Journal of Bacteriology, March 2004, p . 1362-1373, Vol . 186, No . 5

In Silico and Transcriptional Analysis of Carbohydrate Uptake Systems of Streptomyces coelicolor A3[2]

Ralph Bertram,¹ Maximilian Schlicht,¹ Kerstin Mahr,¹ Harald Nothaft,¹ Milton H . Saier Jr.,² and Fritz Titgemeyer^1*

Lehrstuhl für Mikrobiologie, Friedrich-Alexander-Universität Erlangen-Nürnberg, 91058 Erlangen, Germany,¹ Department of Biology, University of California at San Diego, La Jolla, California 92093-0116²

Received 27 August 2003/ Accepted 21 November 2003

 
Streptomyces coelicolor is the prototype for the investigation of antibiotic-producing and differentiating actinomycetes . Assoil bacteria, streptomycetes can metabolize a wide varietyof carbon sources and are hence vested with various specificpermeases . Their activity and regulation substantially determinethe nutritional state of the cell and, therefore, influencemorphogenesis and antibiotic production . We have surveyed thegenome of S . coelicolor A3[2] to provide a thorough descriptionof the carbohydrate uptake systems . Among 81 ATP-binding cassette[ABC] permeases that are present in the genome, we found 45to encode a putative solute binding protein, an essential featurefor carbohydrate permease function . Similarity analysis allowedthe prediction of putative ABC systems for transport of cellobioseand cellotriose, -glucosides, lactose, maltose, maltodextrins,ribose, sugar alcohols, xylose, and ß-xylosides . Anovel putative bifunctional protein composed of a substratebinding and a membrane-spanning moiety is likely to account for ribose or ribonucleoside uptake . Glucose may be incorporated by a proton-driven symporter of the major facilitator superfamily while a putative sodium-dependent permease of the solute-sodium symporter family may mediate uptake of galactose and a facilitator protein of the major intrinsic protein family may internalize glycerol . Of the predicted gene clusters, reverse transcriptasePCRs showed active gene expression in 8 of 11 systems . Togetherwith the previously surveyed permeases of the phosphotransferasesystem that accounts for the uptake of fructose and N-acetylglucosamine, the genome of S . coelicolor encodes at least 53 potential carbohydrate uptake systems.

 
Streptomycetes represent a major fraction of the bacterial soil population [20] . They contribute substantially to carbon recyclingby degrading a whole variety of biopolymers that stem from deadplant and animal material [16] . These organic compounds, whichinclude xylan, chitin, and cellulose, are broken down by exoenzymes.The products are funneled into the cell by specific carbohydrateimporters that usually recognize mono- and disaccharides . Therecent publication of the genome of the model organism Streptomycescoelicolor A3[2] revealed two interesting features concerningcarbon utilization [7], that is, [i] a huge number of 172 genesencoding secreted proteins, such as hydrolases, chitinases,cellulases, lipases, nucleases, and proteases, and [ii] theoccurrence of 81 ATP-binding cassette [ABC] permeases that arepossibly used for the uptake of sugars, oligopeptides, and nucleosidesas well as for drug export [46, 56] . The numerousness of exoenzymesand ABC systems is 5- to 10-fold higher than that of other bacteria, underlining the broad metabolic capacity of streptomycetes [7].

Canonical carbohydrate-specific ABC systems in gram-positive bacteria are oligoprotein assemblies: a membrane-anchored substrate-binding protein is exposed to the outside of the cell, scavenging fora specific substrate molecule [10] [Fig . 1] . Two membrane-integralproteins usually form the transport channel, which typicallyconsists of 12 transmembrane segments . The energy for uptakeis delivered by an intracellular ATPase, which in streptomycetesis usually not encoded within the same operon [18, 39, 42].This has been demonstrated by the characterization of the msiKgene, which encodes the ATPase subunit of several ABC sugarporters.

 
Among the carbohydrate transport systems that have been characterized at the molecular level, ABC transporters have been shown to translocate maltose and maltodextrins in S . coelicolor, cellobiose, cellotriose, and trehalose in Streptomyces reticuli, cellobiose and xylobiose in Streptomyces lividans, and chitobiose and N-acetylglucosamine in Streptomyces olivaceoviridis [18, 39-43, 57, 64] . In S . coelicolor,fructose, N-acetylglucosamine, and possibly two further carbohydratesare transported by the phosphotransferase system [PTS] [29, 30, 33, 54] . A homologous PTS specific for N-acetylglucosaminewas also found in S . olivaceoviridis [61].

In this report, we provide a compilation of carbohydrate uptake systems present in S . coelicolor . In addition to the few already known transport systems, we identified new potential ones by similarity searches of the genome DNA-protein data bank with well-characterized prokaryotic and eukaryotic carbohydrate permeases. To define the possible substrate specificity, each system was evaluated by the analysis of the adjacent metabolic and regulatory genes . Newly identified genes were subjected to reverse transcriptase PCR [RT-PCR] to determine whether they are expressed or not.

 
Computer analyses and screening strategies. All data are based upon sequence comparisons made by using thefreely accessible genome data of S . coelicolor A3[2] [www.sanger.ac.uk/Projects/S_coelicolor]. Sequences were sampled and subjected to similarity searches [BLAST] at the websites of the National Center for Biotechnology Information at the National Institutes of Health, Bethesda,Md., at www.ncbi.nlm.nih.gov, and of The Wellcome Trust SangerInstitute, Hinxton, Cambridge, United Kingdom, at www.sanger.ac.uk/Projects/S_coelicolor.Default settings were used, however, without filtering low-complexityregions . Sequence alignments were conducted with CLUSTALW, applyingpredefined algorithms at www.ebi.ac.uk/clustalw of The EuropeanBioinformatics Institute at The European Molecular Biology Laboratory.Protein family signature sequences were obtained from the Instituteof Bioinformatics, Geneva, Switzerland, at www.expasy.org/prosite. Clone Manager 5 of Scientific & Educational Software, Durham,N.C., was applied to process and analyze DNA sequence data.

To detect ABC systems involved in carbohydrate import, regions adjacent to genes encoding paralogues of the well-characterizedsugar binding protein MalE of Escherichia coli and MalE of S. coelicolor were analyzed [10, 57] . In most cases, the juxtaposedgenes bore high similarity to genes encoding membrane proteinsof the ABC type and were thus considered a putative carbohydratepermease operon . The flanking genes were analyzed whether theyencode possible metabolic enzymes, regulators, or ATP bindingproteins . In the case that the gene products of such a locuscorrelated with the respective binding protein in terms of substratespecificity as determined by BLAST analysis, we considered thepermease to be the one for the particular carbohydrate . Other types of carbohydrate transport systems, which include the major facilitator superfamily [MFS], the solute-sodium symporter [SSS] family, and the major intrinsic protein [MIP] family, were selected by similarity analysis of well-characterized proteins foundin other organisms . The sequences were obtained from the recently updated transporter classification database at The Universityof California at San Diego [http://tcdb.ucsd.edu/tcdb] [9].

