encephalomyelitis and Sindbis alphaviruses, West Nile and St . Louis encephalitis flaviviruses), influenza A virus, Newcastle disease virus, duck plague herpes-virus, Chlamydophila psittaci, Anaplasma phagocytophilum, Borrelia burgdorferi sensu lato, Campylobacter jejuni, Salmonella enterica, Pasteurella multocida, Mycobacterium avium, Candida spp., and avian hematozoans . The efficiency of dispersal of pathogenic microorganisms depends on a wide variety of biotic and abiotic factors affecting the survival of the agent in, or disappearance from, a habitat or ecosystem in a new geographic area. J Antimicrob Chemother . 2005 Jan 13; {Epub ahead of print} Susceptibility of Campylobacter hyointestinalis subsp . hyointestinalis to antimicrobial agents and characterization of quinolone-resistant strains; Laatu M et al.; To study the susceptibility of Campylobacter hyointestinalis subsp . hyointestinalis to several antimicrobial agents and to investigate the mechanisms of nalidixic acid and ciprofloxacin resistance . The disc diffusion method was employed to study the susceptibility of 49 C . hyointestinalis subsp . hyointestinalis strains of reindeer and bovine origin to 12 different antimicrobial agents . In addition, the MICs of nalidixic acid and ciprofloxacin were determined . The nucleotide sequence of a 270 bp fragment of the gyrA gene was determined in ciprofloxacin-susceptible and -resistant strains . The effect of a multidrug efflux pump inhibitor Phe-Arg-beta-naphthylamide (PAbetaN) on the MICs of ciprofloxacin and nalidixic acid was also studied . The only decreased susceptibility for antimicrobial agents of this study was observed for sulphonamide compound and streptomycin (24% and 32% of the strains, respectively), and this phenomenon was observed exclusively in the bovine strains . In sequence studies, a Thr-86-->Ile change was found in strains with MICs of ciprofloxacin of >/= 64 mg/L, but this mutation was absent in strains with lower resistance levels . The use of PAbetaN did not affect the MIC of ciprofloxacin but decreased the MIC of nalidixic acid 2-4-fold . The Finnish C . hyointestinalis subsp . hyointestinalis strains are susceptible to a majority of the antimicrobials of veterinary importance . The mechanism of ciprofloxacin resistance at lower levels (</=32 mg/L) is not associated with a specific mutation in the quinolone resistance-determining region of the gyrA gene . Finally, there are distinct differences in the mechanisms of ciprofloxacin resistance compared with nalidixic acid resistance within the studied species. Clin Microbiol Infect, 2005 Jan, 11(1), 63 - 5 Investigation of possible cytokine induction in peripheral blood mononuclear cells by heat-stable serotypes of Campylobacter jejuni; Chatzipanagiotou S et al.; Several Campylobacter jejuni heat-stable (HS) serotypes have been associated with the autoimmune Guillain-Barre neurological syndrome (GBS) . In order to examine the possible involvement of cytokines in this phenomenon, the levels of three pro-inflammatory cytokines (interleukin (IL)-2sRa, IL-6 and interferon (IFN)-gamma) and one anti-inflammatory cytokine (IL-10) were measured in peripheral blood mononuclear cells after induction by different C . jejuni serotypes . No differences were found for IL-6, IFN-gamma and IL-10, but the non-sialylated serotype HS:3 was associated with decreased production of IL-2sRa . The results raise the possibility that absence of sialylation might be associated with the inability to induce inflammatory factors such as cytokines. Arch Microbiol . 2005 Jan 13; {Epub ahead of print} Phosphonate catabolism by Campylobacter spp; Mendz GL et al.; The catabolism of phosphonates (Phn) by Campylobacter spp . was investigated employing nuclear magnetic resonance spectroscopy and cell culture techniques . The bacteria were capable of cleaving the Phn bonds of different compounds, including alpha-aminomethylphosphonate, phosphonoacetate and phenylphosphonate (PhePhn) . The kinetic parameters of these activities were determined in vivo in intact cells and in situ in whole-cell lysates . Cleavage of Phn-bearing compounds was associated with the cell-wall and cytosolic fractions . Results from substrate competition experiments suggested that at least two enzyme activities appeared to be involved in the cleavage of carbon-phosphate (C-P) bonds . In silico analyses indicated that no genes orthologous to those encoding C-P bond-cleaving enzymes in other bacteria were present in the Campylobacter jejuni genome . In most bacteria studied, Phn catabolism is induced under conditions of phosphate limitation; however, in Campylobacter spp . these activities were expressed in cells grown in media rich in phosphate . In chemically defined media, PhePhn supported bacterial growth and proliferation at concentrations above 100 muM in the absence of phosphate . Thus, Phn utilisation may be a survival mechanism of Campylobacter spp . in milieux lacking sufficient phosphate . The expression of these enzyme activities in media abundant in phosphate suggested also that they may have other physiological roles. Appl Environ Microbiol, 2005 Jan, 71(1), 85 - 92 Temperature-driven campylobacter seasonality in England and wales; Louis VR et al.; Campylobacter incidence in England and Wales between 1990 and 1999 was examined in conjunction with weather conditions . Over the 10-year interval, the average annual rate was determined to be 78.4 +/- 15.0 cases per 100,000, with an upward trend . Rates were higher in males than in females, regardless of age, and highest in children less than 5 years old . Major regional differences were detected, with the highest rates in Wales and the southwest and the lowest in the southeast . The disease displayed a seasonal pattern, and increased campylobacter rates were found to be correlated with temperature . The most marked seasonal effect was observed for children under the age of 5 . The seasonal pattern of campylobacter infections indicated a linkage with environmental factors rather than food sources . Therefore, public health interventions should not be restricted to food-borne approaches, and the epidemiology of the seasonal peak in human campylobacter infections may best be understood through studies in young children. APMIS, 2004 Dec, 112(11-12), 908 - 29 Application of molecular genetic methods in diagnostics and epidemiology of food-borne bacterial pathogens; Lukinmaa S et al.; Lukinmaa S, Nakari UM, Eklund M, Siitonen A . Application of molecular genetic methods in diagnostics and epidemiology of food-borne bacterial pathogens . 2004:112;908-29.Salmonella enterica, Campylobacter and Yersinia species, Shiga toxin-producing Escherichia coli (STEC), Listeria monocytogenes and Clostridium perfringens are the bacterial pathogens constituting the greatest burden of food-borne disease in Finland . Several molecular genetic methods have been applied to diagnose, discriminate and survey these bacteria . PCR, PCR-RFLP and PFGE are the most widely and successfully used . However, these methods are unable to replace conventional and internationally standardised phenotyping . Electronic database libraries of the different genomic profiles will enable continuous surveillance of infections and detection of possible infection clusters at an early stage . Furthermore, whole-genome sequence data have opened up new insights into epidemiological surveillance . Laboratory-based surveillance performed in a timely manner and exploiting adequate methods, and co-operation at local, national and international levels are among the key elements in preventing food-borne diseases . This paper reviews different applications of molecular genetic methods for investigating enteric bacterial pathogens and gives examples of the methods successfully used in diagnostics and epidemiological studies in Finland. Res Microbiol, 2005 Jan-Feb, 156(1), 107 - 14 Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR; Abu-Halaweh M et al.; A two-tube real-time assay, developed in a LightCycler(TM), was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae . In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO(4)-3'), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E . coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E . coli position 1464), detected C . coli, C . lari and C . jejuni . As expected, a Tm of 65 degrees C was derived from the temperature-dependent probe DNA strand disassociation . In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C . jejuni but not for C . coli which lacks the hipO gene . A Tm of 85+/-0.5 and 56 degrees C determined from temperature-dependent dye-DNA disassociation identified C . jejuni and the non-specific PCR products, respectively, in line with our expectation . The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C . coli (74 isolates), C . jejuni (86 isolates) and non-C . coli-C . jejuni (9 isolates) . In addition, the method successfully detected C . jejuni, C . coli and C . lari from 24-h enrichment cultures initiated from 30 commercial chicken samples. Zh Mikrobiol Epidemiol Immunobiol, 2004 Nov-Dec, (6), 63 - 9 {Occurrence of Helicobacter pylori specific antigens in diseases of gastrointestinal tract}; Sequence typing and comparison of population biology of Campylobacter coli and Campylobacter jejuni; Nuffield Department of Clinical Sciences, Oxford University, John Radcliffe Hospital, Oxford OX3 9DU, United Kingdom . kate.dingle@ndcls.ox.ac.uk A multilocus sequence typing (MLST) scheme that uses the same loci as a previously described system for Campylobacter jejuni was developed for Campylobacter coli . The C . coli-specific primers were validated with 53 isolates from humans, chickens, and pigs, together with 15 Penner serotype reference isolates . The nucleotide sequence of the flaA short variable region (SVR) was determined for each isolate . These sequence data were compared to equivalent information for 17 C . jejuni isolates representing the known genetic diversity of this species . C . coli and C . jejuni share approximately 86.5% identity at the nucleotide sequence level within the MLST loci . There is evidence of genetic exchange of the housekeeping genes between the two species, but at a very low rate; only one sequence type from each species showed evidence of imported DNA . The flaA gene was more variable and has been exchanged many times between the two species, making it an unreliable marker for species identification but useful for distinguishing closely related strains . All but 3 of 21 human C . coli clinical isolates were distinct, according to the combined MLST and SVR sequences . The use of a common MLST scheme allows direct comparisons of the population biology and molecular epidemiology of these two closely related human pathogens. J Clin Microbiol, 2005 Jan, 43(1), 335 - 9 Epidemiology of Campylobacter jejuni isolated from patients with Guillain-Barré and Fisher syndromes in Japan; Takahashi M et al.; Campylobacter jejuni isolation is the standard for the diagnosis of this type of bacterial infection, but there have been no epidemiological studies of a large number of C . jejuni isolates from patients with Guillain-Barre syndrome (GBS) and Fisher syndrome (FS) . For 13 years, stool specimens from GBS/FS patients have been sent from 378 hospitals throughout Japan to the Tokyo Metropolitan Institute of Public Health . A total of 113 strains (11%) were isolated from the stool specimens from 1,049 patients . The isolation rate did not differ by region . The rates were 22% for 449 patients with a history of diarrhea and 2% for the others . An additional 18 isolates were provided by various hospitals . There was no noticeable seasonal distribution in the onset of C . jejuni isolated from patients with GBS/FS . The male/female ratios were 1.7:1 for GBS and 2.2:1 for FS . The patient age range showed a peak in 10- to 30-year-old subjects who had GBS and in 10- to 20-year-old subjects who had FS . The predominance of young adults and male patients who had C . jejuni-associated GBS/FS may be related to the preponderance of young adults and male patients who had C . jejuni enteritis . The median interval from diarrhea onset to neurologic symptom onset was 10 days for GBS/FS . Penner's C . jejuni serotype HS:19 was more frequently present in GBS (67%) than in enteritis (6%) patients . HS:2 was more frequent in FS (41%) than in enteritis (14%) patients . These findings suggest that certain C . jejuni strains specifically trigger GBS and that others specifically trigger FS. Proc Natl Acad Sci U S A . 