|
|
Trans R Soc Trop Med Hyg, 2005 Mar, 99(3), 207 - 14 Campylobacter species and drug resistance in a north Indian rural community; Jain D et al.; Campylobacter species are known as agents of enteritis worldwide . However, rural community-based studies on Campylobacter infections are lacking . We carried out a prospective case-control study from July to December 2002 to investigate the prevalence and socio-epidemiological determinants of Campylobacter infection in a rural community in north India and the drug resistance of Campylobacter strains isolated from the community . Stool specimens from 348 subjects with diarrhoea and 351 age- and gender-matched asymptomatic controls were cultured for Campylobacter, Salmonella and Shigella . All Campylobacter strains were identified and tested for antibiotic susceptibility . Campylobacter species were isolated from 47 (13.5%) subjects with diarrhoea and 2 (0.6%) asymptomatic controls respectively (P<0.001) . Campylobacter infection was significantly higher in children aged less than 5 years, families engaged in agriculture and persons who did not wash their hands with soap after peri-anal washing following defaecation . Campylobacter infections were more frequent than combined Salmonella and Shigella infections (47/348 vs . 15/351; P<0.001) in subjects with diarrhoea . Only two Campylobacter-infected individuals with diarrhoea had bloody stools . Antibiotic resistance of Campylobacter species was as follows: ampicillin 81.6%, ciprofloxacin 71.4%, tetracycline 26.5%, furazolidine 14.3%, gentamicin 10.2% and erythromycin 6.1%; 30.6% of strains were multidrug resistant . Increased quinolone resistance and multidrug resistance pose major risks for treatment failure. J Wildl Dis, 2004 Oct, 40(4), 639 - 59 An annotated checklist of pathogenic microorganisms associated with migratory birds; Hubalek Z; The potential for transport and dissemination of certain pathogenic microorganisms by migratory birds is of concern . Migratory birds might be involved in dispersal of microorganisms as their biological carriers, mechanical carriers, or as carriers of infected hematophagous ecto-parasites (e.g., ixodid ticks) . Many species of microorganisms pathogenic to homeothermic vertebrates including humans have been associated with free-living migratory birds . Migratory birds of diverse species can play significant roles in the ecology and circulation of some arboviruses (e.g., eastern and western equine encephalomyelitis and Sindbis alphaviruses, West Nile and St . Louis encephalitis flaviviruses), influenza A virus, Newcastle disease virus, duck plague herpes-virus, Chlamydophila psittaci, Anaplasma phagocytophilum, Borrelia burgdorferi sensu lato, Campylobacter jejuni, Salmonella enterica, Pasteurella multocida, Mycobacterium avium, Candida spp., and avian hematozoans . The efficiency of dispersal of pathogenic microorganisms depends on a wide variety of biotic and abiotic factors affecting the survival of the agent in, or disappearance from, a habitat or ecosystem in a new geographic area. J Antimicrob Chemother . 2005 Jan 13; {Epub ahead of print} Susceptibility of Campylobacter hyointestinalis subsp . hyointestinalis to antimicrobial agents and characterization of quinolone-resistant strains; Laatu M et al.; To study the susceptibility of Campylobacter hyointestinalis subsp . hyointestinalis to several antimicrobial agents and to investigate the mechanisms of nalidixic acid and ciprofloxacin resistance . The disc diffusion method was employed to study the susceptibility of 49 C . hyointestinalis subsp . hyointestinalis strains of reindeer and bovine origin to 12 different antimicrobial agents . In addition, the MICs of nalidixic acid and ciprofloxacin were determined . The nucleotide sequence of a 270 bp fragment of the gyrA gene was determined in ciprofloxacin-susceptible and -resistant strains . The effect of a multidrug efflux pump inhibitor Phe-Arg-beta-naphthylamide (PAbetaN) on the MICs of ciprofloxacin and nalidixic acid was also studied . The only decreased susceptibility for antimicrobial agents of this study was observed for sulphonamide compound and streptomycin (24% and 32% of the strains, respectively), and this phenomenon was observed exclusively in the bovine strains . In sequence studies, a Thr-86-->Ile change was found in strains with MICs of ciprofloxacin of >/= 64 mg/L, but this mutation was absent in strains with lower resistance levels . The use of PAbetaN did not affect the MIC of ciprofloxacin but decreased the MIC of nalidixic acid 2-4-fold . The Finnish C . hyointestinalis subsp . hyointestinalis strains are susceptible to a majority of the antimicrobials of veterinary importance . The mechanism of ciprofloxacin resistance at lower levels (</=32 mg/L) is not associated with a specific mutation in the quinolone resistance-determining region of the gyrA gene . Finally, there are distinct differences in the mechanisms of ciprofloxacin resistance compared with nalidixic acid resistance within the studied species. Clin Microbiol Infect, 2005 Jan, 11(1), 63 - 5 Investigation of possible cytokine induction in peripheral blood mononuclear cells by heat-stable serotypes of Campylobacter jejuni; Chatzipanagiotou S et al.; Several Campylobacter jejuni heat-stable (HS) serotypes have been associated with the autoimmune Guillain-Barre neurological syndrome (GBS) . In order to examine the possible involvement of cytokines in this phenomenon, the levels of three pro-inflammatory cytokines (interleukin (IL)-2sRa, IL-6 and interferon (IFN)-gamma) and one anti-inflammatory cytokine (IL-10) were measured in peripheral blood mononuclear cells after induction by different C . jejuni serotypes . No differences were found for IL-6, IFN-gamma and IL-10, but the non-sialylated serotype HS:3 was associated with decreased production of IL-2sRa . The results raise the possibility that absence of sialylation might be associated with the inability to induce inflammatory factors such as cytokines. Arch Microbiol . 2005 Jan 13; {Epub ahead of print} Phosphonate catabolism by Campylobacter spp; Mendz GL et al.; The catabolism of phosphonates (Phn) by Campylobacter spp . was investigated employing nuclear magnetic resonance spectroscopy and cell culture techniques . The bacteria were capable of cleaving the Phn bonds of different compounds, including alpha-aminomethylphosphonate, phosphonoacetate and phenylphosphonate (PhePhn) . The kinetic parameters of these activities were determined in vivo in intact cells and in situ in whole-cell lysates . Cleavage of Phn-bearing compounds was associated with the cell-wall and cytosolic fractions . Results from substrate competition experiments suggested that at least two enzyme activities appeared to be involved in the cleavage of carbon-phosphate (C-P) bonds . In silico analyses indicated that no genes orthologous to those encoding C-P bond-cleaving enzymes in other bacteria were present in the Campylobacter jejuni genome . In most bacteria studied, Phn catabolism is induced under conditions of phosphate limitation; however, in Campylobacter spp . these activities were expressed in cells grown in media rich in phosphate . In chemically defined media, PhePhn supported bacterial growth and proliferation at concentrations above 100 muM in the absence of phosphate . Thus, Phn utilisation may be a survival mechanism of Campylobacter spp . in milieux lacking sufficient phosphate . The expression of these enzyme activities in media abundant in phosphate suggested also that they may have other physiological roles. Appl Environ Microbiol, 2005 Jan, 71(1), 85 - 92 Temperature-driven campylobacter seasonality in England and wales; Louis VR et al.; Campylobacter incidence in England and Wales between 1990 and 1999 was examined in conjunction with weather conditions . Over the 10-year interval, the average annual rate was determined to be 78.4 +/- 15.0 cases per 100,000, with an upward trend . Rates were higher in males than in females, regardless of age, and highest in children less than 5 years old . Major regional differences were detected, with the highest rates in Wales and the southwest and the lowest in the southeast . The disease displayed a seasonal pattern, and increased campylobacter rates were found to be correlated with temperature . The most marked seasonal effect was observed for children under the age of 5 . The seasonal pattern of campylobacter infections indicated a linkage with environmental factors rather than food sources . Therefore, public health interventions should not be restricted to food-borne approaches, and the epidemiology of the seasonal peak in human campylobacter infections may best be understood through studies in young children. APMIS, 2004 Dec, 112(11-12), 908 - 29 Application of molecular genetic methods in diagnostics and epidemiology of food-borne bacterial pathogens; Lukinmaa S et al.; Lukinmaa S, Nakari UM, Eklund M, Siitonen A . Application of molecular genetic methods in diagnostics and epidemiology of food-borne bacterial pathogens . 2004:112;908-29.Salmonella enterica, Campylobacter and Yersinia species, Shiga toxin-producing Escherichia coli (STEC), Listeria monocytogenes and Clostridium perfringens are the bacterial pathogens constituting the greatest burden of food-borne disease in Finland . Several molecular genetic methods have been applied to diagnose, discriminate and survey these bacteria . PCR, PCR-RFLP and PFGE are the most widely and successfully used . However, these methods are unable to replace conventional and internationally standardised phenotyping . Electronic database libraries of the different genomic profiles will enable continuous surveillance of infections and detection of possible infection clusters at an early stage . Furthermore, whole-genome sequence data have opened up new insights into epidemiological surveillance . Laboratory-based surveillance performed in a timely manner and exploiting adequate methods, and co-operation at local, national and international levels are among the key elements in preventing food-borne diseases . This paper reviews different applications of molecular genetic methods for investigating enteric bacterial pathogens and gives examples of the methods successfully used in diagnostics and epidemiological studies in Finland. Res Microbiol, 2005 Jan-Feb, 156(1), 107 - 14 Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR; Abu-Halaweh M et al.; A two-tube real-time assay, developed in a LightCycler(TM), was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae . In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO(4)-3'), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E . coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E . coli position 1464), detected C . coli, C . lari and C . jejuni . As expected, a Tm of 65 degrees C was derived from the temperature-dependent probe DNA strand disassociation . In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C . jejuni but not for C . coli which lacks the hipO gene . A Tm of 85+/-0.5 and 56 degrees C determined from temperature-dependent dye-DNA disassociation identified C . jejuni and the non-specific PCR products, respectively, in line with our expectation . The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C . coli (74 isolates), C . jejuni (86 isolates) and non-C . coli-C . jejuni (9 isolates) . In addition, the method successfully detected C . jejuni, C . coli and C . lari from 24-h enrichment cultures initiated from 30 commercial chicken samples. Zh Mikrobiol Epidemiol Immunobiol, 2004 Nov-Dec, (6), 63 - 9 {Occurrence of Helicobacter pylori specific antigens in diseases of gastrointestinal tract}; Sequence typing and comparison of population biology of Campylobacter coli and Campylobacter jejuni; Nuffield Department of Clinical Sciences, Oxford University, John Radcliffe Hospital, Oxford OX3 9DU, United Kingdom . kate.dingle@ndcls.ox.ac.uk A multilocus sequence typing (MLST) scheme that uses the same loci as a previously described system for Campylobacter jejuni was developed for Campylobacter coli . The C . coli-specific primers were validated with 53 isolates from humans, chickens, and pigs, together with 15 Penner serotype reference isolates . The nucleotide sequence of the flaA short variable region (SVR) was determined for each isolate . These sequence data were compared to equivalent information for 17 C . jejuni isolates representing the known genetic diversity of this species . C . coli and C . jejuni share approximately 86.5% identity at the nucleotide sequence level within the MLST loci . There is evidence of genetic exchange of the housekeeping genes between the two species, but at a very low rate; only one sequence type from each species showed evidence of imported DNA . The flaA gene was more variable and has been exchanged many times between the two species, making it an unreliable marker for species identification but useful for distinguishing closely related strains . All but 3 of 21 human C . coli clinical isolates were distinct, according to the combined MLST and SVR sequences . The use of a common MLST scheme allows direct comparisons of the population biology and molecular epidemiology of these two closely related human pathogens. J Clin Microbiol, 2005 Jan, 43(1), 335 - 9 Epidemiology of Campylobacter jejuni isolated from patients with Guillain-Barré and Fisher syndromes in Japan; Takahashi M et al.; Campylobacter jejuni isolation is the standard for the diagnosis of this type of bacterial infection, but there have been no epidemiological studies of a large number of C . jejuni isolates from patients with Guillain-Barre syndrome (GBS) and Fisher syndrome (FS) . For 13 years, stool specimens from GBS/FS patients have been sent from 378 hospitals throughout Japan to the Tokyo Metropolitan Institute of Public Health . A total of 113 strains (11%) were isolated from the stool specimens from 1,049 patients . The isolation rate did not differ by region . The rates were 22% for 449 patients with a history of diarrhea and 2% for the others . An additional 18 isolates were provided by various hospitals . There was no noticeable seasonal distribution in the onset of C . jejuni isolated from patients with GBS/FS . The male/female ratios were 1.7:1 for GBS and 2.2:1 for FS . The patient age range showed a peak in 10- to 30-year-old subjects who had GBS and in 10- to 20-year-old subjects who had FS . The predominance of young adults and male patients who had C . jejuni-associated GBS/FS may be related to the preponderance of young adults and male patients who had C . jejuni enteritis . The median interval from diarrhea onset to neurologic symptom onset was 10 days for GBS/FS . Penner's C . jejuni serotype HS:19 was more frequently present in GBS (67%) than in enteritis (6%) patients . HS:2 was more frequent in FS (41%) than in enteritis (14%) patients . These findings suggest that certain C . jejuni strains specifically trigger GBS and that others specifically trigger FS. Proc Natl Acad Sci U S A . 2005 Jan 5; {Epub ahead of print} Enhanced in vivo fitness of fluoroquinolone-resistant Campylobacter jejuni in the absence of antibiotic selection pressure; Luo N et al.; Campylobacter jejuni, a major foodborne human pathogen, has become increasingly resistant to fluoroquinolone (FQ) antimicrobials . By using clonally related isolates and genetically defined mutants, we determined the fitness of FQ-resistant Campylobacter in chicken (a natural host and a major reservoir for C . jejuni) in the absence of antibiotic selection pressure . When monoinoculated into the host, FQ-resistant and FQ-susceptible Campylobacter displayed similar levels of colonization and persistence in the absence of FQ antimicrobials . The prolonged colonization in chickens did not result in loss of the FQ resistance and the resistance-conferring point mutation (C257 --> T) in the gyrA gene . Strikingly, when coinoculated into chickens, the FQ-resistant Campylobacter isolates outcompeted the majority of the FQ-susceptible strains, indicating that the resistant Campylobacter was biologically fit in the chicken host . The fitness advantage was not due to compensatory mutations in the genes targeted by FQ and was linked directly to the single point mutation in gyrA, which confers on Campylobacter a high-level resistance to FQ antimicrobials . In certain genetic backgrounds, the same point mutation entailed a biological cost on Campylobacter, as evidenced by its inability to compete with the FQ-susceptible Campylobacter . These findings provide a previously undescribed demonstration of the profound effect of a resistance-conferring point mutation in gyrA on the fitness of a major foodborne pathogen in its natural host and suggest that the rapid emergence of FQ-resistant Campylobacter on a worldwide scale may be attributable partly to the enhanced fitness of the FQ-resistant isolates. Microbiology, 2005 Jan, 151(Pt 1), 243 - 57 Campylobacter jejuni gene expression in response to iron limitation and the role of Fur; Holmes K et al.; Campylobacter jejuni is a zoonotic pathogen and the most common cause of bacterial foodborne diarrhoeal illness worldwide . To establish intestinal colonization prior to either a commensal or pathogenic interaction with the host, C . jejuni will encounter iron-limited niches where there is likely to be intense competition from the host and normal microbiota for iron . To gain a better understanding of iron homeostasis and the role of ferric uptake regulator (Fur) in iron acquisition in C . jejuni, a proteomic and transcriptome analysis of wild-type and fur mutant strains in iron-rich and iron-limited growth conditions was carried out . All of the proposed iron-transport systems for haemin, ferric iron and enterochelin, as well as the putative iron-transport genes p19, Cj1658, Cj0177, Cj0178 and cfrA, were expressed at higher levels in the wild-type strain under iron limitation and in the fur mutant in iron-rich conditions, suggesting that they were regulated by Fur . Genes encoding a previously uncharacterized ABC transport system (Cj1660-Cj1663) also appeared to be Fur regulated, supporting a role for these genes in iron uptake . Several promoters containing consensus Fur boxes that were identified in a previous bioinformatics search appeared not to be regulated by iron or Fur, indicating that the Fur box consensus needs experimental refinement . Binding of purified Fur to the promoters upstream of the p19, CfrA and CeuB operons was verified using an electrophoretic mobility shift assay (EMSA) . These results also implicated Fur as having a role in the regulation of several genes, including fumarate hydratase, that showed decreased expression in response to iron limitation . The known PerR promoters were also derepressed in the C . jejuni Fur mutant, suggesting that they might be co-regulated in response to iron and peroxide stress . These results provide new insights into the effects of iron on metabolism and oxidative stress response as well as the regulatory role of Fur. Microbiology, 2005 Jan, 151(Pt 1), 233 - 42 A sulphite respiration system in the chemoheterotrophic human pathogen Campylobacter jejuni; Myers JD et al.; The ability to use sulphite as a respiratory electron donor is usually associated with free-living chemolithotrophic sulphur-oxidizing bacteria . However, this paper shows that the chemoheterotrophic human pathogen Campylobacter jejuni has the ability to respire sulphite, with oxygen uptake rates of 23+/-8 and 28+/-15 nmol O(2) min(-1) (mg cell protein)(-1) after the addition of 0.5 mM sodium sulphite or metabisulphite, respectively, to intact cells . The C . jejuni NCTC 11168 Cj0004c and Cj0005c genes encode a monohaem cytochrome c and molybdopterin oxidoreductase, respectively, homologous to the sulphite : cytochrome c oxidoreductase (SOR) of Starkeya novella . Western blots of C . jejuni periplasm probed with a SorA antibody demonstrated cross-reaction of a 45 kDa band, consistent with the size of Cj0005 . The Cj0004c gene was inactivated by insertion of a kanamycin-resistance cassette . The resulting mutant showed wild-type rates of formate-dependent respiration but was unable to respire with sulphite or metabisulphite as electron donors . 2-Heptyl-4-hydroxyquinoline-N-oxide (HQNO), a cytochrome bc(1) complex inhibitor, did not affect sulphite respiration at concentrations up to 25 muM, whereas formate respiration (which occurs partly via a bc(1) dependent route) was inhibited 50 %, thus suggesting that electrons from sulphite enter the respiratory chain after the bc(1) complex at the level of cytochrome c . Periplasmic extracts of wild-type C . jejuni 11168 showed a symmetrical absorption peak at 552 nm after the addition of sulphite, demonstrating the reduction of cytochrome c . No cytochrome c reduction was observed after addition of sulphite to periplasmic extracts of the Cj0004c mutant . A fractionation study confirmed that the majority of the SOR activity is located in the periplasm in C . jejuni, and this activity was partially purified by ion-exchange chromatography . The presence of a sulphite respiration system in C . jejuni is another example of the surprising diversity of the electron-transport chain in this small-genome pathogen . Sulphite respiration may be of importance for survival in environmental microaerobic niches and some foods, and may also provide a detoxification mechanism for this normally growth-inhibitory compound. Microbiology, 2005 Jan, 151(Pt 1), 219 - 31 Characterization of new DsbB-like thiol-oxidoreductases of Campylobacter jejuni and Helicobacter pylori and classification of the DsbB family based on phylogenomic, structural and functional criteria; Raczko AM et al.; In Gram-negative bacterial cells, disulfide bond formation occurs in the oxidative environment of the periplasm and is catalysed by Dsb (disulfide bond) proteins found in the periplasm and in the inner membrane . In this report the identification of a new subfamily of disulfide oxidoreductases encoded by a gene denoted dsbI, and functional characterization of DsbI proteins from Campylobacter jejuni and Helicobacter pylori, as well as DsbB from C . jejuni, are described . The N-terminal domain of DsbI is related to DsbB proteins and comprises five predicted transmembrane segments, while the C-terminal domain is predicted to locate to the periplasm and to fold into a beta-propeller structure . The dsbI gene is co-transcribed with a small ORF designated dba (dsbI-accessory) . Based on a series of deletion and complementation experiments it is proposed that DsbB can complement the lack of DsbI but not the converse . In the presence of DsbB, the activity of DsbI was undetectable, hence it probably acts only on a subset of possible substrates of DsbB . To reconstruct the principal events in the evolution of DsbB and DsbI proteins, sequences of all their homologues identifiable in databases were analysed . In the course of this study, previously undetected variations on the common thiol-oxidoreductase theme were identified, such as development of an additional transmembrane helix and loss or migration of the second pair of Cys residues between two distinct periplasmic loops . In conjunction with the experimental characterization of two members of the DsbI lineage, this analysis has resulted in the first comprehensive classification of the DsbB/DsbI family based on structural, functional and evolutionary criteria. Pediatr Infect Dis J, 2004 Dec, 23(12), 1098 - 104 Outbreaks of enteric infections caused by multiple pathogens associated with calves at a farm day camp; Smith KE et al.; BACKGROUND: Transmission of enteric pathogens at venues where the public contacts farm animals is a growing problem, particularly among children . In 2000 and again in 2001, enteric illness outbreaks caused by multiple pathogens occurred at a farm day camp for children in Minnesota . METHODS: Camp attendees were interviewed about illness history and potential exposures each year . Stool samples from children and calves at the camp were tested for enteric pathogens . RESULTS: Eighty-four illnesses were documented among camp attendees in the 2 outbreaks; laboratory-confirmed infections included Cryptosporidium parvum (17 cases), Escherichia coli O157:H7 (4), non-O157 Shiga toxin-producing E . coli (STEC) (7) and Salmonella enterica serotype Typhimurium and Campylobacter jejuni (1 each) . Kindergarten-fourth grade children provided 1-on-1 care for a bottle-fed calf . Sixty of 83 calves tested carried at least 1 pathogen, including Giardia spp . (26 calves), C . parvum (25), non-O157 STEC (17), Campylobacter spp . (11), 3 serotypes of Salmonella enterica (10) and E . coli O157:H7 (2) . Risk factors among children included caring for an ill calf and getting visible manure on their hands . Always washing hands with soap after touching a calf and washing hands before going home were protective . Prevention measures implemented in 2000 failed to prevent the second outbreak . CONCLUSIONS: Calves were the reservoir of multiple enteric pathogens for children at a farm day camp . Health care providers should consider numerous zoonotic pathogens in patients presenting with gastroenteritis after contact with cattle . Public health officials should help venue operators prospectively implement published guidelines to prevent zoonotic disease transmission. J R Army Med Corps, 2004 Sep, 150(3), 175 - 8 An outbreak of campylobacteriosis amongst directing staff and students at the Infantry Training Centre, Brecon, Wales, March 2004; Hennessy EP; A cohort study was undertaken to determine the source of an outbreak of gastrointestinal illness affecting a number of military personnel at ITC, Brecon during the period 19--30 March 2004 . Of 105 soldiers on a field training exercise over the period 15--19 March 2004, 36 subsequently developed symptoms . Nine patients had Campylobacter sp identified in their stool . Water was provided from a single source . This water was used for washing, shaving, drinking and the preparation of rations . Although not statistically significant, epidemiological investigation suggests that the water may have been the vehicle of infection. Can J Public Health, 2004 Nov-Dec, 95(6), 446 - 50 Syndromic surveillance of gastrointestinal illness using pharmacy over-the-counter sales . A retrospective study of waterborne outbreaks in Saskatchewan and Ontario; Edge VL et al.; OBJECTIVE: To ascertain if monitoring over-the-counter (OTC) drug sales could provide a timely syndromic surveillance method of detecting outbreaks of gastrointestinal illness . METHOD: This study evaluated the potential of a syndromic surveillance system by comparing retrospective pharmacy OTC sales of anti-nauseants and anti-diarrheals to emergency room visits and case numbers from two Canadian outbreaks related to water contamination by Cryptosporidium, and E.coli O157:H7 and Campylobacter . RESULTS: Local sales trends of weekly aggregate OTC products were comparable to the outbreak epidemic curves . Statistical control tests on the sales data indicated the start of the outbreak periods . CONCLUSIONS: An automated monitoring tool based on spatial and temporal trend analyses of daily OTC sales would provide supplemental community health information for public health officials that is timelier than currently available laboratory-based surveillance systems. Antimicrob Agents Chemother, 2005 Jan, 49(1), 457 - 60 Detection and quantification of macrolide resistance mutations at positions 2058 and 2059 of the 23S rRNA gene by pyrosequencing; Haanpera M et al.; A pyrosequencing method for detection and quantification of macrolide resistance mutations at positions 2058 and 2059 (Escherichia coli numbering) of the 23S rRNA gene is described . The method was developed and tested for Streptococcus pneumoniae, Streptococcus pyogenes, Mycobacterium avium, Campylobacter jejuni, and Haemophilus influenzae. J Biol Chem . 2004 Dec 21; {Epub ahead of print} Anion-independent iron coordination by the campylobacter jejuni ferric binding protein; Tom-Yew SA et al.; Campylobacter jejuni, the leading cause of human gastroenteritis, expresses a ferric binding protein (cFbpA) that in many pathogenic bacteria functions to acquire iron as part of their virulence repertoire . Recombinant cFbpA is isolated with ferric iron bound from E . coli . The crystal structure of cFbpA reveals unprecedented iron coordination by only five protein ligands . The histidine and one tyrosine are derived from the N-terminal domain, whereas the three remaining tyrosine ligands are from the C-terminal domain . Surprisingly, a synergistic anion, present in all other characterized ferric transport proteins, is not observed in the cFbpA iron binding site suggesting a novel role for this protein in iron uptake . Furthermore, cFbpA is shown to bind iron with high affinity similar to Neisserial FbpA and exhibits an unusual preference for ferrous iron (oxidized subsequently to the ferric form) or ferric iron chelated by oxalate . Sequence and structure analyses reveal that cFbpA is a member of a new class of ferric binding proteins which includes homologs from invasive and intracellular bacteria as well as cyanobacteria . Overall, six classes are defined based on clustering within the tree and by their putative iron coordination . The absence of a synergistic anion in the iron coordination sphere of cFbpA also suggests an alternative model of evolution for FbpA homologs involving an early iron binding ancestor instead of a requirement for a pre-existing anion binding ancestor. Eur J Haematol, 2005 Jan, 74(1), 70 - 2 HIV MALT lymphoma remission induced by highly active antiretroviral therapy alone; Girard T et al.; Girard T, Luquet-Besson I, Baran-Marszak F, Raphael M, Boue F . HIV(+) MALT lymphoma remission induced by highly active antiretroviral therapy alone . Eur J Haematol 2005: 74: 70-72 . (c) Blackwell Munksgaard 2005.Abstract: MALT lymphoma is usually described in association with Helicobacter pylori, HCV, HHV8, Campylobacter jejuni or in a setting of overreactive immunity . In HIV(+) patients, MALT lymphoma is most commonly described in children . We describe here an original case of HIV(+) MALT lymphoma with bronchial, conjuctival and laryngeal involvement for which a clinical and histopathological remission has been obtained with HAART alone . We conclude that HIV, as well as H . pylori, C . jejuni and HCV can target lymphogenesis in MALT lymphoma. Mol Microbiol, 2005 Jan, 55(1), 90 - 103 Analysis of Campylobacter jejuni capsular loci reveals multiple mechanisms for the generation of structural diversity and the ability to form complex heptoses; Karlyshev AV et al.; Summary We recently demonstrated that Campylobacter jejuni produces a capsular polysaccharide (CPS) that is the major antigenic component of the classical Penner serotyping system distinguishing Campylobacter into >60 groups . Although the wide variety of C . jejuni serotypes are suggestive of structural differences in CPS, the genetic mechanisms of such differences are unknown . In this study we sequenced biosynthetic cps regions, ranging in size from 15 to 34 kb, from selected C . jejuni strains of HS:1, HS:19, HS:23, HS:36, HS:23/36 and HS:41 serotypes . Comparison of the determined cps sequences of the HS:1, HS:19 and HS:41 strains with the sequenced strain, NCTC11168 (HS:2), provides evidence for multiple mechanisms of structural variation including exchange of capsular genes and entire clusters by horizontal transfer, gene duplication, deletion, fusion and contingency gene variation . In contrast, the HS:23, HS:36 and HS:23/36 cps sequences were highly conserved . We report the first detailed structural analysis of 81-176 (HS:23/36) and G1 (HS:1) and refine the previous structural interpretations of the HS:19, HS:23, HS:36 and HS:41 serostrains . For the first time, we demonstrate the commonality and function of a second heptose biosynthetic pathway for Campylobacter CPS independent of the pathway for lipooligosaccharide (LOS) biosynthesis and identify a novel heptosyltransferase utilized by this alternate pathway . Furthermore, we show the retention of two functional heptose isomerases in Campylobacter and the sharing of a phosphatase for both LOS and CPS heptose biosynthesis. J Infect, 2005 Jan, 50(1), 12 - 21 Identification and characterization of a major subgroup of conjugative Campylobacter jejuni plasmids; Schmidt-Ott R et al.; Objectives . Enterocyte invasion of Campylobacter jejuni 81-176 has been reported to depend upon the virulence plasmid pVir . The objective of this study was to determine the prevalence of pVir in clinical C . jejuni isolates, to investigate DNA homologies between C . jejuni plasmids and the significance of plasmids for C . jejuni invasiveness . Methods . DNA homologies between C . jejuni plasmids were studied by southern blot hybridization . C . jejuni invasion into human intestinal Caco-2 cells was assessed in a gentamicin exclusion assay . Results . Twenty-nine percent of C . jejuni isolated from patients with bloody or watery diarrhoea harboured plasmids of various sizes . One plasmid (7%) was a pVir homologue whereas, the majority of the plasmids (53%) belonged to a subgroup distinct from pVir . The plasmids of this novel subgroup share extensive DNA sequence homology with each other, including homologues to so-called invasion-promoting genes . However, conjugative transfer of these plasmids clearly did not increase invasiveness of plasmidless recipient C . jejuni strains . Conclusion . This study indicates that only a small proportion of C . jejuni strains carry the virulence factor pVir and that at least one other distinctive group of plasmids in C . jejuni exists, which does not seem to be associated with invasiveness. Pediatr Infect Dis J, 2004 Oct, 23(10), 966 - 8 Guillain-Barre syndrome with meningoencephalitis after Campylobacter jejuni infection; Tsugawa T et al.; A 14-year-old boy presented with progressive ascending muscle weakness, urinary retention and disturbed consciousness . Initially his cerebrospinal fluid showed pleocytosis, and protein-cellular dissociation developed later . Campylobacter jejuni was isolated from his stool and serum anti-ganglioside antibodies were positive . Our case suggests that coexistence of meningoencephalitis at an early stage of illness does not necessarily exclude the diagnosis of Guillain-Barre syndrome. J Infect Dis, 2005 Jan 1, 191(1), 11 - 9 Epub 2004 Dec 01. Etiologies and manifestations of persistent diarrhea in adults with HIV-1 infection: a case-control study in Lima, Peru; Carcamo C et al.; OBJECTIVE We sought to determine the etiologies, manifestations, and risk factors for persistent (> or =7 days) diarrhea in human immunodeficiency virus type 1 (HIV-1)-infected persons in Peru . DESIGN: The present study is a case-control study of 147 HIV-1-infected case subjects with persistent diarrhea and 147 HIV-1-infected control subjects without diarrhea . METHODS: We obtained clinical, demographic, and exposure data, CD4 lymphocyte counts, and stool samples for detection of enteric parasitic and bacterial pathogens and rotavirus . RESULTS: One or more enteric pathogen was identified in 55% of case subjects and 21% of control subjects (odds ratio adjusted for CD4 lymphocyte count, 3.8; 95% confidence interval, 2.2-6.5) . The median CD4 lymphocyte count was highest with pathogen-free diarrhea and lowest with Cryptosporidium infection . Cryptosporidium species (the most frequent pathogen), Giardia lamblia, Aeromonas species, Campylobacter species, and rotavirus were all significantly associated with diarrhea . Bacterial pathogens were significantly associated with G . lamblia and rotavirus infection . Of the bacterial pathogens (Aeromonas, Campylobacter, Salmonella, and Vibrio species and enterotoxigenic Escherichia coli), only 24% were susceptible to cotrimoxazole, whereas 90% were susceptible to ciprofloxacin . In no case did the sensitivity or positive predictive value of specific clinical and laboratory findings for curable enteric infections exceed 50% . CONCLUSIONS: Several enteric pathogens were associated with diarrhea in HIV-1-infected case subjects in Peru, especially among those who were heterosexual . Clinical findings were poor predictors of detectable microbial etiology . The guidelines for initial management of chronic diarrhea with sulfamethoxazole-trimethoprim in HIV-1-infected persons require revision, at least in settings where prophylaxis with this agent is common. Acta Crystallogr D Biol Crystallogr, 2004 Dec, 60(Pt 12 Pt 2), 2349 - 51 Epub 2004 Dec. Crystallization and preliminary crystallographic studies of MOMP (major outer membrane protein) from Campylobacter jejuni; Bolla JM et al.; Campylobacter jejuni is the leading bacterial cause of human enteritis linked to ingestion of contaminated food or water . MOMP, the major outer membrane protein from these Gram-negative bacteria, belongs to the porin family . In order to determine the three-dimensional structure of this protein and to elucidate the underlying molecular mechanisms, the MOMP from C . jejuni strain 85H has been purified and crystallized by vapour diffusion . Two crystal forms were characterized for this membrane protein . X-ray diffraction data were collected to a resolution of 3.1 A using a synchrotron-radiation source from the orthorhombic crystal form, which belonged to space group P2(1)2(1)2 with unit-cell parameters a = 170.1, b = 101.9, c = 104.9 A . With a trimer in the asymmetric unit, the solvent content is 64% (V(M) = 3.4 A Da(-1)) . The other form exhibits trigonal symmetry (space group R3) with hexagonal unit-cell parameters a = b = 94.2, c = 161.2 A, but diffracts X-rays poorly to about 4 A with significant anisotropy. J Clin Microbiol, 2004 Dec, 42(12), 5731 - 8 Phylogenetic analysis and PCR-restriction fragment length polymorphism identification of Campylobacter species based on partial groEL gene sequences; Karenlampi RI et al.; The phylogeny of 12 Campylobacter species and reference strains of Arcobacter butzleri and Helicobacter pylori was studied based on partial 593-bp groEL gene sequences . The topology of the phylogenetic neighbor-joining tree based on the groEL gene was similar to that of the tree based on the 16S rRNA gene . However, groEL was found to provide a better resolution for Campylobacter species, with lower interspecies sequence similarities (range, 65 to 94%) compared with those for the 16S rRNA gene (range, 90 to 99%) and high intraspecies sequence similarities (range, 95 to 100%; average, 99%) . A new universal reverse primer that amplifies a 517-bp fragment of the groEL gene was developed and used for PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of 68 strains representing 11 Campylobacter species as well as reference strains of A . butzlerii and H . pylori . Digestion with the AluI enzyme discriminated all Campylobacter species included in the study but showed more intraspecies diversity than digestion with the ApoI enzyme . A hippurate-negative variant of Campylobacter jejuni with a high level of groEL sequence similarity to both C . jejuni (96%) and C . coli (94%) gave a unique AluI profile and an ApoI profile identical to those of other C . jejuni strains . In conclusion, groEL gene sequencing and PCR-RFLP analysis are recommended as valuable tools for the identification of Campylobacter species. J Clin Microbiol, 2004 Dec, 42(12), 5549 - 57 Differentiation of Campylobacter coli, Campylobacter jejuni, Campylobacter lari, and Campylobacter upsaliensis by a multiplex PCR developed from the nucleotide sequence of the lipid A gene lpxA; Klena JD et al.; We describe a multiplex PCR assay to identify and discriminate between isolates of Campylobacter coli, Campylobacter jejuni, Campylobacter lari, and Campylobacter upsaliensis . The C . jejuni isolate F38011 lpxA gene, encoding a UDP-N-acetylglucosamine acyltransferase, was identified by sequence analysis of an expression plasmid that restored wild-type lipopolysaccharide levels in Escherichia coli strain SM105 {lpxA(Ts)} . With oligonucleotide primers developed to the C . jejuni lpxA gene, nearly full-length lpxA amplicons were amplified from an additional 11 isolates of C . jejuni, 20 isolates of C . coli, 16 isolates of C . lari, and five isolates of C . upsaliensis . The nucleotide sequence of each amplicon was determined, and sequence alignment revealed a high level of species discrimination . Oligonucleotide primers were constructed to exploit species differences, and a multiplex PCR assay was developed to positively identify isolates of C . coli, C . jejuni, C . lari, and C . upsaliensis . We characterized an additional set of 41 thermotolerant isolates by partial nucleotide sequence analysis to further demonstrate the uniqueness of each species-specific region . The multiplex PCR assay was validated with 105 genetically defined isolates of C . coli, C . jejuni, C . lari, and C . upsaliensis, 34 strains representing 12 additional Campylobacter species, and 24 strains representing 19 non-Campylobacter species . Application of the multiplex PCR method to whole-cell lysates obtained from 108 clinical and environmental thermotolerant Campylobacter isolates resulted in 100% correlation with biochemical typing methods. J Clin Invest, 2004 Dec, 114(11), 1659 - 65 The crucial role of Campylobacter jejuni genes in anti-ganglioside antibody induction in Guillain-Barre syndrome; Godschalk PC et al.; Molecular mimicry of Campylobacter jejuni lipo-oligosaccharides (LOS) with gangliosides in nervous tissue is considered to induce cross-reactive antibodies that lead to Guillain-Barre syndrome (GBS), an acute polyneuropathy . To determine whether specific bacterial genes are crucial for the biosynthesis of ganglioside-like structures and the induction of anti-ganglioside antibodies, we characterized the C . jejuni LOS biosynthesis gene locus in GBS-associated and control strains . We demonstrated that specific types of the LOS biosynthesis gene locus are associated with GBS and with the expression of ganglioside-mimicking structures . Campylobacter knockout mutants of 2 potential GBS marker genes, both involved in LOS sialylation, expressed truncated LOS structures without sialic acid, showed reduced reactivity with GBS patient serum, and failed to induce an anti-ganglioside antibody response in mice . We demonstrate, for the first time, to our knowledge, that specific bacterial genes are crucial for the induction of anti-ganglioside antibodies. Comp Med, 2004 Oct, 54(5), 514 - 23 Lymphoglandular complexes are important colonic sites for immunoglobulin A induction against Campylobacter jejuni in a swine disease model; Mansfield LS et al.; Campylobacter jejuni is a common cause of serious food-borne illness . In an experimental model of human infection, germfree pigs were given C . jejuni, the whipworm Trichuris suis, dual infections with C . jejuni and T . suis, or no infection . In dual-infected pigs, a synergistic effect between C . jejuni and T . suis was observed 27 days after infection, when T . suis fourth-stage larvae were found in the proximal colon . In dual-infected pigs, lymphoglandular complexes (LGCs) in the distal colon were substantially enlarged, and C . jejuni was detected in cells of the follicle-associated epithelium (FAE) and in cells with macrophage morphology within these follicles . In the study reported here, cell types in colonic tissues from these pigs were analyzed by use of immunohistochemical and morphometric analyses for cell surface markers (IgM, IgG, IgA, CD4, CD8, MHC Class II, and macrophage SWC3a) . To our knowledge, we provide the first description of cell types in mammalian LGCs, document that they have all elements necessary for antigen processing, and demonstrate the appearance of IgA germinal centers (GC) in LGCs from C . jejuni-infected pigs (single or dual infected) . Ileocecal Peyer's patches (ICPP) and mesenteric lymph nodes (MLN) also had IgA GC development if C . jejuni was present, but LGCs had the greatest amount of anti-C . jejuni staining, and appreciable increase in overall follicle size and size and number of GCs committed to IgA production . LGCs are present in humans and other mammals and are important in other enteric infections. Appl Environ Microbiol, 2004 Dec, 70(12), 7474 - 80 Effects of climate on incidence of Campylobacter spp . in humans and prevalence in broiler flocks in Denmark; Patrick ME et al.; Campylobacter infections are increasing and pose a serious public health problem in Denmark . Infections in humans and broiler flocks show similar seasonality, suggesting that climate may play a role in infection . We examined the effects of temperature, precipitation, relative humidity, and hours of sunlight on Campylobacter incidence in humans and broiler flocks by using lag dependence functions, locally fitted linear models, and cross validation methods . For humans, the best model included average temperature and sunlight 4 weeks prior to infection; the maximum temperature lagged at 4 weeks was the best single predictor . For broilers, the average and maximum temperatures 3 weeks prior to slaughter gave the best estimate; the average temperature lagged at 3 weeks was the best single predictor . The combined effects of temperature and sunlight or the combined effects of temperature and relative humidity predicted the incidence in humans equally well . For broiler flock incidence these factors explained considerably less . Future research should focus on elements within the broiler environment that may be affected by climate, as well as the interaction of microclimatic factors on and around broiler farms . There is a need to quantify the contribution of broilers as a source of campylobacteriosis in humans and to further examine the effect of temperature on human incidence after this contribution is accounted for . Investigations should be conducted into food consumption and preparation practices and poultry sales that may vary by season. Appl Environ Microbiol, 2004 Dec, 70(12), 7103 - 9 Survival of cold-stressed Campylobacter jejuni on ground chicken and chicken skin during frozen storage; Bhaduri S et al.; Campylobacter jejuni is prevalent in poultry, but the effect of combined refrigerated and frozen storage on its survival, conditions relevant to poultry processing and storage, has not been evaluated . Therefore, the effects of refrigeration at 4 degrees C, freezing at -20 degrees C, and a combination of refrigeration and freezing on the survival of C . jejuni in ground chicken and on chicken skin were examined . Samples were enumerated using tryptic soy agar containing sheep's blood and modified cefoperazone charcoal deoxycholate agar . Refrigerated storage alone for 3 to 7 days produced a reduction in cell counts of 0.34 to 0.81 log10 CFU/g in ground chicken and a reduction in cell counts of 0.31 to 0.63 log10 CFU/g on chicken skin . Declines were comparable for each sample type using either plating medium . Frozen storage, alone and with prerefrigeration, produced a reduction in cell counts of 0.56 to 1.57 log10 CFU/g in ground chicken and a reduction in cell counts of 1.38 to 3.39 log10 CFU/g on chicken skin over a 2-week period . The recovery of C . jejuni following freezing was similar on both plating media . The survival following frozen storage was greater in ground chicken than on chicken skin with or without prerefrigeration . Cell counts after freezing were lower on chicken skin samples that had been prerefrigerated for 7 days than in those that had been prerefrigerated for 0, 1, or 3 days . This was not observed for ground chicken samples, possibly due to their composition . C . jejuni survived storage at 4 and -20 degrees C with either sample type . This study indicates that, individually or in combination, refrigeration and freezing are not a substitute for safe handling and proper cooking of poultry. Appl Environ Microbiol, 2004 Dec, 70(12), 7078 - 85 Characterization of Lactobacillus coryniformis DSM 20001T surface protein Cpf mediating coaggregation with and aggregation among pathogens; Schachtsiek M et al.; Phenotypic characterization of aggregation phenotypes of Lactobacillus coryniformis revealed that strain DSM 20001T coaggregated with Escherichia coli K88, Campylobacter coli, and Campylobacter jejuni but not with other human pathogens . In addition, cells of these pathogens aggregated in the presence of the spent culture supernatant (SCS) of strain DSM 20001T . Cells of E . coli K88 remained viable in the coaggregates and aggregates for up to 24 h . Both coaggregation and aggregation (co/aggregation) occurred at pH 3.5 to 7.5 and was sensitive to heat (85 degrees C for 15 min) and proteinase K . The co/aggregation-promoting factor (Cpf) was purified, and the gene was identified by PCR with degenerate primers derived from internal amino acid sequences . The cpf gene encoded a 19.9-kDa preprotein with a sec-dependent leader and an isoelectric point of 4.4 . The amino acid sequence had no significant similarity to proteins with known functions . Northern analysis revealed not only major transcription from the promoter of cpf but also major transcription from the promoter of the preceding insertion element, ISLco1 belonging to the IS3 family . Recombinant Cpf produced in E . coli mediated aggregation of pathogens comparable to the aggregation obtained with purified Cpf or SCS of strain DSM 20001T . Cpf could be removed from cells of strain DSM 20001T by treatment with 5 M LiCl and could be subsequently reattached to the cell surface by using SCS or recombinant Cpf, which resulted in restoration of the co/aggregation property . These results together with those of the amino acid sequence analysis suggest that Cpf is a novel surface protein of L . coryniformis that mediates co/aggregation of some pathogens. Glycobiology . 