RT-PCR. Cells of S . coelicolor M145 A3[2] [genotype SCP1^- SCP2^-, prototroph]were grown for 12 to 18 h under static conditions and were subsequentlysubjected to 24 h of vigorous shaking at 28°C . The growthmedium was tryptic soy broth without dextrose [Difco] with orwithout 50 mM test carbon source . As an exception, cells testedfor glcP1, glcP2, and fruA expression were grown on mineralmedium with 50 mM glycerolglucose, or fructose, respectively[34].

Total RNA was prepared as described previously [30] . The One-StepRT-PCR kit [Qiagen] was used in combinations with gene-specificoligonucleotides, which were as follows [forward and reverse]:for cebE1, TTCGAGGACATGTCCAAGG and ATGAACTTGTTCCAGTCACC; forcebE2, AAGGAGATCACCGAGACC and TTGTCGTCGTAGTACTGC; for bxlE1,AAGATCGAACAGCAGATCGTCG and ACGGACGGCAGGAAGTTGTCC; for bxlE2,AGAACGACGCCTACAAGACG and ACGGCATTGCGTAGATCTTGC; for xylF, TACGAGAAGTTCGACAAGCand TTGTCGAACGAGGTGTAGG; for lacG, TTCGCCCTGGTGTTCCTCG and ATGGAGGCGAGCACCAGGTCG;for smoE, ATCAAGGTGAACTTCACC and AAGGTGTTCACGACCGTCG; for rbsH,TCCTCATCTCGTACGGGAAGCTGC and ATGGCGAGCTTCTGCCGCTTCACC; for rbsE2,ACACCTTCTGGGACATCGTCC and TCGAAGGTCTTCTCCACTCC; for rbsE3, TACTTCACCGTCGCCGACAAGGand TTGACGTACTTGCGCATGTCG . For 16S rRNA, oligonucleotides 16SrRNA1and 16SrRNA2 were used [30] . The assay mixture contained, in a 20-µl volume, 100 ng of RNA and 5 pmol of each primer.Four microliters of the reaction mixture was taken at appropriatePCR cycles [cycles 21 to 36, depending on the appearance ofsignal in the linear range], and amplification products wereseparated and visualized on a 1% agarose gel . RT-PCR experimentswithout prior reverse transcription were performed to assureexclusion of DNA contamination . The quality of the RNA preparationswas controlled by the presence of equal amounts of 16S rRNA,which is constitutively expressed . The functionality of oligonucleotideswas checked by PCR of chromosomal DNA, giving amplificationproducts of equal intensity for each pair . Data were verifiedin two independent experiments.

 
Fifty-three carbohydrate transport systems were detected inthe genome of S . coelicolor [Tables 1 and 2] . Table 1 givesan overview of gene clusters whose functions are known fromexperimental investigation, for which a possible substrate couldbe proposed based on unambiguous similarity data, or for whichhomologous systems of high similarity have been studied in otherorganisms . These 22 systems include 14 permeases of the ABCtransporter family, four PTS-specific permeases, two copies of a putative sugar porter of the MFS, one member of the SSS family, and one facilitator of the MIP family [14, 32, 33, 36, 46, 49] . In the following sections, we describe these systemsin detail . Table 2 lists 32 putative gene loci, which, however,were less well definable concerning the possible substrate.This table contains only genes for ABC-type porters . Thus, 87%of all found carbohydrate transporters in S . coelicolor appearto be ATP-driven systems.

 
ABC-type carbohydrate transporters. When we started our analysis, there was only one ABC-type carbohydratepermease, MalEFG, described for S . coelicolor that transportsmaltodextrins and maltose [44, 57] . As a first step in the identificationof further permeases, we screened the genome for the presenceof such systems that were described for other Streptomyces species[18, 39, 41, 42, 59, 64] . This led to the identification ofgenes for two potential cellobiose- and cellotriose-specificpermeases, ceb1 and ceb2, two potential ß-xyloside-specificpermeases, bxl1 and bxl2, two putative gene clusters that couldaccount for uptake of -glucosides, agl1 and agl2, and a genelocus containing genes for two adjacent ABC systems, one ofwhich has been shown to translocate N-acetylglucosamine andchitobiose [Fig . 2 and 3].

 
Cellobiose and cellotriose. BLAST searches with the ceb genes of S . reticuli revealed twosimilar gene loci, ceb1 and ceb2, within the S . coelicolor genomewith an identical gene order, cebREFGbglCshl, and 47 to 66%identical proteins [exception, Shl1 and Shl2 with 11% identity]among each other [Fig . 2A and B] [41] . Both gene clusters encodea divergently transcribed regulator, CebR of the LacI family,a sugar-binding protein, CebE, two integral membrane proteins,CebF and CebG, the ß-glucosidase BglC, and a putativesugar hydrolase, Shl . The latter gene is not part of a putativeoperon, since it is convergently positioned . The deduced proteinsshare 50 to 86% and 44 to 72% amino acid identities, respectively,to an ABC transporter for cellobiose and cellotriose encodedby the well-characterized ceb operon of S . reticuli . The S.reticuli system has been extensively characterized . Genes cebEFGare induced by cellobiose, the encoded permease is a high-affinityuptake system for cellobiose and cellotriose, and since a cebEmutation abolishes this function, this ceb operon is the onlysystem for these substrates [41] . A palindromic sequence of18 bp was found 128 bp upstream of both cebE1 and cebE2 . Thiscis element has been reported as the CebR binding site O_CebRin S . reticuli [40] . It is perfectly conserved in system one,whereas system two shares 72% DNA sequence identity.

ß-Xylosides. Two operons were found that share high similarity with the bxlgenes of S . lividans [accession no. AF043654], encoding possibleß-xyloside BxlEFG permeases of the ABC type [Fig.2C and D] . The metabolic enzyme ß-D-xylosidase, BxlA,is encoded by the adjacent downstream gene . The gene cluster bxl1 is almost identical to the S . lividans system, with 89 to 99% protein identity, whereas the bxl2 gene cluster exhibits the same gene order but is more distantly related, with protein identity values from 34 to 71% . The putative regulators BxlR1and BxlR2, encoded within these loci, belong, as in the caseof the ceb operons, to the LacI family . A common palindromicelement of low GC content [TTTCGAAA] was detected in the bxlR-bxlE intergenic regions of both systems . This sequence is situated7 bp in front of bxlE1 . The element occurs twice at positionsbp 154 and 63 upstream of bxlE2 . This sequence is also foundin the intergenic region between bxlR and bxlE of S . lividans, and at the 5' end of xylanase genes [xln] in various streptomycetes.A regulatory role has therefore been postulated [accession no. AF043654].