2005 Jan 5; {Epub ahead of print} Enhanced in vivo fitness of fluoroquinolone-resistant Campylobacter jejuni in the absence of antibiotic selection pressure; Luo N et al.; Campylobacter jejuni, a major foodborne human pathogen, has become increasingly resistant to fluoroquinolone (FQ) antimicrobials . By using clonally related isolates and genetically defined mutants, we determined the fitness of FQ-resistant Campylobacter in chicken (a natural host and a major reservoir for C . jejuni) in the absence of antibiotic selection pressure . When monoinoculated into the host, FQ-resistant and FQ-susceptible Campylobacter displayed similar levels of colonization and persistence in the absence of FQ antimicrobials . The prolonged colonization in chickens did not result in loss of the FQ resistance and the resistance-conferring point mutation (C257 --> T) in the gyrA gene . Strikingly, when coinoculated into chickens, the FQ-resistant Campylobacter isolates outcompeted the majority of the FQ-susceptible strains, indicating that the resistant Campylobacter was biologically fit in the chicken host . The fitness advantage was not due to compensatory mutations in the genes targeted by FQ and was linked directly to the single point mutation in gyrA, which confers on Campylobacter a high-level resistance to FQ antimicrobials . In certain genetic backgrounds, the same point mutation entailed a biological cost on Campylobacter, as evidenced by its inability to compete with the FQ-susceptible Campylobacter . These findings provide a previously undescribed demonstration of the profound effect of a resistance-conferring point mutation in gyrA on the fitness of a major foodborne pathogen in its natural host and suggest that the rapid emergence of FQ-resistant Campylobacter on a worldwide scale may be attributable partly to the enhanced fitness of the FQ-resistant isolates. Microbiology, 2005 Jan, 151(Pt 1), 243 - 57 Campylobacter jejuni gene expression in response to iron limitation and the role of Fur; Holmes K et al.; Campylobacter jejuni is a zoonotic pathogen and the most common cause of bacterial foodborne diarrhoeal illness worldwide . To establish intestinal colonization prior to either a commensal or pathogenic interaction with the host, C . jejuni will encounter iron-limited niches where there is likely to be intense competition from the host and normal microbiota for iron . To gain a better understanding of iron homeostasis and the role of ferric uptake regulator (Fur) in iron acquisition in C . jejuni, a proteomic and transcriptome analysis of wild-type and fur mutant strains in iron-rich and iron-limited growth conditions was carried out . All of the proposed iron-transport systems for haemin, ferric iron and enterochelin, as well as the putative iron-transport genes p19, Cj1658, Cj0177, Cj0178 and cfrA, were expressed at higher levels in the wild-type strain under iron limitation and in the fur mutant in iron-rich conditions, suggesting that they were regulated by Fur . Genes encoding a previously uncharacterized ABC transport system (Cj1660-Cj1663) also appeared to be Fur regulated, supporting a role for these genes in iron uptake . Several promoters containing consensus Fur boxes that were identified in a previous bioinformatics search appeared not to be regulated by iron or Fur, indicating that the Fur box consensus needs experimental refinement . Binding of purified Fur to the promoters upstream of the p19, CfrA and CeuB operons was verified using an electrophoretic mobility shift assay (EMSA) . These results also implicated Fur as having a role in the regulation of several genes, including fumarate hydratase, that showed decreased expression in response to iron limitation . The known PerR promoters were also derepressed in the C . jejuni Fur mutant, suggesting that they might be co-regulated in response to iron and peroxide stress . These results provide new insights into the effects of iron on metabolism and oxidative stress response as well as the regulatory role of Fur. Microbiology, 2005 Jan, 151(Pt 1), 233 - 42 A sulphite respiration system in the chemoheterotrophic human pathogen Campylobacter jejuni; Myers JD et al.; The ability to use sulphite as a respiratory electron donor is usually associated with free-living chemolithotrophic sulphur-oxidizing bacteria . However, this paper shows that the chemoheterotrophic human pathogen Campylobacter jejuni has the ability to respire sulphite, with oxygen uptake rates of 23+/-8 and 28+/-15 nmol O(2) min(-1) (mg cell protein)(-1) after the addition of 0.5 mM sodium sulphite or metabisulphite, respectively, to intact cells . The C . jejuni NCTC 11168 Cj0004c and Cj0005c genes encode a monohaem cytochrome c and molybdopterin oxidoreductase, respectively, homologous to the sulphite : cytochrome c oxidoreductase (SOR) of Starkeya novella . Western blots of C . jejuni periplasm probed with a SorA antibody demonstrated cross-reaction of a 45 kDa band, consistent with the size of Cj0005 . The Cj0004c gene was inactivated by insertion of a kanamycin-resistance cassette . The resulting mutant showed wild-type rates of formate-dependent respiration but was unable to respire with sulphite or metabisulphite as electron donors . 2-Heptyl-4-hydroxyquinoline-N-oxide (HQNO), a cytochrome bc(1) complex inhibitor, did not affect sulphite respiration at concentrations up to 25 muM, whereas formate respiration (which occurs partly via a bc(1) dependent route) was inhibited 50 %, thus suggesting that electrons from sulphite enter the respiratory chain after the bc(1) complex at the level of cytochrome c . Periplasmic extracts of wild-type C . jejuni 11168 showed a symmetrical absorption peak at 552 nm after the addition of sulphite, demonstrating the reduction of cytochrome c . No cytochrome c reduction was observed after addition of sulphite to periplasmic extracts of the Cj0004c mutant . A fractionation study confirmed that the majority of the SOR activity is located in the periplasm in C . jejuni, and this activity was partially purified by ion-exchange chromatography . The presence of a sulphite respiration system in C . jejuni is another example of the surprising diversity of the electron-transport chain in this small-genome pathogen . Sulphite respiration may be of importance for survival in environmental microaerobic niches and some foods, and may also provide a detoxification mechanism for this normally growth-inhibitory compound. Microbiology, 2005 Jan, 151(Pt 1), 219 - 31 Characterization of new DsbB-like thiol-oxidoreductases of Campylobacter jejuni and Helicobacter pylori and classification of the DsbB family based on phylogenomic, structural and functional criteria; Raczko AM et al.; In Gram-negative bacterial cells, disulfide bond formation occurs in the oxidative environment of the periplasm and is catalysed by Dsb (disulfide bond) proteins found in the periplasm and in the inner membrane . In this report the identification of a new subfamily of disulfide oxidoreductases encoded by a gene denoted dsbI, and functional characterization of DsbI proteins from Campylobacter jejuni and Helicobacter pylori, as well as DsbB from C . jejuni, are described . The N-terminal domain of DsbI is related to DsbB proteins and comprises five predicted transmembrane segments, while the C-terminal domain is predicted to locate to the periplasm and to fold into a beta-propeller structure . The dsbI gene is co-transcribed with a small ORF designated dba (dsbI-accessory) . Based on a series of deletion and complementation experiments it is proposed that DsbB can complement the lack of DsbI but not the converse . In the presence of DsbB, the activity of DsbI was undetectable, hence it probably acts only on a subset of possible substrates of DsbB . To reconstruct the principal events in the evolution of DsbB and DsbI proteins, sequences of all their homologues identifiable in databases were analysed . In the course of this study, previously undetected variations on the common thiol-oxidoreductase theme were identified, such as development of an additional transmembrane helix and loss or migration of the second pair of Cys residues between two distinct periplasmic loops . In conjunction with the experimental characterization of two members of the DsbI lineage, this analysis has resulted in the first comprehensive classification of the DsbB/DsbI family based on structural, functional and evolutionary criteria. Pediatr Infect Dis J, 2004 Dec, 23(12), 1098 - 104 Outbreaks of enteric infections caused by multiple pathogens associated with calves at a farm day camp; Smith KE et al.; BACKGROUND: Transmission of enteric pathogens at venues where the public contacts farm animals is a growing problem, particularly among children . In 2000 and again in 2001, enteric illness outbreaks caused by multiple pathogens occurred at a farm day camp for children in Minnesota . METHODS: Camp attendees were interviewed about illness history and potential exposures each year . Stool samples from children and calves at the camp were tested for enteric pathogens . RESULTS: Eighty-four illnesses were documented among camp attendees in the 2 outbreaks; laboratory-confirmed infections included Cryptosporidium parvum (17 cases), Escherichia coli O157:H7 (4), non-O157 Shiga toxin-producing E . coli (STEC) (7) and Salmonella enterica serotype Typhimurium and Campylobacter jejuni (1 each) . Kindergarten-fourth grade children provided 1-on-1 care for a bottle-fed calf . Sixty of 83 calves tested carried at least 1 pathogen, including Giardia spp . (26 calves), C . parvum (25), non-O157 STEC (17), Campylobacter spp . (11), 3 serotypes of Salmonella enterica (10) and E . coli O157:H7 (2) . Risk factors among children included caring for an ill calf and getting visible manure on their hands . Always washing hands with soap after touching a calf and washing hands before going home were protective . Prevention measures implemented in 2000 failed to prevent the second outbreak . CONCLUSIONS: Calves were the reservoir of multiple enteric pathogens for children at a farm day camp . Health care providers should consider numerous zoonotic pathogens in patients presenting with gastroenteritis after contact with cattle . Public health officials should help venue operators prospectively implement published guidelines to prevent zoonotic disease transmission. J R Army Med Corps, 2004 Sep, 150(3), 175 - 8 An outbreak of campylobacteriosis amongst directing staff and students at the Infantry Training Centre, Brecon, Wales, March 2004; Hennessy EP; A cohort study was undertaken to determine the source of an outbreak of gastrointestinal illness affecting a number of military personnel at ITC, Brecon during the period 19--30 March 2004 . Of 105 soldiers on a field training exercise over the period 15--19 March 2004, 36 subsequently developed symptoms . Nine patients had Campylobacter sp identified in their stool . Water was provided from a single source . This water was used for washing, shaving, drinking and the preparation of rations . Although not statistically significant, epidemiological investigation suggests that the water may have been the vehicle of infection. Can J Public Health, 2004 Nov-Dec, 95(6), 446 - 50 Syndromic surveillance of gastrointestinal illness using pharmacy over-the-counter sales . A retrospective study of waterborne outbreaks in Saskatchewan and Ontario; Edge VL et al.; OBJECTIVE: To ascertain if monitoring over-the-counter (OTC) drug sales could provide a timely syndromic surveillance method of detecting outbreaks of gastrointestinal illness . METHOD: This study evaluated the potential of a syndromic surveillance system by comparing retrospective pharmacy OTC sales of anti-nauseants and anti-diarrheals to emergency room visits and case numbers from two Canadian outbreaks related to water contamination by Cryptosporidium, and E.coli O157:H7 and Campylobacter . RESULTS: Local sales trends of weekly aggregate OTC products were comparable to the outbreak epidemic curves . Statistical control tests on the sales data indicated the start of the outbreak periods . CONCLUSIONS: An automated monitoring tool based on spatial and temporal trend analyses of daily OTC sales would provide supplemental community health information for public health officials that is timelier than currently available laboratory-based surveillance systems. Antimicrob Agents Chemother, 2005 Jan, 49(1), 457 - 60 Detection and quantification of macrolide resistance mutations at positions 2058 and 2059 of the 23S rRNA gene by pyrosequencing; Haanpera M et al.; A pyrosequencing method for detection and quantification of macrolide resistance mutations at positions 2058 and 2059 (Escherichia coli numbering) of the 23S rRNA gene is described . The method was developed and tested for Streptococcus pneumoniae, Streptococcus pyogenes, Mycobacterium avium, Campylobacter jejuni, and Haemophilus influenzae. J Biol Chem . 