Journal of Bacteriology, September 2004, p . 6142-6149, Vol . 186, No . 18

Arginine Biosynthesis in Thermotoga maritima: Characterization of the Arginine-Sensitive N-Acetyl-L-Glutamate Kinase

M . Leonor Fernández-Murga, Fernando Gil-Ortiz, José L . Llácer, and Vicente Rubio^*

Instituto de Biomedicina de Valencia [IBV-CSIC], Valencia, Spain

Received 30 March 2004/ Accepted 11 June 2004

 
To help clarify the control of arginine synthesis in Thermotoga maritima, the putative gene [argB] for N-acetyl-L-glutamate kinase [NAGK] from this microorganism was cloned and overexpressed, and the resulting protein was purified and shown to be a highly thermostable and specific NAGK that is potently and selectively inhibited by arginine . Therefore, NAGK is in T . maritima the feedback control point of arginine synthesis, a process thatin this organism involves acetyl group recycling and appearsnot to involve classical acetylglutamate synthase . The inhibitionof NAGK by arginine was found to be pH independent and to dependsigmoidally on the concentration of arginine, with a Hill coefficient[N] of 4, and the 50% inhibitory arginine concentration [I_0.5]was shown to increase with temperature, approaching above 65°Cthe I_0.50 observed at 37°C with the mesophilic NAGK of Pseudomonas aeruginosa [the best-studied arginine-inhibitable NAGK] . At75°C, the inhibition by arginine of T . maritima NAGK wasdue to a large increase in the K_m for acetylglutamate triggered by the inhibitor, but at 37°C arginine also substantially decreased the V_max of the enzyme . The NAGKs of T . maritima andP . aeruginosa behaved in gel filtration as hexamers, justifyingthe sigmoidicity and high Hill coefficient of arginine inhibition,and arginine or the substrates failed to disaggregate theseenzymes . In contrast, Escherichia coli NAGK is not inhibitedby arginine and is dimeric, and thus the hexameric architecturemay be an important determinant of arginine sensitivity . Potentialthermostability determinants of T . maritima NAGK are also discussed.

 
Thermotoga maritima, one of the most highly thermophilic eubacteria [optimum growth temperature, 80°C] [20] and possibly oneof the deepest branching and more slowly evolving of the eubacteriallineages [2], has been the subject of an already completed genomesequencing project [33] and, given its possible evolutionaryposition and biotechnological potential [19], is also the targetof one of the few structural genomics projects being developednow [25].

To exploit to its maximum the completeness of the genomic information and the massive structural data expected, it would be highly desirable to have a detailed knowledge of the physiology and metabolism of T . maritima rather than the patchy existing knowledge [3] . Concerning the object of the present work, arginine biosynthesis,crude T . maritima extracts were shown to exhibit [36] enzymeactivity for N-acetyl-L-glutamate synthase [abbreviated acetylglutamatesynthase], N-acetyl-L-glutamate kinase [NAGK], N-acetyl-L-ornithine:glutamate N-acetyltransferase [or, in short, transacetylase], ornithine transcarbamylase, argininosuccinate synthetase, argininosuccinate lyase, and carbamoyl phosphate synthetase but not to exhibit acetylornithinase activity, and thus it was proposed [36] thatT . maritima, like Pseudomonas aeruginosa and many other organismsbut unlike Escherichia coli [7], makes arginine by using a cyclicpathway, a pathway in which the acetyl group of acetylornithineis transacetylated to glutamate [Fig. 1] . Indeed, putative geneshave been identified in the T . maritima genome for all the enzymesof the cyclic pathway [Fig . 1] except acetylglutamate synthase[11, 27, 33], although BLAST searches for the enzyme yieldedweakly significant hits in the putative gene for NAGK, argB[11], that must reflect homology between acetylglutamate synthaseand NAGK [6], since we demonstrate here that the purified proteinproduct of the cloned and overexpressed T . maritima argB geneis a genuine, highly active, specific, and thermostable NAGK.

 
An important question that is clarified here is the mode offeedback control of arginine biosynthesis in T . maritima . Inthe organisms having a linear route of arginine biosynthesis[that is, in which acetylornithine is deacylated hydrolytically],such as E . coli, the target of feedback inhibition by arginineis the initial step, catalyzed by acetylglutamate synthase [7, 26], whereas in the organisms that recycle the acetyl group[1, 7, 8, 10, 18], such as P . aeruginosa, the key target offeedback inhibition is NAGK, since acetylglutamate synthaseplays a purely anaplerotic role in these organisms [7] . Thus,the report that the NAGK activity found in crude T . maritima extracts was not inhibited by arginine [36] was puzzling, sinceT . maritima appeared to use the cyclic route to make arginine,given the respective presence and absence of transacetylaseand acetylornithinase activity in T . maritima extracts [36].We have examined here the arginine sensitivity of the purifiedT . maritima NAGK, finding that, indeed, this NAGK is potentlyand highly specifically inhibited by arginine, as expected ifit belongs to a cyclic arginine biosynthetic route . We alsoshow that the inhibition is sigmoidal and has a high Hill coefficient,that the arginine concentrations required for inhibition increasewith temperature but are independent of pH, and that at thehigh living temperatures of T . maritima, arginine inhibits NAGKby increasing the value of the K_m for acetylglutamate.

