|
|
Microbios, 1984, 40(161-162), 135 - 44 On the aggregation of cells during growth and its effect on the isolation of auxotrophic mutants of Bacillus brevis ATCC 10068; Rao AS et al.; We have shown that penicillin effects a five log10 kill of a growing culture of a prototrophic strain of Bacillus brevis ATCC 10068 and less than a one log10 kill of an auxotrophic mutant incubated in the absence of the auxotrophic requirement . In spite of this, when a mixed culture of auxotrophic and prototrophic strains were incubated with penicillin under conditions conducive for selection of auxotrophic strains, such strains were not recovered . During growth in both AGM and PY media, the majority of B . brevis cells exist in clumps . Although there is no obvious correlation between the numbers of cells in clumps and the stage of growth with either of the growth media used, bigger clumps consisting of hundreds of single cells were observed in the AGM medium . In experiments with a mixed population of auxotrophic mutants previously derived from the B . brevis ATCC 10068 it was demonstrated that the aggregation of the cells occurred in either the presence or the absence of their growth requirements . The importance of this phenomenon in the aggregation of cells is discussed in relation to the isolation of auxotrophic mutants of B . brevis ATCC 10068. Folia Microbiol (Praha), 1984, 29(4), 273 - 81 Repression of the synthesis of exocellular and intracellular proteinases in Bacillus megaterium; Moravcova J et al.; The synthesis of exocellular proteinase decreases with increasing concentration of amino acids in the growth medium . After removal of amino acids the enzyme synthesis is gradually restored to normal values . The presence of inhibitors of transcription (actinomycin D) or translation (chloramphenicol) blocks the restoration of enzyme synthesis . No active or inactive precursors of the exocellular enzyme could be detected in the cell . It is likely that the enzyme synthesis is regulated by amino acids at the level of specific mRNA synthesis rather than at the translation level or at the level of secretion . The activity of the enzyme that has already been secreted to the external medium is partially inhibited by amino acids . The periplasmic proteinase is repressed by amino acids to the same extent as the exocellular enzyme . The content of the enzyme(s) inside the protoplast is also decreased during growth in the presence of amino acids. Biochem Int, 1984 Jan, 8(1), 27 - 33 An anion binding site in the active centre of phospholipase C from Bacillus cereus; Aalmo K et al.; The bi-Zn2+-enzyme phospholipase C (Bacillus cereus) is readilly inhibited by univalent anions . N.m.r . studies on the 113Cd-substituted enzyme showed the presence of an inert and a perturbable metal, neither of which seemed affected by I- . X-ray crystallographic analysis showed the binding of one I- to the enzyme 4.8 A from the nearest metal (too far for a metal-halide bond) . Phospholipase C contains an arginine residue apparently necessary for substrate binding and I- partially protected against inactivation by an arginine reagent . Thus an arginine residue may represent the binding site for univalent anions in the enzyme active centre. Adv Tuberc Res, 1984, 21, 79 - 106 Research on BCG vaccination; ten Dam HG; BCG vaccination against tuberculosis has been used for many years in practically all national tuberculosis programmes . It is often the mainstay of the programme as regards young children, in whom case-finding and treatment remain deficient, especially regarding the serious meningeal and miliary forms of tuberculosis . Following contradictory reports on the effectiveness of BCG vaccination, a large-scale controlled trial was carried out in south India, under the sponsorship of WHO . The early results of this trial showed that BCG vaccination provided no protection whatsoever against bacillary disease in adults . To examine this unexpected finding WHO convened a Scientific Group, which considered that the reported results per se are valid but might not apply in general . Since the effectiveness of a potentially very useful and generally applied control measure appeared seriously challenged, a Study Group was convened by WHO . The Group considered that under the circumstances BCG vaccination, especially of young children, should be continued, but that the effectiveness of BCG vaccination should be evaluated forthwith . A comprehensive programme has been formulated accordingly . The primary objective of the programme is to evaluate in an expedient manner the effectiveness of BCG vaccination in children . A number of problems inherent to the special situation had to be circumvented . In the case of tuberculosis, community trials of the classical type have to be prolonged and are extremely costly . Moreover, since BCG vaccination has been used widely, it is virtually impossible to find a suitable trial area; many countries are reluctant to conduct such trials for ethical reasons because they require an unvaccinated group . Retrospective studies, although providing no conclusive scientific evidence when carried out in isolation, may give useful information if organized in a comprehensive evaluation programme . Another approach proposed is based on the active follow-up of child contacts of newly detected cases of tuberculosis . This provides information on the magnitude of the tuberculosis problem in children as well as a powerful retrospective evaluation of the protective effect of vaccination; in the case that the results are inconclusive a prospective approach on the same principle would be ethically justified . The study population is only a small fraction of that required in a community trial, and the follow-up of each individual is reduced to a few months . In addition to providing information on the effectiveness of BCG vaccination, the field studies, supported by other research, may clarify the variations in protection observed.(ABSTRACT TRUNCATED AT 400 WORDS) Int J Biochem, 1984, 16(8), 931 - 4 The binding and hydrolysis of sphingomyelin by phospholipase C (Bacillus cereus) as shown by 31P NMR; Aalmo KM et al.; 31P nuclear magnetic resonance studies showed that heavily inactivated phospholipase C (Bacillus cereus) initially caused line broadening in the 31P resonance from sphingomyelin thus indicating enzyme-lipid association . Using larger amounts of enzyme or longer preincubation caused a displacement of the 31P resonance to a position suggesting phosphorylcholine formation . Incubation of the heavily inactivated enzyme with a phosphonolipid caused a displacement of the 31P resonance suggesting hydrolysis. Microbios, 1984, 41(160), 117 - 25 Role of the capsule produced by Bacillus megaterium ATCC 19213 in the accumulation of metallic cations; Cassity TR et al.; A study was undertaken to determine if the capsule produced by Bacillus megaterium ATCC 19213 was capable of binding metallic ions . For non-toxic metallic ions, this was accomplished by determining the relative concentrations of Fe2+, Ca2+, Zn2+, Mg2+, and Mn2+ removed from a chemically defined medium by the normally capsulated parent strain and two mutants with much smaller capsules . For toxic metals, the rates of respiration of the parent strain and a small capsule mutant in the presence of Cu2+, Hg2+, and Ag1+ were compared . It was found that the parent strain accumulated more Ca2+, Mg2+, and Mn2+ . Accumulation of Fe2+ and Zn2+ was similar for the parent strain and the small capsule mutants . Respiration of the parent strain was less inhibited by Cu2+, Hg2+, and Ag1+, indicating that these metals are also bound to the capsule. Mol Gen Genet, 1984, 194(3), 432 - 43 Sequence and evolution of the regions between thr rrn operons in the chloroplast genome of Euglena gracilis bacillaris; El-Gewely MR et al.; The rRNA genes are arranged in three sequential operons preceded by a fourth partial operon . Part or all of a 1462 nucleotide sequence extending from within the 3'-end of the 23S rRNA gene, across the 5S rRNA gene and a presumptive transcription terminator, to within the first structural gene (for 16S rRNA) of the rrn operon was determined for each region between operons . Homologies of the 3'-end of the 23S rRNA gene with the 4.5S rRNA genes of higher plant chloroplasts, and of the 5S rRNA gene with other 5S rRNA genes were examined . The region preceding the 16S rRNA gene, which is expected to contain sites for initiation and regulation of rrn transcription, includes a 305 base-pair sequence with substantial homology with structural genes elsewhere in the chloroplast genome . The homologies suggest that this portion of the leader evolved from copies of parts of the structural genes which had been inserted before the 16S rRNA genes . Thus the chloroplast rrn leader may provide a unique opportunity to study how a regulatory sequence evolved from well-defined structural genes. Med Trop (Mars), 1984 Jan-Mar, 44(1), 49 - 56 {Tuberculosis control in the regional health district of Mauritanian Adrar (September 1976 to September 1980)}; Amblard J; Two strategies toward tuberculosis control in the sanitary district of Adrar (Mauritania) are compared . From September 1976 to September 1978, tuberculosis control is centralized in few health centers where non standardized diagnosis methods are applied, with a curative and non-mobile scheme . From September 1978 to September 1980, this control is decentralized, utilizing the purposely set up preventive medicine structures which are based on one pluri -disciplinary mobile team and on sanitary agents (del egu es sanitaires ) . The comparative study indicates clearly that, during the second period, screening and monitoring of the patients is much more effective (significant decrease in the number of people no more recorded; increased number of the people either cured or presenting a favourable evolution) . The author noticed in the area under investigation, that incidence of the disease did not depend upon both dwelling (urban or rural) and living conditions (nomadic or sedentary) In addition, the interest of paraclinical exams, bacilloscopy excepted, is rather inexistent in the screening of the pulmonary tuberculosis. Zentralbl Mikrobiol, 1984, 139(2), 129 - 33 Occurrence of Bacillus cereus in milk and milk products in Egypt; Helmy ZA et al.; The presence of B . cereus spores in raw, pasteurized, and dry milk as well as in Damietta and processed cheese and in a baby food product was investigated, using three selective agar media for enumeration . The organism was detected in 70, 90, and 50% of milk, in processed and Damietta cheese samples, respectively . Spore counts varied from 10(2) to 10(6) and from 10 to 