2004 Dec 21; {Epub ahead of print} Anion-independent iron coordination by the campylobacter jejuni ferric binding protein; Tom-Yew SA et al.; Campylobacter jejuni, the leading cause of human gastroenteritis, expresses a ferric binding protein (cFbpA) that in many pathogenic bacteria functions to acquire iron as part of their virulence repertoire . Recombinant cFbpA is isolated with ferric iron bound from E . coli . The crystal structure of cFbpA reveals unprecedented iron coordination by only five protein ligands . The histidine and one tyrosine are derived from the N-terminal domain, whereas the three remaining tyrosine ligands are from the C-terminal domain . Surprisingly, a synergistic anion, present in all other characterized ferric transport proteins, is not observed in the cFbpA iron binding site suggesting a novel role for this protein in iron uptake . Furthermore, cFbpA is shown to bind iron with high affinity similar to Neisserial FbpA and exhibits an unusual preference for ferrous iron (oxidized subsequently to the ferric form) or ferric iron chelated by oxalate . Sequence and structure analyses reveal that cFbpA is a member of a new class of ferric binding proteins which includes homologs from invasive and intracellular bacteria as well as cyanobacteria . Overall, six classes are defined based on clustering within the tree and by their putative iron coordination . The absence of a synergistic anion in the iron coordination sphere of cFbpA also suggests an alternative model of evolution for FbpA homologs involving an early iron binding ancestor instead of a requirement for a pre-existing anion binding ancestor. Eur J Haematol, 2005 Jan, 74(1), 70 - 2 HIV MALT lymphoma remission induced by highly active antiretroviral therapy alone; Girard T et al.; Girard T, Luquet-Besson I, Baran-Marszak F, Raphael M, Boue F . HIV(+) MALT lymphoma remission induced by highly active antiretroviral therapy alone . Eur J Haematol 2005: 74: 70-72 . (c) Blackwell Munksgaard 2005.Abstract: MALT lymphoma is usually described in association with Helicobacter pylori, HCV, HHV8, Campylobacter jejuni or in a setting of overreactive immunity . In HIV(+) patients, MALT lymphoma is most commonly described in children . We describe here an original case of HIV(+) MALT lymphoma with bronchial, conjuctival and laryngeal involvement for which a clinical and histopathological remission has been obtained with HAART alone . We conclude that HIV, as well as H . pylori, C . jejuni and HCV can target lymphogenesis in MALT lymphoma. Mol Microbiol, 2005 Jan, 55(1), 90 - 103 Analysis of Campylobacter jejuni capsular loci reveals multiple mechanisms for the generation of structural diversity and the ability to form complex heptoses; Karlyshev AV et al.; Summary We recently demonstrated that Campylobacter jejuni produces a capsular polysaccharide (CPS) that is the major antigenic component of the classical Penner serotyping system distinguishing Campylobacter into >60 groups . Although the wide variety of C . jejuni serotypes are suggestive of structural differences in CPS, the genetic mechanisms of such differences are unknown . In this study we sequenced biosynthetic cps regions, ranging in size from 15 to 34 kb, from selected C . jejuni strains of HS:1, HS:19, HS:23, HS:36, HS:23/36 and HS:41 serotypes . Comparison of the determined cps sequences of the HS:1, HS:19 and HS:41 strains with the sequenced strain, NCTC11168 (HS:2), provides evidence for multiple mechanisms of structural variation including exchange of capsular genes and entire clusters by horizontal transfer, gene duplication, deletion, fusion and contingency gene variation . In contrast, the HS:23, HS:36 and HS:23/36 cps sequences were highly conserved . We report the first detailed structural analysis of 81-176 (HS:23/36) and G1 (HS:1) and refine the previous structural interpretations of the HS:19, HS:23, HS:36 and HS:41 serostrains . For the first time, we demonstrate the commonality and function of a second heptose biosynthetic pathway for Campylobacter CPS independent of the pathway for lipooligosaccharide (LOS) biosynthesis and identify a novel heptosyltransferase utilized by this alternate pathway . Furthermore, we show the retention of two functional heptose isomerases in Campylobacter and the sharing of a phosphatase for both LOS and CPS heptose biosynthesis. J Infect, 2005 Jan, 50(1), 12 - 21 Identification and characterization of a major subgroup of conjugative Campylobacter jejuni plasmids; Schmidt-Ott R et al.; Objectives . Enterocyte invasion of Campylobacter jejuni 81-176 has been reported to depend upon the virulence plasmid pVir . The objective of this study was to determine the prevalence of pVir in clinical C . jejuni isolates, to investigate DNA homologies between C . jejuni plasmids and the significance of plasmids for C . jejuni invasiveness . Methods . DNA homologies between C . jejuni plasmids were studied by southern blot hybridization . C . jejuni invasion into human intestinal Caco-2 cells was assessed in a gentamicin exclusion assay . Results . Twenty-nine percent of C . jejuni isolated from patients with bloody or watery diarrhoea harboured plasmids of various sizes . One plasmid (7%) was a pVir homologue whereas, the majority of the plasmids (53%) belonged to a subgroup distinct from pVir . The plasmids of this novel subgroup share extensive DNA sequence homology with each other, including homologues to so-called invasion-promoting genes . However, conjugative transfer of these plasmids clearly did not increase invasiveness of plasmidless recipient C . jejuni strains . Conclusion . This study indicates that only a small proportion of C . jejuni strains carry the virulence factor pVir and that at least one other distinctive group of plasmids in C . jejuni exists, which does not seem to be associated with invasiveness. Pediatr Infect Dis J, 2004 Oct, 23(10), 966 - 8 Guillain-Barre syndrome with meningoencephalitis after Campylobacter jejuni infection; Tsugawa T et al.; A 14-year-old boy presented with progressive ascending muscle weakness, urinary retention and disturbed consciousness . Initially his cerebrospinal fluid showed pleocytosis, and protein-cellular dissociation developed later . Campylobacter jejuni was isolated from his stool and serum anti-ganglioside antibodies were positive . Our case suggests that coexistence of meningoencephalitis at an early stage of illness does not necessarily exclude the diagnosis of Guillain-Barre syndrome. J Infect Dis, 2005 Jan 1, 191(1), 11 - 9 Epub 2004 Dec 01. Etiologies and manifestations of persistent diarrhea in adults with HIV-1 infection: a case-control study in Lima, Peru; Carcamo C et al.; OBJECTIVE We sought to determine the etiologies, manifestations, and risk factors for persistent (> or =7 days) diarrhea in human immunodeficiency virus type 1 (HIV-1)-infected persons in Peru . DESIGN: The present study is a case-control study of 147 HIV-1-infected case subjects with persistent diarrhea and 147 HIV-1-infected control subjects without diarrhea . METHODS: We obtained clinical, demographic, and exposure data, CD4 lymphocyte counts, and stool samples for detection of enteric parasitic and bacterial pathogens and rotavirus . RESULTS: One or more enteric pathogen was identified in 55% of case subjects and 21% of control subjects (odds ratio adjusted for CD4 lymphocyte count, 3.8; 95% confidence interval, 2.2-6.5) . The median CD4 lymphocyte count was highest with pathogen-free diarrhea and lowest with Cryptosporidium infection . Cryptosporidium species (the most frequent pathogen), Giardia lamblia, Aeromonas species, Campylobacter species, and rotavirus were all significantly associated with diarrhea . Bacterial pathogens were significantly associated with G . lamblia and rotavirus infection . Of the bacterial pathogens (Aeromonas, Campylobacter, Salmonella, and Vibrio species and enterotoxigenic Escherichia coli), only 24% were susceptible to cotrimoxazole, whereas 90% were susceptible to ciprofloxacin . In no case did the sensitivity or positive predictive value of specific clinical and laboratory findings for curable enteric infections exceed 50% . CONCLUSIONS: Several enteric pathogens were associated with diarrhea in HIV-1-infected case subjects in Peru, especially among those who were heterosexual . Clinical findings were poor predictors of detectable microbial etiology . The guidelines for initial management of chronic diarrhea with sulfamethoxazole-trimethoprim in HIV-1-infected persons require revision, at least in settings where prophylaxis with this agent is common. Acta Crystallogr D Biol Crystallogr, 2004 Dec, 60(Pt 12 Pt 2), 2349 - 51 Epub 2004 Dec. Crystallization and preliminary crystallographic studies of MOMP (major outer membrane protein) from Campylobacter jejuni; Bolla JM et al.; Campylobacter jejuni is the leading bacterial cause of human enteritis linked to ingestion of contaminated food or water . MOMP, the major outer membrane protein from these Gram-negative bacteria, belongs to the porin family . In order to determine the three-dimensional structure of this protein and to elucidate the underlying molecular mechanisms, the MOMP from C . jejuni strain 85H has been purified and crystallized by vapour diffusion . Two crystal forms were characterized for this membrane protein . X-ray diffraction data were collected to a resolution of 3.1 A using a synchrotron-radiation source from the orthorhombic crystal form, which belonged to space group P2(1)2(1)2 with unit-cell parameters a = 170.1, b = 101.9, c = 104.9 A . With a trimer in the asymmetric unit, the solvent content is 64% (V(M) = 3.4 A Da(-1)) . The other form exhibits trigonal symmetry (space group R3) with hexagonal unit-cell parameters a = b = 94.2, c = 161.2 A, but diffracts X-rays poorly to about 4 A with significant anisotropy. J Clin Microbiol, 2004 Dec, 42(12), 5731 - 8 Phylogenetic analysis and PCR-restriction fragment length polymorphism identification of Campylobacter species based on partial groEL gene sequences; Karenlampi RI et al.; The phylogeny of 12 Campylobacter species and reference strains of Arcobacter butzleri and Helicobacter pylori was studied based on partial 593-bp groEL gene sequences . The topology of the phylogenetic neighbor-joining tree based on the groEL gene was similar to that of the tree based on the 16S rRNA gene . However, groEL was found to provide a better resolution for Campylobacter species, with lower interspecies sequence similarities (range, 65 to 94%) compared with those for the 16S rRNA gene (range, 90 to 99%) and high intraspecies sequence similarities (range, 95 to 100%; average, 99%) . A new universal reverse primer that amplifies a 517-bp fragment of the groEL gene was developed and used for PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of 68 strains representing 11 Campylobacter species as well as reference strains of A . butzlerii and H . pylori . Digestion with the AluI enzyme discriminated all Campylobacter species included in the study but showed more intraspecies diversity than digestion with the ApoI enzyme . A hippurate-negative variant of Campylobacter jejuni with a high level of groEL sequence similarity to both C . jejuni (96%) and C . coli (94%) gave a unique AluI profile and an ApoI profile identical to those of other C . jejuni strains . In conclusion, groEL gene sequencing and PCR-RFLP analysis are recommended as valuable tools for the identification of Campylobacter species. J Clin Microbiol, 2004 Dec, 42(12), 5549 - 57 Differentiation of Campylobacter coli, Campylobacter jejuni, Campylobacter lari, and Campylobacter upsaliensis by a multiplex PCR developed from the nucleotide sequence of the lipid A gene lpxA; Klena JD et al.; We describe a multiplex PCR assay to identify and discriminate between isolates of Campylobacter coli, Campylobacter jejuni, Campylobacter lari, and Campylobacter upsaliensis . The C . jejuni isolate F38011 lpxA gene, encoding a UDP-N-acetylglucosamine acyltransferase, was identified by sequence analysis of an expression plasmid that restored wild-type lipopolysaccharide levels in Escherichia coli strain SM105 {lpxA(Ts)} . With oligonucleotide primers developed to the C . jejuni lpxA gene, nearly full-length lpxA amplicons were amplified from an additional 11 isolates of C . jejuni, 20 isolates of C . coli, 16 isolates of C . lari, and five isolates of C . upsaliensis . The nucleotide sequence of each amplicon was determined, and sequence alignment revealed a high level of species discrimination . Oligonucleotide primers were constructed to exploit species differences, and a multiplex PCR assay was developed to positively identify isolates of C . coli, C . jejuni, C . lari, and C . upsaliensis . We characterized an additional set of 41 thermotolerant isolates by partial nucleotide sequence analysis to further demonstrate the uniqueness of each species-specific region . The multiplex PCR assay was validated with 105 genetically defined isolates of C . coli, C . jejuni, C . lari, and C . upsaliensis, 34 strains representing 12 additional Campylobacter species, and 24 strains representing 19 non-Campylobacter species . Application of the multiplex PCR method to whole-cell lysates obtained from 108 clinical and environmental thermotolerant Campylobacter isolates resulted in 100% correlation with biochemical typing methods. J Clin Invest, 2004 Dec, 114(11), 1659 - 65 The crucial role of Campylobacter jejuni genes in anti-ganglioside antibody induction in Guillain-Barre syndrome; Godschalk PC et al.; Molecular mimicry of Campylobacter jejuni lipo-oligosaccharides (LOS) with gangliosides in nervous tissue is considered to induce cross-reactive antibodies that lead to Guillain-Barre syndrome (GBS), an acute polyneuropathy . To determine whether specific bacterial genes are crucial for the biosynthesis of ganglioside-like structures and the induction