2004 Dec 1; {Epub ahead of print} The N-X-S/T consensus sequence is required but not sufficient for bacterial N-linked protein glycosylation; Nita-Lazar M et al.; In the Gram-negative bacterium Campylobacter jejuni there is a pgl (protein glycosylation) locus dependent general N-glycosylation system of proteins . One of the proteins encoded by pgl locus, PglB, a homologue of the eukaryotic oligosaccharyltransferase component Stt3p, is proposed to function as an oligosaccharyltransferase in this prokaryotic system . The sequence requirements of the acceptor polypeptide for N-glycosylation were analyzed by reverse genetics using the reconstituted glycosylation of the model protein AcrA in Escherichia coli . As in eukaryotes, the N-X-S/T sequon is an essential but not a sufficient determinant for Nlinked protein glycosylation . This conclusion was supported by the analysis of a novel C . jejuni glycoprotein, HisJ . Export of the polypeptide to the periplasm was required for glycosylation . Our data support the hypothesis that eukaryotic and bacterial N-linked protein glycosylation are homologous processes. Commun Dis Intell, 2004, 28(3), 359 - 89 Foodborne disease investigation across Australia: annual report of the OzFoodNet network, 2003; OzFoodNet Working Group; In 2003, OzFoodNet conducted enhanced surveillance of foodborne diseases across Australia, which covered all states and territories . During 2003, there were 23,250 notifications of eight potentially foodborne diseases, of which 67 per cent and 30 per cent were due to Campylobacter and Salmonella infections respectively . The most common Salmonella serotype was Typhimurium, as in previous years . Most S . Enteritidis were acquired overseas, except for Queensland where 52 per cent of infections were acquired locally . Locally acquired S . Enteritidis infections in Australia were predominantly due to phage type 26 . The most common serotype of Shiga toxin producing E . coli was O157, although for 49 per cent of notified infections serotype was unknown due to the use of polymerase chain reaction based screening tests . There were 12 materno-foetal listeriosis infections in 2003, which was an increase compared to recent years . During 2003, there were 444 outbreaks of gastroenteritis and foodborne disease recorded . Ninety-nine of these were of foodborne origin affecting 1,686 persons, hospitalising 105 and causing six deaths . A wide range of agents and foods caused these outbreaks, with Salmonella Typhimurium being the most common pathogen . Outbreaks associated with fish and seafood dishes, poultry meat, and Asian style and imported foods were common . Four outbreaks with international implications were reported: an outbreak of Salmonella in Montevideo involving contaminated tahini from the Middle East and three outbreaks of norovirus infection associated with imported Japanese oysters . Outbreak data indicated a need to monitor food safety in aged care settings, restaurants and catering . Eighty-nine investigations into clusters of gastrointestinal illness where a source could not be identified were conducted, including multi-state outbreaks of salmonellosis . One multistate investigation of antibiotic resistant Salmonella Paratyphi b Java identified 18 cases who had recent exposure to tropical fish aquariums . Ninety-seven per cent of Salmonella notifications on state and territory surveillance databases have complete information on serotype and phage type . In 2003, OzFoodNet demonstrated the benefits of national collaboration to control food borne disease. BMC Infect Dis . 2004 Nov 29;4(1):54. Regional risks and seasonality in travel-associated campylobacteriosis; Ekdahl K et al.; BACKGROUND: The epidemiology of travel-associated campylobacteriosis is still largely unclear, and various known risk factors could only explain limited proportions of the recorded cases . METHODS: Using data from 28,704 notifications of travel-associated campylobacteriosis in Sweden 1997 to 2003 and travel patterns of 16,255 Swedish residents with overnight travel abroad in the same years, we analysed risks for travel-associated campylobacteriosis in 19 regions of the world, and looked into the seasonality of the disease in each of these regions . RESULTS: The highest risk was seen in returning travellers from the Indian subcontinent (1,253/100,000 travellers), and the lowest in travellers from the other Nordic countries (3/100,000 travellers) . In Africa, large differences in risk between regions were noted, with 502 /100,000 in travellers from East Africa, compared to 76/100,00 from West Africa and 50/100,000 from Central Africa . A distinct seasonal pattern was seen in all temperate regions with peaks in the summer, while no or less distinct seasonality was seen in tropical regions . In travellers to the tropics, the highest risk was seen in children below the age of six . CONCLUSIONS: Data on infections in returning travellers together with good denominator data could provide comparable data on travel risks in various regions of the world. Int J Biometeorol . 2004 Nov 23; {Epub ahead of print} Climate variability and campylobacter infection: an international study; Sari Kovats R et al.; Campylobacter is among the most important agents of enteritis in developed countries . We have described the potential environmental determinants of the seasonal pattern of infection with campylobacter in Europe, Canada, Australia and New Zealand . Specifically, we investigated the role of climate variability on laboratory-confirmed cases of campylobacter infection from 15 populations . Regression analysis was used to quantify the associations between timing of seasonal peaks in infection in space and time . The short-term association between weekly weather and cases was also investigated using Poisson regression adapted for time series data . All countries in our study showed a distinct seasonality in campylobacter transmission, with many, but not all, populations showing a peak in spring . Countries with milder winters have peaks of infection earlier in the year . The timing of the peak of infection is weakly associated with high temperatures 3 months previously . Weekly variation in campylobacter infection in one region of the UK appeared to be little affected by short-term changes in weather patterns . The geographical variation in the timing of the seasonal peak suggests that climate may be a contributing factor to campylobacter transmission . The main driver of seasonality of campylobacter remains elusive and underscores the need to identify the major serotypes and routes of transmission for this disease. Comp Immunol Microbiol Infect Dis, 2005 Jan, 28(1), 71 - 82 Bacterial flora of free-living Double-crested cormorant (Phalacrocorax auritus) chicks on Prince Edward Island, Canada, with reference to enteric bacteria and antibiotic resistance; Dobbin G et al.; Cloacal and pharyngeal swabs from 100 tree-nesting Double-crested cormorant (DCC) chicks were examined by culture for commensal and potentially pathogenic bacteria . No Salmonella or Erysipelothrix were isolated from the cloacal swabs . Twenty-two cloacal swabs were positive for Campylobacter, of which 14 were C . jejuni, C . coli, and 1 C . lari . None belonged to common serotypes isolated from humans or animals in recent years in Canada . Tests for antimicrobial drug resistance among 187 commensal Escherichia coli isolates from the cloacal swabs indicated that </=5% were resistant to any of the 12 antibiotics tested . This contrasts with the frequently high resistance rates among E . coli isolates from poultry . Pharyngeal swabs from DCC were negative for Pasteurella multocida . Culture of cloacal swabs from 100 ground-nesting DCC chicks resulted in the recovery of 19 Salmonella isolates, all of which were S . enterica serotype Typhimurium . None of these isolates were resistant to any of the 12 antibiotics tested . Altogether, these findings suggest that DCC from this region are not being colonized with commensal or potentially pathogenic enteric bacteria from agricultural or human sources and that enteric bacteria isolated from these birds are unlikely to contribute to a gene pool of antimicrobial drug resistance. Antimicrob Agents Chemother, 2004 Dec, 48(12), 4886 - 8 PCR-restriction fragment length polymorphism assay for detection of gyrA mutations associated with fluoroquinolone resistance in Campylobacter coli; Alonso R et al.; A fragment of the gyrA gene was sequenced from 34 isolates of Campylobacter coli, including 23 isolates resistant to ciprofloxacin . All ciprofloxacin-resistant isolates examined by DNA sequencing carried a point mutation at position Thr-86 on the gyrA gene product, involving the replacement of Thr-86 by Ile . A combined PCR-restriction fragment length polymorphism technique using RsaI was developed to detect this mutation. Mol Microbiol, 2004 Dec, 54(5), 1269 - 86 The Campylobacter jejuni dccRS two-component system is required for optimal in vivo colonization but is dispensable for in vitro growth; MacKichan JK et al.; A Campylobacter jejuni two-component signal transduction system (TCSTS), designated dccR-dccS (diminished capacity to colonize; Cj1223c-Cj1222c), has been found to be important for in vivo colonization but dispensable for in vitro growth . A DeltadccR response regulator mutant generated using the virulent strain 81-176 background exhibited significantly reduced colonization of immunocompetent limited flora (I-LF) mice, severe combined immunodeficient limited flora (SCID-LF) mice, and 1-day-old chicks . A DeltadccS sensor kinase mutant was likewise defective for colonization in the I-LF mouse model . DeltadccR-infected SCID-LF mice also exhibited dramatically reduced inflammation relative to wild type-infected SCID-LF mice . Despite this diminished colonization capacity, the DeltadccRS mutants were indistinguishable from wild type for growth under numerous in vitro conditions as well as for various phenotypes . Microarray analysis identified several genes encoding putative periplasmic and membrane proteins as being regulated by this two-component system; binding of purified His-tagged DccR to the promoter region of two of these genes supports a direct protein-DNA interaction . A conserved repeat sequence was identified in the promoter regions of these genes and in three other promoter regions in the genome, including that of an operon encoding a putative type I secretion system . Two of the regulated target genes were found to be essential for optimal colonization . Both the two-component system and the putative regulated genes have uncharacterized homologues in other Campylobacter and Helicobacter spp., suggesting that they may perform an important function in colonization among a variety of related pathogenic species. J Int Acad Periodontol, 2004 Oct, 6(4), 113 - 9 Herpesviruses, the missing link between gingivitis and periodontitis? Slots J. Herpesviruses appear to assume a major etiopathogenic role in various types of destructive periodontal disease . Human cytomegalovirus (HCMV), Epstein-Barr virus (EBV) and HCMV-EBV co-infection are closely associated with disease-active periodontitis in juveniles and adults, with acute necrotizing ulcerative gingivitis in children, and with periodontal abscesses . In particular, HCMV reactivation in periodontitis lesions seems to be linked to advancing disease . HCMV infects periodontal monocytes/macrophages and T-lymphocytes, and EBV infects periodontal B-lymphocytes . Herpesvirus-infected inflammatory cells generate a great variety of pro-inflammatory cytokines and may possess diminished ability to defend against bacterial challenge . Herpesvirus-associated periodontal sites tend to harbor elevated levels of periodontopathic bacteria, including Dialister pneumosintes, Porphyromonas gingivalis, Tannerella forsythia, Prevotella intermedia, Prevotella nigrescens, Treponema denticola, Campylobacter rectus and Actinobacillus actinomycetemcomitans . In summary, the available data suggest that periodontitis occurs more frequently and progresses more rapidly in herpesvirus-infected than in non-infected periodontal sites . An infectious disease model based on herpesvirus-bacteria-host immune response interactions is presented to explain how a gingivitis lesion or a stable periodontal site with increased probing depth may convert into a tissue-destroying periodontitis lesion. Int J Syst Evol Microbiol, 2004 Nov, 54(Pt 6), 2369 - 73 Campylobacter insulaenigrae sp . nov., isolated from marine mammals; Foster G et al.; Phenotypic and phylogenetic studies were performed on four Campylobacter-like organisms recovered from three seals and a porpoise . Comparative 16S rRNA gene sequencing studies demonstrated that the organisms represent a hitherto unknown subline within the genus Campylobacter, associated with a subcluster containing Campylobacter jejuni, Campylobacter coli and Campylobacter lari . DNA-DNA hybridization studies confirmed that the bacteria belonged to a single species, for which the name Campylobacter insulaenigrae sp . nov . is proposed . The type strain of Campylobacter insulaenigrae sp . nov . is NCTC 12927(T) (=CCUG 48653(T)). Blood . 2004 Nov 12; {Epub ahead of print} Immunoproliferative small intestinal disease (IPSID); a model for mature B-cell neoplasms; Al-Saleem T et al.; Immunoproliferative small intestinal disease (IPSID) was recently added to the growing list of infectious pathogen-associated human lymphomas . Molecular and immunohistochemical studies demonstrated an association with Campylobacter jejuni . IPSID is a variant of the B-cell lymphoma of mucosa associated lymphoid tissue (MALT), which involves mainly the proximal small intestine resulting in malabsorption, diarrhea and abdominal pain . Geographically, IPSID is most prevalent in the Middle East and Africa . IPSID lymphomas reveal excessive plasma cell differentiation and produce truncated alpha heavy chain proteins lacking the light chains as well as the first constant domain . The corresponding mRNA lacks the VH and the CH1 sequences and contains deletions as well as insertions of unknown origin . The encoding gene sequence reveals a deletion of V region and parts of CH1 domain . Cytogenetic studies demonstrated clonal rearrangements involving predominantly the heavy and light chain genes, including t9;14 translocation involving the PAX5 gene . Early stage IPSID responds to antibiotics (30-70% complete remission) . Most untreated IPSID patients progress to lymphoplasmacytic and immunoblastic lymphoma invading the intestinal wall, mesenteric lymph nodes, and may metastasize to a distant organ . IPSID lymphoma shares clinical, morphological and molecular features with MALT lymphoma, lymphoplasmacytic lymphoma and with plasma cell neoplasms. Int J Food Microbiol, 2004 Dec 15, 97(2), 187 - 95 Survival of Campylobacter jejuni on various fresh produce; Karenlampi R et al.; The survival of seven human and two chicken Campylobacter jejuni strains, with known Penner heat-stable (HS) serotypes and pulsed-field gel electrophoresis (PFGE) genotypes, was investigated on fresh-cut iceberg lettuce . In addition, the survival of four selected C . jejuni strains was assessed on cantaloupe pieces, cucumber slices, grated carrot and strawberries . Fresh produce was inoculated with 10(5) to 10(7) colony-forming units (CFU) of C . jejuni per gram, and the bacterium was enumerated using standard procedures after sample storage at 7 and 21 degrees C for 24, 48 and 72 h . The absolute values of the slopes (death rates) of the survival curves (log(10) CFU/g versus time) were calculated and compared . At 7 degrees C, the mean death rates (day(-1)) were 0.44 on cantaloupe, 0.41 on cucumber slices, 0.43 on grated carrot, 0.59 on iceberg lettuce and 1.02 on strawberries . The corresponding death rates (day(-1)) at 21 degrees C were 1.52, 1.55, 2.61, 1.39 and 8.74 . The death rate of C . jejuni on strawberries (pH 3.4) was significantly (P<0.05) higher than on other produce . Moreover, the death rate at 21 degrees C as compared with 7 degrees C was significantly higher (P<0.05) . Minor differences were observed in the survival of different C . jejuni strains . Our results suggest that after contamination of fresh produce, including strawberries, C . jejuni may survive sufficiently long to pose a risk to the consumer. J Antimicrob Chemother, 2004 Dec, 54(6), 1025 - 1030 Epub 2004 Nov 10. Antimicrobial resistance in Campylobacter strains isolated from French broilers before and after antimicrobial growth promoter bans; Desmonts MH et al.; OBJECTIVES: The antimicrobial susceptibility of Campylobacter strains isolated from standard and free-range broilers in 1992-1996 and 2001-2002 was studied . METHODS: Strains were isolated from caeca or skin samples collected from standard or free-range broilers arriving in slaughterhouses . The MICs of ampicillin, nalidixic acid, enrofloxacin, tetracycline, erythromycin and gentamicin were determined by agar dilution and compared according to species (Campylobacter jejuni or Campylobacter coli), production system and sampling period . RESULTS: Results showed that all chickens harboured Campylobacter . An increase over time of the C . coli/C . jejuni ratio for standard chickens occurred . A wide range of MICs was observed among isolates from the same broiler or from the same farm . Strains collected on entry to the slaughterhouse and after storage showed no significant difference in their antibiotic resistance . C . coli was more resistant than C . jejuni to tetracycline and erythromycin during the first period and to all tested molecules (except gentamicin) during the second period . Strains isolated from standard chickens were also more often resistant than those isolated from free-range broilers . The percentage of C . jejuni strains resistant to ampicillin decreased from 1992-1996 to 2001-2002, whereas no change could be observed for the other antimicrobial agents . However, for C . coli the resistance to ampicillin, nalidixic acid, enrofloxacin, tetracycline and erythromycin significantly increased . CONCLUSION: There was an increase in the incidence of antibiotic resistance of C . coli between 1992-1996 and 2001-2002. An Pediatr (Barc), 2004 Nov, 61(5), 403 - 7 {Erythema nodosum: etiological changes in the last two decades}; Sota Busselo I et al.; OBJECTIVE: To study the etiological factors associated with erythema nodosum in children hospitalized between January 1985 and December 2003 . MATERIAL AND METHODS: We performed a retrospective, descriptive study through review of the medical records of children with a diagnosis of erythema nodosum (MBDS-ICD 9-CM, code 6952) . Forty-five patients (27 boys and 18 girls) aged between 10 months and 14 years were studied . The following variables were analyzed: age, sex, associated symptoms, complementary investigations (blood count, erythrocyte sedimentation rate, throat swab, chest x-ray, Mantoux test, ASLO titer, stool culture, serology) and final diagnosis . RESULTS: The most frequent etiology was tuberculosis (10 patients), followed by Salmonella enteritidis (7 patients), group A beta -hemolytic Streptococcus (3 patients), Salmonella typhimurium (2 patients), Campylobacter jejuni (2 patients), Yersinia enterocolitica (1 patient), infectious mononucleosis caused by Epstein Barr virus (1 patient), cat scratch disease (1 patient), BCG vaccination (1 patient), associated chronic hepatitis B infection (1 patient), and associated amoxicillin treatment (1 patient) . Etiology was unknown in 15 patients . The last case of erythema nodosum associated with tuberculous infection dated back to 1991, after which the most frequent etiologic factors associated with erythema nodosum were gastrointestinal pathogens . CONCLUSIONS: According to our results, the main etiological factor currently associated with erythema nodosum is gastrointestinal infection . Consequently, stool cultures, especially when there are associated gastrointestinal symptoms, are essential. Avian Dis, 2004 Sep, 48(3), 647 - 50 Inability of cecal microflora to promote reversion of viable nonculturable Campylobacter jejuni; Ziprin RL et al.; Campylobacter jejuni cells are able to enter a viable but nonculturable (VBNC) state when they are suspended in water . In the present experiments we inoculated day-of-hatch leghorn and broiler chicks with normal gut microflora and subsequently challenged these with high doses of VBNC C . jejuni . The objective was to determine if the pre-establishment of a normal gut flora would enable VBNC Campylobacter to recover, revert to the vibrionic form, and colonize the cecum . Day-of-hatch leghorn and broiler chicks were gavaged through the esophagus with 0.75 ml of a continuous-flow culture of normal cecal organisms . Two days after gavage, the same chicks were gavaged with 0.75 ml (greater than 10(9) colony-forming units) of a VBNC suspension of C . jejuni . Seven days later, cecal contents were collected, serially diluted, and examined for the presence of viable culturable C . jejuni . Our results demonstrated that the VBNC C . jejuni cells were unable to revert to a vibrionic culturable form capable of colonizing the cecum. Avian Dis, 2004 Sep, 48(3), 625 - 30 Isolation and prevalence of Campylobacter in the reproductive tracts and semen of commercial turkeys; Cole K et al.; Campylobacter is one of the most commonly reported bacterial causes of human foodborne infections in the United States, and epidemiologic evidence indicates that a significant proportion of human infections result from the improper preparation of poultry products . Campylobacter frequently colonizes the avian intestinal tract, but recent research indicates that this organism can also colonize the avian reproductive tract and possibly contaminate eggs and subsequent offspring . The present studies were undertaken to determine the prevalence of Campylobacter in the reproductive systems of commercial turkeys . In the first study, pooled semen samples from seven commercial turkey farms were randomly collected by abdominal massage over a period of 13 wk . The pooled semen samples were serially diluted, and 0.1 ml of each dilution was plated on Campy-Line agar and incubated at 42 C for 48 hr in a microaerophilic environment for enumeration of Campylobacter . Campylobacter was isolated from 57 of the 59 pooled semen samples, and levels ranged from below the limit of detection (<10(1)) to 1.6 x 10(6) cfu/ml of semen . In the second study, the reproductive tracts of 11 hens and 17 toms were aseptically excised, and the segments (female: vagina, shell gland, isthmus, magnum, and infundibulum; male: ductus deferens and testes) were swabbed with a dry cotton sterile swab . The swabs were incubated for 24 hr in Campylobacter enrichment broth, and 0.1 ml of the enriched sample solution was streaked onto Campy-Line agar plates and incubated at 42 C for 48 hr in a microaerophilic environment . Of the 11 hens sampled, Campylobacter was isolated from the vagina (10/11), the shell gland (7/11), the isthmus (8/11), the magnum (6/11), and the infundibulum (4/11) . Of the 17 toms sampled, Campylobacter was isolated from the ductus deferens (8/17) and the testes (2/17) . Campylobacter is present in the reproductive tracts and semen of commercial turkeys and may lead to vertical transmission of Campylobacter from the hen to the chick. J Vet Med B Infect Dis Vet Public Health, 2004 Oct-Nov, 51(8-9), 374 - 9 Evidence of an association between use of anti-microbial agents in food animals and anti-microbial resistance among bacteria isolated from humans and the human health consequences of such resistance; Angulo FJ et al.; Several lines of evidence indicate that the use of anti-microbial agents in food animals is associated with anti-microbial resistance among bacteria isolated from humans . The use of anti-microbial agents in food animals is most clearly associated with anti-microbial resistance among Salmonella and Campylobacter isolated from humans, but also appears likely among enterococci, Escherichia coli and other bacteria . Evidence is also accumulating that the anti-microbial resistance among bacteria isolated from humans could be the result of using anti-microbial agents in food animals and is leading to human health consequences . These human health consequences include: (i) infections that would not have otherwise occurred and (ii) increased frequency of treatment failures and increased severity of infection . Increased severity of infection includes longer duration of illness, increased frequency of bloodstream infections, increased hospitalization and increased mortality . Continued work and research efforts will provide more evidence to explain the connection between the use of anti-microbial agents in food animals and anti-microbial-resistant infections in humans . One particular focus, which would solidify this connection, is to understand the factors that dictate spread of resistance determinants, especially resistant genes . With continued efforts on the part of the medical, veterinary and public health community, such research may contribute to more precise guidelines on the use of anti-microbials in food animals. J Vet Med B Infect Dis Vet Public Health, 2004 Oct-Nov, 51(8-9), 361 - 3 Veterinary use of antimicrobials and emergence of resistance in zoonotic and sentinel bacteria in the EU; Bywater RJ; Antimicrobials are essential for treatment of sick animals, but even if used correctly, may eventually lead to antimicrobial resistance . While this represents a potential hazard to humans, the great majority of resistant human pathogens, especially the more important ones, are unrelated to animal sources . A survey of informed medical opinion suggested that of the human antimicrobial resistance problem, <4% was seen as potentially linked to animal sources . This proportion related largely to zoonotic bacteria which by definition have the capacity to carry resistance between species, although the evidence for resulting harm remains limited . A recent study compared resistance among chicken, pig and cattle isolates of Salmonella spp., Campylobacter spp . and Escherichia coli from a series of EU countries . When tested against antimicrobial agents, this survey showed variation of resistance between countries, between hosts and between organisms . Such variation may give insight into preferred methods of antimicrobial administration or disease control, but it is clear that the epidemiology of antimicrobial resistance induction and dissemination in animals remains complex and is yet to be fully understood. Epidemiol Mikrobiol Imunol, 2004 Aug, 53(3), 100 - 5 {Trends in the incidence of salmonellosis and campylobacteriosis in the Czech Republic}; Prikazska M et al.; Salmonellosis and campylobacteriosis are the most frequently reported acute enteric diseases of infectious origin in the Czech Republic . Epidemiological data on salmonellosis and campylobacteriosis have been reportable in this country since 1951 and 1984, respectively . In 2003, 53,486 cases of acute enteric infections were reported: 26,899 (52%) diagnosed as salmonellosis and 20,063 (almost 40%) diagnosed as campylobacteriosis . In 1989, the annual incidence of salmonellosis was three times as high as in the previous year, the upward trend continued until 1995 (528/100,000) and since 1998 the salmonellosis incidence rates have been declining . The incidence of campylobacteriosis showed a progressive increase since 1984 to peak in 2002 with a following slight decline in 2003 . Morbidity from salmonellosis and campylobacteriosis is highest in the age group 0-4-year-olds . The most frequent causative agents are Salmonella Enteritidis (96%) and Campylobacter jejuni, respectively . Both infections are foodborne . Ready-to-eat meals, poultry, confectionery and eggs seem to be most frequently implicated in outbreaks of salmonellosis in public catering and families . Sporadic cases of campylobacteriosis are mostly associated with ingestion of poultry and chopped meat . The incidence rates of these two infections are positively correlated with the average daily temperatures. Biosens Bioelectron, 2004 Nov 1, 20(4), 684 - 98 Multipathogen oligonucleotide microarray for environmental and biodefense applications; Sergeev N et al.; Food-borne pathogens are a major health problem . The large and diverse number of microbial pathogens and their virulence factors has fueled interest in technologies capable of detecting multiple pathogens and multiple virulence factors simultaneously . Some of these pathogens and their toxins have potential use as bioweapons . DNA microarray technology allows the simultaneous analysis of thousands of sequences of DNA in a relatively short time, making it appropriate for biodefense and for public health uses . This paper describes methods for using DNA microarrays to detect and analyze microbial pathogens . The FDA-1 microarray was developed for the simultaneous detection of several food-borne pathogens and their virulence factors including Listeria spp., Campylobacter spp., Staphylococcus aureus enterotoxin genes and Clostridium perfringens toxin genes . Three elements were incorporated to increase confidence in the microarray detection system: redundancy of genes, redundancy of oligonucleotide probes (oligoprobes) for a specific gene, and quality control oligoprobes to monitor array spotting and target DNA hybridization . These elements enhance the reliability of detection and reduce the chance of erroneous results due to the genetic variability of microbes or technical problems with the microarray . The results presented demonstrate the potential of oligonucleotide microarrays for detection of environmental and biodefense relevant microbial pathogens. Dis Aquat Organ, 2004 Sep 8, 60(3), 233 - 40 Development of monoclonal antibodies for detection of necrotizing hepatopancreatitis in penaeid shrimp; Bradley-Dunlop DJ et al.; Monoclonal antibodies (MAbs) were produced against necrotizing hepatopancreatitis bacteria (NHP-B) of penaeid shrimp . The MAbs tested in dot-immunoblot (D-IB) assays were capable of detecting the NHP-B in hepatopancreas samples collected from moribund juvenile Litopenaeus vannamei during an experimentally induced NHP-B infection . The MAbs were also screened by immunohistochemistry (IHC) using case submissions that were determined to be infected not only by histology, but also polymerase chain reaction (PCR) and in situ hybridization (ISH) assays using specific digoxigenin (DIG)-labeled probes on histological sections prepared from naturally infected shrimp . Two of the MAbs were chosen for development of detection methods for NHP . The MAbs were tested using IHC methods on Davidson's alcohol-formalin-acetic acid (AFA) fixed tissue sections and identified NHP-B infected cells and tissues in a pattern similar to that seen with DIG-labeled NHP-specific gene probes . None of the MAbs reacted with tissue from specific pathogen-free (SPF) shrimp or with shrimp tissues infected with a rickettsia-like bacteria, Vibrio sp., Campylobacter sp., and Spiroplasma sp . The MAbs were found to be negative against these other organisms, demonstrating that they are species specific and useful for rapid diagnostic detection of NHP-B. Poult Sci, 2004 Oct, 83(10), 1734 - 8 Effects of aeration and storage temperature on Campylobacter concentrations in poultry semen; Cole K et al.; Campylobacter is one of the most commonly reported bacterial causes of human foodborne infections in the United States . Recent evidence has demonstrated that Campylobacter is present in poultry semen and may contribute to the vertical transmission between the breeder hen and offspring . As Campylobacter is considered sensitive to oxygen and cold temperature, the objective of this study was to determine if aeration and storage temperature could reduce or eliminate Campylobacter in poultry semen . In 4 separate trials, pooled semen samples were collected from roosters or toms, diluted with a commercial poultry semen extender, and inoculated with an average of 10(7) cells/mL of a wild-type C . jejuni or C . coli semen isolate . Pooled ejaculates were then divided into 3 aeration treatments: Control (no aeration), air, or oxygen (gently bubbled for 20 min with atmospheric air or oxygen, respectively) . Immediately after aeration, pooled semen samples were further divided to 3 test storage temperatures: 4, 23, or 42 degrees C . At 0, 2, 6, and 24 h of storage, samples were enumerated for Campylobacter . Aeration of the semen alone, or aeration with reduced temperatures (4 or 23 degrees C), did not reduce the amount of Campylobacter compared with the controls . Campylobacter concentrations were, however, reduced when stored at 42 degrees C for 24 h . This effect is associated with reduced sperm viability and is therefore not a practical treatment of reducing Campylobacter in semen . It appears alternative methods will be needed to eliminate Campylobacter from poultry semen. Poult Sci, 2004 Oct, 83(10), 1728 - 33 Detection of Campylobacter or Salmonella in turkey semen and the ability of poultry semen extenders to reduce their concentrations; Donoghue AM et al.; Campylobacter and Salmonella are the most commonly reported pathogens causing foodborne illness in the United States . In turkeys, the potential that semen used for artificial insemination is contaminated with these foodborne pathogens has not been investigated . Because semen on turkey farms is pooled and then used to inseminate multiple hens, contaminated semen could easily spread these bacteria throughout entire flocks via artificial insemination . The objectives of this study were to 1) determine if semen from commercial turkey farms contained these foodborne pathogens and 2) if present, evaluate the efficacy of semen extenders to reduce or eliminate Campylobacter and Salmonella from semen . Semen was collected from randomized pools of ejaculates from 10 to 30 toms per farm from 6 flocks over a 7-wk period and, on occasion, was found to contain Campylobacter, Salmonella, or both . To evaluate the efficacy of semen extenders to reduce or eliminate pathogens, pooled ejaculates were challenged with Campylobacter or Salmonella and treated with commercial poultry extenders containing various concentrations of antibiotics or an antibiotic combination previously demonstrated to remove Campylobacter from mammalian semen . Results demonstrate that commercial turkey semen may contain Campylobacter or Salmonella, and the semen extenders tested either did not reduce the bacteria or reduced but did not eliminate these bacteria from semen . We concluded that semen may be a potential vehicle for Campylobacter transfer to hens, and, if this is true, development of a method for eliminating pathogens in semen before insemination could reduce the risk of colonization. J Biol Chem . 2004 Oct 27; {Epub ahead of print} A single bifunctional UDP-GlcNAc/Glc 4-epimerase supports the synthesis of three cell surface glycoconjugates in campylobacter jejuni; Bernatchez S et al.; The major cell-surface carbohydrates (lipooligosaccharide, capsule and glycoprotein N-linked heptasaccharide) of Campylobacter jejuni NCTC 11168 contain Gal and/or GalNAc residues . GalE is the sole annotated UDP-glucose 4-epimerase in this bacterium . The presence of GalNAc residues in these carbohydrates suggested that GalE may be an UDP-GlcNAc 4-epimerase . GalE was shown to epimerize UDP-Glc and UDP-GlcNAc in coupled assays with C . jejuni glycosyltransferases and in sugar nucleotide epimerization equilibria studies . Thus, GalE possesses UDP-GlcNAc 4-epimerase activity and was renamed Gne . The Km(app) of a purified MalE-Gne fusion protein for UDP-GlcNAc and UDP-GalNAc are 1087M and 1070 M while those for UDP-Glc and UDP-Gal are 780 M and 784 M . The kcat and kcat/ Km(app) were three to four times higher for UDP-GalNAc and UDP-Gal than for UDP-GlcNAc and UDP-Glc . The comparison of the kinetic parameters of MalE-Gne to those of other characterized bacterial UDP-GlcNAc 4-epimerases indicated that Gne is a bifunctional UDP-GlcNAc/Glc 4-epimerase . The UDP-sugar binding site of Gne was modeled using the structure of the UDP-GlcNAc 4-epimerase WbpP from Pseudomonas aeruginosa . Small differences were noted and these may explain the bifunctional character of the C . jejuni Gne . In a gne mutant of C . jejuni, the LOS was shown by CE-MS to be truncated by at least five sugars . Furthermore, both the glycoprotein N-linked heptasaccharide and capsule were no longer detectable by high resolution magic angle spinning NMR . These data indicate that Gne is the enzyme providing Gal and GalNAc residues for the synthesis of all three cell-surface carbohydrates in C . jejuni NCTC 11168. J Food Prot, 2004 Oct, 67(10), 2288 - 91 Effects of postchill application of acidified sodium chlorite to control Campylobacter spp . and Escherichia coli on commercial broiler carcasses; Oyarzabal OA et al.; Experiments were performed to assess the reduction of Campylobacter spp . and Escherichia coli in commercial broiler carcasses by postchill dip applications of acidified sodium chlorite . Carcass rinses were collected before the inside-outside-bird washer (IOBW), post-IOBW, postchill, and after the postchill application of acidified sodium chlorite . Prevalence and counts of Campylobacter spp . and E . coli were determined . The mean values for Campylobacter spp . and E . coli counts differed significantly at sampling sites . The IOBW reduced the bacterial counts significantly in only one experiment . The chiller reduced Campylobacter counts significantly in both experiments but failed to significantly reduce the counts of E . coli in one experiment . No major reduction in the prevalence after enrichment for Campylobacter spp . was detected post-IOBW or postchill . However, a significant reduction in Campylobacter spp . and in E . coli counts and Campylobacter spp . prevalence was seen after the postchill application of acidified sodium chlorite . These results demonstrate that the antimicrobial effect of acidified sodium chlorite applied postchill may be used to significantly reduce Campylobacter spp . and E . coli in commercial broiler carcasses . Postchill systems may eventually be used in different applications, such as mist, spray, or bath, which could be applied closer to the final stages in processing. J Food Prot, 2004 Oct, 67(10), 2171 - 7 Detection of seven virulence and toxin genes of Campylobacter jejuni isolates from Danish turkeys by PCR and cytolethal distending toxin production of the isolates; Bang DD et al.; A total of 117 Campylobacter jejuni isolates from Danish turkeys were tested for the presence of seven virulence and toxin genes by PCR . One hundred seventeen (100%) isolates were positive for flaA, cadF, and ceuE gene primers . One hundred three (88%) isolates were positive for cdt gene cluster PCR detection (cdt gene cluster-PCR), whereas 101 (86.3%), 102 (87.2%), and 110 (94%) isolates were positive for cdtA-, cdtB-, and cdtC-PCR, respectively . Only 39 (33.3%) isolates were positive for virB11 . Of 117 isolates, 114 (97.4%) produced cytolethal distending toxin (CDT) in Vero cell assays, 105 (89.7%) in Colon 205 assays, and 109 (93.2%) in chicken embryo cell assays . The CDT titers were determined in Vero cell assays . Of 117 isolates, 50 (42.7%) produced a CDT titer of 1:100, 29 (24.8%) of 1:50, and 27 (23%) of 1:5 to 1:10; 8 (6.8%) produced a CDT titer at undiluted supernatants and 3 (2.6%) produced no toxin . Twenty-nine C . jejuni isolates that were PCR negative for one or more individual cdt toxin genes also produced low or no CDT toxin . The high prevalence of the seven virulence and toxin genes demonstrates that these putative pathogenic determinants are widespread among Campylobacter isolates from turkeys and calls for further investigation for the elimination of Campylobacter infection in industrial turkey production and in industrial food chains. Emerg Infect Dis, 2004 Oct, 10(10), 1863 - 7 Arcobacter species in humans; Vandenberg O et al.; During an 8-year study period, Arcobacter butzleri was the fourth most common Campylobacter-like organism isolated from 67,599 stool specimens . Our observations suggest that A . butzleri displays microbiologic and clinical features similar to those of Campylobacter jejuni; however, A . butzleri is more frequently associated with a persistent, watery diarrhea. Emerg Infect Dis, 2004 Oct, 10(10), 1844 - 7 Campylobacteriosis, Eastern Townships, Quebec; Michaud S et al.; Independent risk factors for campylobacteriosis (eating raw, rare, or undercooked poultry; consuming raw milk or raw milk products; and eating chicken or turkey in a commercial establishment) account for <50% of cases in Quebec . Substantial regional and seasonal variations in campylobacteriosis were not correlated with campylobacter in chickens and suggested environmental sources of infection, such as drinking water. Emerg Infect Dis, 2004 Aug, 10(8), 1490 - 2 Flies and Campylobacter infection of broiler flocks; Hald B et al.; A total of 8.2% of flies caught outside a broiler house in Denmark had the potential to transmit Campylobacter jejuni to chickens, and hundreds of flies per day passed through the ventilation system into the broiler house . Our study suggests that flies may be an important source of Campylobacter infection of broiler flocks in summer. Emerg Infect Dis, 2004 Aug, 10(8), 1474 - 7 Swimming and Campylobacter infections; Schonberg-Norio D et al.; A matched case-control study was conducted to study risk factors for domestically acquired sporadic Campylobacter infections in Finland . Swimming in natural sources of water was a novel risk factor . Eating undercooked meat and drinking dug-well water were also independent risk factors for Campylobacter infection. Nat Rev Microbiol, 2004 Nov, 2(11), 872 - 85 Comparative analysis of four Campylobacterales; Eppinger M et al.; Comparative genome analysis can be used to identify species-specific genes and gene clusters, and analysis of these genes can give an insight into the mechanisms involved in a specific bacteria-host interaction . Comparative analysis can also provide important information on the genome dynamics and degree of recombination in a particular species . This article describes the comparative genome analysis of representatives of four different Campylobacterales species - two pathogens of humans, Helicobacter pylori and Campylobacter jejuni, as well as Helicobacter hepaticus, which is associated with liver cancer in rodents, and the non-pathogenic commensal species, Wolinella succinogenes. J Periodontal Res, 2004 Dec, 39(6), 398 - 404 The distribution of periodontopathic bacteria among Japanese children and their parents; Umeda M et al.; OBJECTIVE AND BACKGROUND: It is not well known how periodontopathic bacteria colonize in the oral cavity during childhood . The purpose of this study was to investigate the distribution of periodontopathic bacteria in oral cavities of children and their parents and the relationship between the bacterial findings and clinical parameters . METHODS: Fifty-six children (mean age: 8.3 +/- 3.5, range: 1-15 years), including 15 with deciduous dentition, 26 with mixed dentition and 15 with permanent dentition, and their parents participated in this study . Whole saliva and dental plaque of the children and whole saliva of their parents were collected for detection of seven species of periodontopathic bacteria (Actinobacillus actinomycetemcomitans, Tannerella forsythensis (Bacteroides forsythus), Campylobacter rectus, Porphyromonas gingivalis, Prevotella intermedia, Prevotella nigrescens and Treponema denticola) using the polymerase chain reaction method . Clinical parameters including simplified Oral Hygiene Index and Papillary-Marginal-Attachment Index were recorded for the children and their accompanied parents . RESULTS: The detection frequencies of T . forsythensis, C . rectus, P . nigrescens, T . denticola, A . actinomycetemcomitans and P . gingivalis in the oral cavities of children were 42.9%, 94.6%, 42.9%, 48.2%, 1.8% and 8.9%, respectively . T . forsythensis, P . gingivalis and T . denticola were detected more frequently in the saliva of parents (54.8%, 54.8%, 88.1%, respectively) than in the saliva of children (25.5%, 7.3%, 41.8%, respectively) . Different detection frequencies of P . nigrescens were found among the oral cavities of children with deciduous, mixed and permanent dentitions . In mixed dentition, females harbored T . forsythensis more frequently than males did . Children who harbored T . forsythensis, P . intermedia, P . nigrescens and T . denticola showed high scores for oral debris measurement by simplified Oral Hygiene Index . T . forsythensis, P . intermedia and P . nigrescens were detected more frequently in children whose parents were positive for these pathogens than in children whose parents were negative . CONCLUSIONS: High plaque retention seems to promote the colonization of periodontal pathogens in the oral cavities of children . T . forsythensis, P . intermedia and P . nigrescens were detected more frequently in the oral cavities of children whose parents already harbored these bacteria . Familial transmission of these bacteria is suggested . (c)Blackwell Munksgaard 2004 J Appl Microbiol, 2004, 97(5), 883 - 91 Microbiological status of piggery effluent from 13 piggeries in the south east Queensland region of Australia; Chinivasagam HN et al.; AIMS: To assist in the development of safe piggery effluent re-use guidelines by determining the level of selected pathogens and indicator organisms in the effluent ponds of 13 south-east Queensland piggeries . METHODS AND RESULTS: The numbers of thermotolerant coliforms, Campylobacter jejuni/coli, Erysipelothrix rhusiopathiae, Escherichia coli, Salmonella and rotavirus were determined in 29 samples derived from the 13 piggeries . The study demonstrated that the 13 final effluent ponds contained an average of 1.2 x 10(5) colony-forming units (CFU) 100 ml(-1) of thermotolerant coliforms and 1.03 x 10(5) CFU 100 ml(-1) of E . coli . The Campylobacter level varied from none detectable (two of 13 piggeries) to a maximum of 930 most probable number (MPN) 100 ml(-1) (two of 13 piggeries) . Salmonella was detected in the final ponds of only four of the 13 piggeries and then only at a low level (highest level being 51 MPN 100 ml(-1)) . No rotavirus and no Erysip . rhusiopathiae were detected . The average log10 reductions across the ponding systems to the final irrigation pond were 1.77 for thermotolerant coliforms, 1.71 for E . coli and 1.04 for Campylobacter . CONCLUSIONS: This study has provided a baseline knowledge on the levels of indicator organisms and selected pathogens in piggery effluent . SIGNIFICANCE AND IMPACT OF THE STUDY: The knowledge gained in this study will assist in the development of guidelines to ensure the safe and sustainable re-use of piggery effluent. J Clin Microbiol, 2004 Oct, 42(10), 4840 - 2 Sequence-based typing of flaB is a more stable screening tool than typing of flaA for monitoring of Campylobacter populations; Mellmann A et al.; Different typing schemes for Campylobacter spp . were evaluated with 70 outbreak and sporadic isolates . The discriminatory indexes were 0.944 (by pulsed-field gel electrophoresis), 0.920 (by genotyping of the flagellin A gene), 0.902 (by genotyping of flaB), and 0.886 (by multilocus sequence typing) . Cross-classification gave 94.77 or 95.82% (PFGE-flaA or PFGE-flaB) concordance . flaA was overdiscriminatory in three cases, most probably due to intragenomic recombination. J Clin Microbiol, 2004 Oct, 42(10), 4566 - 76 Large-scale comparative genomics meta-analysis of Campylobacter jejuni isolates reveals low level of genome plasticity; Taboada EN et al.; We have used comparative genomic hybridization (CGH) on a full-genome Campylobacter jejuni microarray to examine genome-wide gene conservation patterns among 51 strains isolated from food and clinical sources . These data have been integrated with data from three previous C . jejuni CGH studies to perform a meta-analysis that included 97 strains from the four separate data sets . Although many genes were found to be divergent across multiple strains (n = 350), many genes (n = 249) were uniquely variable in single strains . Thus, the strains in each data set comprise strains with a unique genetic diversity not found in the strains in the other data sets . Despite the large increase in the collective number of variable C . jejuni genes (n = 599) found in the meta-analysis data set, nearly half of these (n = 276) mapped to previously defined variable loci, and it therefore appears that large regions of the C . jejuni genome are genetically stable . A detailed analysis of the microarray data revealed that divergent genes could be differentiated on the basis of the amplitudes of their differential microarray signals . Of 599 variable genes, 122 could be classified as highly divergent on the basis of CGH data . Nearly all highly divergent genes (117 of 122) had divergent neighbors and showed high levels of intraspecies variability . The approach outlined here has enabled us to distinguish global trends of gene conservation in C . jejuni and has enabled us to define this group of genes as a robust set of variable markers that can become the cornerstone of a new generation of genotyping methods that use genome-wide C . jejuni gene variability data. Microbiology, 2004 Oct, 150(Pt 10), 3507 - 17 Nucleotide sequences and comparison of two large conjugative plasmids from different Campylobacter species; Batchelor RA et al.; Two large tetracycline resistance (TcR) plasmids have been completely sequenced, the pTet plasmid (45.2 kb) from Campylobacter jejuni strain 81-176 and a plasmid pCC31 (44.7 kb) from Campylobacter coli strain CC31 that was isolated from a human case of severe gastroenteritis in the UK . Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence and overall gene organization . Several predicted proteins encoded by genes involved in conjugation showed highest homology to proteins found in Actinobacillus actinomycetemcomitans, a periodontal pathogen . In addition to replication- and conjugation-associated genes, both plasmids carried a tet(O) gene encoding tetracycline resistance, a 6 kb ORF encoding a putative methylase and a number of genes of unknown function . The pTet plasmid co-exists in C . jejuni strain 81-176 with a smaller, previously characterized, non-conjugative plasmid pVir that also encodes a type IV secretion system (T4SS) that may affect virulence . In contrast, the T4SS encoded by pTet and pCC31 are shown to mediate bacterial conjugation between Campylobacter . The possible origin and evolution of pCC31 and pTet is discussed. Dtsch Tierarztl Wochenschr, 2004 Aug, 111(8), 326 - 31 {Monitoring and risk assessment of campylobacter infections}; Bartelt E; The aim of a national study of a "Quantitative Risk Assessment of Campylobacter infections and broiler chicken" at the Federal Institute for Risk Assessment is to estimate the chicken meat associated risk of Campylobacteriosis in Germany by using probabilistic models . Furthermore, process parameters (modelling parameters) with the most vital impact on the risk of Campylobacteriosis due to chicken meat have to be elaborated to give recommendations for risk management options in the whole food chain . The outcome of Joint FAO/WHO Expert Consultations on Risk Assessment of Microbiological Hazards in Foods (JEMRA) with respect to Campylobacter spp . in broiler chickens are the baseline for the national approach . In addition, national studies from Canada, Denmark and The Netherlands have to be considered . Typical regional data with respect to the disease, to risk factors in Germany and to the qualitative and quantitative occurrence of Campylobacter in broiler chickens along the "farm-to-fork" continuum have to be collected and validated for elaboration of the four elements of a risk assessment . Data on the prevalence of the agent at different stages of the food chain given in available surveillance systems in Germany are limited with respect to their suitability as incoming parameters for the models . A monitoring programme, as required in the Directive 2003/99/EC on the monitoring of zoonoses and zoonotic agents, as well as coordinated programmes for the official food control authorities, could improve the data baseline for risk assessment studies for instance . To collect all necessary information on the quantitative load of Camylobacter in broiler chickens will go beyond the scope of any existing or future monitoring systems . Results can only be achieved by detailed studies . Beside this, regional data on production and processing of broiler chicken, consumption data and information on the behaviour of consumers in households when preparing broiler chicken products are relevant for assessing the final risk to the consumers . For some questions, especially with respect to the dose-response-relation, internationally used models have to be applied . The national study is embedded in a national epidemiological network of "Foodborne Infections in Germany" which is coordinated by the Robert-Koch-Institute and supported by the Federal Ministry of Education and Research (BMBF). New Microbiol, 2004 Jul, 27(3), 281 - 5 Campylobacter fetus bacteremia in an immunocompromised patient: case report and review of the literature; Monno R et al.; A 33-year-old woman underwent a liver transplantation and splenectomy in 1985 and had followed immunosuppressive therapy until 1995 . Afterwards a non-Hodgkin lymphoma was diagnosed and chemotherapy was started . In January 2000, because of suspect transplantation rejection she was treated with steroid and immunosuppressive therapy . Fever occurred after two months and Cytomegalovirus (CMV) infection was diagnosed . Ganciclovir was started with clinical remission . In November 2000 fever recurred without clinical symptoms . Lymphoma recurrence was excluded and CMV was detected by PCR in several biological fluids . Blood cultures were positive for a bacterium that was identified as Campylobacter fetus . The patient was successfully treated with intravenous ciprofloxacin . For persistent CMV viremia therapy with gancyclovir was stopped and foscarnet was used (60mg/Kg/tid i.v . for two weeks) . Bacteremia due to C . fetus is rare, occurring mainly in immunocompromised patients . In our patient the immunosuppressive therapy, chemotherapy for lymphoma and CMV infection had made the patient susceptible to bacteremia with this infrequently found bacterium . The clinical microbiologist should be aware of this infection in immunocompromised hosts. J Food Prot, 2004 Sep, 67(9), 1892 - 903 A quantitative analysis of cross-contamination of Salmonella and Campylobacter spp . via domestic kitchen surfaces; Kusumaningrum HD et al.; Epidemiological data indicate that cross-contamination during food preparation in the home contributes noticeably to the occurrence of foodborne diseases . To help prevent such occurrences, the inclusion of a cross-contamination model in exposure assessments would aid in the development and evaluation of interventions used to control the spread of pathogenic bacteria . A quantitative analysis was carried out to estimate the probability of contamination and the levels of Salmonella and Campylobacter spp . on salads as a result of cross-contamination from contaminated chicken carcasses via kitchen surfaces . Data on the prevalence and numbers of these bacteria on retail chicken carcasses and the use of unwashed surfaces to prepare foods were collected from scientific literature . The rates of bacterial transfer were collected from laboratory experiments and literature . A deterministic approach and Monte Carlo simulations that incorporated input parameter distributions were used to estimate the contamination of the product . The results have shown that the probability of Campylobacter spp . contamination on salads is higher than that of Salmonella spp., since both the prevalence and levels of Campylobacter spp . on chicken carcasses are higher than those of Salmonella spp . It is realistic to expect that a fraction of the human exposure to Campylobacter spp., in particular, originates from cross-contamination in private kitchens during food handling . The number of human campylobacteriosis cases could be reduced either by reducing the degree of Campylobacter spp . contamination on chicken carcasses or by improving the hygiene in private kitchens . To eliminate the cross-contamination route, it is important to use separate surfaces or to properly wash the surfaces during the preparation of raw and cooked foods or ready-to-eat foods. Theriogenology, 2004 Nov, 62(8), 1367 - 82 Immunization in heifers with dual vaccines containing Tritrichomonas foetus and Campylobacter fetus antigens using systemic and mucosal routes; Cobo ER et al.; Vaccines against both bovine venereal campylobacteriosis and trichomonosis were tested . Heifers were assigned to three groups . Groups 1 (n = 21 heifers) and group 2 (n = 20) received a commercial or experimental vaccine, respectively, containing both Campylobacter fetus and Tritrichomonas foetus antigens . Group 3 (n = 21) received adjuvant alone . Preparations were injected SQ in groups 1 and 3 at days -60 and -30 (day 0 was considered the first day of a 90-day breeding period), and in group 2 SQ at days -30 and +11 and into the vaginal submucosa at day -9 . Heifers were exposed to two pathogen-infected bulls for 90 days (from day 0 to day +90); furthermore, half of the heifers in each group were challenged at day +39 by an intravaginal instillation of C . fetus venerealis and T . foetus . Pregnancy diagnosis, vaginal culture, and determination of systemic IgG for both organisms were performed . Compared to controls, vaccinated heifers resisted or quickly cleared both pathogens, had a higher pregnancy rate and a higher systemic immune response during and after the breeding period . Overall, the experimental vaccine was superior to the commercial vaccine (groups 2 and 1, respectively) . In conclusion, an experimental vaccine containing both C . fetus and T . foetus antigens, given both SQ and intravaginal immediately before breeding and early in the breeding season, yielded superior protection for heifers exposed to bulls harboring C . fetus and T . foetus. Poult Sci, 2004 Sep, 83(9), 1497 - 506 Nonimmunized egg yolk powder can suppress the colonization of Salmonella typhimurium, Escherichia coli O157:H7, and Campylobacter jejuni in laying hens; Kassaify ZG et al.; If colonized, poultry shed enteric pathogens in the feces . Of those that colonize poultry Salmonella spp., Campylobacter jejuni (C . jejuni), and Escherichia coli (E . coli) O157:H7 are the most concern to the industry . The authors previously discovered that the introduction of 5% dried nonimmunized egg yolk powder in the regular feed could eliminate and prevent Salmonella enteritidis intestinal colonization of laying hens . Hence, the efficacy of nonimmunized dried egg yolk powder supplement in controlling the colonization of laying hens with Salmonella typhimurium (S . typhimurium), C . jejuni, and E . coli O157:H7 was investigated in this study . The 10% (wt/ wt) egg yolk powder eliminated S . typhimurium after 2 wk of feeding and the 5 and 7.5% (wt/wt) supplements significantly (P < 0.05) reduced the frequency of colonization . Similarly, 7.5 and 10% egg yolk powder reduced the colonization of C . jejuni and E . coli O157:H7 significantly (P < 0.05) after 1 wk of feeding . In the prevention trial, pathogen-free chickens were fed supplemented feed (10% egg yolk powder) for 4 wk and were then infected . S . typhimurium was prevented from colonizing the intestine throughout the 4-wk test, and E . coli O157:H7 colonization was delayed for 2 wk . C . jejuni and E . coli O157:H7 populations in the intestine were significantly (P < 0.05) suppressed by egg yolk powder supplementation throughout the test . None of the supplement concentrations affected BW or the mean weight and number of the eggs laid per hen . At the end of the study, the organisms were absent or significantly (P < 0.05) reduced in the intestine, ovary, oviduct, and spleen of hens fed the egg yolk powder treatment . This study indicates that nonimmunized egg yolk powder is able to reduce the frequency of colonization of foodborne pathogens and prevent these organisms from colonizing the intestinal tract . Addition of egg yolk powder to the regular feed at a concentration of 7.5 to 10% (wt/wt) may be a simple means of reducing or inhibiting S . typhimurium, C . jejuni, and E . coli O157:H7 colonization in laying hens. Microb Drug Resist, 2004 Fall, 10(3), 243 - 7 Antimicrobial susceptibility patterns of Arcobacter butzleri and Arcobacter cryaerophilus strains isolated from humans and broilers; Houf K et al.; The MICs of five antimicrobial agents were determined by the agar dilution method for 98 Arcobacter butzleri and 28 Arcobacter cryaerophilus strains from humans, and poultry . With gentamicin, a MIC of 16 microg/ml was recorded for one A . butzleri strain isolated from poultry, whereas for the other strains MICs ranged from 0.25 to 4 microg/ml . With ciprofloxacin, a bimodal distribution of susceptibility levels was seen for human A . butzleri isolates (0.015-0.03 versus 0.12-0.25), whereas MICs for 65 of the 68 A . butzleri poultry strains ranged from 0.12 to 0.5 microg/ml and three strains from three different broilers were resistant with a MIC of 16 microg/ml . One A . cryaerophilus strain from poultry was resistant to erythromycin at a MIC of 128 microg/ml, whereas MICs for the other Arcobacter strains ranged from 2 to 32 microg/ml . No difference in susceptibility or resistance among the human and poultry strains tested was observed with doxycycline and nalidixic acid . The presence of acquired resistance to erythromycin and ciprofloxacin among poultry isolates is a matter of concern, because the two antimicrobials are generally prescribed as first-line drugs for the treatment of infections with Campylobacteraceae in humans . Copyright Mary Ann Liebert, Inc. Euro Surveill . 2004 Sep 1;9(9) {Epub ahead of print} Travellers returning to Sweden as sentinels for comparative disease incidence in other European countries, campylobacter and giardia infection as examples; Ekdahl K et al.; Comparable figures on disease incidence between countries are difficult to attain . We therefore compared risk of infection for Swedes going to other European countries . We took as the numerator the number of imported cases from European countries of campylobacter and giardia infection in the national Swedish surveillance database, and as the denominator, the number of visitors to each country from a commercial database on foreign travel . Risk of infection in tourists was also compared to national incidence figures for a selection of countries. Vet Microbiol, 2004 Oct 5, 103(1-2), 77 - 84 Evaluation of a monoclonal antibody-based enzyme-linked immunosorbent assay for detection of Campylobacter fetus in bovine preputial washing and vaginal mucus samples; Brooks BW et al.; A monoclonal antibody-based enzyme-linked immunosorbent assay (ELISA) was described and evaluated for use as a presumptive screening test for detection of Campylobacter fetus in bovine preputial washing and vaginal mucus samples . A total of 725 diagnostic samples collected in the field and submitted in Clark's transport enrichment medium (TEM) were analyzed . Cultural isolation of C . fetus was used as the standard for comparison . After incubation of the TEM vials for 4-5 days, fluid was removed for culture and ELISA testing . A sandwich ELISA format was used and the target antigen was C . fetus lipopolysaccharides (LPS) . A rabbit anti-C . fetus polyclonal antiserum was used as the capture antibody . Murine monoclonal antibodies (MAbs) to C . fetus serotype A and B LPS core and O-polysaccharides and a goat anti-mouse horseradish peroxidase conjugate were used as detection antibodies . ELISA and culture results for the diagnostic samples were in complete agreement . Seven hundred and eight samples were negative by both tests . All 17 culture positive samples were positive by ELISA with a MAb to LPS core . The ELISA with MAbs to LPS O-polysaccharides detected all culture positive samples with the homologous C . fetus serotype . Sixty-six preputial wash samples from three known C . fetus culture positive bulls were also analyzed . Forty-nine of these samples were positive by both ELISA and culture, 16 were positive by ELISA only, and one was negative by both ELISA and culture . The results indicate that this ELISA is useful as a screening test for the detection of C . fetus in diagnostic samples. Bioresour Technol, 2005 Jan, 96(2), 135 - 43 Pathogen survival during livestock manure storage and following land application; Nicholson FA et al.; This paper reports the first year results of field experiments to determine the survival times of pathogens in livestock manures during storage and following land application, using viable count methods . E . coli O157, Salmonella and Campylobacter survived in stored slurries and dirty water for up to three months, with Listeria surviving for up to three months . In contrast, all these pathogens survived for less than one month in solid manure heaps where temperatures greater than 55 degrees C were obtained . Following manure spreading to land, E . coli O157, Salmonella and Campylobacter generally survived in the soil for up to one month after application to both the sandy arable and clay loam grassland soils, whereas Listeria commonly survived for more than one month . These data are being used to develop guidelines on the management of manures to minimize the risks of pathogen transfer from animal manures to the human food chain. J Bacteriol, 2004 Oct, 186(19), 6508 - 14 N-linked protein glycosylation is required for full competence in Campylobacter jejuni 81-176; Larsen JC et al.; The recent sequencing of the virulence plasmid of Campylobacter jejuni 81-176 revealed the presence of genes homologous to type IV secretion systems (TFSS) that have subsequently been found in Helicobacter pylori and Wolinella succinogenes . Mutational analyses of some of these genes have implicated their involvement in intestinal epithelial cell invasion and natural competence . In this report, we demonstrate that one of these type IV secretion homologs, Cjp3/VirB10, is a glycoprotein . Treatment with various glycosidases and binding to soybean agglutinin indicated that the structure of the glycan present on VirB10 contains a terminal GalNAc, consistent with previous reports of N-linked glycans in C . jejuni . Site-directed mutagenesis of five putative N-linked glycosylation sites indicated that VirB10 is glycosylated at two sites, N32 and N97 . Mutants in the N-linked general protein glycosylation (pgl) system of C . jejuni are significantly reduced in natural transformation, which is likely due, in part, to lack of glycosylation of VirB10 . The natural transformation defect in a virB10 mutant can be complemented in trans by using a plasmid expressing wild-type VirB10 or an N32A substitution but not by using a mutant expressing VirB10 with an N97A substitution . Taken together, these results suggest that glycosylation of VirB10 specifically at N97 is required for the function of the TFSS and for full competence in C . jejuni 81-176. J Antimicrob Chemother, 2004 Oct, 54(4), 744 - 54 Epub 2004 Sep 16. A European survey of antimicrobial susceptibility among zoonotic and commensal bacteria isolated from food-producing animals; Bywater R et al.; OBJECTIVE: To study antimicrobial resistance in zoonotic bacteria isolated from food animals in different countries using uniform methodology . METHODS: Samples were taken at slaughter from chickens, pigs and cattle in four EU countries per host . Escherichia coli (indicator organism; n = 2118), Salmonella spp . (n = 271) and Campylobacter spp . (n = 1325) were isolated in national laboratories and MICs tested in a central laboratory against, where appropriate, ampicillin, cefepime, cefotaxime, ciprofloxacin, chloramphenicol, erythromycin, gentamicin, nalidixic acid, streptomycin, tetracycline and trimethoprim/sulfamethoxazole . RESULTS: Isolation rates were high for E . coli, low for Salmonella and intermediate for Campylobacter . MIC results showed resistance prevalence varied among compounds, hosts and countries . For E . coli and Salmonella, resistance to newer compounds (cefepime, cefotaxime, ciprofloxacin) was absent or low, but to older compounds (except gentamicin), resistance was variable and higher . E . coli isolates from Sweden showed low resistance, whereas among isolates from Spain (pigs), resistance to ampicillin, chloramphenicol, streptomycin, tetracycline and trimethoprim/sulfamethoxazole was higher; the UK, France, the Netherlands, Germany, Italy and Denmark were intermediate . For Campylobacter spp . isolates from chickens, nalidixic acid and ciprofloxacin resistance was >30% in France and the Netherlands, >6% in the UK and zero in Sweden . Nalidixic acid resistance was high in cattle (20%-64%), whereas ciprofloxacin resistance was markedly lower in cattle, variable in pigs (3%-21%) and highest in Sweden . Generally, Campylobacter coli was more resistant than Campylobacter jejuni . CONCLUSION: Antimicrobial resistance among enteric organisms in food animals varied among countries, particularly for older antimicrobials, but resistance to newer compounds used to treat disease in humans was generally low. Clin Microbiol Infect, 2004 Oct, 10(10), 868 - 76 Campylobacter, from obscurity to celebrity; Butzler JP; After its successful isolation from stools in the 1970s, Campylobacter jejuni has rapidly become the most commonly recognised cause of bacterial gastroenteritis in man . Reported cases of human campylobacteriosis represent only a small fraction of the actual number . In industrialised countries, the incidence of C . jejuni/Campylobacter coli infections peaks during infancy, and again in young adults aged 15-44 years . Acute self-limited gastrointestinal illness, characterised by diarrhoea, fever and abdominal cramps, is the most common presentation of C . jejuni/C . coli infection . The introduction of selective media has made the diagnosis of Campylobacter enteritis a simple procedure . In general, Campylobacter enteritis is a self-limiting disease which seldom requires antimicrobial therapy, although one in 1000 infections may lead to the Guillain-Barre syndrome . In industrialised countries, most infections are acquired through the handling and consumption of poultry meat . In developing countries, where the disease is confined to young children, inadequately treated water and contact with farm animals are the most important risk factors . Many infections are acquired during travel . Fluoroquinolone resistance has been reported in C . jejuni since the late 1980s in Europe and Asia, and since 1995 in the USA . The use of fluoroquinolones to treat animals used for food has accelerated this trend of resistance . In Australia, where fluoroquinolones have not been licensed for use in food production animals, C . jejuni remains susceptible to fluoroquinolones . The public health burden of Campylobacter spp . other than C . jejuni/C . coli remains unmeasured . Better diagnostic methods may reveal the true health burden of these organisms. Muscle Nerve, 2004 Oct, 30(4), 423 - 32 Blood gammadelta T cells, Campylobacter jejuni, and GM1 titers in Guillain-Barré syndrome; Scelsa SN et al.; The gammadelta T cells participate in microbial defense, are prevalent in intestinal epithelia, and are activated in autoimmune diseases . We studied whether peripheral blood gammadelta cells and gammadelta subsets are increased in Guillain-Barre syndrome (GBS) and whether elevations are associated with Campylobacter jejuni infection or GM1 elevations . In 20 GBS patients, we performed serial flow cytometry studies of blood gammadelta, Vdelta1, and Vdelta2 cells (+/- CD8+), C jejuni, and ganglioside titers . There was no significant difference in median gammadelta T-cell percentages between GBS patients and controls at onset and at convalescence . However, 5 patients had marked Vdelta1/CD8+ elevations . Elevated Vdelta1 or Vdelta1/CD8+ cells occurred in 3 of 6 patients with C jejuni or GM1 titer elevations . A minority of GBS patients have elevations of Vdelta1/CD8+ cells, possibly associated with elevated C jejuni or GM1 titers . The gammadelta T cells may have a cytotoxic (or suppressor) role in the disease. J Toxicol Environ Health A, 2004 Oct 22-Nov 26, 67(20-22), 1879 - 87 Heavy rainfall and waterborne disease outbreaks: the Walkerton example; Auld H et al.; Recent research indicates that excessive rainfall has been a significant contributor to historical waterborne disease outbreaks . The Meteorological Service of Canada, Environment Canada, provided an analysis and testimony to the Walkerton Inquiry on the excessive rainfall events, including an assessment of the historical significance and expected return periods of the rainfall amounts . While the onset of the majority of the Walkerton, Ontario, Escherichia coli O157:H7 and Campylobacter outbreak occurred several days after a heavy rainfall on May 12, the accumulated 5-d rainfall amounts from 8-12 May were particularly significant . These 5-d accumulations could, on average, only be expected once every 60 yr or more in Walkerton and once every 100 yr or so in the heaviest rainfall area to the south of Walkerton . The significant link between excess rainfall and waterborne disease outbreaks, in conjunction with other multiple risk factors, indicates that meteorological and climatological conditions need to be considered by water managers, public health officials, and private citizens as a significant risk factor for water contamination . A system to identify and project the impacts of such challenging or extreme weather conditions on water supply systems could be developed using a combination of weather/climate monitoring information and weather prediction or quantitative precipitation forecast information . The use of weather monitoring and forecast information or a "wellhead alert system" could alert water system and water supply managers on the potential response of their systems to challenging weather conditions and additional requirements to protect health . Similar approaches have recently been used by beach managers in parts of the United States to predict day-to-day water quality for beach advisories. Vet Rec, 2004 Aug 14, 155(7), 193 - 6 Surveillance programme for Campylobacter species in Swedish broilers, July 2001 to June 2002; Hansson I et al.; A total of 20,599 samples from 4133 slaughter groups representing about 71 million broilers slaughtered between July 1,2001 and June 30, 2002 were tested for Campylobacter species . From each slaughter group, 40 cloacal samples and 10 samples of neck skin were taken from the carcases on the slaughter line and the samples were pooled, 10 to a pool . Campylobacter species were detected in cloacal samples from 17 per cent of the slaughter groups and in neck skin samples from 22 per cent of the groups, and the monthly prevalence figures ranged from 6 to 32 per cent . In most of the infected groups all four pooled cloacal samples were positive, but 18 per cent of the infected groups had only one or two positive samples . More than 90 per cent of the Campylobacter-positive slaughter groups were delivered by half the producers, and one in four of the producers delivered no Campylobacter-positive slaughter groups. J Clin Periodontol, 2004 Oct, 31(10), 869 - 77 Clinical and microbiological changes associated with the use of combined antimicrobial therapies to treat "refractory" periodontitis; Haffajee AD et al.; BACKGROUND: The present investigation examined clinical and microbial changes after a combined aggressive antimicrobial therapy in subjects identified as "refractory" to conventional periodontal therapy . METHOD: Fourteen subjects were identified as "refractory" based on full-mouth mean attachment loss and/or >3 sites with attachment loss > or =3 mm following scaling and root planing (SRP), periodontal surgery and systemic antibiotics . After baseline monitoring, subjects received SRP, locally delivered tetracycline at pockets > or =4 mm, systemically administered amoxicillin (500 mg, t.i.d . for 14 days)+metronidazole (250 mg, t.i.d . for 14 days) and professional removal of supragingival plaque weekly for 3 months . Subjects were monitored clinically every 3 months post-therapy for 2 years . Subgingival plaque samples were taken at the same time points from the mesial aspect of each tooth and the levels of 40 subgingival taxa were determined using checkerboard DNA-DNA hybridization . Mean levels of each species were averaged within a subject at each visit . Significance of changes in clinical and microbiological parameters over time were evaluated using the Friedman or Wilcoxon signed ranks test . RESULTS: On average, subjects showed significant improvements in all clinical parameters after therapy . Mean (+/-SEM) full-mouth pocket depth reduction was 0.83+/-0.13 mm and mean attachment level "gain" was 0.44+/-0.12 at 24 months . Clinical improvement was accompanied by major reductions in multiple subgingival species during the first 3 months of active therapy that were maintained for most species to the last monitoring visit . Reductions occurred for three Actinomyces species, "orange complex" species including Campylobacter showae, Eubacterium nodatum, three Fusobacterium nucleatum subspecies, Peptostreptococcus micros, Prevotella intermedia as well as the "Streptococcus milleri" group, Streptococcus anginosus, Streptococcus constellatus and Streptococcus intermedus . Subjects differed in their response to therapy; six modest response subjects exhibited less attachment level gain and were characterized by reductions in the microbiota from baseline to 3 months, but re-growth of many species thereafter . CONCLUSIONS: The combined antibacterial therapy was successful in controlling disease progression in 14 "refractory" periodontitis subjects for 2 years . Copyright Blackwell Munksgaard, 2004 J Pak Med Assoc, 2004 Jun, 54(6), 291 - 4 Evaluation of frequency of isolation and trends in antibiotic resistance among Campylobacter isolates over 11 year period; Ibrahim NG et al.; OBJECTIVE: To analyze frequency of isolation and trends in antibiotic resistance among Campylobacter isolates over 11 year period in Microbiology Laboratory, Aga Khan University from the year 1992-2002 . METHODS: Total 52,777 stool specimens were processed during the study period . Enteric pathogens isolated from 8,483 stool samples were further analyzed for frequency of isolation and antimicrobial resistance . Statistical Analysis was done by using descriptive statistics of SPSS version 10 . Values were expressed as percentages, mean and rates . RESULTS: Campylobacter species were third in frequency of isolation with an isolation rate of 24.8% . C . jejuni was the predominant pathogen followed by C.coli . Isolation rate of Campylobacter was higher (45.7%) among children under 2 years of age as compared to other age groups . A steady rise in resistance among Campylobacter isolates against ampicillin; tetracycline and ofloxacin has been noted whereas resistance against erythromycin remained fairly low . CONCLUSION: The isolation of Campylobacter is higher from stool specimens of children of less than two years of age rendering Campylobacteriosis to be an important cause of gastroenteritis in pediatric population . This study also demonstrates a steady rise in antibiotic resistance in Campylobacter isolates especially against quinolones with fall in resistance against erythromycin throughout the study period. J Clin Gastroenterol, 2004 Oct, 38(9), 772 - 5 The diagnostic yield of stool pathogen studies during relapses of inflammatory bowel disease; Meyer AM et al.; GOALS: We sought to determine the yield of stool analysis for bacterial culture, ova and parasites, and Clostridium difficile toxin in suspected relapses of inflammatory bowel disease (IBD) . BACKGROUND: The diagnostic yield of such stool studies has not been examined recently in the United States . STUDY: The medical records of consecutive IBD patients who underwent stool testing for relapses at our institution between July 1, 2000, and November 25, 2001, were abstracted for demographics, stool test results, recent antibiotic exposure, and hospitalization . RESULTS: Fifty-four patients were evaluated during 62 relapses with 99 stool samples . Twelve stool tests were positive . C . difficile accounted for the majority of positive tests (10/12) . Of these, 9 (90%) were associated with antibiotic use in the prior month versus 10 (22%) in the C . difficile-negative group (P < 0.001) . Hospitalization, prednisone use, or sulfasalazine use did not differ significantly with C . difficile status . Eight C . difficile-positive patients improved clinically with targeted antibiotic therapy . Two bacterial cultures (4%) were positive for Campylobacter jejuni and Plesiomonas shigelloides . CONCLUSION: Stool studies yielded a pathogen, mainly C . difficile, in 20% of the relapsing IBD patients . Antibiotic use was significantly associated with a positive C . difficile toxin . Toxin-positive patients improved clinically with targeted antibiotics. J Clin Microbiol, 2004 Sep, 42(9), 4405 - 7 Campylobacter fetus of reptile origin as a human pathogen; Tu ZC et al.; A Campylobacter species was isolated from blood from a febrile patient with precursor T-cell acute lymphoblastic leukemia, and after antibiotic treatment, a similar bacterium was isolated from blood 37 days later . Although phenotypic testing did not definitively identify the organisms, molecular analysis indicated that they were the same strain of Campylobacter fetus subsp . fetus and were of reptile origin. J Clin Microbiol, 2004 Sep, 42(9), 3985 - 91 Use of culture, PCR analysis, and DNA microarrays for detection of Campylobacter jejuni and Campylobacter coli from chicken feces; Keramas G et al.; A DNA microarray for detection of Campylobacter spp . was recently developed and applied to detect Campylobacter spp . directly from chicken feces . Sixty-five pooled chicken cloacal swab samples from 650 individual broiler chickens were included in the study . The results of Campylobacter sp . detection obtained with DNA microarrays were compared to those obtained by conventional culture and gel electrophoresis . By conventional culture, 60% of the samples were positive for either Campylobacter jejuni or Campylobacter coli . By PCR and capillary electrophoresis, 95% of the samples were positive for Campylobacter spp., whereas with DNA microarrays all samples were positive for Campylobacter spp . By application of DNA microarray analysis, the isolates in 4 samples (6%) could not be identified to the species level, whereas by PCR-capillary electrophoresis, the isolates in 12 samples (19%) remained unidentified . Interestingly, PCR-capillary electrophoresis analysis revealed that two (3%) of the samples were positive for both C . jejuni and C . coli, while DNA microarray analysis revealed that nine (14%) of the samples were positive for both species . Of 65 samples, 2 samples were identified to contain C . coli by conventional culture but were positive for C . jejuni by both PCR-capillary electrophoresis and DNA microarray analysis . The discrepancy between the methods is discussed. J Mol Biol, 2004 Oct 1, 342(5), 1583 - 97 The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases; Moroz OV et al.; The crystal structure of the dUTPase from the important gastric pathogen Campylobacter jejuni has been solved at 1.65 A spacing . This essential bacterial enzyme is the second representative of the new family of dimeric dUTPases to be structurally characterised . Members of this family have a novel all-alpha fold and are unrelated to the all-beta dUTPases of the majority of organisms including eukaryotes such as humans, bacteria such as Escherichia coli, archaea like Methanococcus jannaschii and animal viruses . Therefore, dimeric dUTPases can be considered as candidate drug targets . The X-ray structure of the C.jejuni dUTPase in complex with the non-hydrolysable substrate analogue dUpNHp allows us to define the positions of three catalytically significant phosphate-binding magnesium ions and provides a starting point for a detailed understanding of the mechanism of dUTP/dUDP hydrolysis by dimeric dUTPases . Indeed, a water molecule present in the structure is ideally situated to act as the attacking nucleophile during hydrolysis . A comparison of the dUTPases from C.jejuni and Trypanosoma cruzi reveals a common fold with certain distinct features, both in the rigid and mobile domains as defined in the T.cruzi structure . Homologues of the C.jejuni dUTPase have been identified in several other bacteria and bacteriophages, including the dCTPase of phage T4 . Sequence comparisons of these proteins define a new superfamily of d(C/U)TPases that includes three distinct enzyme families: (1) dUTPases in trypanosomatides, C.jejuni and several other Gram-negative bacteria, (2) predicted dUTPases in various Gram-positive bacteria and their phages, and (3) dCTP/dUTPases in enterobacterial T4-like phages . All these enzymes share a basic module that consists of two alpha-helices from the rigid domain, two helices from the mobile domain and connecting loops . These results in concert with a number of conserved residues responsible for interdomain cross-talk provide valuable insight towards rational drug design. Int J Food Microbiol, 2004 Nov 1, 96(2), 173 - 9 Species identification by genotyping and determination of antibiotic resistance in Campylobacter jejuni and Campylobacter coli from humans and chickens in Sweden; Ronner AC et al.; Campylobacter is today the most common cause of human bacterial enteritis in Sweden, as well as in most other industrialized countries . Common sources of infection are undercooked chicken meat, unpasteurized milk and contaminated drinking water . One aim with our present study was to identify the species Campylobacter jejuni and Campylobacter coli strains from humans and chickens using a polymerase chain reaction/restriction enzyme analysis (PCR/REA) method, as well as traditional hippurate hydrolysis test . Another aim was to investigate the antibiotic resistance pattern of the human domestic C . jejuni/C . coli isolates from infected patients and isolates from healthy Swedish chicken, as well as isolates from humans infected abroad . If discrimination between C . jejuni and C . coli was based on testing for hippurate hydrolysis, 95% of the human domestic strains and 88% of the chicken strains were identified as C . jejuni . Based on genotyping by PCR/REA, 100% of the human domestic strains and 98% of the chicken strains were attributed to C . jejuni . The E-test and disc diffusion methods were used for phenotypic antibiotic resistance studies . The two methods gave similar results . Most Swedish C . jejuni/C . coli isolates both from humans and chickens were sensitive to doxycycline and erythromycin, which are antibiotics used to treat human infection . Only 7% of the human domestic strains and 2% of the chicken strains were resistant to the quinolones tested . As a comparison, more than 94% of strains isolated from travelers to Asia and southern Europe showed antibiotic resistance to one or more drugs. Gastroenterology, 2004 Sep, 127(3), 845 - 58 Helicobacter pylori and H2O2 increase AP endonuclease-1/redox factor-1 expression in human gastric epithelial cells; Ding SZ et al.; BACKGROUND & AIMS: Helicobacter pylori infection causes inflammation, accumulation of reactive oxygen species, and oxidative DNA damage in the gastric mucosa . Apurinic/apyrimidinic endonuclease-1 (APE-1)/redox factor-1 (Ref-1) repairs damaged DNA and reductively activates transcription factors, including activator protein-1 . Considering that H . pylori generate reactive oxygen species and that reactive oxygen species modulate APE-1/Ref-1 in other cell types, we examined the effect of H . pylori, oxidative stress, and antioxidants on APE-1/Ref-1 expression in human gastric epithelial cells . METHODS: Human gastric epithelial cell lines or cells isolated from mucosal biopsy samples were stimulated with H . pylori, Campylobacter jejuni, and/or H 2 O 2 in the presence or absence of antioxidants . APE-1/Ref-1 expression was assayed by Western blot or reverse-transcription polymerase chain reaction, and its cellular distribution was determined by using indirect conventional and confocal immunofluorescence . New protein synthesis was detected by {S 35 }methionine labeling . APE-1/Ref-1 function was assessed by using a luciferase-linked reporter construct containing 3 activator protein 1 binding sites . RESULTS: APE-1/Ref-1 protein and messenger RNA were detected in resting gastric epithelial cells . APE-1/Ref-1 protein expression was increased after stimulation with H 2 O 2 or live cag pathogenicity island-bearing H . pylori, but not cag pathogenicity island-negative H . pylori or C . jejuni . H . pylori - or reactive oxygen species-mediated increases in APE-1/Ref-1 expression involved de novo protein synthesis that was inhibited by antioxidants . H . pylori or H 2 O 2 also induced nuclear accumulation of APE-1/Ref-1, and overexpression of APE-1/Ref-1 increased activator protein 1 binding activity . CONCLUSIONS: The data show that H . pylori or reactive oxygen species enhance APE-1/Ref-1 protein synthesis and nuclear accumulation in human gastric epithelial cells and implicate APE-1/Ref-1 in the modulation of the pathogenesis of H . pylori infection. J Appl Microbiol, 2004, 97(4), 853 - 60 A novel method for isolation of Campylobacter spp . from environmental samples, involving sample processing, and blood- and antibiotic-free medium; Baserisalehi M et al.; AIMS: To develop a method that involves sample processing, and blood- and antibiotic-free medium for isolation and enumeration of Campylobacter spp . from environmental samples . METHODS AND RESULTS: The sample processing (preT) was standardized to minimize the population of competing bacteria . A blood- and antibiotic-free differential, Kapadnis-Baseri medium (KB medium) was formulated and tested for isolation of Campylobacter spp . in comparison with CAT medium . PreT-KB method was evaluated in comparison with the conventional viable count method and with the conventional most probable number (C . MPN) method for enumeration of Campylobcater from environmental samples . The results indicated that sample processing significantly reduced population of competing bacteria . The KB medium selected Gram-negative bacteria and differentiated Campylobacter from lactose-fermenting competing bacteria . The population of Campylobacter detected by preT-KB method was similar to that by conventional viable count method . While, the population of Campylobacter spp . determined by preT-KB method was higher than that by C . MPN method . In addition, the preT-KB method detected antibiotic sensitive campylobacters . CONCLUSION: The preT minimizes population of competing bacteria and the KB medium selects Gram-negative bacteria and differentiates Campylobacter from them . Therefore, Campylobacter can be isolated from environmental samples without using antibiotics . SIGNIFICANCE AND IMPACT OF THE STUDY: The preT-KB method is simple and facilitates isolation of antibiotic sensitive and enumeration of Campylobacter in the environmental samples . Therefore, the new method will be useful for isolation and enumeration of Campylobacter from water, food and sewage samples . Besides, it would also detect antibiotic-sensitive campylobacters, which are not detected by conventional viable count and MPN methods. Ann Biol Clin (Paris), 2004 Sep-Oct, 62(5), 591 - 4 {Anti-GD1b IgG positive case of overlapping Ficher's and Guillain-Barré syndromes}; Caudie C et al.; We describe a patient who developed overlapping sensory ataxic form of Guillain-Barre syndrome (GBS) and Miller Fisher syndrome (MFS) following Campylobacter jejuni infection . Two cerebrospinal fluid examinations shown albuminocytologic dissociation associated with Campylobacter jejuni infection after tongue pierced . He had high titers