10(2)/ml of raw and pasteurized milk, respectively . In the two types of cheese and dried milk spore densities reached 10 to 10(3)/g . Egg yolk agar (E) gave better recovery rate of B . cereus when compared to the other two media, containing lithium chloride plus polymyxine B- sulphat (I) or polymyxin B-sulphate alone (KG) . The latter agar medium favoured the development of larger colonies, surrounded by a more distinctive zone of precipitation. Microbiol Immunol, 1984, 28(2), 181 - 8 Occurrence of galactosamine-6-phosphate as a constituent of Bacillus megaterium spore coat; Nasu M et al.; Galactosamine-6-phosphate was identified as a component of the coat of the Bacillus megaterium QM B1551 spore . It was one of the main constituents of the outermost layer of the spore coat, but it was absent from the other integuments including the cortex . These findings suggest that galactosamine-6-phosphate comprises the phosphorus-containing skeleton structure of the spore coat. Folia Microbiol (Praha), 1984, 29(2), 99 - 103 Mutants of Bacillus megaterium with altered synthesis of an exocellular neutral proteinase; Kucerova H et al.; Germinated spores of Bacillus megaterium were mutagenized with ethyl methanesulphonate and spread on test agar with caseinate . Colonies with altered proteolytic zones or morphology were isolated and tested in liquid media . The mutants can be divided into four groups: A) those producing more proteinase in both growth and sporulation media, B) those producing the same amount of the enzyme in growth medium but higher amount in sporulation medium, C) those producing less proteinase in the growth medium and more in the sporulation one, D) those producing less or no enzyme . Clones of the first three groups were phenotypically asporogenic . All mutants producing more enzyme during growth retained their sensitivity to repression by amino acids . Isolation of mutants of types B) and C) supports the idea of differences in the control of proteinase synthesis during growth and during sporulation. Zentralbl Mikrobiol, 1984, 139(1), 49 - 55 Entomopathogenic spore-formers from soil samples of mosquito habitats in northern Nigeria; Weiser J et al.; Spore-forming bacteria, isolated from bottom soil samples of periodical mosquito-breeding places in Kaduna, N . Nigeria, were tested for mosquito pathogenicity . Culex pipiens autogenicus was used for this screening . Five strains, all of the Bacillus thuringiensis group, were active in 85 isolates from 32 samples . The isolates were from three different serotypes (H-14, H-5a5c, and H-8a8b) . The activity, compared with the SIP standard, was in the known limits of B . thuringiensis israelensis. Radiat Environ Biophys, 1984, 23(1), 69 - 73 The effect of superoxide dismutase on the radiosensitivity of bacterial spores at various oxygen concentrations; Gazso GL et al.; Superoxide dismutases are considered to be essential protective agent against radiation injury . Experiments were carried out to investigate the effect of extracellularly added SOD on the radiosensitivity of Bacillus megaterium spores . 120 micrograms/ml SOD had no effect on the radiosensitivity of Bacillus megaterium spores at different oxygen concentrations . Relative enzyme activity obtained at various oxygen concentrations indicating the lack of oxygen effect in the radiation-induced inactivation of SOD. Cell Immunol, 1984 Jan, 83(1), 170 - 80 Antibody-dependent cytolysis (ADCC) of tumor cells by activated murine macrophages is a two-step process: quantification of target binding and subsequent target lysis; Johnson WJ et al.; To analyze the antibody-dependent cell-mediated cytotoxicity (ADCC) reaction between tumor cells and activated murine macrophages in detail, it must be first determined if physical binding occurred between the two cell types . Over 15-20 min in vitro, antibody-coated HSB neoplastic targets became so firmly attached to the activated macrophages that they resisted removal with 4 vigorous washes . When a quantitative assay of binding was employed, attachment of tumor cells to activated macrophages was found to depend on the concentration of antibody and on the density of the macrophages . These two variables also determined the subsequent extent of cytolysis . Binding of antibody-coated targets by macrophages elicited with thioglycollate broth or activated by bacillus Calmette-Guerin (BCG) was comparable . Lysis by the activated macrophages, however, was far greater . Binding occurred at 4, 22, or 37 degrees C, while the subsequent lytic reaction occurred only at 37 degrees C . Thioglycollate broth effectively inhibited lysis but had no effect on binding . A porous filter placed between activated macrophages and targets resulted in abrogation of binding and lysis, even when antibody-coated targets were placed beneath the filters . When labeled, uncoated targets were added to cultures of macrophages in the presence of unlabeled antibody-coated targets, no lysis of the bystander (i.e., uncoated) targets was seen . The data suggest that ADCC is a multistep reaction, that vigorous physical binding of antibody-coated targets by activated macrophages is an initial and necessary step in ADCC, that such binding is not sufficient for ADCC, that such binding controls the selectivity of lysis in ADCC, and that the second step in ADCC results in target lysis. J Urol, 1984 Jan, 131(1), 139 - 42 Comparison of the efficacy of intravesical Bacillus Calmette-Guérin with thiotepa, mitomycin C, poly I:C/poly-L-lysine and cis platinum in murine bladder cancer; Shapiro A et al.; The efficacy of intravesical Bacillus Calmette-Guerin for the treatment of the mouse bladder tumor MBT-2 was compared with that of thiotepa, mitomycin C, cis-diamminedichloroplatinum II and poly I:C/poly-L-lysine . MBT-2 cells were instilled into the bladder immediately after electrocauterization . Drug instillations were initiated 24 hours later and continued on a weekly basis for 4 weeks . Both Bacillus Calmette-Guerin and cis-diamminedichloroplatinum II significantly (p less than .0004) inhibited MBT-2 tumor implantation when compared to diluent-treated controls . Neither mitomycin C, thiotepa nor poly I:C/poly-L-lysine significantly inhibited tumor implantation . Mean tumor weights also were significantly (p less than .05) reduced in Bacillus Calmette-Guerin and cis-diamminedichloroplatinum II-treated mice, while tumor mean weights in mice treated with thiotepa, mitomycin C or poly I:C/poly-L-lysine were not significantly different than controls . These results suggest that the efficacy of intravesical Bacillus Calmette-Guerin in comparison with other drugs in the MBT-2 mouse bladder tumor model is similar to observations reported in human clinical trials in which intravesical Bacillus Calmette-Guerin was shown to be more effective than other cytotoxic drugs . These data further support the utility of the MBT-2 model for the study of the mechanisms by which Bacillus Calmette-Guerin inhibits bladder tumor growth. Microbiol Immunol, 1984, 28(10), 1093 - 8 Further studies of the use of cycloheximide for cultivating Mycobacterium lepraemurium in cell culture; Matsuo Y; The advantage of using cycloheximide for cultivating Mycobacterium lepraemurium in cell culture was further demonstrated . Continuous multiplication of the bacillus in successive subcultures was obtained in MFP, HEp-2 and Vero cells maintained in culture medium containing 0.1 microgram of cycloheximide per ml . Growth characteristics were comparable to those observed in the cultures of A31 cells previously reported . The procedure was simple and convenient . Comparable results, however, have not been obtained in cultures of other established cell lines, HeLa 229, L, MDCK, and Neuro-2a. Exp Lung Res, 1984, 6(2), 159 - 69 Alveolar macrophage plasminogen activator; Schuyler M et al.; Plasminogen activator is a neutral serine protease secreted by many different cells, including activated peritoneal macrophages, which can mediate both inflammation and fibrinolysis and perhaps cytolysis of tumor cells . Secretion of plasminogen activator by rabbit alveolar macrophages derived from normal animals and rabbits pretreated with bacillus Calmette-Guerin (BCG) to activate these macrophages was examined . Plasminogen activator was secreted into media of cultured alveolar macrophages, but was not present within the cells . Secretion, which was dependent upon the presence of viable cells, could be blocked by protein synthesis inhibitors and enhanced by concanavalin A and phorbol myristate acetate . The inhibition profile of rabbit alveolar macrophage plasminogen activator is consistent with that of a serine protease . Plasminogen activator is present in two forms with molecular weights of 28,000 and 45,000 . Alveolar macrophage plasminogen activator was secreted in cultures from most rabbits (17 of 23) pretreated with BCG, but rarely in those from normal animals (2 of 14) . Lavage fluids from many rabbits contained viable Bordetella bronchiseptica, but the presence of this organism showed no correlation with secretion of plasminogen activator . Rabbit alveolar macrophages secrete a plasminogen activator similar to that secreted by mouse peritoneal macrophages as described previously . Secretion is enhanced by activation of alveolar macrophage populations. Folia Microbiol (Praha), 1984, 29(1), 19 - 22 Kinetics of alpha-amylase production in a continuous culture of Bacillus licheniformis; Votruba J et al.; As found during continuous cultivation of Bacillus licheniformis on a semisynthetic medium (glucose or maltose as C source), the specific rate of alpha-amylase production is proportional to growth rate but is repressed by higher substrate concentrations . Besides glucose or maltose, peptone was also used as an alternative carbon source during cultivation . The specific rate of production of the enzyme on maltose is half that found with glucose. Mikrobiologiia, 1984 Jan-Feb, 53(1), 103 - 7 {Structural study of the basal bodies of the flagella of Bacillus brevis var . G.-B . P+}; Novikova NA et al.; The structural organisation of the flagellum basal body was studied in Bacillus brevis var . G.