J Biol Chem, 1980 Feb 25, 255(4), 1635 - 42 Escherichia coli phosphoenolpyruvate carboxylase . Studies on the mechanism of synergistic activation by nucleotides; Smith TE et al.; Kinetic studies were done to obtain a quantitative estimation of the synergistic interactions that occur between phosphoenolpyruvate carboxylase (orthophosphate:oxaloacetate carboxylase (phosphorylating) E.C . 4.1.1.31) from Escherichia coli K12 and various combinations of its primary substrate, P-enolpyruvate, and the activators acetylcoenzyme A, CDP, GTP, and fructose 1,6-bisphosphate . The analysis involves the evaluation of apparent K values, KS for P-enolpyru;ate and KA for activators, as a function of the concentration of P-enolpyruvate or another activator in the case of KA determinations . Methods are presented which allow the determination of dissociation constants for P-enolpyruvate and activators from binary, ternary, and quaternary complexes of enzyme with substrates or activators, or both . It was observed that synergistic activation occurs with acetyl coenzyme A and all of the coactivators but not with fructose 1,6-bisphosphate and the other co-activators . The enhancement of binding from the binary enzyme substrate (or activator) complex to the ternary or quaternary complexes is in the range of 100-fold . The dissociation constants for P-enolpyruvate, acetyl coenzyme A, CDP, and fructose 1,6-bisphosphate are the same from any active enzyme species . Synergistic activation by multiple activators reflects the ability of co-activators to shift the equilibrium concentrations of active enzyme species away from the inactive forms via a modified "cascade" scheme, thus decreasing the probability that dissociation of any one activator will yield an inactive enzyme species. Nucleic Acids Res, 1980 Feb 25, 8(4), 845 - 54 DNA gyrase stimulates transcription; Akrigg A et al.; The nuclear DNA of HeLa cells can now be isolated unbroken and supercoiled . Using DNA gyrase and the untwisting enzyme, we have prepared an allomorphic series of templates derived from this nuclear DNA, and also from the circular DNA of the bacterial virus, PM2 . We have then transcribed these templates using 2 different RNA polymerases--from wheat germ and Escherichia coli . Relaxed DNA is transcribed slowly by both polymerases . Supertwisting the naturally-supercoiled templates with gyrase slightly inhibits transcription by the bacterial polymerase but stimulates dramatically transcription by RNA polymerase II from wheat germ. Nucleic Acids Res, 1980 Feb 25, 8(4), 759 - 66 Interaction of the cAMP receptor protein with the lac promoter; Simpson RB; The cyclic AMP receptor protein (CRP) stimulates transcription of the lactose operon by binding to the lac promoter . I have identified those 5-positions of thymines in the promoter that lie close to bound CRP . Although ultraviolet irradiation of DNA with 5-bromouracil substituted in place of thymine normally cleaves the DNA at the bromouracils, a protein bound to the DNA can perturb these cleavages at those locations at which the protein lies close to the bromine . The contacts inferred from this photochemical probe and the results of nucleolytic attack of this complex by exonuclease III support a model where the cyclic AMP receptor protein binds to the promoter making symmetrical contacts with one face of the double helix and then stimulates transcription through contacts with RNA polymerase. J Biol Chem, 1980 Feb 25, 255(4), 1623 - 9 Phosphatidic acid accumulation in the membranes of Escherichia coli mutants defective in CDP-diglyceride synthetase; Ganong BR et al.; CTP-phosphatidic acid cytidylyltransferase (CDP-diglyceride synthetase) is a key enzyme in the biogenesis of membrane phospholipids in Escherichia coli . Using a modification of a previously described autoradiographic screening procedure (Raetz, C . R . H . (1975) Proc . Natl . Acad . Sci . U.S.A . 72, 2274-2278), we have isolated six mutant strains in which the specific activity of the synthetase is 1 to 10% that of the wild type, as judged by in vitro assays . The synthesis of dCDP-diglyceride, as well as CDP-diglyceride, is defective in these organisms . The mutations responsible for the enzyme defects (designated cds) all map in the same location near minute 4 on the chromosome . Although none of the mutants obtained are temperature-sensitive for growth, all of them exhibit significantly elevated levels of phosphatidic acid in vivo . The highest increase is observed in the mutant GL60, in which phosphatidic acid constitutes about 5% of the membrane lipid, in contrast to 0.2% in typical wild type strains . The accumulation of phosphatidic acid occurs primarily at the expense of phosphatidylglycerol and cardiolipin, but the total lipid-to-protein ratio of GL60 is nearly normal . In vivo labeling of GL60 with 32Pi suggests that the increased phosphatidic acid pool is the result of a partial metabolic block early in the phospholipid pathway, but that most of this expanded pool is nonetheless available for de novo synthesis. Biochemistry, 1980 Feb 19, 19(4), 643 - 7 Synthesis of 8-14C-labeled O6-methyldeoxyguanosine and its deoxynucleotide copolymers; Abbott PJ et al.; To study the nature and repair of the promutagenic DNA lesion O6-methylguanine, we have synthesized 8-14C-labeled O6-methyldeoxyguanosine triphosphate and investigated the kinetics of its incorporation into the synthetic copolymers poly(dC'm6dG) and poly(dT,m6dG) . Deoxy{8-14C}guanosine was methylated with ethereal diazomethane and the products were separated by high-pressure liquid chromatography . O6-Methyldeoxy{14C}guanosine was converted to the 5'-monophosphate with carrot phosphotransferase and then to the 5'-triphosphate via the phosphorimidazolidate formed by the action of N,N'-carbonyldiimidazole . Although m6dGTP was a poor substrate for Escherichia coli DNA polymerase I, copolymers could be synthesized from dCTP or dTTP and m6dGTP with terminal deoxynucleotidyl transferase . The percent of m6dG in the polymer increased linearly as the percentage of m6dGTP in the polymerization mixture was increased to 20% of the total . The percent incorporation of m6dGTP into poly(dT,m6dG) was, however, higher than into poly(dC,m6dG) . Good yields of both polymers were readily obtained . The stability of O6-methyldeoxyguanosine in poly(dT,m6dG) was found to be pH dependent, and the half-life has been measured at four different pH values. Experientia, 1980 Feb 15, 36(2), 215 - 6 The effect of endotoxin on plasma alpha-aminoisobutyric acid; Kuttner RE et al.; The i.v . injection of bacterial endotoxin into dogs was found to cause a rapid increase in plasma levels of infused alpha-aminoisobutyric acid . The findings suggest that nonmetabolic factors (tissue uptake, fluid shifts) influence amino acid distribution during endotoxemia. Boll Soc Ital Biol Sper, 1980 Feb 15, 56(3), 238 - 44 {New 5'-sulfurated nucleosides as inhibitors of the biosynthesis of polyamines}; Cacciapuoti G et al.; The inhibitory effect of the deaminated analogs of S-adenosyl(5')-3-methylthiopropylamine on spermidine synthase (EC 2.5.1.16.) from E . coli, AdoMet decarboxylase (EC 4.1.1.50.) from human placenta and E . coli and AdoMet lyase (EC 3.3.1.-) from rat liver have been reported . 5'-isobutylthioadenosine, a new powerful antiproliferative drug has been assayed as substrate of MTA phosphorylase (EC 2.4.2.1) . The apparent Km is 1,8x10(-5) M . The inhibitory effect of 5'-isobutylthiadenosine on AdoMet lyase and spermidine synthase was also demonstrated. Science, 1980 Feb 15, 207(4432), 777 - 9 Cell growth with trans fatty acids is affected by adenosine 3',5'-monophosphate and membrane fluidity; Tsao YK et al.; Two positional isomers (9 and 11) of trans octadecenoates did not support growth on glucose of an Escherichia coli mutant that requires unsaturated fatty acids . However, the trans fatty acids provided sufficient fluidity to produce much higher cell yields when the concentration of adenosine 3',5'-monophosphate was raised . The effectiveness of the trans acids rose from 0 to 1 cell per femtomole to 15 to 20 cells per femtomole as the concentration of adenosine 3',5'-monophosphate was increased . The corresponding cis positional isomers supported high yields (35 to 40 cells per femtomole) independent of supplementation . The enhanced growth with adenosine 3',5'-monophosphate supplementation is not due to an increased uptake and incorporation of the trans isomers relative to the cis isomers, since the 9-trans isomer was incorporated more rapidly than the 9-cis isomer into the membrane phospholipids under all growth conditions and represented 21 +/- 2 mole percent of the acids . The finding that cells growing with trans fatty acid isomers have a higher requirement for adenosine 3',5'-monophosphate may indicate that some fatty acids can alter the metabolic regulation normally exerted by the cyclic nucleotide. Nucleic Acids Res, 1980 Feb 11, 8(3), 643 - 56 Transfer RNA structure by carbon NMR: C2 of adenine, uracil and cytosine; Schmidt PG et al.; Fourier transform 13C NMR spectra of E . coli tRNA enriched on 13C in either position 2 of adenine (60 atom % 13C) or in position 2 of uracil (82%) and cytosine (63%) were taken at 25.16 MHz over the temperature range 10 degrees - 76 degrees . For C2 of adenine the peak as initially 5 ppm wide, but narrowed to 0.5 ppm as the molecule unfolded . C2 of uracil displayed behavior similar to that of adenine while the cytosine peak, initially relatively narrow at low temperature, sharpened less dramatically . Comparison of spectra at 26.16 MHz and 67.9 MHz showed that the peak widths for folded tRNA were determined largely by chemical shift non-equivalence . T2 T2 measurements suggested that intrinsic line widths of most cytosine C2 peaks were 4 Hz and 2-3 Hz for uracil . Adenine C2 with a directly bonded proton had resonances of about 40 Hz line width . T1 values were measured for C2 of adenine and the ribose carbons of tRNA . Consideration of dipolar relaxation and chemical shift anisotrophy led to a calculated rotational correlation time of 1.6 +/- 0.4 x 10(-8) sec for the adenines and 1.3 +/- 0.3 x 10(-8) sec for the ribose carbons. Nucleic Acids Res, 1980 Feb 11, 8(3), 611 - 22 Photoaddition of trimethylpsoralen as a probe for the intracellular organization of Escherchia coli DNA; Hallick LM et al.; It has been previously demonstrated that photoreaction with 4,5',8-tri-methylpsoralen (trioxsalen) can be used as a probe for the in vivo structure of eucaryotic chromatin . We have used this probe to analyze the organization of intracellular Escherichia coli DNA . In contrast to eucaryotic DNA, bacterial DNA within the intact cell is not protected from saturating doses of trioxsalen photoaddition . The final level of covalently bound trioxsalen upon saturation is identical to that found with purified DNA . In addition, the distribution of interstrand DNA cross-links formed by low doses of trioxsalen photoadducts does not exhibit the repeating pattern that has been observed with eucaryotic nucleosomes. Nucleic Acids Res, 1980 Feb 11, 8(3), 487 - 506 Sequence-specific interactions of the tight-binding I12-X86 lac repressor with non-operator DNA; Schmitz A et al.; The tight-binding I12-X86 lac repressor binds to non-operator DNA in a sequence-specific fashion . Using the DNA of the E . coli I gene we have investigated these sequence-specific interactions and compared them to the operator binding of wild-type repressor . The specific, non-operator DNA interactions are sensitive to the inducer IPTG . One strong binding site in the I gene DNA was found to be one of two expected on the basis of their homology with the lac operator . The binding of I12-X86 repressor to this site was visualized using the footprinting technique, and found to be consistent with an operator-like binding configuration . The protection pattern extends into an adjacent sequence suggesting that two repressor tetramers are bound in tandem. Nucleic Acids Res, 1980 Feb 11, 8(3), 543 - 54 Adenovirus terminal protein protects single stranded DNA from digestion by a cellular exonuclease; Dunsworth-Browne M et al.; Adenovirus 5 DNA-protein complex is isolated from virions as a duplex DNA molecule covalently attached by the 5' termini of each strand to virion protein of unknown function . The DNA-protein complex can be digested with E . coli exonuclease III to generate molecules analogous to DNA replication intermediates in that they contain long single stranded regions ending in 5' termini bound to terminal protein . The infectivity of pronase digested Adenovirus 5 DNA is greatly diminished by exonuclease III digestion . However, the infectivity of the DNA-protein complex is not significantly altered when up to at least 2400 nucleotides are removed from the 3' ends of each strand . This indicates that the terminal protein protects 5' terminated single stranded regions from digestion by a cellular exonuclease . DNA-protein complex prepared from a host range mutant with a mutation mapping in the left 4% of the genome was digested with exonuclease III, hybridized to a wild type restriction fragment comprising the left 8% of the genome, and transfected into HeLa cells . Virus with wild type phenotype was recovered at high frequency. J Biol Chem, 1980 Feb 10, 255(3), 865 - 9 Amino acid substitutions in protein biosynthesis . Poly(A)-directed polyphenylalanine synthesis; Pezzuto JM et al.; The fidelity of protein biosynthesis in vitro was studied quantitatively in a well defined system that employed poly(A) as a message for the elaboration of phenylalanine-containing polypeptides from Escherichia coli phenylalanyl-tRNALys . Admixture of phenylalanyl-tRNALys and lysyl-tRNALys in three different ratios resulted in the efficient formation of peptides that contained the amino acids in the same ratios in which they had been utilized in the individual incubation mixtures . The incorporation was also shown to be codon-specific in a quantitative sense; the poly(A)-directed incorporation of {14C}phenylalanine from phenylalanyl-tRNALys was unaffected by {3H}phenylalanyl tRNAPhe, by arginyl-tRNA (one species of which responds to the codon triplet AGA) or by unfractionated E . coli tRNA . These findings suggest that the transfer of amino acids from (misacylated) tRNAs into polypeptides in vitro is as predicted by the adapter hypothesis and that such systems can operate with sufficient fidelity to permit the preparation of proteins having defined amino acid substitutions. J Biol Chem, 1980 Feb 10, 255(3), 813 - 5 The rapid purification of T4 DNA ligase from a lambda T4 lig lysogen; Tait RC et al.; A procedure has been developed for the rapid purification of the enzyme T4 DNA ligase . The procedure involves the induction at 42 degrees C of a lambda lysogen containing the gene for T4 DNA ligase (Murray, N.E., Bruce, S.A., and Murray, K . (1979) J . Mol . Biol . 