-Glucosides. We identified two gene clusters, agl1 and agl2, that encode potential ABC transporters for -glucosides. agl1EFG encodesa permease that bears considerable similarity [35, 38, and 46%protein identity, respectively] to AglEFG encoded by the aglEFGAKoperon of Sinorhizobium meliloti [Fig. 2E] [63] . Heterologous expression of the latter genes in Ralstonia eutrophus promoted growth on all tested -glucosides, which were sucrose, maltose,and trehalose . Thus, the agl1 locus may encode a permease witha broad specificity for -glycosidic di- and trisaccharides.No genes for a catabolic -glucosidase or a regulator were foundin the vicinity of agl1EFG . However, S . coelicolor has at leastthree -glucosidases that share about 56% identical amino acidsamong each other . aglA1 is associated with the malEFG operon[57], aglA2 is part of the agl2 gene cluster [see below], and the third one is encoded by SCH63.27.

A second gene cluster, agl2REFGAX, was found on cosmid SC8F11 [Fig . 2F] . The gene products exhibit 98 to 100% identity toaglEFGAX of S . lividans, which has been proposed to encode atransporter for an -glucoside [59] . However, the authors wereunable to determine the substrate, although this has been addressedthoroughly by assaying the purified AglA -glucosidase for 24 -glycosidic compounds [59] . The S . lividans agl cluster is regulatedby the LacI-like regulator RDR [regulator gene within the right-directedrepeat of AUD1], which is located upstream of aglE togetherwith the cis elements RIP [right imperfect palindrome] and PBS[potential binding sequence] . RDR is part of the highly amplifiable11.4-kb element AUD1 that encodes two further related regulators,LDR and MDR [regulator genes within the left- and middle-directedrepeat of AUD1] . These regulators are involved in the massiveamplification of AUD1 to more than 100 copies [59] . Hence, RDRhas a dual regulatory function in S . lividans . Since the AUD1element also precedes the agl2 gene cluster in S . coelicolor,the systems are most likely homologous and should, therefore,be subject to identical regulation.

The ngc-xyl locus. In S . olivaceoviridis, N-acetylglucosamine and N,N'-diacetylchitobiose are transported by the ABC permease NgcEFG [64] . The system has been characterized by extensive biochemical analysis of NgcE, which binds N-acetylglucosamine and other chitin-degradation products . Inactivation of the gene locus demonstrated further the specificity of NgcEFG . The S . coelicolor gene cluster with the highest similarity was found on cosmid SC7B7 [Fig . 3] . It comprises two consecutive EFG gene arrangements interrupted by a regulator gene of the ROK family [53] . The first EFG geneset shares protein identities of 31 to 48% with ngcEFG of S.olivaceoviridis and was therefore designated ngcEFG . However,the genes do not encode a functional permease for N-acetylglucosaminebecause S . coelicolor exclusively uses the PTS for the uptakeof this carbon source [29] . Thus, ngcEFG may be a good candidatefor a chitobiose transport system . The ROK regulator shows,with 94%, a >50% higher identity to NgcR of S . olivaceoviridisthan the ngcEFG-encoded products . Thus, it can be considereda true homologue concerning the physiological role . We havetentatively designated the gene rok7B7, since it is not clearyet which of the adjacent operons is controlled by the encodedprotein.

The second gene cluster includes genes whose products have similarity [34 to 47% protein identity] to the predicted xylose ABC permease XylFGH of E . coli [51] . With the same gene order as found inE . coli, the genes encode a solute-binding protein, an ATPase,and a membrane protein . Thus, in contrast to the other ABC systemsdescribed above, this permease comprises the required ATPasegene but only one membrane-integral protein . A putative chitinasegene in the opposite orientation follows downstream . xylFGHmay encode a xylose permease . S . coelicolor can readily usethis carbon source, and gene homologues for the metabolic enzymesxylose isomerase, XylA, and xylulokinase, XylB, are locatedon the overlapping cosmids 2SCG11 and SCG11A . The putative xylA[2SCG11.03c] and xylB [SCG11A.01] genes are divergently transcribed.A possible ROK family regulator gene [SCG11A.02] is situateddownstream of xylB, which could thus be involved in the regulationof xylA, xylB, and xylFGH.

ABC systems for lactose, ribose, sugar alcohols, and other carbohydrates. Further potential ABC-type porters for carbohydrates were classifiedunder the assumption that the gene locus must encode a periplasmicbinding protein [E], which is usually not found in noncarbohydrateABC-type systems . A BLASTP query yielded around 30 paraloguesof S . coelicolor MalE, which served as a sequence template ofan ABC solute binding-protein [57] . An iterative search of afar distant paralogue resulted in the nearly identical set ofproteins, presumably containing all ABC carbohydrate bindingproteins that are present in S . coelicolor . Amino acid identitiesranged from 23 to 35% . A phylogenetic tree of MalE paraloguesrevealed a high degree of radial symmetry with no remarkableclustering [data not shown] . A signature sequence of 18 aminoacids sharing the consensus pattern [GAP]-[LIVMFA]-[STAVDN]-X₄-[GSAV]-[LIVMFY]₂-Y-[ND]-X₃-[LIVMF]-X-[KNDE] could be observed with fairly good agreement in the N-terminal third of the proteins [52] . In particular, MalE and the productsof open reading frame [ORF] SCD95A.19 and ORF SC6D11.04c matchedexactly to this signature sequence.

Lactose. An assembly of genes around ORF SC6D11.04c may encode a lactose-specificABC system because the products of SC6D11.04c to SC6D11.06cexhibit 24, 29, and 31% protein identity to LacEFG of Agrobacteriumradiobacter, respectively [13, 62] [Fig . 4A] . Interestingly, the system has an unusual reversed gene order, GFE . The permeasegene cluster is flanked by a putative ß-galactosidase[SC6D11.03c] that shows 43% protein identity to the ß-galactosidaseBgaB of Bacillus stearothermophilus [15] . A probable regulator of the LacI family with an identity of 35% to LacI of E . coli was found to precede lacG and was thus designated LacI [12]. Between these two ORFs, two identical copies of a perfect 16-bp palindrome are located as possible cis regulatory elements. They are spaced by 29 bp, with the closer one positioned 38bp upstream of lacG.