-B . P+ by electron microscopy . It was compared with that of Escherichia coli MS 1350 . The basal body of a B . brevis flagellum contains, in addition to two pairs of rings on a rod, another ring-like structure (d = 13.6 nm, h = 4.3 nm) which we referred to as a "collar" . The collar makes the basal body of B . brevis different from that of B . subtilis, another Gram-positive bacterium . The collar seems to fasten the flagellum of B . brevis to the cell wall . We have concluded that the basal body can differ not merely among bacterial systematic groups, but also among bacteria belonging to one and the same genus . The role of individual elements in the structure of the basal body of bacterial flagella is discussed. Prikl Biokhim Mikrobiol, 1984 Jan-Feb, 20(1), 64 - 8 {Purification of Bacillus mesentericus proteolytic enzymes by affinity chromatography}; Koltukova NV et al.; By means of affinity chromatography on Ovomucoid-Sepharose two proteinases hydrolyzing casein and elastin were isolated from the supernatant of the Bacillus mesentericus culture medium . The activity yield of proteinases was 100% . The characteristics of the purified enzymes were studied . It is demonstrated that B . mesentericus possesses several proteinases. Int Arch Allergy Appl Immunol, 1984, 73(2), 108 - 13 Species-restriction of rat lymphoid cell migration inhibitory factor; Whitacre CC et al.; Migration inhibitory factor (MIF) was produced by lymphoid cells of Lewis rats in response to infection with Bacille Calmette Guerin (BCG), mixed lymphocyte reaction or concanavalin A stimulation . It was found that rat lymphokine-containing supernatants demonstrate a definite species specificity, in that MIF activity is observed only when rat indicator cells and not when guinea-pig indicator cells are used . A comparative study of MIF activities, using rat peritoneal exudate cells, revealed that all three methods stimulated MIF production by either spleen or lymph node cells . Only infection with BCG induced peripheral blood leukocytes to elaborate MIF . In all cases, rat MIF inhibited rat peritoneal exudate cells but not guinea-pig peritoneal exudate cells . Possible explanations for the species specificity of rat MIF including a role for receptor carbohydrate moieties and fibronectin are discussed. Infect Immun, 1984 Jan, 43(1), 79 - 83 Evaluation of Mycobacterium leprae immunogenicity via adoptive transfer studies; Graham L Jr et al.; The immune response of mice to live, heat-killed, or autoclaved Mycobacterium leprae was investigated . After sensitization with 10(7) organisms in each group, recipient mice were transfused with the sensitized splenocytes 28 days later . A selected number of these mice were infected with 5 X 10(3) M . leprae, and the remaining animals were sacrificed at scheduled intervals for evidence of cell-mediated immunity to the M . leprae cell extract . Data from these and the bacteriological assays showed that all three materials induce cell-mediated immunity and also extend protection against the M . leprae challenge but not against a Listeria monocytogenes challenge . Adoptive immunity against M . leprae was expressed equally effectively in both non-irradiated animals and those sublethally (500 R) irradiated . This study reveals that, after adoptive transfer of immunity, a bacillary restriction occurs with concomitant onset of delayed hypersensitivity and that the protection observed could be specifically directed against an M . leprae challenge. Infect Immun, 1984 Jan, 43(1), 245 - 52 Chemical synthesis and serology of disaccharides and trisaccharides of phenolic glycolipid antigens from the leprosy bacillus and preparation of a disaccharide protein conjugate for serodiagnosis of leprosy; Fujiwara T et al.; We examined the structural requirements within the species-specific 3,6-di-O-methyl-beta-D-glucopyranosyl-(1 leads to 4)-2,3-di-O-methyl- alpha-L-rhamnopyranosyl-(1 leads to 2)-3-O-methyl-alpha-L-rhamnopyranose unit of the phenolic glycolipid I antigen of Mycobacterium leprae for binding to anti-glycolipid immunoglobulin M from human leprosy sera . We used chemically defined, partially deglycosylated fragments of phenolic glycolipid I, two other minor M . leprae-specific phenolic glycolipids (those containing 6-O-methyl-beta-D-glucopyranosyl-(1 leads to 4)-2,3-di-O-methyl-alpha- L-rhamnopyranosyl-(1 leads to 2)-3-O-methyl-alpha-L-rhamnopyranose and 3,6-di-O-methyl-beta-D-glucopyranosyl-(1 leads to 4)-3-O-methyl-alpha- L-rhamnopyranosyl-(1 leads to 2)-3-O-methyl-alpha-rhamnopyranose units), and phenolic glycolipids from other mycobacteria . Additionally, the trisaccharide of phenolic glycolipid I, the 3,6-di-O-methyl-beta-D-glucopyranosyl-(1 leads to 4)-2, 3-di-O-methyl-alpha-L-rhamnopyranose, the 6-O-methyl-beta-D-glucopyranosyl-(1 leads to 4)-2,3-di-O-methyl-alpha- L-rhamnopyranose, and the beta-D-glucopyranosyl-(1 leads to 4)-2,3-di-O-methyl-alpha- L-rhamnopyranose disaccharides were synthesized and characterized, and their activities were examined . Only the phenolic glycolipids containing 3,6-di-O-methyl-beta-D-glucopyranosyl at the nonreducing terminus were efficient in binding the anti-glycolipid immunoglobulin M, and the 3,6-di-O-methyl-beta-D-glucopyranosyl-containing di- and trisaccharides were the most effective in inhibiting this binding . Thus, the 3,6-di-O-methyl-beta-D-glucopyranosyl substituent was recognized as the primary antigen determinant in phenolic glycolipid I . With this information, bovine serum albumin containing reductively aminated 3,6-di-O-methyl-beta-D-glucopyranosyl-(1 leads to 4)-2,3-di-O-methyl- L-rhamnose was prepared and shown to be highly active in the serodiagnosis of leprosy. Cancer Res, 1984 Jan, 44(1), 383 - 5 Immunotherapy for chronic myelogenous leukemia: survival not affected by treatment in the stable phase; Baker MA et al.; Thirty-one consecutive patients with chronic myelogenous leukemia were treated in the chronic phase with immunotherapy in addition to chemotherapy . Immunotherapy consisted of Bacillus Calmette-Guerin and allogeneic myeloblasts given by vaccination, and chemotherapy comprised busulfan p.o . in most patients . No randomly allocated control group was designated, but patient characteristics appear to be typical of those of other published groups . Twenty-eight of 31 patients were followed from diagnosis to death, and the three remaining patients were followed for over 5 years . The median survival of the patients in our group was 37 months . There was a constant rate of decline in survival with time, with a mean annual death rate of 30% per year . Twenty-five of the 31 patients terminated in blast crisis . One of 21 patients achieved complete remission in blast crisis of myeloid or indeterminate type, and three of four patients achieved complete remission for blast crisis of lymphoid type . The median survival, the rate of decline in survival, and the remission rate in blast crisis do not appear to differ from those of comparable groups of patients treated with chemotherapy alone. Rev Argent Microbiol, 1984, 16(3), 119 - 44 {Numerical taxonomy of the genus Bacillus}; Cinto RO et al.; Eighty-one morphologic and biochemical features of seventy Bacillus strains were studied . Techniques of Numerical Taxonomy were used for this purpose . One method of coding and four others of clustering methods were used . Clustering methods were: weighted an unweighted pair-groups methods using arithmetic averages (WPGMA and UPGMA, respectively) and those of simple and complete linkage . With this methodology four dendrograms were obtained . The highest cophenetic correlation coefficient (0,718) was obtained from UPGMA . With UPGMA a classification in eleven groups and fourteen subgroups was obtained . Group was defined as the cluster of strains linked with similarity coefficients greater than 0.700 and subgroup as the cluster of strains linked with similarity coefficients greater than 0.800 . It is important to take into account that in WPGMA dendrogram a very similar distribution was observed . As in classical taxonomy, the characteristic morphologic and physiological variabilities of the genus Bacillus were observed. Acta Vitaminol Enzymol, 1984, 6(3), 165 - 74 Purification and some properties of a thermostable alpha-amylase from Bacillus apiarius CBML 152; Ghosh SB et al.; A thermostable alpha-amylase was purified from Bacillus apiarius CBML 152 by ethanol precipitation, starchamylase complex formation and by ion-exchange chromatography using DEAE-cellulose at pH 8.6, eluted with 0.2 to 0.3 M NaCl in the starting buffer (0.5 M tris-HCl, pH 8.6) . The purified enzyme was homogeneous in polyacrylamide gel electrophoresis . The molecular weight of the enzyme was found to be about 65,000 dalton by gel electrophoresis in the presence of SDS . Characteristically the enzyme was an acidic protein, highly pH stable and thermostable, retaining 100% activity after being exposed to 60 degrees C for 1 hr and to pH 6.0-9.0 for 48 hr . Some divalent cations, as Ca2+, Fe2+, Mn2+ and Zn2+, stimulated the enzyme activity at different molar concentrations. Acta Radiol Oncol, 1984, 23(1), 75 - 8 Combination of misonidazole and lipoic acid on the radiation sensitivity of Bacillus megaterium spores; Gazso GL et al.; The radiation sensitizing action of a combination of misonidazole and lipoic acid was investigated in Bacillus megaterium spores at various oxygen concentrations . Lipoic acid and misonidazole were applied in two concentrations (0.1 and 1.0 mmol/l) and four combinations were prepared from them . No uniform correlation was found, neither to the combination of the compounds nor to the gas conditions . The combination of two radiation sensitizing compounds with in all probability different action mechanisms does not unequivocally enhance the radiation sensitizing effect under anoxic and hypoxic conditions. Microbios, 1984, 39(157-158), 137 - 50 Physiological responses of Bacillus species to concanavalin A . 