An additional key point requiring clarification, given the existence of arginine-sensitive and insensitive NAGKs, concerns the nature of the physical determinants that render a NAGK sensitive to feedback inhibition by arginine . Although the structure at atomic resolution of E . coli NAGK was previously reported and substrate binding and catalysis by this enzyme were clarified [15, 34],E . coli NAGK is not inhibited by arginine, and thus its structurehas yielded no clues concerning the physical bases of arginineinhibition . Our present results shed some new light on thisquestion, since they strongly suggest that a hexameric quaternarystructure may be a key trait of arginine-inhibitable NAGKs.

 
Construction of NAGK expression vector [pNAGK-TM16]. The putative T . maritima argB gene, corresponding to gene TM1784 of the T . maritima gene list [33; http://www.TIGR.org], was PCR-cloned from the genomic DNA of T . maritima [provided byF . E . Jenney, University of Georgia] by using a high-fidelity proofreading thermostable DNA polymerase [Deep Vent; New England Biolabs], the forward primer derived from nucleotides 1760682to 1760714 of TM1784 [5'GGAGGTACAGCATATGAGGATCGACACGGTCA3'], and the reverse primer derived from the complementary antiparallel sequence for nucleotides 1761527 to 1761539 of TM1784 [5'GTGTTCATCAGAAGCTTCTTTACCCCTCCAGTTCT3'].These primers encompass the beginning and the end of the putativeopen reading frame [underlined] and short flanking genomic T.maritima sequences, and they incorporate mutations [shown initalic] to introduce NdeI [direct primer] and HindIII [reverseprimer] sites after the initiator and stop codons . The amplifiedfragment, digested with NdeI and HindIII and ligated with T4ligase into the same sites of plasmid pET-22b [Novagen], wasused to transform E . coli DH5 cells [Clontech], allowing theisolation of plasmid pNAGK-TM16, which carries in its insertthe NAGK gene from T . maritima, as corroborated by automatedDNA sequencing [DNA sequencing core facility, IBV-CSIC, Valencia,Spain].

Protein expression and purification. Expression of the cloned putative argB gene was performed asdescribed previously for human ornithine transcarbamylase [31], using overnight induction at 25°C with 0.01 mM isopropyl-ß-D-thiogalactoside and E . coli BL21 [DE3] cells [Novagen] cotransformed with pNAGK-TM16and with plasmid pGroESL [a pACYC184-derived expression plasmidencoding the E . coli chaperonins GroES and GroEL [16], providedby A . E . Gatenby, DuPont de Nemours, Wilmington, Delaware]. The cells, harvested by centrifugation from 1.5-liter cultures, were resuspended at 4°C in 15 ml of 0.1 M Na phosphate-0.2mM dithioerythritol, pH 7.0, per gram of cells and were disruptedby sonication on ice . The lysate was centrifuged for 30 minat 4°C and 35,000 x g, and the supernatant was incubatedfor 9 min at 80°C, chilled, and centrifuged again for 15 min at 4°C and 18,000 x g . All subsequent steps were doneat 4°C . The supernatant was dialyzed overnight against acolumn buffer consisting of 20 mM Na phosphate-1 mM dithioerythritol,pH 8.0 . It was then loaded onto a Q-Sepharose Fast Flow column[1 by 18 cm; Amersham Biosciences] preequilibrated with thebuffer, the column was washed with 100 ml of buffer, and thena 400-ml linear gradient of 0 to 0.5 M NaCl in the same buffer was applied . The overexpressed, partially pure protein [monitored by sodium dodecyl sulfate-polyacrylamide gel electrophoresis [SDS-PAGE] as a band of 30 kDa] was eluted at approximately0.15 M NaCl . Fractions containing the protein were pooled, dialyzed overnight against 20 mM Na phosphate-1 mM dithioerythritol-20mM MgCl₂, pH 7.0, and loaded onto an Affigel Blue column [2by 20 cm; Bio-Rad] preequilibrated with the same buffer . Afterthe column was washed with 180 ml of buffer, a 400-ml lineargradient of 0.5 to 3 M NaCl in the same buffer devoid of MgCl₂was applied to the column . The >95% pure protein was elutedat approximately 1.5 M NaCl, concentrated to >2.5 mg/ml byultrafiltration [Amicon stirred cell and YM10 membrane], andsupplemented with 10% [vol/vol] glycerol before storage at –20°C.The preparation of P . aeruginosa and E . coli NAGKs has beenreported previously [12, 14].