 
Sugar alcohols. Sugar alcohols are reduced forms of aldoses or ketoses . Whilemannitol is a very good carbon source for S . coelicolor, growthon sorbitol is barely detectable . A gene cluster on cosmid SCI7was found that could encode a permease for mannitol or anothersugar alcohol [Fig . 4B] . Designated smoREFGD, this cluster containssmoR, a putative regulator gene of the operon, smoE, the solute binding protein-encoding gene, smoF and smoG, genes coding for membrane translocators, and smoD, a putative alcohol dehydrogenase-encodinggene . The deduced protein product of smoR is 39% identical tothe galactitol regulator GatR from Klebsiella oxytoca and iscategorized as a member of the DeoR family [7a] . Identitiesof the other deduced proteins to the corresponding system inRhodobacter sphaeroides are 43% for the periplasmic sorbitolbinding protein SmoE and 41% for sorbitol-mannitol transport inner membrane proteins SmoF and SmoG [accession no. AFO18073][50] . SmoD exhibits 30% identity to GutB, a sorbitol dehydrogenasepresent in Bacillus subtilis [27] . Two direct repeats of 8 bp,spaced by four nucleotides and 54 bp upstream of smoE, mightbe the cis sites for SmoR.

Putative ribose permease with novel domain structure. A putative ABC system for ribose uptake was discovered on cosmidSCC57A [Fig . 4C] . Most remarkably, the permease gene rbsH encodesa unique fusion protein composed of a membrane-spanning moietyand an extracellular solute-binding moiety, which both exhibit 47% protein identity to the ribose permease RbsC and to the ribose-binding protein RbsB of E . coli [35] . Another noteworthyfeature is the presence of an ATPase gene [rbsA] [8] . The genecluster further comprises a ribokinase gene [rbsK], whose productbears 41% protein identity to the ribokinase of E . coli, andrbsD, which encodes a small protein [129 amino acids] showing33 and 44% identity to the E . coli and B . subtilis high-affinityRbsD ribose transport proteins [6, 17, 31] . A probable LacI family-type regulator, RbsR, is encoded in the beginning ofthe gene cluster . RbsR shares 37% identity to its E . coli counterpart[24].

Two further gene clusters were found that potentially couldencode a ribose ABC permease [Table 1] . The assumed gene products of SCAH10.22 to -24 [rbs2EFA] are a substrate-binding lipoprotein, an integral membrane protein, and an ATPase, each with remarkable similarities to ribose ABC systems of other bacteria . SCF43.19 to -22 [rbs3EFGA] may encode a third ribose-like permease . Despite the primary similarity to ribose systems, these loci might also be involved in the transport of ribose-containing substrates,such as nucleoribosides, that streptomycetes are estimated tofeed on.

The presence of ATPase genes in all three putative ribose uptake systems is in obvious contrast to the majority of the otherABC systems described here.

Less-well-definable ABC porters for carbohydrate. Thirty-one gene clusters were detected that could encode furtherABC-type porters for carbohydrates [Table 2] . All but two contain genes for a solute-binding protein with at least one adjacent permease gene . Four of them comprise a gene for an ABC-typeATPase, which implies that most ABC porters must share a commonATPase . It was not possible to suggest a probable substratefor the encoded permeases because similarity analyses revealeda substrate heterogeneity among each gene cluster . Yet, theirpresence underlines the fact that S . coelicolor has an astonishingnumber of carbohydrate transporters at its disposal, predominantlyof the ABC type . The system to which SC7E4.29 belongs has beendescribed as the dasRABC regulon of Streptomyces griseus, whichencodes an ABC transporter that is involved in a glucose-dependent differentiation process [48] . The transporter is expressed towardsthe commencement of aerial hypha formation and during sporulation.However, our analysis did not provide an unambiguous hint asto a possible substrate, and dasABC was therefore classifiedas a less-well-definable system.

Putative galactose-Na⁺ symporter of the SSS family. Galactose can be readily utilized by S . coelicolor . Genes for the utilization of galactose have been identified in S . lividans, and the homologues of S . coelicolor have been noted [1, 7].The products of the galKE1T operon in S . lividans mediate thefunneling of galactose into glycolysis via phosphorylation [GalK],epimerization [GalE1] and transfer of an uridylyl group, mediatedby GalT . The promoter region of the galKEIT operon has beenanalyzed with respect to its role in glucose repression [23].The galactose transporter-encoding gene, however, has so farnot been elucidated . This could be galP, an orf that is divergently orientated upstream of galT . GalP shares 28% similarity with the Na⁺-galactose symporter SglS of Vibrio parahaemolyticus [38, 55] [Fig . 5A] . The postulated galactose permease belongsto the SSS family and appears to be the only member of thisfamily within the S . coelicolor genome that serves as a carbohydratepermease [36] . Possible regulatory elements are a 10-bp palindrome14 bp upstream of galP as well as two 12-bp direct repeats separatedby 33 bp and located 85 bp in front of galP.

 
Glucose permease of the MFS. Glucose is a preferred carbon source of S . coelicolor, and manyreports have been published that deal with the mechanism ofglucose repression [2, 19, 22] . However, a glucose transporter has not yet been identified . When the genome was screened with the non-PTS glucose permeases GlcP of Synechocystis sp . strain PCC6803 and Glf of Zymomonas mobilis, a homologous protein with 51 and 33% identity, respectively, was detected and designated GlcP [61, 65] . Interestingly, the corresponding gene occursin two copies on the chromosome, glcP1 [SC7A1.22] and glcP2[SC9A4.15], which exhibit 99% DNA sequence identity to eachother and encode identical gene products [Fig . 5B and C] . DNAsequence similarity is extended to 39 bp [except two nucleotides]in the upstream area and only 4 bp in the downstream region.A common dyad repeat is located 18 bp upstream of both glcPgenes . Furthermore, a 10-bp palindromic region is present 70bp upstream of glcP1, and another dyad sequence is exclusivelyfound 41 bp in front of glcP2 . The adjacent genes do not encodepotential metabolic or regulatory genes that may be functionallyassociated.

BLAST searches with other sugar permeases of the MFS, such asthe xylose permease XylE and arabinose permease AraE of E . coli, revealed that S . coelicolor has more than 50 members of this family . However, no further genes besides glcP1 and glcP2 were detected that encode an obvious permease for carbohydrates.