of anti-ganglioside antibodies, we characterized the C . jejuni LOS biosynthesis gene locus in GBS-associated and control strains . We demonstrated that specific types of the LOS biosynthesis gene locus are associated with GBS and with the expression of ganglioside-mimicking structures . Campylobacter knockout mutants of 2 potential GBS marker genes, both involved in LOS sialylation, expressed truncated LOS structures without sialic acid, showed reduced reactivity with GBS patient serum, and failed to induce an anti-ganglioside antibody response in mice . We demonstrate, for the first time, to our knowledge, that specific bacterial genes are crucial for the induction of anti-ganglioside antibodies. Comp Med, 2004 Oct, 54(5), 514 - 23 Lymphoglandular complexes are important colonic sites for immunoglobulin A induction against Campylobacter jejuni in a swine disease model; Mansfield LS et al.; Campylobacter jejuni is a common cause of serious food-borne illness . In an experimental model of human infection, germfree pigs were given C . jejuni, the whipworm Trichuris suis, dual infections with C . jejuni and T . suis, or no infection . In dual-infected pigs, a synergistic effect between C . jejuni and T . suis was observed 27 days after infection, when T . suis fourth-stage larvae were found in the proximal colon . In dual-infected pigs, lymphoglandular complexes (LGCs) in the distal colon were substantially enlarged, and C . jejuni was detected in cells of the follicle-associated epithelium (FAE) and in cells with macrophage morphology within these follicles . In the study reported here, cell types in colonic tissues from these pigs were analyzed by use of immunohistochemical and morphometric analyses for cell surface markers (IgM, IgG, IgA, CD4, CD8, MHC Class II, and macrophage SWC3a) . To our knowledge, we provide the first description of cell types in mammalian LGCs, document that they have all elements necessary for antigen processing, and demonstrate the appearance of IgA germinal centers (GC) in LGCs from C . jejuni-infected pigs (single or dual infected) . Ileocecal Peyer's patches (ICPP) and mesenteric lymph nodes (MLN) also had IgA GC development if C . jejuni was present, but LGCs had the greatest amount of anti-C . jejuni staining, and appreciable increase in overall follicle size and size and number of GCs committed to IgA production . LGCs are present in humans and other mammals and are important in other enteric infections. Appl Environ Microbiol, 2004 Dec, 70(12), 7474 - 80 Effects of climate on incidence of Campylobacter spp . in humans and prevalence in broiler flocks in Denmark; Patrick ME et al.; Campylobacter infections are increasing and pose a serious public health problem in Denmark . Infections in humans and broiler flocks show similar seasonality, suggesting that climate may play a role in infection . We examined the effects of temperature, precipitation, relative humidity, and hours of sunlight on Campylobacter incidence in humans and broiler flocks by using lag dependence functions, locally fitted linear models, and cross validation methods . For humans, the best model included average temperature and sunlight 4 weeks prior to infection; the maximum temperature lagged at 4 weeks was the best single predictor . For broilers, the average and maximum temperatures 3 weeks prior to slaughter gave the best estimate; the average temperature lagged at 3 weeks was the best single predictor . The combined effects of temperature and sunlight or the combined effects of temperature and relative humidity predicted the incidence in humans equally well . For broiler flock incidence these factors explained considerably less . Future research should focus on elements within the broiler environment that may be affected by climate, as well as the interaction of microclimatic factors on and around broiler farms . There is a need to quantify the contribution of broilers as a source of campylobacteriosis in humans and to further examine the effect of temperature on human incidence after this contribution is accounted for . Investigations should be conducted into food consumption and preparation practices and poultry sales that may vary by season. Appl Environ Microbiol, 2004 Dec, 70(12), 7103 - 9 Survival of cold-stressed Campylobacter jejuni on ground chicken and chicken skin during frozen storage; Bhaduri S et al.; Campylobacter jejuni is prevalent in poultry, but the effect of combined refrigerated and frozen storage on its survival, conditions relevant to poultry processing and storage, has not been evaluated . Therefore, the effects of refrigeration at 4 degrees C, freezing at -20 degrees C, and a combination of refrigeration and freezing on the survival of C . jejuni in ground chicken and on chicken skin were examined . Samples were enumerated using tryptic soy agar containing sheep's blood and modified cefoperazone charcoal deoxycholate agar . Refrigerated storage alone for 3 to 7 days produced a reduction in cell counts of 0.34 to 0.81 log10 CFU/g in ground chicken and a reduction in cell counts of 0.31 to 0.63 log10 CFU/g on chicken skin . Declines were comparable for each sample type using either plating medium . Frozen storage, alone and with prerefrigeration, produced a reduction in cell counts of 0.56 to 1.57 log10 CFU/g in ground chicken and a reduction in cell counts of 1.38 to 3.39 log10 CFU/g on chicken skin over a 2-week period . The recovery of C . jejuni following freezing was similar on both plating media . The survival following frozen storage was greater in ground chicken than on chicken skin with or without prerefrigeration . Cell counts after freezing were lower on chicken skin samples that had been prerefrigerated for 7 days than in those that had been prerefrigerated for 0, 1, or 3 days . This was not observed for ground chicken samples, possibly due to their composition . C . jejuni survived storage at 4 and -20 degrees C with either sample type . This study indicates that, individually or in combination, refrigeration and freezing are not a substitute for safe handling and proper cooking of poultry. Appl Environ Microbiol, 2004 Dec, 70(12), 7078 - 85 Characterization of Lactobacillus coryniformis DSM 20001T surface protein Cpf mediating coaggregation with and aggregation among pathogens; Schachtsiek M et al.; Phenotypic characterization of aggregation phenotypes of Lactobacillus coryniformis revealed that strain DSM 20001T coaggregated with Escherichia coli K88, Campylobacter coli, and Campylobacter jejuni but not with other human pathogens . In addition, cells of these pathogens aggregated in the presence of the spent culture supernatant (SCS) of strain DSM 20001T . Cells of E . coli K88 remained viable in the coaggregates and aggregates for up to 24 h . Both coaggregation and aggregation (co/aggregation) occurred at pH 3.5 to 7.5 and was sensitive to heat (85 degrees C for 15 min) and proteinase K . The co/aggregation-promoting factor (Cpf) was purified, and the gene was identified by PCR with degenerate primers derived from internal amino acid sequences . The cpf gene encoded a 19.9-kDa preprotein with a sec-dependent leader and an isoelectric point of 4.4 . The amino acid sequence had no significant similarity to proteins with known functions . Northern analysis revealed not only major transcription from the promoter of cpf but also major transcription from the promoter of the preceding insertion element, ISLco1 belonging to the IS3 family . Recombinant Cpf produced in E . coli mediated aggregation of pathogens comparable to the aggregation obtained with purified Cpf or SCS of strain DSM 20001T . Cpf could be removed from cells of strain DSM 20001T by treatment with 5 M LiCl and could be subsequently reattached to the cell surface by using SCS or recombinant Cpf, which resulted in restoration of the co/aggregation property . These results together with those of the amino acid sequence analysis suggest that Cpf is a novel surface protein of L . coryniformis that mediates co/aggregation of some pathogens. Glycobiology . 2004 Dec 1; {Epub ahead of print} The N-X-S/T consensus sequence is required but not sufficient for bacterial N-linked protein glycosylation; Nita-Lazar M et al.; In the Gram-negative bacterium Campylobacter jejuni there is a pgl (protein glycosylation) locus dependent general N-glycosylation system of proteins . One of the proteins encoded by pgl locus, PglB, a homologue of the eukaryotic oligosaccharyltransferase component Stt3p, is proposed to function as an oligosaccharyltransferase in this prokaryotic system . The sequence requirements of the acceptor polypeptide for N-glycosylation were analyzed by reverse genetics using the reconstituted glycosylation of the model protein AcrA in Escherichia coli . As in eukaryotes, the N-X-S/T sequon is an essential but not a sufficient determinant for Nlinked protein glycosylation . This conclusion was supported by the analysis of a novel C . jejuni glycoprotein, HisJ . Export of the polypeptide to the periplasm was required for glycosylation . Our data support the hypothesis that eukaryotic and bacterial N-linked protein glycosylation are homologous processes. Commun Dis Intell, 2004, 28(3), 359 - 89 Foodborne disease investigation across Australia: annual report of the OzFoodNet network, 2003; OzFoodNet Working Group; In 2003, OzFoodNet conducted enhanced surveillance of foodborne diseases across Australia, which covered all states and territories . During 2003, there were 23,250 notifications of eight potentially foodborne diseases, of which 67 per cent and 30 per cent were due to Campylobacter and Salmonella infections respectively . The most common Salmonella serotype was Typhimurium, as in previous years . Most S . Enteritidis were acquired overseas, except for Queensland where 52 per cent of infections were acquired locally . Locally acquired S . Enteritidis infections in Australia were predominantly due to phage type 26 . The most common serotype of Shiga toxin producing E . coli was O157, although for 49 per cent of notified infections serotype was unknown due to the use of polymerase chain reaction based screening tests . There were 12 materno-foetal listeriosis infections in 2003, which was an increase compared to recent years . During 2003, there were 444 outbreaks of gastroenteritis and foodborne disease recorded . Ninety-nine of these were of foodborne origin affecting 1,686 persons, hospitalising 105 and causing six deaths . A wide range of agents and foods caused these outbreaks, with Salmonella Typhimurium being the most common pathogen . Outbreaks associated with fish and seafood dishes, poultry meat, and Asian style and imported foods were common . Four outbreaks with international implications were reported: an outbreak of Salmonella in Montevideo involving contaminated tahini from the Middle East and three outbreaks of norovirus infection associated with imported Japanese oysters . Outbreak data indicated a need to monitor food safety in aged care settings, restaurants and catering . Eighty-nine investigations into clusters of gastrointestinal illness where a source could not be identified were conducted, including multi-state outbreaks of salmonellosis . One multistate investigation of antibiotic resistant Salmonella Paratyphi b Java identified 18 cases who had recent exposure to tropical fish aquariums . Ninety-seven per cent of Salmonella notifications on state and territory surveillance databases have complete information on serotype and phage type . In 2003, OzFoodNet demonstrated the benefits of national collaboration to control food borne disease. BMC Infect Dis . 2004 Nov 29;4(1):54. Regional risks and seasonality in travel-associated campylobacteriosis; Ekdahl K et al.; BACKGROUND: The epidemiology of travel-associated campylobacteriosis is still largely unclear, and various known risk factors could only explain limited proportions of the recorded cases . METHODS: Using data from 28,704 notifications of travel-associated campylobacteriosis in Sweden 1997 to 2003 and travel patterns of 16,255 Swedish residents with overnight travel abroad in the same years, we analysed risks for travel-associated campylobacteriosis in 19 regions of the world, and looked into the seasonality of the disease in each of these regions . RESULTS: The highest risk was seen in returning travellers from the Indian subcontinent (1,253/100,000 travellers), and the lowest in travellers from the other Nordic countries (3/100,000 travellers) . In Africa, large differences in risk between regions were noted, with 502 /100,000 in travellers from East Africa, compared to 76/100,00 from West Africa and 50/100,000 from Central Africa . A distinct seasonal pattern was seen in all temperate regions with peaks in the summer, while no or less distinct seasonality was seen in tropical regions . In travellers to the tropics, the highest risk was seen in children below the age of six . CONCLUSIONS: Data on infections in returning travellers together with good denominator data could provide comparable data on travel risks in various regions of the world. Int J Biometeorol . 