Enzyme activity assays. NAGK activity was measured with the hydroxylamine-containingcolorimetric assay of Haas and Leisinger [17], which detectsat 540 nm the formation of acetylglutamyl hydroxamate [extinctioncoefficient, 456 M^–1 cm^–1 [17]], although when indicated,ADP was measured [35] in samples taken from this assay mixture.To prevent enzyme inactivation associated with extreme dilutionof the enzyme, 0.02 mg of bovine serum albumin [shown in preliminarytests to prevent dilution inactivation]/ml was added in allassays involving extreme dilutions . Unless otherwise indicated,the enzyme was incubated for 10 min at 37°C in the assaymedium at pH 7.5, and the concentrations of ATP, acetylglutamate,and MgCl₂ were 10, 40, and 20 mM, respectively . When a pH of6.5 was used, the assay mixture was brought to this pH withHCl . To determine the effect on the activity [assayed at either37°C or 75°C] of various ATP and acetylglutamate concentrations,the concentration of acetylglutamate was varied between 2 and80 mM at five fixed concentrations of ATP [range, 2.5 to 25mM], keeping a constant excess of 10 mM MgCl₂ over the concentrationof the nucleotide . One enzyme unit is the amount of enzyme thatgenerates 1 µmol of product in 1 min . The program GraphPadPrism [GraphPad Software, San Diego, Calif.] was used for fittingto the arginine inhibition data the sigmoidal curves generatedwith the nonlogarithmic form of the Hill equation for inhibition,v_Arg = v_Arg=0 x {1 – [Arg^N/[I_0.5^N + Arg^N]]}, where N isthe Hill coefficient, I_0.5 is the concentration of argininethat yields 50% inhibition, v_Arg is the velocity at a given concentration of arginine, and v_Arg=0 is the velocity in the absence of arginine . The same program was used for hyperbolic fitting of the substrate saturation data and for estimatingV_max and K_m values from secondary hyperbolic plots of apparent V_max values for one substrate versus the concentration of theother substrate . In this way, the K_m value given for each substratehas been estimated at infinite concentration of the other substrate,and the V_max is the velocity extrapolated at infinite concentrationof both substrates.

Analytical gel filtration chromatography. Chromatography on a Superdex 200HR [10/30] column mounted onan KTA fast protein liquid chromatography system [Amersham Biosciences]was carried out at 24°C at a flow rate of 0.25 ml/min, monitoringthe optical density at 280 nm of the effluent . The same solutionwas used for running the column and for suspending the proteinsamples [0.2- to 0.3-ml samples containing 0.02 to 0.23 mg ofprotein], consisting of either 50 mM Tris-HCl-0.15 M NaCl, pH7.5, or 0.1 M K phosphate, pH 7.0 . When indicated, 10 mM arginineor a mixture of 40 mM acetylglutamate-10 mM ATP-20 mM MgCl₂was included in the solutions, and in these cases the enzymewas incubated for 15 min at 24°C with these components beforegel filtration . Molecular weight marker proteins, either commercial[Amersham Biosciences or Sigma] or produced in our laboratory[Pyrococcus furiosus carbamate kinase [35] and intact or truncatedE . coli aspartokinase III [29]], were used for column calibration.

Other methods. Cross-linking with dimethyl suberimidate [Pierce] and electrophoreticanalysis of the cross-linked protein by SDS-PAGE in phosphatebuffer were carried out as reported previously [9], using anNAGK concentration of 0.5 mg of protein ml^–1 . In all otherinstances, SDS-PAGE was performed according to procedures describedby Laemmli [23] with gels of 15% polyacrylamide concentration.Densitometry analysis of the digitized images of the Coomassieblue-stained gels was carried out with the program Sigmagel[Jandel Scientific] . Protein concentrations were determinedby the method described by Bradford [5] using a commercial reagent[Bio-Rad] and bovine serum albumin as a standard . Preparationof N-acetyl-D-glutamate from the racemic mixture by selectiveaminoacylase deacylation of the L form has been reported previously[4].

 
Expression and purification. The T . maritima gene TM1784 [nucleotides 1760682 to 1761527of the T . maritima chromosome], PCR-cloned into the pET-22b-derivedplasmid pNAGK-TM16, yielded insoluble protein when overexpressedin E . coli BL21 [DE3] cells under standard induction conditions[12] . However, when the expression was carried out using cellsthat also overexpressed the chaperonins GroES and GroEL fromthe cotransforming plasmid pGroESL, a large fraction of theproduct was soluble if the concentration of isopropyl-ß-D-thiogalactoside was low and the induction temperature was 25°C [Fig . 2]. The relatively high abundance of the overexpressed protein and its thermostability [see below] simplified its purificationin only three steps [see Materials and Methods]: [i] heat treatment,causing threefold purification with 95% yield; [ii] ion-exchange chromatography, resulting in 16-fold purified protein and 70%yield relative to the initial extract; and [iii] dye-affinity chromatography, giving >95% pure protein [measured by SDS-PAGE][Fig. 2] in a yield of approximately 10 mg liter^–1 of initial culture . The mass of the isolated protein, determined by matrix-assisted laser desorption ionization-time of flightmass spectrometry, was 30,341 Da, in excellent agreement withthe sequence-deduced polypeptide mass [30,344], and its N-terminal sequence determined experimentally in 35 cycles of Edman sequencing agreed exactly with the gene-deduced sequence . These findings indicated that the purified protein was the genuine productof the cloned gene, that it had no significant posttranslational modifications, and that it preserved uncleaved the N-terminal methionine.