132, 493-504), followed by purification of the ligase activity by phosphocellulose and hydroxylapatite chromatography . This results in the purification of large amounts of ligase with very high specific activity . The enzyme is free of contaminating exo- and endonuclease activities and active in the ligation of DNA fragments possessing cohesive or blunt-end termini. J Biol Chem, 1980 Feb 10, 255(3), 1107 - 12 Evidence for the identity and some comparative properties of alpha-ketoglutarate and 2-keto-4-hydroxyglutarate dehydrogenase activity; Gupta SC et al.; Enzyme preparations of pig heart and Escherichia coli are shown to catalyze a NAD+- and CoASH-dependent oxidation of 2-keto-4-hydroxyglutarate . Several independent lines of evidence support the conclusion that this hydroxyketo acid is a substrate for the well known alpha-ketoglutarate dehydrogenase complex of the citric acid cycle . The evidence includes (a) a constant ratio of specific activity values for the two substrates through several steps of purification, (b) identical elution profiles from a calcium phosphate gel-cellulose column and a constant ratio of specific activity toward the two substrates throughout the activity peak, (c) identical inactivation curves in controlled heat denaturation studies, (d) the same pH activity curves, (e) no effect on the oxidation of either keto acid by repeated freezing and thawing of dehydrogenase preparations, and (f) the same activity pattern when the E . coli complex is distributed into several fractions by sucrose density gradient centrifugation . Additionally, the same cofactors are required for maximal activity and glyoxylate inhibits the oxidation of either substrate noncompetitively . Ferricyanide-linked oxidation of 2-keto-4-hydroxyglutarate yields malate as the product and a 1:2:1 stoichiometric relationship is obtained between the amount of hydroxyketo acid oxidized, ferricyanide reduced, and malate formed. J Biol Chem, 1980 Feb 10, 255(3), 1096 - 106 Initiation of DNA replication by the dnaG protein; Benz EW Jr et al.; Highly purified preparations of dnaG protein from Escherichia coli prime minus strand synthesis of phage alpha 3 DNA in vitro . This protein synthesizes primer oligonucleotides which may be composed of ribonucleotide or deoxyribonucleotide moieties or both . The presence of deoxyribonucleotide moieties in the chain limits primer chain length; this effect occurs even when ribonucleoside triphosphates are included in the priming reaction . The dnaG protein can use ADP in place of ATP . Primer formation by dnaG protein is strictly stoiochiometric in vitro; one molecule of dnaG protein is required to prime one molecule of alpha 3 DNA . All of these primers are equally efficient in the subsequent elongation reaction with DNA elongation factors I and III, dnaZ gene product, and DNA polymerase III to form RFII . The site recognized by dnaG protein on alpha 3 DNA in vitro is within the same region of the alpha 3 chromosome as the origin of replication in vivo . Structural properties of this site are crucial to dnaG action in vitro . No other enzymatic activity for dnaG protein has been detected. J Biol Chem, 1980 Feb 10, 255(3), 1128 - 37 The structure and aminoacylation of a temperature-sensitive tRNATrp (Escherichia coli); Eisenberg SP et al.; A temperature-sensitive (t.s.) tRNATrp from Escherichia coli has a single base change from the wild type (w.t.) species, which results in the loss of a base pair at the bottom of the CCA stem of the cloverleaf structure . Thermodynamic studies on this t.s . tRNA show that it is more susceptible to denaturation than the w.t . due to a larger change in the entropy of denaturation . Correlated with this thermodynamic result is the finding that the denatured t.s . tRNA's T psi C loop is more susceptible to digestion by T1 RNase, suggesting that it has greater freedom than the corresponding structure on the denatured w.t . molecule . In contrast, the native form of the t.s . tRNATrp is very similar to the w.t . with regard to aminoacylation, T1 RNase susceptibility, and column chromatographic mobility, despite the fact that it necessarily has one less base pair . In addition, the well known denaturation-dependent shift in column chromatographic mobility, which is observed for both the t.s . and w.t . molecules, depends on a modification in the anticodon loop, since tRNATrp lacking that modification does not shift when denatured . Thus, though it is not usually thought to be implicated, denaturation probably affects the conformation of the anticodon loop . The lethal phenotype of the mutant at high temperature, defective attenuation of the tryptophan biosynthetic operon in the mutant, and some aspects of the denatured state are clarified by these findings. J Biol Chem, 1980 Feb 10, 255(3), 1124 - 7 Investigations on the association of phosphatidylserine synthase with the ribosomal component from Escherichia coli; Louie K et al.; The CDP-1,2-diacyl-sn-glycerol (CDP-diacylglycerol):L-serine O-phosphatidyltransferase (EC 2.7.8.8, phosphatidylserine synthase) of Escherichia coli is the first enzyme in the pathway committed to the biosynthesis of the major lipid in E . coli, phosphatidylethanolamine . The enzyme is unique among the phospholipid biosynthetic enzymes due to its high affinity for ribosomes in crude extracts . We report here investigations which define the nature of this in vitro affinity for ribosomes . Phosphatidylserine synthase can be dissociated from ribosomes in the presence of various inorganic salts at high ionic strength . Dissociation was also brought about by cellular levels of the polyamine spermidine . These results suggest the interaction of the enzyme with ribosomes in vitro is primarily ionic in nature, and polyamines may prevent this interaction in vivo . In the presence of nonionic detergent-lipid substrate mixed micelles under assay conditions the enzyme is also dissociated from ribosomes . Dissociation does not occur in the presence of detergent alone or in the presence of lipids which are not substrates or products of the enzyme . This dissociation by lipid substrate indicates the enzyme is not associated with ribosomes during catalysis. Nature, 1980 Feb 7, 283(5747), 599 - 600 Post-transciptional control of coordinated ribosomal protein synthesis in Escherichia coli; Olsson MO et al.; The synthesis of the approximately 50 different ribosomal proteins (r proteins) is very well coordinated in Escherichia coli . As the r-protein genes are arranged in many different operons, placed at separate locations on the E . coli chromosome, it is not obvious how this coordination is maintained . The first indication that special controls are involved in the coordination came from the observations that merodiploid strains containing F' factors with some of the ribosomal genes also synthesise the r proteins in balanced amounts . The overall regulation of r-protein synthesis in reponse to changes in growth conditions is primarily mediated by changes in the rate of transcription of the r-protein genes . To investigate whether the gene dosage control seen in merodiploid strains is also transcriptional in nature or whether other mechanisms are involved, we compared the transcriptionof r-protein mRNA in haploid and merodiploid strains . It was found that the rate of transcription of the r-protein mRNA from the str-spc cluster of genes changes in proportion to the gene dosage and it is concluded that the expression of r-protein genes is adjusted by post-transcriptional control. Nature, 1980 Feb 7, 283(5747), 541 - 5 Sequence of the lactose permease gene; Buchel DE et al.; The nucleotide sequence of the lacY gene coding for lactose permease (M protein) in Escherichia coli has been determined . The sequence includes the intergenic regions between the lacZ (beta-galactosidase) and lacY genes as well as the region between the lacY and lacA (transacetylase) genes . Lactose permease is predicted to consist of 417 residues (71% nonpolar), resulting in a protein with a molecular weight of 46,504 . The reading frame was confirmed by the sequence of a nonsense mutation changing codon 33 from UGG to UAG. Biochemistry, 1980 Feb 5, 19(3), 596 - 600 Resolution and identification of iron-containing antigens in membrane vesicles from Escherichia coli; Owen P et al.; Iron-containing antigens present in membrane vesicles prepared from Escherichia coli ML 308-225 were analyzed by crossed immunoelectrophoresis following growth of the organism in the presence of 59Fe . Seven discrete antigens (or antigen complexes) are detected by autoradiography, and six contain primarily nonheme iron . Three immunoprecipitates are positively identified as NADH dehydrogenase (EC 1.6.99.3), NADPH dehydrogenase (EC 1.6.99.1), and glutamate dehydrogenase (EC 1.4.1.4) based on activity stains for these enzymes . Two other immunogens containing nonheme iron correspond to antigens no . 22 and 37 in the crossed immunoelectrophoresis reference pattern of Owen & Kaback {Owen, P., & Kaback, H . R . (1978) Proc . Natl . Acad . Sci . U.S.A . 75, 3148} . In addition, the immunoprecipitate corresponding to Braun's lipoprotein contains tightly bound iron. Biochemistry, 1980 Feb 5, 19(3), 451 - 7 Quantitative study of the fluidity of Escherichia coli membranes using deuterium magnetic resonance; Nichol CP et al.; Specifically deuterated palmitic acid was incorporated into the membrane phospholipids of the L51 strain of Escherichia coli . The cytoplasmic and outer membranes were separated by using standard techniques and studied by deuterium nuclear magnetic resonance between 0 and 40 degrees C . Distinctive liquid-crystalline and gel spectra were observed to coexist over a wide temperature range . The relative intensities of these spectra provided a direct measure of the fraction of the deuterium-labeled phospholipids in the fluid state as a function of temperature . Above 37 degrees C, the amount of immobilized or gel-phase phospholipid is estimated to be less than 3% of the total phospholipid . The gel to liquid-crystalline transition region for the outer membrane was shifted upwards by approximately 7 degrees C relative to that of the cytoplasmic membrane, in agreement with previous studies {Davis, J . H., Nichol, C . P., Weeks, G., & Bloom, M . (1979) Biochemistry 18, 2103} . The orientational order in the fluid phase of both membranes decreased gradually with increasing temperature and was greater in the outer membrane than in the cytoplasmic membrane . The orientational order of the gel-phase component was the same for both membranes, within an experimental uncertainty of 10%, and was independent of temperature from 0 to 30 degrees C for the outer membrane and from 10 to 30 degrees C for the cytoplasmic membrane. Biochemistry, 1980 Feb 5, 19(3), 526 - 31 Characterization of the inhibitory (epsilon) subunit of the proton-translocating adenosine triphosphatase from Escherichia coli; Sternweis PC et al.; The inhibitory subunit (epsilon) of the F1 adenosine triphosphatase (ATPase) was purified to homogeneity from the ML 308-225 and K12 (lambda) strains of Escherichia coli . No tryptophan or cysteine was detected in the subunit from either strain . The highly active epsilon from both strains was found to be a globular protein with a Stokes' radius of 18--19 A . Circular dichroism spectra suggested an alpha-helix content of approximately 40% . The molecular weight of epsilon was approximately 15000--16000 by sedimentation equilibrium centrifugation in the presence and absence of guanidinium hydrochloride, molecular sieve chromatography, and gel electrophoresis in the presence of sodium dodecyl sulfate and 8 M urea . The s20,w of epsilon was approximately 1.6 s-1 . Inhibition of the purified F1 ATPase by epsilon displayed noncompetitive kinetics with a Ki of approximately 10 nM . The inhibition of the ATPase was rapidly reversed by diluting the enzyme--epsilon mixture . {125I}epsilon which was incorporated into ECF1 was readily displaced by unlabeled epsilon . epsilon had no significant effect on the ATPase activity of "native" or reconstituted everted membrane vesicles under a variety of assay conditions . Combining the epsilon-inhibited F1 ATPase with its hydrophobic portion in everted membrane vesicles reconstituted the reversible proton-translocating ATPase and restored nearly full ATPase activity . These results suggest that epsilon inhibits the enzyme only when the F1 ATPase becomes detached from its hydrophobic subunits. Brain Res, 1980 Feb 3, 183(1), 135 - 43 Cerebellar tRNA methyltransferases: a developmental study; Dainat J et al.; Developmental patterns of homologous and heterologous tRNA methylation by cerebellar tRNA methyltransferases are described . The study revealed that: (a) homologous tRNA methylation results in the predominant formation of N2-methylguanine and 1-methyladenine; (b) tRNA methyltransferase of bulk-isolated Purkinje and granule cells methylate E . coli tRNAglu2 in vitro in a characteristic manner, and (c) the methylation of 8-day-old cerebellar, cortical and hepatic tRNA in vivo yields tRNAs containing different proportions of methylated bases . The findings suggest that the presumably cell-specific populations of cerebellar tRNA methyltransferases continue to alter their substrate recognition characteristics up to and beyond the first month of post-natal life. Am J Vet Res, 1980 Feb, 41(2), 264 - 6 Infectious bovine keratoconjunctivitis: effects of vaccination on Moraxella bovis carrier state in cattle; Pugh GW Jr et al.; A study was conducted to determine whether vaccination of cattle while they were undergoing an acute episode of infectious bovine keratoconjunctivitis (IBK), would cause vaccinated cattle to abort Moraxella bovis infection sooner than nonvaccinated cattle . Fourteen calves were allotted into two groups of seven calves each, and the eyes of each calf were exposed to a virulent culture of M bovis . Twenty days after calves were infected and showing signs of IBK, seven calves were vaccinated with M bovis pilus vaccine made from the exposure strain . Ocular and nasal discharges were collected and examined for M bovis for 64 days . Most calves developed signs of IBK after exposure and all but one calf (nonvaccinated) developed ocular infection with M bovis . The mean number of days (33 and 33.3, respectively) of ocular infection was not significantly (P = 0.05) different in the vaccinated calves than in the nonvaccinated calves . The eyes of the calf that did not become infected with M bovis were infected with nearly a pure culture of Escherichia coli . This calf failed to develop ocular infection, but had M bovis in its nasal discharge throughout the study (64 days) . Moraxella bovis was isolated from the nasal discharge of other calves only when there were concurrent ocular infections. No Shinkei Geka, 1980 Feb, 8(2), 167 - 72 {Subdural abscess in infant and child (author's transl}; Honda E et al.; Two cases of subdural abscess in infant and child treated with irrigation via burr holes were reported . The first case was a 1.4-year-old boy with right hemiparesis and mental retardation since severe head trauma at 9 months old . The patient with manifested with an acute onset of high fever followed by disturbance of consciousness and convulsive seizures 2.5 months prior to admission to our department . During admission in the other hospital, the diagnosis of septicemia caused by E . coli was made by blood cultures when CT scan demonstrated a huge lentiform low density area over the right hemisphere and contralateral crescent low density area . The low density area on the right side was well circumscribed by high density rim which was enhanced by contrast medium . Under the diagnosis of bilateral subdural abscess secondary to septicemia caused by E . coli, irrigation of the purulent cavity was carried out . The contralateral low density area was found to be chronic subdural effusion . The second case of 3-month-old infant who complained of high fever, neck stiffness, unconsciousness and right hemiconvulsions 8 days prior to admission . CT scan showed bilateral crescent low density areas indicating subdural effusion . Subdural punctures performed via the fontanelle revealed pus in the left subdural space and xanthocromic fluid in the right side . The low density area on CT scan was changed to the lentiform high density area circumscribed smooth high density rim during the course of the patient . The subdural abscess was treated with irrigation via burr holes . In this report, the etiology of the subdural abscess and route of infection in addition to follow up study of CT findings were presented with the literature. Can J Microbiol, 1980 Feb, 26(2), 232 - 4 A unique environmental occurrence of hydrogen sulfide positive Escherichia coli; Roberts NC et al.; For the first time in nearly 4 decades of surveillance, H2S positive Escherichia coli have been isolated from Calcasieu Lake and River . These results are reported because of recent clinical interest in these organisms. Biochem J, 1980 Feb 1, 185(2), 463 - 71 Precolicin E1, the major gene product of plasmid-ColE1 deoxyribonucleic acid in vitro; Watson DH; Coupled transcription and translation of plasmid-ColE1 DNA in vitro under optimized conditions gave one major product . This has an apparent weight of 71 000, the same N-terminal sequence as colicin E1 and was not digested by deoxyribonuclease or ribonuclease . It differed from colicin E1 in its C-terminal residue and amino acid composition . It had lower specific activities in cell killing and in the fluorescence-enhancement in vitro assay of Phillips & Cramer {(1973) Biochemistry 12, 1170--1176} than did colicin E1, but both proteins bound in equimolar amounts to colicin-sensitive and colicin-resistant cells . The product of plasmid-ColE1-DNA-directed protein synthesis was converted into a protein indistinguishable in structure and activity from colicin E1 by incubation in the reaction mixture, after deoxyribonuclease and ribonuclease treatment, for a further 20 h at 37 degrees C . A protein with similar properties to the 71 000-dalton product in vitro was identified in extracts of a ColE1+ colicin-tolerant mutant of Escherichia coli K12 . It is concluded that this protein probably represents a pre-form of colicin E1 which may be involved in colicin-E1 secretion or cellular colicin-E1 immunity in colicin-E-producing cells, or both of these processes. Genetics, 1980 Feb, 94(2), 277 - 90 Definition of additional flagellar genes in Escherichia coli K12; Komeda Y et al.; Twenty-nine flagellar genes in Escherichia coli K12 have previously been assigned to three regions of the genome . Flagellar region I is located between pyrC and ptsG, region II between aroD and uvrC, and region III between uvrC and his . In this study, flagellar mutants in Escherichia coli K12 were obtained by selection for resistance to the flagellotropic phage, chi . They were analyzed in complementation tests using P1 phage-mediated transduction . In addition to the fla genes already described, eight more flagellar genes were identified . This analysis defined six more fla genes in region I (flaU, etc.), one more in region II (flbB) and one more in region III (flbC) . Region I was shown to include at least 12 fla cistrons . Complementation analysis with polar Mu phage-induced Fla- mutants and with lambda fla phage defined four transcriptional units in region I . These were: flaU, flbA-flaW-flaV-flaK-flaX-flaL-flaY-flaM, flaZ and flaS- flaT, with transcription proceeding from left to right . The flB gene was found to be part of an operon: flB-flaI in region II . In region III, a previously unidentified gene flbC was located between hag and flaN. Infect Immun, 1980 Feb, 27(2), 693 - 6 Influence of serum concentration on opsonization by the classical and alternative complement pathways; Tofte RW et al.; In this investigation of bacterial opsonization by the serum complement system, the importance of using various serum concentrations and of performing kinetic studies is demonstrated. Br J Exp Pathol, 1980 Feb, 61(1), 97 - 107 A quantitative model for subcutaneous abscess formation in mice; Joiner KA et al.; The purpose of this experiment was to develop an experimental model of s.c . encapsulated abscesses in which abscess formation could be assessed by quantitative measurements . Inocula were composed of bacterial broth cultures, autoclaved mouse caecal contents or both in combination . These inocula were injected s.c . on the flank in 2 strains of mice . Large encapsulated abscesses formed in all recipients by Day 4 when the inoculum contained either B . fragilis or S . aureus combined with caecal contents . Bacterial concentrations per ml of pus at Day 6 were 10(10.1+/-0.02) for B . fragilis and 10(8.4+/-0.1) for S . aureus . Spontaneous external drainage began by 10--15 days, and complete healing of the lesion occurred by 4--6 weeks . The typical histological pattern consisted of a collagen capsule surrounding a rim of neutrophils, enclosing a central area of necrotic cells and fibre from the inoculum . The cross-sectional areas of the capsule, the neutrophil band and the entire abscess were measured in a reproducible manner by planimetry, and abscess volumes were calculated . Values for these measurements varied with different inocula and different times after inoculation, but were highly consistent for a specified time and inoculum. Br J Exp Pathol, 1980 Feb, 61(1), 8 - 15 The effect of freezing and pasteurizing bovine milk on its ability to protect neonatal guinea-pigs against colonization of the small intestine by Escherichia coli; Dolby JM et al.; The ability of frequent feeding of bovine milk diets to prevent the colonization of the small intestines of newborn guinea-pigs with orally inoculated Escherichia coli was tested . At 3--4 days small intestinal samples from suckled controls were frequently sterile or were colonized with only very low numbers of Esch . coli . No bovine milk diet exhibited a significant "protective" effect but the diets could, however, be ranged in order of effectiveness in decreasing colonization by Esch . coli . Raw, fresh bovine milk was best, followed by milk pasteurized at 56 degrees or 63 degrees, then boiled milk; frozen milk was the worst . Because of this last finding, neither the bacteriostatic lactoferrin-dependent activity nor the lactoperoxidase could be correlated with the ability to decrease the colonization of the small intestines by Esch . coli. Ann Rheum Dis, 1980 Feb, 39(1), 68 - 74 Defective polymorphonuclear leucocyte chemotaxis in rheumatoid arthritis associated with a serum inhibitor; Hanlon SM et al.; Cellular and/or serum components of polymorphonuclear leucocyte chemotaxis were assessed in 21 patients with rheumatoid arthritis . No difference in the chemotactic migration of control and patient cells in response to a number of chemotactic solutions could be detected (P = 0.38) . Deficient generation of chemotactic activity in patient sera (P = 0.58) as compared to control sera (P = 0.014) after incubation of the sera with Escherichia coli lipopolysaccharide, resulted in a significant difference in the chemotactic activity of the control and rheumatoid serum preparations for polymorphonuclear leucocytes (P = 0.0012) . This defect was associated with the presence of a serum inhibitor of chemotaxis, the potency of which was inversely correlated with the level of chemotactic activity generated in the rheumatoid sera (r = -0.941, P less than 0.001). Acta Pathol Microbiol Scand {C}, 1980 Feb, 88(1), 39 - 45 Experimental Escherichia coli 06 infection in mice . 1 . Effect of immunisation on resistance in relation to 06 antibody levels in mice of different strains; Ahlstedt S; The susceptibility to intraperitoneal infection with E . coli 06:k2 bacteria and the increase of resistance after immunization and immune serum injection was analysed in eight mouse strains (CBA, A/J, C3H, C3H/HeJ, C57 B1/6J congenitally athymic C57 B1 nu/nu and their heterozygous nu/+ litter mates as well as NMRI mice) . A different susceptibility to the infection was found among the strains . This was not related to endotoxin resistance or thymus deficiency or to the ability of the animals to form antibodies as measured with the enzyme-linked immunosorbent assay, ELISA . Immunization of the animals with 5 x 10(7) E . coli 06:K13 bacteria resulted in a smaller increase in resistance in the less susceptible CBA mice than in the more susceptible A/J or C3H/HeJ mice . This pattern was further accentuated after repeated immunization . The development of resistance by immunization seemed independent of T-cells, since the nu/nu mice were as resistant as the nu/+ mice . The nu/nu mice, however, formed less antibodies after vaccination than did their nu/+ litter mates . The lowest antibody responses were noted in the NMRI mice, but this was accompanied with similar increase in resistance compared with the other strains forming 10-fold more 06 antibodies . Immunization with as little as 102-104 bacteria also resulted in a rise in resistance . This was, however, accompanied by a minute increase in antibody titer . Despite content of minute antibody levels administration of such immune serum gave protection of the recipients . It was concluded that very small amounts of antibodies would provide protection against E . coli infection varying from one mouse strain to another. Mol Gen Genet, 1980 Feb, 177(3), 485 - 91 Analysis of rpsD mutations in Escherichia coli . IV . Accumulation of minor forms of protein S7(K) in ribosomes of rpsD mutant strains due to translational read-through; Olsson MO et al.; A certain proportion of protein S7 exists in an altered form in E . coli rpsD (S4) mutants . Depending on the type of S4 mutation involved, two different forms of the altered S7 can be distinguished . The unusual form is longer than normal S7 by about 500 daltons due to extra material at the carboxyl end of the protein . It is suggested that a mutationally altered S4 might lower the efficiency of termination during translation of the messenger for S7 . This results in an increased frequency of translational read-through, which gives the observed longer forms of S7 . Data are interpreted to mean that one class of S4 mutants might suppress UGA and UAG whereas another class only suppresses UGA. J Gen Microbiol, 1980 Feb, 116(2), 553 - 6 Properties of a transmissible plasmid conferring citrate-utilizing ability in Escherichia coli of human origin; Ishiguro N et al.; Transfer of citrate utilization (Cit+) was achieved with a plasmid (pCIT354) which is Fi+, has F-like pili and fails to inhibit phage propagation . Transduction of Cit+ was achieved with P1 hage . Results of incompatibility tests with R plasmids indicated that pCIT354 is a self-repressed F-like plasmid. Eur J Biochem, 1980 Feb, 104(1), 255 - 62 Effect of ultraviolet irradiation on 30-S ribosomal subunits . Identification of the RNA region crosslinked to protein S7; Ehresmann B et al.; The effects of ultraviolet irradiation on Escherichia coli 30-S ribosomal subunits were studied . At the doses of radiation used in this work (0-4.5 x 10(5) quanta/30-S subunit), only protein S7 was found to be significantly crosslinked to the 16-S RNA . In conditions where 25% of the protein was covalently crosslinked, the ability of the irradiated 30-S subunits to reassociate with 50-S subunits and their activity in polyphenylalanine synthesis decreased strongly . Similar results were obtained by irradiation with a germicide lamp (254 nm) or with a monochromatic ultraviolet light at 248 nm . No additional proteins were crosslinked to the 16-S RNA by irradiating 30-S subunits depleted in protein S1 or 70-S ribosomes . The covalent complex of 16-S RNA and protein S7 was isolated and digested by T1 ribonuclease . The oligonucleotide remaining attached to the crosslinked protein was characterised as A-C-C-U-C-G {position 1261 - 1266, see the sequence published by Carbon et al . (1979) Eur . J . Biochem . 