2004 Nov 23; {Epub ahead of print} Climate variability and campylobacter infection: an international study; Sari Kovats R et al.; Campylobacter is among the most important agents of enteritis in developed countries . We have described the potential environmental determinants of the seasonal pattern of infection with campylobacter in Europe, Canada, Australia and New Zealand . Specifically, we investigated the role of climate variability on laboratory-confirmed cases of campylobacter infection from 15 populations . Regression analysis was used to quantify the associations between timing of seasonal peaks in infection in space and time . The short-term association between weekly weather and cases was also investigated using Poisson regression adapted for time series data . All countries in our study showed a distinct seasonality in campylobacter transmission, with many, but not all, populations showing a peak in spring . Countries with milder winters have peaks of infection earlier in the year . The timing of the peak of infection is weakly associated with high temperatures 3 months previously . Weekly variation in campylobacter infection in one region of the UK appeared to be little affected by short-term changes in weather patterns . The geographical variation in the timing of the seasonal peak suggests that climate may be a contributing factor to campylobacter transmission . The main driver of seasonality of campylobacter remains elusive and underscores the need to identify the major serotypes and routes of transmission for this disease. Comp Immunol Microbiol Infect Dis, 2005 Jan, 28(1), 71 - 82 Bacterial flora of free-living Double-crested cormorant (Phalacrocorax auritus) chicks on Prince Edward Island, Canada, with reference to enteric bacteria and antibiotic resistance; Dobbin G et al.; Cloacal and pharyngeal swabs from 100 tree-nesting Double-crested cormorant (DCC) chicks were examined by culture for commensal and potentially pathogenic bacteria . No Salmonella or Erysipelothrix were isolated from the cloacal swabs . Twenty-two cloacal swabs were positive for Campylobacter, of which 14 were C . jejuni, C . coli, and 1 C . lari . None belonged to common serotypes isolated from humans or animals in recent years in Canada . Tests for antimicrobial drug resistance among 187 commensal Escherichia coli isolates from the cloacal swabs indicated that </=5% were resistant to any of the 12 antibiotics tested . This contrasts with the frequently high resistance rates among E . coli isolates from poultry . Pharyngeal swabs from DCC were negative for Pasteurella multocida . Culture of cloacal swabs from 100 ground-nesting DCC chicks resulted in the recovery of 19 Salmonella isolates, all of which were S . enterica serotype Typhimurium . None of these isolates were resistant to any of the 12 antibiotics tested . Altogether, these findings suggest that DCC from this region are not being colonized with commensal or potentially pathogenic enteric bacteria from agricultural or human sources and that enteric bacteria isolated from these birds are unlikely to contribute to a gene pool of antimicrobial drug resistance. Antimicrob Agents Chemother, 2004 Dec, 48(12), 4886 - 8 PCR-restriction fragment length polymorphism assay for detection of gyrA mutations associated with fluoroquinolone resistance in Campylobacter coli; Alonso R et al.; A fragment of the gyrA gene was sequenced from 34 isolates of Campylobacter coli, including 23 isolates resistant to ciprofloxacin . All ciprofloxacin-resistant isolates examined by DNA sequencing carried a point mutation at position Thr-86 on the gyrA gene product, involving the replacement of Thr-86 by Ile . A combined PCR-restriction fragment length polymorphism technique using RsaI was developed to detect this mutation. Mol Microbiol, 2004 Dec, 54(5), 1269 - 86 The Campylobacter jejuni dccRS two-component system is required for optimal in vivo colonization but is dispensable for in vitro growth; MacKichan JK et al.; A Campylobacter jejuni two-component signal transduction system (TCSTS), designated dccR-dccS (diminished capacity to colonize; Cj1223c-Cj1222c), has been found to be important for in vivo colonization but dispensable for in vitro growth . A DeltadccR response regulator mutant generated using the virulent strain 81-176 background exhibited significantly reduced colonization of immunocompetent limited flora (I-LF) mice, severe combined immunodeficient limited flora (SCID-LF) mice, and 1-day-old chicks . A DeltadccS sensor kinase mutant was likewise defective for colonization in the I-LF mouse model . DeltadccR-infected SCID-LF mice also exhibited dramatically reduced inflammation relative to wild type-infected SCID-LF mice . Despite this diminished colonization capacity, the DeltadccRS mutants were indistinguishable from wild type for growth under numerous in vitro conditions as well as for various phenotypes . Microarray analysis identified several genes encoding putative periplasmic and membrane proteins as being regulated by this two-component system; binding of purified His-tagged DccR to the promoter region of two of these genes supports a direct protein-DNA interaction . A conserved repeat sequence was identified in the promoter regions of these genes and in three other promoter regions in the genome, including that of an operon encoding a putative type I secretion system . Two of the regulated target genes were found to be essential for optimal colonization . Both the two-component system and the putative regulated genes have uncharacterized homologues in other Campylobacter and Helicobacter spp., suggesting that they may perform an important function in colonization among a variety of related pathogenic species. J Int Acad Periodontol, 2004 Oct, 6(4), 113 - 9 Herpesviruses, the missing link between gingivitis and periodontitis? Slots J. Herpesviruses appear to assume a major etiopathogenic role in various types of destructive periodontal disease . Human cytomegalovirus (HCMV), Epstein-Barr virus (EBV) and HCMV-EBV co-infection are closely associated with disease-active periodontitis in juveniles and adults, with acute necrotizing ulcerative gingivitis in children, and with periodontal abscesses . In particular, HCMV reactivation in periodontitis lesions seems to be linked to advancing disease . HCMV infects periodontal monocytes/macrophages and T-lymphocytes, and EBV infects periodontal B-lymphocytes . Herpesvirus-infected inflammatory cells generate a great variety of pro-inflammatory cytokines and may possess diminished ability to defend against bacterial challenge . Herpesvirus-associated periodontal sites tend to harbor elevated levels of periodontopathic bacteria, including Dialister pneumosintes, Porphyromonas gingivalis, Tannerella forsythia, Prevotella intermedia, Prevotella nigrescens, Treponema denticola, Campylobacter rectus and Actinobacillus actinomycetemcomitans . In summary, the available data suggest that periodontitis occurs more frequently and progresses more rapidly in herpesvirus-infected than in non-infected periodontal sites . An infectious disease model based on herpesvirus-bacteria-host immune response interactions is presented to explain how a gingivitis lesion or a stable periodontal site with increased probing depth may convert into a tissue-destroying periodontitis lesion. Int J Syst Evol Microbiol, 2004 Nov, 54(Pt 6), 2369 - 73 Campylobacter insulaenigrae sp . nov., isolated from marine mammals; Foster G et al.; Phenotypic and phylogenetic studies were performed on four Campylobacter-like organisms recovered from three seals and a porpoise . Comparative 16S rRNA gene sequencing studies demonstrated that the organisms represent a hitherto unknown subline within the genus Campylobacter, associated with a subcluster containing Campylobacter jejuni, Campylobacter coli and Campylobacter lari . DNA-DNA hybridization studies confirmed that the bacteria belonged to a single species, for which the name Campylobacter insulaenigrae sp . nov . is proposed . The type strain of Campylobacter insulaenigrae sp . nov . is NCTC 12927(T) (=CCUG 48653(T)). Blood . 2004 Nov 12; {Epub ahead of print} Immunoproliferative small intestinal disease (IPSID); a model for mature B-cell neoplasms; Al-Saleem T et al.; Immunoproliferative small intestinal disease (IPSID) was recently added to the growing list of infectious pathogen-associated human lymphomas . Molecular and immunohistochemical studies demonstrated an association with Campylobacter jejuni . IPSID is a variant of the B-cell lymphoma of mucosa associated lymphoid tissue (MALT), which involves mainly the proximal small intestine resulting in malabsorption, diarrhea and abdominal pain . Geographically, IPSID is most prevalent in the Middle East and Africa . IPSID lymphomas reveal excessive plasma cell differentiation and produce truncated alpha heavy chain proteins lacking the light chains as well as the first constant domain . The corresponding mRNA lacks the VH and the CH1 sequences and contains deletions as well as insertions of unknown origin . The encoding gene sequence reveals a deletion of V region and parts of CH1 domain . Cytogenetic studies demonstrated clonal rearrangements involving predominantly the heavy and light chain genes, including t9;14 translocation involving the PAX5 gene . Early stage IPSID responds to antibiotics (30-70% complete remission) . Most untreated IPSID patients progress to lymphoplasmacytic and immunoblastic lymphoma invading the intestinal wall, mesenteric lymph nodes, and may metastasize to a distant organ . IPSID lymphoma shares clinical, morphological and molecular features with MALT lymphoma, lymphoplasmacytic lymphoma and with plasma cell neoplasms. Int J Food Microbiol, 2004 Dec 15, 97(2), 187 - 95 Survival of Campylobacter jejuni on various fresh produce; Karenlampi R et al.; The survival of seven human and two chicken Campylobacter jejuni strains, with known Penner heat-stable (HS) serotypes and pulsed-field gel electrophoresis (PFGE) genotypes, was investigated on fresh-cut iceberg lettuce . In addition, the survival of four selected C . jejuni strains was assessed on cantaloupe pieces, cucumber slices, grated carrot and strawberries . Fresh produce was inoculated with 10(5) to 10(7) colony-forming units (CFU) of C . jejuni per gram, and the bacterium was enumerated using standard procedures after sample storage at 7 and 21 degrees C for 24, 48 and 72 h . The absolute values of the slopes (death rates) of the survival curves (log(10) CFU/g versus time) were calculated and compared . At 7 degrees C, the mean death rates (day(-1)) were 0.44 on cantaloupe, 0.41 on cucumber slices, 0.43 on grated carrot, 0.59 on iceberg lettuce and 1.02 on strawberries . The corresponding death rates (day(-1)) at 21 degrees C were 1.52, 1.55, 2.61, 1.39 and 8.74 . The death rate of C . jejuni on strawberries (pH 3.4) was significantly (P<0.05) higher than on other produce . Moreover, the death rate at 21 degrees C as compared with 7 degrees C was significantly higher (P<0.05) . Minor differences were observed in the survival of different C . jejuni strains . Our results suggest that after contamination of fresh produce, including strawberries, C . jejuni may survive sufficiently long to pose a risk to the consumer. J Antimicrob Chemother, 2004 Dec, 54(6), 1025 - 1030 Epub 2004 Nov 10. Antimicrobial resistance in Campylobacter strains isolated from French broilers before and after antimicrobial growth promoter bans; Desmonts MH et al.; OBJECTIVES: The antimicrobial susceptibility of Campylobacter strains isolated from standard and free-range broilers in 1992-1996 and 2001-2002 was studied . METHODS: Strains were isolated from caeca or skin samples collected from standard or free-range broilers arriving in slaughterhouses . The MICs of ampicillin, nalidixic acid, enrofloxacin, tetracycline, erythromycin and gentamicin were determined by agar dilution and compared according to species (Campylobacter jejuni or Campylobacter coli), production system and sampling period . RESULTS: Results showed that all chickens harboured Campylobacter . An increase over time of the C . coli/C . jejuni ratio for standard chickens occurred . A wide range of MICs was observed among isolates from the same broiler or from the same farm . Strains collected on entry to the slaughterhouse and after storage showed no significant difference in their antibiotic resistance . C . coli was more resistant than C . jejuni to tetracycline and erythromycin during the first period and to all tested molecules (except gentamicin) during the second period . Strains isolated from standard chickens were also more often resistant than those isolated from free-range broilers . The percentage of C . jejuni strains resistant to ampicillin decreased from 1992-1996 to 2001-2002, whereas no change could be observed for the other antimicrobial agents . However, for C . coli the resistance to ampicillin, nalidixic acid, enrofloxacin, tetracycline and erythromycin significantly increased . CONCLUSION: There was an increase in the incidence of antibiotic resistance of C . coli between 1992-1996 and 