 
The purified protein is a highly thermostable NAGK. As expected for NAGK, the purified protein yielded color inthe classical hydroxylamine-coupled NAGK enzyme activity assay[17], corresponding to an amount of acetylglutamyl phosphatesynthesized that was equivalent, within experimental error,to the amount of ADP produced [45 µmol of protein min^–1 mg^–1 at 37°C] . Both color production and ADP releasewere strictly dependent on the addition of N-acetyl-L-glutamateto the assay, and this substrate could not be replaced by either[Table 1] its D isomer [the small amount of activity observedwith this isomer was due to traces of the L isomer [4]], its one-less-carbon analog N-acetyl-L-aspartate, or the nonacetylatedamino acid, L-glutamate, proving the exquisite specificity ofthe enzyme for N-acetyl-L-glutamate, as expected for genuineNAGK [18] . Concerning the nucleotide substrate [Table 1], theenzyme used GTP much less effectively than ATP, and the pyrimidinenucleotides UTP and CTP were very poor substrates.

 
Given the hyperthermophilic character of T . maritima, the NAGK of this organism should be highly thermostable . This stabilitywas confirmed by the experiments shown in Fig . 3A . Whereas E. coli and P . aeruginosa NAGKs were completely inactivated at 70°C in 10 and 30 min, respectively, the T . maritima enzyme retained approximately 100, 80, and 60% of its activity when heated for 1 h at 70, 80, and 85°C, respectively . Only at90°C was the enzyme inactivated at a rate comparable tothat of P . aeruginosa NAGK at 70°C . The enzyme exhibitedan optimum assay temperature of 80°C [Fig . 3B], the optimalgrowth temperature of T . maritima [20], and although at 37°C its specific activity [45 U mg^–1] was somewhat lower than those of the NAGKs of P . aeruginosa [130 U mg^–1] and E.coli [64 U mg^–1 [14]] at the optimal growth temperaturesof these organisms, the activity of the T . maritima enzyme wasby far the highest [677 U mg^–1 at 80°C] . An Arrheniusplot of activity versus the reciprocal of absolute temperature[Fig . 3B, inset] failed to reveal any break in the 25 to 80°Ctemperature range that might reflect a drastic phase transition.

 
Inhibition of T . maritima NAGK by arginine. Figure 4 shows that T . maritima NAGK is potently inhibited by arginine . Similar to what is observed with P . aeruginosa NAGK [24] [Fig . 4B], the inhibition of T . maritima NAGK was virtuallycomplete and was sigmoidally dependent on the concentrationof the inhibitor, but the concentration of arginine needed forinhibition at 37°C was considerably lower for T . maritimaNAGK than for P . aeruginosa NAGK . However, as the temperaturewas increased, the concentrations of arginine needed to inhibitT . maritima NAGK also increased [Fig . 4A], and thus, at thehigh living temperatures of T . maritima, the arginine sensitivity of this NAGK resembled closely that of the NAGK of P . aeruginosa at 37°C.

 
In contrast to the large increase with temperature of the I_0.5 for arginine [Fig . 4A, inset], the sigmoidicity of the inhibitionwas little affected by the temperature, as reflected in therelatively small change in the value of the Hill coefficient, N [see Materials and Methods], from 4.25 at 37°C to 3.45 at 75°C [Fig . 4A, inset] . The sigmoidal character and the value of N [4] indicate that each enzyme molecule contains atleast four equivalent sites for arginine to which the effectorbinds cooperatively [30].

Arginine inhibition of P . aeruginosa NAGK was previously reported [18] and has been confirmed here [Fig . 4B] to be strongly influencedby pH changes in the 6.5 to 7.5 range, as expected if argininebinding involves an ionizable group with a pK value within thispH range [possibly a histidine] . No group with such characteristicsappears to be involved in the inhibition by arginine of T . maritimaNAGK, given the lack of influence on this inhibition of similarpH changes [Fig . 4B].

The replacement of L-arginine by arginine analogs revealed thatarginine is a highly specific inhibitor of T . maritima NAGK[data not shown] . Whereas the addition of 1 mM L-arginine caused95% inhibition [assayed at 37°C], the same concentrationof D-arginine or of agmatine [the product of arginine decarboxylation]caused no inhibition . The inability of agmatine to inhibit indicatesthat the -carboxylate group of arginine is essential . However,the negative charge on the -carboxylate appears unessential,since a 1 mM concentration of the methyl ester of L-argininewas strongly inhibitory [80% inhibition] . In contrast, neither1 mM citrulline nor 1 mM L-canavanine caused any substantial inhibition, and similarly, L-lysine, L-ornithine, putrescine,the guanidinium ion, and urea, tested at 1 mM concentrations,failed to inhibit the enzyme.

The enzyme exhibited hyperbolic kinetics for its two substrates irrespective of the assay temperature [tested at 37 and 75°C]and of the presence or absence of arginine [data not shown].At 75°C, arginine caused an important increase in the K_mof the enzyme for acetylglutamate [K_m^NAG], the only detrimentaleffect on enzyme functionality [Fig . 5, top panel], and thus,this mechanism may be the basic mechanism for the inhibitionin vivo of T . maritima NAGK by arginine . However, at 37°C,in addition to increasing the K_m^NAG, arginine substantiallydecreased the V_max, and at high concentrations it also modestlyincreased the K_m^ATP [Fig . 5, bottom panel].