of monospecific anti-GD1b IgG antibody . Because of the rarety of this disorder the diagnostic was difficult . There is a close association of IgG anti-ganglioside GD1b antibodies in sensory ataxic GBS . The findings of the present study show that antibody to GD1b ganglioside is one of the immunological factors in the pathogenesis of sensory ataxic form of GBS, a rare specific immuno-clinical variant form of GBS with prominent sensory ataxia. Ann Biol Clin (Paris), 2004 Sep-Oct, 62(5), 587 - 9 {Sepsis due to Campylobacter fetus subsp fetus in an hepatitis C virus patient}; Dumoulard B et al.; Campylobacter fetus subsp fetus was identified as an unusual etiologic agent of septicemia in an immuno-compromized patient VHC positive by utilizing a 16S rRNA molecular kit in our hospital's clinical laboratory . This method would appear as a performing approach to identify pathogens when discrepancies exist between phenotypical tests. Appl Environ Microbiol, 2004 Sep, 70(9), 5111 - 8 Effect of length of time before incorporation on survival of pathogenic bacteria present in livestock wastes applied to agricultural soil; Hutchison ML et al.; In response to reports that the contamination of food can occur during the on-farm primary phase of food production, we report data that describes a possible cost-effective intervention measure . The effect of time before soil incorporation of livestock wastes spread to land on the rate of decline of zoonotic agents present in the waste was investigated . Fresh livestock wastes were inoculated with laboratory-cultured Salmonella, Listeria, and Campylobacter spp . and Escherichia coli O157 before they were spread onto soil . Incorporation of the spread wastes was either immediate, delayed for 1 week, or did not occur at all . Bacterial decline was monitored over time and found to be significantly more rapid for all waste types when they were left on the soil surface . There were no significant differences in initial bacterial decline rates when wastes were spread in summer or winter . Our results indicate that not incorporating contaminated livestock wastes into soil is a potential intervention measure that may help to limit the spread of zoonotic agents further up the food chain . The implications of these findings are discussed in relation to current advice for livestock waste disposal. J Pediatr, 2004 Sep, 145(3), 297 - 303 Human milk oligosaccharides are associated with protection against diarrhea in breast-fed infants; Morrow AL et al.; OBJECTIVE: To determine the association between maternal milk levels of 2-linked fucosylated oligosaccharide and prevention of diarrhea as a result of Campylobacter, caliciviruses, and diarrhea of all causes in breast-fed infants . STUDY DESIGN: Data and banked samples were analyzed from 93 breast-feeding mother-infant pairs who were prospectively studied during 1988-1991 from birth to 2 years with infant feeding and diarrhea data collected weekly; diarrhea was diagnosed by a study physician . Milk samples obtained 1 to 5 weeks postpartum were analyzed for oligosaccharide content . Data were analyzed by Poisson regression . RESULTS: Total 2-linked fucosyloligosaccharide in maternal milk ranged from 0.8 to 20.8 mmol/L (50%-92% of milk oligosaccharide) . Moderate-to-severe diarrhea of all causes (n=77 cases) occurred less often (P=.001) in infants whose milk contained high levels of total 2-linked fucosyloligosaccharide as a percent of milk oligosaccharide . Campylobacter diarrhea (n=31 cases) occurred less often (P=.004) in infants whose mother's milk contained high levels of 2'-FL, a specific 2-linked fucosyloligosaccharide, and calicivirus diarrhea (n=16 cases) occurred less often (P=.012) in infants whose mother's milk contained high levels of lacto-N-difucohexaose (LDFH-I), another 2-linked fucosyloligosaccharide . CONCLUSION: This study provides novel evidence suggesting that human milk oligosaccharides are clinically relevant to protection against infant diarrhea. J Periodontol, 2004 Jul, 75(7), 918 - 24 Relationship of subgingival and salivary microbiota to gingival overgrowth in heart transplant patients following cyclosporin A therapy; Romito GA et al.; BACKGROUND: Severe gingival overgrowth (GO) is induced in patients taking cyclosporin A (CsA) following organ transplantation . Determining which patient will develop GO is still not possible . The purpose of this study was to establish an association between CsA and gingival overgrowth in heart transplant patients taking into account periodontal and microbiological conditions . METHODS: Thirty patients (10 female, 20 male; range: 13 to 67 years; mean age: 44.89) undergoing CsA treatment were evaluated using the gingival index (GI), plaque index (PI), probing depth (PD), and clinical attachment level (CAL) . Subgingival samples collected from the deepest site of each quadrant and saliva samples were submitted to microbial analysis . All patients had at least 12 teeth . Exclusion criteria were the use of antibiotics and/or having undergone periodontal treatment 6 months prior to the study . Patients were divided in two groups: with gingival (GO+) and without gingival overgrowth (GO-) . RESULTS: There were no statistically significant differences between the GO+ and GO- groups when CsA dosage, time since transplant, GI, PI, PD, and CAL were compared . Microbiological examination of the subgingival samples detected the following microorganisms: Actinobacillus actinomycetemcomitans (23%), Porphyromonas gingivalis (36%), Prevotella intermedia (93%), Fusobacterium sp . (66%), Campylobacter rectus (30%), Micromonas micros (66%), enteric rods (0%), and yeasts (30%) . A positive association between M . micros and the GO+ group was found (P < 0.001) . Yeasts were detected in 30% of the subgingival and saliva samples . CONCLUSIONS: Clinical parameters were not sufficient to determine which patients would develop GO . However, colonization by M . micros might play a role in the etiology of GO. Poult Sci, 2004 Aug, 83(8), 1452 - 5 Impact of feathers and feather follicles on broiler carcass bacteria; Cason JA et al.; Genetically featherless and feathered broiler siblings were used to test the contribution of feathers and feather follicles to the numbers of aerobic bacteria, Escherichia coli, and Campylobacter in whole-carcass rinse samples taken immediately after carcasses were defeathered for 30 or 60 s . Numbers of spoilage bacteria were counted after the same fully processed carcasses were stored for 1 wk at 2 degrees C . In each of 3 replications, twenty-eight 11-wk-old, mixed-sex, genetically featherless or feathered broilers were processed in a laboratory processing facility . Immediately after individual defeathering in a mechanical picker, carcasses were sampled using a carcass rinse technique . Carcasses were eviscerated, immersion chilled at 2 degrees C for 30 min, individually bagged, and stored for 1 wk at 2 degrees C, after which all carcasses were rinsed again, and spoilage bacteria in the rinsate were enumerated . There were no significant differences (P < or = 0.05) between the featherless and feathered broilers in numbers of aerobic bacteria, E . coli, and Campylobacter in rinse samples taken immediately after defeathering and no differences between carcasses picked for 30 or 60 s . There were no differences in numbers of spoilage bacteria after 1 wk of refrigeration for any of the feather presence-picking length combinations . Although the defeathering step in poultry processing has been identified as an opportunity for bacterial contamination from the intestinal tract and cross-contamination between carcasses, the presence of feathers and feather follicles does not make a significant difference in carcass bacterial contamination immediately after defeathering or in spoilage bacteria after 1 wk of refrigeration. Eur J Clin Microbiol Infect Dis, 2004 Sep, 23(9), 718 - 21 Epub 2004 Aug 24. A case of cellulitis complicating Campylobacter jejuni subspecies jejuni bacteremia and review of the literature; Monselise A et al.; Infection with Campylobacter species is a predominant cause of food-borne gastroenteritis in the industrialized world . Bacteremia is detected in <1% of patients with diarrhea, mainly in immunocompromised hosts or those in the extremes of age . Reported here is the case of a 78-year-old, immunocompromised male patient with Campylobacter jejuni subsp . jejuni bacteremia complicated by cellulitis . The infection was characterized by a protracted course with several recurrences and refractoriness to multiple antibiotic regimens, responding only to a prolonged course of meropenem treatment . The frequency of cellulitis as reflected in previously reported series of Campylobacter bacteremia and the clinical characteristics of this difficult-to-treat infection are reviewed . J Food Prot, 2004 Aug, 67(8), 1610 - 6 Use of MIDI-fatty acid methyl ester analysis to monitor the transmission of Campylobacter during commercial poultry processing; Hinton A Jr et al.; The presence of Campylobacter spp . on broiler carcasses and in scald water taken from a commercial poultry processing facility was monitored on a monthly basis from January through June . Campylobacter agar, Blaser, was used to enumerate Campylobacter in water samples from a multiple-tank scalder; on prescalded, picked, eviscerated, and chilled carcasses; and on processed carcasses stored at 4 degrees C for 7 or 14 days . The MIDI Sherlock microbial identification system was used to identify Campylobacter-like isolates based on the fatty acid methyl ester profile of the bacteria . The dendrogram program of the Sherlock microbial identification system was used to compare the fatty acid methyl ester profiles of the bacteria and determine the degree of relatedness between the isolates . Findings indicated that no Campylobacter were recovered from carcasses or scald tank water samples collected in January or February, but the pathogen was recovered from samples collected in March, April, May, and June . Processing generally produced a significant (P < 0.05) decrease in the number of Campylobacter recovered from broiler carcasses, and the number of Campylobacter recovered from refrigerated carcasses generally decreased during storage . Significantly (P < 0.05) fewer Campylobacter were recovered from the final tank of the multiple-tank scald system than from the first tank . MIDI similarity index values ranged from 0.104 to 0.928 based on MIDI-fatty acid methyl ester analysis of Campylobacterjejuni and Campylobacter coli isolates . Dendrograms of the fatty acid methyl ester profile of the isolates indicated that poultry flocks may introduce several strains of C . jejuni and C . coli into processing plants . Different populations of the pathogen may be carried into the processing plant by successive broiler flocks, and the same Campylobacter strain may be recovered from different poultry processing operations . However, Campylobacter apparently is unable to colonize equipment in the processing facility and contaminate broilers from flocks processed at later dates in the facility. Acta Microbiol Pol, 2004, 53(1), 61 - 4 Antigenicity of the Campylobacter coli CjaA protein produced by Escherichia coli; Raczko A et al.; Immunogenic C . coli CjaA protein is a candidate for a chicken anti-Campylobacter subunit vaccine . In order to enhance its immunogenicity an antigenic determinant of the CjaA protein was identified . Thereafter, two copies of the antigenic epitope were cloned in tandem directly or with a flexible hinge between them . All experiments documented that the CjaA protein contained not only linear antigenic epitope/s but also conformational ones. J Endod, 2004 Sep, 30(9), 638 - 43 Selected endodontic pathogens in the apical third of infected root canals: a molecular investigation; Siqueira JF Jr et al.; Bacteria located at the apical portion of the root canals are conceivably in a strategic position to induce damage to the periradicular tissues and resulting inflammatory diseases . This study sought to investigate the prevalence of 11 selected putative endodontic pathogens in the apical third of infected root canals associated with periradicular lesions . The apical root portion of 23 extracted teeth with carious pulpal exposures and attached periradicular lesions was sectioned, and the root canals were sampled for microbiological investigation . DNA was extracted from the samples and analyzed for the presence of 11 bacterial species using a nested polymerase chain reaction assay . The results showed that Pseuramibacter alactolyticus occurred in 10 cases (44%), Treponema denticola in 6 (26%), Fusobacterium nucleatum in 6 (26%), Porphyromonas endodontalis in 4 (17%), Filifactor alocis in 2 (9%), Dialister pneumosintes in 1 (4%), Porphyromonas gingivalis in 1 (4%), and Tannerella forsythensis in 1 (4%) . No sample yielded Prevotella intermedia, Prevotella nigrescens, or Campylobacter rectus . Of the samples examined, 17 were positive for at least 1 of the target species . Occurrence of these bacterial species in the apical third of infected root canals suggests that they can be involved in causation of periradicular lesions. Antimicrob Agents Chemother, 2004 Sep, 48(9), 3442 - 50 Incidence of antibiotic resistance in Campylobacter jejuni isolated in Alberta, Canada, from 1999 to 2002, with special reference to tet(O)-mediated tetracycline resistance; Gibreel A et al.; Of 203 human clinical isolates of Campylobacter jejuni from Alberta, Canada (1999 to 2002), 101 isolates (50%) were resistant to at least 64 microg of tetracycline/ml, with four isolates exhibiting higher levels of tetracycline resistance (512 microg/ml) . In total, the MICs for 37% of tetracycline-resistant isolates (256 to 512 microg/ml) were higher than those previously reported in C . jejuni (64 to 128 microg/ml) . In the tetracycline-resistant clinical isolates, 67% contained plasmids and all contained the tet(O) gene . Four isolates resistant to high levels of tetracycline (MIC = 512 microg/ml) contained plasmids carrying the tet(O) gene, which could be transferred to other isolates of C . jejuni . The tetracycline MICs for transconjugants were comparable to those of the donors . Cloning of tet(O) from the four high-level tetracycline-resistant isolates conferred an MIC of 32 microg/ml for Escherichia coli DH5alpha . In contrast, transfer to a strain of C . jejuni by using mobilization conferred an MIC of 128 microg/ml . DNA sequence analysis determined that the tet(O) genes encoding lower MICs (64 to 128 microg/ml) were identical to one other, although the tet(O) genes encoding a 512-microg/ml MIC demonstrated several nucleotide substitutions . The quinolone resistance determining region of four ciprofloxacin-resistant isolates (2%) was analyzed, and resistance was associated with a chromosomal mutation in the gyrA gene resulting in a Thr-86-Ile substitution . In addition, six kanamycin-resistant isolates contained large plasmids that carry the aphA-3 marker coding for 3'-aminoglycoside phosphotransferase . Resistance to erythromycin was not detected in 203 isolates . In general, resistance to most antibiotics in C . jejuni remains low, except for resistance to tetracycline, which has increased from about 8 to 50% over the past 20 years. Oral Microbiol Immunol, 2004 Oct, 19(5), 314 - 21 Microbiological profile of early onset/aggressive periodontitis patients; Kamma JJ et al.; OBJECTIVES: The objectives of this study were to characterize the bacterial profile and to seek possible bacterial associations in the subgingival microbiota of early onset periodontitis/aggressive periodontitis patients by using two different techniques, culture and immunofluorescence . MATERIAL AND METHODS: The study group consisted of 66 systemically healthy individuals with evidence of early onset periodontitis - 41 females and 25 males aged 23-35 years (mean 31.1 +/- 3.1 years) . Bacterial samples were collected from the deepest site in each quadrant, resulting in a total of 264 sites with a mean probing pocket depth of 6.6 +/- 1.5 mm . Samples were cultured anaerobically and in 10% CO(2) using selective and nonselective media, and isolates were characterized to species level . Indirect immunofluorescence using monoclonal antibodies was applied to detect Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Tannerella forsythia (Bacteroides forsythus, Tannerella forsythensis), Prevotella intermedia/Prevotella nigrescens, Campylobacter rectus, Peptostreptococcus micros and Actinomyces israelii . RESULTS: 93.6% of sampled sites showed bleeding on probing and 23.5% were positive for suppuration . P . intermedia/P . nigrescens, P . gingivalis, and C . rectus were detected in 77.3-85.9% of samples using culture methods and in 85.6-91.3% using immunofluorescence . P . micros and A . actinomycetemcomitans were found, respectively, in 63.3% and 25.0% of all sites using culturing and in 58.7% and 27.7% sites using immunofluorescence . Significantly strong positive associations were observed between T . forsythia and C . rectus (odds ratio 109.46), and T . forsythia and P . gingivalis (odd ratio 90.26), whereas a negative association was seen between P . intermedia/P . nigrescens and A . actinomycetemcomitans (odds ratio 0.42) . Coinfection by P . gingivalis, T . forsythia, P . intermedia/P . nigrescens and C . rectus was observed in 62.1% of the test sites, and in 89.4% of the studied subjects . The sensitivity of immunofluorescence for T . forsythia, C . rectus, P . intermedia/P . nigrescens and P . gingivalis was found to be very high (0.99-0.94) using culture as the reference detection method . The agreement between culture and immunofluorescence in detecting the presence or absence of the investigated species was 85.2-88.1% for P . gingivalis, P . intermedia/P . nigrescens, C . rectus, and T . forsythia, 75.9% for A . actinomycetemcomitans and 70.4% for P . micros . CONCLUSIONS: The microbial profile of the early onset/aggressive periodontitis population was complex . The agreement between the two detection methods was very high. Int J Antimicrob Agents, 2004 Sep, 24(3), 261 - 7 Antimicrobial susceptibilities of Campylobacter isolated from food-producing animals on farms (1999-2001): results from the Japanese Veterinary Antimicrobial Resistance Monitoring Program; Ishihara K et al.; Nationwide monitoring of antimicrobial resistance in Campylobacter isolated from food-producing animals on farms was performed in Japan . A total of 468 Campylobacter isolates were obtained during the period from June 1999 to March 2001 . Campylobacter species showed high frequencies of resistance to oxytetracycline and dihydrostreptomycin . The frequencies of resistance in Campylobacter coli to aminoglycosides, macrolides, tetracycline and quinolones were higher than those in Campylobacter jejuni to the same drugs . All of the C . jejuni isolates were susceptible to macrolide antibiotics, whereas 48.4% of the C . coli isolates were resistant to macrolides . Resistance to fluoroquinolones was observed in C . jejuni isolates from broilers (12%) and layers (2.6%), indicating that the level of fluoroquinolone resistance in Japan could be ranked as low. J Periodontal Res, 2004 Oct, 39(5), 315 - 9 Initial antimicrobial effect of controlled-release doxycycline in subgingival sites; Jorgensen MG et al.; OBJECTIVES: To determine the ability of a 10% doxycycline hyclate controlled-release polymer (Atridox) to suppress periodontopathic bacteria when placed subgingivally following scaling and root planing (Sc/Rp) . METHODS: Eight males and seven females, mean age 48 years, with moderate to advanced periodontitis participated in the study . In each patient, bilateral periodontal pockets probing 6-7 mm were randomly assigned to treatment by Sc/Rp + doxycycline polymer or by Sc/Rp alone . Subgingival placement of doxycycline polymer was carried out according to the manufacturer's instructions . Sc/Rp was performed with hand instruments for at least 10 min in each study tooth . Subgingival samples were collected by paper-points at baseline, at 2 weeks and at 4 weeks post-treatment . Culture methodology was used to isolate and identify putative periodontal pathogens, including Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Dialister pneumosintes, Tannerella forsythia, Prevotella intermedia/Prevotella nigrescens, Campylobacter species, Eubacterium species, Fusobacterium species, Peptostreptococcus micros, Eikenella corrodens, Staphylococcus species, enteric gram-negative rods, beta-hemolytic streptococci and yeasts . The microbiologic examination was carried out blindly . Microbiological data were analyzed using a General Linear Model Analysis of Variance for within and between group effects . RESULTS: Sites receiving Sc/Rp + doxycycline polymer and sites receiving Sc/Rp alone exhibited similar levels of periodontal pathogens at baseline and did not differ significantly in total viable counts and proportional recovery of periodontopathic bacteria post-treatment . CONCLUSIONS: Controlled-release doxycycline placed in moderate to deep periodontal pockets caused no significant additional reduction in the subgingival pathogenic microbiota compared to thorough Sc/Rp alone . Since controlled-release doxycycline may not significantly suppress several subgingival pathogenic microorganisms and seems to possess no distinct advantage over broad-spectra, safe and inexpensive antiseptics, the rationale for its employment in periodontal therapy remains unclear. Eur J Clin Microbiol Infect Dis, 2004 Sep, 23(9), 722 - 4 Epub 2004 Aug 20. Campylobacter fetus meningitis in a diabetic adult cured by imipenem; Herve J et al.; Reported here is the successful management of a severe case of Campylobacter fetus subspecies fetus meningitis, complicated by septic shock, in a patient without overt immunosuppression who was cured by imipenem . Meningitis caused by C . fetus has rarely been reported in adults, and only exceptionally in non-immunocompromised patients, and septic shock has not previously been reported as a complication of such meningitis . The best antibiotic regimen for treating this condition remains to be determined . Imipenem has displayed high in vitro activity against C . fetus but has been used rarely in clinical practice . It was administered in this case with good results . Saudi Med J, 2004 Aug, 25(8), 1006 - 9 Triple therapy with pantoprazole, clarithromycin and amoxicillin for eradication in patients with Helicobacter pylori positive duodenal ulcers; Ghazzawi IM et al.; OBJECTIVE: To assess the effectiveness of a 7-day pantoprazole 40 mg twice a day (bid) plus clarithromycin 500 mg bid and amoxicillin one gram bid therapy in the eradication of Helicobacter pylori (H . pylori) in patients with H . pylori positive duodenal ulcers . METHODS: The present study was a prospective, non-comparative and open-label designed . After confirming duodenal ulcer by endoscopy, patients with evidence of H . pylori infection with Campylobacter like organism (CLO) test, histology or culture were given eradication treatment for 7 days . Successful eradication was confirmed with second endoscopy after 4 weeks unless all CLO test, histology or culture were negative . Relief of symptoms and any adverse effects were recorded . The trial took place between February 2002 and April 2002 at King Hussein Medical Center, Royal Medical Services, Amman, Jordan . RESULTS: Eradication rate of H . pylori was 94% at 4 weeks after treatment was given . There was an improvement in gastrointestinal symptoms and adverse events were recorded in 5 patents only; however, in no case was withdrawal of treatment necessary . CONCLUSION: This study demonstrates that a 7-day pantoprazole 40 mg bid plus clarithromycin 500 mg bid and amoxicillin one gram bid therapy is an effective and well tolerated therapeutic approach for H . pylori eradication. FEMS Microbiol Lett, 2004 Aug 15, 237(2), 235 - 42 The fdh operon of Sulfurospirillum multivorans; Schmitz RP et al.; The complete single copy fdh operon (approximately 5.7 kb) encoding the formate dehydrogenase subunits of the gram negative, reductively dehalogenating anaerobe Sulfurospirillum multivorans was sequenced and analyzed . The gene fdhA encoding the catalytically active periplasmic subunit is part of an operon (fdhEABCD) containing additional structural genes . The genes fdhEABCD were cotranscribed as indicated by RT-PCR and primer extension experiments . Two mRNAs for fdhEABCD and fdhABCD were either transcribed independently from two transcription start sites upstream of fdhE and fdhA or might result from posttranscriptional processing of the full-length fdhEABCD mRNA . The operon shows a high degree of similarity to the fdh operons of Campylobacter jejuni and Wolinella succinogenes in terms of architecture and putative cofactor binding motifs of the gene products. J Infect Dis, 2004 Sep 15, 190(6), 1150 - 7 Epub 2004 Aug 03. Prolonged diarrhea due to ciprofloxacin-resistant campylobacter infection; Nelson JM et al.; BACKGROUND: Campylobacter causes >1 million infections annually in the United States . Fluoroquinolones (e.g., ciprofloxacin) are used to treat Campylobacter infections in adults . Although human infections with ciprofloxacin-resistant Campylobacter have become increasingly common, the human health consequences of such infections are not well described . METHODS: A case-control study of persons with sporadic Campylobacter infection was conducted within 7 FoodNet sites during 1998-1999 . The E-test system (AB Biodisk) was used to test for antimicrobial susceptibility to ciprofloxacin; ciprofloxacin resistance was defined as a ciprofloxacin minimum inhibitory concentration of > or =4 microg/mL . We conducted a case-comparison study of interviewed persons who had an isolate tested . RESULTS: Of 858 isolates tested, 94 (11%) were ciprofloxacin resistant . Among 290 persons with Campylobacter infection who did not take antidiarrheal medications, persons with ciprofloxacin-resistant infection had a longer mean duration of diarrhea than did persons with ciprofloxacin-susceptible infection (9 vs . 7 days {P=.04}) . This difference was even more pronounced among the 63 persons who did not take antidiarrheal medications or antimicrobial agents (12 vs . 6 days {P=.04}) . In a multivariable analysis-of-variance model, the persons with ciprofloxacin-resistant infection had a longer mean duration of diarrhea than did the persons with ciprofloxacin-susceptible infection (P=.01); this effect was independent of foreign travel . The association between ciprofloxacin resistance and prolonged diarrhea is consistent across a variety of analytical approaches . CONCLUSIONS: Persons with ciprofloxacin-resistant Campylobacter infection have a longer duration of diarrhea than do persons with ciprofloxacin-susceptible Campylobacter infection . Additional efforts are needed to preserve the efficacy of fluoroquinolones. Water Sci Technol, 2004, 50(1), 147 - 54 Elimination of viruses, bacteria and protozoan oocysts by slow sand filtration; Hijnen WA et al.; The decimal elimination capacity (DEC) of slow sand filters (SSF) for viruses, bacteria and oocysts of Cryptosporidium has been assessed from full-scale data and pilot plant and laboratory experiments . DEC for viruses calculated from experimental data with MS2-bacteriophages in the pilot plant filters was 1.5-2 log10 . E . coli and thermotolerant coliforms (Coli44) were removed at full-scale and in the pilot plant with 2-3 log10 . At full-scale, Campylobacter bacteria removal was 1 log10 more than removal of Coli44, which indicated that Coli44 was a conservative surrogate for these pathogenic bacteria . Laboratory experiments with sand columns showed 2-3 and >5-6 log10 removal of spiked spores of sulphite-reducing clostridia (SSRC; C . perfringens) and oocysts of Cryptosporidium respectively . Consequently, SSRC was not a good surrogate to quantify oocyst removal by SSF . Removal of indigenous SSRC by full-scale filters was less efficient than observed in the laboratory columns, probably due to continuous loading of these filter beds with spores, accumulation and retarded transport . It remains to be investigated if this also applies to oocyst removal by SSF . The results additionally showed that the schmutzdecke and accumulation of (in)organic charged compounds in the sand increased the elimination of microorganisms . Removal of the schmutzdecke reduced DEC for bacteria by +/-2 log10, but did not affect removal of phages . This clearly indicated that, besides biological activity, both straining and adsorption were important removal mechanisms in the filter bed for microorganisms larger than viruses. Epidemiol Infect, 2004 Aug, 132(4), 585 - 93 Human campylobacteriosis in Scotland: seasonality, regional trends and bursts of infection; Miller G et al.; Fourier time-series models were constructed to study regional and national seasonality of human campylobacteriosis in Scotland between 1997 and 2001 . Strong seasonality was demonstrated with an annual peak of reported cases in late June to early July . The prominence of this peak varied between regions, which was exemplified for the two major population centres: Lothian, with mixed urban/rural population, had a more prominent peak than Greater Glasgow, which has a predominantly urban population . No significant trend of annual cases of campylobacteriosis was found nationally and Fourier models successfully predicted the seasonal pattern of national and regional cases in 2002 . During the period studied, the Fourier model identified >20 bursts of infection (potential outbreaks) . Multi-regional bursts were also identified in the summers of 1998 and 2000 - the latter comprising the vast majority of the regions in Scotland, which could suggest a national outbreak. Scand J Infect Dis, 2004, 36(6-7), 435 - 42 Genetic and epidemiological relationships among Campylobacter isolates from humans; Hook H et al.; 84 Campylobacter jejuni isolates from Swedish patients with domestic infection were characterized with pulsed-field gel electrophoresis (PFGE), and the subtype information considered in relation to epidemiological data . Based on pattern combinations from restriction cleavage with SmaI and SalI, 52 different PFGE types were identified . Types with an average pattern similarity of at least 82% and 63% were assembled in groups and clusters, respectively . The 2 largest clusters included 71% of the isolates . The distribution in time varied between different groups and clusters, where some were isolated sporadically during the whole period and others appeared more concentrated in time . Types in 1 cluster were significantly more often isolated in summer than other types in the study . Isolates from children showed lower pattern similarity to other isolates than isolates from adults . Sets of type and time related cases, possibly representing small outbreaks, were identified when indistinguishable PFGE patterns were found in isolates from temporally related cases . Our results indicate that although a large number of genotypes may be found among C . jejuni strains infecting humans, a large proportion of these may be genetically related, and that different genotypes may appear during different seasons and infect individuals of different ages. Neurology, 2004 Aug 10, 63(3), 529 - 33 Does Campylobacter jejuni infection elicit "demyelinating" Guillain-Barre syndrome? Kuwabara S, Ogawara K, Misawa S, Koga M, Mori M, Hiraga A, Kanesaka T, Hattori T, Yuki N. BACKGROUND: Campylobacter jejuni enteritis is the most common antecedent infection in Guillain-Barre syndrome (GBS) . C . jejuni-related GBS is usually acute motor axonal neuropathy (AMAN), but previous reports described many cases of the demyelinating subtype of GBS (acute inflammatory demyelinating polyneuropathy {AIDP}) after C . jejuni infection . OBJECTIVE: To investigate whether C . jejuni infection elicits AIDP . METHODS: In 159 consecutive patients with GBS, antibodies against C . jejuni were measured using ELISA . Antecedent C . jejuni infection was determined by the strict criteria of positive C . jejuni serology and a history of a diarrheal illness within the previous 3 weeks . Electrodiagnostic studies were performed weekly for the first 4 weeks, and sequential findings were analyzed . RESULTS: There was evidence of recent C . jejuni infection in 22 (14%) patients . By electrodiagnostic criteria, these patients were classified with AMAN (n = 16; 73%) or AIDP (n = 5; 23%) or as unclassified (n = 1) in the first studies . The five C . jejuni-positive patients with the AIDP pattern showed prolonged motor distal latencies in two or more nerves and had their rapid normalization within 2 weeks, eventually all showing the AMAN pattern . In contrast, patients with cytomegalovirus- or Epstein-Barr virus-related AIDP (n = 13) showed progressive increases in distal latencies in the 8 weeks after onset . CONCLUSION: Patients with C . jejuni-related Guillain-Barre syndrome can show transient slowing of nerve conduction, mimicking demyelination, but C . jejuni infection does not appear to elicit acute inflammatory demyelinating polyneuropathy. J Clin Microbiol, 2004 Aug, 42(8), 3613 - 9 Development of two PCR-based techniques for detecting helical and coccoid forms of Helicobacter pylori; Shahamat M et al.; The primary mode of transmission of Helicobacter pylori, a human pathogen carried by more than half the population worldwide, is still unresolved . Some epidemiological data suggest water as a possible transmission route . H . pylori in the environment transforms into a nonculturable, coccoid form, which frequently results in the failure to detect this bacterium in environmental samples by conventional culture techniques . To overcome limitations associated with culturing, molecular approaches based on DNA amplification by PCR have been developed and used for the detection of H . pylori in clinical and environmental samples . Our results showed the glmM gene as the most promising target for detection of H . pylori by PCR amplification . Under optimal amplification conditions, glmM-specific primers generated PCR-amplified products that were specific for H . pylori and some other Helicobacter species . Genome sequence analysis revealed the existence of a conserved region linked to a hypervariable region upstream of the 16S rRNA gene of H . pylori . Selective PCR primer sets targeting this sequence were evaluated for the specific detection of H . pylori . One primer set, Cluster2 and B1J99, were shown to be highly specific for H . pylori strains and did not produce any PCR products when other Helicobacter species and other bacterial species were analyzed . In tests with 32 strains of H . pylori, 6 strains of other Helicobacter species, 8 strains of Campylobacter jejuni, and 21 strains belonging to different genera, the primers for glmM were selective for the Helicobacter genus and the primers containing the region flanking the 16S rRNA gene were selective for H . pylori species only . The combination of two sensitive PCR-based methods, one targeting the glmM gene and the other targeting a hypervariable flanking region upstream of the 16S rRNA gene, are complementary to each other . Whereas the glmM-specific primers provide a rapid, sensitive presumptive assay for the presence of H . pylori and closely related Helicobacter spp., the primers for sequences flanking the 16S rRNA gene can confirm the presence of H . pylori and locate the potential source of this bacterium. J Clin Microbiol, 2004 Aug, 42(8), 3441 - 8 High-resolution genotyping of Campylobacter upsaliensis strains originating from three continents; Lentzsch P et al.; Ninety-six Campylobacter upsaliensis strains that originated from Australia, Canada, and Europe (Germany) and that were isolated from humans, dogs, and cats were serotyped for their heat-stable surface antigens . All of them were genotyped by enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR) profiling, and 83 strains were genotyped by macrorestriction analysis with the endonuclease XhoI . Eighty-four percent of the strains belonged to five different serotypes (serotypes OI, OII, OIII, OIV, and OVI), with the proportions of strains in each serotype being comparable among the groups of strains from all three continents . Two serotypes, OIII and OIV, were prevalent at rates of 35 to 40% . Serotypes OI, OII, and OVI were detected at rates of 1.5 to 15% . Between 10 and 17.7% of the strains did not react with the available antisera . Analysis of the ERIC-PCR profiles revealed two distinct genotypic clusters, which represented the German and the non-European strains, respectively . XhoI macrorestriction yielded two genotypic clusters; one of them contained 80.2% of the German strains and 34.6% of the non-European strains, and the second cluster consisted of 65.4% of the non-European strains and 19.8% of the German strains . Fourteen strains from all three continents were analyzed for their 16S rRNA gene sequences . Only two minor variations were detected in four of the strains . In conclusion, C . upsaliensis has undergone diverging processes of genome arrangement on different continents during evolution without segregating into different subspecies. Bioinformatics, 2004 Dec 12, 20(18), 3613 - 9 Epub 2004 Aug 05. Training HMM structure with genetic algorithm for biological sequence analysis; Won KJ et al.; SUMMARY: Hidden Markov models (HMMs) are widely used for biological sequence analysis because of their ability to incorporate biological information in their structure . An automatic means of optimizing the structure of HMMs would be highly desirable . However, this raises two important issues; first, the new HMMs should be biologically interpretable, and second, we need to control the complexity of the HMM so that it has good generalization performance on unseen sequences . In this paper, we explore the possibility of using a genetic algorithm (GA) for optimizing the HMM structure . GAs are sufficiently flexible to allow incorporation of other techniques such as Baum-Welch training within their evolutionary cycle . Furthermore, operators that alter the structure of HMMs can be designed to favour interpretable and simple structures . In this paper, a training strategy using GAs is proposed, and it is tested on finding HMM structures for the promoter and coding region of the bacterium Campylobacter jejuni . The proposed GA for hidden Markov models (GA-HMM) allows, HMMs with different numbers of states to evolve . To prevent over-fitting, a separate dataset is used for comparing the performance of the HMMs to that used for the Baum-Welch training . The GA-HMM was capable of finding an HMM comparable to a hand-coded HMM designed for the same task, which has been published previously. J Periodontol, 2004 Jun, 75(6), 909 - 13 Implant therapy following liver transplantation: clinical and microbiological results after 10 years; Heckmann SM et al.; BACKGROUND: The number of immunocompromised patients is increasing as a consequence of successful organ transplantation . Placing dental implants in these patients has been questioned because of their increased risk for infections . The 10-year follow-up data of a 71-year-old liver transplant recipient with long-term immunosuppressive therapy is reported . Six months after liver transplantation, two interforaminal implants were inserted in the edentulous mandible, and an overdenture using non-rigid telescopic attachments was fabricated 3 months later . METHODS: Oral clinical parameters included the modified plaque index, sulcus fluid flow rate, modified bleeding index, probing depth, distance implant mucosa, attachment level, width of the keratinized mucosa and mobility values . The distance implant bone (DIB) was determined on digital panoramic radiographs . The levels of eight periodontal marker organisms were established using DNA probe technology . Additionally, swabs of the edentulous oral mucosa were taken for microbiological culture and antimicrobial resistance testing . RESULTS: The peri-implant parameters were within normal ranges indicating a stable osseointegration with moderate vertical bone loss . Actinobacillus actinomycetemcomitans, Tannerella forsythensis, Campylobacter rectus, and Treponema denticola were not detected . Low levels of Porphyromonas gingivalis, Fusobacterium nucleatum, and Eikenella corrodens were found . Prevotella intermedia was the only bacterium with a level higher than 10(4) . The mucosal swabs indicated the presence of an abundant normal oral flora, including Escherichia coli and Candida albicans . The antibiogram revealed multiple resistance to antibiotics . CONCLUSION: This case report suggests that immunocompromised patients can be successfully rehabilitated with dental implants. Ann Neurol, 2004 Aug, 56(2), 228 - 39 An anti-ganglioside antibody-secreting hybridoma induces neuropathy in mice; Sheikh KA et al.; Immune responses against gangliosides are strongly implicated in the pathogenesis of some variants of Guillain-Barre syndrome (GBS) . For example, IgG antibodies against GM1, GD1a, and related gangliosides are frequently present in patients with post-Campylobacter acute motor axonal neuropathy (AMAN) variant of GBS, and immunization of rabbits with GM1 has produced a model of AMAN . However, the role of anti-ganglioside antibodies in GBS continues to be debated because of lack of a passive transfer model . We recently have raised several monoclonal IgG anti-ganglioside antibodies . We passively transfer these antibodies by intraperitoneal hybridoma implantation and by systemic administration of purified anti-ganglioside antibodies in mice . Approximately half the animals implanted with an intraperitoneal clone of anti-ganglioside antibody-secreting hybridoma developed a patchy, predominantly axonal neuropathy affecting a small proportion of nerve fibers . In contrast to hybridoma implantation, passive transfer with systemically administered anti-ganglioside antibodies did not cause nerve fiber degeneration despite high titre circulating antibodies . Blood-nerve barrier studies indicate that animals implanted with hybridoma had leaky blood-nerve barrier compared to mice that received systemically administered anti-ganglioside antibodies . Our findings suggest that in addition to circulating antibodies, factors such as antibody accessibility and nerve fiber resistance to antibody-mediated injury play a role in the development of neuropathy . J Bacteriol, 2004 Aug, 186(16), 5332 - 41 Role of an inducible single-domain hemoglobin in mediating resistance to nitric oxide and nitrosative stress in Campylobacter jejuni and Campylobacter coli; Elvers KT et al.; Campylobacter jejuni expresses two hemoglobins, each of which exhibits a heme pocket and structural signatures in common with vertebrate and plant globins . One of these, designated Cgb, is homologous to Vgb from Vitreoscilla stercoraria and does not possess the reductase domain seen in the flavohemoglobins . A Cgb-deficient mutant of C . jejuni was hypersensitive to nitrosating agents (S-nitrosoglutathione {GSNO} or sodium nitroprusside) and a nitric oxide-releasing compound (spermine NONOate) . The sensitivity of the Cgb-deficient mutant to methyl viologen, hydrogen peroxide, and organic peroxides, however, was the same as for the wild type . Consistent with the protective role of Cgb against NO-related stress, cgb expression was minimal in standard laboratory media but strongly and specifically induced after exposure to nitrosative stress . In contrast, the expression of Cgb was independent of aeration and the presence of superoxide . In the absence of preinduction by exposure to nitrosative stress, no difference was seen in the degree of respiratory inhibition by NO or the half-life of the NO signal when cells of the wild type and the cgb mutant were compared . However, cells expressing GSNO-upregulated levels of Cgb exhibited robust NO consumption and respiration that was relatively NO insensitive compared to the respiration of the cgb mutant . Based on similar studies in Campylobacter coli, we also propose an identical role for Cgb in this closely related species . We conclude that, unlike the archetypal single-domain globin Vgb, Cgb forms a specific and inducible defense against NO and nitrosating agents. Lett Appl Microbiol, 2004, 39(3), 261 - 6 The pattern and kinetics of substrate metabolism of Campylobacter jejuni and Campylobacter coli; Mohammed KA et al.; AIMS: The main aim was to investigate the patterns and kinetics of substrate oxidation by Campylobacter jejuni and C . coli . METHODS AND RESULTS: Substrate oxidation profiles by 100 strains were determined using oxygen electrode system . All the isolates tested oxidized formate, l-lactate, cysteine, glutamine and serine with high oxidation rates and high affinity but varied in their ability to oxidize citric acid cycle intermediates, aspartic acid and serine . CONCLUSIONS: Based on the oxidation ability of alpha-ketoglutarate, succinate, fumarate and aspartic acid, Campylobacter strains tested were divided into three distinct metabolic categories . The first group was able to metabolize alpha-ketoglutarate, succinate, fumarate and aspartic acid; the second group was unable to oxidize alpha-ketoglutarate; and the third group was unable to oxidize, succinate, fumarate, and aspartic acid . Furthermore, serine oxidation rate enabled the differentiation of C . jejuni and C . coli . SIGNIFICANCE AND IMPACT OF THE STUDY: Overall, the results highlights the extensive metabolic diversity between and within Campylobacter species . In addition, the kinetic data of oxidized substrates obtained may improve the isolation procedures of the organism. Lett Appl Microbiol, 2004, 39(3), 252 - 6 Some potential sources for transmission of Campylobacter jejuni to broiler chickens; Ramabu SS et al.; AIMS: The aim of the study was to determine Campylobacter jejuni contamination and prevalence on fomites moving between broiler farms and the processing plant in the period after cleaning and before departure to harvest chickens . In addition, changes in the proportion of contaminated fomites in the course of a day were assessed . METHODS AND RESULTS: Pooled swab samples were obtained from pallets, crates, wheels of trucks, tractors and forklifts, truck beds, and from drivers' and catchers' boots . After enrichment in Bolton's broth Campylobacter were recovered on modified blood-free Campylobacter selective agar (mCCDA) . Isolates were identified using tests for phenotypic and biochemical characteristics . Of the 209 samples collected, 53% were positive for C . jejuni, with all fomites positive except tractor wheels . Pallets had the highest contamination rate at 75% . More than 50% of catchers' boots, drivers' boots, crates and truck wheels were positive . Forty-seven per cent and 31% of truck beds and forklift wheels, respectively, were contaminated . The proportion of contaminated fomites did not change significantly during the day . CONCLUSIONS: This study has identified trucks, forklifts, pallets, crates, drivers' and catchers' boots as potential sources of C . jejuni for broilers . SIGNIFICANCE AND IMPACT OF THE STUDY: Campylobacter jejuni contamination of broiler processing plant fomites was found to be extensive ranging from 31% for truck beds to 75% for pallets . The proportion of contaminated fomites was observed to be similar throughout