160, 399-410} . Analysis of this fragment suggests that protein S7 was linked to the cytosine at position 1265 in the RNA sequence. Eur J Biochem, 1980 Feb, 104(1), 19 - 33 The role of the codon and the initiation factor IF-2 in the selection of N-blocked aminoacyl-tRNA for initiation; van der Laken K et al.; Poly(uridylic acid) {poly(U)} and poly(xanthidylic acid) {poly(X)} strongly stimulate the IF-2-dependent binding of fMET-tRNA to 30-S ribosomal subunits from Escherichia coli {Van der Laken et al . (1979) FEBS Lett . 100, 230-234} . The N-formylmethionine moiety is incorporated into poly(phenylalanine) upon subsequent addition of other components required for protein synthesis when poly(U) is used as template . This paper shows that N-acetylated Phe-tRNAPhe (AcPhe-tRNA), but not Phe-tRNAPhe or tRNAPhe, competes with fMET-tRNA for binding to poly(U)-programmed 30-S ribosomal subunits . The two species of N-blocked aminoacyl-tRNA are bound to poly(U)-programmed and poly(X)-programmed 30-S subunits in a ratio that is linearly dependent on the ratio of the two species added . With poly(U) as template there is no apparent preference for either fMET-tRNA or AcPhe-tRNA, whereas with poly(X) there is a 2-3-fold preference for fMET-tRNA . The initiation factor IF-2, which is strictly required for the binding of N-blocked aminoacyl-tRNAs, has a higher affinity for fMET-tRNA than for AcPhe-tRNA . It is concluded that (a) interaction of the 30-S ribosomal subunit with poly(U) or poly(X) leads to IF-2-dependent binding of N-blocked aminoacyl-tRNA; (b) the initiation factor IF-2-discriminates in favour of fMET-TRNA; (c) the presence of the cognate codon discriminates in favour of the corresponding N-blocked aminoacyl-tRNA. J Bacteriol, 1980 Feb, 141(2), 989 - 92 Modification of aspartate before its condensation with dihydroxyacetone phosphate during quinolinic acid formation in Escherichia coli; Steiner BM et al.; A crude enzyme preparation from a nadA mutant of Escherichia coli was used to catalyze the conversion of {14C}aspartic acid into a precursor of quinolinic acid, a key intermediate in the biosynthesis of nicotinamide adenine dinucleotide. J Bacteriol, 1980 Feb, 141(2), 806 - 13 Involvement of the ftsA gene product in late stages of the Escherichia coli cell cycle; Tormo A et al.; Strain D-3 was shown, by genetic complementation with lambda phage vectors carrying either the wild type or a temperature-sensitive allele, to contain an ftsA mutation . The presence of this mutation rendered the strain unable to divide at 42 degrees C . The action of the ftsA gene product in strain D-3 takes place at a late stage of the cycle, starting near the end of the replication cycle and extending until cell division is completed . The action of the ftsA gene product seemed to take a constant time, independent of the duration of the cell division cycle . Experiments in which all other requirements for division except a "termination protein" were completed show that cells of strain D-3 can divide under these conditions only at the permissive temperature . We conclude that a likely role for the ftsA gene product is that of a termination protein. J Bacteriol, 1980 Feb, 141(2), 779 - 85 Protein expression in Escherichia coli minicells containing recombinant plasmids specifying trimethoprim-resistant dihydrofolate reductases; Fling ME et al.; Deoxyribonucleic acid fragments containing the structural genes for several trimethoprim-resistant dihydrofolate reductases from naturally occurring plasmids were inserted into small cloning vehicles . The genetic expression of these hybrid plasmids was studied in purified Escherichia coli minicells . The type I dihydrofolate reductase, encoded by plasmid R483 and residing within transposon 7 (Tn7), had a subunit molecular weight of 18,000 . The type II dihydrofolate reductase, specified by plasmid R67, had a subunit molecular weight of 9,000 . These two enzymes were antigenically distinct in that anti-type II dihydrofolate reductase (R67) antibody did not cross-react with the type I (R483) protein . The trimethoprim-resistant reductase specified by plasmid R388 had a subunit molecular weight of about 10,500 and was immunologically related to the type II (R67) enzyme . A 9,000 subunit of the dihydrofolate encoded by the transposition element Tn402 was also antigenically related to the R67 reductase. J Bacteriol, 1980 Feb, 141(2), 758 - 69 Genetic and molecular characteristics of Vir plasmids of bovine septicemic Escherichia coli; Lopez-Alvarez J et al.; Three wild strains of bovine septicemic Escherichia coli were selected on the basis of their production of a toxin lethal for mice and chickens and their characteristic surface antigen . The transfer of these virulence (Vir) properties from two of the three to recipient E . coli was detected after mating . One Vir plasmid (pJL1) was derepressed for transfer and associated with mobilization of chromosomal markers . The other, pJL2, was repressed . Both plasmids were tagged with transposon Tn5 (kanamycin resistance), and transfer parameters of the tagged plasmids were studied . The Tn5 insertion in pJL2 usually increased transfer efficiency 100-fold . Plasmid pJL1 was classified as a member of the FIV incompatibility group . A pJL1::Tn5 derivative plasmid was incompatible with ColV1 . Plasmid pJL2 behaved as an fi+ plasmid . Both plasmids pJL1 and pJL2 had a molecular weight of 92 x 10(6) and were present at about four copies per chromosome; their deoxyribonucleic acid (DNA) structures were not identical on the basis of restriction enzyme analysis . DNA-DNA hybridization revealed a polynucleotide sequence homology of at least 58% between the two plasmids . No plasmids could be detected in one wild or certain laboratory-derived Vir+ E . coli strains. J Bacteriol, 1980 Feb, 141(2), 635 - 44 Purification and characterization of 3-deoxy-D-manno-octulosonate 8-phosphate synthetase from Escherichia coli; Ray PH; 3-Deoxy-D-manno-octulosonate (KDO)-8-phosphate synthetase has been purified 450-fold from frozen Escherichia coli B cells . The purified enzyme catalyzed the stoichiometric formation of KDO-8-phosphate and Pi from phosphoenolpyruvate (PEP) and D-arabinose-5-phosphate . The enzyme showed no metal requirement for activity and was inhibited by 1 mM Cd2+, Cu2+, Zn2+, and Hg2+ . The inhibition by Hg2+ could be reversed by dithiothreitol . The optimum temperature for enzyme activity was determined to be 45 degrees C, and the energy of activation calculated by the Arrhenius equation was 15,000 calories (ca . 3,585 J) per mol . The enzyme activity was shown to be pH and buffer dependent, showing two pH optima, one at pH 4.0 to 6.0 in succinate buffer and one at pH 9.0 in glycine buffer . The isoelectric point of the enzyme was 5.1 . KDO-8-phosphate synthetase had a molecular weight of 90,000 +/- 6,000 as determined by molecular sieving through G-200 Sephadex and by Ferguson analysis using polyacrylamide gels . Based on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, the 90,000-molecular-weight native enzyme was composed of three identical subunits, each with an apparent molecular weight of 32,000 +/- 4,000 . The enzyme had an apparent Km for D-arabinose-5-phosphate of 2 X 10(-5) M and an apparent Km for PEP of 6 X 10(-6) M . No other sugar or sugar-phosphate could substitute for D-arabinose-5-phosphate . D-Ribose-5-phosphate was a competitive inhibitor of D-arabinose-5-phosphate, with an apparent Ki of 1 X 10(-3) M . The purified enzyme has been utilized to synthesize millimole quantities of pure KDO-8-phosphate. Proc Natl Acad Sci U S A, 1980 Feb, 77(2), 905 - 9 Hydrolysis of GTP on elongation factor Tu.ribosome complexes promoted by 2'(3')-O-L-phenylalanyladenosine; Campuzano S et al.; In the presence of Escherichia coli ribosomes and elongation factor EF) Tu, 2'(3')-O-L-phenylalanyladenosine (AdoPhe), the 3'-terminal portion of Phe-tRNAPhe, promotes the hydrolysis of GTP . The reaction requires the presence of both 30S and 50S ribosomal subunits and of proteins L7/L12 on the 50S subunit, is unaffected by mRNA {poly(uridylic acid)}, and is strongly stimulated by EF-Ts . It is proposed that the AdoPhe-dependent GTP hydrolysis, like that promoted by aminoacyl-tRNA, is mediated by a ternary complex with EF-Tu and GTP; however, in contrast to aminoacyl-tRNA, AdoPhe is probably not retained by ribosomes after GTP hydrolysis . Phe-tRNAPhe or N-acetyl-Phe-tRNAPhe bound to the ribosomal acceptor site do not inhibit, but even stimulate, GTP hydrolysis by AdoPhe.EF-Tu.GTP . Thus, the binding site for EF-Tu on the ribosome is probably available for interaction with AdoPhe.EF-Tu.GTP regardless of whether the nearby acceptor site is vacant of occupied with aminoacyl-tRNA or peptidyl-tRNA . The results demonstrate the critical role of the 3'-terminal region of aminoacyl-tRNA in activating the EF-Tu- plus ribosome-dependent GTPase. Proc Natl Acad Sci U S A, 1980 Feb, 77(2), 870 - 4 Formylmethionyl-tRNA alters RNA polymerase specificity; Debenham PG et al.; Escherichia coli fMet-tRNAfMet alters the pattern of promoter selection of E . coli RNA polymerase (RNA nucleotidyltransferase, nucleosidetriphosphate:RNA nucleotidyltransferase; EC 2.7.7.6), affecting RNA synthesis from the rRNA, suIII+tRNA, and lac promoters in different ways . The in vitro synthesis of the stable RNA species is selectively decreased, whereas that of lac RNA from both the wild-type and mutant UV5 promoters is selectively increased at high ionic strength . The functional effect of fMet-tRNAfMet resembles that of the nucleotide guanosine 3'-diphosphate 5'-diphosphate (ppGpp) . This nucleotide competes with the binding of fMet-tRnafMet to RNA polymerase. Proc Natl Acad Sci U S A, 1980 Feb, 77(2), 866 - 9 Inhibition of RNA polymerase activity by the Escherichia coli protein biosynthesis elongation factor Ts; Biebricher CK et al.; The transcribing activity of DNA-dependent RNA polymerase (nucleosidetriphosphate:RNA nucleotidyltransferase, EC 2.7.7.6) from Escherichia coli is inhibited in vitro by addition of preparations of elongation factor Ts purified to homogeneity . The inhibitory activity of elongation factor Ts on the RNA polymerase activity and the enzymatic activity of elongation factor Ts show the same temperature sensitivity . The extent of inhibition is strongly dependent on the template used for transcription . A mechanism for the control of RNA synthesis in vivo based on this inhibition found in vitro is proposed. Proc Natl Acad Sci U S A, 1980 Feb, 77(2), 1078 - 82 Functional expression in yeast of the Escherichia coli plasmid gene coding for chloramphenicol acetyltransferase; Cohen JD et al.; The Escherichia coli R factor-derived chloramphenicol resistance (camr) gene is functionally expressed in the yeast Saccharomyces cerevisiae . the gene was introduced by transformation into yeast cells as part of a chimeric plasmid, pYT11-LEU2, constructed in vitro . The plasmide vector consists of the E . coli plasmid pBR325 (carrying the camr gene), the yeast 2-micron DNA plasmid, and the yeast LEU2 structural gene . Yeast cells harboring pYT11-LEU2 acquire resistance to chloramphenicol and cell-free extracts prepared from such cells contain chloramphenicol acetyltransferase (acetyl-CoA: chloramphenicol 3-O-acetyltransferase, EC 2.3.1.28), the enzyme specified by the camr gene in E . coli . Resistance to chloramphenicol and the presence of chloramphenicol acetyltransferase activity segregate with the yeast marker LEU2, carried by the transforming plasmid, during both mitotic growth and meiotic division. Proc Natl Acad Sci U S A, 1980 Feb, 77(2), 1063 - 7 Escherichia coli mutator mutants deficient in methylation-instructed DNA mismatch correction; Glickman BW et al.; Our approach to the isolation of DNA mismatch-correction-deficient mutants was based upon the isolation of 2-aminopurine-resistant second-site revertants of Escherichia coli dam- mutants . We isolated such second-site revertants which, when separated from the dam- mutation, have a mutator character of their own . These new mutators all mapped at three known mutator loci, mutH, mutL, and mutS, which exhibit the same mutagenic spectrum as the dam- mutator: increased levels of base substitution and frameshift mutations . The mutator potencies of double and triple mut- mutants suggest that these mutators are involved in the same general mismatch-repair pathway . All these mutations result in a hyper-recombination phenotype, but in four-factor crosses among lambda phages, a specific loss of intragenic recombination (Pam3 X Pam80) was found in mutL and mutS mutants, as would be predicted from the postulated role of mismatch correction in gene conversion and high negative interference phenomena. Mutat Res, 1980 Feb, 69(2), 201 - 16 Molecular dosimetry of the chemical mutagen ethyl methanesulfonate: quantitative comparison of mutation induction in Escherichia coli, V79 Chinese