 
T . maritima NAGK appears to be hexameric, and arginine does not alter the aggregation state of this enzyme. Cross-linking of T . maritima NAGK with dimethyl suberimidateresulted in the generation of multiple bands in SDS-PAGE [Fig.6A] of decreasing intensity with increasing mass, migratingas expected for oligomers of 2, 3, 4, 5, and 6 subunits [thelast is too faint to be seen in Fig . 6A] . The decrease in theintensity with the increasing number of cross-linked subunitsis to be expected for partial efficiency for the cross-linkingof every pair of interacting chains . Thus, these results suggestthat T . maritima NAGK oligomerizes at least to hexamers.

 
An independent confirmation that T . maritima NAGK is hexameric was obtained by using size exclusion chromatography on Superdexat 24°C, which revealed the elution of the enzyme as anapproximately symmetrical peak [Fig . 6B] at a position fitting the expectation for a hexamer [Fig . 6C] . Similar to T . maritimaNAGK, the NAGK from P . aeruginosa behaved in gel filtrationexperiments as expected for a hexamer, whereas E . coli NAGK,which is insensitive to arginine and which was shown by X-ray crystallography to be dimeric [15, 34], was eluted, as expectedfor a dimer, much later than the T . maritima and P . aeruginosaNAGKs [Fig . 6B and C] . The same elution patterns and positionswere observed with T . maritima and P . aeruginosa NAGKs whenthe buffer used in the gel filtration experiments was 50 mMTris-HCl-0.15 M NaCl, pH 7.5, as shown in Fig . 6, or when itwas 0.1 M K phosphate, pH 7.0 [data not shown], as used previouslyin gel filtration experiments with P . aeruginosa NAGK [17]. Similarly, the elution of these enzymes was not altered substantially by the addition to the enzyme solution and to the buffers of either 10 mM arginine or a mixture of 40 mM acetylglutamate,10 mM ATP, and 20 mM MgCl₂ [data not shown] . In the latter case, the nucleotide gave a high background optical absorption, butthe position of elution of the enzymes was corroborated by collecting fractions and measuring the protein in the fractions with the Bradford assay.

 
Our demonstrations that gene TM1784 encodes an arginine-inhibitable NAGK, of the apparent absence from the T . maritima genome of a gene for acetylglutamate synthase, and of the likely possibility that, as in Thermotoga neapolitana [28], argJ encodes in T.maritima a bifunctional transacetylase/acetylglutamate synthaseadd up to strongly suggest that T . maritima represents the firstexample of a variant cyclic route of arginine synthesis [Fig.1] that unites the characteristics of being controlled on theshort-term by feedback arginine inhibition of NAGK and of usingas an exclusive maker of acetylglutamate [either by recyclingor de novo synthesis] the product of gene argJ.

The sigmoidal inverse dependency with a relatively high Hill coefficient between NAGK activity and arginine concentrationis well suited for allowing arginine synthesis at basal cellconcentrations of arginine and for stopping this synthesis ratherabruptly above a certain arginine threshold, provided that thisthreshold is adequately set . The increase in the I_0.5 of argininefor T . maritima NAGK appears to be a necessary adaptation toset this threshold, at the high living temperatures of T . maritima, within the same range of controlling arginine concentrationsas that for P . aeruginosa at 37°C . The increase in the I_0.5 with increasing temperature can be explained if the temperature influences the equilibrium between the high- and low-affinity conformations in which the arginine site must exist accordingto classical allosteric theory [30], with the high temperatures favoring the occurrence of the low-affinity conformation . This effect of temperature appears not to be an exclusive propertyof T . maritima NAGK, since the K_i value of arginine for Chlamydomonasreinhardtii NAGK was reported to increase when the temperaturewas raised from 15 to 37°C [10].

At 75°C, arginine is a K-type allosteric inhibitor [30] of T . maritima NAGK, since its only detrimental effect on the activity of the enzyme is to increase the K_m^NAG . In other well-studiedexamples of arginine-sensitive NAGKs [10, 18], the apparentaffinity for acetylglutamate is also decreased by arginine,although in the case of P . aeruginosa NAGK this effect resultsfrom a change in the kinetics for acetylglutamate from hyperbolicto sigmoidal [18] . The latter observation, the multiplicityof the kinetic effects of arginine at 37°C in T . maritimaNAGK [decreased V_max, somewhat increased K_m^ATP, and increased K_m^NAG; see above], and the structural and chemical characteristicsof the acetylglutamate site [characterized structurally in E.coli NAGK [15, 34]] appear to exclude direct physical competition between arginine and acetylglutamate for the same site as the mechanism by which arginine decreases the affinity for acetylglutamate. Indeed, the present and previous [24] findings highlight theexquisite specificity of arginine-sensitive NAGKs for the inhibitor,strongly supporting the existence of a distinct arginine sitewhich, in accordance with the sigmoidicity and value of theHill coefficient, must be present in T . maritima NAGK with amultiplicity of at least four nonindependent sites per enzyme molecule and which, given the results with arginine analogs [reference 24 and present results], must bind arginine in a highly stereospecific way according to the principle of three-point attachment [13].