2 . Effect on growth, oxygen uptake, enzyme activities and intracellular cyclic guanosine 3',5'-monophosphate level of B . cereus ATCC 14579; Lau TM et al.; The effect of the mitogen concanavalin A (Con A) on growth and several physiological aspects of Bacillus cereus ATCC 14579 was investigated . Con A at concentrations ranging from 50 to 750 micrograms/ml stimulated growth (the growth rate increased from 0.52/h to 0.97/h, and final yield increased by 2.3-fold over the control) of the bacterial cells . Con A-treated cells also increased their oxygen uptake (1.6-fold increase when treated with 750 micrograms/ml of Con A) . The activities of the membrane-bound dehydrogenase and phosphatase increased by 1.75-fold and 2.1-fold, respectively, when treated with 500 micrograms/ml of Con A . However, only a one-fold increase in alpha-glucosidase activity was observed when cells were treated with the same concentration of Con A . Con A at concentrations of 500 to 1,000 micrograms/ml stimulated the cellular synthesis of cyclic guanosine 3',5'-monophosphate (cGMP) by one-fold . It is proposed that binding of Con A to the cell envelope led to increased synthesis of cGMP which might serve as an intracellular messenger for expression of the mitogenic signal of Con A . Since the use of 50 mg/ml of alpha-methyl-D-mannopyranoside (alpha-MM), a Con A inhibitor, could reverse the stimulatory effect of Con A, it was obvious that the stimulatory action was initiated by the specific binding of Con A molecules to the cell envelope . Furthermore, the stimulatory effect was found to be Con A dosage dependent. Bull Soc Pathol Exot Filiales, 1984 Jan-Feb, 77(1), 28 - 31 {An Aeromonas hydrophila choleriform syndrome . Apropos of a case from the Ivory Coast}; Dosso M et al.; An observation of a case of choleriform syndrome of the Aeromonas hydrophila subspecies anaerogenes biotype II is reported . In a country dealing with a severe comma bacillus under endemo -sporadic from, the case report here could be wrongly diagnosed as cholera. J Gen Microbiol, 1984 Jan, 130 ( Pt 1), 203 - 8 Plasmid transformation of Bacillus sphaericus 1593; McDonald KO et al.; Plasmids pUB110 and pBC16 were introduced by protoplast transformation into the entomocidal bacterium Bacillus sphaericus 1593 . Transformants expressed the antibiotic resistance determinants present on the plasmid and exhibited sporulation frequencies and larvicidal toxicities which were equivalent to those characteristic of the parent strain . These transformations constitute the first report of genetic transfer in B . sphaericus. In Vitro, 1984 Jan, 20(1), 66 - 70 Specificity of cultured insect tissue cells for bioassay of entomocidal protein from Bacillus thuringiensis; Johnson DE et al.; Cultured tissue cells from lepidopteran and dipteran sources displayed an order-specific response to entomocidal protein from crystals of Bacillus thuringiensis . Protein isolated from crystals of B . thuringiensis subsp . kurstaki was effective against cells of the spruce budworm (Choristoneura fumiferana) and the tobacco hornworm (Manduca sexta), but was inactive against both mosquito cell lines tested (Aedes aegypti and Anopheles gambiae) . Conversely, protein from inclusion bodies of B . thuringiensis subsp . israelensis was fully active only against the mosquito cell lines but displayed reduced (four- to seven-fold) toxicity for the lepidopteran cell lines . One exception to this pattern of specificity was observed with a Plodia interpunctella cell line, which failed to respond to either crystal protein preparation . The moth toxin was stable at 4 degrees C for months, whereas the mosquito toxin was susceptible to proteolytic degradation and was unstable for periods longer than 2 wk. Proc Natl Acad Sci U S A, 1984 Jan, 81(1), 80 - 4 Template requirements for initiation of phage phi 29 DNA replication in vitro; Garcia JA et al.; The template requirements for the formation of the phi 29 protein p3-dAMP initiation complex in vitro have been studied . The initiation reaction requires the parental protein p3 but not an intact DNA molecule . Protein p3-containing fragments from the left- or right-hand DNA ends were active as template for formation of the initiation complex provided they had a minimal size: a 26-base-pair-long fragment was active whereas a 10-base-pair-long one was essentially inactive . However, the activity of the latter was restored by ligation of an unspecific DNA sequence . phi 29 DNA internal fragments, as well as denatured phi 29 DNA, were inactive as template for the initiation reaction . The terminal protein-DNA complex isolated from Bacillus phage phi 15 was active in formation of the phi 29 p3-dAMP complex, whereas the protein-DNA complex isolated from Bacillus phage GA-1 or from the pneumococcal phage Cp-1, both with a morphology similar to that of phage phi 29, as well as that obtained from adenovirus, were inactive. Cancer Res, 1984 Jan, 44(1), 20 - 4 Negative and positive immunobiological responses in mice pretreated with Bacillus Calmette-Guérin cell wall; Mizushima Y et al.; Spleen cells from C57BL/6 mice injected i.p . with Bacillus Calmette-Guerin cell walls (BCGcw) showed strongly depressed response to the T-cell mitogen phytohemagglutinin-P in vitro . Mitogen reactivity of normal spleen cells could be suppressed by the addition of spleen cells from BCGcw-treated mice . The suppressor cells mediating this effect appeared to belong to the plastic-adherent, radioresistant, and non-T-cell populations, maybe macrophages . Spleen cells from mice which had been passively transferred i.p . with the adherent cells from BCGcw-treated mice also showed the depressed mitogen response in vitro . Depressed T-cell reactivity of spleen cells obtained from animals immunized with BCGcw on a per-cell basis was also demonstrated in vivo: graft versus host reactivity of spleen cells obtained from animals immunized with BCGcw was depressed as compared to normal spleen cells . At times when strong suppressor cell activity could be detected in BCGcw-treated mice, activity of alloimmune cytotoxic lymphocytes generated in vivo by immunizing with X-irradiated allogeneic MH-134 tumor cells was weaker in BCGcw-pretreated mice than in untreated control groups (detected by means of 51Cr release assay) . Furthermore, accelerated development of s.c . inoculated syngeneic B-16 melanoma cells was observed in BCGcw-pretreated mice . On the other hand, stronger resistance to i.v . inoculated B-16 tumor cells was observed in BCGcw-pretreated mice . BCGcw-treated mice responded normally to i.p . immunization with 2 X 10(8) sheep erythrocytes . Negative and positive immunobiological responses were observed in C57BL/6 mice pretreated with BCGcw. Acta Microbiol Pol, 1984, 33(2), 147 - 56 Generic composition and physiological and cultural properties of heterotrophic bacteria isolated from soil, rhizosphere and mycorrhizosphere of pine (Pinus silvestris L.); Dahm H; Among the bacteria studied Arthrobacter globiformis was predominating in the root zone, while in the non-rhizosphere soil most numerous were Bacillus circulans and A . globiformis . Ammonifiers were more numerous among the root zone bacteria than among the root free soil organisms . The reverse was noted with bacteria capable of hydrolysing starch, cellulose, pectin and chitin. EMBO J, 1984 Jan, 3(1), 101 - 5 Projected structure of unstained, frozen-hydrated T-layer of Bacillus brevis; Lepault J et al.; This paper presents the projected structure of the T-layer of Bacillus brevis, obtained from electron microscopic studies of the unstained protein layer in the frozen-hydrated state . Computer image processing is used to correct for the effects of the contrast transfer function, and to increase the signal-to-noise ratio by lattice averaging . The results obtained show a good agreement with those previously obtained using negatively stained specimens . It is shown that the contrast of T-layer embedded in ice can be approximated to pure phase contrast. Int Arch Allergy Appl Immunol, 1984, 73(2), 104 - 7 Immune responses to a hapten-carrier conjugate in splenectomized and BCG-treated guinea pigs; Neveu PJ; The effects of splenectomy on antibody synthesis and delayed hypersensitivity (DH) reactions were studied in Bacillus Calmette-Guerin (BCG)-treated guinea pigs injected intravenously with an hapten-carrier complex . Splenectomy was performed either before BCG treatment or between BCG treatment and immunization . Splenectomy had no effect on anti-hapten anaphylactic antibody synthesis whatever time it was performed . On the contrary, splenectomy abolished DH reactions to the carrier when performed after the BCG treatment, but not before . These results suggested that splenectomy leads to the depletion of macrophages activated by BCG which are efficient in antigenic presentation to the T lymphocytes involved in cell-mediated immunity. Mol Gen Genet, 1984, 195(1-2), 23 - 8 Biocide gene(s) and biocidal activity in different strains of Bacillus sphaericus . Expression of the gene(s) in E . coli maxicells; Louis J et al.; The recently cloned biocidal determinant of the highly toxic strain of B . sphaericus 1593M (Ganesan et al . 1983) was used as probe to investigate homologous sequences in different toxic and non-toxic strains of B . sphaericus . It was found that the potent strains we have analysed are characterised by the presence of DNA sequences (6.6, 6.4, 5.8, 1.6, 1.3 and 0.6 Kb) not found in the non-toxic strains . These results further show that one of the two weakly toxic strains analysed presents a hybridisation pattern completely different from that observed with the highly potent strains of B . sphaericus . When the DNA of the two non-toxic strains was analysed, SSII-I failed to hybridise to the probe and Rem4 exhibited mainly one hybridisable sequence of 2.3 Kb not detectable in the toxic strains . No region of homology to the probe was found in the DNA of two strains of B . thuringiensis (var . berliner and var . israeliensis) analysed . By dot blot hybridisation experiments it was estimated that the larvicidal determinant might be present in about one to three copies per genome . With the use of E . coli maxicells we have shown further that the toxin gene(s) encoded four polypeptides with molecular weights of 21, 19, 15 and 12 Kd . The significance of these findings is discussed. Acta Microbiol Pol, 1984, 33(3-4), 257 - 62 Studies on the antibiosis of Streptomyces roseofulvus 210 against Bacillus mycoides infection of sugar beet; Stankiewicz M et al.; Streptomyces roseofulvus 210 isolated from the rhizosphere of sugar beet demonstrated antibiotic properties against Bacillus mycoides . Antibiotic produced was of macrolide character, it was able to inhibit the growth of Bacillus mycoides in the soil and to reduce the infection of sugar beet seedlings in micropot and pot experiments. Mol Gen Genet, 1984, 197(1), 8 - 18 Location of protein S4 on the small ribosomal subunit of E . coli and B . stearothermophilus with protein- and hapten-specific antibodies; Stoffler-Meilicke M et al.; In spite of considerable effort there is still serious disagreement in the literature about the question of whether epitopes of ribosomal protein S4 are accessible for antibody binding on the intact small ribosomal subunit . We have attempted to resolve this issue using three independent approaches: (i) a re-investigation of the exposure and the location of epitopes of ribosomal protein S4 on the surface of the 30S subunit and 30S core particles of the E . coli ribosome, including rigorous controls of antibody specificity, (ii) a similar investigation of protein S4 from Bacillus stearothermophilus and (iii) the labelling of residue Cys-31 of E . coli S4 with a fluorescein derivative the accessibility of which towards a fluorescein-specific antibody was demonstrated directly by fluorimetry . In each of the three cases the antigen (E . coli S4, B . stearothermophilus S4 or fluorescein) was found to reside on the small lobe. Thromb Haemost, 1983 Dec 30, 50(4), 