2001-2002. An Pediatr (Barc), 2004 Nov, 61(5), 403 - 7 {Erythema nodosum: etiological changes in the last two decades}; Sota Busselo I et al.; OBJECTIVE: To study the etiological factors associated with erythema nodosum in children hospitalized between January 1985 and December 2003 . MATERIAL AND METHODS: We performed a retrospective, descriptive study through review of the medical records of children with a diagnosis of erythema nodosum (MBDS-ICD 9-CM, code 6952) . Forty-five patients (27 boys and 18 girls) aged between 10 months and 14 years were studied . The following variables were analyzed: age, sex, associated symptoms, complementary investigations (blood count, erythrocyte sedimentation rate, throat swab, chest x-ray, Mantoux test, ASLO titer, stool culture, serology) and final diagnosis . RESULTS: The most frequent etiology was tuberculosis (10 patients), followed by Salmonella enteritidis (7 patients), group A beta -hemolytic Streptococcus (3 patients), Salmonella typhimurium (2 patients), Campylobacter jejuni (2 patients), Yersinia enterocolitica (1 patient), infectious mononucleosis caused by Epstein Barr virus (1 patient), cat scratch disease (1 patient), BCG vaccination (1 patient), associated chronic hepatitis B infection (1 patient), and associated amoxicillin treatment (1 patient) . Etiology was unknown in 15 patients . The last case of erythema nodosum associated with tuberculous infection dated back to 1991, after which the most frequent etiologic factors associated with erythema nodosum were gastrointestinal pathogens . CONCLUSIONS: According to our results, the main etiological factor currently associated with erythema nodosum is gastrointestinal infection . Consequently, stool cultures, especially when there are associated gastrointestinal symptoms, are essential. Avian Dis, 2004 Sep, 48(3), 647 - 50 Inability of cecal microflora to promote reversion of viable nonculturable Campylobacter jejuni; Ziprin RL et al.; Campylobacter jejuni cells are able to enter a viable but nonculturable (VBNC) state when they are suspended in water . In the present experiments we inoculated day-of-hatch leghorn and broiler chicks with normal gut microflora and subsequently challenged these with high doses of VBNC C . jejuni . The objective was to determine if the pre-establishment of a normal gut flora would enable VBNC Campylobacter to recover, revert to the vibrionic form, and colonize the cecum . Day-of-hatch leghorn and broiler chicks were gavaged through the esophagus with 0.75 ml of a continuous-flow culture of normal cecal organisms . Two days after gavage, the same chicks were gavaged with 0.75 ml (greater than 10(9) colony-forming units) of a VBNC suspension of C . jejuni . Seven days later, cecal contents were collected, serially diluted, and examined for the presence of viable culturable C . jejuni . Our results demonstrated that the VBNC C . jejuni cells were unable to revert to a vibrionic culturable form capable of colonizing the cecum. Avian Dis, 2004 Sep, 48(3), 625 - 30 Isolation and prevalence of Campylobacter in the reproductive tracts and semen of commercial turkeys; Cole K et al.; Campylobacter is one of the most commonly reported bacterial causes of human foodborne infections in the United States, and epidemiologic evidence indicates that a significant proportion of human infections result from the improper preparation of poultry products . Campylobacter frequently colonizes the avian intestinal tract, but recent research indicates that this organism can also colonize the avian reproductive tract and possibly contaminate eggs and subsequent offspring . The present studies were undertaken to determine the prevalence of Campylobacter in the reproductive systems of commercial turkeys . In the first study, pooled semen samples from seven commercial turkey farms were randomly collected by abdominal massage over a period of 13 wk . The pooled semen samples were serially diluted, and 0.1 ml of each dilution was plated on Campy-Line agar and incubated at 42 C for 48 hr in a microaerophilic environment for enumeration of Campylobacter . Campylobacter was isolated from 57 of the 59 pooled semen samples, and levels ranged from below the limit of detection (<10(1)) to 1.6 x 10(6) cfu/ml of semen . In the second study, the reproductive tracts of 11 hens and 17 toms were aseptically excised, and the segments (female: vagina, shell gland, isthmus, magnum, and infundibulum; male: ductus deferens and testes) were swabbed with a dry cotton sterile swab . The swabs were incubated for 24 hr in Campylobacter enrichment broth, and 0.1 ml of the enriched sample solution was streaked onto Campy-Line agar plates and incubated at 42 C for 48 hr in a microaerophilic environment . Of the 11 hens sampled, Campylobacter was isolated from the vagina (10/11), the shell gland (7/11), the isthmus (8/11), the magnum (6/11), and the infundibulum (4/11) . Of the 17 toms sampled, Campylobacter was isolated from the ductus deferens (8/17) and the testes (2/17) . Campylobacter is present in the reproductive tracts and semen of commercial turkeys and may lead to vertical transmission of Campylobacter from the hen to the chick. J Vet Med B Infect Dis Vet Public Health, 2004 Oct-Nov, 51(8-9), 374 - 9 Evidence of an association between use of anti-microbial agents in food animals and anti-microbial resistance among bacteria isolated from humans and the human health consequences of such resistance; Angulo FJ et al.; Several lines of evidence indicate that the use of anti-microbial agents in food animals is associated with anti-microbial resistance among bacteria isolated from humans . The use of anti-microbial agents in food animals is most clearly associated with anti-microbial resistance among Salmonella and Campylobacter isolated from humans, but also appears likely among enterococci, Escherichia coli and other bacteria . Evidence is also accumulating that the anti-microbial resistance among bacteria isolated from humans could be the result of using anti-microbial agents in food animals and is leading to human health consequences . These human health consequences include: (i) infections that would not have otherwise occurred and (ii) increased frequency of treatment failures and increased severity of infection . Increased severity of infection includes longer duration of illness, increased frequency of bloodstream infections, increased hospitalization and increased mortality . Continued work and research efforts will provide more evidence to explain the connection between the use of anti-microbial agents in food animals and anti-microbial-resistant infections in humans . One particular focus, which would solidify this connection, is to understand the factors that dictate spread of resistance determinants, especially resistant genes . With continued efforts on the part of the medical, veterinary and public health community, such research may contribute to more precise guidelines on the use of anti-microbials in food animals. J Vet Med B Infect Dis Vet Public Health, 2004 Oct-Nov, 51(8-9), 361 - 3 Veterinary use of antimicrobials and emergence of resistance in zoonotic and sentinel bacteria in the EU; Bywater RJ; Antimicrobials are essential for treatment of sick animals, but even if used correctly, may eventually lead to antimicrobial resistance . While this represents a potential hazard to humans, the great majority of resistant human pathogens, especially the more important ones, are unrelated to animal sources . A survey of informed medical opinion suggested that of the human antimicrobial resistance problem, <4% was seen as potentially linked to animal sources . This proportion related largely to zoonotic bacteria which by definition have the capacity to carry resistance between species, although the evidence for resulting harm remains limited . A recent study compared resistance among chicken, pig and cattle isolates of Salmonella spp., Campylobacter spp . and Escherichia coli from a series of EU countries . When tested against antimicrobial agents, this survey showed variation of resistance between countries, between hosts and between organisms . Such variation may give insight into preferred methods of antimicrobial administration or disease control, but it is clear that the epidemiology of antimicrobial resistance induction and dissemination in animals remains complex and is yet to be fully understood. Epidemiol Mikrobiol Imunol, 2004 Aug, 53(3), 100 - 5 {Trends in the incidence of salmonellosis and campylobacteriosis in the Czech Republic}; Prikazska M et al.; Salmonellosis and campylobacteriosis are the most frequently reported acute enteric diseases of infectious origin in the Czech Republic . Epidemiological data on salmonellosis and campylobacteriosis have been reportable in this country since 1951 and 1984, respectively . In 2003, 53,486 cases of acute enteric infections were reported: 26,899 (52%) diagnosed as salmonellosis and 20,063 (almost 40%) diagnosed as campylobacteriosis . In 1989, the annual incidence of salmonellosis was three times as high as in the previous year, the upward trend continued until 1995 (528/100,000) and since 1998 the salmonellosis incidence rates have been declining . The incidence of campylobacteriosis showed a progressive increase since 1984 to peak in 2002 with a following slight decline in 2003 . Morbidity from salmonellosis and campylobacteriosis is highest in the age group 0-4-year-olds . The most frequent causative agents are Salmonella Enteritidis (96%) and Campylobacter jejuni, respectively . Both infections are foodborne . Ready-to-eat meals, poultry, confectionery and eggs seem to be most frequently implicated in outbreaks of salmonellosis in public catering and families . Sporadic cases of campylobacteriosis are mostly associated with ingestion of poultry and chopped meat . The incidence rates of these two infections are positively correlated with the average daily temperatures. Biosens Bioelectron, 2004 Nov 1, 20(4), 684 - 98 Multipathogen oligonucleotide microarray for environmental and biodefense applications; Sergeev N et al.; Food-borne pathogens are a major health problem . The large and diverse number of microbial pathogens and their virulence factors has fueled interest in technologies capable of detecting multiple pathogens and multiple virulence factors simultaneously . Some of these pathogens and their toxins have potential use as bioweapons . DNA microarray technology allows the simultaneous analysis of thousands of sequences of DNA in a relatively short time, making it appropriate for biodefense and for public health uses . This paper describes methods for using DNA microarrays to detect and analyze microbial pathogens . The FDA-1 microarray was developed for the simultaneous detection of several food-borne pathogens and their virulence factors including Listeria spp., Campylobacter spp., Staphylococcus aureus enterotoxin genes and Clostridium perfringens toxin genes . Three elements were incorporated to increase confidence in the microarray detection system: redundancy of genes, redundancy of oligonucleotide probes (oligoprobes) for a specific gene, and quality control oligoprobes to monitor array spotting and target DNA hybridization . These elements enhance the reliability of detection and reduce the chance of erroneous results due to the genetic variability of microbes or technical problems with the microarray . The results presented demonstrate the potential of oligonucleotide microarrays for detection of environmental and biodefense relevant microbial pathogens. Dis Aquat Organ, 2004 Sep 8, 60(3), 233 - 40 Development of monoclonal antibodies for detection of necrotizing hepatopancreatitis in penaeid shrimp; Bradley-Dunlop DJ et al.; Monoclonal antibodies (MAbs) were produced against necrotizing hepatopancreatitis bacteria (NHP-B) of penaeid shrimp . The MAbs tested in dot-immunoblot (D-IB) assays were capable of detecting the NHP-B in hepatopancreas samples collected from moribund juvenile Litopenaeus vannamei during an experimentally induced NHP-B infection . The MAbs were also screened by immunohistochemistry (IHC) using case submissions that were determined to be infected not only by histology, but also polymerase chain reaction (PCR) and in situ hybridization (ISH) assays using specific digoxigenin (DIG)-labeled probes on histological sections prepared from naturally infected shrimp . Two of the MAbs were chosen for development of detection methods for NHP . The MAbs were tested using IHC methods on Davidson's alcohol-formalin-acetic acid (AFA) fixed tissue sections and identified NHP-B infected cells and tissues in a pattern similar to that seen with DIG-labeled NHP-specific gene probes . None of the MAbs reacted with tissue from specific pathogen-free (SPF) shrimp or with shrimp tissues infected with a rickettsia-like bacteria, Vibrio sp., Campylobacter sp., and Spiroplasma sp . The MAbs were found to be negative against these other organisms, demonstrating that they are species specific and useful for rapid diagnostic detection of NHP-B. Poult Sci, 2004 Oct, 83(10), 1734 - 8 Effects of aeration and storage