the day . The impact of contaminated fomites as sources of colonization of broilers with C . jejuni is discussed. Poult Sci, 2004 Jul, 83(7), 1232 - 9 Effects of carcass washers on Campylobacter contamination in large broiler processing plants; Bashor MP et al.; Campylobacter, a major foodborne pathogen found in poultry products, remains a serious problem facing poultry processors . Campylobacter research has primarily focused on detection methods, prevalence, and detection on carcasses; limited research has been conducted on intervention . The aim of this study was to assess the effectiveness of carcass washing systems in 4 large broiler-processing plants in removing Campylobacter species . Washing systems evaluated included combinations of inside/outside carcass washers and homemade cabinet washers . Processing aids evaluated were trisodium phosphate (TSP) and acidified sodium chlorite (ASC) . The washer systems consisted of 1 to 3 carcass washers and used from 2.16 to 9.73 L of water per carcass . The washer systems used chlorinated water with 25 to 35 ppm of total chlorine . These washer systems on average reduced Campylobacter populations by log 0.5 cfu/mL from log 4.8 cfu/mL to log 4.3 cfu/mL . Washer systems with TSP or ASC reduced Campylobacter populations on average by an additional log 1.03 to log 1.26, respectively . Total average reductions in Campylobacter populations across the washer system and chill tank were log 0.76 cfu/mL . Washer systems that included antimicrobial systems had total average reductions in Campylobacter populations of log 1.53 cfu/mL . These results suggest that carcass washer systems consisting of multiple washers provide minimal reductions in Campylobacter populations found on poultry in processing plants . A more effective treatment of reducing Campylobacter populations is ASC or TSP treatment; however, these reductions, although significant, will not eliminate the organism from raw poultry. Poult Sci, 2004 Jul, 83(7), 1213 - 7 Recovery of Campylobacter from broiler feces during extended storage of transport cages; Berrang ME et al.; Feces deposited in transport cages by a Campylobacter-positive flock can cause the spread of Campylobacter to subsequent flocks placed in the same cages . This experiment was designed to determine the effect of extended cage storage on the viability of Campylobacter in feces deposited on the cage floor during commercial transport and holding . After 4 h of feed (but not water) withdrawal, Campylobacter-positive broilers were caught by commercial catching crews, placed into 3 new commercial cages and transported with the rest of the flock to the holding area at a commercial processing facility . Broilers were allowed to remain in the cages for 8 h before being unloaded by facility personnel . After removal of the broilers, empty cages were held under a shed and sampled at 7 intervals for the presence of viable Campylobacter . Cages were sampled by removing all the feces out of a different randomly assigned compartment in each cage at 0.5, 2, 4, 6, 8, 24, and 48 h after unloading . No decrease in Campylobacter numbers was noted through 8 h of storage . After 24 h in both replications, Campylobacter was detected in 2 of 3 compartments by direct plating and detected in the third by enrichment only . After 48 h, Campylobacter was detected in one replication by enrichment only, and was not detected in the second replication at all . Storing soiled transport cages for 48 h between uses results in lower numbers of Campylobacter in feces, but may not eliminate Campylobacter entirely . Due to cage cost and space requirements, routine cage storage between uses would not be practical. J Nutr, 2004 Aug, 134(8 Suppl), 2022S - 2026S Bacteria in the gut: friends and foes and how to alter the balance; Rastall RA; The activities of the bacteria resident in the colon of companion animals can have an impact upon the health of the host . Our understanding of this microbial ecosystem is presently increasing due to the development of DNA-based microbiological tools that allow identification and enumeration of nonculturable microorganisms . These techniques are changing our view of the bacteria that live in the gut, and they are facilitating dietary-intervention approaches to modulate the colonic ecosystem . This is generally achieved by the feeding of either live bacteria (probiotics) or nondigestible oligosaccharides (prebiotics) that selectively feed the indigenous probiotics . Feeding studies with a Lactobacillus acidophilus probiotic have shown positive effects on carriage of Clostridium spp . in canines and on recovery from Campylobacter spp . infection in felines . Immune function was improved in both species . Prebiotic feeding studies with lactosucrose and fructo-oligosaccharides in both cats and dogs have shown positive effects on the microflora balance . Recently synbiotic forms (a probiotic together with a prebiotic) targeted at canines have been developed that show promise as dietary-intervention tools. Avian Dis, 2004 Apr-Jun, 48(2), 254 - 62 Relationship of messenger RNA reverse transcriptase-polymerase chain reaction signal to Campylobacter spp . viability; Sung KD et al.; SUMMARY . Discriminating viable from dead cells is of importance in the development of bacterial detection methods . A positive reverse transcriptase-polymerase chain reaction (RT-PCR) amplification signal was tested as a potential predictor of chick colonization . Some researchers have suggested that the presence of messenger RNA (mRNA) may not correlate with cell viability . Chicken colonization by cells that have positive mRNA signal but that are noncultivable would provide a correlation in cell viability and persistence of mRNA . The role of a viable but noncultivable (VBNC) form of Campylobacter spp . for colonization of poultry could be verified by such an mRNA signal . The levels of four strains of Campylobacter spp., previously isolated from poultry feces, declined progressively over time, and loss of cultivability occurred after 6 to 7 wk incubation in phosphate-buffered saline (PBS) at 4 C . Cold-stored, noncultivable and heat-inactivated (60 C for 10 min) Campylobacter spp . produced inconsistent amplified products from RT-PCR assay, depending on the target transcripts and strains used, although all fresh cultures showed mRNA signals . For the most part, signals of mRNA species from VBNC and heat-killed Campylobacter spp . AH-1, AH-2, and CH-3 persisted . RT-PCR amplification of transcripts originating from the tkt and cmp genes and a 256-base pair amplicon (from a previously described putative haem-copper oxidase) provided consistent signals, whereas transcripts from the flaA gene did not . Presumed VBNC and heat-inactivated Campylobacter spp., which produced positive mRNA signal but was not cultivable by conventional culture-based methods, did not establish colonization in the intestine of chicks 7 days after challenge . These results lead us to question the correlation between mRNA durability with cell viability as well as the significance of the VBNC cells in environmental transmission of Campylobacter spp. Int J Food Microbiol, 2004 Sep 1, 95(2), 225 - 9 Antimicrobial activity of reuterin in combination with nisin against food-borne pathogens; Arques JL et al.; Antimicrobial activity of reuterin individually or in combination with nisin against different food-borne Gram-positive and Gram-negative pathogens in milk was investigated . Reuterin (8 AU/ml) exhibited bacteriostatic activity against Listeria monocytogenes, whereas its activity was slightly bactericidal against Staphylococcus aureus at 37 degrees C . Higher bactericidal activity was detected against Escherichia coli O157:H7, Salmonella choleraesuis subsp . choleraesuis, Yersinia enterocolitica, Aeromonas hydrophila subsp . hydrophila and Campylobacter jejuni . A significant synergistic effect on L . monocytogenes and a slight additive effect on S . aureus after 24 h at 37 degrees C were observed when reuterin was combined with nisin (100 IU/ml) . The combination of reuterin with nisin did not enhance the antimicrobial effect of reuterin against Gram-negative pathogens. Int J Food Microbiol, 2004 Sep 1, 95(2), 111 - 8 Occurrence of Campylobacter in retail foods in Ireland; Whyte P et al.; A surveillance study was carried out to determine the prevalence of Campylobacter in a range of retail foods purchased in three Irish cities over a 20-month period between March 2001 and October 2002 . In total 2391 food samples were analysed during this period . Campylobacter was isolated from 444 raw chicken (49.9%), 33 turkey (37.5%) and 11 duck samples (45.8%) . Lower isolation rates of 7/221 (3.2%), 10/197 (5.1%) and 31/262 (11.8%) were observed for raw beef, pork and lamb, respectively . One sample of pork pate from 120 samples analysed (0.8%) was Campylobacter-positive . A total of three shellfish samples (oysters) from 129 raw specimens examined (2.3%) were found to contain Campylobacter . Low prevalences of the organism (0.9%) were also isolated from fresh mushrooms . Of 62 raw bulk tank milk samples analysed, Campylobacter was recovered in a single sample (1.6%) . Campylobacter was not detected in any of the comminuted pork puddings, prepared vegetables and salads, retail sandwiches or cheeses made from unpasteurised milk . In total, 543 Campylobacter were isolated from all of the food samples analysed, of which 453 (83.4%) were confirmed as Campylobacter jejuni and the remaining 90 (16.6%) as Campylobacter coli. J Microbiol Methods, 2004 Sep, 58(3), 403 - 11 Application of oligonucleotide array technology for the rapid detection of pathogenic bacteria of foodborne infections; Hong BX et al.; A rapid and accurate method for detection for common pathogenic bacteria in foodborne infections was established by using oligonucleotide array technology . Nylon membrane was used as the array support . A mutation region of the 23S rRNA gene was selected as the discrimination target from 14 species (genera) of bacteria causing foodborne infections and two unrelated bacterial species . A pair of universal primers was designed for PCR amplification of the 23S rRNA gene . Twenty-one species (genera)-specific oligonucleotide detection probes were synthesized and spotted onto the nylon membranes . The 23S rRNA gene amplification products of 14 species of pathogenic bacteria were hybridized to the oligonucleotide array . Hybridization results were analyzed with digoxigenin-linked enzyme reaction . Results indicated that nine species of pathogenic bacteria (Escherichia coli, Campylobacter jejuni, Shigella dysenteriae, Vibrio cholerae, Vibrio parahaemolyticus, Proteus vulgaris, Bacillus cereus, Listeria monocytogenes and Clostridium botulinum) showed high sensitivity and specificity for the oligonucleotide array . Two other species (Salmonella enterica and Yersinia enterocolitica) gave weak cross-reaction with E . coli, but the reaction did not affect their detection . After redesigning the probes, positive hybridization results were obtained with Staphylococcus aureus, but not with Clostridium perfringens and Streptococcus pyogenes . The oligonucleotide array can also be applied to samples collected in clinical settings of foodborne infections . The superiority of oligonucleotide array over other tests lies on its rapidity, accuracy and efficiency in the diagnosis, treatment and control of foodborne infections. Proc Natl Acad Sci U S A, 2004 Aug 3, 101(31), 11404 - 9 Epub 2004 Jul 26. Carbohydrate mimicry between human ganglioside GM1 and Campylobacter jejuni lipooligosaccharide causes Guillain-Barre syndrome; Yuki N et al.; Molecular mimicry between microbial and self-components is postulated as the mechanism that accounts for the antigen and tissue specificity of immune responses in postinfectious autoimmune diseases . Little direct evidence exists, and research in this area has focused principally on T cell-mediated, antipeptide responses, rather than on humoral responses to carbohydrate structures . Guillain-Barre syndrome, the most frequent cause of acute neuromuscular paralysis, occurs 1-2 wk after various infections, in particular, Campylobacter jejuni enteritis . Carbohydrate mimicry {Galbeta1-3GalNAcbeta1-4(NeuAcalpha2-3)Galbeta1-} between the bacterial lipooligosaccharide and human GM1 ganglioside is seen as having relevance to the pathogenesis of Guillain-Barre syndrome, and conclusive evidence is reported here . On sensitization with C . jejuni lipooligosaccharide, rabbits developed anti-GM1 IgG antibody and flaccid limb weakness . Paralyzed rabbits had pathological changes in their peripheral nerves identical with those present in Guillain-Barre syndrome . Immunization of mice with the lipooligosaccharide generated a mAb that reacted with GM1 and bound to human peripheral nerves . The mAb and anti-GM1 IgG from patients with Guillain-Barre syndrome did not induce paralysis but blocked muscle action potentials in a muscle-spinal cord coculture, indicating that anti-GM1 antibody can cause muscle weakness . These findings show that carbohydrate mimicry is an important cause of autoimmune neuropathy. Mol Cell Probes, 2004 Aug, 18(4), 255 - 61 Identification of ciprofloxacin-resistant Campylobacter jejuni and analysis of the gyrA gene by the LightCycler mutation assay; Dionisi AM et al.; A real-time PCR assay was developed to identify ciprofloxacin-resistant Campylobacter jejuni . Ciprofloxacin resistance in C . jejuni has been associated with a C-->T nucleotide point mutation occurring at the 86 codon of the gyrA gene . Other nucleotide substitutions have been identified in proximity to or at the same codon in the gyrA gene, but their role in ciprofloxacin resistance is still unknown . The LightCycler assay is based on the fluorescence resonance energy transfer technology using melting peak analysis of two fluorescent probes hybridized on PCR amplicons . This assay was used to detect the 86-codon mutation conferring ciprofloxacin resistance, as well as other nucleotides substitutions occurring within the same site in the gyrA gene . This gyrA mutation assay allows a rapid and reproducible screening method of ciprofloxacin resistant strains and was applied to C . jejuni strains isolated in Italy in 2000. Cytokine, 2004 Aug 21-Sep 7, 27(4-5), 107 - 12 Orally administered IL-6 induces elevated intestinal GM-CSF gene expression and splenic CFU-GM; Rollwagen FM et al.; Orally administered interleukin (IL)-6 has been shown to be of benefit in eliminating Campylobacter infection and in preventing sepsis following hemorrhage . In related experiments, it was seen that proliferating cells were found in the spleens of untreated mice given IL-6 by oral gavage . Injection of the DNA label, BrdU, showed that significant proliferation began at 4 h and peaked at 24 h in the splenic red pulp of animals given oral IL-6 . Mice given saline showed no increase in splenic BrdU uptake . Histological analysis suggested a hematopoietic lineage for these cells . Clonogenic assays performed on spleen cells taken from mice given oral IL-6 revealed that increased granulocyte-macrophage colony forming units (GM-CFU) were present at 24 h post-IL-6 administration . No increase in GM colonies occurred in mice fed IL-3, granulocyte-colony stimulating factor (G-CSF) or granulocyte-macrophage (GM)-CSF . RT-PCR analysis of intestinal mRNA from treated mice revealed that GM-CSF mRNA was elevated at 4 h after oral IL-6 administration, but not in mice fed other cytokines . It is suggested that oral administration of IL-6 induces both proliferation and a brief elevation of GM-CFU in the hematopoietic spleens of mice . This increase appears to be the result of increased GM-CSF mRNA production in the intestines of mice fed IL-6. J Food Prot, 2004 Jul, 67(7), 1463 - 8 Campylobacter colonization of sibling turkey flocks reared under different management conditions; Smith K et al.; Uncertainty exists concerning the key factors contributing to Campylobacter colonization of poultry, especially the possible role of vertical transmission from breeder hens to young birds . A longitudinal study of Campylobacter colonization was performed in two sibling pairs of turkey flocks (four flocks total) . Each pair of sibling flocks shared breeder hen populations and was obtained from the same hatchery . One flock of each pair was grown on a commercial farm, and the other was grown in an instructional demonstration unit (Teaching Animal Unit {TAU}) . Flocks were located within a 60-mi (96.8-km) radius . The time of placement, feed formulations, stocking density, and general husbandry were the same for both flocks, and each flock was processed at a commercial processing plant following standard feed withdrawal and transport protocols . Both flocks grown on the commercial farms became colonized with Campylobacter between weeks 2 and 3 and remained colonized until processing . Between 80 and 90% of isolates were Campylobacter coli, and the remainder were Campylobacter jejuni . In contrast, neither C . coli nor C . jejuni were isolated from either of the TAU flocks at any time during the production cycle . None of the fla types of Campylobacter from the breeders that provided poults to one of the commercial flocks matched those from the progeny . These results failed to provide evidence for vertical transmission and indicate that this type of transmission either did not occur or was not sufficient to render the TAU turkey flocks Campylobacter positive . Management practices such as proper litter maintenance, controlled traffic between the TAU farm and other turkey flocks, and other less well-defined aspects of turkey production were likely responsible for the absence of Campylobacter in the TAU flocks before harvest. Eur J Gastroenterol Hepatol, 2004 Aug, 16(8), 775 - 8 Enteric infection in relapse of inflammatory bowel disease: importance of microbiological examination of stool; Mylonaki M et al.; OBJECTIVE: Previous reports have suggested that diarrhoeal relapses of inflammatory bowel disease (IBD) may be associated or confused with enteric infection, and that treatment of such infections with appropriate antibiotics may be beneficial . To re-evaluate the suggestion that enteric infection is rare and microbiological testing of stool not routinely necessary in patients presenting with relapse of IBD, we have reviewed the incidence of concurrent infection in patients presenting in relapse over a recent 5-year period . METHODS: Stool microbiology results relating to relapses of IBD during the period 1997-2001 were obtained retrospectively . Relapse was confirmed by standard clinical, sigmoidoscopic and laboratory criteria . RESULTS: During the period 1997-2001 there were 237 relapses in 213 patients . Enteric infection was found in 25 (10.5%) relapses in 24 patients; in seven patients, infection was associated with the initial presentation of their IBD . Clostridium difficile toxin was detected in 13 (5.5%) instances; the 12 other infections (5% relapses) were Campylobacter spp . (five), Entamoeba histolytica (three), Salmonella spp . (one), Plesiomonas shigelloides (one), Strongyloides stercoralis (one) and Blastocystis hominis (one) . There was a significant association between infection and the need for hospital admission . Of the 13 relapses associated with C . difficile, ten were in outpatients, seven patients had undergone previous antibiotic treatment, and four patients were presenting with IBD for the first time . All relapses resolved satisfactorily after treatment with antibiotics with or without corticosteroids . CONCLUSIONS: The high prevalence of enteric infections, of which C . difficile was the most common, indicates that all patients presenting with relapse of IBD should have stool examined microbiologically. Microb Drug Resist, 2004 Summer, 10(2), 124 - 31 Development of a standardized susceptibility test for campylobacter with quality-control ranges for ciprofloxacin, doxycycline, erythromycin, gentamicin, and meropenem; McDermott PF et al.; A standardized agar dilution susceptibility testing method was developed for Campylobacter that consisted of testing on Mueller-Hinton medium supplemented with 5% defibrinated sheep blood in an atmosphere of 10% CO2, 5% O2, and 85% N2 . Campylobacter jejuni ATCC 33560 was identified as a quality-control (QC) strain . Minimal inhibitory concentration (MIC) QC ranges were determined for two incubation time/temperature combinations: 36 degrees C for 48 hr and 42 degrees C for 24 hr . Quality-control ranges were determined for ciprofloxacin, doxycycline, erythromycin, gentamicin, and meropenem . For all antimicrobial agents tested at both temperatures, 95-100% of the QC MIC results fell within recommended QC ranges . Twenty-one Campylobacter clinical isolates, encompassing five species of Campylobacter (C . jejuni, C . coli, C . jejuni, subsp . doylei, C . fetus, and C . lari) were tested in conjunction with the C . jejuni QC strain . While C . jejuni and C . coli could be reliably tested under both test conditions, growth of C . jejuni subsp . doylei, C . fetus, and C . lari isolates was inconsistent when incubated at 42 degrees C . Therefore, it is recommended that these species only be tested at 36 degrees C. Microb Drug Resist, 2004 Summer, 10(2), 98 - 105 Characterization of plasmid-mediated aphA-3 kanamycin resistance in Campylobacter jejuni; Gibreel A et al.; A total of 254 isolates of Campylobacter jejuni and three isolates of Campylobacter coli, isolated from Sweden, Canada, and Egypt, were screened for kanamycin resistance . Eight strains of C . jejuni contained large plasmids that carried the aphA-3 kanamycin-resistance marker . In six plasmids, the aphA-3 gene was located downstream of an apparent insertion sequence, designated IS607*, which showed a considerable similarity to IS607, characterized on the chromosome of some Helicobacter pylori strains . In contrast, the other plasmids carried the aphA-3 gene as a part of a resistance cluster . This included three resistance markers encoding 6'-adenylyltransferase (aadE), streptothricin acetyltransferase (sat), and 3'-aminoglycoside phosphotransferase type III (aphA-3) . The genetic organization of this resistance cluster suggests that it has been acquired by C . jejuni from a Gram-positive organism . The IS607* element was also observed in kanamycin-susceptible strains of C . jejuni on plasmids mediating tetracycline resistance . The kanamycin-resistance phenotype transferred along with tetracycline resistance by conjugation from four representative C . jejuni strains to a recipient strain of C . jejuni . The kanamycin-resistance determinant (aphA-3) was stably transferred from one of the four C . jejuni strains to a recipient strain of Escherichia coli . However, the C . jejuni plasmid, which also carries the tetO gene, was not maintained in E . coli . Pulsed-field gel electrophoresis revealed the integration of approximately 50 kb of the plasmid into the chromosome of the E . coli recipient. Bundesgesundheitsblatt Gesundheitsforschung Gesundheitsschutz, 2004 Jul, 47(7), 633 - 46 {Zoonoses in working- and wild animals and their significance in Germany . An overview}; Conraths FJ et al.; The control of infectious diseases transmitted from animals to humans (zoonoses) was recently put on a new basis in the European Union when a new Zoonoses Directive entered into force . Brucellosis, campylobacteriosis, echinococcosis, listeriosis, salmonellosis, trichinosis, and the respective causative agents, tuberculosis due to Mycobacterium bovis, and verotoxigenic Escherichia coli must be included in monitoring . Additional zoonoses and zoonotic agents are to be monitored according to the epidemiological situation . Against this background, the current knowledge on important zoonoses transmitted from livestock and some wildlife animals to humans as well as the epidemiological situation in Germany with regard to these diseases is summarized. J Proteome Res, 2004 May-Jun, 3(3), 582 - 6 High-throughput cloning of Campylobacter jejuni ORfs by in vivo recombination in Escherichia coli; Parrish JR et al.; A rate-limiting and costly step in many proteomics analyses is the cloning of all of the ORFs for an organism into technique-specific vectors . Here, we describe the generation of a Campylobacter jejuni expression clone set using a high-throughput cloning approach based on recombination in E . coli . The approach uses native E . coli recombination functions and requires no in vitro enzymatic steps or special strains . Our results indicate that this approach is an efficient and economical alternative for high-throughput cloning. Proc R Soc Lond B Biol Sci, 2004 May 7, 271 Suppl 4, S127 - 30 Classification of eubacteria based on their complete genome: where does Mycoplasmataceae belong? Sorimachi K, Okayasu T. The amino acid compositions of 11 Gram-positive and 12 Gram-negative eubacteria were determined from their complete genomes . They were classified into two groups, 'S-type' represented by Staphylococcus aureus and 'E-type' represented by Escherichia coli, based on their patterns of amino acid compositions determined from the complete genome . These two groups were characterized by their concentrations of Arg, Ala and Lys . Mycoplasmas, which lack a cell wall, belonged to the 'S-type', while Gram-positive mycobacteria belonged to the 'E-type' . Rickettsia prowazekii, Borrelia burgdorferi, Campylobacter jejuni and Helicobacter pylori, which are Gram-negative, belong to the 'S-type' . The classification into two groups based on their amino acid compositions determined from the complete genome was independent of Gram staining . In addition, the amino acid composition based on the plasmid resembled that based on the parent complete genome. Z Gastroenterol, 2004 Jul, 42(7), 599 - 603 {Diarrhea and weight loss in common variable immunodeficiency}; Liesch Z et al.; A 25-year-old male was hospitalized for diarrhea and weight loss . Since childhood he had experienced recurrent episodes of pneumonia and diarrhea . Physical and laboratory findings were compatible with malabsorption . On endoscopy, nodular lymphoid hyperplasia (NLH) of the small intestine was found . Common variable immunodeficiency syndrome (CVID) was suspected and diagnosis was established by demonstrating a significant reduction of plasma gamma-globulin levels . Immediately after starting immunoglobulin treatment diarrhea stopped, and both incidence and severity of pulmonary infections were significantly reduced, while recurrent gastrointestinal infections (notably lambliasis and Campylobacter infections) continued to occur and both bronchiectases and splenomegaly were progressive over years . This case report focuses on CVID as a potential underlying cause of diarrhea . The most important complications of the disease are presented . Therapeutical options are discussed in the light of recently published data. J Clin Microbiol, 2004 Jul, 42(7), 3321 - 3 Genetic relatedness and quinolone resistance of Campylobacter jejuni strains isolated in 2002 in Hong Kong; Chu YW et al.; Pulsed-field gel electrophoresis fingerprints of 98 Campylobacter jejuni isolates from patients (85) and chicken carcasses (13) in Hong Kong in 2002 demonstrated high genetic diversity . The prevalence of quinolone resistance among the isolates was 85.9%, and replacement of the threonine-86 residue in the gyrase subunit A was the major resistance mechanism. Lett Appl Microbiol, 2004, 39(2), 207 - 14 Levels of zoonotic agents in British livestock manures; Hutchison ML et al.; AIMS: To determine the prevalence and levels of zoonotic agents in livestock wastes . METHODS AND RESULTS: A proportionally weighted survey was undertaken and livestock waste samples analysed quantitatively for Escherichia coli O157, pathogenic Listeria, Salmonella, Campylobacter, Giardia and Cryptosporidium . A significant proportion of wastes contained at least one zoonotic agent . Relationships were found between dry matter content and the presence and levels of some zoonotic agents . CONCLUSIONS: British livestock wastes contain measurable levels of the zoonotic agents that cause most cases of gastroenteritis in the UK . SIGNIFICANCE AND IMPACT OF THE STUDY: Animal wastes are disposed of by spreading to agricultural land used for the production of crops and livestock grazing . As British wastes are contaminated with significant levels of zoonotic agents, the practice may represent a way for pathogens to travel further up the food chain. Appl Environ Microbiol, 2004 Jul, 70(7), 4379 - 83 Validation of a PCR-based method for detection of food-borne thermotolerant campylobacters in a multicenter collaborative trial; Josefsen MH et al.; A PCR-based method for rapid detection of food-borne thermotolerant campylobacters was evaluated through a collaborative trial with 12 laboratories testing spiked carcass rinse samples . The method showed an interlaboratory diagnostic sensitivity of 96.7% and a diagnostic specificity of 100% for chicken samples, while these values were 94.2 and 83.3%, respectively, for pig samples. Appl Environ Microbiol, 2004 Jul, 70(7), 3877 - 83 Longitudinal study of Campylobacter jejuni bacteriophages and their hosts from broiler chickens; Connerton PL et al.; A longitudinal study of bacteriophages and their hosts was carried out at a broiler house that had been identified as having a population of Campylobacter-specific bacteriophages . Cloacal and excreta samples were collected from three successive broiler flocks reared in the same barn . Campylobacter jejuni was isolated from each flock, whereas bacteriophages could be isolated from flocks 1 and 2 but were not isolated from flock 3 . The bacteriophages isolated from flocks 1 and 2 were closely related to each other in terms of host range, morphology, genome size, and genetic content . All Campylobacter isolates from flock 1 were genotypically indistinguishable by pulsed-field gel electrophoresis (PFGE) . PFGE and multilocus sequence typing indicated that this C . jejuni type was maintained from flock 1 to flock 2 but was largely superseded by three genetically distinct C . jejuni types insensitive to the resident bacteriophages . All isolates from the third batch of birds were insensitive to bacteriophages and genotypically distinct . These results are significant because this is the first study of an environmental population of C . jejuni bacteriophages and their influence on the Campylobacter populations of broiler house chickens . The role of developing bacteriophage resistance was investigated as this is a possible obstacle to the use of bacteriophage therapy to reduce the numbers of campylobacters in chickens . In this broiler house succession was largely due to incursion of new genotypes rather than to de novo development of resistance. J Appl Microbiol, 2004, 97(2), 347 - 53 Determination of toxicity of Campylobacter jejuni isolated from humans and from poultry carcasses acquired at various stages of production; Gilbert C et al.; AIM: The research focused on the determination of the toxicity variation associated with Campylobacter jejuni isolated from humans and chickens . METHODS AND RESULTS: Campylobacter jejuni isolates were obtained from chicken carcasses and from humans exhibiting symptoms of campylobacteriosis . Using HeLa cells as the in vitro model, toxicity was determined for each isolate . The mean toxicity level of the chicken isolates was significantly lower than that of the human isolates (P < 0.001) . There was a wide range of toxicity in C . jejuni isolated from chickens and the percentage of isolates exhibiting low toxicity remaining relatively constant . All C . jejuni isolates from humans possessed either medium or high levels of toxicity . CONCLUSIONS: All wildtype C . jejuni isolates obtained from poultry carcasses may not be equally important as a human foodborne pathogen . SIGNIFICANCE AND IMPACT OF STUDY: Campylobacter jejuni remains a primary foodborne pathogen and increased efforts are needed to determine the impact of wildtype isolates in causing human illness . The present research indicates that all isolates may not be equally important in regards to disease potential . The information found should be included in efforts to develop C . jejuni detection, control and infection modelling. Eur J Biochem, 2004 Jul, 271(14), 3028 - 35 Biosynthesis of isoprenoids: a bifunctional IspDF enzyme from Campylobacter jejuni; Gabrielsen M et al.; In the nonmevalonate pathway of isoprenoid biosynthesis, the conversion of 2C-methyl-d-erythritol 4-phosphate into its cyclic diphosphate proceeds via nucleotidyl intermediates and is catalyzed by the products of the ispD, ispE and ispF genes . An open reading frame of Campylobacter jejuni with similarity to the ispD and ispF genes of Escherichia coli was cloned into an expression vector directing the formation of a 42 kDa protein in a recombinant E . coli strain . The purified protein was shown to catalyze the transformation of 2C-methyl-D-erythritol 4-phosphate into 4-diphosphocytidyl-2C-methyl-D-erythritol and the conversion of 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate at catalytic rates of 19 micro mol x mg(-1) x min(-1) and 7 micro mol x mg(-1) x min(-1), respectively . Both enzyme-catalyzed reactions require divalent metal ions . The C . jejuni enzyme does not catalyze the formation of 2C-methyl-D-erythritol 3,4-cyclophosphate from 4-diphosphocytidyl-2C-methyl-D-erythritol, a side reaction catalyzed in vitro by the IspF proteins of E . coli and Plasmodium falciparum . Comparative genomic analysis show that all sequenced alpha- and epsilon-proteobacteria have fused ispDF genes . These bifunctional proteins are potential drug targets in several human pathogens (e.g . Helicobacter pylori, C . jejuni and Treponema pallidum). J Bacteriol, 2004 Jul, 186(14), 4781 - 95 Identification of Campylobacter jejuni ATCC 43431-specific genes by whole microbial genome comparisons; Poly F et al.; This study describes a novel approach to identify unique genomic DNA sequences from the unsequenced strain C . jejuni ATCC 43431 by comparison with the sequenced strain C . jejuni NCTC 11168 . A shotgun DNA microarray was constructed by arraying 9,600 individual DNA fragments from a C . jejuni ATCC 43431 genomic library onto a glass slide . DNA fragments unique to C . jejuni ATCC 43431 were identified by competitive hybridization to the array with genomic DNA of C . jejuni NCTC 11168 . The plasmids containing unique DNA fragments were sequenced, allowing the identification of up to 130 complete and incomplete genes . Potential biological roles were assigned to 66% of the unique open reading frames . The mean G+C content of these unique genes (26%) differs significantly from the G+C content of the entire C . jejuni genome (30.6%) . This suggests that they may have been acquired through horizontal gene transfer from an organism with a G+C content lower than that of C . jejuni . Because the two C . jejuni strains differ by Penner serotype, a large proportion of the unique ATCC 43431 genes encode proteins involved in lipooligosaccharide and capsular biosynthesis, as expected . Several unique open reading frames encode enzymes which may contribute to genetic variability, i.e., restriction-modification systems and integrases . Interestingly, many of the unique C . jejuni ATCC 43431 genes show identity with a possible pathogenicity island from Helicobacter hepaticus and components of a potential type IV secretion system . In conclusion, this study provides a valuable resource to further investigate Campylobacter diversity and pathogenesis . J Bacteriol, 2004 Jul, 186(14), 4714 - 29 Iron acquisition and regulation in Campylobacter jejuni; Palyada K et al.; Iron affects the physiology of bacteria in two different ways: as a micronutrient for bacterial growth and as a catalyst for the formation of hydroxyl radicals . In this study, we used DNA microarrays to identify the C . jejuni genes that have their transcript abundance affected by iron availability . The transcript levels of 647 genes were affected after the addition of iron to iron-limited C . jejuni cells . Several classes of affected genes were revealed within 15 min, including immediate-early response genes as well as those specific to iron acquisition and metabolism . In contrast, only 208 genes were differentially expressed during steady-state experiments comparing iron-rich and iron-limited growth conditions . As expected, genes annotated as being involved in either iron acquisition or oxidative stress defense were downregulated during both time course and steady-state experiments, while genes encoding proteins involved in energy metabolism were upregulated . Because the level of protein glycosylation increased with iron limitation, iron may modulate the level of C . jejuni virulence by affecting the degree of protein glycosylation . Since iron homeostasis has been shown to be Fur regulated in C . jejuni, an isogenic fur mutant was used to define the Fur regulon by transcriptome profiling . A total of 53 genes were Fur regulated, including many genes not previously associated with Fur regulation . A putative Fur binding consensus sequence was identified in the promoter region of most iron-repressed and Fur-regulated genes . Interestingly, a fur mutant was found to be significantly affected in its ability to colonize the gastrointestinal tract of chicks, highlighting the importance of iron homeostasis in vivo . Directed mutagenesis of other genes identified by the microarray analyses allowed the characterization of the ferric enterobactin receptor, previously named CfrA . Chick colonization assays indicated that mutants defective in enterobactin-mediated iron acquisition were unable to colonize the gastrointestinal tract . In addition, a mutation in a receptor (Cj0178) for an uncharacterized iron source also resulted in reduced colonization potential . Overall, this work documents the complex response of C . jejuni to iron availability, describes the genetic network between the Fur and iron regulons, and provides insight regarding the role of iron in C . jejuni colonization in vivo . J Bacteriol, 2004 Jul, 186(14), 4535 - 42 Helicobacter pylori FlgR is an enhancer-independent activator of sigma54-RNA polymerase holoenzyme; Brahmachary P et al.; Helicobacter pylori FlgR activates transcription with sigma54-RNA polymerase holoenzyme (sigma54-holoenzyme) from at least five flagellar operons . Activators of sigma54-holoenzyme generally bind enhancer sequences located >70 bp upstream of the promoter and contact sigma54-holoenzyme bound at the promoter through DNA looping to activate transcription . H . pylori FlgR lacks the carboxy-terminal DNA-binding domain present in most sigma54-dependent activators . As little as 42 bp of DNA upstream of the flaB promoter and 26 bp of DNA sequence downstream of the transcriptional start site were sufficient for efficient FlgR-mediated expression from a flaB'-'xylE reporter gene in H . pylori, indicating that FlgR does not use an enhancer to activate transcription . Other examples of sigma54-dependent activators that lack a DNA-binding domain include Chlamydia trachomatis CtcC and activators from the other Chlamydia spp . whose genomes have been sequenced . FlgR from Helicobacter hepaticus and Campylobacter jejuni, which are closely related to H . pylori, appear to have carboxy-terminal DNA-binding domains, suggesting that the loss of the DNA-binding domain from H . pylori FlgR occurred after the divergence of these bacterial species . Removal of the amino-terminal regulatory domain of FlgR resulted in a constitutively active form of the protein that activated transcription from sigma54-dependent genes in Escherichia coli . The truncated FlgR protein also activated transcription with E . coli sigma54-holoenzyme in an in vitro transcription assay . Mol Microbiol, 2004 Jul, 53(2), 541 - 53 FlaC, a protein of Campylobacter jejuni TGH9011 (ATCC43431) secreted through the flagellar apparatus, binds epithelial cells and influences cell invasion; Song YC et al.; Type III secretion systems identified in bacterial pathogens of animals and plants transpose effectors and toxins directly into the cytosol of host cells or into the extracellular milieu . Proteins of the type III secretion apparatus are conserved among diverse and distantly related bacteria . Many type III apparatus proteins have homologues in the flagellar export apparatus, supporting the notion that type III secretion systems evolved from the flagellar export apparatus . No type III secretion apparatus genes have been found in the complete genomic sequence of Campylobacter jejuni NCTC11168 . In this study, we report the characterization of a protein designated FlaC of C . jejuni TGH9011 . FlaC is homologous to the N- and C-terminus of the C . jejuni flagellin proteins, FlaA and FlaB, but lacks the central portion of these proteins . flaC null mutants form a morphologically normal flagellum and are highly motile . In wild-type C . jejuni cultures, FlaC is found predominantly in the extracellular milieu as a secreted protein . Null mutants of the flagellar basal rod gene (flgF) and hook gene (flgE) do not secrete FlaC, suggesting that a functional flagellar export apparatus is required for FlaC secretion . During C . jejuni infection in vitro, secreted FlaC and purified recombinant FlaC bind to HEp-2 cells . Invasion of HEp-2 cells by flaC null mutants was reduced to a level of 14% compared with wild type, suggesting that FlaC plays an important role in cell invasion. J Neuroimmunol, 2004 Jul, 152(1-2), 98 - 111 Innate murine B cells produce anti-disialosyl antibodies reactive with Campylobacter jejuni LPS and gangliosides that are polyreactive and encoded by a restricted set of unmutated V genes; Boffey J et al.; In Guillain-Barre syndrome following Campylobacter enteritis, anti-lipopolysaccharide antibodies cross-react with neural gangliosides, thereby precipitating autoimmune neuropathy . We examined the properties of 15 murine anti-LPS/ganglioside mAbs specific for NeuAc(alpha2-8)NeuAc-Gal disialosyl epitopes . Many mAbs displayed features of an innate B cell origin including polyreactivity (13/15), hybridoma CD5 mRNA expression (5/15), predominance of IgM (9/15) or IgG3 (3/6) isotype, low affinity, and utilisation of unmutated VH and VL VDJ rearrangements . Antibody specificity resided in highly selective V gene usage, with 6/15 mAbs being encoded by the VH7183.3b gene . These data indicate that neuropathogenic antiganglioside autoantibodies can arise from the natural autoantibody repertoire. J Food Prot, 2004 Jun, 67(6), 1226 - 8 Baseline rates of Campylobacter and Salmonella in raw chicken in Wales, United Kingdom, in 2002; Meldrum RJ et al.; The Public Health Laboratory Service in Wales, in cooperation with local authorities and the Food Standards Agency Wales, carried out a survey to establish baseline figures for the contamination of raw retail chicken with Salmonella and Campylobacter available within Wales, a devolved part of the United Kingdom with a population of approximately 3 million . Seven hundred thirty-nine samples were obtained between November 2001 and December 2002 . Overall, 71% of samples were contaminated with Campylobacter, and 8% were contaminated with Salmonella . There were no significant differences between fresh and frozen carcasses and between samples taken from retailers or butchers . There was seasonal variation in the level of Campylobacter contamination of fresh chicken, with a peak in June and the lowest positive rates in January, March, and December . There was no similar peak observed in frozen samples or for Salmonella. J Food Prot, 2004 Jun, 67(6), 1146 - 52 Direct microscopic observation of viability of Campylobacter jejuni on chicken skin treated with selected chemical sanitizing agents; Chantarapanont W et al.; The objective of this research was to determine the effect of chlorine, acidified sodium chlorite, and peracetic acid treatments on viable Campylobacter jejuni located at various depths within follicles or folds of chicken skin . Chicken skin was inoculated with C . jejuni transformed with P(c)gfp plasmid (GFP-Campylobacter), which also codes for kanamycin resistance . Effectiveness of sanitizer treatments was determined by plate count . C . jejuni were also observed on chicken skin by confocal scanning laser microscopy, whereby viable and nonviable cells were differentiated by their ability to take up staining with 5-cyano-2,3-ditolyl tetrazolium chloride . Sodium hypochlorite, peracetic acid, and acidified sodium chlorite were each applied at 40 or 100 ppm for 2 or 15 min . Each sanitizer resulted in approximately a 1-log decrease (CFU) when used at 100 ppm for 15 min and no significant decrease when used at 40 ppm for 2 min . Numbers of viable cells observed on the skin by direct microscopic count were similar to numbers obtained by plate count . Although viable counts decreased with sanitizer treatments, the total number of Campylobacter cells (live plus dead) attached to the skin remained unchanged . After each chemical treatment, viable C . jejuni were observed at depths of 0 to 10, 11 to 20, and 21 to 30 microm in folds or follicles of chicken skin . Most of the C . jejuni that survived treatment were located at 0 to 10 microm depth, which is where most of the viable cells were located before treatment . The inability of chemical sanitizers to effectively eliminate C . jejuni on chicken skin does not appear to be a result of protection by location in feather follicles or other depressions in the skin. Prev Vet Med, 2004 Jun 10, 64(1), 15 - 25 Risk factors for Campylobacter spp . infection in Senegalese broiler-chicken flocks; Cardinale E et al.; Our objective was to identify the risk factors for Campylobacter infection in Senegalese broiler flocks . Seventy broiler farms were studied around Dakar from January 2000 to December 2001 around Dakar . A questionnaire was administered to the farmers, and samples of fresh droppings were taken to assess the flocks' Campylobacter status . About 63% of the flocks were infected by Campylobacter spp.; Campylobacter jejuni was the most-prevalent species (P < 0.05) . An elevated risk of Campylobacter infection was associated with other animals (mainly laying hens, cattle and sheep) being bred in the farm, the farm staff not wearing their work clothing exclusively in the poultry houses, uncemented poultry-house floors and the use of cartons that transport chicks from the hatchery to the farm as feed plates (rather than specifically designed feed plates) . Alternatively, thorough cleaning and disinfection of poultry-house surroundings and manure disposal outside the farm were associated with decreased flock risk. Przegl Epidemiol, 2004, 58(1), 9 - 19 {Infectious diseases in Poland in 2002}; Zielinski A et al.; New regulations concerning infectious diseases effective in Poland since 2002 did not changed surveillance of infectious diseases . The most frequent infectious disease as in the previous years was influenza . 228.055 cases were reported (596.5/100,000) . Number of foodborne infections and intoxications remains high--26.734 cases (69.0/100,000) . 