Glycerol permease of the MIP family. To complete the analysis on carbohydrate uptake systems, itshould be noted that glycerol is efficiently metabolized bythe genes of the gylRCABX region [14] [Fig . 5D] . Deletion of gylR demonstrated that substrate induction and catabolite repressionof the gyl operon are mediated through GylR . GylC shares 49%amino acid identity to GlpF of B . subtilis [5] . GylA and GylBexhibit 52 and 32% identity to glycerol kinase GlpK and glycerol-3-phosphatedehydrogenase GlpD of E . coli, respectively [4, 26] . GylX shares similarity with proteins of unknown function present in other actinomycetes and archaea . We observed that glycerol transportis inducible by this substrate and repressible by glucose [unpublished data] . Furthermore, we demonstrated that the specific repressorGylR, a member of the IclR family, binds within the upstreamregion [400 bp] of gylC [unpublished data] [37] . There are three potential palindromic binding sites of 8 to 10 bp for GylR.

Which carbohydrate genes are expressed and what is the true substrate? The substrate definition of the well-definable carbohydrate transport systems that are compiled in Table 1 has been derivedfrom available molecular genetic, biochemical, and in silico data . From transcriptional and growth analyses of malEFG and from the mutation of malE and the adjacent regulatory gene malR, it is obvious that this ABC permease is inducible by amylose and maltotriose [44] . It transports not only maltotriose with the highest specificity but also maltose and other maltodextrins. The regulator MalR reacts best on maltopentaose and confers substrate induction and glucose repression [44, 58] . From thepublished data on the glycerol-, galactose-, fructose-, andN-acetylglucosamine-utilizing systems, it is rather evidentthat GylC, GalP, FruA, and NagE2 are the respective permeases[14, 23, 29, 30, 47].

For the remaining systems of Table 1, we suggested their possiblefunction solely on the basis of in silico data . To support ourfindings, we performed RT-PCR experiments to examine whether the particular system is expressed and whether it is inducedby the suggested substrate . Therefore, we measured the mRNAlevels of a representative gene of the respective operon [seeMaterials and Methods for details] . As can be seen from Fig.6, cebE1, cebE2, and bxlE1 were not expressed, which indicates that these are silent genes or that their expression occurs only under very specific growth conditions . mRNA of bxlE2 was readily detectable . Since it may transport ß-xylosides,we checked whether the presence of xylose could induce bxlE2.This was not the case . Due to cost restriction, we did not tryinduction by the more likely inducer xylobiose [18] . Gene expression of xylF, lacE, and smoE was as well detectable by RT-PCR . However,the addition of xylose, lactose, or mannitol to the growth medium,respectively, did not reveal induction of gene expression . Thus,these systems are constitutively expressed in the complex richmedium we used . In correlation with the mRNA lacE data, we measuredthat lactose uptake is also constitutive [our unpublished data].Of the three potential ribose permease systems, we found thatthey are all expressed . Here, the amounts of rbsE2 mRNA wereelevated when ribose was present in the growth medium, whichstrengthens the suggestion that the rbs2 gene locus encodesa ribose-specific permease . Expression of glcP was clearly glucosedependent and therefore confirmed our suggestion . It shouldbe noted that we could not distinguish between glcP1 and glcP2gene activity, due to the almost identical sequence conservation.RT-PCR of fruA [Fig . 6] and crr [IIA domain of the PTS permeasefor N-acetylglucosamine] further revealed the specificity ofthe suggested systems [29, 30, 33] . Due to the uncertainty of a possible substrate and cost restriction [chitobiose], we refrained from analyzing the agl and ngc loci.

 
Chromosomal distribution. Different from the genomes of most other bacteria, the chromosomeof S . coelicolor is linear . A central core appears to be flankedby two arms, which are subject to more-intensive genetic variation.These arms range from 0 to about 1.5 Mbp [left arm] and fromabout 6.4 Mbp to the end of the chromosome [right arm] [7].The genetic localization of the newly identified carbohydrateuptake systems shows a distribution both in the core and inthe variable region [Fig . 7] . It is remarkable that ceb1, glcP1, and rbs1 are located in the core region, whereas the ceb2, glcP2,rbs2, and rbs3 systems lie within the variable region . Thissupports the thesis that the variable region harbors nonessentialand duplicate genes [7].

 
This report provides a comprehensive survey of the carbohydrate permeases present in S . coelicolor . We were able to collecta total of 53 potential systems and conclude the following.[i] The huge number of detected carbohydrate uptake systemsreflects perfectly the lifestyle of streptomycetes . They livein the soil and feed primarily on complex long-chain carbohydratesfrom plants, insects, and fungi . These polysaccharides are brokendown by exoenzymes and internalized as mono- and disaccharides.[ii] It seems that S . coelicolor may predominantly use permeasesof the ABC type for the internalization of carbohydrates, afeature that has recently been found in the archaean Sulfolobussolfataricus as well [11] . It can be inferred that -glucosides, lactose, maltodextrins, maltose, ribose, ß-xylosides,xylose, and sugar alcohols are likely to be transported by ABCsystems, but only the maltose-maltodextrin system MalEFG hasbeen experimentally proven [44, 57] . Another 31 ABC systems are present that may contribute to the uptake of further carbohydrates. Genes encoding the required ATPase for ABC permease function were only within the permease gene cluster in four cases . This finding, which is unusual among bacteria, supports the resultsfrom previous studies with S . reticuli and S . lividans, where the ATPase MsiK assists several ABC permeases [18, 42] . [iii]Fructose, N-acetylglucosamine, and probably two yet-unidentifiedsugars are transported by PTSs [29, 30, 33] . The fructose andN-acetylglucosamine PTSs are the only uptake systems for therespective substrate in S . coelicolor . They are unequivocallycharacterized by mutation and extensive biochemical analysis[29, 30] . [iv] S . coelicolor probably has just one porter ofthe SSS family [galactose], the MFS [glucose], and the MIP family [glycerol] at its disposal . It is noteworthy that a potential permease of the preferred carbon source glucose is encoded bytwo identical gene copies . Research on the glycerol and galactoseoperons strongly suggests that, although not biochemically characterized,the permease gene is carried within the respective operon [14]. [v] Three systems are present in duplicated form . It appears that the two potential permeases for cellobiose and cellotriose,Ceb1 and Ceb2, are not expressed . The genes encoding the potential ß-xyloside permease Bxl2 are expressed, whereas Bxl1may be silent. glcP expression was clearly glucose inducible.Due to the high sequence identity, it was not possible to determineto which extent the glcP1 or glcP2 allele is transcribed . However,it should be noted that for ceb, bxl, and glcP, both loci putativelyencode isofunctional transporters that may be expressed at differentgrowth phases or under different growth conditions, as is truealso for anabolic genes, such as that for glycogen synthesis [45] . [vi] A gene encoding a regulator was found in most geneclusters . Just the regulators, ROK7B71, SmoR, and GylR, belongto the ROK, DeoR, and IclR families, respectively . All others are members of the LacI family of bacterial regulators . This group appears to be rather heterogeneous, which holds true alsofor the primary sequence of the -helix-turn--helix motifs [28].Therefore, the respective cognate operators can display pronouncedvariation, thus diminishing undesired cross-recognition . Nevertheless,we have included in our analysis the presence of putative cisactive elements that may be recognized by these regulatory proteins.A divergent orientation of repressor and metabolic genes indicatesthat the metabolic operon and the repressor itself might besimultaneously controlled by one or more copies of a regulatorbinding site in between . Such autogenous regulation has beenfound in divergeons for sucrose and arabinose utilization [21,25] . [vii] The presence of metabolic genes within a permeasegene cluster occurred at a rate of 74% . It indicates that anumber of catabolic enzymes are not coordinately regulated withthe respective permease . This is reasonable when low- and high-affinitytransport systems for the same substrate are expressed independentlyof an abundant or scarce supply of carbon source or when thecatabolic enzyme is required for metabolism of different substrates.Glucose kinase, for instance, should be present whenever freeinternal glucose from glucose-containing saccharides is deliveredand is thus independently regulated [3, 22].