804 - 9 Effect of cyclic AMP and cyclic GMP on thromboplastin (factor III) synthesis in human monocytes in vitro; Lyberg T; Human monocytes in vitro respond to various agents (immune complexes, lectins, endotoxin, the divalent ionophore A 23187, 12-O-tetradecanoyl-phorbol 13-acetate {TPA}, purified protein derivative {PPD} of Bacille Calmette-Guerin) with an increased synthesis of the protein component of thromboplastin . The effect of cyclic AMP and cyclic GMP on this response has been studied . Dibutyryl-cyclic AMP, prostaglandin E1 and the phosphodiesterase inhibitors 3-butyl-1-methyl-xanthine (MIX) and rac-4-(3-butoxy-4-methoxybenzyl)-2-imidazolidinone (Ro 20-1724), separately and in combination have a pronounced inhibitory effect on the response to immune complexes and PPD, and a moderate effect on the response to endotoxin and lectins . The effect on TPA response and on the response to A 23187 was slight . Dibutyryl-cyclic GMP (1 mM) gave a slight inhibition of the TPA and IC response, but had essentially no effect on the response to other inducers . The intracellular cAMP level increased when monocytes were incubated with IC, TPA or A 23187 followed by a decrease to basal levels within 1-2 hr, whereas lectin (PHA) and PPD did not induce such changes . The cAMP response to endotoxin varied . Stimulation with IC induced an increase in monocyte cGMP levels, whereas the other stimulants did not cause such changes. Biochim Biophys Acta, 1983 Dec 28, 749(3), 238 - 43 Synthesis and application of a fluorescent imido ester for specific labelling of amino groups in proteins; Bozler H et al.; 2-(5'-Dimethylaminonaphthalene-1'-sulfonamido)methylimidic acid methyl ester has been synthesized for fluorescence labelling of amino groups in proteins . The incorporation of the dansyl group serving as an extrinsic fluorescent probe is determined spectrophotometrically . Glucose dehydrogenase (beta-D-glucose: NAD(P+) 1-oxidoreductase, EC 1.1.1.47) from Bacillus megaterium having a reactive lysine residue which belongs to the active site has been labelled . To give proof of the selectivity of the modification, the enzyme preparation having 1.3 dansyl groups per subunit has been digested with trypsin and the major labelled peptide has been isolated and sequenced. J Mol Biol, 1983 Dec 25, 171(4), 571 - 6 Structural homology in the amino-terminal domains of two aminoacyl-tRNA synthetases; Blow DM et al.; The three-dimensional structures of two animoacyl-tRNA synthetases, the methionyl-tRNA synthetase from Escherichia coli (MetRS) and the tyrosyl-tRNA synthetase from Bacillus stearothermophilus (TyrRS), show a remarkable similarity over a span of about 140 amino acids . The region of homologous folding corresponds to a five-stranded parallel beta-sheet, including a mononucleotide-binding fold . One cysteine and two histidine residues that were found to be invariant in the amino acid sequences occupy similar places in the nucleotide-binding fold . In TyrRS, these residues are close to the adenylate binding site, and in MetRS to the Mg2+-ATP binding site. Lancet, 1983 Dec 17, 2(8364), 1383 - 8 Variant strain of Propionibacterium acnes: a clue to the aetiology of Kawasaki disease; Kato H et al.; By means of anaerobic culture for 3-4 weeks a variant strain of Propionibacterium acnes was isolated from one lymph-node biopsy specimen, and from blood samples of five of twenty-three patients with early Kawasaki disease, but from only one of fifteen blood samples from patients after 8 days' illness . No anaerobe was isolated from sixty age-matched controls with various disorders, but the same bacillus with the same serotype was isolated from house-dust mites from six patients' homes . Patients had significantly higher serum agglutination titres to these strains than controls . The antigen moiety of P acnes was found in the patients' circulating immune complexes . Inoculation of animals caused various inflammatory lesions, particularly in the reticuloendothelial system, and coronary arteritis, myocarditis, and endocarditis in one of them, suggesting that the bacillus is pathogenic . The culture filtrate of this strain showed toxicity in tissue culture . This variant strain of P acnes may have a causative role in Kawasaki disease and house-dust mites a role as vectors. Biochim Biophys Acta, 1983 Dec 12, 749(2), 211 - 3 The use of mannan-Sepharose 4B affinity chromatography for the purification of endo-beta-N-acetylglucosaminidase from Bacillus alvei; Morinaga T et al.; In order to facilitate the isolation of endo-beta-N-acetylglucosaminidase for the structural analysis of glycoconjugates, we have isolated a strain of Bacillus alvei which produces a high level of endo-beta-N-acetylglucosaminidase . We have also devised a simple procedure for the purification of endo-beta-N-acetylglucosaminidase from B . alvei using mannan-Sepharose affinity chromatography . By using this method, endo-beta-N-acetylglucosaminidase was purified 3300-fold with 85% yield from the crude enzyme obtained by ammonium sulfate precipitation of the culture medium . The molecular weight of this enzyme was estimated to be about 66 000 by gel filtration . When using (Man)6(GlcNAc)2-Asn-Dns as substrate, the optimal activity occurs at pH 6.5 with Km of 1.9 mM . The action of endo-beta-N-acetylglucosaminidase toward several glycopeptides was also studied. Biochim Biophys Acta, 1983 Dec 12, 749(2), 192 - 7 Thermal denaturation of native and cross-linked Bacillus cereus 569/H beta-lactamase I; Arnold LD et al.; Thermal denaturation of native and internally cross-linked Bacillus cereus 569/H beta-lactamase I (beta-lactamhydrolase, EC 3.5.2.6) was investigated using differential scanning calorimetry . Application of temperature-scanning kinetics provided an estimate of various activation parameters for the denaturation process . Evidence is presented to indicate that subtle temperature-induced conformational changes preceding gross denaturation are sufficient to cause inactivation of the enzyme. Can J Microbiol, 1983 Dec, 29(12), 1634 - 41 Fatty acid composition and primer specificity of de novo fatty acid synthetase in Bacillus globispores, Bacillus insolitus, and Bacillus psychrophilus; Kaneda T et al.; The fatty acid compositions of three psychrophilic species of Bacillus were determined by gas--liquid chromatography . The proportions of straight-chain fatty acids, branched-chain fatty acids, and unsaturated fatty acids were found to be 13.3, 86.7, and 26.1% of the total cellular fatty acids for Bacillus globispores, 36.6, 63.4, and 25.1% for Bacillus insolitus, and 6.9, 93.1, and 18.4% for Bacillus psychrophilus, respectively . In all three organisms the de novo fatty acid synthetase specificity towards acyl-CoA primers was butyryl-CoA greater than propionyl-CoA much greater than acetyl-CoA . This shows that B . insolitus, which has an unusually large proportion of straight-chain fatty acids for Bacillus, does not possess a different de novo fatty acid synthetase than the other two organisms . Therefore, the greater proportion of straight-chain fatty acids in B . insolitus may be explained by a large supply of straight-chain primer. Eur J Clin Microbiol, 1983 Dec, 2(6), 554 - 8 Treatment of gram-negative bacillary septicemia with cefoperazone; Lagast H et al.; Cefoperazone, a new broad-spectrum cephalosporin, was administered by continuous infusion or intermittent injection to 20 and 25 patients respectively with gram-negative bacillary septicemia most of whom had severe underlying disease . No difference was observed in the clinical response of the two groups . The overall rate of favourable response was 76% . Of the 40 non-neutropenic patients treated three died of infection despite sensitivity of the organism, three improved temporarily and three died as the result of superinfection . Three of the five neutropenic patients treated failed to respond to cefoperazone therapy, despite adequate serum bactericidal activity . Tolerance to cefoperazone was satisfactory . Emergence of cefoperazone-resistant strains leading to relapse or superinfection was not a major cause of failure. Eur J Biochem, 1983 Dec 1, 137(1-2), 67 - 73 NAD+ analogue binding to glyceraldehyde-3-phosphate dehydrogenase; Wallen L et al.; A series of NAD+ analogues, modified on the pyridinium ring, have been tested for their enzymic properties in reactions with D-glyceraldehyde-3-phosphate dehydrogenase form sturgeon muscle, rabbit muscle and Bacillus stearothermophilus . The observed activity, inhibition and binding data are correlated to the structure of the enzyme and coenzyme analogue by model building on a Vector General interactive graphic display system using coordinates from the B . stearothermophilus holoenzyme structure . Most of the analogues with substituents in the pyridinium-3 position could be bound to glyceraldehyde-3-phosphate dehydrogenase, either in manner similar to NAD+ or in a completely different way with the substituted pyridinium ring rotated 110 degrees or more around the glycosidic bond . This indicates different possible modes of binding of NAD+ analogues within the pyridinium binding subsite . Analogues with substituents in the pyridinium-4 position are shown to be weakly bound to glyceraldehyde-3-phosphate dehydrogenase . This is explained by a strong interaction of the substituent in the 4 position with the residues Asn-313 and Cys-149. Antonie Van Leeuwenhoek, 1983 Dec, 49(6), 551 - 8 Activity of penicillin-acylase-producing bacteria against alpha-aminobenzylpenicillins; Baker WL; A method has been developed for the chemical analysis of individual alpha-aminobenzylpenicillin derivatives . This analytical procedure may conveniently be used to determine whether microorganisms possess penicillin acylases which show considerable activity against alpha-aminobenzylpenicillin derivatives . The method is not sufficiently sensitive to determine low levels of enzyme activity . Organisms known to produce penicillin acylases which are active against benzyl- or phenoxymethylpenicillin showed variable responses to alpha-aminobenzylpenicillin substrates . A significant difference in activity profile was noted between the intracellular enzyme of Escherichia coli and the extracellular enzyme of Bacillus megaterium. Acta Odontol Scand, 1983 Dec, 41(6), 321 - 6 Steam sterilization of air turbine dental handpieces; Edwardsson S et al.; The efficacy of autoclaving high-speed dental handpieces was tested in two types of downward displacement steam sterilizers (instrument autoclaves), commonly used in the dentist's office . Eight series of experiments were performed with various sterilization schedules . Lubrication oils with or without antimicrobial agent were used in four of the series . Each handpiece was inoculated with 1 ml of a suspension containing equal amounts of saliva and spores of Bacillus stearothermophilus (approx . 