Since from the present data the arginine-sensitive NAGKs from T . maritima and P . aeruginosa appear hexameric, whereas the arginine-insensitive NAGK of E . coli is dimeric, the hexameric architecture may be a key determinant of arginine sensitivity among NAGKs, in addition to providing the structural basis forthe sigmoidal nature and high Hill coefficient of the inhibitionby arginine . In earlier gel filtration experiments [17] performedat 4°C and taking many hours, arginine triggered the partialdissociation of P . aeruginosa NAGK oligomers [which in retrospectmay be reinterpreted as hexamers] . However, we find at 24°Cand on a much shorter time scale [<1 h] no hexamer dissociation triggered by arginine with P . aeruginosa or T . maritima NAGK,and thus the differences between active and inactive NAGK must be subtler than hexamer disaggregation.

The present study reveals that the thermostability among thethree NAGKs that have been studied here increases in the orderE . coli < P . aeruginosa < T . maritima, conforming withthe recent proposal that a high degree of aggregation is animportant determinant of enzyme thermostability [38], since the less stable of these three NAGKs is a dimer whereas theother two appear hexameric [Fig . 3A] . Comparison of the two hexameric NAGKs for classical markers of thermostability [21, 22, 32, 37] reveals that the T . maritima enzyme, which withstands temperatures 15 to 20°C higher than P . aeruginosa NAGK,has, relative to the latter enzyme, fewer glutamine residues[three versus eight; glutamines can be deamidated at high temperature]and a larger proportion of aliphatic [30 versus 25%] and charged[28 versus 23%] residues . T . maritima NAGK also differs in thesetraits from E . coli NAGK [which has 11 glutamines and 26% aliphaticand 21% charged residues], supporting the importance of suchtraits for NAGK thermostability . From these observations, itappears that in T . maritima NAGK the risk of thermal deamidationis decreased, the compactness and hydrophobicity of the enzymeinterior is increased by the elevation in the proportion ofaliphatic apolar residues, the number of ion pairs is also increasedas revealed by the elevated number of charged residues, andthe new intersubunit interactions found in the hexamer but notpresent in the dimeric E . coli NAGK strengthen and give furtherresilience to the structure . For a more direct analysis of theimportance of these factors for the thermostability of NAGK,and for understanding in physical terms the mechanism of NAGKinhibition by arginine, the determination of the three-dimensionalstructures of the P . aeruginosa and T . maritima NAGKs appearsnecessary . Crystallographic studies with these enzymes are currentlybeing carried out in our laboratory and might soon provide thismuch-sought structural information.

 
This work was supported by grant BMC2001-2182 of the SpanishMinistry of Science and Technology . M.L.F.-M., F.G.-O., andJ.L.L . are fellows of Fundación Carolina, FundaciónFerrer, and Instituto de Salud Carlos III, respectively.

We thank Juan J . Calvete [IBV-CSIC, Valencia, Spain] for N-terminal sequencing and mass spectrometry, Francis E . Jenney, Jr . [Department of Biochemistry, University of Georgia, Athens], for providing the genomic DNA from T . maritima, and A . E . Gatenby [DuPontde Nemours] for providing pGroESL.

 
* Corresponding author . Mailing address: Instituto de Biomedicina de Valencia [IBV-CSIC], C/ Jaime Roig 11, 46010-Valencia, Spain . Phone: 34 96 339 17 72 . Fax: 34 96 369 08 00 . E-mail: rubio@ibv.csic.es .