This study documents that our molecular understanding of streptomycete nutrition concerning the intake of carbohydrates is still at the very beginning . We hope that the compilation presented heremay serve as a guide to stimulate further investigation of S. coelicolor and other relevant Streptomyces species.

 
We thank Miriam König and Andreas W . Thomae for assistanceand fruitful discussions.

This work was supported through grant SFB473 and Graduiertenkolleg 40 of the Deutsche Forschungsgemeinschaft.

 
* Corresponding author . Mailing address: Lehrstuhl für Mikrobiologie, Friedrich-Alexander-Universität Erlangen-Nürnberg, Staudtstrasse 5, D-91058 Erlangen, Germany . Phone: 49-9131-8528084 . Fax: 49-9131-8528082 . E-mail: ftitgem@biologie.uni-erlangen.de .

1. Adams, C . W., J . A . Fornwald, F . J . Schmidt, M . Rosenberg, and M . E . Brawner. 1988 . Gene organization and structure of the Streptomyces lividans gal operon . J . Bacteriol . 170:203-212.
2. Angell, S., C . G . Lewis, M . J . Buttner, and M . J . Bibb. 1994 . Glucose repression in Streptomyces coelicolor A3[2]: a likely regulatory role for glucose kinase . Mol . Gen . Genet . 244:135-143.
3. Angell, S., E . Schwarz, and M . J . Bibb. 1992 . The glucose kinase gene of Streptomyces coelicolor A3[2]: its nucleotide sequence, transcriptional analysis and role in glucose repression . Mol . Microbiol . 6:2833-2844.
4. Austin, D., and T . J . Larson. 1991 . Nucleotide sequence of the glpD gene encoding aerobic sn-glycerol 3-phosphate dehydrogenase of Escherichia coli K-12 . J . Bacteriol . 173:101-107.
5. Beijer, L., R . P . Nilsson, C . Holmberg, and L . Rutberg. 1993 . The glpP and glpF genes of the glycerol regulon in Bacillus subtilis . J . Gen . Microbiol . 139:349-359.
6. Bell, A . W., S . D . Buckel, J . M . Groarke, J . N . Hope, D . H . Kingsley, and M . A . Hermodson. 1986 . The nucleotide sequences of the rbsD, rbsA, and rbsC genes of Escherichia coli K12 . J . Biol . Chem . 261:7652-7658 .
7. Bentley, S . D., K . F . Chater, A . M . Cerdeno-Tarraga, G . L . Challis, N . R . Thomson, K . D . James, D . E . Harris, M . A . Quail, H . Kieser, D . Harper, A . Bateman, S . Brown, G . Chandra, C . W . Chen, M . Collins, A . Cronin, A . Fraser, A . Goble, J . Hidalgo, T . Hornsby, S . Howarth, C . H . Huang, T . Kieser, L . Larke, L . Murphy, K . Oliver, S . O'Neil, E . Rabbinowitsch, M . A . Rajandream, K . Rutherford, S . Rutter, K . Seeger, D . Saunders, S . Sharp, R . Squares, S . Squares, K . Taylor, T . Warren, A . Wietzorrek, J . Woodward, B . G . Barrell, J . Parkhill, and D . A . Hopwood. 2002 . Complete genome sequence of the model actinomycete Streptomyces coelicolor A3[2] . Nature 417:141-147.
7. Brinkkötter, A., A . Shakeri-Garakani, and J . W . Lengeler. 2002 . Two class II D-tagatose-bisphosphate aldolases from enteric bacteria . Arch . Microbiol . 177:410-419.
8. Buckel, S . D., A . W . Bell, J . K . Rao, and M . A . Hermodson. 1986 . An analysis of the structure of the product of the rbsA gene of Escherichia coli K12 . J . Biol . Chem . 261:7659-7662 .
9. Busch, W., and M . H . Saier, Jr. 2002 . The transporter classification [TC] system, 2002 . Crit . Rev . Biochem . Mol . Biol . 37:287-337 .
10. Ehrmann, M., R . Ehrle, E . Hofmann, W . Boos, and A . Schlösser. 1998 . The ABC maltose transporter . Mol . Microbiol . 29:685-694.
11. Elferink, M . G., S . V . Albers, W . N . Konings, and A . J . Driessen. 2001 . Sugar transport in Sulfolobus solfataricus is mediated by two families of binding protein-dependent ABC transporters . Mol . Microbiol . 39:1494-1503.
12. Farabaugh, P . J. 1978 . Sequence of the lacI gene . Nature 274:765-769.
13. Greenwood, J . A., A . Cornish, and C . W . Jones. 1990 . Binding-protein-dependent lactose transport in Agrobacterium radiobacter . J . Bacteriol . 172:1703-1710.
14. Hindle, Z., and C . P . Smith. 1994 . Substrate induction and catabolite repression of the Streptomyces coelicolor glycerol operon are mediated through the GylR protein . Mol . Microbiol . 12:737-745.
15. Hirata, H., T . Fukazawa, S . Negoro, and H . Okada. 1986 . Structure of a beta-galactosidase gene of Bacillus stearothermophilus . J . Bacteriol . 166:722-727.
16. Hodgson, D . A. 2000 . Primary metabolism and its control in streptomycetes: a most unusual group of bacteria . Adv . Microb . Physiol . 42:47-238.
17. Hope, J . N., A . W . Bell, M . A . Hermodson, and J . M . Groarke. 1986 . Ribokinase from Escherichia coli K12 . Nucleotide sequence and overexpression of the rbsK gene and purification of ribokinase . J . Biol . Chem . 261:7663-7668 .
18. Hurtubise, Y., F . Shareck, D . Kluepfel, and R . Morosoli. 1995 . A cellulase/xylanase-negative mutant of Streptomyces lividans 1326 defective in cellobiose and xylobiose uptake is mutated in a gene encoding a protein homologous to ATP-binding proteins . Mol . Microbiol . 17:367-377.
19. Kwakman, J . H., and P . W . Postma. 1994 . Glucose kinase has a regulatory role in carbon catabolite repression in Streptomyces coelicolor . J . Bacteriol . 176:2694-2698.
20. Locci, R. 1986 . Streptomycetes and related genera, p . 2492-2541 . In P . H . A . Sneath, N . S . Mair, M . E . Sharpe, and J . G . Holt [ed.], Bergey's manual of systematic bacteriology, vol . 2 . Williams & Wilkins, Baltimore, Md.