10(6) spores/ml) . Neither sterilization at 120-124 degrees C for 20 min nor at 134-136 degrees C for 10 min resulted in complete inactivation of the spores in series in which the instruments were tested without oil or with oil containing no antimicrobial agent . However, when the handpieces were lubricated with oil containing isopropanol and formaldehyde and the schedule 134-136 degrees C/10 min was used, no growth was observed . The results indicate that instrument autoclaves with built-in programs of 120-124 degrees C/20 min and 134-136 degrees C/10 min could have insufficient capacity to sterilize lubricated or unlubricated dental handpieces . The use of oils containing an antimicrobial agent can overcome this problem. Arch Intern Med, 1983 Dec, 143(12), 2265 - 8 Pathogenicity of Eikenella corrodens in humans; Suwanagool S et al.; Eikenella corrodens is resident flora of the normal adult human oral cavity . Four cases of verified infection and previous case reports of infections caused by this organism were reviewed and analyzed . Rarely has this bacillus been found as the sole isolate to initiate infection in the host with normal immune status . In the immunocompromised host, this organism was observed as the sole isolate in cases of persistent empyemas and/or overwhelming pneumonias with bacteremias . The potential of the organism singly to perpetuate an established infection appears real . In the immunocompromised patients such potentials are accentuated and can result in fulminant pulmonary infections and death . The finding of E corrodens in an infection site of a compromised patient should indicate specific therapy. J Bacteriol, 1983 Dec, 156(3), 1130 - 4 Genetic transformation of Bacillus brevis 47, a protein-secreting bacterium, by plasmid DNA; Takahashi W et al.; A method has been developed for introducing plasmid DNA into Bacillus brevis 47, a protein-secreting bacterium . Treatment of B . brevis 47 cells with 50 mM Tris-hydrochloride buffer of alkaline pH was effective for inducing DNA uptake competence . In the presence of polyethylene glycol, the Tris-treated cells incorporated plasmid DNA with a frequency of 10(-4) (transformants per viable cell) when 1 microgram of plasmid DNA was added to 10(9) Tris-treated cells . The pH of Tris-hydrochloride buffer as well as the concentration and molecular weight of the polyethylene glycol affected the transformation frequency . The growth phase of B . brevis 47 cells strongly influenced the frequency . Two plasmids, pHW1 and pUB110, have been introduced into B . brevis 47 by this method . The mechanism of induction of competence for DNA uptake in connection with removal of the outer two protein layers of the cell wall by treatment of B . brevis 47 cells with Tris-hydrochloride buffer is discussed. Cancer Res, 1983 Dec, 43(12 Pt 1), 5778 - 82 Mammary tumor growth inhibition in C3H/He mice by long-term Bacillus Calmette-Guérin immunoprophylaxis versus enhancement by primary Bacillus Calmette-Guérin therapy; Vaage J; The effects of long-term prophylactic use of and the effects of treatments with Bacillus Calmette-Guerin (BCG) and methanol extraction residue of BCG have been compared in C3H/He mice implanted with the immunogenic syngeneic mammary carcinoma MC2 . The effect of long-term BCG treatment on the development of spontaneous mammary tumors was also investigated . Enhanced resistance to primary tumor development and MC2 growth was only seen in groups of mice that had received long-term pretreatments with BCG or methanol extraction residue of BCG . A negative effect of BCG treatment on host resistance was seen in animals that were given their first injection of BCG and received their first MC2 implant at the same time . Previous immunization against BCG or against MC2 prevented detectable impairment of host resistance by BCG treatment . These observations suggest that the initial phase of BCG infection may have a negative effect on the development of an immune response against cancer . Prolonged, multidose prophylactic administration of BCG may be required to achieve enhanced protection. Biochem Biophys Res Commun, 1983 Nov 15, 116(3), 851 - 8 Partial characterization of a barbiturate-induced cytochrome P-450-dependent fatty acid monooxygenase from Bacillus megaterium; Narhi LO et al.; A soluble cytochrome P-450-dependent fatty acid monooxygenase activity obtained from Bacillus megaterium ATCC 14581 can be induced by at least 13 different barbiturates . In general, the potency of these compounds as inducers increases with their increasing lipophilicity . We have now shown that at least 4 of these barbiturates (phenobarbital, secobarbital, pentobarbital and methohexital) seem to induce the same active cytochrome P-450-containing enzyme by a non-substrate type mechanism . The partially purified enzymes obtained from cultures induced with each of the 4 barbiturates tested were all of similar molecular size (Mr = 130,000 +/- 10,000) and had similar turnover numbers (1400-1800 +/- 300) with either palmitoleate or myristate as substrates . None of the tested barbiturates served as substrates, activators or inhibitors of any of the monooxygenase preparations, nor did they appear to interact in any way with the monooxygenase enzyme or the P-450 component. Eur J Biochem, 1983 Nov 15, 136(3), 545 - 51 The interaction of nocardicin A with the penicillin-binding proteins of Bacillus megaterium KM; Todd JA et al.; The inhibition of elongation of Bacillus megaterium KM growing in the presence of low concentrations of nocardicin A resulted in the production of osmotically stable, actively dividing coccal-shaped cells . Saturation of penicillin-binding proteins 3a and 3b with nocardicin A in vivo at these concentrations was correlated with the inhibition of cell elongation . Analysis of the DD-carboxypeptidase activity of isolated vegetative membranes of B . megaterium KM in vitro indicated that penicillin-binding protein 4 is not a DD-carboxypeptidase under the assay conditions used . Penicillin-binding proteins were analysed by two-dimensional gel electrophoresis and the suitability of lysozyme treatment of cells as a method of membrane preparation was investigated with regard to the detection of proteins with highly labile penicillin-binding activities in vitro. Biochim Biophys Acta, 1983 Nov 14, 748(3), 389 - 97 Inactivation of Bacillus cereus 569/H beta-lactamase I by 6-beta-(trifluoromethane sulfonyl)amidopenicillanic acid sulfone and its N-methyl derivative; Clarke AJ et al.; 6-beta-(Trifluoromethane sulfonyl)amidopenicillanic acid sulfone and its N-methyl derivative were found to be potent inhibitors of Bacillus cereus 569/H beta-lactamase I . The rate of the inactivation of the enzyme by both compounds was found to increase with the decreasing pH of the reaction medium . The reaction of the enzyme with 6-beta-(trifluoromethane sulfonyl)amidopenicillanic acid sulfone was found to be irreversible at the pH values investigated . In contrast, the reaction with the N-methyl derivative at neutral pH was consistent with the partitioning of the acyl enzyme intermediate in three pathways which included (a) deacylation to yield active enzyme, (b) conversion to a transiently inhibited species, and (c) conversion to an irreversibly inactive form . The amino acid composition of the chromophoric peptide obtained from the enzyme inactivated by either of the compounds was consistent with the occurrence of an initial acylation of serine-70 of the protein. J Biol Chem, 1983 Nov 10, 258(21), 13328 - 30 Proteins of the Bacillus stearothermophilus ribosome . Crystallization of proteins L30 and S5; Appelt K et al.; Proteins L30 and S5 from the 50 S and 30 S subunits, respectively, of the Bacillus stearothermophilus ribosome have been crystallized . L30 crystals are tetragonal and the space group is P4(1)2(1)2 (or P4(3)2(1)2) with cell dimensions a = b = 46.3 A and c = 61.4 A . S5 crystals are trigonal with the space group P3(1)21 (or P3(2)21) and cell dimensions a = b = 59.3 A and c = 109.8 A . In both cases, there appears to be a single molecule in the asymmetric unit. Biochim Biophys Acta, 1983 Nov 8, 760(3), 421 - 3 Alpha 2-macroglobulin 'fast' forms inhibit superoxide production by activated macrophages; Hoffman M et al.; Mouse peritoneal macrophages activated by bacillus Calmette-Guerin (BCG) were incubated with human alpha 2-macroglobulin converted to its 'fast' form with either trypsin or methylamine before being stimulated with phorbol myrystate acetate . Both alpha 2-macroglobulin-trypsin and alpha 2-macroglobulin-methylamine inhibited macrophage production of superoxide anion (O2-) while native alpha 2-macroglobulin had little effect except at high concentration . The alpha 2-macroglobulin 'fast' forms, which bind with a Kd of about 8 nM, inhibited 50% generation of O2- (ID50) at a concentration of 7 nM while alpha 2-macroglobulin inhibited O2- production with an ID50 of 141 nM . The 'fast' forms of alpha 2-macroglobulin may play a role in the feedback regulation of inflammatory reactions. J Mol Biol, 1983 Nov 5, 170(3), 597 - 610 Structure of the Bacillus sphaericus R modification methylase gene; Posfai G et al.; A 2.5 X 10(3) base-pair segment of Bacillus sphaericus R DNA cloned in Escherichia coli has previously been shown to carry the functional BspRI modification methylase gene . The approximate location of the gene on this DNA segment and its direction of transcription were established by subcloning experiments . The nucleotide sequence of the relevant region was determined by the Maxam-Gilbert procedure . An open reading frame that can code for a 424 amino acid protein was found . The calculated molecular weight (48,264) of this protein is in fair agreement with previous estimates (50,000 to 52,000) . The synthesis of this protein was demonstrated in E . coli minicells . The initiation point of transcription by E . coli RNA polymerase was localized by in vitro transcription experiments . The open reading frame starts 29 base-pairs downstream from the transcription initiation site and it is preceded by a sequence showing extensive Shine-Dalgarno complementarity . Subcloning experiments and translation in minicells suggest that after removal of this translational initiation site, a secondary start site 29 amino acids downstream can also start translation in E . coli, and this shorter protein retains the methylase activity . The overall base composition of the gene and the codon usage indicate a strong preference for A.T base-pairs. Can Med Assoc J, 1983 Nov 1, 129(9), 965 - 8 Preventive health