77% of them were caused by Salmonella . In this high number of foodborne infections in 4,492 (16.8%) etiologic factor was not found . In this number Campylobacter infections, rarely tested in Poland may be found . Especially alarming is number of cases of diarrhea among children 0-2 . Age adjusted incidence of 2.464/100,000 is the highest occurrence among infectious diseases in Poland . There was noted decrease of incidence of newly diagnosed cases of viral hepatitis B (5.3/100,000) which dropped to the level of the incidence of viral hepatitis C (5.17/100,000) . Hepatitis A remains at the low level (0.9/100,000) . Level of newly diagnosed cases of AIDS (113 cases, 0.3/100,000) remains relatively stable for last few years . The major problem is decreasing reporting of possible risk factors . Infectious diseases caused 0.74% of deaths . Mortality from infectious diseases was 6.9/100,000 and was significantly higher among men (8.9) then among women . (5.1) . In the age groups 35-64 it was 3-4 times higher . In urban settings mortality from infectious diseases was higher (7.2/100,000) then in the country (6.6) . In particular districts (voivodeships) mortality indices remained in the range of 4.3 (opolskie) to 11.4 (slaskie) . As in previous years, the highest number of deaths was caused by tuberculosis and its late sequels (35.4%) . Attention should be given to the increased number of deaths due to sepsis (33.6%, without neonatal sepsis). J Agric Saf Health, 2004 May, 10(2), 127 - 32 Outbreak of occupational campylobacteriosis associated with a pheasant farm; Heryford AG et al.; A cluster of campylobacteriosis cases occurred at a pheasant farm in rural Wyoming during the summer of 2000 . This study examined the potential causes of the outbreak . A cohort study of all farm workers was conducted to assess foodborne and occupational exposures at the facility . Eight of fifteen workers (53%) became ill, and four were stool-culture positive for Campylobacter jejuni . High attack rates were noted among workers who had direct contact with pheasant feces and first-time workers at the farm . This investigation suggests an association between campylobacteriosis and occupational animal exposure to pheasants . Enhanced educational efforts targeting occupations with direct animal contact are critical, particularly in rural communities. Clin Microbiol Infect, 2004 Jul, 10(7), 634 - 9 Enteropathogens associated with cases of gastroenteritis in a rural population in Jordan; Nimri LF et al.; Stool specimens were collected from 180 patients belonging to a population of recently settled Bedouins in Jordan who presented with acute or persistent diarrhoea and other symptoms, and from 100 non-diarrhoeal controls . All samples were examined for parasites and bacterial pathogens by culture and PCR . Bacterial isolates were tested for their susceptibility to common antimicrobial agents . Pathogens and potential enteropathogens were identified from 140 (77.8%) of the patients, with more than one pathogen being recovered from 67 (37.2%) patients . Potentially pathogenic parasites were observed in 90 (50%) patients; those that were associated significantly with diarrhoea were Giardia lamblia, Blastocystis hominis, Cryptosporidium spp., Entamoeba histolytica and Cyclospora cayetanensis . Pathogenic bacteria were isolated from 72 (40%) patients, and, of these, 62.5% were resistant to at least one antibiotic, and 30.6% of these were multiresistant . Diarrhoeagenic Escherichia coli strains were found in 14.3% of the patients and 2.9% of the control subjects (not statistically significant) . The most common enteropathogenic bacteria found were Shigella spp., Campylobacter jejuni and Yersinia enterocolitica . Unusual bacterial species were the predominant organisms recovered in a few cases and could represent a possible cause of diarrhoea . Overall, there was a high endemicity of diarrhoeal disease in the area studied . Risk factors that correlated significantly with contracting diarrhoea were socio-economic status, education, use of unchlorinated well or tank water, and a low level of personal hygiene. Lett Appl Microbiol, 2004, 38(4), 306 - 10 An evaluation of five preservation techniques and conventional freezing temperatures of -20 degrees C and -85 degrees C for long-term preservation of Campylobacter jejuni; Gorman R et al.; AIMS: This study aimed to identify a simple, inexpensive preservation technique that will allow a quick and reliable recovery of Campylobacter jejuni following long-term periods of preservation . METHODS AND RESULTS: Preservation techniques include (i) Cryobank microbial preservation system using hypertonic 'cryopreservative solution' and glass beads, (ii) Cryobank microbial preservation system using defibrinated lysed horse blood and glass beads, (iii) FBP medium, (iv) 15% glycerol/85% nutrient broth no . 2 culture, and (v) 50% glycerol/50% nutrient broth no . 2 culture . Each preservation technique was evaluated over a 1-year period at conventional freezing temperatures of -20 degrees C and -85 degrees C . Replacement of 'cryopreservative fluid' in commercially prepared vials of glass beads with lysed horse blood increased the duration of preservation of Camp . jejuni by up to 6 months . CONCLUSIONS: FBP medium proved the most successful preservation technique with 100 and 80% recovery after 1 year at -85 degrees C and -20 degrees C, respectively . SIGNIFICANCE AND IMPACT OF THE STUDY: This study demonstrated a simple inexpensive preservation method for long-term storage of Camp . jejuni. J S Afr Vet Assoc, 2004 Mar, 75(1), 30 - 6 An investigation into the causes of low calving percentage in communally grazed cattle in Jericho, North West Province; Mokantla E et al.; The communal grazing system is generally understood to have a low input, low output type of management . However, the actual inputs and outputs of the farmers are not well known and the farmers are often unaware of their problems . Although the causes of low calving percentage are well understood in commercial beef farming enterprises in South Africa, the same is not true for communal farming systems . The aim of this study was to determine the reproductive performance of beef cattle on a communal farming system in Jericho, North West Province . Ten farmers from five villages with a total of 265 cows and 13 bulls were purposively selected . The selection criteria were that each farmer had to have a minimum of 10 breeding cows and a bull and be willing to participate in the study . This was followed by a 12-month longitudinal study with monthly herd visits where cows were examined rectally and bulls (n = 13) were subjected to a single breeding soundness evaluation . The calving percentage was found to be 37.7% . This is lower than the recorded percentages for commercial beef cattle on extensive grazing . The factors playing a role in low calving percentage were ranked using field data . From this it appeared that failure of cows to become pregnant was the main cause of poor calving percentage as opposed of loss of calves through abortion or resorption . Sub-fertility of the bulls was found to be of great significance and it is proposed that this be included in extension messages and that bulls be fertility tested routinely . Poor body condition score of cows, mainly caused by poor management, was also considered to play a major role in reducing pregnancy rates . Infectious diseases like trichomonosis, campylobacteriosis and brucellosis played a much leser role than anticipated. Infect Immun, 2004 Jul, 72(7), 3769 - 76 Adaptation of Campylobacter jejuni NCTC11168 to high-level colonization of the avian gastrointestinal tract; Jones MA et al.; The genome sequence of the human pathogen Campylobacter jejuni NCTC11168 has been determined recently, but studies on colonization and persistence in chickens have been limited due to reports that this strain is a poor colonizer . Experimental colonization and persistence studies were carried out with C . jejuni NCTC11168 by using 2-week-old Light Sussex chickens possessing an acquired natural gut flora . After inoculation, NCTC11168 initially colonized the intestine poorly . However, after 5 weeks we observed adaptation to high-level colonization, which was maintained after in vitro passage . The adapted strain exhibited greatly increased motility . A second strain, C . jejuni 11168H, which had been selected under in vitro conditions for increased motility (A . V . Karlyshev, D . Linton, N . A . Gregson, and B . W . Wren, Microbiology 148:473-480, 2002), also showed high-level intestinal colonization . The levels of colonization were equivalent to those of six other strains, assessed under the same conditions . There were four mutations in C . jejuni 11168H that reduced colonization; maf5, flaA (motility and flagellation), and kpsM (capsule deficiency) eliminated colonization, whereas pglH (general glycosylation system deficient) reduced but did not eliminate colonization . This study showed that there was colonization of the avian intestinal tract by a Campylobacter strain having a known genome sequence, and it provides a model for colonization and persistence studies with specific mutations. J Periodontol, 2004 May, 75(5), 717 - 25 Subgingival microbiota of chilean patients with chronic periodontitis; Lopez NJ et al.; BACKGROUND: An association between race/ethnicity and the composition of the subgingival microbiota has been found in chronic periodontitis . A study was undertaken to determine the characteristics of the subgingival microbiota of chronic periodontitis in Chileans residing in Santiago . METHODS: Twenty-six subjects (mean age 45 +/- 7 years) with chronic periodontitis, mean probing depth (PD) 2.63 +/- 0.5 mm, mean attachment level (AL) 3.70 +/- 0.77 mm, and without a history of periodontal therapy were selected . Measurements of PD, AL, bleeding on probing, and plaque accumulation were recorded at six sites per tooth . Subgingival plaque samples were taken from the mesial aspect of every tooth and evaluated for the presence, levels, and proportions of 40 bacterial taxa using whole genomic DNA probes and checkerboard DNA-DNA hybridization . The microbial data of the Chileans were compared with data from 115 chronic periodontitis patients from Boston, Massachusetts . Since several clinical and demographic parameters differed between the two populations, significance of differences for each species was determined using analysis of covariance, adjusting for age, plaque level, mean PD, gender, and smoking status . RESULTS: Each of the individual test species was present in at least 25 of the 26 subjects, and 12 subjects (46.1%) harbored all 40 test species . With the exception of Prevotella intermedia, all test species colonized more than 75% of sites, and 25 species colonized > or = 90% of sites including the co-colonizing species of advanced periodontal lesions, termed the red complex, composed of the three species Porphyromonas gingivalis, Tannerella forsythensis (formerly Bacteroides forsythus), and Treponema denticola as well as Fusobacterium nucleatum subspecies, Campylobacter rectus, Peptostreptococcus micros, and Treponerma socranskii . Sixteen of the 40 species differed significantly between Chilean and U.S . subjects . Red, yellow, and other complexes were significantly higher in the Chileans, while the Actinomyces were higher in the U.S . subjects . CONCLUSIONS: The composition of the subgingival plaque differs among different subject populations . Thus, care should be taken when extrapolating the findings of one study to different ethnic groups. Emerg Infect Dis, 2004 Jun, 10(6), 1102 - 9 Antimicrobial resistance among Campylobacter strains, United States, 1997-2001; Gupta A et al.; We summarize antimicrobial resistance surveillance data in human and chicken isolates of Campylobacter . Isolates were from a sentinel county study from 1989 through 1990 and from nine state health departments participating in National Antimicrobial Resistance Monitoring System for enteric bacteria (NARMS) from 1997 through 2001 . None of the 297 C . jejuni or C . coli isolates tested from 1989 through 1990 was ciprofloxacin-resistant . From 1997 through 2001, a total of 1,553 human Campylobacter isolates were characterized: 1,471 (95%) were C . jejuni, 63 (4%) were C . coli, and 19 (1%) were other Campylobacter species . The prevalence of ciprofloxacin-resistant Campylobacter was 13% (28 of 217) in 1997 and 19% (75 of 384) in 2001; erythromycin resistance was 2% (4 of 217) in 1997 and 2% (8 of 384) in 2001 . Ciprofloxacin-resistant Campylobacter was isolated from 10% of 180 chicken products purchased from grocery stores in three states in 1999 . Ciprofloxacin resistance has emerged among Campylobacter since 1990 and has increased in prevalence since 1997. Emerg Infect Dis, 2004 Jun, 10(6), 1056 - 63 Quinolone-resistant Campylobacter infections: risk factors and clinical consequences; Engberg J et al.; We integrated data on quinolone and macrolide susceptibility patterns with epidemiologic and typing data from Campylobacter jejuni and C . coli infections in two Danish counties . The mean duration of illness was longer for 86 patients with quinolone-resistant C . jejuni infections (median 13.2 days) than for 381 patients with quinolone-sensitive C . jejuni infections (median 10.3 days, p = 0.001) . Foreign travel, eating fresh poultry other than chicken and turkey, and swimming were associated with increased risk for quinolone-resistant C . jejuni infection . Eating fresh chicken (of presumably Danish origin) was associated with a decreased risk . Typing data showed an association between strains from retail food products and broiler chickens and quinolone-sensitive domestically acquired C . jejuni infections . An association between treatment with a fluoroquinolone before stool-specimen collection and having a quinolone-resistant C . jejuni infection was not observed. J Periodontal Res, 2004 Aug, 39(4), 207 - 12 Herpesviral-bacterial interrelationships in aggressive periodontitis; Saygun I et al.; BACKGROUND: Recent findings have begun to provide a basis for a causal link between herpesviruses and aggressive periodontitis . One theory is that herpesviruses cooperate with specific bacteria in the etiopathogenesis of the disease . This study examined whether the presence of herpesviruses {human cytomegalovirus (HCMV), Epstein-Barr virus (EBV) type 1, herpes simplex virus (HSV) type 1 and 2} is associated with the presence of putative pathogenic bacteria (Porphyromonas gingivalis, Prevotella intermedia, Tannerella forsythia, Campylobacter rectus, Actinobacillus actinomycetemcomitans) in aggressive periodontitis lesions . METHODS: The study included 18 young adults with advanced periodontitis and 16 periodontally healthy subjects from Ankara, Turkey . Subgingival specimens pooled from two sites in each subject were collected by a periodontal curette . Qualitative polymerase chain reaction methodology was used to identify herpesviruses and bacteria . Chi-square tests were employed to determine statistical associations among herpesviruses, bacteria and periodontal disease . RESULTS: HCMV, EBV-1 and HSV-1 were each detected in 72-78% of the aggressive periodontitis patients . HSV-2 occurred in 17% of the periodontitis patients . EBV-1 was detected in one periodontally healthy subject . The study bacteria occurred in 78-83% (P . gingivalis, T . forsythia, C . rectus) and in 44% (P . intermedia, A . actinomycetemcomitans) of the periodontitis samples, and in 0-19% of the samples from healthy periodontal sites . HCMV, EBV-1 and HSV-1 were positively associated with P . gingivalis, P . intermedia, T . forsythia and C . rectus, but not with A . actinomycetemcomitans . HSV-2 was not associated with any test bacteria . CONCLUSIONS: These results support the notion that the clinical outcome of some types of severe periodontal infection depends on the presence of specific herpesviruses and bacterial pathogens . Our findings open the door to testing a variety of hypotheses regarding the deleterious aspects of combined herpesviral-bacterial infections in periodontal sites . Copyright Blackwell Munksgaard, 2004 Digestion, 2004, 69(4), 201 - 10 Epub 2004 Jun 16. Effects of Helicobacter pylori on endothelial cell proliferation and chemotaxis; Pearce HR et al.; BACKGROUND/AIM: Helicobacter pylori is associated with an increased risk of peptic ulcer disease development and recurrence . Ulcer healing is dependent upon angiogenesis, requiring endothelial cell (EC) proliferation and chemotaxis . This study determined whether extracts of H . pylori affected EC proliferation and/or chemotaxis in vitro . METHODS: The effects of water and broth extracts of three genotypically different strains of H . pylori and of single strains of Campylobacter jejuni and Escherichia coli on human dermal microvascular EC (HuDMEC) and human umbilical vein EC (HUVEC) were assessed . Tetrazolium dye (MTT) proliferation, dual staining cell viability, flow cytometry, and microchemotaxis assays were performed . RESULTS: H . pylori (all strains) and C . jejuni inhibited HuDMEC (p < 0.01) and HUVEC (p < 0.01) proliferation and decreased the proportion of HUVECs in the S phase of the cell cycle . E . coli had no effect on EC proliferation . The levels of vascular endothelial growth factor stimulated chemotaxis were significantly greater (p < 0.01) than the levels of basal migration for both control and extract-treated ECs . However, none of the bacterial extracts affected EC basal migration or chemotaxis . CONCLUSION: H . pylori extracts inhibit HuDMEC and HUVEC proliferation in vitro by a cytostatic, strain-independent mechanism . A similar antiproliferative effect of C . jejuni was observed . Our findings suggest that both H . pylori and C . jejuni have the ability to inhibit one of the key stages of angiogenesis which may have implications in peptic ulcer disease. J Antimicrob Chemother, 2004 Aug, 54(2), 341 - 7 Epub 2004 Jun 16. Expression of the efflux pump genes cmeB, cmeF and the porin gene porA in multiple-antibiotic-resistant Campylobacter jejuni; Pumbwe L et al.; AIMS: In Escherichia coli, increased expression of efflux pumps and/or decreased expression of porins can confer multiple antibiotic resistance (MAR), causing resistance to at least three unrelated classes of antibiotics, detergents and dyes . It was hypothesized that in Campylobacter jejuni, the efflux systems CmeABC, CmeDEF and the major outer membrane porin protein, MOMP (encoded by porA) could confer MAR . METHODS: The expression of cmeB, cmeF and porA in 32 MAR C . jejuni isolated from humans or poultry was determined by comparative (C)-reverse transcriptase (RT)-PCR and denaturing DHPLC . A further 13 ethidium bromide-resistant isolates and three control strains were also investigated . Accumulation of ciprofloxacin+/-carbonyl cyanide-m-chlorophenyl hydrazone (CCCP) was also determined for all strains . RESULTS: Although resistance to ethidium bromide has been associated with MAR, expression of all three genes was similar in the ethidium bromide-resistant isolates . These data indicate that CmeB, CmeF and MOMP play no role in resistance to this agent in C . jejuni . Six MAR isolates over-expressed cmeB, 3/32 over-expressed cmeB and cmeF . No isolates over-expressed cmeF alone . Expression of porA was similar in all isolates . All nine isolates that over-expressed cmeB contained a mutation in cmeR, substituting glycine 86 with alanine . All cmeB over-expressing isolates also accumulated low concentrations of ciprofloxacin, which were restored to wild-type levels in the presence of CCCP . CONCLUSIONS: These data indicate that over-expression of cmeB is associated with MAR in isolates of C . jejuni . However, as cmeB was over-expressed by only one-third (9/32) of MAR isolates, these data also indicate other mechanisms of MAR in C . jejuni. Zhonghua Liu Xing Bing Xue Za Zhi, 2004 Mar, 25(3), 240 - 4 {Preliminary analysis on the proteomic feature of Guillain-Barré syndrome-associated Campylobacter jejuni}; Tian XY et al.; OBJECTIVE: To search the marker proteins of Guillain-Barre syndrome (GBS)-associated Campylobacter jejuni (C . jejuni) by comparing the protein maps of GBS-associated C . jejuni strains with that of non-GBS-associated C . jejuni strains . METHODS: The whole-cell proteins of eight GBS-associated and eight non-GBS-associated C . jejuni strains were separated using the two-dimensional gel electrophoresis respectively . The differentially expressed proteins between the two sets of strains were identified by matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF-MS) after in-gel tryptic digestion . RESULTS: Twenty differentially expressed spots were found with seventeen identified ones using MSCOT database . These proteins were identified as wlaX protein and some other proteins involving in energy metabolism (malate dehydrogenase, triosephosphate isomerase, Ni/Fe-hydrogenase small chain, cysteine synthase, branched-chain amino acid aminotransferase), cell process (heat shock protein, iron-uptake ABC transport system periplasmic iron-binding protein, alkyl hydroperoxide reductase), cell envelope (flagellin, UDP-N-acetylenolpyruvoylglucosamine reductase) etc . CONCLUSION: WlaX proteins were probably associated with LPS biosynthesis or virulence of C . jejuni . WlaX protein and flagellin protein were the possible marker-proteins of GBS-associated C . jejuni strains. Biochem J, 2004 Oct 1, 383(Pt 1), 83 - 9 Characterization of N-acetylneuraminic acid synthase isoenzyme 1 from Campylobacter jejuni; Sundaram AK et al.; Escherichia coli NeuNAc (N-acetylneuraminic acid) synthase catalyses the condensation of PEP (phosphoenolpyruvate) and ManNAc (N-acetylmannosamine) to form NeuNAc and is encoded by the neuB gene . Campylobacter jejuni has three neuB genes, one of which is very similar to the E . coli neuB gene . We have characterized the C . jejuni neuraminic acid synthase with respect to acylamino sugar specificity and stereochemistry of the PEP condensation . We determined the specificity of C . jejuni NeuNAc synthase for N-acetylmannosamine, N-butanoylmannosamine, N-propionoylmannosamine and N-pentanoylmannosamine . We find that, although this enzyme exhibits similar K(m) values for N-acylmannosamine molecules with different N-acyl groups, the kcat/K(m) values decreased with increasing chain length . NeuNAc synthase is a member of a PEP-utilizing family of enzymes that form oxo acids from PEP and a monosaccharide . This family includes KDO 8-P (2-keto-3-deoxy-D-manno-octulosonate 8-phosphate) synthase and DAH 7-P (2-keto-3-deoxy-D-arabino-heptulosonate 7-phosphate) synthase . Both enzymes catalyse the condensation of the re face of the aldehyde group of the monosaccharide with the si face of the PEP molecule . The C . jejuni NeuNAc synthase catalysed the condensation of Z- and E-{3-2H}PEP with ManNAc, yielding (3S)-3-deutero-NeuNAc and (3R)-3-deutero-NeuNAc respectively . The condensation of Z-{3-F}PEP and ManNAc yielded (3S)-3-fluoro-NeuNAc . Results of our studies suggest that the C . jejuni NeuNAc synthase, similar to KDO 8-P synthase and DAH 7-P synthase, catalyses the condensation of the si face of PEP with the aldehyde sugar . The present study is the first stereochemical analysis of the reaction catalysed by a bacterial NeuNAc synthase. Pediatr Infect Dis J, 2004 Jun, 23(6), 577 - 9 Relapsing cellulitis associated with Campylobacter coli bacteremia in an agammaglobulinemic patient; Tokuda K et al.; Campylobacter coli rarely causes bacteremia or extraintestinal infection . We report herein a case of agammaglobulinemia in which cellulitis associated with C . coli bacteremia relapsed after a disease-free interval of >5 years . Pulsed field gel electrophoresis revealed that the organisms in this patient were genetically identical, suggesting a latent C . coli infection. Int J Food Microbiol, 2004 Jul 15, 94(2), 203 - 9 Genotyping of broiler-originated Campylobacter jejuni and Campylobacter coli isolates using fla typing and random amplified polymorphic DNA methods; Ertas HB et al.; Liver and intestine samples taken from 200 broilers at 20 flocks were inoculated onto Preston Enrichment broth and agar for selective isolation of Campylobacter jejuni and Campylobacter coli . The isolates were identified by both conventional and polymerase chain reaction (PCR) methods . Campylobacter spp . were identified in 102 of 400 samples (200 liver and 200 intestine), 57 (14.25%) of which were identified as C . jejuni and 45 (11.25%) as C . coli . PCR-restriction fragment length polymorphism (RFLP) of the flagellin gene (flaA) and random amplified polymorphic DNA (RAPD) typing were used to describe the heterogeneity among amplified DNA products of C . jejuni and C . coli isolates . Flagellin gene analysis by RFLP of the isolates produced seven different band profiles . On the other hand, five distinct band profiles were obtained in the examination of the isolates with RAPD assay using a random primer (OPA-11) . The results of this study demonstrated that a relatively low heterogeneity existed among C . jejuni and C . coli strains isolated from the commercial broiler flocks in eastern Turkey . In the comparison of both typing methods, fla typing provided more discrimination than the RAPD assay used. Int J Food Microbiol, 2004 Jul 15, 94(2), 169 - 74 In vitro inhibitory activity of Chinese leek extract against Campylobacter species; Lee CF et al.; Three aqueous extracts of dietary materials of Chinese leek (leek flower stem, soft leek and green leek) and two other reference extracts of Allium plants were used to investigate the antibacterial effects against Campylobacter jejuni and Campylobacter coli . All the tested strains of Campylobacter species were isolated from chickens . The minimum concentration of aqueous leek extracts (ALEs) required to inhibit the bacterial growth was 2.0 mg/ml . Among the plant extracts tested, ALEs shared the lowest value of minimum inhibitory concentration (MIC), and soft leek significantly demonstrated the strongest inhibitory activities (P < 0.05) . All the Allium plants tested shared similar characteristics of heat and pH susceptibility . Heat treatment (>75 degrees C) of the extracts reduced the inhibitory activity . The boiled ALEs revealed significant loss of inhibition (P < 0.05), but they retained some inhibitory effect . The antibacterial activities of the ALEs were stable between pH 2.0 and 8.0, while the effects were significantly decreased (P < 0.05) when pH of the ALEs were adjusted to 1.0 or 9.0 above . The results indicated that the antibacterial activities of the ALEs against Campylobacter species were more effective than that of aqueous garlic extract. J Toxicol Environ Health A, 2004 Apr 23-May 28, 67(8-10), 667 - 85 Discerning strain effects in microbial dose-response data; Coleman ME et al.; In order to estimate the risk or probability of adverse events in risk assessment, it is necessary to identify the important variables that contribute to the risk and provide descriptions of distributions of these variables for well-defined populations . One component of modeling dose response that can create uncertainty is the inherent genetic variability among pathogenic bacteria . For many microbial risk assessments, the "default" assumption used for dose response does not account for strain or serotype variability in pathogenicity and virulence, other than perhaps, recognizing the existence of avirulent strains . However, an examination of data sets from human clinical trials in which Salmonella spp . and Campylobacter jejuni strains were administered reveals significant strain differences . This article discusses the evidence for strain variability and concludes that more biologically based alternatives are necessary to replace the default assumptions commonly used in microbial risk assessment, specifically regarding strain variability. Berl Munch Tierarztl Wochenschr, 2004 May-Jun, 117(5-6), 207 - 13 {Dose-response-models and their implications for quantitative risk assessment for Campylobacter infections}; Stellbrink E et al.; For some time now there have been several projects dealing with the assessment of campylobacteriosis risks for consumers . Dose-response relationships form a crucial part of such assessments, as they specify disease probabilities depending on different microbial concentrations in foods . Evaluation of such models, however, is difficult because of problems to find data on which reliable assumptions could be based . Ongoing risk analyses for Campylobacter mainly refer to a single administration study with human volunteers published by Black et al . (1988) . However, whether results from this study can be transferred to target populations envisaged in risk assessments remains questionable for several reasons . In this paper some alternative dose-response models, their fit to the data of Black et al., and risk estimates resulting in a fictitious scenario are discussed and compared . Depending on the dose-response model assumed risk estimates can differ remarkably . Therefore it is hardly possible to make reliable quantifications of risks in reality, however, it can be determined how much they may vary assuming different scenarios. J Appl Microbiol, 2004, 97(1), 141 - 8 Characterization of erythromycin resistance in Campylobacter coli and Campylobacter jejuni isolated from pig offal in New Zealand; Harrow SA et al.; AIMS: To determine the level and mechanism(s) of antimicrobial resistance in Campylobacter isolates obtained from human and environmental sources from South Canterbury, New Zealand . METHODS AND RESULTS: A total of 251 Campylobacter isolates were tested for susceptibility to ciprofloxacin, erythromycin, nalidixic acid and tetracycline using disc diffusion assays . Five pig offal isolates were observed to be highly erythromycin resistant, with minimal inhibitory concentrations determined to be >/=256 microg ml(-1) . Nucleotide sequencing of the 23S ribosomal DNA (rDNA) in these resistant isolates identified an A --> G change at Escherichia coli position 2059 that has been previously implicated in erythromycin resistance in Campylobacter coli . Macrorestriction profiling using pulsed-field gel electrophoresis showed these isolates were nonclonal . CONCLUSIONS: The majority of Campylobacter isolates from South Canterbury remain sensitive to the most clinically relevant antimicrobial agents . Our results support other reports showing that specific variations in the 23S rDNA contribute to erythromycin resistance . SIGNIFICANCE AND IMPACTS OF THE STUDY: This study defines the baseline frequency of antimicrobial resistance associated with Campylobacter isolates from South Canterbury, and discusses the likely molecular mechanisms conferring erythromycin resistance in this organism . Resistance to erythromycin in these isolates is not linked to a dominant Campylobacter clone and has likely arisen independently in different genetic lines exposed to selective antimicrobial pressure. J Appl Microbiol, 2004, 97(1), 134 - 40 Evidence for natural horizontal transfer of tetO gene between Campylobacter jejuni strains in chickens; Avrain L et al.; AIMS: The transfer of tetO gene conferring resistance to tetracycline was studied between Campylobacter jejuni strains, in the digestive tract of chickens . METHODS AND RESULTS: In vitro conjugation experiments were first performed in order to select donor/recipient couples for further in vivo assay . Then, chickens were inoculated with a donor/recipient couple of C . jejuni strains displaying spontaneous in vitro tetracycline resistance gene transfer . The donor was a tetracycline-resistant ampicillin-susceptible strain, and the recipient was a tetracycline-susceptible ampicillin-resistant strain . Chicken droppings were streaked on antimicrobial selective media and bi-resistant Campylobacter isolates were further characterized according to their donor or recipient flaA gene RFLP profile . The acquisition of tetracycline-resistance gene by the recipient C . jejuni strain from the donor C . jejuni strain was confirmed by tetO PCR . CONCLUSIONS: The study showed that transfer of tetO gene occurs rapidly and without antimicrobial selection pressure between C . jejuni strains in the digestive tract of chickens . SIGNIFICANCE AND IMPACT OF THE STUDY: The rapid and spontaneous transfer of tetO gene may explain the high prevalence of tetracycline resistance in chicken Campylobacter strains. Tijdschr Diergeneeskd, 2004 May 15, 129(10), 332 - 5 {Campylobacter and Salmonella control in chickens and the role of fermented food}; Heres L; Salmonella and Campylobacter are undesirable pathogens on poultry . Therefore the effect of fermented feed on the colonization in the gastro-intestinal tract of the chicken, the introduction of both bacteria in a chicken flocks, and the transmission between chickens was studied . Broilers that were fed with fermented feed were significantly less susceptible for Salmonella and Campylobacter than chickens on a standard chicken feed . The spread of Salmonella between broiler chickens was reduced . However, the results also showed, like for other known control measures, that this feed can not absolutely guarantee the absence of Salmonella and Campylobacter . Therefore fermented feed must be seen as one of the hurdles in a so called multiple hurdle strategy . The combination of different hurdles should prevent the introduction and transmission . The effect of fermented feed on Campylobacter and Salmonella is partially caused by the presence of high concentrations of organic acids . In chickens fed with liquid feed the acidic barrier in the first part of the GI-tract was clearly improved . Besides organic acids there are other changes in the GI-tract . Changes in colonization levels of indicator organisms, changes in levels of organic acids and an increased pH in ileum and ceacum . These changes indicate a stabilised GI-flora in fermented feed fed poultry . The research confirmed that by changes in the composition of the feed (carbohydrates, acids, or micro-organisms) the GI-health can be promoted and therewith can contribute to the control of food pathogens in farmed animals. Semin Pediatr Infect Dis, 2004 Apr, 15(2), 78 - 85 Antimicrobial use in agriculture: controlling the transfer of antimicrobial resistance to humans; Angulo FJ et al.; Salmonella and Campylobacter infections occur commonly in children . Some of these infections are severe, requiring treatment with antimicrobial agents . Many classes of antimicrobial agents that are used in humans also are used in food animals for growth promotion, disease prevention, and therapy . The use of such antimicrobial agents in food animals increases the likelihood that human bacterial pathogens that have food animal reservoirs, such as Salmonella or Campylobacter, will develop cross-resistance to drugs approved for use in human medicine . Resistance determinants also may be transmitted from food animals to humans through the food supply with bacteria that usually are commensal, such as Escherichia coli and enterococci . Clinicians should be aware that antimicrobial resistance is increasing in food-borne pathogens and that patients who are taking antimicrobial agents for any reason are at increased risk for acquiring antimicrobial-resistant food-borne infections . Several European countries have demonstrated that restricting the use of antimicrobial agents in food animals can be followed by a decrease in antimicrobial resistance in humans without compromising animal health or significantly increasing the cost of production . Appropriate use of antimicrobial agents in humans and food animals is an important factor in maintaining their effectiveness. Semin Pediatr Infect Dis, 2004 Apr, 15(2), 71 - 7 Antimicrobial resistance among enteric pathogens; Pickering LK; Diarrhea is a major cause of morbidity and mortality in infants and children worldwide . Use of antimicrobial therapy in children with bacterial diarrhea involves consideration of advantages and limitations of use of appropriate agents in the general population and in specific hosts . Antimicrobial agents for bacterial diarrhea should be prescribed with an appreciation of limitations including antimicrobial resistance . Studies from many countries have reported resistance to Campylobacter jejuni, Campylobacter coli, Shigella species, Salmonella species, and shiga toxin producing Escherichia coli . In many geographic areas of the world including the United States, resistance patterns have demonstrated a consistent increase over the course of time, with resistance occurring to several classes of antimicrobial agents . Resistance patterns are influenced by geographic location, year isolates were obtained, classes of antimicrobial agents, pressure exerted by antimicrobial use, and source of the isolate . Because antimicrobial resistance among enteric pathogens is a common finding, has increased over time, and varies by geographic location, constant monitoring of susceptibility patterns is necessary for selection of appropriate antimicrobial agents for therapy when indicated. Microbiology, 2004 Jun, 150(Pt 6), 1957 - 64 The Campylobacter jejuni general glycosylation system is important for attachment to human epithelial cells and in the colonization of chicks; Karlyshev AV et al.; It has recently been shown that the enteropathogen Campylobacter jejuni has an N-linked general protein glycosylation pathway (Pgl) that modifies many of the organism's proteins . To determine the role of the N-linked general glycosylation in C jejuni, the authors studied the pglH gene, which shows high similarity to a family of sugar transferases . pglH mutants were constructed in strains 81116 and 11168H . Both mutants were shown to be deficient in their ability to glycosylate a number of C . jejuni proteins, but their lipooligosaccharide and capsule were unaffected . The pglH mutants had significantly reduced ability to adhere to and invade human epithelial Caco-2 cells . Additionally, the 81116 pglH mutant was severely affected in its ability to colonize chicks . These results suggest that glycosylation is important for the attachment of C . jejuni to human and chicken host cells and imply a role for glycoproteins in the pathogenesis of C . jejuni. J Clin Microbiol, 2004 Jun, 42(6), 2836 - 9 Identification of Campylobacter jejuni multilocus sequence type ST-21 clonal complex by single-nucleotide polymorphism analysis; Best EL et al.; Conserved single-nucleotide polymorphisms (SNPs) which characterize the allelic profile of the major epidemiological lineage ST-21 were identified from the alleles within the current Campylobacter jejuni multilocus sequence typing (MLST) database . Allelic discrimination assays were designed for the detection of SNPs, enabling rapid strain profiling for clonal complex ST-21 . This method is suitable for epidemiological investigations and is complementary to full MLST. J Clin Microbiol, 2004 Jun, 42(6), 2668 - 74 Etiology of sporadic cases of pediatric acute gastroenteritis in asturias, Spain, and genotyping and characterization of norovirus strains involved; Boga JA et al.; From November 2000 to October 2001, a reverse transcription-PCR using primers directed to the norovirus RNA polymerase coding region was included in a viral and bacterial routine screening to diagnose sporadic cases of acute gastroenteritis among children in Asturias, Spain . The role of noroviruses (8.6% of the positively diagnosed cases) as the cause of sporadic pediatric gastroenteritis was evaluated with respect to the detection rates of other gastroenteritis-associated viruses and bacteria . The results indicated that noroviruses were less common than rotaviruses (36.9%), Campylobacter spp . (28.8%), and Salmonella spp . (18.4%) but more frequent than astroviruses (4.3%), adenoviruses (3.8%), and Yersinia spp . (2.2%) . Mixed infections involving noroviruses were rarely observed (0.5%) . The presence of a norovirus-associated pediatric gastroenteritis peak in summer, as well as the complete absence of norovirus-associated cases in colder months, challenges the view that norovirus infections exclusively have wintertime seasonality . On the other hand, phylogenetic analysis of the amplified fragments showed that the norovirus strains responsible were closely related . A further study using the full-length capsid region showed that these strains could be included into genogroup II, Bristol/Lorsdale cluster, and were closely related to the 1995 and 1996 U.S . subset of strains associated with outbreaks recorded worldwide between 1995 and 1996. Appl Environ Microbiol, 2004 Jun, 70(6), 3588 - 92 Enrichment followed by quantitative PCR both for rapid detection and as a tool for quantitative risk assessment of food-borne thermotolerant campylobacters; Josefsen MH et al.; As part of a large international project for standardization of PCR (Food-PCR; a multiplex, multiplatform, ready-to-go enrichment followed by a real-time PCR method, including an internal amplification control, was developed for detection of food-borne thermotolerant campylobacters in chickens . Chicken rinse samples were enriched in Bolton broth for 20 h, a simple and rapid (1-h) resin-based DNA extraction was performed, and DNA samples were then tested with two instrument platforms: ABI-PRISM 7700 and RotorGene 3000 . The method was validated against an International Standard Organization (ISO)-based culture method by testing low, medium, and high levels of 12 spiked and 66 unspiked, presumably naturally contaminated, chicken rinse samples . In the RotorGene, a positive PCR response was detected in 40 samples of the 66 . This was in complete agreement with the enriched ISO culture . The ABI-PRISM 7700 missed one culture-positive sample . Positive samples contained 10(2) to 10(7) CFU/ml after enrichment in Bolton broth . In the enriched samples a detection probability of 95% was obtained at levels of 1 x 10(3) and 2 x 10(3) CFU/ml in the RotorGene and ABI-PRISM, respectively . The amplification efficiency in both platforms was 90%, although the linear range of amplification of purified genomic DNA was 1.5 x 10(1) to 1 x 10(7) (R(2) = 1.00) for the RotorGene and 10(3) to 10(7) (R(2) = 0.99) for the ABI-PRISM . In RotorGene and ABI-PRISM the levels of precision of detection as determined by standard deviation (coefficients of variation) of 6-carboxyfluorescein (FAM) threshold cycle (Ct) values were 0.184 to 0.417 (0.65 to 2.57%) and 0.119 to 0.421 (0.59 to 1.82%), respectively . The results showed a correlation (R(2)) of 0.94 between the target FAM Ct values and CFU per milliliter of enriched naturally contaminated chicken samples, which indicates PCR's additional potential as a tool for quantitative risk assessment . Signal from the internal amplification control was detected in all culture-negative samples (VIC Ct: 23.1 to 28.1) . The method will be taken further and validated in an international collaborative trial with regard to standardization. J Microbiol Methods, 2004 Jul, 58(1), 39 - 48 Towards an international standard for PCR-based detection of foodborne thermotolerant campylobacters: interaction of enrichment media and pre-PCR treatment on carcass rinse samples; Josefsen MH et al.; As part of a large EU project for standardisation of polymerase chain reaction (PCR), a systematic evaluation of the interaction of enrichment media, type of DNA polymerase and pre-PCR sample treatment for a PCR detecting thermotolerant campylobacters was carried out . The growth-supporting capacity and PCR compatibility of enrichment in Preston, Mueller-Hinton and Bolton broth (blood-containing and blood-free) were evaluated . The effect of resin-based DNA extraction and DNA extraction by boiling on the final PCR assay was investigated . The time-course studies indicated that a 20-h sample enrichment in blood-containing Bolton broth, followed by a simple resin-based extraction of DNA and a PCR amplification using Tth polymerase, resulted in strong and clear PCR amplicons for target (287 bp) and internal amplification control (IAC, 124 bp) . The enrichment PCR-based method, tested on 68 presumably naturally contaminated poultry-rinse samples, showed a diagnostic sensitivity of 97.5% (39 PCR-positive/40 total positive samples) and a diagnostic specificity of 100% (28 PCR-negative/28 total negative samples; P=0.32) when compared to a standard bacteriological method (ISO 10272) . Ann Acad Med Singapore, 2004 May, 33(3), 385 - 8 A case of right loin pain: septic ovarian vein thrombosis due to Campylobacter fetus bacteraemia; Teh HS et al.; INTRODUCTION: Septic ovarian venous thrombosis is an uncommon condition . Diagnosis is often not immediately apparent clinically and there are many that mimic this condition . We described an unusual case of septic ovarian vein thrombosis associated with Campylobacter fetus (C . fetus) bacteraemia . CLINICAL PICTURE: A 46-year-old female presented with fever and acute right loin pain . Right ovarian venous thrombosis was demonstrated on sonography and confirmed with computed tomography and magnetic resonance imaging . C . fetus was isolated from the blood . TREATMENT AND OUTCOME: The patient was given antibiotics and anticoagulation therapy with good response . CONCLUSION: Septic ovarian vein thrombosis should be considered as a differential diagnosis in female patients presenting with fever associated with lower abdominal pain . C . fetus bacteraemia also predisposes to thrombophlebitis, including septic ovarian vein thrombosis . When they are diagnosed in a timely manner and treated appropriately, the response is good and potential serious complications, including thromboembolism, and death could be averted . Radiological imaging is useful in the diagnostic work-up of this condition. Vet Microbiol, 2004 Jun 21, 101(2), 91 - 9 Prevalence and antimicrobial resistance of Campylobacter coli isolated from fattening pigs in France; Payot S et al.; Campylobacter are a leading cause of human diarrhea . The usual source of infection is contaminated food, particularly poultry but pork has also been described . The veterinary use of antimicrobial drugs has been suggested to be largely responsible for resistance in human isolates of this zoonotic pathogen . A study was carried out to investigate the occurrence and antimicrobial resistance of Campylobacter isolated from French fattening pigs . From March 1998 to June 1999, stomach samples were collected at slaughter from 240 fattening pigs originating from 24 different farms . Half of the pigs were found to be positive for Campylobacter but considerable variation was observed between farms . Isolates all belong to the Campylobacter coli species . Susceptibilities of the strains were determined for five antimicrobial drugs using agar dilution . Resistance to tetracycline and erythromycin was high (79 and 55%, respectively) . For nalidixic acid, enrofloxacin and ampicillin, resistance was observed in 34, 15 and 20% of the isolates, respectively . More than one-third of the strains was resistant to at least three antimicrobial drugs . A Thr86Ile modification in GyrA was observed in the enrofloxacin-resistant strains studied . The multiresistant strains analyzed expressed the multidrug transporter CmeB at a high level . Results indicated a high prevalence of C . coli in the stomach of the French pigs examined . In addition, a high proportion of the strains was resistant to antimicrobial drugs, particularly to tetracycline and erythromycin, or were multiresistant . Vet Microbiol, 2004 Jun 21, 101(2), 75 - 82 Correlation between invasion of Caco-2 eukaryotic cells and colonization ability in the chick gut in Campylobacter jejuni; Hanel I et al.; In an in vitro cell culture model using Caco-2 cells the adhesion and invasion properties of 11 Campylobacter (C.) jejuni isolates of different origin were studied . Additionally, we investigated the colonization ability of the strains in a chick model . Virtually, all C . jejuni showed cell adherence in the in vitro assay, but there were large differences in the invasion frequencies among the Campylobacter isolates . The colonization ability in the chick gut also differed markedly and enabled the formation of three groups: non-colonizing, weak or delayed colonization and strong colonization ability . On this occasion, we found a putative correlation between invasion of Caco-2 cells and colonization in the chick gut . Non-colonizers are not invasive or only have small invasion indexes . Strains which colonize weakly or exhibit delayed colonization have a medium invasion index and strong colonizers show markedly higher values of this parameter . The characterization of the flagellin gene of the used C . jejuni strains resulted in eight flaA types . There was no association between flaA type and invasion or colonization ability in the chick gut . Water Res, 2004 May, 38(10), 2589 - 95 The occurrence of campylobacters in water sources in South Africa; Diergaardt SM et al.; Campylobacter spp., mainly C . jejuni and C . coli, are recognized as significant human bacterial pathogens, being responsible for increasing numbers of gastroenteritis cases worldwide . Several reports have indicated that environmental waters are potential reservoirs and transmitting vehicles for these bacteria . The purpose of this study was thus to examine the occurrence of campylobacters in drinking and environmental water sources of South Africa, a country with a warmer climate and higher microbial pollution levels than those previously addressed in the Northern Hemisphere where similar investigations have been undertaken . Various types of water samples (five drinking water, four ground water, 11 surface water and four raw sewage) were collected from different parts of South Africa . Detection was by enrichment in Bolton broth prior to plating on both selective mCCDA or through a 0.6microm membrane filter on non-selective blood agar isolation media . Out of 100 initially selected Campylobacter-like isolates, only 22 did not grow aerobically and were subsequently identified as Campylobacter spp . by biochemical tests . However, the results obtained by 16S rRNA sequence analysis indicated that only three of these strains (13.6%) were Campylobacter jejuni and the remaining 19 strains were identified as Arcobacter butzleri . The spread of Arcobacter via water warrants further investigation, especially in view of the higher levels of detection and pathogenic nature of these bacteria. FEMS Microbiol Lett, 2004 Jun 1, 235(1), 57 - 63 Identification of an oxidative stress-sensitive protein from Campylobacter jejuni, homologous to rubredoxin oxidoreductase/rubrerythrin; Yamasaki M et al.; An oxidative stress-sensitive protein was found in the microaerophile Campylobacter jejuni . A novel 27-kDa protein was found to decrease concomitantly with a decrease in viability from either exogenous H(2)O(2) stress or endogenous oxidative stresses in aerobic conditions . Sequence analyses revealed that the 27-kDa protein was identical to Cj0012c in C . jejuni NCTC11168 and its deduced 215 amino acid sequence has similarity to two non-heme iron proteins found in other bacteria, rubredoxin oxidoreductase (Rbo) and rubrerythrin (Rbr) . Thus, we designated the protein as Rrc (Rbo/Rbr-like protein of C . jejuni) . In H(2)O(2)-treated cells, Western blot analysis showed some bands smaller than Rrc, and RT-PCR showed similar expression of Rrc mRNA to the control without treatment, suggesting that the sensitive response of Rrc to oxidative stress is due to degradation of the protein. N Z Med J . 