21. Luesink, E . J., J . D . Marugg, O . P . Kuipers, and W . M . de Vos. 1999 . Characterization of the divergent sacBK and sacAR operons, involved in sucrose utilization by Lactococcus lactis . J . Bacteriol . 181:1924-1926 .
22. Mahr, K., G . P . van Wezel, C . Svensson, U . Krengel, M . J . Bibb, and F . Titgemeyer. 2000 . Glucose kinase of Streptomyces coelicolor A3[2]: large-scale purification and biochemical analysis . Antonie Leeuwenhoek 78:253-261.
23. Mattern, S . G., M . E . Brawner, and J . Westpheling. 1993 . Identification of a complex operator for galP1, the glucose-sensitive, galactose-dependent promoter of the Streptomyces galactose operon . J . Bacteriol . 175:1213-1220.
24. Mauzy, C . A., and M . A . Hermodson. 1992 . Structural and functional analyses of the repressor, RbsR, of the ribose operon of Escherichia coli . Protein Sci . 1:831-842 .
25. Mota, L . J., L . M . Sarmento, and I . de Sa-Nogueira. 2001 . Control of the arabinose regulon in Bacillus subtilis by AraR in vivo: crucial roles of operators, cooperativity, and DNA looping . J . Bacteriol . 183:4190-4201 .
26. Muramatsu, S., and T . Mizuno. 1989 . Nucleotide sequence of the region encompassing the glpKF operon and its upstream region containing a bent DNA sequence of Escherichia coli . Nucleic Acids Res . 17:4378.
27. Ng, K., R . Ye, X . C . Wu, and S . L . Wong. 1992 . Sorbitol dehydrogenase from Bacillus subtilis . Purification, characterization, and gene cloning . J . Biol . Chem . 267:24989-24994 .
28. Nguyen, C . C., and M . H . Saier, Jr. 1995 . Phylogenetic, structural and functional analyses of the LacI-GalR family of bacterial transcription factors . FEBS Lett . 377:98-102.
29. Nothaft, H., D . Dresel, A . Willimek, K . Mahr, M . Niederweis, and F . Titgemeyer. 2003 . The phosphotransferase system of Streptomyces coelicolor is biased for N-acetylglucosamine metabolism . J . Bacteriol . 185:7019-7023 .
30. Nothaft, H., S . Parche, A . Kamionka, and F . Titgemeyer. 2003 . In vivo analysis of HPr reveals a fructose-specific phosphotransferase system that confers high-affinity uptake in Streptomyces coelicolor . J . Bacteriol . 185:929-937 .
31. O'Reilly, M., K . Woodson, B . C . Dowds, and K . M . Devine. 1994 . The citrulline biosynthetic operon, argC-F, and a ribose transport operon, rbs, from Bacillus subtilis are negatively regulated by Spo0A . Mol . Microbiol . 11:87-98.
32. Pao, S . S., I . T . Paulsen, and M . H . Saier, Jr. 1998 . Major facilitator superfamily . Microbiol . Mol . Biol . Rev . 62:1-34 .
33. Parche, S., H . Nothaft, A . Kamionka, and F . Titgemeyer. 2000 . Sugar uptake and utilisation in Streptomyces coelicolor: a PTS view to the genome . Antonie Leeuwenhoek 78:243-251.
34. Parche, S., R . Schmid, and F . Titgemeyer. 1999 . The phosphotransferase system [PTS] of Streptomyces coelicolor identification and biochemical analysis of a histidine phosphocarrier protein HPr encoded by the gene ptsH . Eur . J . Biochem . 265:308-317 .
35. Park, Y., Y . J . Cho, T . Ahn, and C . Park. 1999 . Molecular interactions in ribose transport: the binding protein module symmetrically associates with the homodimeric membrane transporter . EMBO J . 18:4149-4156 .
36. Reizer, J., A . Reizer, and M . H . Saier, Jr. 1994 . A functional superfamily of sodium/solute symporters . Biochim . Biophys . Acta 1197:133-166.
37. Reverchon, S., W . Nasser, and J . Robert-Baudouy. 1991 . Characterization of kdgR, a gene of Erwinia chrysanthemi that regulates pectin degradation . Mol . Microbiol . 5:2203-2216.
38. Sarker, R . I., Y . Okabe, M . Tsuda, and T . Tsuchiya. 1996 . Sequence of a Na+/glucose symporter gene and its flanking regions of Vibrio parahaemolyticus . Biochim . Biophys . Acta 1281:1-4.
39. Schlösser, A. 2000 . MsiK-dependent trehalose uptake in Streptomyces reticuli . FEMS Microbiol . Lett . 184:187-192.
40. Schlösser, A., T . Aldekamp, and H . Schrempf. 2000 . Binding characteristics of CebR, the regulator of the ceb operon required for cellobiose/cellotriose uptake in Streptomyces reticuli . FEMS Microbiol . Lett . 190:127-132.
41. Schlösser, A., J . Jantos, K . Hackmann, and H . Schrempf. 1999 . Characterization of the binding protein-dependent cellobiose and cellotriose transport system of the cellulose degrader Streptomyces reticuli . Appl . Environ . Microbiol . 65:2636-2643 .
42. Schlösser, A., T . Kampers, and H . Schrempf. 1997 . The Streptomyces ATP-binding component MsiK assists in cellobiose and maltose transport . J . Bacteriol . 179:2092-2095.
43. Schlösser, A., and H . Schrempf. 1996 . A lipid-anchored binding protein is a component of an ATP-dependent cellobiose/cellotriose-transport system from the cellulose degrader Streptomyces reticuli . Eur . J . Biochem . 242:332-338.
44. Schlösser, A., A . Weber, and H . Schrempf. 2001 . Synthesis of the Streptomyces lividans maltodextrin ABC transporter depends on the presence of the regulator MalR . FEMS Microbiol . Lett . 196:77-83.
45. Schneider, D., C . J . Bruton, and K . F . Chater. 2000 . Duplicated gene clusters suggest an interplay of glycogen and trehalose metabolism during sequential stages of aerial mycelium development in Streptomyces coelicolor A3[2] . Mol . Gen . Genet . 263:543-553.