care of Indian preschoolers in the Sioux Lookout Zone, northwestern Ontario; Plaxton K et al.; The provision of preventive health care to native children in the Sioux Lookout Zone of northwestern Ontario was assessed by reviewing the medical charts of 568 randomly selected preschoolers in 1980 . Data were collected on the method of infant feeding; immunization status, vaccination and testing for tuberculosis; development, vision and hearing screening; monitoring of growth; and nutritional status and vitamin supplementation . Most of the children had been breast-fed and had received primary diphtheria-pertussis-tetanus-polio immunization as well as measles-mumps-rubella and bacille Calmette-Guerin vaccination . However, less than 30% had undergone developmental screening, and only 10% and 8% respectively had had their vision and hearing screened . Growth monitoring was adequate in the first year of life but not thereafter . Only about 55% of the children had ever had a hemoglobin level determined . More emphasis on health promotion is needed if native children are to receive adequate preventive health care. Pediatr Infect Dis, 1983 Nov-Dec, 2(6), 446 - 51 Management of tuberculin reactors in children and adolescents previously vaccinated with BCG; Nemir RL et al.; Between 1960 and 1981, 142 Bacillus Calmette-Guerin (BCG)-vaccinated children and adolescents were evaluated in the Children's Chest Clinic, Bellevue Hospital . These patients came from 28 countries and had positive tuberculin reactions and/or exposure to active tuberculosis . Antituberculous therapy was given to 8 with active tuberculosis, to 8 with calcified pulmonary primary lesions and to 105 positive tuberculin reactors without disease . In a 1 1/2- to 16-year follow-up no tuberculous disease occurred, and two patients with previously negative roentgenograms developed calcified pulmonary lesions . Guidelines are given for the management of patients previously vaccinated with BCG with special reference to the value of prophylactic isoniazid therapy for those considered infected by Mycobacterium tuberculosis but without evidence of disease. J Reticuloendothel Soc, 1983 Nov, 34(5), 341 - 57 Leprosy in wild armadillos (Dasypus novemcinctus) on the Texas Gulf Coast: anatomic pathology; Folse DS et al.; Recent studies of the "naturally occurring leprosy-like disease of wild armadillos" establish that the causative bacillus is genetically identical to M . leprae from human sources, and thus the disease is a zoonosis, sylvatic leprosy . A recent survey of 451 wild armadillos from the Texas Gulf Coast demonstrated sylvatic leprosy in 4.66% . This companion study reports the anatomic pathologic changes seen in the 17 leprous and 17 nonleprous armadillos necropsied in that survey . Findings support previous studies on the histopathology and pathogenesis of sylvatic leprosy, but a broader spectrum of histologic changes are noted. South Med J, 1983 Nov, 76(11), 1433 - 5 Tenosynovitis of the forearm due to Mycobacterium terrae (radish bacillus); Mehta JB et al.; A patient had tenosynovitis of the forearm due to Mycobacterium terrae complex . The condition responded well to the combination of surgery and antituberculous chemotherapy. J Bacteriol, 1983 Nov, 156(2), 909 - 13 Postincision steps of photoproduct removal in a mutant of Bacillus cereus 569 that produces UV-sensitive spores; Weinberger S et al.; An excision-defective mutant of Bacillus cereus 569 is normal in incision and repair synthesis, but rejoining of incision breaks is defective, resulting in accumulation of low-molecular-weight DNA after UV irradiation . The defect in removal of photoproducts by exonuclease after incision renders both vegetative cells and dormant spores of the mutant sensitive to UV . A similarity is indicated to the uvrD mutation described recently in Escherichia coli. Biochem Int, 1983 Nov, 7(5), 577 - 83 A new alkaline elastase of an alkalophilic bacillus; Tsai YC et al.; A new alkaline elastase was purified from the culture broth of an alkalophilic Bacillus sp . Ya-B . This was a serine proteinase . Molecular weight was 25,000 . The optimum pH for elastin and casein was 11.75 . The enzyme had very high specific activity, 12,400 units/mg protein for casein, and 2,440 units/mg protein for elastin at the optimum pH . It showed marked preference for elastin . The relative activity of elastin/casein of this enzyme was 17 and 6 times higher than those of subtilisin BPN' and subtilisin Carlsberg, respectively . This enzyme also had higher keratin and collagen hydrolyzing activity in comparison with subtilisin. Ann Microbiol (Paris), 1983 Nov-Dec, 134B(3), 443 - 6 {Isolation of a large aerobic sporulated sheathed bacteria from soil by elective culture}; Pichinoty F; Eleven endospore-forming strains of a probably unknown species of Bacillus were isolated from samples of pasteurized soil by aerobic enrichment culture at 32 degrees C in a minimal medium containing benzoate, p-hydroxybenzoate or cyclohexane carboxylate, as source of carbon and energy . They grew in the form of unbranched, flexible filaments 1.8 micrograms in diameter and sometimes more than 1,000 micrograms in length . The organism was not coenocytic because transverse partitions were visible . The endospores were oval (1.8 x 2.2 micrograms) and did not deform the filaments . A thin, translucid sheath was present . The 11 strains were prototrophic, used benzoate and acetate as sources of carbon and energy but did not grow in common peptone media . Only the isolation technique has been described here. Ann Microbiol (Paris), 1983 Nov-Dec, 134B(3), 367 - 77 Taxonomy of mycobacterial strains isolated from the tissues of leprosy patients; David HL et al.; Thirty-six slowly growing mycobacteria isolated from the tissues of leprosy patients were studied using 40 characteristics as well as susceptibility to 27 distinct mycobacteriophages . The composition in mycolic acids of selected strains was also studied . According to the data, the strains formed 5 clusters . Some of the clusters were possibly as yet undescribed species; however, comparison of the data with the known properties of Mycobacterium leprae leads to the conclusion that none of the strains were identical to the leprosy bacillus. Bull Soc Pathol Exot Filiales, 1983 Nov, 76(5), 652 - 6 {Diagnosis of the Whitmore bacillus in the laboratory}; Galimand M et al.; After realization of a new synthetic medium for Whitmore bacillus enrichment and isolation, the authors describe a new specific and immunologic process for Pseudomonas pseudomallei isolation from very polluted samples. Prikl Biokhim Mikrobiol, 1983 Nov-Dec, 19(6), 733 - 7 {Effect of temperature on exoprotease and bacitracin synthesis and sporulation in Bacillus licheniformis 28KA}; Egorov NS et al.; By means of physiological experiments the effect of temperatures ranging from 30 degrees C to 55 degrees C on the synthesis of exoprotease and bacitracin, as well as on sporification in Bacillus licheniformis 28KA was studied . The synthesis of exoprotease and sporification were found to be less stable to the temperature variation than the vegetative growth of the microorganism . The temperature, favourable for the maximum yield of then enzyme and spores, is 10 degrees below the temperature which is optimal for the growth of the organism (50 degrees C) . The synthesis of bacitracin is substantially sensitive to the temperature variation . The maximum synthesis of the antibiotic was observed at 50 degrees C . High concentrations of glucose inhibit the synthesis of the enzyme and bacitracin, as well as sporification in Bacillus licheniformis 28KA. Gene, 1983 Nov, 25(1), 1 - 7 Molecular cloning of the glyceraldehyde-3-phosphate dehydrogenase genes of Bacillus stearothermophilus and Escherichia coli, and their expression in Escherichia coli; Branlant G et al.; Recombinant plasmids derived from pBR322, which carry gap genes coding for the D-glyceraldehyde-3-phosphate dehydrogenases (GAPDH) of Bacillus stearothermophilus and Escherichia coli, have been isolated . The selection was carried out by complementation of an E . coli gapam mutant . Two plasmids containing B . stearothermophilus and E . coli DNA inserts of 4.3 kb and 1.4 kb, respectively, were characterized . Transformation of the E . coli mutant with either of the recombinant plasmids lead to a very high expression of the GAPDH activity . GAPDH produced by the strain containing the B . stearothermophilus gap gene was characterized by immunological cross-reactivity with antiserum raised against pure B . stearothermophilus GAPDH. Br J Rheumatol, 1983 Nov, 22(4 Suppl 2), 151 - 5 Clinical aspects of Reiter's disease; Catterall RD; The clinical manifestations and results of investigations in a series of 221 patients diagnosed as suffering from Reiter's disease are described in detail . Attention is drawn to the very varied natural history of the disease, the relapse rate of 60% and the development of serious complications and disability in young people . The failure to establish the cause of the condition or to unravel its relationship to nonspecific urethritis and bacillary dysentery contrasts with the reported presence of the human leucocyte antigen HLA-B27 in 76% of patients . There is no curative treatment but symptomatic treatment will relieve pain and stiffness and may shorten the duration of individual attacks . Prolonged follow-up of established cases, monitoring of activity of the disease by regular measurements of the erythrocyte sedimentation test and prompt treatment of relapses may prevent the development of serious locomotor disability. Arch Biochem Biophys, 1983 Nov, 227(1), 233 - 41 Two types of entomocidal toxins in the parasporal crystals of Bacillus thuringiensis kurstaki; Yamamoto T et al.; Two types of entomocidal proteins of Bacillus thuringiensis kurstaki were isolated from the parasporal bodies (crystals), and their structures were compared with each other in relation to the toxic activity . When the crystals were dissociated in 2% 2-mercaptoethanol at pH 10, a protein of Mr = 135,000, called delta-endotoxin, was liberated . The crystals of a strain of B . thuringiensis kurstaki, the HD-1 strain, also released another protein in small quantities . This minor component of HD-1, which had been discovered and named mosquito factor by Yamamoto and McLaughlin (T . Yamamoto and R . E . McLaughlin (1981) Biochem . Biophys . Res . Commun . 