2004 May 21;117(1194):U893. Lack of association between long-term illness and infectious intestinal disease in New Zealand; Lake R et al.; AIMS: To investigate whether the increase in notified cases of infectious intestinal disease in New Zealand from 1988 to 2001 has resulted in a concurrent increase in associated secondary illness cases . METHODS: National surveillance system data were compared to hospital discharge data . RESULTS: No statistically significant correlation between the number of cases of campylobacteriosis and Guillain-Barre syndrome (GBS) was found . There was no statistically significant correlation between the number of cases of campylobacteriosis, salmonellosis, shigellosis, and any of the categories of reactive arthritis; apart from two correlations with campylobacteriosis: with arthropathy associated with Reiter's disease and nonspecific urethritis (Pearson correlation R2=0.69; p<0.02) and unspecified infective arthritis (Pearson correlation R2=0.75; p<0.008) . The later category is likely to include cases of both infective and non-infective aetiology . CONCLUSION: In New Zealand, infectious intestinal diseases are not making a significant contribution to the burden of hospitalisation for reactive arthritis or GBS. Eur J Oral Sci, 2004 Jun, 112(3), 216 - 23 Gene expression signatures in chronic and aggressive periodontitis: a pilot study; Papapanou PN et al.; This pilot study examined gene expression signatures in pathological gingival tissues of subjects with chronic or aggressive periodontitis, and explored whether new subclasses of periodontitis can be identified based on gene expression profiles . A total of 14 patients, seven with chronic and seven with aggressive periodontitis, were examined with respect to clinical periodontal status, composition of subgingival bacterial plaque assessed by checkerboard hybridizations, and levels of serum IgG antibodies to periodontal bacteria assayed by checkerboard immunoblotting . In addition, at least two pathological pockets/patient were biopsied, processed for RNA extraction, amplification and labeling, and used to study gene expression using Affymetrix U-133 A arrays . Based on a total of 35 microarrays, no significantly different gene expression profiles appeared to emerge between chronic and aggressive periodontitis . However, a de novo grouping of the 14 subjects into two fairly robust clusters was possible based on similarities in gene expression . These two groups had similar clinical periodontal status and subgingival bacterial profiles, but differed significantly with respect to serum IgG levels against the important periodontal pathogens Porphyromonas gingivalis, Tannerella forsythensis and Campylobacter rectus . These early data point to the usefulness of gene expression profiling techniques in the identification of subclasses of periodontitis with common pathobiology. Intern Med J, 2004 May, 34(5), 250 - 8 Sensitivity and specificity of serology in determining recent acute Campylobacter infection; Taylor BV et al.; BACKGROUND: The measurement of serum antibodies to Campylobacter spp . has been used to investigate links between prior Campylobacter infections and the development of Guillain-Barre syndrome and its variants . Little is known of the serum antibody response to acute infections in the short- or long-term . AIMS: The aims of the present study were to investigate the normal serum response to an acute Campylobacter infection and the sensitivity and specificity of anti-Campylobacter antibodies in determining recent Campylobacter infection . METHODS: An enzyme-linked immunosorbent assay (ELISA) method was used to measure serum anti-Campylobacter immunoglobulin G (IgG), IgA and IgM antibodies . Controls consisted of 420 blood donors without recent gastroenteritis, 25 patients with other gastrointestinal infections, 24 patients with neurological conditions not affecting the peripheral nerves and 19 patients with autoimmune disorders . Three patient groups were assessed: 99 patients with acute Campylobacter infections, all of whom were tested 3 weeks post-infection; 69 of these patients tested 3-6 months later; and 74 additional patients tested >20 months post-infection . Western blot analysis was performed on controls and patients with high titre anti-Campylobacter antibodies to assess for cross-reactivity and specificity . RESULTS: Following acute infections, all antibody classes rose in the majority of but not in all patients, followed by decreasing titres that did not return to baseline levels . Sixteen per cent of enteritis cases did not demonstrate a rise in titres and 9% of cases had significant levels of antibodies >20 months post-infection . The ELISA used was shown to be highly specific for the detection of Campylobacter antibodies . CONCLUSION: The use of Campylobacter-specific antibody levels as the sole marker of prior infection is an unreliable method of determining the association between Campylobacter infection and neurological disease. J Food Prot, 2004 May, 67(5), 980 - 92 Public health consequences of macrolide use in food animals: a deterministic risk assessment; Hurd HS et al.; The potential impact on human health from antibiotic-resistant bacteria selected by use of antibiotics in food animals has resulted in many reports and recommended actions . The U.S . Food and Drug Administration Center for Veterinary Medicine has issued Guidance Document 152, which advises veterinary drug sponsors of one potential process for conducting a qualitative risk assessment of drug use in food animals . Using this guideline, we developed a deterministic model to assess the risk from two macrolide antibiotics, tylosin and tilmicosin . The scope of modeling included all label claim uses of both macrolides in poultry, swine, and beef cattle . The Guidance Document was followed to define the hazard, which is illness (i) caused by foodborne bacteria with a resistance determinant, (ii) attributed to a specified animal-derived meat commodity, and (iii) treated with a human use drug of the same class . Risk was defined as the probability of this hazard combined with the consequence of treatment failure due to resistant Campylobacter spp . or Enterococcus faecium . A binomial event model was applied to estimate the annual risk for the U.S . general population . Parameters were derived from industry drug use surveys, scientific literature, medical guidelines, and government documents . This unique farm-to-patient risk assessment demonstrated that use of tylosin and tilmicosin in food animals presents a very low risk of human treatment failure, with an approximate annual probability of less than 1 in 10 million Campylobacter-derived and approximately 1 in 3 billion E . faecium-derived risk. J Food Prot, 2004 May, 67(5), 901 - 7 Serological methods and selective agars to enumerate Campylobacter from broiler carcasses: data from inter- and intralaboratory analyses; Siragusa GR et al.; Routine analytical means to estimate Campylobacter numbers per milliliter of carcass rinses are needed in high-sample-throughput poultry laboratories . We compared three serological confirmatory tests that were amenable to such a setting when used in conjunction with Campy-Line and Campy-Cefex Campylobacter selective agars . Pre- and post-chlorinated chiller carcass rinse samples were obtained and held on ice, then analyzed 24 h later in two separate laboratories . Presumptive counts on both pre- and postchiller samples from between laboratories on individual agars and between both agars were highly correlated . Agreement among the three serological tests was nearly complete . The use of a premeasured and dried latex anti-Campylobacter antibody agglutination test format was superior to that of either a liquid latex agglutination format or a direct phosphate-buffer microscopic technique in terms of practicality as was the inclusion of an unarmed latex control to detect auto agglutination . A routine procedure for Campylobacter level estimation was suggested . This procedure, when used in conjunction with a serological confirmatory step, should provide processors with a means to assess reductions in numbers per milliliter of carcass rinses versus strictly presence-absence testing. J Med Microbiol, 2004 Jun, 53(Pt 6), 483 - 93 Characterization of a haemolytic phospholipase A(2) activity in clinical isolates of Campylobacter concisus; Istivan TS et al.; A membrane-bound, haemolytic phospholipase A(2) (PLA(2)) activity was detected in clinical strains of Campylobacter concisus isolated from children with gastroenteritis . The clinical strains were assigned into two molecular groups (genomospecies) based on PCR amplification of their 23S rDNA . This calcium-dependent, heat-stable, haemolytic PLA(2) activity was detected in strains from both genomospecies . A crude haemolysin extract (CHE) was initially prepared from cellular outer-membrane proteins of these isolates and was further fractionated by ultrafiltration . The haemolytic activity of the extracted fraction (R30) was retained by ultrafiltration using a 30 kDa molecular mass cut-off filter, and was designated haemolysin extract (HE) . Both CHE and HE had PLA(2) activity and caused stable vacuolating and cytolytic effects on Chinese hamster ovary cells in tissue culture . Primers for the conserved region of pldA gene (phospholipase A gene) from Campylobacter coli amplified a gene region of 460 bp in all tested isolates, confirming the presence of a homologous PLA gene sequence in C . concisus . The detection of haemolytic PLA(2) activity in C . concisus indicates the presence of a potential virulence factor in this species and supports the hypothesis that C . concisus is a possible opportunistic pathogen. J Bacteriol, 2004 Jun, 186(11), 3296 - 303 Secretion of virulence proteins from Campylobacter jejuni is dependent on a functional flagellar export apparatus; Konkel ME et al.; Campylobacter jejuni, a gram-negative motile bacterium, secretes a set of proteins termed the Campylobacter invasion antigens (Cia proteins) . The purpose of this study was to determine whether the flagellar apparatus serves as the export apparatus for the Cia proteins . Mutations were generated in five genes encoding three structural components of the flagella, the flagellar basal body (flgB and flgC), hook (flgE2), and filament (flaA and flaB) genes, as well as in genes whose products are essential for flagellar protein export (flhB and fliI) . While mutations that affected filament assembly were found to be nonmotile (Mot-) and did not secrete Cia proteins (S-), a flaA (flaB+) filament mutant was found to be nonmotile but Cia protein secretion competent (Mot-, S+) . Complementation of a flaA flaB double mutant with a shuttle plasmid harboring either the flaA or flaB gene restored Cia protein secretion, suggesting that Cia export requires at least one of the two filament proteins . Infection of INT 407 human intestinal cells with the C . jejuni mutants revealed that maximal invasion of the epithelial cells required motile bacteria that are secretion competent . Collectively, these data suggest that the C . jejuni Cia proteins are secreted from the flagellar export apparatus. Int J Oral Maxillofac Surg, 2004 Jun, 33(4), 356 - 60 Bacteremia after plate removal and tooth extraction; Rajasuo A et al.; Our aim was to investigate the occurrence of bacteremia associated with removal of a semirigid osteosynthesis plate and an adjacent third molar . Ten patients with fixed mandibular angle fracture were bacteriologically sampled from the second molar's distal gingival pocket, from the third molar's extraction socket and from the osteosynthesis plate . Blood samples from the ante-cubital vein were taken 10 times until 30 min postoperatively . Established culture, isolation and identification methods for the bacterial species were used . Bacteremia was detected in 60% of the subjects, most frequently 1.5 min after removal of the plate (20%) and 1.5 and 5 min after extraction of the tooth (20%), but also 10 min (10%) and 30 min (10%) postoperatively . 13 different bacterial species or groups were isolated, mean 2.5 +/- 1.9 per bacteremia-positive subject . The majority (85%) were anaerobes with Actinomyces, Campylobacter and Lactobacillus species predominating . In all the blood culture-positive cases the corresponding species was also recovered from one or more of the oral samples . These results show that oral surgical procedures are associated with a high frequency of longstanding anaerobic bacteremia, which could be harmful in patients at risk. Diagn Microbiol Infect Dis, 2004 May, 49(1), 71 - 4 Campylobacter infection in 682 bulgarian patients with acute enterocolitis, inflammatory bowel disease, and other chronic intestinal diseases; Boyanova L et al.; The aim of the study was to assess Campylobacter infections in 309 patients with acute enterocolitis, 272 patients with relapses of chronic enterocolitis, 70 patients with inflammatory bowel disease (involving Crohn's disease and ulcerative colitis) and 31 patients with other chronic intestinal illnesses . Isolation and identification were performed conventionally . Limited agar dilution method was used for susceptibility testing of the strains . Campylobacter species were isolated in patients with acute enterocolitis (7.8%), chronic enterocolitis (6.2%), Crohn's disease (6.2%), ulcerative colitis (3.7%), and irritable bowel syndrome (8.3%) . Hippurate-positive Campylobacter jejuni isolates accounted for 62.2% of Campylobacter strains . One tetracycline resistant Campylobacter upsaliensis isolate was detected from a girl with acute enterocolitis . Resistance rates to erythromycin (31.1%) and clarithromycin (22.2%) were high, whereas those to amoxicillin/clavulanate (4.4%), ampicillin/sulbactam (13.3%), tetracycline (24.4%) and ciprofloxacin (22.2%) were relatively low . Resistance to erythromycin and either tetracycline or ciprofloxacin was detected in 8.9% and 6.7% . The involvement of Campylobacter infection in relapses of chronic intestinal disorders and the susceptibility patterns of the strains strongly emphasize the role of Campylobacter as a cause of infection in this group of patients. J Clin Microbiol, 2004 May, 42(5), 2301 - 5 Use of the omp50 gene for identification of Campylobacter species by PCR; Dedieu L et al.; We studied the prevalence of the omp50 gene and the Omp50 protein in Campylobacter strains . Immunodetection assays and DNA-DNA hybridizations showed that most C . coli strains tested were negative and most C . jejuni and C . lari strains tested were positive . A PCR assay was developed, using the omp50 gene as a species-specific target . We propose a combination of a hippurate test and an omp50 assay to perform identification of Campylobacter species. Lett Appl Microbiol, 2004, 38(6), 505 - 9 Inactivation of Campylobacter jejuni by high hydrostatic pressure; Solomon EB et al.; AIMS: To investigate the response of Campylobacter jejuni ATCC 35919 and 35921 to high pressure processing (HPP) while suspended in microbiological media and various food systems . METHODS AND RESULTS: Campylobacter jejuni 35919 and 35921 were subjected to 10-min pressure treatments between 100 and 400 MPa at 25 degrees C suspended in Bolton broth, phosphate buffer (0.2 m, pH 7.3), ultra-high temperature (UHT) whole milk, UHT skim milk, soya milk and chicken puree . The survivability of C . jejuni was further investigated by inoculated pack studies . HPP at 300-325 MPa for 10 min at 25 degrees C was sufficient to reduce viable numbers of both strains to below detectable levels when cells were pressurized in Bolton broth or phosphate buffer . All food products examined offered a protective effect in that an additional 50-75 MPa was required to achieve similar levels of inactivation when compared with broth and buffer . Inoculated pack studies showed that the survivability of C . jejuni following pressurization improved with decreasing post-treatment storage temperature . SIGNIFICANCE AND IMPACT OF THE STUDY: These data demonstrated that HPP at levels of <or=400 MPa, can inactivate C . jejuni in both model and food systems. Aust Fam Physician, 2004 Apr, 33(4), 253 - 5 Gastrointestinal health . The role of pro- and pre-biotics in standard foods; Ried K; BACKGROUND: Diarrhoea is a common symptom of gastrointestinal illness, ranking among the 20 most frequent reasons for patient encounters in general practice in Australia . Children under 5 years of age are especially vulnerable to bacterial gastroenteritis such as infections with Campylobacter jejuni . Everyday diet, in particular the regular consumption of pro- and pre-biotics, can help with the maintenance of a healthy gastrointestinal system . OBJECTIVE: This article outlines the potential of 'everyday standard' food items such as cheese to promote healthy gastrointestinal microflora and to prevent gastrointestinal illness such as diarrhoea . DISCUSSION: Some common food items such as yoghurt, sauerkraut, garlic and cheese contain probiotics in the form of live lactic acid bacteria, and/or prebiotics in the form of fructans, a dietary fibre . Cheese contains both probiotic bacteria and the prebiotic dietary fibre inulin . The regular consumption of cheese has been associated with a reduction in the risk of Campylobacter enteritis. Scand J Rheumatol, 2004, 33(1), 55 - 7 Acute anterior uveitis in association with an outbreak of Campylobacter jejuni infection; Hannu T et al.; We report a case of acute anterior uveitis (AAU) in association with an outbreak of Campylobacter jejuni infection, with the first estimation of the incidence of AAU triggered by Campylobacter, and discuss reactive ophthalmological complications (AAU, iritis, and conjunctivitis) attributable to Campylobacter. MMWR Morb Mortal Wkly Rep, 2004 Apr 30, 53(16), 338 - 43 Preliminary FoodNet data on the incidence of infection with pathogens transmitted commonly through food--selected sites, United States, 2003; Centers for Disease Control and Prevention (CDC); In the United States, an estimated 76 million persons contract foodborne and other acute diarrheal illnesses each year . CDC's Emerging Infections Program Foodborne Diseases Active Surveillance Network (FoodNet) collects data on diseases caused by enteric pathogens transmitted commonly through food in nine U.S . sites . FoodNet quantifies and monitors the incidence of these infections by conducting active surveillance for laboratory-diagnosed illness . This report describes preliminary surveillance data for 2003 and compares them with 1996-2002 data . The data indicate substantial declines in the incidence of infections caused by Campylobacter, Cryptosporidium parvum, Escherichia coli O157, Salmonella, and Yersinia enterocolitica . These data represent progress toward meeting the 2010 national health objectives of reducing the incidence of foodborne infections (objective nos . 10.1a, 10.1b, and 10.1d) . However, increased efforts are needed to reduce further the incidence of foodborne illnesses, particularly among children. Proc Natl Acad Sci U S A, 2004 May 11, 101(19), 7409 - 14 Epub 2004 May 03. Helicobacter pylori interacts with the human single-domain trefoil protein TFF1; Clyne M et al.; Why Helicobacter pylori colonizes only gastric tissue is unknown . It is found on gastric mucus-secreting cells and in the overlying gastric mucus but not deep in gastric glands . This localization mirrors the expression of trefoil factor 1, TFF1 . We hypothesized that H . pylori interacting with TFF1 could explain the tropism of this bacteria for gastric tissue . Recombinant human TFF1 expressed in Escherichia coli was purified by affinity chromatography, ion-exchange chromatography, and gel filtration . Binding of H . pylori was assessed by using flow cytometry and the BIAcore system, which allows real-time monitoring of molecular interactions . In flow cytometry, H . pylori bound to the TFF1 dimer, but Campylobacter jejuni strains and the laboratory strain of E . coli, HB101, did not bind . When the BIAcore system was used, H . pylori bound strongly to TFF1-coated dextran chips compared with uncoated chips . Binding was inhibited by a TFF1 monoclonal antibody and by soluble TFF1 . H . pylori bound to porcine gastric mucin only if it was pretreated with TFF1 . In conclusion, H . pylori interacts avidly with the dimeric form of TFF1, and this interaction enables binding to gastric mucin, suggesting that TFF1 may act as a receptor for the organism in vivo . This interaction may underline the previously unexplained tropism of this organism for gastric tissue and its colocalization with the gastric mucin MUC5AC. Int J Antimicrob Agents, 2004 May, 23(5), 468 - 72 Relative contribution of target gene mutation and efflux to fluoroquinolone and erythromycin resistance, in French poultry and pig isolates of Campylobacter coli; Payot S et al.; Thirty-eight avian and swine French isolates of Campylobacter coli were studied for their mechanisms of co-resistance to fluoroquinolones and erythromycin . A Thr86Ile modification of GyrA, responsible for fluoroquinolone resistance, was found in all the strains . Two different levels of resistance to erythromycin (MIC of 8-16 or >/=256 mg/l) were observed . A A2075G mutation in the 23S rRNA genes was found only in the highly-resistant strains . Phe-Arg-beta-naphthylamide, an efflux pump inhibitor, potentiated erythromycin in all the strains examined but restored susceptibility only in the strains with a low-level of resistance . This suggests the involvement of efflux in intrinsic and in acquired low-level of resistance to erythromycin in C . coli. BMC Microbiol . 2004 Apr 30;4(1):19. Antimicrobial activity of copper surfaces against suspensions of Salmonella enterica and Campylobacter jejuni; Faundez G et al.; BACKGROUND: Salmonella enterica and Campylobacter jejuni are amongst the more prevalent bacterial pathogens that cause foodborne diseases . These microorganisms are common contaminants of poultry and poultry products . This study was aimed to evaluate the antibacterial activity of metallic copper surfaces on these important enteropathogens, and to determine the potential acquisition of copper by food exposed to this metal . RESULTS: The antibacterial activity of copper surfaces was evaluated overlying them with suspensions of 10(6) CFU/ml of S . enterica and C . jejuni . Bacterial counts obtained after 0, 2, 4 and 8 hours at 10 degrees C and 25 degrees C were compared with those obtained in stainless steel and a synthetic polymer as control surfaces . The results showed that when these enteropathogens were kept in contact with copper a significant antibacterial activity was noted, on the contrary when the same load of pathogen suspensions were tested over the control surfaces it was found that the bacterial counts remained unchanged or even increased with time . The potential acquisition of copper by food exposed to this surface was also evaluated . Meat exposed for one hour to a copper surface adsorbed residual copper in a time dependent manner . CONCLUSIONS: These results shows that metallic copper surfaces have an antibacterial activity against S . enterica and C . jejuni and suggest its potential application as an inhibitory agent in the various stages of the food processing operations. Br Poult Sci, 2004 Feb, 45(1), 49 - 54 Influence of bird strain on competitive exclusion of Campylobacter jejuni in young chicks; Laisney MJ et al.; 1 . Newly hatched chicks of either layer or broiler strain were treated orally at regular intervals with either homologous or heterologous gut-flora preparations from young donor birds, in an attempt to prevent subsequent colonisation with Campylobacter jejuni by 'competitive exclusion' (CE) . 2 . Donors of 3 to 10 d of age were chosen to correspond with the period in which intensively reared poultry are least likely to become colonised with Campylobacter . 3 . In two separate trials, material from donor layer hens (ISA Brown) protected male chicks of the same strain against a low (195 to 360 cfu/bird) Campylobacter challenge, but the same kind of material was ineffective when administered to chicks of a broiler strain (JA957) . 4 . Two further trials involved treatment preparations from young broilers, which failed to prevent Campylobacter colonisation of broiler chicks, even when colonisation occurred relatively slowly from a challenge of 90 to 94 cfu/bird . 5 . It was concluded that any CE effect observed was strongly dependent on bird strain. Microbiol Immunol, 2004, 48(4), 221 - 8 Infection with Campylobacter jejuni induces tyrosine-phosphorylated proteins into INT-407 cells; Biswas D et al.; The mechanisms used by Campylobacter jejuni to induce internalization into host intestinal epithelial cells have not been defined . In this study, we obtained evidence that exposure of INT-407 cells to protein kinase inhibitors results in decreased invasion of these cells by C . jejuni in a dose dependent manner . Preincubation of INT-407 cells in the presence of staurosporine, tyrphostin 46 and genistein decreased invasion of these cells by C . jejuni significantly . Moreover, C . jejuni infection of INT-407 cells induced tyrosine phosphorylation of several Triton X-100 soluble proteins with approximate molecular weights of 170, 145, 90, 60 and 55 kDa that were absent or reduced in the presence of genistein in cells after 1 hr of pretreatment . These data suggest that tyrosine protein kinase-linked pathways strongly regulate the internalization of C . jejuni into intestinal epithelial cells. J Peripher Nerv Syst, 2004 Jun, 9(2), 98 - 103 Chronic inflammatory demyelinating polyneuropathy after Campylobacter jejuni infection mimicking vasculitic mononeuritis multiplex in a diabetic; Rajabally YA et al.; Chronic inflammatory demyelinating polyneuropathy (CIDP) is a clinically heterogeneous disorder . Recent reports suggest that CIDP could be more frequent in diabetics . We report here a case of CIDP presenting as mononeuritis multiplex with accompanying cranial nerve involvement in an insulin-dependent diabetic who presented a preceding Campylobacter jejuni infection and misleading skin lesions . Treatment with intravenous immunoglobulins was successful . This case suggests that CIDP should be considered as a potential diagnosis in all diabetics with localized, acute or sub-acute onset, and multiple, or overlapping mononeuropathies. Kansenshogaku Zasshi, 2004 Jan, 78(1), 70 - 5 {Campylobacter fetus subsp . fetus sepsis: a case report and review of the literatures in Japan}; Saito S et al.; We report a 32-year-old female with eating disorder whose body weight was only 20 kg . She was admitted to the hospital with severe low nutrition, low proteinemia, liver dysfunction, hypokalemia and hypoglycemia . On the third hospital day, she had a high fever and Campylobacter fetus subsp . fetus (C . fetus) was isolated from the blood . After treatment with meropenem (1 g/day) intravenous drip injection, her condition improved . C . fetus sepsis is not common disease in Japan . A review of 37 cases of this disease in Japan revealed that the age range of adult patients was 20 to 60 years old . The male-to-female ratio was 4.6 to 1.0 . Seventy-eight percent of the patients had underlying diseases which were composed of 11 patients with liver disease, 6 patients with blood dyscrasia and some with diabetes mellitus, heart disease, other malignant tumor and collagen disease . There was no case with eating disorder . All apparent sources of infection in Japan originate from eating raw food . Gastrointestinal symptoms were observed in only 16% of the patients . Recent recommendations for the treatment of C . fetus sepsis are to use gentamicin, imipenem and meropenem . Some strains of C . fetus have resistance to erythromycin, ciprofloxacin . The mortality of this infection is 14% in Japan. Trans R Soc Trop Med Hyg, 2004 Jun, 98(6), 342 - 6 Detection of preceding Campylobacter jejuni infection by polymerase chain reaction in patients with Guillain-Barré syndrome; Sinha S et al.; Based on culture and serological evidence, a strong association between Campylobacter jejuni infection and Gullain-Barre syndrome (GBS) has been established . However, culture underestimates C . jejuni infection in GBS and the specificity of serology remains uncertain . Thus, a direct sensitive detection method for recent C . jejuni infection is required . We used the PCR technique in GBS patients to assess its role in the diagnosis of C . jejuni infection . From June 2001 to March 2003, stool specimens from 42 patients with GBS and an equal number of age- and gender-matched healthy controls were analysed for C . jejuni infection by culture and PCR . Gullain-Barre syndrome subtypes were classified by clinical and electrophysiological studies . Of the GBS patients, two (4.8%) and eight (19%) were positive by culture and PCR, respectively, and the difference was significant (P < 0.05) . None of the controls were positive for C . jejuni by culture or PCR . All C . jejuni-positive GBS patients had axonal degeneration with or without sensory involvement . The incidence of C . jejuni-associated GBS cases was more frequent during summer than winter (7/19, 36.8% vs . 1/23, 4.3%, P < 0.01) . Polymerase chain reaction appears to be a sensitive tool to detect preceding C . jejuni infection in GBS patients. Clin Infect Dis, 2004 Apr 15, 38 Suppl 3, S311 - 7 Persistent diarrhea, arthritis, and other complications of enteric infections: a pilot survey based on California FoodNet surveillance, 1998-1999; Rees JR et al.; Numerous complications of enteric infections have been described, including persistent diarrhea, reactive arthritis, and Guillain-Barre syndrome . We determined the frequency of self-reported complications of enteric infections in a pilot study in the California site of the Foodborne Diseases Active Surveillance Network . From 1 April 1998 through 31 March 1999, active surveillance identified 1454 infections in Alameda and San Francisco counties, of which 52% were Campylobacter infections, 22% were Salmonella infections, 15% were Shigella infections, 6% were Cryptosporidium infections, 2% were Escherichia coli O157:H7 infections, 2% were Yersinia infections, and 1% were Vibrio infections . We mailed surveys to 1331 eligible participants, and 571 (43%) were returned . A new health problem following infection was reported by 153 (27%) of the respondents: 12 (8%) reported new onset of joint pain and 53 (35%) reported new gastrointestinal symptoms, of whom 38 reported persistent diarrhea, including 2 who reported irritable bowel syndrome . Three respondents reported hair loss . The frequency, nature, and etiology of these complications merit further investigation. Clin Infect Dis, 2004 Apr 15, 38 Suppl 3, S285 - 96 Risk factors for sporadic Campylobacter infection in the United States: A case-control study in FoodNet sites; Friedman CR et al.; Campylobacter is a common cause of gastroenteritis in the United States . We conducted a population-based case-control study to determine risk factors for sporadic Campylobacter infection . During a 12-month study, we enrolled 1316 patients with culture-confirmed Campylobacter infections from 7 states, collecting demographic, clinical, and exposure data using a standardized questionnaire . We interviewed 1 matched control subject for each case patient . Thirteen percent of patients had traveled abroad . In multivariate analysis of persons who had not traveled, the largest population attributable fraction (PAF) of 24% was related to consumption of chicken prepared at a restaurant . The PAF for consumption of nonpoultry meat that was prepared at a restaurant was also large (21%); smaller proportions of illness were associated with other food and nonfood exposures . Efforts to reduce contamination of poultry with Campylobacter should benefit public health . Restaurants should improve food-handling practices, ensure adequate cooking of meat and poultry, and consider purchasing poultry that has been treated to reduce Campylobacter contamination. Clin Infect Dis, 2004 Apr 15, 38 Suppl 3, S279 - 84 Fluoroquinolone-resistant Campylobacter infections: eating poultry outside of the home and foreign travel are risk factors; Kassenborg HD et al.; A 12-month, population-based, case-control study of Campylobacter infections was conducted at Foodborne Disease Active Surveillance Network surveillance areas during 1998-1999 . Of 858 Campylobacter isolates tested for antimicrobial susceptibility to the fluoroquinolone ciprofloxacin, 94 (11%) were resistant . Travel outside of the United States was reported by 27 (42%) of 64 patients with fluoroquinolone-resistant Campylobacter infection and by 51 (9%) of 582 patients with fluoroquinolone-susceptible Campylobacter infection (odds ratio {OR}, 7.6; 95% confidence interval {CI}, 4.3-13.4) . When patients with domestically acquired fluoroquinolone-resistant Campylobacter infection were compared with matched healthy control subjects in a multivariate analysis, those infected were 10 times more likely to have eaten chicken or turkey cooked at a commercial establishment (18 {55%} of 33 case patients vs . 7 {21%} of 33 controls; matched OR, 10.0; 95% CI, 1.3-78) . Although travel outside of the United States was associated with fluoroquinolone-resistant Campylobacter infection, most infections among study participants were domestically acquired . This study provides additional evidence that poultry is an important source of domestically acquired fluoroquinolone-resistant Campylobacter infection . Control measures should include efforts to improve food handling in commercial establishments. Clin Infect Dis, 2004 Apr 15, 38 Suppl 3, S190 - 7 Laboratory practices for stool-specimen culture for bacterial pathogens, including Escherichia coli O157:H7, in the FoodNet sites, 1995-2000; Voetsch AC et al.; In 2000, we surveyed microbiologists in 388 clinical laboratories, which tested an estimated 339,000 stool specimens in 1999, about laboratory methods and policies for the routine testing of stool specimens for Salmonella, Shigella, Campylobacter, and Vibrio species, Yersinia entercolitica, and Escherichia coli O157:H7 . The results were compared with those of similar surveys conducted in 1995 and 1997 . Although these laboratories reported routinely testing for Salmonella, Shigella, and Campylobacter species, only 57% routinely tested for E . coli O157:H7, 50% for Y . entercolitica, and 50% for Vibrio species . The mean proportions of stool specimens that yielded these pathogens were as follows: Campylobacter, 1.3% of specimens; Salmonella, 0.9%; Shigella, 0.4%; and E . coli O157:H7, 0.3% . The proportion of laboratories that routinely tested for E . coli O157:H7 increased from 59% in 1995 to 68% in 2000; however, the proportion of stool specimens tested decreased from 53% to 46% . E . coli O157:H7 should be routinely sought in stool specimens submitted for microbiologic culture. Clin Infect Dis, 2004 Apr 15, 38 Suppl 3, S165 - 74 Epidemiology of sporadic Campylobacter infection in the United States and declining trend in incidence, FoodNet 1996-1999; Samuel MC et al.; Campylobacter species are a leading cause of foodborne illness in the United States, but few population-based data describing patterns and trends of disease are available . We summarize data on culture-confirmed cases of Campylobacter infection reported during 1996-1999 to the Foodborne Diseases Active Surveillance Network (FoodNet) system . The average annual culture-confirmed incidence was 21.9 cases/100,000 population, with substantial site variation (from 43.8 cases/100,000 population in California to 12.2 cases/100,000 population in Georgia) . The incidence among male subjects was consistently higher than that among female subjects in all age groups . The incidence trended downward over the 4 years, with incidences of 23.6, 25.2, 21.4, and 17.5 cases/100,000 population for 1996-1999, respectively--a 26% overall decrease . This trend was sharpest and most consistent in California . Overall, we estimate that ~2 million people were infected with Campylobacter in the United States each year during this time period . Although the number of Campylobacter infections appears to have decreased in the United States during 1996-1999, the disease burden remains significant, which underscores the need to better understand how the disease is transmitted. J Neuroimmunol, 2004 May, 150(1-2), 132 - 8 Functional polymorphisms in LPS receptors CD14 and TLR4 are not associated with disease susceptibility or Campylobacter jejuni infection in Guillain-Barré patients; Geleijns K et al.; Guillain-Barre syndrome (GBS) is an acute immune-mediated polyneuropathy preceded by infections . Campylobacter jejuni is the most frequent pathogen and its lipopolysaccharide (LPS) induces antibodies cross-reactive with gangliosides . In this study we assessed whether known functional polymorphisms in the LPS receptors CD14 and Toll-like receptor 4 (TLR4) are associated with an increased susceptibility for GBS or with C . jejuni serology or C . jejuni related clinical and serological features . Comparison of the genotypes of 242 GBS patients and 210 healthy subjects showed that polymorphisms in CD14 and TLR4 did not confer disease susceptibility and were not associated with C . jejuni infection. Emerg Infect Dis, 2004 Jan, 10(1), 127 - 30 Domestically acquired Campylobacter infections in Finland; Vierikko A et al.; Campylobacter jejuni isolates (n = 533) from domestic cases diagnosed in Finland during a 3-month peak period were studied . The highest rate was observed among those 70-74 years of age . Domestic C . jejuni isolates were especially frequent in the eastern districts . Six serotypes covered 61% of all C . jejuni isolates. J Appl Microbiol, 2004, 96(5), 1040 - 7 Analysis of gyrA mutations in quinolone-resistant and -susceptible Campylobacter jejuni isolates from retail poultry and human clinical isolates by non-radioactive single-strand conformation polymorphism analysis and DNA sequencing; Beckmann L et al.; AIMS: The aims of this study were to characterize the molecular variations in the quinolone resistance-determining region (QRDR) of gyrA among quinolone-resistant and -susceptible Campylobacter jejuni isolates originating from foods of animal origin and human infections and to evaluate the suitability of the single-strand conformation polymorphism (SSCP) method as a screening method for molecular characterization of fluoroquinolone resistance . METHODS AND RESULTS: Alterations in QRDR of gyrA from 182 C . jejuni isolates were determined by nonradioisotopic SSCP analysis and direct sequencing . A total of 13 types of nucleic acid sequence combinations within the QRDR of the gyrA gene resulted in 11 different SSCP patterns . All nalidixic acid resistant strains possessed nucleotide substitution at either codon Thr-86 or Asp-90 . Silent mutations were detected additionally . Thr-86 to Ile mutation was detected in all 139 ciprofloxacin resistant strains, which showed cross-resistance to nalidixic acid . CONCLUSIONS: The SSCP method is suitable for a molecular screening of quinolone resistant C . jejuni isolates and in combination with DNA sequencing suitable to detect genetic variations of the QRDR of gyrA . SIGNIFICANCE AND IMPACT OF STUDY: This study provides data of the genetic variations of the QRDR of gyrA from C . jejuni isolates of foods and human beings. Avian Dis, 2004 Jan-Mar, 48(1), 138 - 47 Relationship of Campylobacter isolated from poultry and from darkling beetles in New Zealand; Bates C et al.; Campylobacter, a foodborne pathogen closely associated with poultry, is considered to be an important agent of human gastroenteritis in New Zealand . The pathways involved in the contamination of poultry flocks remain unclear; however, many vectors, such as insects, rodents, and wild birds, have been implicated . Infestation of poultry houses by insects, particularly darkling beetles (Alphitobius diaperinus), is difficult to control . Furthermore, darkling beetles are known vectors for a variety of pathogens that include Salmonella, infectious bursal disease virus, Aspergillus, Escherichia coli, and Marek's disease virus . In this investigation, the relationship between darkling beetles and Campylobacter contamination of poultry flocks was investigated . A New Zealand breeder flock and four of its progeny broiler flocks were included in the study . Samples of beetles and of intestinal excreta of the birds were cultured for the presence of Campylobacter spp . A subset of the recovered isolates was subsequently genotyped using flaA short variable region (SVR) DNA sequence analysis . A large number of Campylobacter subtypes were isolated, indicating that Campylobacter colonization of poultry is likely to arise from a number of different reservoirs . However, a set of genetically distinct isolates were found to be common to the broiler flocks and to the beetles . This research provides data that indicates that Alphitobius diaperinus may serve as a source of Campylobacter contamination of poultry . A more thorough understanding of the relationship between beetle infestation and the Campylobacter status of poultry flocks should enable progress in further development of biosecurity control measures. Mikrobiol Z, 2003 Nov-Dec, 65(6), 49 - 58 {Oral cavity microbial coenobia in healthy children and children with chronic recurrent aphthous stomatitis}; Safronova LA et al.; Peculiarities of quantitative and qualitative composition of microbiocenosis of the oral cavity in healthy children and children with chronic aphthous recurrent stomatitis have been studied . Strains of microorganisms (n = 259) have been isolated and identified . The results obtained showed that the studied biotope is characterised by a wide spectrum of isolated microflora . The growth of microorganism association is observed in all the studied samples . The analysis of genus and species composition of microbiocenosis of the mucous membrane indicated that streptococci, neiserii, corynebacteria, enterococci, lactobacilli, epidermal staphylococci and candidas were distinguished as to isolation frequency among the isolated strains . These bacteria were isolated from oral cavity of healthy and sick children, but their quantity in 1 mm2 of sick children mucosa prevailed, except for Streptococcus salivarius, S . mitis and Lactobacillus sp.: their quantity was far less . Golden staphylococci, escherichia, klebsiella, clostridia, hemophilic rods and campylobacteria were isolated from sick children only. J Physiol Pharmacol, 2003 Dec, 54 Suppl 3, 23 - 41 Discovery by Jaworski of Helicobacter pylori and its pathogenetic role in peptic ulcer, gastritis and gastric cancer; Konturek JW; The presence of spiral-shaped micro-organisms in the human stomach was described over 100 years ago by Polish clinical researcher, Professor W . Jaworski at Cracow Jagiellonian University . Their presence was then confirmed in animals by G . Bizzazero, but was not really taken seriously until the late 1970s, when J.R . Warren, a pathologist in Perth, Australia, noted the appearance of spiral bacteria overlaying gastric mucosa, chiefly over inflamed tissue . Warren and B.J . Marshall cultured these organisms in 1982 from 11 patients with gastritis and were able to demonstrate a strong association between the presence of Helicobacter pylori (H . pylori) and the finding of inflammation in gastric biopsies . People, who did not exhibit gastritis, also did