hamster cells and L5178Y mouse lymphoma cells, and some cytological results in vitro and in vivo; Aaron CS et al.; Molecular dosimetry studies were carried out to measure the extent of binding of radio-labeled ethyl groups to the DNA of Escherichia coli, V79 Chinese hamster cells and L5178Y mouse lymphoma cells treated with ethyl methanesulfonate (EMS) . The results show that (1) the amount of ethylation of the DNA is similar in these cells when treatment conditions are identical, (2) the relationship between dose to DNA (ethylations per nucleotide) versus exposure (mM applied concentration) is non-linear in the sense that less alkylation of the DNA is observed at the higher exposures than would be predicted on the basis of proportionality between dose to DNA and exposure, and (3) the non-linearity of the genetic response in the bacterial cells is not reflected in a non-linearity of the alkylation of the DNA in those cells . Quantitative comparison of the frequencies of gene mutations in the various systems shows that the mutation frequency per unit of DNA alkylation is heterogeneous among the mammalian cell systems and that the frequencies observed in the bacterial cells fall within the range observed with mammalian cells . Alkylation of the DNA in the bone marrow, testis and liver of Swiss random-bred mice was also measured . The results support the conclusion that the distribution of the compound to the various tissues is rapid and probably uniform . Quantitative assessment of the cytological data (micronuclei, sister-chromatid exchanges, etc.) on the basis of dose was not as useful because of the low efficiency of EMS for inducing cytologically observable damage. J Biochem (Tokyo), 1980 Feb, 87(2), 441 - 9 Regulation of Escherichia coli phosphoenolpyruvate carboxylase by multiple effectors in vivo . Estimation of the activities in the cells grown on various compounds; Morikawa M et al.; Intracellular concentrations of phosphoenolpyruvate (PEP) and five kinds of allosteric effectors (acetyl-CoA, fructose 1,6-bisphosphate, GTP, L-aspartate, and L-malate) of PEP carboxylase were measured in E . coli cells grown on various compounds as a carbon source . Based on the data obtained, reaction systems which contained a definite concentration of the enzyme and the ligands at the concentrations found in vivo were constructed and the enzyme activities were measured . The ratio of each activity thus obtained to the maximal activity attainable with the same concentration of enzyme and saturating concentrations of the activators was estimated . For the cells grown on glucose, glycerol, or lactate, the extent of exhibition of the enzyme activity was 2-15% of the maximal activity . For the cells grown on acetate or oleate, the extent was 1-3% . For the cells grown on succinate, L-aspartate, L-malate, or glucose plus L-aspartate, the extent was less than 0.4% . Consideration of the data obtained in the present studies, together with those obtained in our previous studies on the enzyme level (Teraoka, H . et al . (1970) J . Biochem . 67, 567-575), showed that the control of the enzyme reaction in vivo is considerably different from that expected from the in vitro experiments, and that deficiencies of "coarse control" are covered by a "fine control." Eur J Biochem, 1980 Feb, 103(3), 431 - 8 Trans-membrane translocation of proteins . A detailed physico-chemical analysis; von Heijne G; A detailed, computerized procedure for analysing the translocation process of any protein with known sequence from a physico-chemical point of view is presented and used to gain a better understanding of the molecular 'rules' that govern the final outcome of the process . With the aid of this prodedure a number of testable predictions of the orientations of particular membrane-bound proteins can be made . It is also suggested that ovalbumin, the only known secreted protein lacking a cleavable prepiece, initiates translocation in a way that differs from other secreted proteins. J Urol, 1980 Feb, 123(2), 153 - 6 Post-transplantation pyelonephritis: factors producing low patient and transplant morbidity; Pearson JC et al.; A retrospective study of 1,100 consecutive renal transplantations done on 959 patients revealed postoperative pyelonephritis in 15 patients, 14 of whom were women . Sixteen of the 20 episodes of pyelonephritis were caused by Escherichia coli and only 4 episodes occurred within the first year after transplantation, thus revealing the crucial differentiation from a rejection episode . When the etiology of the original renal failure was pyelonephritis the incidence of pyelonephritis in the transplanted kidneys was high . This high incidence also was true for cases associated with post-transplantation urological complications . When the etiology of renal failure was diabetes or polycystic renal disease, or when urologic abnormalities pre-existed the incidence of pyelonephritis was low . No transplant or patient loss was caused by post-transplantation pyelonephritis, probably because of prompt, correct diagnosis and a low urological complication rate. Arch Intern Med, 1980 Feb, 140(2), 271 - 3 Fatal pulmonary hemorrhage due to nitrofurantoin; Averbuch SD et al.; Acute and chronic pleuropneumonic reactions as well as rare fatalities following nitrofurantoin exposure have been reported . A case of fatal fulminant hemorrhagic pneumonitis following nitrofurantoin exposure is reported here . Recent experimental evidence suggests that a toxic mechanism may be responsible for the observed reaction. Appl Environ Microbiol, 1980 Feb, 39(2), 307 - 16 Electrochemical detection and counting of Escherichia coli in the presence of a reducible coenzyme, lipoic acid; Junter GA et al.; Reduction of lipoic acid by bacteria coupled to oxygen consumption during glucose absorption can be followed potentiometrically with a pair of gold and reference electrodes in a minimal culture medium . The variations in potential as a function of time have the shape of a wave . A theoretical expression was derived relating the size of the original inoculum to the time preceding the appearance of the wave . The validity of that relation was experimentally verified with Escherichia coli, and the time needed for a drop of 100 mV was determined . Detection of small inocula, e.g., down to a range of 10 viable E . coli per liter, is possible in about 11 h by yeast extract stimulation . The method, technically simple and adequately sensitive, suggests the possibility of automated detectors of bacterial contaminations. Acta Endocrinol (Copenh), 1980 Feb, 93(2), 223 - 7 Practical procedure for enzyme immunoassay of progesterone in bovine serum; Nakao T; An enzyme immunoassay of progesterone was established by using beta-galactosidase from E . coli as a label . The enzyme was conjugated with 11 alpha-hydroxyprogesterone-hemisuccinate using water-soluble carbodiimide . Rabbit antiserum to 11 alpha-hydroxyprogesterone-hemisuccinate-bovine serum albumin was previously obtained and anti-rabbit gamma globulin goat serum was used as second antibody . The enzyme activity was measured by utilizing hydrolysis of O-nitrophenyl-beta-D-galactopyranoside . The least detectable concentration of progesterone was 12 pg per tube . The measurable range of progesterone in 0.1 ml of bovine serum was between 0.25 ng/ml and 10 ng/ml . This method satisfied the general criteria regarding specifity, precision and recovery rate . Correlation between the progesterone levels determined by enzyme immunoassay and radioimmunoassay was quite high (r = 0.99, P less than or equal to 0.01) . The present enzyme immunoassay can be applied for practical and routine analysis of serum progesterone. J Bacteriol, 1980 Feb, 141(2), 528 - 33 Efflux of beta-galactosidase products from Escherichia coli; Huber RE et al.; Several different strains of Escherichia coli were grown on a variety of carbon sources under various growth conditions . Lactose was added (usually at mid-log phase), and the concentrations of the products of beta-galactosidase action on this sugar (galactose, glucose, and allolactose) were determined at various times thereafter in the total culture and in the medium . It was found that with each strain, with all carbon sources, and under all of the conditions studied, a very large proportion of the products were found in the medium . Control studies were carried out which showed that these results were not artifacts of the method of separating the cells from the medium . The results also did not arise from the secretion of beta-galactosidase into the medium, from the diffusion of substrates and products into and out of the cells due to leaks in the membrane, or from faults in the method of sugar analysis . In addition, the results showed that there were very high levels of products inside the cells under the conditions used and that the efflux of the products was rapid . The efflux might be energetically advantageous to the cell as well as being a means of storing excess products until needed. J Bacteriol, 1980 Feb, 141(2), 485 - 92 Escherichia coli regulatory mutation affecting lysine transport and lysine decarboxylase; Popkin PS et al.; A spontaneous thiosine-resistant mutant of Escherichia coli was shown to have the following characteristics: lowered initial rate of lysine uptake and lowered plateau level of accumulation of exogenous lysine by both the lysine-specific and the general basic amino acid transport systems; altered repressibility of these two lysine transport systems; a derepressed level of lysine decarboxylase; normal growth rate; parental levels of lysyl-transfer ribonucleic acid synthetase and the inducible and constitutive arginine and ornithine decarboxylases . Both the mutant (lysP) and its parent (lysP+) feed a lysine auxotroph when they are plated in proximity on solid medium . However, the feeding response was observable after 1 day less of incubation when the mutant was the feeding strain . Despite the derepressed level of lysine decarboxylase in exponential cultures of the mutant extracts of these cultures had no detectable cadaverine pool . Conjugation experiments established the following gene order: gyrA (formerly nalA) lysP metG his . All thiosine-resistant recombinants assayed showed reduced lysine transport . In many of these recombinants the derepression of lysine decarboxylase was not expressed. J Microsc, 1980 Feb, 118(2), 161 - 76 Effects of glutaraldehyde and glycerol on freeze-fractured Escherichia coli; Arancia G et al.; Glutaraldehyde and glycerol are widely used in the freeze-fracture technique as sample pretreatments before rapid freezing . However, they can both introduce relevant structural changes and influence the visualization of the fracture faces and surfaces of membranes . A comparison of the results obtained on E . coli cells differently pretreated with glutaraldehyde and glycerol is presented . In particular the effect on the distribution and density of the intramembranous particles (IMP) is pointed out . Glycerol treatment at 310 K introduces an IMP redistribution, outlined by the appearance of several smooth areas on the fracture faces of the cytoplasmic membrane, which is prevented by glutaraldehyde prefixation at the same temperature . On the other hand, glutaraldehyde treatment at 310 K following glycerol incubation results in the disappearance of the smooth areas, suggesting a substantial change in the IMP distribution caused by the fixative . Cells shifted down to 277 K and treated with glycerol at this temperature before quick-freezing, present on the convex fracture face of the cytoplasmic membrane large smooth areas resulting from a lipid transition while the smaller areas observed at 310 K are not detectable . Glutaraldehyde treatment at 277 K seems also to be responsible for a redistribution of IMP since poorly delimited large smooth areas, containing several IMP, can be observed . In this paper the results of a statistical analysis are also reported, showing that the IMP density can be strongly influenced by pretreatments. Eur J Biochem, 1980 Feb, 103(3), 439 - 46 The topography of the 5' end of 16-S RNA in the presence and absence of ribosomal proteins S4 and S20; Ehresmann C et al.; A ribonucleoprotein prepared by strong ribonuclease digestion of a complex of 16-S ribosomal RNA and proteins S4 and S20 from Escherichia coli has been characterized; its nucleotide sequence, the positions of enzyme cuts and the sequence excisions have been placed in the completed sequence of 16-S RNA . The positions and yields of enzyme cuts, and excisions of sequence, are compared with those of various ribonucleoproteins prepared with S4 or S20 alone, and with the ribonuclease-resistant S4 RNA prepared from renatured 16-s RNA in the absence of ribosomal protein . These data yield important information on the topography and organisation of the 5' third of the 16-s RNA which is selectively maintained in its native conformation by the bound proteins; they also provide criteria for testing secondary structural models of this region of 16-S RNA. Biotechnol Bioeng, 1980 Feb, 22(2), 311 - 21 Immobilization of beta-galactosidase and other enzymes onto p-amino-carbanilated cellulose derivatives; Beddows CG et al.; beta-Galactosidase and other enzymes were immobilized on p-amino-carbanilated derivatives of cellulose and methylol cellulose using the diazo method and through glutaraldehyde . The optimum conditions for coupling cellulose tri-(p-amino-carbanilate) (CTAC) to beta-galactosidase were established . The diazo coupling method with CTAC gave greater activity than with glutaraldehyde when coupled to beta-galactosidase (Escherichia coli) . The stability of the CTAC-beta--galactosidase system was examined . The disubstituted p-amino-carbanilate derivative (CDAC) gave a lower activity, whereas the methylol analog (MCTAC) gave slightly greater activity . The CTAC was also used to immobilize glucose oxidase, trypsin, pepsin, and papain. Acta Med