46. Schneider, E. 2001 . ABC transporters catalyzing carbohydrate uptake . Res . Microbiol . 152:303-310.
47. Seno, E . T., and K . F . Chater. 1983 . Glycerol catabolic enzymes and their regulation in wild-type and mutant strains of Streptomyces coelicolor A3[2] . J . Gen . Microbiol . 129:1403-1413.
48. Seo, J . W., Y . Ohnishi, A . Hirata, and S . Horinouchi. 2002 . ATP-binding cassette transport system involved in regulation of morphological differentiation in response to glucose in Streptomyces griseus . J . Bacteriol . 184:91-103 .
49. Smith, C . P., and K . F . Chater. 1988 . Cloning and transcription analysis of the entire glycerol utilization [gylABX] operon of Streptomyces coelicolor A3[2] and identification of a closely associated transcription unit . Mol . Gen . Genet . 211:129-137.
50. Stein, M . A., A . Schäfer, and F . Giffhorn. 1997 . Cloning, nucleotide sequence, and overexpression of smoS, a component of a novel operon encoding an ABC transporter and polyol dehydrogenases of Rhodobacter sphaeroides Si4 . J . Bacteriol . 179:6335-6340.
51. Sumiya, M., E . O . Davis, L . C . Packman, T . P . McDonald, and P . J . Henderson. 1995 . Molecular genetics of a receptor protein for D-xylose, encoded by the gene xylF, in Escherichia coli . Receptors Channels 3:117-128.
52. Tam, R., and M . H . Saier, Jr. 1993 . Structural, functional, and evolutionary relationships among extracellular solute-binding receptors of bacteria . Microbiol . Rev . 57:320-346.
53. Titgemeyer, F., J . Reizer, A . Reizer, and M . H . Saier, Jr. 1994 . Evolutionary relationships between sugar kinases and transcriptional repressors in bacteria . Microbiology 140:2349-2354.
54. Titgemeyer, F., J . Walkenhorst, J . Reizer, M . H . Stuiver, X . Cui, and M . H . Saier, Jr. 1995 . Identification and characterization of phosphoenolpyruvate:fructose phosphotransferase systems in three Streptomyces species . Microbiology 141:51-58.
55. Turk, E., O . Kim, J . le Coutre, J . P . Whitelegge, S . Eskandari, J . T . Lam, M . Kreman, G . Zampighi, K . F . Faull, and E . M . Wright. 2000 . Molecular characterization of Vibrio parahaemolyticus vSGLT: a model for sodium-coupled sugar cotransporters . J . Biol . Chem . 275:25711-25716 .
56. van Veen, H . W., and W . N . Konings. 1998 . The ABC family of multidrug transporters in microorganisms . Biochim . Biophys . Acta 1365:31-36.
57. van Wezel, G . P., J . White, M . J . Bibb, and P . W . Postma. 1997 . The malEFG gene cluster of Streptomyces coelicolor A3[2]: characterization, disruption and transcriptional analysis . Mol . Gen . Genet . 254:604-608.
58. van Wezel, G . P., J . White, P . Young, P . W . Postma, and M . J . Bibb. 1997 . Substrate induction and glucose repression of maltose utilization by Streptomyces coelicolor A3[2] is controlled by malR, a member of the lacl-galR family of regulatory genes . Mol . Microbiol. 23:537-549.
59. Volff, J . N., and J . Altenbuchner. 2000 . The 1-kb-repeat-encoded DNA-binding protein as repressor of an alpha-glucosidase operon flanking the amplifiable sequence AUD1 of Streptomyces lividans . Microbiology 146:923-933 .
60. Wang, F., X . Xiao, A . Saito, and H . Schrempf. 2002 . Streptomyces olivaceoviridis possesses a phosphotransferase system that mediates specific, phosphoenolpyruvate-dependent uptake of N-acetylglucosamine . Mol . Genet . Genomics 268:344-351.
61. Weisser, P., R . Kramer, H . Sahm, and G . A . Sprenger. 1995 . Functional expression of the glucose transporter of Zymomonas mobilis leads to restoration of glucose and fructose uptake in Escherichia coli mutants and provides evidence for its facilitator action . J . Bacteriol . 177:3351-3354.
62. Williams, S . G., J . A . Greenwood, and C . W . Jones. 1992 . Molecular analysis of the lac operon encoding the binding-protein-dependent lactose transport system and beta-galactosidase in Agrobacterium radiobacter . Mol . Microbiol . 6:1755-1768.
63. Willis, L . B., and G . C . Walker. 1999 . A novel Sinorhizobium meliloti operon encodes an alpha-glucosidase and a periplasmic-binding-protein-dependent transport system for alpha-glucosides . J . Bacteriol . 181:4176-4184 .
64. Xiao, X., F . Wang, A . Saito, J . Majka, A . Schlösser, and H . Schrempf. 2002 . The novel Streptomyces olivaceoviridis ABC transporter Ngc mediates uptake of N-acetylglucosamine and N, N'-diacetylchitobiose . Mol . Genet . Genomics 267:429-439.
65. Zhang, C . C., M . C . Durand, R . Jeanjean, and F . Joset. 1989 . Molecular and genetical analysis of the fructose-glucose transport system in the cyanobacterium Synechocystis PCC6803 . Mol . Microbiol . 3:1221-1229.

Free Online Full-text Article

What Is Staphylococcus Aureus?, What Is Fermentation?, What Is Water Purification?, What Is Environmental Microbiology?, What Is Bioremediation?, i, Microorganism, r, Bacteria, r, Microbiology, e, Microbe, o, Microbes, s, Antibiotics, s, Enterobacters, i, Bacillus subtilis, i, Microorganisms, e, Bacillus, a, Bacteriophage, r, Wastewater, c, Haemophilus, a, Pathogenic bacterium, e, Escherichia coli, c, Escherichia coli, n, Lactobacillus, e, S. cerevisiae, o, Bacillus, n, Microorganisms, s, Antibiotics, s, Escherichia coli, i, Clostridia, c, Fermentations, o, Achromobacter, c, Yeasts




 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005