not have the organism, a finding which was confirmed in a number of studies . Originally called Campylobacter pyloridis, the name was changed to Campylobacter pylori, and then later to Helicobacter pylori (H . pylori) as specific morphologic, structural, and genetic features indicated that it should be placed in a new genus . Marshall elegantly fulfilled Koch's postulates for the role of H . pylori in antral gastritis with the self administration of H . pylori, and also showed that it could be cured by use of antibiotics and bismuth salts . Most persons who are infected with H . pylori never suffer any symptoms related to the infection; however, H . pylori causes chronic active, chronic persistent, and atrophic gastritis in adults and children . Infection with H . pylori also causes duodenal and gastric ulcers . Infected persons have a 2- to 6-fold increased risk of developing gastric cancer and mucosal-associated-lymphoid-type (MALT) lymphoma compared with their uninfected counterparts . The role of H . pylori in non-ulcer dyspepsia remains unclear . These practical aspects of H . pylori were subjects of two international symposia organized by us in 1995 and 1997 in Cracow, helping to promote research and Polish consensus regarding treatment of H . pylori infection. J Clin Microbiol, 2004 Apr, 42(4), 1648 - 51 Analysis of Helicobacter pylori genotypes and correlation with clinical outcome in Turkey; Saribasak H et al.; The predominant Helicobacter pylori strains circulating among geographic locations differ in regard to genomic structure . The association of the cagA-positive, vacA s1 genotypes with peptic ulcer disease (PUD) and gastric cancer was reported in Western countries but not in East Asian countries . Strains from Western countries predominantly possessed cagA type 2a, vacA s1a or s1b/m1a, or vacA m2a genotypes, whereas strains from East Asia possessed cagA type 1a, vacA s1c/m1b, or vacA m2b genotypes . Whether the Turkish strains possessed such genotypes was investigated and correlated with the disease outcome . Seventy-three patients from Turkey were enrolled . H . pylori was detected in 65 (89%) patients (22 with gastritis, 33 with PUD, and 10 with gastric cancer) by any of the following tests: Campylobacter-like organism test, culture, or PCR . Among the H . pylori-positive patients, presence of the cagA gene (78%) was significantly associated with PUD (P < 0.00001), gastric cancer (P < 0.001), and vacA s1a genotypes (P < 0.0001) . Multiple vacA genotypes were more prevalent in PUD and gastric cancer patients than in patients with gastritis . Restriction fragment length polymorphism analysis of the cagA gene revealed three different patterns with no significant association with clinical outcome . Turkish strains examined predominantly possessed cagA type 2a, vacA s1a/m1a, or vacA m2a genotypes, which were typical genotypes in strains from Western countries . This fact might be one of the reasons for the low prevalence of severe gastroduodenal diseases in Turkey compared to the East Asian countries. J Ayub Med Coll Abbottabad, 2003 Oct-Dec, 15(4), 34 - 6 Diagnostic efficacy of stool antigen test (HPSA), CLO test and serology for the detection of Helicobacter pylori infection; Baqai R et al.; BACKGROUND: The diagnosis of Helicobacter pylori infection was initially being made through invasive methods but now non invasive methods have been developed to make the diagnosis easier . The present study was done to evaluate the diagnostic efficacy of a two non invasive tests i.e . Helicobacter pylori Stool antigen test (HpSA) and Helicobacter pylori IgG serology with an invasive method i.e . Campylobacter like organism (CLO) gel test . METHODS: The study was conducted in the gastroenterology unit of Pakistan Medical Research Council Research Centre Karachi . Adult patients with gastroduodenal disease were selected for study and their medical history was recorded . Endoscopy was done on all patients and the antral biopsy sample was tested for H . pylori using CLO test . Serology (IgG) was done elsewhere using ELISA and titers of over 50 units were recorded as positive . HpSA was done to determine the presence of H . pylori antigen in stool . RESULTS: Out of 43 patients 34 (79%) were males and 9 (21%) females . The main presenting symptom was epigastric pain in 74% cases . Although H . pylori IgG antibody titers of over 50 were taken as positive but for this study titres of over 100 were taken as significant for comparison with other tests . CLO test was positive in 26 (60.5%) cases, H . Pylori antibody titers of over 100 IU were present in 33 (76.7%) cases and HpSA in 21 (48.8%) . Using CLO test as the gold standard the sensitivity of serology was 81% and that of HpSA 65% with a 29% and 76% specificity respectively . CONCLUSION: In our setting CLO test is still the best diagnostic test for H . Pylori detection . Both non invasive tests i.e . serology and stool HpSA are less sensitive than CLO but amongst each other both are equally sensitive. Vet Microbiol, 2004 Apr 19, 99(3-4), 259 - 67 Effect of acidified feed on susceptibility of broiler chickens to intestinal infection by Campylobacter and Salmonella; Heres L et al.; Consumption of poultry meat is associated with human Campylobacter and Salmonella infections . One way to control the presence of these bacteria in broiler flocks is to make chickens less susceptible for colonisation . Acidification of feed may be a tool to reduce the Campylobacter and Salmonella carriage in broiler chickens . In the present experiments an acidified feed with high levels of organic acid, 5.7% lactic acid and 0.7% acetic acid, was applied . In an in vitro experiment the reduction or growth of Campylobacter and Salmonella was measured after addition of 10(7)cfu of these bacteria into a conventional broiler feed, acidified feed and fermented feed, whereas the numbers of Salmonella increased in non-acidified feed . The number of Campylobacter decreased 2-3 (10)log cfu . In the acidified and fermented feed a complete reduction of Campylobacter was observed within 20 min, and a total Salmonella reduction started after 1h, and was complete after 2h . Subsequently, an in vivo experiment with 100 individually housed broiler chickens showed that chickens fed acidified feed were less susceptible to an infection with Campylobacter than were chickens fed conventional feed . The size of reduction was however limited . The susceptibility for Salmonella colonisation was not affected by acidified feed . It is concluded that the role for acidified feed in the control of Campylobacter and Salmonella is limited. J Infect, 2004 May, 48(4), 307 - 13 Health hazards posed by feral pigeons; Haag-Wackernagel D et al.; A comprehensive literature search of epidemiological studies and reports of transmissions of disease from feral pigeons to humans was performed . There were 176 documented transmissions of illness from feral pigeons to humans reported between 1941 and 2003 . Feral pigeons harbored 60 different human pathogenic organisms, but only seven were transmitted to humans . Aerosol transmission accounted for 99.4% of incidents . There was a single report of transmission of Salmonella enterica serotype Kiambu to humans from feral pigeons, and no reports of transmission of Campylobacter spp . The most commonly transmitted pathogens continue to be Chlamydophila psittaci and Cryptococcus neoformans . Although feral pigeons pose sporadic health risks to humans, the risk is very low, even for humans involved in occupations that bring them into close contact with nesting sites . In sharp contrast, the immunocompromised patient may have a nearly 1000-fold greater risk of acquiring mycotic disease from feral pigeons and their excreta than does the general population. Mol Microbiol, 2004 Apr, 52(2), 471 - 84 Identification of Campylobacter jejuni genes involved in commensal colonization of the chick gastrointestinal tract; Hendrixson DR et al.; Campylobacter jejuni is the leading cause of bacterial gastroenteritis in humans in developed countries throughout the world . This bacterium frequently promotes a commensal lifestyle in the gastrointestinal tracts of many animals including birds and consumption or handling of poultry meats is a prevalent source of C . jejuni for infection in humans . To understand how the bacterium promotes commensalism, we used signature-tagged transposon mutagenesis and identified 29 mutants representing 22 different genes of C . jejuni strain 81-176 involved in colonization of the chick gastrointestinal tract . Among the determinants identified were two adjacent genes, one encoding a methyl-accepting chemotaxis protein (MCP), presumably required for proper chemotaxis to a specific environmental component, and another gene encoding a putative cytochrome c peroxidase that may function to reduce periplasmic hydrogen peroxide stress during in vivo growth . Deletion of either gene resulted in attenuation for growth throughout the gastrointestinal tract . Further examination of 10 other putative MCPs or MCP-domain containing proteins of C . jejuni revealed one other required for wild-type levels of caecal colonization . This study represents one of the first genetic screens focusing on the bacterial requirements necessary for promoting commensalism in a vertebrate host. Vaccine, 2004 Mar 29, 22(11-12), 1379 - 89 Oral immunization of chickens with avirulent Salmonella vaccine strain carrying C . jejuni 72Dz/92 cjaA gene elicits specific humoral immune response associated with protection against challenge with wild-type Campylobacter; Wyszynska A et al.; It is well documented that poultry and poultry products are the major source of human campylobacteriosis and salmonellosis . This study examined the general efficacy of avirulent Salmonella vaccine strains expressing Campylobacter antigen as a bivalent chicken vaccine prototype . Three C . jejuni genes: cjaA (cj0982c), cjaC (cj0734c) and cjaD (cj0113) encoding highly immunogenic proteins which are conserved among different Campylobacter serotypes, were introduced into avirulent Salmonella enterica sv . Typhimurium (chi 4550 and chi 3987) strains of two different serotypes (UK-1 and SR) . The high copy number plasmid pYA3341 Asd(+) was used as a cloning vector . The constitutive expression of all analysed genes as measured by Western immunoblot technique was independent of the particular host strain . Specific rabbit anti-rCjaA antibody reacted not only with CjaA but also with other solute-binding protein (family 3), component of the ABC transport system (CjaC protein), was chosen as the protective antigen for animal experiments . Chickens orally immunized with Salmonella expressing Campylobacter cjaA gene developed serum IgG and mucosal IgA antibody responses against Campylobacter membrane proteins and Salmonella OMPs, as measured by an ELISA test . Protection experiment showed that chicken immunization with avirulent Salmonella carrying Campylobacter cjaA gene greatly reduced the ability of heterologous wild type C . jejuni strain to colonize the bird cecum. Epidemiol Infect, 2004 Apr, 132(2), 317 - 25 Association between environmental risk factors and campylobacter infections in Sweden; Nygard K et al.; Campylobacter sp . is the most common cause of acute bacterial gastroenteritis in Sweden and the incidence has been increasing . Case-control studies to identify risk factors have been conducted in several countries, but much remains unexplained . The geographical distribution of campylobacter infections varies substantially, and many environmental factors may influence the observed pattern . Geographical Information Systems (GIS) offer an opportunity to use routinely available surveillance data to explore associations between potential environmental risk factors showing a geographical pattern and disease incidence, complementing traditional approaches for investigating risk factors for disease . We investigated associations between campylobacter incidence and environmental factors related to water and livestock in Sweden . Poisson regression was used to estimate the strength of the associations . Positive associations were found between campylobacter incidence and average water-pipe length per person, ruminant density, and a negative association with the percentage of the population receiving water from a public water supply . This indicates that drinking water and contamination from livestock may be important factors in explaining sporadic human campylobacteriosis in Sweden, and that contamination occurring in the water distribution system might be more important than previously considered. Epidemiol Infect, 2004 Apr, 132(2), 211 - 21 Costs of gastroenteritis in The Netherlands; van den Brandhof WE et al.; In order to target the most important cost components of gastroenteritis in The Netherlands and to indicate which change of policy yields the largest decrease in costs, the cost of illness of gastroenteritis and the number of Disability Adjusted Life Years (DALYs) in the Dutch population in 1999 were determined . The costs of gastroenteritis were estimated using data mainly from a community-based cohort study . For calculating DALYs, data on the number of deaths due to gastroenteritis were used from Statistics Netherlands . On average, the costs for gastroenteritis were 77 Euro (euros) per case . For all patients in The Netherlands, the costs were estimated at 345 million euros (ranging between 252 and 531 million euros) . Indirect costs made up 82% of this total . An estimate of costs for patients with campylobacter, salmonella or norovirus infections was, in total, 10-17% of the costs of gastroenteritis . Gastroenteritis was associated with a loss of approximately 67,000 DALYs. Acta Microbiol Pol, 2003, 52 Suppl, 17 - 22 Emerging food pathogens and bacterial toxins; Bielecki J; Many different foodborne diseases have been described . For example, Shigella bacteria, hepatitis A virus and Norwalk virus were shown as a unwashed hands microorganisms, but pathogen Campylobacter and Escherichia coli were named as raw and undercooked meat and poultry or raw milk and untreated water born bacteria . However, two of them: Listeria monocytogenes and Yersinia enterocolitica are known as growing at refrigerator temperatures . Essential virulence determinants of Listeria monocytogenes pathogenicity are well known as a bacterial toxins . Basic molecular mechanisms of pathogenicity depending from these toxins were presented . It was shown that other bacterial toxins may act as very danger food poisoning substances . This is why elimination of pathogenic microorganisms from foods is an obvious solution in some food processes, however this approach is not practical or even desirable in many processes . Thus, risk assessment and microbial monitoring will continue to play important roles in ensuring food safety . Some technological advances have the capability of delivering detection systems that can not only monitor pathogenic microorganisms, but also entire microbial populations in the food matrix. Can J Gastroenterol, 2004 Mar, 18(3), 175 - 7 Does whipworm increase the pathogenicity of Campylobacter jejuni? A clinical correlate of an experimental observation; Shin JL et al.; Campylobacter jejuni is a leading cause of acute diarrhea worldwide, usually mild and self-limiting . No adequate hypothesis has yet been formulated to explain why in an otherwise healthy host this infection is occasionally severe . In a pig model, C jejuni has been shown to be pathogenic only in the presence of swine whipworm . A human case of life-threatening C jejuni colitis leading to toxic megacolon and acute renal failure, associated with concomitant whipworm (Trichuris suis) ova in the feces, is reported . The potential of T suis to potentiate C jejuni in humans deserves further study. Lab Chip, 2004 Apr, 4(2), 152 - 8 Epub 2004 Jan 16. Development of a multiplex microarray microsystem; Keramas G et al.; A hybrid multiplex microarray microsystem has been developed that consists of 32 individually addressable array reaction chambers, supporting the use of multichannel pipettes for addition of up to 8 samples simultaneously . Discrimination between Campylobacter jejuni and Campylobacter coli bacteria was observed in DNA samples containing Campylobacter spp., with the same specificity and sensitivity as when compared to a full-size microarray . The spinloaded multiplex microarray microsystem described provides a novel and convenient test format for simultaneous low-density microarray analysis and is universally adaptable to other DNA, protein or small molecule microarray based applications. Brain Behav Immun, 2004 May, 18(3), 238 - 45 Brain response to cecal infection with Campylobacter jejuni: analysis with Fos immunohistochemistry; Gaykema RP et al.; Infections with bacterial pathogens can induce increased anxiety-like behaviors in rodents without otherwise noticeable behavioral or physiological symptoms of sickness, as shown with the food-borne pathogen Campylobacter jejuni . This observation implicates the ability of the brain to sense, and respond to, such an infection . We tested our hypothesis that intestinal infection with the gram-negative bacterium C . jejuni leads to activation of certain brain regions that process gastro-intestinal sensory information . The induction of c-Fos protein as a marker for neuronal activation was assessed in the brains of mice inoculated orally with live C . jejuni, as compared to saline-treated controls . Upon colonization of the intestines, C . jejuni activated visceral sensory nuclei in the brainstem (the nucleus of the solitary tract and the lateral parabrachial nucleus) both one and two days after the oral challenge . In addition, increased c-Fos expression occurred in the hypothalamic paraventricular nucleus on the second day . This neural response occurred in the absence of measurable systemic immune activation, as serum levels of tumor necrosis factor-alpha, interleukin-1beta, and interleukin-6 were undetectable and/or unchanged . These findings support the notion that information about infection with C . jejuni in the gut is indeed relayed to the visceral sensory structures in the brain . The brain responses observed could contribute to changes in behavior observed after infection. Poult Sci, 2004 Mar, 83(3), 330 - 4 Effect of organic acids in drinking water for young broilers on Campylobacter infection, volatile fatty acid production, gut microflora and histological cell changes; Chaveerach P et al.; Water is a prominent vehicle for Campylobacter spread throughout a chicken flock . The aim of this study was to evaluate the effect of organic acids administered through the drinking water, as a decontamination method, on gut microflora and the development of lesions in the gastrointestinal tracts of young broilers inoculated with 2 different doses of Campylobacter . The results revealed that most of the chickens were infected with Campylobacter at the end of the experiment . The drinking water was free of Campylobacter throughout the study . No difference of volatile fatty acid levels between treatment and control groups was observed in the crop and cecal contents . In the cecal contents, the total aerobic bacteria numbers were significantly higher in the treatment groups compared with the control groups (P < 0.01 and P < 0.04, respectively) . Moreover, no damaged epithelial cells were observed in the chicken gut due to consumption of acidified drinking water . Acidified drinking water could therefore play a crucial role in a biosecurity strategy of preventing Campylobacter spread via drinking water in broiler flocks. Niger Postgrad Med J, 2003 Dec, 10(4), 211 - 5 Resistotyping of Campylobacter jejuni; Adesida SA et al.; The principal objective of typing in epidemiology is to trace a strain as it passes from one individual to another . Resistotyping is a phenotypic method that consists of testing bacterial strains against a set of arbitrarily chosen chemical agents, whereby, a resistance pattern that is characteristic of a strain is generated and, is believed to describe the isolates for epidemiological purposes . This simple typing system is described for campylobacter isolated in Lagos, Nigeria . Resistotyping was performed with twenty chemical agents incorporated into disc . The resistotyping results revealed that the twenty isolates from human and chickens belonged to 14 different resistotypes with the largest group comprising 25% of the isolates . The human strains were distinctly differentiated into eight resistotypes . All the Campylobacter Jejuni isolates were resistant to potassium chloride (A), Boric acid (B), Sodium biselenite (C), potassium dischromate (F), potassium permanganate (I) ferrous sulphate (N), magnesium sulphate (O), sodium hydrogen phosphate (P), sodium sulphate (Q), and magnesium chloride (R) . Only one strain was resistant to mercuric chloride (M) while three of the strains were sensitive to disodium orthophosphate (H), sodium azide (J), and metronidazole (T) . The method seems to be adequate for defining the relatedness of our isolates in epidemiologic situation and has proven promising for Campylobacter jejuni in our environment. J Mol Evol, 2004 Feb, 58(2), 225 - 37 Molecular evolution of hisB genes; Brilli M et al.; The sixth and eighth steps of histidine biosynthesis are catalyzed by an imidazole glycerol-phosphate (IGP) dehydratase (EC 4.2.1.19) and by a histidinol-phosphate (HOL-P) phosphatase (EC 3.1.3.15), respectively . In the enterobacteria, in Campylobacter jejuni and in Xylella/Xanthomonas the two activities are associated with a single bifunctional polypeptide encoded by hisB . On the other hand, in Archaea, Eucarya, and most Bacteria the two activities are encoded by two separate genes . In this work we report a comparative analysis of the amino acid sequence of all the available HisB proteins, which allowed us to depict a likely evolutionary pathway leading to the present-day bifunctional hisB gene . According to the model that we propose, the bifunctional hisB gene is the result of a fusion event between two independent cistrons joined by domain-shuffling . The fusion event occurred recently in evolution, very likely in the proteobacterial lineage after the separation of the gamma- and the beta-subdivisions . Data obtained in this work established that a paralogous duplication event of an ancestral DDDD phosphatase encoding gene originated both the HOL-P phosphatase moiety of the E . coli hisB gene and the gmhB gene coding for a DDDD phosphatase, which is involved in the biosynthesis of a precursor of the inner core of the outer membrane lipopolysaccharides (LPS). BMC Evol Biol . 2004 Feb 20;4(1):7. The iron-sulfur cluster assembly genes iscS and iscU of Entamoeba histolytica were acquired by horizontal gene transfer; van der Giezen M et al.; BACKGROUND: Iron-sulfur (FeS) proteins are present in all living organisms and play important roles in electron transport and metalloenzyme catalysis . The maturation of FeS proteins in eukaryotes is an essential function of mitochondria, but little is known about this process in amitochondriate eukaryotes . Here we report on the identification and analysis of two genes encoding critical FeS cluster (Isc) biosynthetic proteins from the amitochondriate human pathogen Entamoeba histolytica . RESULTS: E . histolytica IscU and IscS were found to contain all features considered essential for their biological activity, including amino acid residues involved in substrate and/or co-factor binding . The IscU protein differs significantly from other eukaryotic homologs and resembles the long type isoforms encountered in some bacteria . Phylogenetic analyses of E . histolytica IscS and IscU showed a close relationship with homologs from Helicobacter pylori and Campylobacter jejuni, to the exclusion of mitochondrial isoforms . CONCLUSIONS: The bacterial-type FeS cluster assembly genes of E . histolytica suggest their lateral acquisition from epsilon proteobacteria . This is a clear example of horizontal gene transfer (HGT) from eubacteria to unicellular eukaryotic organisms, a phenomenon known to contribute significantly to the evolution of eukaryotic genomes. Infect Immun, 2004 Apr, 72(4), 2452 - 5 A deep-rough mutant of Campylobacter jejuni 81-176 is noninvasive for intestinal epithelial cells; Kanipes MI et al.; A waaF mutant of Campylobacter jejuni 81-176 showed decreased invasion of INT407 cells in vitro and increased sensitivity to some antibiotics compared to what was seen with the wild-type strain. Infect Immun, 2004 Apr, 72(4), 2148 - 51 Normally occurring human anti-GM1 immunoglobulin M antibodies and the immune response to bacteria; Alaniz ME et al.; Anti-GM(1) antibodies of the immunoglobulin M (IgM) isotype are normal components of the antibody repertoire of adult human serum . Using a sensitive high-performance thin-layer chromatography (HPTLC) immunostaining assay, we found that these antibodies were absent in the umbilical vein and children <1 month of age but could be detected after 1 month of age . Although most of the children older than 6 months of age were positive, there were still a few negative children . The appearance of anti-GM(1) IgM antibodies showed a perfect concordance with two well-characterized antibacterial antibodies, anti-Forssman and anti-blood group A, which indicates a similar origin . We also studied IgM reactivity with lipopolysaccharides (LPSs) from gram-negative bacteria isolated from stool samples from healthy babies and from Escherichia coli HB101 in serum from individuals of different ages . We found a positive reaction with both LPSs in all the children more than 1 month of age analyzed, even in those that were negative for anti-GM(1) antibodies . Anti-GM(1) IgM antibodies were purified from adult serum by affinity chromatography and tested for the ability to bind LPSs from different bacteria . This highly specific preparation showed reactivity only with LPS from a strain of Campylobacter jejuni isolated from a patient with diarrhea . We conclude that normally occurring IgM antibodies are generated after birth, probably during the immune defense against specific bacterial strains. Ann Trop Med Parasitol, 2004 Mar, 98(2), 181 - 9 Prevalence of Helicobacter pylori infection among adult dyspeptic patients in Ethiopia; Asrat D et al.; In developing countries such as Ethiopia, where chronic gastritis and peptic-ulcer disease are the most common endoscopic findings, it is important to study the association between Helicobacter pylori infection and gastroduodenal diseases . Both invasive and non-invasive diagnostic methods were therefore used to investigate 300, consecutive, adult patients with dyspepsia, from the gastrointestinal clinic of Tikur Anbassa University Hospital, Addis Ababa . The apparent overall prevalence of H . pylori infection varied according to the detection method employed . Culture revealed H . pylori in only 69% of the patients but this pathogen appeared more common when rapid urease tests (71%), PCR-denaturating gradient gel electrophoresis (91%), histopathology (81%), silver staining (75%) or stool-antigen tests (81%) were employed . Antibodies to H . pylori were detected, both by enzyme immuno-assay (EIA) and immunoblotting, in approximately 80% of the patients, whether the antigens used were of a reference strain or from a local isolate of H . pylori . When some of the EIA-positive and EIA-negative sera were cross-absorbed with antigens of Campylobacter jejuni and re-tested by EIA, the H . pylori-positive sera remained positive and the negative sera remained negative . Dyspeptic patients in Ethiopia, like most of those previously observed elsewhere in Africa, are often infected with H . pylori . It is important that the management of these patients should not be hampered by the misinterpretation of the African epidemiology of this pathogen. Int J Food Microbiol, 2004 Apr 1, 92(1), 45 - 53 Prevalence and characteristics of Shiga toxin-producing Escherichia coli, Salmonella spp . and Campylobacter spp . isolated from slaughtered sheep in Switzerland; Zweifel C et al.; Caecum samples collected from 653 slaughtered sheep from two Swiss abattoirs were examined . The aim of this study was: (i) to determine the prevalence of Shiga toxin-producing Escherichia coli (STEC), Salmonella spp . and Campylobacter spp.; (ii) to further characterize isolated strains; and (iii) to discuss the results obtained with their relevance to food safety . The percentage of samples testing positive for STEC by a polymerase chain reaction was 29.9% . The prevalence of positive Salmonella spp . samples was 11.0% and of Campylobacter spp . 17.5% . In 55.3% of the 76 isolated non-O157 STEC strains, stx2 variants (mostly stx2d) were detected . Additional virulence factors were harbored by 55.3% of the STEC strains, 10.5% of them being eae positive, 55.3% ehxA positive and 2.6% astA positive . All isolated salmonella were identified as Salmonella enterica subsp . diarizonae serovar 61:k:1,5,(7) . Pulsed-field gel electrophoresis (PFGE) was performed for genotyping and 22 different restriction endonuclease digestion profiles were found among these strains for the different farms of origin . Of the 114 isolated Campylobacter spp . strains, 64.9% were shown to be Campylobacter jejuni and 35.1% Campylobacter coli, nine strains showed resistance against tetracycline, ciprofloxacin/nalidixic acid or streptomycin . In conclusion, sheep are a reservoir for the pathogens of latent zoonoses as non-O157 STEC, S . enterica subsp . diarizonae and Campylobacter spp . The maintenance of slaughter hygiene is consequently of crucial importance . It can be measured in daily practice by "slaughter-process-controls" and regular microbiological monitoring of carcasses . These are valuable tools for verifying slaughter hygiene according to hazard analysis critical control point principles. J Environ Health, 2004 Mar, 66(7), 34 - 40, 45 Cryptosporidiosis: a brief literature review and update regarding Cryptosporidium in feces of Canada geese (Branta canadensis); Kassa H et al.; Canada geese are increasingly abundant in Ohio, with large nesting populations throughout the state, and goose feces contaminate grassy areas and pavements in many public, commercial, and residential sites . In 1999 the authors found a high prevalence of Giardia, Campylobacter, and especially Cryptosporidium in collected feces of Canada geese . The purpose of this follow-up study was to survey known Canada geese sites in three counties in Ohio (Lucas, Ottawa, and Wood) and to determine the prevalence of sites testing positive for Cryptosporidium . The sites included golf courses, cemeteries, public parks, and health care and teaching facilities . At each of 11 sites, 12 goose feces of wet and loose appearance were collected and manually compressed into one composite sample representing that site . The samples were tested for Cryptosporidium with a sensitive monoclonal enzyme immunoassay (EIA) method . In 2000 and 2001, nine of 11 sites (81.8 percent) and nine of 10 sites (90 percent), respectively, were positive for Cryptosporidium . The species or genotypes of Cryptosporidium found in the geese feces and their potential to infect humans is unknown . A survey of the literature indicates, however, that while C . parvum (human genotype) is the main cause of cryptosporidiosis in humans, C . parvum (zoonotic genotypes), C . meleagridis (bird genotype), and C . felis (cat genotype) have occasionally been isolated from infected people . Further research is required to define the public health importance of Cryptosporidium in feces of Canada geese and other bird species. J Vet Med Sci, 2004 Feb, 66(2), 155 - 60 Acquisition of quinolone resistance and point mutation of the gyrA gene in Campylobacter jejuni isolated from broilers and in vitro-induced resistant strains; Chuma T et al.; A dramatic rise in the number of resistant Campylobacter to quinolones has been documented in human patients and domestic animals . In this study, the mechanism of acquisition of quinolone resistance was studied by detecting point mutations in the gyrA gene of Campylobacter strains obtained from broilers and strains with in vitro-induced resistance . The minimal inhibitory concentrations (MICs) of norfloxacin (NFLX) and ofloxacin (OFLX) for the strains that had no point mutation were slightly increased from the source strain (Campylobacter jejuni ATCC 33560) . The MICs of nalidixic acid (NA), NFLX, and OFLX for the strains that had the point mutation at Thr-86 were 100 or 200 microg/ml, 50 microg/ml, and 25 microg/ml, respectively . The MIC of NA for the strain that had a point mutation at Asp-90 higher than those for the strains that had the point mutation at Thr-86, but the MICs of NFLX and OFLX were relatively lower than those for the strains that had point mutation at Thr-86 . These findings suggest that the degree of antimicrobial resistance against NA, NFLX, and OFLX in the in vitro-induced C . jejuni strains was associated with the location of the point mutation in gyrA . On the other hand, a point mutation in all seven resistant strains isolated from broilers was located only at Thr-86, while the MICs of the three quinolones varied in each wild strain . This suggests that another mechanism might also be involved in the acquisition of quinolone resistance in C . jejuni wild strains. J Epidemiol Community Health, 2004 Apr, 58(4), 273 - 7 An outbreak of gastroenteritis from a non-chlorinated community water supply; Kuusi M et al.; STUDY OBJECTIVE: To determine the source and the extent of a community wide outbreak of gastroenteritis . DESIGN: A matched case-control study with postal questionnaires . Subtyping of campylobacter strains by pulsed field gel electrophoresis (PFGE) . SETTING: A rural municipality with a population of 8600 in southern Finland, August 2000 . Two thirds of the population receive non-chlorinated ground water from the municipal water supply . PARTICIPANTS: Cases were randomly selected among residents of the municipality who contacted the municipal health centre because of gastroenteritis and had illness onset between 31 July and 20 August 2000 . Community controls were identified from the population registry and matched according to sex, year of birth, and postal code . Main results: Four hundred and sixty three persons contacted the municipal health centre because of gastroenteritis . Campylobacter jejuni was isolated from stool samples of 24 persons . One hundred and thirty seven cases and 388 controls were enrolled in the case-control study . In multivariate analysis, drinking unboiled water from the municipal supply was significantly associated with illness (odds ratio 11.1, 95% confidence interval 1.4 to 90.2) . C jejuni was isolated from one tap water sample . The water isolate and all but one of the patient isolates were indistinguishable by PFGE . CONCLUSIONS: Combining epidemiological investigation with molecular subtyping methods provided strong evidence that water was the source of the outbreak . Non-chlorinated small ground water systems may be susceptible to waterborne outbreaks and constitute a risk to rural populations. J Pharmacol Exp Ther, 2004 Jul, 310(1), 116 - 25 Epub 2004 Mar 15. Involvement of capsaicin-sensitive afferent nerves and cholecystokinin 2/gastrin receptors in gastroprotection and adaptation of gastric mucosa to Helicobacter pylori-lipopolysaccharide; Brzozowski T et al.; Lipopolysaccharide (LPS) is one of the virulence factors in the Helicobacter pylori (Hp)-infected stomach, but it remains unknown whether single and prolonged pretreatment with Hp-LPS can affect the course of gastric damage induced by aspirin (ASA) . We compared the effects of Hp-LPS with those induced by LPSs isolated from intestinal Bacteroides fragilis, Yersinia enterocolitica, and Campylobacter jejuni applied for 4 days on acute ASA-induced gastric lesions in rats . The area of ASA-induced gastric lesions, gastric blood flow (GBF), expression of mRNA and protein of leptin and plasma leptin, gastrin, interleukin-1beta, and tumor necrosis factor-alpha levels were examined . Single (once) or repeated (five times) i.p . injections of Hp-LPS (1 mg/kg) or intestinal LPSs failed to produce macroscopic gastric damage and did not affect the GBF when compared with vehicle . Hp-LPS injected repeatedly suppressed the gastric acid secretion, up-regulated leptin mRNA and protein, and increased plasma leptin and gastrin levels . Hp-LPS significantly reduced the ASA-induced gastric damage and the accompanying decline in the GBF, and these effects were significantly attenuated by capsaicin denervation and selective antagonism of cholecystokinin-B (CCK2) receptors by RPR-102681 {N-(metoxy-3 phenyl) N-(N-methyl N-phenyl-carbamylmethyl) carbamoylmethyl}-3 ureido}-3 phenyl}-2 propronique} but not by loxiglumide, an antagonist of CCK1 receptors . We conclude that 1) daily application of Hp-LPS enhances gastric mucosal resistance against ASA damage due to the increase of GBF and the expression and release of leptin and gastrin exerting trophic and gastroprotective effects, and 2) this enhanced resistance to ASA damage in Hp-LPS-adapted stomach is mediated by the sensory afferents and specific CCK2/gastrin receptors. Vojnosanit Pregl, 2004 Jan-Feb, 61(1), 21 - 7 {The role of certain Campylobacter types in the etiology of enterocolitis}; Otasevic M et al.; BACKGROUND: In recent decades, medical community has increasingly been calling attention to the importance of Campylobacter as an disease-causing agent in humans . Nowadays, Campylobacter jejuni (C . jejuni) is known as the most frequent bacterial cause of diarrhea worldwide . Epidemiological differences of the infections caused by Campylobacter, present in the developed and the developing countries, are attributed to the differences of the types of virulence . Due to the specificity, and the demanding features of Campylobacter, as well as poorly equipped microbiological laboratories, campylobacteriosis is insufficiently studied in our country . This investigation aimed to determine the participation of some Campylobacter species in the etiology of diarrheal diseases in our population . METHODS: The four-years continuous monitoring of Campylobacter presence was performed in the faeces of 12,605 patients with enterocolitis . The control group included 5,774 examinees of healthy children and youth . Faeces samples were cultivated on Skirrow's selective medium, and further incubated according to effective methodology for Campylobacter . Identification of strains was based on morphological, cultural and physiologic features of strains (oxidase test, catalase test, susceptibility to nalidixic acid, and hypurate hydrolysis) . As a statistical method, for data processing, chi 2 test and Fisher's exact test were used . RESULTS: Campylobacter was proven in 3.86% of enterocolitis patients, and in 0.71% of healthy population . Out of 518 Campylobacter isolates, 86.48% belonged to enterocolitis outpatients, and 13.51% to inpatients . Predominant symptoms of the disease were diarrhea (81.83%), increased temperature (34.71%), vomiting (19.77%), and stomach pain (15.17%) . The diseased were predominantly infants in the first year of life . Out of 300 Campylobacter isolates, 75% were identified as Campylobacter jejuni, 23% as Campylobacter coli (C . coli), and 2% as Campylobacter lari (C . lari) . CONCLUSION: Species of Campylobacter genus participate in the etiology of enterocolitis at 3.86% . According to numerous parameters the infection in our population coincides with the infection in the population of European countries . Frequent findings of C . coli in our region are in discrepancy with the results of numerous studies conducted in the developed countries. J Neuroimmunol, 2004 Apr, 149(1-2), 160 - 6 Haemophilus influenzae as a possible cause of Guillain-Barré syndrome; Ju YY et al.; Recent reports have contained conflicting results on the relationship between antecedent Haemophilus influenzae infection and Guillain-Barre syndrome (GBS) . To investigate the prevalence of H . influenzae infection in GBS patients in a British population, we carried out a retrospective study with 62 consecutive GBS patients and 63 normal controls of similar age and sex . Whole bacteria of both encapsulated and nonencapsulated strains of H . influenzae were employed as antigens in an enzyme-linked immunosorbent assay (ELISA) for anti-H . influenzae IgG, IgM and IgA antibodies . Elevated antibodies of two or three classes were found in one GBS patient and none in the normal controls . Six GBS patients had IgG antibodies against nonencapsulated H . influenzae compared with only one in the normal control group (p=0.06) . Western blot for IgG antibody showed that all the sera with IgG antibodies recognized the lipopolysaccharide (LPS) of both strains of H . influenzae . Antiganglioside GM1 antibody was not associated with anti-H . influenzae antibody in our study . Absorption with encapsulated or nonencapsulated H . influenzae, Campylobacter jejuni and Escherichia coli before testing on Western blot showed that only nonencapsulated H . influenzae absorbed the anti-LPS antibodies . In conclusion, there is a possible but rare association of GBS with nonencapsulated H . influenzae in the UK. Drugs, 2004, 64(6), 597 - 610 Guillain-Barré syndrome: epidemiology, pathophysiology and management; Kuwabara S; Guillain-Barre syndrome (GBS) is clinically defined as an acute peripheral neuropathy causing limb weakness that progresses over a time period of days or, at the most, up to 4 weeks . GBS occurs throughout the world with a median annual incidence of 1.3 cases per population of 100 000, with men being more frequently affected than women . GBS is considered to be an autoimmune disease triggered by a preceding bacterial or viral infection . Campylobacter jejuni, cytomegalovirus, Epstein-Barr virus and Mycoplasma pneumoniae are commonly identified antecedent pathogens.In the acute motor axonal neuropathy (AMAN) form of GBS, the infecting organisms probably share homologous epitopes to a component of the peripheral nerves (molecular mimicry) and, therefore, the immune responses cross-react with the nerves causing axonal degeneration; the target molecules in AMAN are likely to be gangliosides GM1, GM1b, GD1a and GalNAc-GD1a expressed on the motor axolemma . In the acute inflammatory demyelinating polyneuropathy (AIDP) form, immune system reactions against target epitopes in Schwann cells or myelin result in demyelination; however, the exact target molecules in the case of AIDP have not yet been identified . AIDP is by far the most common form of GBS in Europe and North America, whereas AMAN occurs more frequently in east Asia (China and Japan).The prognosis of GBS is generally favourable, but it is a serious disease with a mortality of approximately 10% and approximately 20% of patients are left with severe disability . Treatment of GBS is subdivided into: (i) the management of severely paralysed patients with intensive care and ventilatory support; and (ii) specific immunomodulating treatments that shorten the progressive course of GBS, presumably by limiting nerve damage . High-dose intravenous immunoglobulin (IVIg) therapy and plasma exchange aid more rapid resolution of the disease . The predominant mechanisms by which IVIg therapy exerts its action appear to be a combined effect of complement inactivation, neutralisation of idiotypic antibodies, cytokine inhibition and saturation of Fc receptors on macrophages . Corticosteroids alone do not alter the outcome of GBS. Clin Diagn Lab Immunol, 2004 Mar, 11(2), 250 - 4 Rectal nitric oxide gas and stool cytokine levels during the course of infectious gastroenteritis; Enocksson A et al.; Nitric oxide (NO) is known to be an important inflammatory mediator with a potential role in gastrointestinal diseases . We prospectively studied the luminal NO levels in 51 patients with infectious gastroenteritis, 35 patients with nonenteric bacterial infections, and 11 healthy control subjects . The levels of proinflammatory cytokines were simultaneously measured in the stools of patients with gastroenteritis . Rectal gas was sampled with balloon catheters made of silicone and was analyzed for NO levels by chemiluminescence . The median rectal NO level was 2,450 ppb in the acute phase of gastroenteritis and gradually decreased to 225 ppb after 3 to 8 weeks, whereas the median NO values were 150 ppb in patients with nonenteric bacterial infections and 100 ppb in healthy control subjects . Patients with Salmonella, Shigella, and Campylobacter infections generally had more severe symptoms and a higher median NO level (17,250 ppb) than patients with Clostridium difficile-associated diarrhea (median NO value, 275 ppb) . Interleukin-1 beta levels were elevated in 82% of the patients at disease onset and decreased during the convalescent phase . In contrast, gamma interferon was detected in only 16% of the patients and was predominantly collected in stool samples collected during the subacute and convalescent stages . Our data point to the possibility of using this easy, minimally invasive method for luminal NO measurement as a diagnostic tool, among others, to evaluate the degree of intestinal inflammation in patients with infectious gastroenteritis. J Appl Microbiol, 2004, 96(4), 834 - 43 Diversities and similarities in PFGE profiles of Campylobacter jejuni isolated from migrating birds and humans; Broman T et al.; AIMS: To genetically sub-type Campylobacter jejuni strains isolated from migratory birds, and to compare these with clinical strains collected in the same area and corresponding time period, with the aim to increase our knowledge on sub-types occurring among wild birds and their possible impact on human disease . METHODS AND RESULTS: We sub-typed C . jejuni strains from migrating birds (n = 89) and humans (n = 47), using macrorestriction profiling by pulsed-field gel electrophoresis . Isolates from migrant birds often exhibited sub-types with higher levels of similarity to isolates from birds of the same species or feeding guild, than to isolates from other groups of birds . Likewise, could the vast majority of sub-types found among the migrant bird isolates not be identified among sub-types from human cases . Only two bird strains, one from a starling (Sturnus vulgaris) and one from a blackbird (Turdus merula), had sub-types that were similar to some of the human strain sub-types . CONCLUSIONS: Isolates from one bird species, or feeding guild, often exhibited high similarities, indicating a common transmission source for individuals, or an association between certain sub-types of C . jejuni and certain ecological guilds or phylogenetic groups of birds . Sub-types occurring among wild birds were in general distinctively different from those observed in patients . The two bird isolates that were similar to human strains were isolated from bird species that often live in close associations with human settlements . SIGNIFICANCE AND IMPACT OF STUDY: Wild birds have often been mentioned as a potential route for transmission of C . jejuni to humans . Our study demonstrates that strains isolated from birds most often are different from clinical strains, but that some strain similarities occur, notably in birds strongly associated with human activities.
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||