1. Abadjieva, A., K . Pauwels, P . Hilven, and M . Crabeel. 2001 . A new yeast metabolon involving at least the two first enzymes of arginine biosynthesis: acetylglutamate synthase activity requires complex formation with acetylglutamate kinase . J . Biol . Chem . 276:42869-42880 .
2. Achenbach-Richter, L., R . Gupta, K . O . Stetter, and C . R . Woese. 1987 . Were the original eubacteria thermophiles? Syst . Appl . Microbiol . 9:34-39.
3. Adams, M . W. 1994 . Biochemical diversity among sulfur-dependent, hyperthermophilic microorganisms . FEMS Microbiol . Rev . 15:261-277.
4. Alonso, E., and V . Rubio. 1987 . Inactivation of mitochondrial carbamoyl phosphate synthetase induced by ascorbate, oxygen, and Fe³⁺ in the presence of acetylglutamate: protection by ATP and HCO₃^– and lack of inactivation of ornithine transcarbamylase . Arch . Biochem . Biophys . 258:342-350.
5. Bradford, M . M. 1976 . A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding . Anal . Biochem . 72:248-254.
6. Caldovic, L., and M . Tuchman. 2003 . N-Acetylglutamate and its changing role through evolution . Biochem . J . 372:279-290.
7. Cunin, R., N . Glansdorff, A . Pierard, and V . Stalon. 1986 . Biosynthesis and metabolism of arginine in bacteria . Microbiol . Rev . 50:314-352.
8. Cybis, J., and R . H . Davis. 1975 . Organization and control in the arginine biosynthetic pathway of Neurospora. J . Bacteriol . 123:196-202.
9. Davis, G . E., and G . R . Stark. 1970 . Use of dimethyl suberimidate, a cross-linking reagent, in studying the subunit structure of oligomeric proteins . Proc . Natl . Acad . Sci . USA 66:651-656.
10. Dénes, G. 1973 . N-Acetylglutamate-5-phosphotransferase, p . 511-520 . In P . D . Boyer [ed.], The enzymes, 3rd ed., vol . IX . Academic Press, New York, N.Y.
11. Dimova, D., P . Weigel, M . Takahashi, F . Marc, G . D . Van Duyne, and V . Sakanyan. 2000 . Thermostability, oligomerization and DNA-binding properties of the regulatory protein ArgR from the hyperthermophilic bacterium Thermotoga neapolitana. Mol . Gen . Genet . 263:119-130.
12. Fernández-Murga, M . L., S . Ramon-Maiques, F . Gil-Ortiz, I . Fita, and V . Rubio. 2002 . Towards structural understanding of feedback control of arginine biosynthesis: cloning and expression of the gene for the arginine-inhibited N-acetyl-L-glutamate kinase from Pseudomonas aeruginosa, purification and crystallization of the recombinant enzyme and preliminary X-ray studies . Acta Crystallogr . Sect . D Biol . Crystallogr . 58:1045-1047.
13. Fersht, A. 1985 . Enzyme structure and mechanism . Freeman, New York, N.Y.
14. Gil, F., S . Ramon-Maiques, A . Marina, I . Fita, and V . Rubio. 1999 . N-Acetyl-L-glutamate kinase from Escherichia coli: cloning of the gene, purification and crystallization of the recombinant enzyme and preliminary X-ray analysis of the free and ligand-bound forms . Acta Crystallogr . Sect . D Biol . Crystallogr . 55:1350-1352.
15. Gil-Ortiz, F., S . Ramón-Maiques, I . Fita, and V . Rubio. 2003 . The course of phosphorus in the reaction of N-acetyl-L-glutamate kinase, determined from the structures of crystalline complexes, including a complex with an AlF₄^– transition state mimic . J . Mol . Biol . 331:231-244.
16. Goloubinoff, P., A . A . Gatenby, and G . H . Lorimer. 1989 . GroE heat-shock proteins promote assembly of foreign prokaryotic ribulose bisphosphate carboxylase oligomers in Escherichia coli. Nature 337:44-47.
17. Haas, D., and T . Leisinger. 1975 . N-Acetylglutamate 5-phosphotransferase of Pseudomonas aeruginosa. Purification and ligand-direct association-dissociation . Eur . J . Biochem . 52:365-375.
18. Haas, D., and T . Leisinger. 1975 . N-Acetylglutamate 5-phosphotransferase of Pseudomonas aeruginosa. Catalytic and regulatory properties . Eur . J . Biochem . 52:377-383.
19. Huber, R., and K . O . Stetter. 1992 . The order Thermotogales, p . 3809-3815 . In A . Balows, H . G . Trüper, M . Dworkin, W . Harder, and K . H . Schleifer [ed.], The procaryotes . Springer, Berlin, Germany.
20. Huber, R., T . A . Langworthy, H . König, M . Thomm, M . Woese, U . B . Sleytr, and K . O . Stetter. 1986 . Thermotoga maritima sp . nov . represents a new genus of unique extremely thermophilic eubacteria growing up to 90°C . Arch . Microbiol . 144:324-333.
21. Karshikoff, A., and R . Ladenstein. 2001 . Ion pairs and the thermotolerance of proteins from hyperthermophiles: a "traffic rule" for hot roads . Trends Biochem . Sci . 26:550-556.
22. Ladenstein, R., and G . Antranikian. 1998 . Proteins from hyperthermophiles: stability and enzymatic catalysis close to the boiling point of water . Adv . Biochem . Eng . Biotechnol . 61:37-85.
23. Laemmli, U . K. 1970 . Cleavage of structural proteins during the assembly of the head of bacteriophage T4 . Nature 227:680-685.