Okayama, 1980 Feb, 34(1), 1 - 10 Finestructure and template activities of DNA-histone complexes reconstituted in the presence and absence of urea; Hidaka H et al.; Several DNA-histone complexes were reconstituted in the presence and absence of urea . The fiber size of DNA-histone H1 complex was about 20 A in width with knobs 100 to 250 A in diameter interspersed at an average interval of about 1,100 A . H1-was associated with DNA segments corresponding to a DNA size of fewer than 100 base pairs . DNA-histones H2A, H2B, H3 and H4 complex consisted of globular subunits 100 to 150 A in diameter alternating with thin strands, like beads on a string . DNA-whole histones complex was 200 to 250 A in width and had a condensed configuration . The nuclease digestion pattern of the complexes containing histones H2A, H2B, H3 and H4 was regular, similar to that of chromatin, and was disrupted by urea . The complex containing H1 was inactive for in vitro RNA synthesis by escherichia coli RNA polymerase, whereas the other complexes were active . The complexes reconstituted in the absence of urea had template activities slightly less than in the presence of urea. J Bacteriol, 1980 Feb, 141(2), 464 - 9 Suppression of induction of SOS functions in an Escherichia coli tif-1 mutant by plasmid R100.1; Bagdasarian M et al.; The tif-1 mutation in the recA gene of Escherichia coli caused, at 40 degrees C, lethal cell filamentation, induction of the recA protein, mutagenesis, and, in lambda lysogens, prophage induction . The presence of plasmid R100.1 in tif-1 strains suppressed tif-mediated cell filamentation and killing, recA protein induction, and prophage induction in lysogens . It also reduced mutagenesis in a tif-1 sfiA11(R100.1) strain . Plasmids F'lac, P1, and pMB9, in contrast, had little or no effect on tif-mediated induction of lambda . The presence of R100.1 did not inhibit the induction of the recA protein or of lambda by ultraviolet irradiation or mitomycin C treatment of tif-1(R100.1) or tif-1(lambda)(R100.1) strains. J Bacteriol, 1980 Feb, 141(2), 431 - 5 Periplasmic maltose-binding protein confers specificity on the outer membrane maltose pore of Escherichia coli; Heuzenroeder MW et al.; ompB mutants of Escherichia coli K-12 are markedly deficient in porin in their outer membrane . This results in a decreased rate of uptake for many substrates: the maltose pore (lambda receptor) can in some circumstances, in the absence of the periplasmic maltose-binding protein, compensate for the consequent defects in permeability to lactose, mannitol, glycylglycyl-L-valine, and tri-L-ornithine . It is postulated that the maltose-binding protein associates with the maltose pore and confers on it the specificity for maltose, and that the absence of the maltose-binding protein leaves the pore open and results in enhanced transmembrane diffusion of molecules other than maltose . This paper presents evidence to support this hypothesis. Proc Natl Acad Sci U S A, 1980 Feb, 77(2), 799 - 803 An Escherichia coli replication protein that recognizes a unique sequence within a hairpin region in phi X174 DNA; Shlomai J et al.; Protein n', a prepriming DNA replication enzyme of Escherichia coli, is a phi X174 DNA-dependent ATPase . Restriction of phi X174 DNA have led to the identification of a 55-nucleotide fragment that carries the protein n' recognition sequence . Molecular hybridization and sequence analysis have located this sequence within the untranslated region between genes F and G, a map location analogous to that of the unique complementary strand origin of phage G4 DNA . Within the 55-nucleotide fragment is a sequence of 44 nucleotides that forms a stable hairpin structure . This duplex may be the signal for protein n' to initiate the prepriming events that led to the start of phi X174 complementary DNA strand replication. J Virol, 1980 Feb, 33(2), 845 - 55 Molecular cloning of the Harvey sarcoma virus circular DNA intermediates . II . Further structural analyses; Chang HW et al.; Three species of unintegrated supercoiled Harvey sarcoma virus DNA (6.6, 6.0, and 5.4 kilobase pairs) have been molecularly cloned from Harvey sarcoma virus-infected cells . On the basis of restriction enzyme analyses, the 6.6- and 6.0-kilobase pair viral DNAs contain two and one copies, respectively, of a 650-base pair DNA segment which contains sequences present at the 3' and 5' termini of the viral genome . R-loop structures formed between Moloney leukemia virus RNA and the cloned Harvey sarcoma virus DNA indicated that about 500 base pairs of the 650-base pair repeating segment was complementary to the 3' end of the viral RNA . During amplification in the Escherichia coli host, some recombinants containing the 6.6- or the 6.0-kilobase pair Harvey sarcoma virus DNA insert acquired or lost the complete 650-base pair DNA segment . These changes occurred in both recA+ and recA- E . coli. J Virol, 1980 Feb, 33(2), 689 - 96 DNA binding properties of simian virus 40 T-antigens synthesized in vivo and in vitro; Prives C et al.; Simian virus 40 large T- and small t-antigens have been shown previously to share immunological determinants and common sequences and to have roles in virus-induced cell transformation . However, only large T-antigen is a DNA binding protein . Under all conditions tested, small t-antigen did not interact with DNA . Large T-antigen synthesized in infected cells bound to both native calf thymus and simian virus 40 DNAs . As its binding efficiency was less than 100%, it is likely that there are different forms of T-antigen which vary in their affinity for DNA . Large T-antigen synthesized in cell-free protein-synthesizing systems primed by simian virus 40 mRNA also bound to DNA-cellulose, whereas small t-antigen similarly synthesized in vitro did not . An 82,000-molecular-weight T-antigen polypeptide synthesized in cell-free protein-synthesizing systems primed by simian virus 40 complementary RNA transcribed in vitro from simian virus 40 DNA by Escherichia coli RNA polymerase bound efficiently to simian virus 40 DNA . As this product did not share sequences with the small t-antigen, it can be concluded that the amino-terminal portion of the T-antigen is not required for some of its specific DNA binding properties. Mol Gen Genet, 1980 Feb, 177(3), 527 - 33 Cloning of DNA of the rpoBC operon from the chromosome of Escherichia coli K12; Newman A et al.; We provide evidence that, in terms of transcriptional organisation, the rpoBC operon carried by lambdarifd 18 accurately represents the corresponding region of the E . coli K12 chromosome . A restriction fragment of E . coli K12 chromosomal DNA carrying the genes rpoBC (encoding the beta and beta' subunits of RNA polymerase) and rplL (coding for ribosomal proteins L7/L12) was cloned in a lambda vector, and the resulting phage tested for gene expression . In common with the corresponding fragment of lambdarifd 18 DNA, the chromosomal fragment has no strong promoter for rplL or rpoBC transcription . Another new phage was constructed by adding, to the restriction fragment carrying the rplL rpoBC structural genes from lambdarifd 18, a sequence from the E . coli K12 chromosome which includes a promoter for these genes . As in lambdarifd 18 itself, this promoter is shared with rplJ but not with rplKA . The properties of the latter phage also show that the dominant rifampicin-resistance characteristic of lambdarifd 18 results from more than one mutation. J Bacteriol, 1980 Feb, 141(2), 770 - 8 Metabolite gene regulation: imidazole and imidazole derivatives which circumvent cyclic adenosine 3',5'-monophosphate in induction of the Escherichia coli L-arabinose operon; Kline EL et al.; Imidazole, histidine, histamine, histidinol phosphate, urocanic acid, or imidazolepropionic acid were shown to induce the L-arabinose operon in the absence of cyclic adenosine 3',5'-monophosphate . Induction was quantitated by measuring the increased differential rate of synthesis of L-arabinose isomerase in Escherichia coli strains which carried a deletion of the adenyl cyclase gene . The crp gene product (cyclic adenosine 3',5'-monophosphate receptor protein) and the araC gene product (P2) were essential for induction of the L-arabinose operon by imidazole and its derivatives . These compounds were unable to circumvent the cyclic adenosine 3',5'-monophosphate in the induction of the lactose or the maltose operons . The L-arabinose regulon was catabolite repressed upon the addition of glucose to a strain carrying an adenyl cyclase deletion growing in the presence of L-arabinose with imidazole . These results demonstrated that several imidazole derivatives may be involved in metabolite gene regulation (23). Proc Natl Acad Sci U S A, 1980 Feb, 77(2), 900 - 4 Initiation of DNA replication by the Escherichia coli dnaG protein: evidence that tertiary structure is involved; Sims J et al.; The dnaG protein of Escherichia coli initiates DNA replication by synthesizing primer oligonucleotides for elongation by DNA polymerae . The experiments reported here probe the nature of the nucleic acid element recognized by the dnaG protein . Three well-separated groups of nucleotides within the negative-strand origin of the single-stranded phage phi K are protected by the dnaG protein against nuclease digestion . DNA as far as 115 bases from the start site of primer synthesis is involved in binding of the dnaG protein to the replication origin . One molecule of dnaG protein could protect all of these nucleotides if the DNA were folded into a higher-order tertiary structure . Protection of the phi K origin by dnaG protein requires DNA binding protein, and it does not occur if the group of protected nucleotides most distant from the start site is removed from the template . There is no binding of dnaG protein to the complementary strand of the phi K origin-region DNA . The observed protection of the positive strand is due to a functional nucleic acid-protein complex. Proc Natl Acad Sci U S A, 1980 Feb, 77(2), 857 - 61 recA protein-catalyzed strand assimilation: stimulation by Escherichia coli single-stranded DNA-binding protein; McEntee K et al.; The single-stranded DNA-binding protein of Escherichia coli significantly alters the strand assimilation reaction catalyzed by recA protein {McEntee, K., Weinstock, G . M . & Lehman, I . R . (1979) Proc . Natl . Acad . Sci . USA 76, 2615--2619} . The binding protein (i) increases the rate and extent of strand assimilation into homologous duplex DNA, (ii) enhances the formation of a complex between recA protein and duplex DNA in the presence of homologous or heterologous single-stranded DNA, (iii) reduces the rate and extent of ATP hydrolysis catalyzed by recA protein in the presence of single-stranded DNA, (iv) reduces the high concentration of recA protein required for strand assimilation, and (v) permits detection of strand assimilation in the presence of the ATP analog, adenosine 5'-O-(O-thiotriphosphate) . Single-stranded DNA-binding protein purified from a binding protein mutant (lexC) is considerably less effective than wild-type binding protein in stimulating strand assimilation, a result which suggests that single-stranded DNA-binding protein participates in general recombination in vivo. Proc Natl Acad Sci U S A, 1980 Feb, 77(2), 750 - 4 Plasmids containing insertion elements are potential transposons; Ohtsubo E et al.; We studied in vivo recombination between the plasmid pHS1, a temperature-sensitive replication mutant carrying tetracycline resistance, and pSM1, a small plasmid carrying one copy of the insertion element IS1 . Recombinant plasmids were found by selection for tetracycline resistance at 42 degrees C . Their formation was independent of recA function . Analysis of the physical structures of various recombinant DNA molecules with electron microscopy and restriction endonucleases revealed that pSMI was integrated at its IS1 into numerous sites on pHS1, giving rise to a duplication of IS1 in the same orientation at both junctions . Nucleotide sequence analysis of recombinant plasmids and their parental plasmid DNA revealed that nine nucleotides at a target site were duplicated at the junction of each IS1 . This phenomenon implies that plasmids containing a translocatable DNA element can be potential transposons. Gene, 1980 Feb, 8(3), 279 - 300 Plasmids containing many tandem copies of a synthetic lactose operator; Sadler JR et al.; Up to 12 tandem copies of the lactose operator sequence AATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTGG (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAA (5') have been cloned in the EcoRI site of plasmid pMB9 . A 12-operator plasmid is about 8% operator by weight and represents a rich source of this DNA segment . A procedure for the rapid and convenient isolation of operator in mg quantities is presented . The lifetimes of complexes formed between repressor and oligo-operator plasmids increased with increasing numbers of tandem operators per plasmid . Evidence is presented indicating that only one tetrameric repressor molecule binds strongly to a segment of four (or fewer) tandem operators, but that two repressor molecules can be accommodated on segments containing at least six tandem operators. Genetics, 1980 Feb, 94(2), 291 - 9 Genetic mapping and some characterization of the rnpA49 mutation of Escherichia coli that affects the RNA-processing enzyme ribonuclease P; Apirion D; A mutant defective in the enzyme RNase P was isolated by P . SCHEDL and P . PRIMAKOFF (1973) . The mutation rnpA49 found in this strain, which confers temperature sensitivity on carrier strains, was mapped by conjugation and transduction experiments and located around minute 82 of the E . coli map, with the suggested order rnpA bglB phoS rbsP ilv . As expected, the rnpA49 mutation is recessive . Even though this mutation is conditional, it is manifested at temperatures at which the carrier strains can grow. J Bacteriol, 1980 Feb, 141(2), 680 - 6 