temperature on Campylobacter concentrations in poultry semen; Cole K et al.; Campylobacter is one of the most commonly reported bacterial causes of human foodborne infections in the United States . Recent evidence has demonstrated that Campylobacter is present in poultry semen and may contribute to the vertical transmission between the breeder hen and offspring . As Campylobacter is considered sensitive to oxygen and cold temperature, the objective of this study was to determine if aeration and storage temperature could reduce or eliminate Campylobacter in poultry semen . In 4 separate trials, pooled semen samples were collected from roosters or toms, diluted with a commercial poultry semen extender, and inoculated with an average of 10(7) cells/mL of a wild-type C . jejuni or C . coli semen isolate . Pooled ejaculates were then divided into 3 aeration treatments: Control (no aeration), air, or oxygen (gently bubbled for 20 min with atmospheric air or oxygen, respectively) . Immediately after aeration, pooled semen samples were further divided to 3 test storage temperatures: 4, 23, or 42 degrees C . At 0, 2, 6, and 24 h of storage, samples were enumerated for Campylobacter . Aeration of the semen alone, or aeration with reduced temperatures (4 or 23 degrees C), did not reduce the amount of Campylobacter compared with the controls . Campylobacter concentrations were, however, reduced when stored at 42 degrees C for 24 h . This effect is associated with reduced sperm viability and is therefore not a practical treatment of reducing Campylobacter in semen . It appears alternative methods will be needed to eliminate Campylobacter from poultry semen. Poult Sci, 2004 Oct, 83(10), 1728 - 33 Detection of Campylobacter or Salmonella in turkey semen and the ability of poultry semen extenders to reduce their concentrations; Donoghue AM et al.; Campylobacter and Salmonella are the most commonly reported pathogens causing foodborne illness in the United States . In turkeys, the potential that semen used for artificial insemination is contaminated with these foodborne pathogens has not been investigated . Because semen on turkey farms is pooled and then used to inseminate multiple hens, contaminated semen could easily spread these bacteria throughout entire flocks via artificial insemination . The objectives of this study were to 1) determine if semen from commercial turkey farms contained these foodborne pathogens and 2) if present, evaluate the efficacy of semen extenders to reduce or eliminate Campylobacter and Salmonella from semen . Semen was collected from randomized pools of ejaculates from 10 to 30 toms per farm from 6 flocks over a 7-wk period and, on occasion, was found to contain Campylobacter, Salmonella, or both . To evaluate the efficacy of semen extenders to reduce or eliminate pathogens, pooled ejaculates were challenged with Campylobacter or Salmonella and treated with commercial poultry extenders containing various concentrations of antibiotics or an antibiotic combination previously demonstrated to remove Campylobacter from mammalian semen . Results demonstrate that commercial turkey semen may contain Campylobacter or Salmonella, and the semen extenders tested either did not reduce the bacteria or reduced but did not eliminate these bacteria from semen . We concluded that semen may be a potential vehicle for Campylobacter transfer to hens, and, if this is true, development of a method for eliminating pathogens in semen before insemination could reduce the risk of colonization. J Biol Chem . 2004 Oct 27; {Epub ahead of print} A single bifunctional UDP-GlcNAc/Glc 4-epimerase supports the synthesis of three cell surface glycoconjugates in campylobacter jejuni; Bernatchez S et al.; The major cell-surface carbohydrates (lipooligosaccharide, capsule and glycoprotein N-linked heptasaccharide) of Campylobacter jejuni NCTC 11168 contain Gal and/or GalNAc residues . GalE is the sole annotated UDP-glucose 4-epimerase in this bacterium . The presence of GalNAc residues in these carbohydrates suggested that GalE may be an UDP-GlcNAc 4-epimerase . GalE was shown to epimerize UDP-Glc and UDP-GlcNAc in coupled assays with C . jejuni glycosyltransferases and in sugar nucleotide epimerization equilibria studies . Thus, GalE possesses UDP-GlcNAc 4-epimerase activity and was renamed Gne . The Km(app) of a purified MalE-Gne fusion protein for UDP-GlcNAc and UDP-GalNAc are 1087M and 1070 M while those for UDP-Glc and UDP-Gal are 780 M and 784 M . The kcat and kcat/ Km(app) were three to four times higher for UDP-GalNAc and UDP-Gal than for UDP-GlcNAc and UDP-Glc . The comparison of the kinetic parameters of MalE-Gne to those of other characterized bacterial UDP-GlcNAc 4-epimerases indicated that Gne is a bifunctional UDP-GlcNAc/Glc 4-epimerase . The UDP-sugar binding site of Gne was modeled using the structure of the UDP-GlcNAc 4-epimerase WbpP from Pseudomonas aeruginosa . Small differences were noted and these may explain the bifunctional character of the C . jejuni Gne . In a gne mutant of C . jejuni, the LOS was shown by CE-MS to be truncated by at least five sugars . Furthermore, both the glycoprotein N-linked heptasaccharide and capsule were no longer detectable by high resolution magic angle spinning NMR . These data indicate that Gne is the enzyme providing Gal and GalNAc residues for the synthesis of all three cell-surface carbohydrates in C . jejuni NCTC 11168. J Food Prot, 2004 Oct, 67(10), 2288 - 91 Effects of postchill application of acidified sodium chlorite to control Campylobacter spp . and Escherichia coli on commercial broiler carcasses; Oyarzabal OA et al.; Experiments were performed to assess the reduction of Campylobacter spp . and Escherichia coli in commercial broiler carcasses by postchill dip applications of acidified sodium chlorite . Carcass rinses were collected before the inside-outside-bird washer (IOBW), post-IOBW, postchill, and after the postchill application of acidified sodium chlorite . Prevalence and counts of Campylobacter spp . and E . coli were determined . The mean values for Campylobacter spp . and E . coli counts differed significantly at sampling sites . The IOBW reduced the bacterial counts significantly in only one experiment . The chiller reduced Campylobacter counts significantly in both experiments but failed to significantly reduce the counts of E . coli in one experiment . No major reduction in the prevalence after enrichment for Campylobacter spp . was detected post-IOBW or postchill . However, a significant reduction in Campylobacter spp . and in E . coli counts and Campylobacter spp . prevalence was seen after the postchill application of acidified sodium chlorite . These results demonstrate that the antimicrobial effect of acidified sodium chlorite applied postchill may be used to significantly reduce Campylobacter spp . and E . coli in commercial broiler carcasses . Postchill systems may eventually be used in different applications, such as mist, spray, or bath, which could be applied closer to the final stages in processing. J Food Prot, 2004 Oct, 67(10), 2171 - 7 Detection of seven virulence and toxin genes of Campylobacter jejuni isolates from Danish turkeys by PCR and cytolethal distending toxin production of the isolates; Bang DD et al.; A total of 117 Campylobacter jejuni isolates from Danish turkeys were tested for the presence of seven virulence and toxin genes by PCR . One hundred seventeen (100%) isolates were positive for flaA, cadF, and ceuE gene primers . One hundred three (88%) isolates were positive for cdt gene cluster PCR detection (cdt gene cluster-PCR), whereas 101 (86.3%), 102 (87.2%), and 110 (94%) isolates were positive for cdtA-, cdtB-, and cdtC-PCR, respectively . Only 39 (33.3%) isolates were positive for virB11 . Of 117 isolates, 114 (97.4%) produced cytolethal distending toxin (CDT) in Vero cell assays, 105 (89.7%) in Colon 205 assays, and 109 (93.2%) in chicken embryo cell assays . The CDT titers were determined in Vero cell assays . Of 117 isolates, 50 (42.7%) produced a CDT titer of 1:100, 29 (24.8%) of 1:50, and 27 (23%) of 1:5 to 1:10; 8 (6.8%) produced a CDT titer at undiluted supernatants and 3 (2.6%) produced no toxin . Twenty-nine C . jejuni isolates that were PCR negative for one or more individual cdt toxin genes also produced low or no CDT toxin . The high prevalence of the seven virulence and toxin genes demonstrates that these putative pathogenic determinants are widespread among Campylobacter isolates from turkeys and calls for further investigation for the elimination of Campylobacter infection in industrial turkey production and in industrial food chains. Emerg Infect Dis, 2004 Oct, 10(10), 1863 - 7 Arcobacter species in humans; Vandenberg O et al.; During an 8-year study period, Arcobacter butzleri was the fourth most common Campylobacter-like organism isolated from 67,599 stool specimens . Our observations suggest that A . butzleri displays microbiologic and clinical features similar to those of Campylobacter jejuni; however, A . butzleri is more frequently associated with a persistent, watery diarrhea. Emerg Infect Dis, 2004 Oct, 10(10), 1844 - 7 Campylobacteriosis, Eastern Townships, Quebec; Michaud S et al.; Independent risk factors for campylobacteriosis (eating raw, rare, or undercooked poultry; consuming raw milk or raw milk products; and eating chicken or turkey in a commercial establishment) account for <50% of cases in Quebec . Substantial regional and seasonal variations in campylobacteriosis were not correlated with campylobacter in chickens and suggested environmental sources of infection, such as drinking water. Emerg Infect Dis, 2004 Aug, 10(8), 1490 - 2 Flies and Campylobacter infection of broiler flocks; Hald B et al.; A total of 8.2% of flies caught outside a broiler house in Denmark had the potential to transmit Campylobacter jejuni to chickens, and hundreds of flies per day passed through the ventilation system into the broiler house . Our study suggests that flies may be an important source of Campylobacter infection of broiler flocks in summer. Emerg Infect Dis, 2004 Aug, 10(8), 1474 - 7 Swimming and Campylobacter infections; Schonberg-Norio D et al.; A matched case-control study was conducted to study risk factors for domestically acquired sporadic Campylobacter infections in Finland . Swimming in natural sources of water was a novel risk factor . Eating undercooked meat and drinking dug-well water were also independent risk factors for Campylobacter infection. Nat Rev Microbiol, 2004 Nov, 2(11), 872 - 85 Comparative analysis of four Campylobacterales; Eppinger M et al.; Comparative genome analysis can be used to identify species-specific genes and gene clusters, and analysis of these genes can give an insight into the mechanisms involved in a specific bacteria-host interaction . Comparative analysis can also provide important information on the genome dynamics and degree of recombination in a particular species . This article describes the comparative genome analysis of representatives of four different Campylobacterales species - two pathogens of humans, Helicobacter pylori and Campylobacter jejuni, as well as Helicobacter hepaticus, which is associated with liver cancer in rodents, and the non-pathogenic commensal species, Wolinella succinogenes. J Periodontal Res, 2004 Dec, 39(6), 398 - 404 The distribution of periodontopathic bacteria among Japanese children and their parents; Umeda M et al.; OBJECTIVE AND BACKGROUND: It is not well known how periodontopathic bacteria colonize in the oral cavity during childhood . The purpose of this study was to investigate the distribution of periodontopathic bacteria in oral cavities of children and their parents and the relationship between the bacterial findings and clinical parameters . METHODS: Fifty-six children (mean age: 8.3 +/- 3.5, range: 1-15 years), including 15 with deciduous dentition, 26 with mixed dentition and 15 with permanent dentition, and their parents participated in this study . Whole saliva and dental plaque of the children and whole saliva of their parents were collected for detection of seven species of periodontopathic bacteria (Actinobacillus actinomycetemcomitans, Tannerella forsythensis (Bacteroides forsythus), Campylobacter rectus, Porphyromonas gingivalis, Prevotella intermedia, Prevotella nigrescens and Treponema denticola) using the polymerase chain reaction method . Clinical parameters including simplified Oral Hygiene Index and Papillary-Marginal-Attachment Index were recorded for the children and their accompanied parents . RESULTS: The detection frequencies of T . forsythensis, C . rectus, P . nigrescens, T . denticola, A . actinomycetemcomitans and P . gingivalis in the oral cavities of children were 42.9%, 94.6%, 42.9%, 48.2%, 1.8% and 8.9%, respectively . T . forsythensis, P . gingivalis and T . denticola were detected more frequently in the saliva of parents (54.8%, 54.8%, 88.1%, respectively) than in the saliva of children (25.5%, 7.3%, 41.8%, respectively) . Different detection frequencies of P . nigrescens were found among the oral cavities of children with deciduous, mixed