24. Leisinger, T., C . O'Sullivan, and D . Haas. 1974 . Arginine analogues: effect on growth and on the first two enzymes of the arginine pathway in Pseudomonas aeruginosa. J . Gen . Microbiol . 84:253-260.
25. Lesley, S . A., P . Kuhn, A . Godzik, A . M . Deacon, I . Mathews, A . Kreusch, G . Spraggon, H . E . Klock, D . McMullan, T . Shin, J . Vincent, A . Robb, L . S . Brinen, M . D . Miller, T . M . McPhillips, M . A . Miller, D . Scheibe, J . M . Canaves, C . Guda, L . Jaroszewski, T . L . Selby, M . A . Elsliger, J . Wooley, S . S . Taylor, K . O . Hodgson, I . A . Wilson, P . G . Schultz, and R . C . Stevens. 2002 . Structural genomics of the Thermotoga maritima proteome implemented in a high-throughput structure determination pipeline . Proc . Natl . Acad . Sci . USA 99:11664-11669 .
26. Maas, W . K., G . D . Novelli, and F . Lipmann. 1953 . Acetylation of glutamic acid by extracts of Escherichia coli. Proc . Natl . Acad . Sci . USA 39:1004-1008.
27. Makarova, K . S., A . A . Mironov, and M . S . Gelfand. 2001 . Conservation of the binding site for the arginine repressor in all bacterial lineages . Genome Biol . 2:research0013.1-0013.8 . [Online.] http://genomebiology.com/2001/2/4/RESEARCH/0013.
28. Marc, F., P . Weigel, C . Legrain, Y . Almeras, M . Santrot, N . Glansdorff, and V . Sakanyan. 2000 . Characterization and kinetic mechanism of mono- and bifunctional ornithine acetyltransferases from thermophilic microorganisms . Eur . J . Biochem . 267:5217-5226 .
29. Marco-Marin, C., S . Ramon-Maiques, S . Tavarez, and V . Rubio. 2003 . Site-directed mutagenesis of Escherichia coli acetylglutamate kinase and aspartokinase III probes the catalytic and substrate-binding mechanisms of these amino acid kinase family enzymes and allows three-dimensional modelling of aspartokinase . J . Mol . Biol . 334:459-476.
30. Monod, J., J . Wyman, and J . P . Changeux. 1965 . On the nature of allosteric transitions: a plausible model . J . Mol . Biol . 12:88-118.
31. Morizono, H., M . Tuchman, B . S . Rajagopal, M . T . McCann, C . D . Listrom, X . Yuan, D . Venugopal, G . Barany, and N . M . Allewell. 1997 . Expression, purification and kinetic characterization of wild-type human ornithine transcarbamylase and a recurrent mutant that produces 'late onset' hyperammonaemia . Biochem . J . 322:625-631.
32. Mozhaev, V . V. 1993 . Mechanism-based strategies for protein thermostabilization . Trends Biotechnol . 11:88-95.
33. Nelson, K . E., R . A . Clayton, S . R . Gill, M . L . Gwinn, R . J . Dodson, D . H . Haft, E . K . Hickey, J . D . Peterson, W . C . Nelson, K . A . Ketchum, L . McDonald, T . R . Utterback, J . A . Malek, K . D . Linher, M . M . Garrett, A . M . Stewart, M . D . Cotton, M . S . Pratt, C . A . Phillips, D . Richardson, J . Heidelberg, G . G . Sutton, R . D . Fleischmann, J . A . Eisen, O . White, S . L . Salzberg, H . O . Smith, J . C . Venter, and C . M . Fraser. 1999 . Evidence for lateral gene transfer between archaea and bacteria from genome sequence of Thermotoga maritima. Nature 399:323-329.
34. Ramón-Maiques, S., A . Marina, F . Gil-Ortiz, I . Fita, and V . Rubio. 2002 . Structure of acetylglutamate kinase, a key enzyme for arginine biosynthesis and a prototype for the amino acid kinase enzyme family, during catalysis . Structure [Cambridge] 10:329-342.
35. Ramon-Maiques, S., H . G . Britton, and V . Rubio. 2002 . Molecular physiology of phosphoryl group transfer from carbamoyl phosphate by a hyperthermophilic enzyme at low temperature . Biochemistry 41:3916-3924.
36. Van de Casteele, M., M . Demarez, C . Legrain, N . Glansdorff, and A . Pierard. 1990 . Pathways of arginine biosynthesis in extreme thermophilic archaeo- and eubacteria . J . Gen . Microbiol . 136:1177-1183.
37. Vieille, C., D . S . Burdette, and J . G . Zeikus. 1996 . Thermozymes . Biotechnol . Annu . Rev . 2:1-83.
38. Villeret, V., B . Clantin, C . Tricot, C . Legrain, M . Roovers, V . Stalon, N . Glansdorff, and J . Van Beeumen. 1998 . The crystal structure of Pyrococcus furiosus ornithine carbamoyltransferase reveals a key role for oligomerization in enzyme stability at extremely high temperatures . Proc . Natl . Acad . Sci . USA 95:2801-2806 .

Free Online Full-text Article

What Is Prokaryote?, What Is Molecular Microbiology?, What Is Antibiotic?, What Is Bioassay?, What Is Water Purification?, r, Microbes, n, Bacterium, s, Microorganism, i, Microbe, n, Bacteriology, i, Meningococcus, a, Antibiotics, o, Prokaryotes, c, Pseudomonas, s, Pasteurella, a, Pseudomonas, c, Haemophilus, r, Bacteriological, r, Citrobacter, c, Yeasts, e, Streptococcal, i, Microorganism, e, Escherichia coli, c, Providencia, i, Pseudomonas, c, Microbial, c, Agrobacterium, i, Streptococci, a, Bacillus, c, Microbial, n, Bacillus




 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005