Incorporation and excision of 5-fluorouracil from deoxyribonucleic acid in Escherichia coli; Warner HR et al.; When Escherichia coli are grown in the presence of 5-fluorouracil, the 5-fluorouracil is incorporated almost exclusively into ribonucleic acid as fluorouridylate . In this study, small but detectable amounts were incorporated into ribonucleic acid as fluorocytidylate and into deoxyribonucleic acid as fluorodeoxyuridylate and fluorodeoxycytidylate . The amount of 5-fluorouracil found in deoxyribonucleic acid as fluorodeoxyuridylate increased 50-fold when the cells were deficient in both deoxyuridine triphosphatase and uracil-deoxyribonucleic acid glycosylase activities . Therefore, the same mechanisms which excluded uracil from deoxyribonucleic acid in vivo also excluded 5-fluorouracil . Even though purified uracil-deoxyribonucleic acid glycosylase excised 5-fluorouracil from deoxyribonucleic acid at only 5% the rate with which it excised uracil, most of the 5-fluorouracil excised from deoxyribonucleic acid in vivo was apparently excised directly by uracil-deoxyribonucleic acid glycosylase rather than by repair initiated by excision of uracil. J Bacteriol, 1980 Feb, 141(2), 550 - 7 Assembly of outer membrane lipoprotein in an Escherichia coli mutant with a single amino acid replacement within the signal sequence of prolipoprotein; Lin JJ et al.; We have compared the rate of assembly of outer membrane proteins including the lipoprotein in a pair of isogenic mlpA+ (lpp+) and mlpA (lpp) strains by pulse-chase experiments . The rate of assembly of the mutant prolipoprotein into the outer membrane was slightly slower than that of the wild-type lipoprotein . The rate of assembly of protein I and protein H-2 was similar in the wild type and the mutant, whereas the rate of assembly of protein II into the outer membrane was slightly reduced in the mutant strain . The organization of outer membrane was slightly reduced in the mutant strain . The organization of outer membrane proteins in the mutant cells appeared not to be grossly altered, based on the apparent resistance (or susceptibility) of these proteins toward trypsin treatment and their resistance to solubilization by Sarkosyl . Like the wild-type lipoprotein, the mutant prolipoprotein in the outer membrane was resistant to trypsin . On the other hand, the prolipoprotein in the cytoplasmic membrane fraction of the mutant cell envelope was susceptible to trypsin digestion . We conclude from these data that proteolytic cleavage of prolipoprotein is not essential for the translocation and proper assembly of lipoprotein into outer membrane. J Bacteriol, 1980 Feb, 141(2), 456 - 63 Structural specificity of the spermidine requirement of an Escherichia coli auxotroph; Jorstad CM et al.; A homologous series of spermidine analogs was synthesized with the general structure NH3+ (CH2)nNH2+(CH2)3NH3+, where spermidine has n = 4 . The influence of these compounds on growth and on the syntheses of protein and messenger ribonucleic acid was examined in a spermidine auxotroph of Escherichia coli . All of the homologs tested were taken up by the cells to an intracellular level equivalent to the level of spermidine which gives optimal growth . With increasing chain length of the homologs, there was reduced ability to stimulate growth . The homologs with n = 7 and n = 8 were essentially inactive . A similar specificity was observed when the ability of the homologs to restore the rates of protein and messenger ribonucleic acid chain elongation was compared to that of spermidine . These results suggest that a definite spatial arrangement of the amino groups of spermidine is required for productive interaction at its intracellular site(s) of action. Proc Natl Acad Sci U S A, 1980 Feb, 77(2), 890 - 4 Immunoelectron microscopic localization of the site of photo-induced affinity labeling of the small ribosomal subunit with puromycin; Olson HM et al.; Ribosomes from Escherichia coli strain TPR201 (which lack N6,N6-dimethyladenosine) have been photoaffinity labeled with {3H}puromycin in the presence of chloramphenicol . Puromycin-modified 30S ribosomal subunits appear to be identical to untreated subunits in electron micrographs and are efficiently precipitated by antibodies to the puromycin analog N6,N6-dimethyladenosine . Electron micrographs of subunit-antibody complexes show ribosomal subunits to which an individual antibody molecule is bound and pairs of 30S subunits which appear to be crosslinked by a single IgG molecule . A predominant site of puromycin photoaffinity labeling has been identified from the apparent point of contact of antibody and ribosomal subunit . The puromycin site is localized to the small upper portion of the particle on the side opposite to the subunit platform . This location is close to that reported for ribosomal protein S14, the major puromycin-labeled protein in the small ribosomal subunit. Proc Natl Acad Sci U S A, 1980 Feb, 77(2), 837 - 41 Apparent involvement of ribonuclease D in the 3' processing of tRNA precursors; Cudny H et al.; Escherichia coli RNase D and RNase II have been purified to homogeneity and compared for their ability to remove extra nucleotides following the -C-C-A sequence in tRNA precursors . RNase D and RNase II are single-chain proteins with molecular weights of 38,000 and 78,000, respectively . Both enzymes require a divalent cation for activity on tRNA precursors, but, in addition, RNase II is stimulated by monovalent cations . RNase D specifically removes mononucleotide residues from a mixture of tRNA precursors to generate amino acid acceptor activity for essentially all amino acids . Although RNase II can also remove precursor-specific residues, no amino acid acceptor activity is recovered . Similarly, RNase D action on the E . coli tRNATyr precursor is limited, whereas RNase II causes extensive degradation . In contrast to the processive mode of hydrolysis by RNase II, RNase D removes nucleotides randomly and slows down greatly at the -C-C-A sequence, thereby allowing the tRNA to be aminoacylated and protected from further degradation . These results suggest that RNase D is the 3'-processing nuclease in vivo and that RNase II is a nonspecific degradative enzyme . The importance of RNA conformation for correct processing is also discussed. Eur J Biochem, 1980 Feb, 104(1), 65 - 9 Affinity labeling of the Escherichia coli aspartate-beta-semialdehyde dehydrogenase with an alkylating coenzyme analogue . Half-site reactivity and competition with the substrate alkylating analogue; Biellmann JF et al.; 3-Chloroacetylpyridine-adenine dinucleotide phosphate (clac3PdADP+, a NADP+ alkylating analogue, irreversibly inactivates aspartate-beta-semialdehyde dehydrogenase with pseudo-first-order kinetics . NADP+ and NADPH, but not the substrate, protected the enzyme from inactivation . The pH dependence of the inactivation kinetics was determined . Incorporation of 1 mol cl{14C}-ac3PdADP+/dimer totally inactivates the enzyme . Successive alkylation by the coenzyme analogue and by the substrate analogue, L-2-amino-4-oxo-5-chloropentanoic acid, was studied . After inactivation with the coenzyme analogue, no incorporation of the substrate analogue was detected . However, when the enzyme was first inactivated with the substrate analogue, the protein could subsequently be alkylated with the coenzyme analogue . The binding of NADP+ and NADPH to aspartate-beta-semialdehyde dehydrogenase was determined by fluorescence. Eur J Biochem, 1980 Feb, 104(1), 59 - 64 Aspartate-beta-semialdehyde dehydrogenase from Escherichia coli . Affinity labeling with the substrate analogue L-2-amino-4-oxo-5-chloropentanoic acid: an example of half-site reactivity; Biellmann JF et al.; The substrate binding site of aspartate-beta-semialdehyde dehydrogenase from Escherichia coli was studied by affinity labeling with L-2-amino-4-oxo-5-chloropentanoic acid . The substrate analogue irreversibly inactivates the enzyme with pseudo-first-order kinetics and with a half-of-the-sites reactivity . The substrate aspartate beta-semialdehyde protects the enzyme against the inactivation . A single group is labeled at the active site and is concluded to be the side-chain of a histidine residue . The amino acid sequence around the active site residue was established from a peptic digest of the labeled enzyme: Phe-Val-Gly-Gly-Asp-(modified residue)-Thr-Val-Ser. Eur J Biochem, 1980 Feb, 104(1), 53 - 8 Aspartate-beta-semialdehyde dehydrogenase from Escherichia coli . Purification and general properties; Biellmann JF et al.; Aspartate-beta-semialdehyde dehydrogenase, from an Escherichia coli mutant derepressed for the biosynthesis of L-lysine, has been purified to homogeneity . Its isoelectric point is pH 4.3 . This enzyme has a molecular weight of 77000 and is composed of two identical or highly similar subunits of molecular weight 38000 +/- 2000 . Their N-terminal amino-acid sequence is Met-Lys-Asx-Val-Gly- . Three cysteine residues per subunit were detected: two are reactive in the native enzyme and one is partially protected by the substrate . Formation of an acyl-enzyme intermediate was also detected . Correlation of the 1H nuclear magnetic resonance spectrum of {4-2H}NADPH produced from {4-2H}NADP+ indicated that aspartate beta-semialdehyde dehydrogenase transfers the pro-S hydrogen from NADPH (class B dehydrogenase) . A short comparison with the corresponding yeast enzyme is given. J Bacteriol, 1980 Feb, 141(2), 858 - 67 flu, a metastable gene controlling surface properties of Escherichia coli; Diderichsen B; flu, a gene of Escherichia coli K-12, was discovered and mapped between his and shiA . It is shown that flu is a metastable gene that changes frequently between the flu+ and flu states . flu+ variants give stable homogeneous suspensions, are piliated, and form glossy colonies . flu variants aggregate, fluff and sediment from suspensions, are nonpiliated, and form frizzy colonies . flu+ and flu variants can be isolated from most strains . Implications of these observations are discussed, and it is demonstrated that flu+ variants of strain P678-54 yield three times more minicells than flu variants. Boll Soc Ital Biol Sper, 1980 Jan 30, 56(2), 108 - 14 {Influence of Zn++ and of Mg++ on alkaline phosphatase activity of different origins}; Casey H et al.; Many researches have shown the role of some bivalent ions on the structure and function of alkaline phosphatase . For this reason we considered interesting to assay the effect of Zn++ and Mg++, at various concentrations, on the activity of alkaline phosphatase (APase) from different sources . The isoenzymes of alkaline phosphatase used for the experiments were from rat kidney and bone, from calf intestinal mucosa and from Escherichia coli . In order to investigate the effect of Zn++ and Mg++ on the enzyme activity, the two ions were removed using EDTA as chelating agent . The residual enzymatic activity was measured after having preincubated for 15 min the enzyme with EDTA at a final concentration of 0.05 mM, 0.1 mM, 0.5 mM, 5 mM, 25 mM . The reactivation of the enzyme was studied using as reference a sample, in which the final concentration of EDTA was 5 mM . In these series of experiments the enzymatic activity was assayed after a preincubation of the reaction mixture with ZnCl2 10 mM, MgCl2 10 mM and ZnCl2 +MgCl2 10 mM . The inactivation in the time of the enzyme by 5 mM EDTA was also studied . The results obtained show that APase from intestinal mucosa maintained, at the lower concentrations of EDTA (0.05, 0.1 and 0.5 mM), a residual activity higher than that of the enzymes of other source . Moreover, whilst the activity of the mucosal enzyme was completely restored by the addition of Zn++, the complete reactivation of the other enzyme activities was obtained only by the addition of Zn++ and Mg++ together . Concerning the inactivation by EDTA during the time, it was shown that APase from calf intestinal mucosa was inactivated after 60 min of incubation, while the enzymes from other sources lost completely their activity after 10 min. Nucleic Acids Res, 1980 Jan 25, 8(2), 403 - 21 Comparative study of the interaction of polyuridylic acid with 30S subunits and 70S ribosomes of Escherichia coli; Katunin VI et al.; Fractionated polyuridylic acid with an average chain length of 55 nucleotides forms binary complexes with 30S subunits with a stoichiometry of I:I . These complexes are heterogeneous in stability . The more stable one is characterized by an association constant K2 - 5.5xI09 M-I, and the less stable-by KI = I06xM-I, at 20 mM Mg2+, 200 mM NH4(+) and 0 degrees C . The main reason for this heterogeneity is the presence or absence of the ribosomal protein SI in the presence or absence of the ribosomal protein SI in the subunits . Decrease of Mg2+ concentration down to 5 mM hardly changes the K2 values but reduction of the NH4(+) concentration to 50 mM results in a 25-fold increase of K2 . Association constants K2 for the stable complex, i.e . in the presence of SI protein, were measured at different temperatures (0 - 30 degrees C) and the thermodynamic parameters of binding (delta H degrees, delta S degrees, delta G degrees) were determined . Analogous experiments were made with 70S ribosomes . K2 values as well as delta H degrees, delta S degrees, delta G degrees appeared the same both for 30S and 70S ribosomes in all conditions examined . This is strong evidence that the 50S subunits do not contribute to the interaction of poly(U) with the complete 70S ribosomes. J Biol Chem, 1980 Jan 25, 255(2), 714 - 7 Regulation of phospholipid biosynthesis in Escherichia coli . Cloning of the structural gene for the biosynthetic sn-glycerol-3-phosphate dehydrogenase; Clark D et al.; The structural gene for the Escherichia coli biosynthetic sn-glycerol-3-phosphate (glycerol-P) dehydrogenase gpsA, was transferred from a defective transducing phage (lambda dcysE, gpsA) into the Eco RI site of plasmid pMB9 by recombinant DNA techniques . The recombinant plasmids suppressed the glycerol-P requirement of gpsA- mutants and strains bearing one such plasmid, pDC2, overproduced the glycerol-P dehydrogenase about 60-fold . The glycerol-P dehydrogenase from a strain bearing the pDC2 was purified 200-fold to homogeneity . This is contrasted to the 12,000-fold purification required to purify the enzyme from a wild type strain (Edgar, J . R., and Bell, R . M . (1978) J . Biol . Chem . 