and permanent dentitions . In mixed dentition, females harbored T . forsythensis more frequently than males did . Children who harbored T . forsythensis, P . intermedia, P . nigrescens and T . denticola showed high scores for oral debris measurement by simplified Oral Hygiene Index . T . forsythensis, P . intermedia and P . nigrescens were detected more frequently in children whose parents were positive for these pathogens than in children whose parents were negative . CONCLUSIONS: High plaque retention seems to promote the colonization of periodontal pathogens in the oral cavities of children . T . forsythensis, P . intermedia and P . nigrescens were detected more frequently in the oral cavities of children whose parents already harbored these bacteria . Familial transmission of these bacteria is suggested . (c)Blackwell Munksgaard 2004 J Appl Microbiol, 2004, 97(5), 883 - 91 Microbiological status of piggery effluent from 13 piggeries in the south east Queensland region of Australia; Chinivasagam HN et al.; AIMS: To assist in the development of safe piggery effluent re-use guidelines by determining the level of selected pathogens and indicator organisms in the effluent ponds of 13 south-east Queensland piggeries . METHODS AND RESULTS: The numbers of thermotolerant coliforms, Campylobacter jejuni/coli, Erysipelothrix rhusiopathiae, Escherichia coli, Salmonella and rotavirus were determined in 29 samples derived from the 13 piggeries . The study demonstrated that the 13 final effluent ponds contained an average of 1.2 x 10(5) colony-forming units (CFU) 100 ml(-1) of thermotolerant coliforms and 1.03 x 10(5) CFU 100 ml(-1) of E . coli . The Campylobacter level varied from none detectable (two of 13 piggeries) to a maximum of 930 most probable number (MPN) 100 ml(-1) (two of 13 piggeries) . Salmonella was detected in the final ponds of only four of the 13 piggeries and then only at a low level (highest level being 51 MPN 100 ml(-1)) . No rotavirus and no Erysip . rhusiopathiae were detected . The average log10 reductions across the ponding systems to the final irrigation pond were 1.77 for thermotolerant coliforms, 1.71 for E . coli and 1.04 for Campylobacter . CONCLUSIONS: This study has provided a baseline knowledge on the levels of indicator organisms and selected pathogens in piggery effluent . SIGNIFICANCE AND IMPACT OF THE STUDY: The knowledge gained in this study will assist in the development of guidelines to ensure the safe and sustainable re-use of piggery effluent. J Clin Microbiol, 2004 Oct, 42(10), 4840 - 2 Sequence-based typing of flaB is a more stable screening tool than typing of flaA for monitoring of Campylobacter populations; Mellmann A et al.; Different typing schemes for Campylobacter spp . were evaluated with 70 outbreak and sporadic isolates . The discriminatory indexes were 0.944 (by pulsed-field gel electrophoresis), 0.920 (by genotyping of the flagellin A gene), 0.902 (by genotyping of flaB), and 0.886 (by multilocus sequence typing) . Cross-classification gave 94.77 or 95.82% (PFGE-flaA or PFGE-flaB) concordance . flaA was overdiscriminatory in three cases, most probably due to intragenomic recombination. J Clin Microbiol, 2004 Oct, 42(10), 4566 - 76 Large-scale comparative genomics meta-analysis of Campylobacter jejuni isolates reveals low level of genome plasticity; Taboada EN et al.; We have used comparative genomic hybridization (CGH) on a full-genome Campylobacter jejuni microarray to examine genome-wide gene conservation patterns among 51 strains isolated from food and clinical sources . These data have been integrated with data from three previous C . jejuni CGH studies to perform a meta-analysis that included 97 strains from the four separate data sets . Although many genes were found to be divergent across multiple strains (n = 350), many genes (n = 249) were uniquely variable in single strains . Thus, the strains in each data set comprise strains with a unique genetic diversity not found in the strains in the other data sets . Despite the large increase in the collective number of variable C . jejuni genes (n = 599) found in the meta-analysis data set, nearly half of these (n = 276) mapped to previously defined variable loci, and it therefore appears that large regions of the C . jejuni genome are genetically stable . A detailed analysis of the microarray data revealed that divergent genes could be differentiated on the basis of the amplitudes of their differential microarray signals . Of 599 variable genes, 122 could be classified as highly divergent on the basis of CGH data . Nearly all highly divergent genes (117 of 122) had divergent neighbors and showed high levels of intraspecies variability . The approach outlined here has enabled us to distinguish global trends of gene conservation in C . jejuni and has enabled us to define this group of genes as a robust set of variable markers that can become the cornerstone of a new generation of genotyping methods that use genome-wide C . jejuni gene variability data. Microbiology, 2004 Oct, 150(Pt 10), 3507 - 17 Nucleotide sequences and comparison of two large conjugative plasmids from different Campylobacter species; Batchelor RA et al.; Two large tetracycline resistance (TcR) plasmids have been completely sequenced, the pTet plasmid (45.2 kb) from Campylobacter jejuni strain 81-176 and a plasmid pCC31 (44.7 kb) from Campylobacter coli strain CC31 that was isolated from a human case of severe gastroenteritis in the UK . Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence and overall gene organization . Several predicted proteins encoded by genes involved in conjugation showed highest homology to proteins found in Actinobacillus actinomycetemcomitans, a periodontal pathogen . In addition to replication- and conjugation-associated genes, both plasmids carried a tet(O) gene encoding tetracycline resistance, a 6 kb ORF encoding a putative methylase and a number of genes of unknown function . The pTet plasmid co-exists in C . jejuni strain 81-176 with a smaller, previously characterized, non-conjugative plasmid pVir that also encodes a type IV secretion system (T4SS) that may affect virulence . In contrast, the T4SS encoded by pTet and pCC31 are shown to mediate bacterial conjugation between Campylobacter . The possible origin and evolution of pCC31 and pTet is discussed. Dtsch Tierarztl Wochenschr, 2004 Aug, 111(8), 326 - 31 {Monitoring and risk assessment of campylobacter infections}; Bartelt E; The aim of a national study of a "Quantitative Risk Assessment of Campylobacter infections and broiler chicken" at the Federal Institute for Risk Assessment is to estimate the chicken meat associated risk of Campylobacteriosis in Germany by using probabilistic models . Furthermore, process parameters (modelling parameters) with the most vital impact on the risk of Campylobacteriosis due to chicken meat have to be elaborated to give recommendations for risk management options in the whole food chain . The outcome of Joint FAO/WHO Expert Consultations on Risk Assessment of Microbiological Hazards in Foods (JEMRA) with respect to Campylobacter spp . in broiler chickens are the baseline for the national approach . In addition, national studies from Canada, Denmark and The Netherlands have to be considered . Typical regional data with respect to the disease, to risk factors in Germany and to the qualitative and quantitative occurrence of Campylobacter in broiler chickens along the "farm-to-fork" continuum have to be collected and validated for elaboration of the four elements of a risk assessment . Data on the prevalence of the agent at different stages of the food chain given in available surveillance systems in Germany are limited with respect to their suitability as incoming parameters for the models . A monitoring programme, as required in the Directive 2003/99/EC on the monitoring of zoonoses and zoonotic agents, as well as coordinated programmes for the official food control authorities, could improve the data baseline for risk assessment studies for instance . To collect all necessary information on the quantitative load of Camylobacter in broiler chickens will go beyond the scope of any existing or future monitoring systems . Results can only be achieved by detailed studies . Beside this, regional data on production and processing of broiler chicken, consumption data and information on the behaviour of consumers in households when preparing broiler chicken products are relevant for assessing the final risk to the consumers . For some questions, especially with respect to the dose-response-relation, internationally used models have to be applied . The national study is embedded in a national epidemiological network of "Foodborne Infections in Germany" which is coordinated by the Robert-Koch-Institute and supported by the Federal Ministry of Education and Research (BMBF). New Microbiol, 2004 Jul, 27(3), 281 - 5 Campylobacter fetus bacteremia in an immunocompromised patient: case report and review of the literature; Monno R et al.; A 33-year-old woman underwent a liver transplantation and splenectomy in 1985 and had followed immunosuppressive therapy until 1995 . Afterwards a non-Hodgkin lymphoma was diagnosed and chemotherapy was started . In January 2000, because of suspect transplantation rejection she was treated with steroid and immunosuppressive therapy . Fever occurred after two months and Cytomegalovirus (CMV) infection was diagnosed . Ganciclovir was started with clinical remission . In November 2000 fever recurred without clinical symptoms . Lymphoma recurrence was excluded and CMV was detected by PCR in several biological fluids . Blood cultures were positive for a bacterium that was identified as Campylobacter fetus . The patient was successfully treated with intravenous ciprofloxacin . For persistent CMV viremia therapy with gancyclovir was stopped and foscarnet was used (60mg/Kg/tid i.v . for two weeks) . Bacteremia due to C . fetus is rare, occurring mainly in immunocompromised patients . In our patient the immunosuppressive therapy, chemotherapy for lymphoma and CMV infection had made the patient susceptible to bacteremia with this infrequently found bacterium . The clinical microbiologist should be aware of this infection in immunocompromised hosts. J Food Prot, 2004 Sep, 67(9), 1892 - 903 A quantitative analysis of cross-contamination of Salmonella and Campylobacter spp . via domestic kitchen surfaces; Kusumaningrum HD et al.; Epidemiological data indicate that cross-contamination during food preparation in the home contributes noticeably to the occurrence of foodborne diseases . To help prevent such occurrences, the inclusion of a cross-contamination model in exposure assessments would aid in the development and evaluation of interventions used to control the spread of pathogenic bacteria . A quantitative analysis was carried out to estimate the probability of contamination and the levels of Salmonella and Campylobacter spp . on salads as a result of cross-contamination from contaminated chicken carcasses via kitchen surfaces . Data on the prevalence and numbers of these bacteria on retail chicken carcasses and the use of unwashed surfaces to prepare foods were collected from scientific literature . The rates of bacterial transfer were collected from laboratory experiments and literature . A deterministic approach and Monte Carlo simulations that incorporated input parameter distributions were used to estimate the contamination of the product . The results have shown that the probability of Campylobacter spp . contamination on salads is higher than that of Salmonella spp., since both the prevalence and levels of Campylobacter spp . on chicken carcasses are higher than those of Salmonella spp . It is realistic to expect that a fraction of the human exposure to Campylobacter spp., in particular, originates from cross-contamination in private kitchens during food handling . The number of human campylobacteriosis cases could be reduced either by reducing the degree of Campylobacter spp . contamination on chicken carcasses or by improving the hygiene in private kitchens . To eliminate the cross-contamination route, it is important to use separate surfaces or to properly wash the surfaces during the preparation of raw and cooked foods or ready-to-eat foods. Theriogenology, 2004 Nov, 62(8), 1367 - 82 Immunization in heifers with dual vaccines containing Tritrichomonas foetus and Campylobacter fetus antigens using systemic and mucosal routes; Cobo ER et al.; Vaccines against both bovine venereal campylobacteriosis and trichomonosis were tested . Heifers were assigned to three groups . Groups 1 (n = 21 heifers) and group 2 (n = 20) received a commercial or experimental vaccine, respectively, containing both Campylobacter fetus and Tritrichomonas foetus antigens . Group 3 (n = 21) received adjuvant alone . Preparations were injected SQ in groups 1 and 3 at days -60 and -30 (day 0 was considered the first day of a 90-day breeding period), and in group 2 SQ at days -30 and +11 and into the vaginal submucosa at day -9 . Heifers were exposed to two pathogen-infected bulls for 90 |