253, 6348-6353) . The homogeneous enzyme purified from a strain bearing the pDC2 plasmide was strongly inhibited by glycerol-P (Ki of 2.5 microM) . The introduction of the pDC2 plasmid into glycerol-P auxotrophs containing a Km-defective glycerol-P acyltranferase, defined by the plsB locus, caused a 60-fold overproduction of the glycerol-P requirement . This strongly suggests that the intracellular level of glycerol-P is stringently regulated in vivo by a mechanism involving feedback inhibition of the glycerol-P dehydrogenase by glycerol-P. J Biol Chem, 1980 Jan 25, 255(2), 534 - 9 Development of Escherichia coli virus T1 . The role of the proton-motive force; Wagner EF et al.; In the interaction between Escherichia coli virus T1 and its host cell, which leads to reorientation of macromolecule synthesis, the alteration of the host cell membrane is an important step: The proton-motive force is rapidly reduced . This became apparent from selective changes in energy-coupled transports: proton-motive force- and ATP-dependent transports are inhibited in wild type cells . However, in ATPase-deficient (unc-) cells the ATP-driven transports are not affected by T1 . The membrane potential is reduced by T1 as was measured by triphenylmethylphosphonium ion distribution . The potassium gradient is dissipated and calcium ions are accumulated by the cells . However, the residual (but reduced) membrane energy is essential for T1 development since the addition of uncouplers prevents any viral production . Consistently, the cell membrane remains intact after T1 infection: proteins, like beta-galactoside, amino acids, and alpha-methylglucoside cannot passively penetrate the membrane of T1-infected cells. J Biol Chem, 1980 Jan 25, 255(2), 512 - 7 Location of three active site residues in the NH2-terminal sequence of the beta 2 subunit tryptophan synthase from Escherichia coli; Higgins W et al.; The three known active site residues of the tryptophan synthase beta 2 subunit from Escherichia coli are shown to fall within 25 residues of each other in the primary sequence of the NH2-terminal region of the beta 2 subunit . These residues are: lysine-86, which forms a Schiff's base with pyridoxal phosphate; histidine-81 or histidine-85, which removes the alpha proton of L-serine; and cysteine-61, which reacts with bromoacetylpyridoxamine phosphate, an affinity label for the beta 2 subunit . The sequence of the first 78 residues of a single cyanogen bromide fragment containing these active site residues has been determined by automatic Edman degradation and by sequence analysis of daughter peptides . This 79-residue cyanogen bromide fragment, which contains the 22-residue pyridoxyl peptide sequenced earlier by Fluri et al . (Fluri, R., Jackson, L . E., Lee, W . E., and Crawford, I . P . (1971) J . Biol . Chem . 246, 6620-6624), was placed at the NH2-terminal end of the beta chain beginning at residue 22 . Thus, the primary sequence of residues 1 to 99 of the beta 2 subunit is reported. J Biol Chem, 1980 Jan 25, 255(2), 379 - 83 Studies on the quaternary structure of Escherichia coli pyruvate oxidase; Stevens DJ et al.; Pyruvate oxidase is a peripheral membrane enzyme isolated from Escherichia coli . The enzyme catalyzes the oxidative decarboxylation of pyruvate to yield acetate plus CO2 . The specific activity of the purified oxidase is stimulated 25-fold by lipids, and this lipid requirement has been the subject of previous studies . Since the enzyme is a tetramer at high protein concentrations (1 mg/ml) and is known to self-aggregate under certain conditions, the question arose as to whether the lipid stimulation observed in the steady state assay might be due to a change in the quaternary structure of the protein, either a dissociation or further association . This report is directed at determining the state of association of pyruvate oxidase under assay conditions by using fluorescence polarization . A photoreactive, nonspecific probe, 1-azidonaphthalene 5-sulfonate, was used to label the protein surface with an extrinsic fluorophore . It is concluded that under steady state assay conditions the oxidase remains tetrameric. J Biol Chem, 1980 Jan 25, 255(2), 357 - 60 Synthesis of ribosomal protein S1 following nutritional shift-up in Escherichia coli K-12; Adachi K et al.; The synthesis rate of ribosomal protein S1 was measured in Escherichia coli K-12 during the transitional period following a nutritional shift-up from acetate minimal to glucose/amino acids/nucleosides medium . The synthesis rate of S1 increased without a lag suggesting that the S1 gene is under stringent control and located very close to its promoter . The rate of S1 synthesis slowed between 7 and 15 min, and then increased to the postshift-up steady state rate . The postshift-up steady state rate was half the initial rate obtained between 0 and 7 min . The slow down in the synthesis rate between 7 and 15 min indicates that an unknown factor(s), in addition to guanosine 5'-diphosphate, 3'-diphosphate, participates in the regulation of S1 gene expression. J Biol Chem, 1980 Jan 25, 255(2), 540 - 2 Development of escherichia coli virus T1 . ATP-mediated discrimination of gene expression; Wagner EF et al.; The mechanism of host shut-off following virus T1 infection was studied using Escherichia coli wild type and ATPase deficient (unc-) cells . Host protein synthesis measured either as amino acid incorporation into proteins or as enzyme synthesis is immediately inhibited in T1-infected wild type cells . In contrast, host repression in the ATPase-deficient cells is almost unaffected after T1 infection . The continuation of host macromolecule synthesis in the unc- cells is due to constant ATP concentrations after infection, whereas an immediate drop in intracellular ATP levels in T1-infected wild type cells causes repression of host protein synthesis . This result is confirmed when host protein synthesis is determined at decreasing ATP concentrations following the starvation of cells. Nucleic Acids Res, 1980 Jan 25, 8(2), 389 - 402 Non-specific binding of restriction endonuclease EcoR1 to DNA; Woodhead JL et al.; Restriction endonuclease, EcoRl cleaves the DNA sequence (see formula in text) at the points indicated . Under certain conditions, EcoRl activity is observed when (see formula in text) is cut . Mg2+ is required for both activities . We find that in addition to binding to the above sites, EcoRl will also bind, although less strongly, to DNA containing neither site . Methyl acetimidate, which reacts specifically with lysine residues, inactivates the enzyme . This specific effect can be prevented by SV40 DNA and lambda DNA which contain EcoRl and EcoRl sites, by 0X174 DNA, which has only EcoRl sites and also by Polyd(AT) and polyd(GC) containing neither site . Protection occurs in the absence or presence of magnesium . The significance of this non-specific binding, both for the use and mechanism of EcoRl will be discussed. Nucleic Acids Res, 1980 Jan 25, 8(2), 361 - 75 Evidence implying DNA polymerase beta function in excision repair; Siedlecki JA et al.; Comparison was made of the ability of calf thymus DNA polymerases alpha and beta to replicate the following templates: native E . coli CR-34 DNA (T-DNA), calf thymus DNA activated by DNase I (act.DNA), BU-DNA (from E . coli CR-34 cells cultured on BUdR-containing medium) with damages resulting from incomplete excision repair, as well as thermally denatured act.DNA and BU-DNA (s.s.act.DNA and s.s.BU-DNA) . 3H-TTP incorporation during extensive replication of act.DNA was similar for both enzymes, being, as expected, 40 times higher than for T-DNA . Likewise, the differences in the yield of the s.s.act.DNA or s.s.BU-DNA replication between both enzymes were negligible . In contrast, damaged native DNA was 6 - 30 times more extensively replicated by DNA polymerase beta than alpha . We propose that this is due to the greater ability of DNA polymerase beta compared with alpha to replicate single-stranded gaps, the presence of which is more likely in damaged BU-DNA than in T-DNA and act.DNA. Nucleic Acids Res, 1980 Jan 25, 8(2), 253 - 64 Isolation of DNA from agarose gels using DEAE-paper . Application to restriction site mapping of adenovirus type 16 DNA; Winberg G et al.; A new method for isolating DNA from agarose gels is described . The method involves the simultaneous transfer of all DNA-fragments from an agarose slab gel onto DEAE-cellulose paper and the elution of the individual fragments from the paper with 1 M NaCl . DNA isolated from agarose gels in this way is susceptible to cleavage with several restriction endonucleases, and can be labeled in vitro with E coli DNA-polymerase I, T4 DNA-polymerase and T4 polynucleotide kinase . We have used the method to construct restriction endonuclease maps of adenovirus type 16 DNA. Nucleic Acids Res, 1980 Jan 25, 8(2), 299 - 317 Electrophoretic transfer of DNA, RNA and protein onto diazobenzyloxymethyl (DBM) - paper; Stellwag EJ et al.; A method has been developed for the electrophoretic transfer of DNA, RNA, protein and ribonucleoprotein particles from a variety of gels onto diazobenzyloxymethyl (DBM) - paper . Conditions for the electrophoretic transfer of these macromolecules have been optimized to allow for nearly quantitative transfer and covalent coupling . DNA and RNA electrophoretically transferred to DBM-paper retain their ability to hybridize with specific probes . The high efficiency of transfer and the high capacity of DBM-paper for nucleic acids makes possible the sensitive detection of specific nucleotide sequences . Similar efficiency is achieved in electrophoretic transfer and covalent coupling of proteins to DBM-paper . Macromolecules can also be electrophoretically transferred and bound to DBM-paper incapable of covalent bond formation . Their elution from the paper in high salt provides a new and useful preparative method for isolation of DNA, RNA and protein. Nature, 1980 Jan 24, 283(5745), 346 - 50 Lateral mobility in reconstituted membranes--comparisons with diffusion in polymers; Schindler M et al.; The diffusion coefficients (D) of lipopolysaccharide, phospholipid, and Escherichia coli matrix protein were determined in reconstituted multibilayer membranes . Over a range of protein concentration of 0--60% by weight, D for lipopolysaccharide decreased 10-fold, whereas D for phospholipid remained essentially constant . The diffusion coefficient of matrix protein at a concentration of 50% was less than or equal to 10(-12) cm2 s-1 . These results are discussed in terms of a model for diffusion in polymeric networks. Biochemistry, 1980 Jan 22, 19(2), 395 - 400 Transfer ribonucleic acid guanine transglycosylase isolated from rat liver; Shindo-Okada N et al.; Transfer ribonucleic acid (tRNA) guanine transglycosylase (guanine insertion enzyme) was isolated from rat liver and extensively purified . The enzyme catalyzes an exchange of queuine (the base of queuosine, Q) as well as its precursors and guanine for guanine originally located in the first position of the anticodon of "undermodified" tRNATyr, tRNAHis, tRNAAsn, and tRNAAsp from an Escherichia coli mutant or rat ascites hepatoma cells . This is in contrast to the previous observation that E . coli tRNA-guanine transglycosylase catalyzes the exchange of queuine precursors, such as 7-(aminoethyl)-7-deazaguanine and 7-cyano-7-deazaguanine, but not of queuine itself {Okada, N., Noguchi, S . Kasai, H., Shindo-Okada, N., Ohgi, T., Goto, T., & Nishimura, S . (1979) J . Biol . Chem . 254, 3067-3073} . The Km value for queuine of the rat liver enzyme is 9.2 X 10(-7) M, much lower than the values for the bases of queuosine precursors or guanine . Thus, the actual substrate for tRNA-guanine transglycosylase in queuosine biosynthesis in vivo in rat liver may not be 7-(aminomethyl)-7-deazaguanine, which is thought to be an actual substrate guanine, the E . coli system . Queuine or some queuine derivative may be the actual substrate for the tRNA-guanine transglycosylase reaction in the biosynthesis of Q in tRNA of mammalian cells . 6-Thioguanine and 8-azaguanine are also found to be good substrates. Biochemistry, 1980 Jan 22, 19(2), 325 - 9 Stereochemical course of a phosphokinase using a chiral {18O}phosphorothioate . Comparison with the transfer of a chiral {16O,17O,18O}phosphoryl group; Pliura DH et al.; Synthetic adenosine 5'-O-{3-18O,3-thio}triphosphate having the R configuration at the gamma-phosphorus has been used as a substrate in the reaction catalyzed by glycerol kinase . The product sn-glycerol 3-{18O}phosphorothioate has been isolated, and the configuration at phosphorus has been determined by ring closure to the two diastereoisomeric cyclic 2,3-phosphorothioates of sn-glycerol and analysis of the 18O content of each diastereoisomer . The structural identity of these diastereoisomers has been determined by correlation with one of the corresponding diastereoisomers of the cyclic 2,3-phosphorothioate of D-glycerate, whose crystal structure is reported here . From these experiments it is evident that glyc:rol kinase catalyzes the transfer of a thiophosphoryl group with inversion of the configuration at phosphorus, in gratifying agreement with the result from the transfer of a chiral {16O,17O,18O}phosphoryl group {Blattler, W . A., & Knowles, J . R . (1979) J . Am . Chem . Soc . 101, 510}. Biochim Biophys Acta, 1980 Jan 18, 617(1), 20 - 7 The effect of temperature and membrane lipid composition on the rate of beta-oxidation by