103, 414-421) because of its toxicity to mosquito larvae, could be liberated selectively from the crystals by alkali treatment without any thiol reagent at pH 11 . Electron microscopic observation suggested that the bipyramidal crystal is composed of a homogeneous component, presumably the delta-endotoxin, and the mosquito factor is not within the crystal matrix . The liberated toxins, including the mosquito factor, were purified by Sephacryl S-300 column chromatography and activated by proteinases obtained from gut juice of the cabbage looper (Trichoplusia ni) . The activated toxins were characterized by peptide mapping using techniques of HPLC and sodium dodecyl sulfate-polyacrylamide gel electrophoresis . Peptide mapping revealed that the mosquito factor is a protein distinctly different from the delta-endotoxin . Furthermore, a comparison between two strains of B . thuringiensis kurstaki indicated that minor differences in the structure of the delta-endotoxins, in particular the differences in their proteinase-resistant region, caused significant variations in their toxicity to susceptible insects. Transplantation, 1983 Nov, 36(5), 509 - 13 Mycobacterial infections in marrow transplant patients; Navari RM et al.; Bone marrow transplant recipients undergo ablation of host immune defenses with total-body irradiation or high dose chemotherapy, or both . Over a 5.6-year period, mycobacterial infections were observed in 7 of 682 patients with leukemia who received marrow grafts . Four patients had pulmonary and three extrapulmonary infection . Granulomas were observed in the lungs of three patients, in the liver of one patient, and in the skin of one patient . Cultures revealed Mycobacterium tuberculosis in two patients, Mycobacterium fortuitum in two patients, and Mycobacterium kansasii in one patient . In the six patients treated with antimycobacterial therapy in either the pretransplant or posttransplant period, complete resolution of the infection was achieved . Pretransplant chest radiograph abnormalities suggesting mycobacterial infections should be aggressively evaluated in these immunocompromised hosts . Prophylaxis should be considered in marrow graft recipients with a well-established history of inadequately treated tuberculosis, previous Bacille Calmette-Guerin immunotherapy, known family contacts, recent skin test conversion, or past skin test positivity. J Exp Med, 1983 Nov 1, 158(5), 1522 - 36 The mononuclear phagocyte system of the mouse defined by immunohistochemical localization of antigen F4/80 . Relationship between macrophages, Langerhans cells, reticular cells, and dendritic cells in lymphoid and hematopoietic organs; Hume DA et al.; The macrophage-specific antigen F4/80 has been localized in mouse lymphoid and hematopoietic tissue and skin using immunoperoxidase staining . The antigen permits identification of early mononuclear phagocyte precursors in the bone marrow, and is present also on larger cells forming the center of hematopoietic islands and lining vascular sinuses . In thymus F4/80+ cells are numerous in both cortex and medulla and are particularly concentrated around the corticomedullary region . In spleen, lymph node, and gut-associated lymphoid areas the major F4/80+ populations are in the red pulp, the medulla and subcapsular sinus, and the adjacent lamina propria, respectively . F4/80+ cells are rarely seen in T-dependent areas of lymph nodes, spleen, or Peyer's patch, but are present in large numbers in these areas during bacillus Calmette-Guerin (BCG)-induced inflammation . Macrophage infiltration occurs also in lymph nodes from athymic nu/nu mice and is therefore T cell independent . The interdigitating cell of T-dependent areas is F4/80-, but the Langerhans cell of the epidermis of the skin, which bears some ultrastructural resemblance to the interdigitating cell, is F4/80+ . We conclude that the two cell types are probably not related. J Bacteriol, 1983 Nov, 156(2), 949 - 51 Excretion of the penicillinase of an alkalophilic Bacillus sp . through the Escherichia coli outer membrane; Kudo T et al.; Two plasmids containing the penicillinase gene of alkalophilic Bacillus sp . strain 170, pEAP1 and pEAP2, were constructed . Most of the penicillinase produced by Escherichia coli, which carried these plasmids, was found in the culture medium . This excretion is caused by the cloned DNA fragment which contains some component that changes the outer membrane of E . coli. Mol Biol (Mosk), 1983 Nov-Dec, 17(6), 1227 - 35 {Interaction of bacterial flagella with myosin}; Novikova NA et al.; The interaction of isolated flagellar filaments of Bacillus brevis var . G.-B . P+ with skeletal muscle myosin has been investigated . Bacterial flagellar filaments co-precipitate with myosin at low ionic strength (at the conditions of myosin aggregation) . Addition of bacterial flagellar filaments to myosin led to inhibition of its K+-EDTA- and Ca2+-ATPase activity, but had no influence on Mg2+-ATPase . Monomeric protein of bacterial flagella filaments (flagellin) did not co-precipitate with myosin and had no influence on its ATPase activity . The flagella filaments did not co-precipitate with myosin in the presence of F-actin if it was mixed with myosin before the filaments . If the flagella filaments were added to myosin solution before the addition of F-actin the amount of filaments and actin in myosin precipitate were comparable . In this case the presence of flagella filaments decreased activation of myosin Mg2+-ATPase by actin to 25-30% . Thus the bacterial flagellar filaments are able to interact with myosin and modify its ATPase activity . Probably, these properties of filaments are caused by resemblance of flagellin and actin . For instance, the unique origin of these proteins may be the reason of such resemblance. Can J Microbiol, 1983 Nov, 29(11), 1576 - 82 Studies on the mode of action of a bacteriocin produced by Bacillus stearothermophilus; Fikes JD et al.; Thermocin 10 was purified by elution from a carboxymethyl cellulose column . The eluted thermocin was homogeneous and yielded single bands with identical relative mobility when stained for protein or glycoprotein . Thermocin 10 inhibited RNA synthesis 3 min after its addition . Cell motility, oxygen uptake, ATP synthesis, and DNA synthesis were inhibited 10 min after the addition of thermocin 10 . Total cell protein was reduced to one quarter of its normal content in cells treated with thermocin. J Immunol, 1983 Nov, 131(5), 2545 - 50 Nonspecific cytotoxicity of vaccinia-induced peritoneal exudates in hamsters is mediated by Thy-1.2 homologue-positive cells distinct from NK cells and macrophages; Yang H et al.; Vaccinia virus-induced peritoneal exudate cells (PEC) in the hamster were characterized with regard to cell type(s), target specificity, and expression of the T cell antigen, Thy 1.2 homologue . Hamsters were immunized intraperitoneally with vaccinia virus and cytotoxicity was measured against 51Cr-labeled targets in a 16-hr assay . PEC collected 4 days after immunization were cytotoxic for both baby hamster kidney cells (BHK) and herpes virus-infected BHK (BHKHSV) . Both the nonadherent (lymphocyte) and adherent macrophage (MP) fractions of PEC were cytotoxic . Treatment of cells with a monoclonal anti-murine Thy 1.2 antibody (alpha-Thy 1.2) known to detect a Thy 1.2 homologue on hamster T cells, removed all of the cytotoxicity in both PEC fractions, whereas, cytotoxic spleen cells from the same animals were resistant to antibody treatment . Similarly, the cytotoxic cells in PEC induced by bacillus Calmette-Guerin were exclusively of the Thy 1.2 homologue-positive phenotype . Target specificities of Thy 1.2+ PEC and Thy 1.2- spleen cells were similar as evidenced by comparable activity against hamster BHK and BHKHSV targets and murine SV3T3 and YAC-1 targets . Previous studies have attributed the cytotoxicity of the adherent PEC to MP . However, as determined by immunofluorescence and morphological studies, treatments that enriched for MP decreased cytotoxic activity, whereas, procedures that enriched for lymphocytes enhanced cytotoxic activity suggesting that all cytotoxicity in PEC is mediated by a non-specific Thy 1.2 homologue positive lymphocyte (Thy 1.2+ CL) . Thus our data support the conclusion that intraperitoneal inoculation of hamsters with vaccinia induces two distinctly compartmentalized phenotypes with similar cytotoxic characteristics--the Thy 1.2+ CL and the Thy 1.2 homologue-negative natural killer cell (NK) or NK-like cell in the peritoneum and in the spleen, respectively. Gastroenterology, 1983 Nov, 85(5), 1187 - 91 Disseminated Mycobacterium avium-intracellulare infection in acquired immunodeficiency syndrome mimicking Whipple's disease; Gillin JS et al.; We report a patient with acquired immunodeficiency syndrome whose clinical presentation and histologic features resembled Whipple's disease . The unique feature of this case was the absence of Whipple's bacillus and the presence of Mycobacterium avium-intracellulare within macrophages infiltrating the small intestinal lamina propria. Bioorg Khim, 1983 Nov, 9(11), 1578 - 80 {BbvII--a new site-specific endonuclease from Bacillus brevis 80}; Bunina ZF et al.; BbvII, a new site-specific endonuclease, has been isolated from Bacillus brevis 80 by gel-filtration and chromatography on heparin-Sepharose . The endonuclease recognizes a non-symmetrical sequence 5'-GTCTTC-3' in double-stranded DNA and cleaves DNA 3'-CAGAAG-5' in both strands outside the recognition sequence. FEBS Lett, 1983 Oct 31, 163(1), 73 - 5 Proteins of the Bacillus stearothermophilus ribosome . A 5 A structure analysis of protein S5; White SW et al.; The structure of protein S5 from the small subunit of the Bacillus stearothermophilus ribosome is described to a resolution of 5 A . The molecular boundary is visible and shows the protein to be essentially compact although slightly elongated in one dimension. FEBS Lett, 1983 Oct 31, 163(1), 69 - 72 A compact three-dimensional crystal form of the large ribosomal subunit from Bacillus stearothermophilus; Yonath A et al.; A new form of well-ordered three-dimensional crystals of intact 50 S ribosomal subunits from Bacillus stearothermophilus have been obtained . Electron micrographs of positively stained sections of these crystals revealed that the ribosomal particles are packed closely . The cell parameters have been determined . Representative electron micrographs and their computed contoured filtered images are shown. J Biol Chem, 1983 Oct 25, 258(20), 12661 - 9 The characteristics of liver glucose-6-phosphatase in the envelope of isolated nuclei and microsomes are identical; Arion WJ et al.; We have compared the characteristics of glucose-6-phosphatase (EC 3.1.3.9) in the envelope of purified nuclei and microsomes from rat liver . The latency of mannose-6-P hydrolysis, permeability to EDTA, and susceptibility of the enzyme to protease-mediated inactivation all indicated that the permeability barrier defined by the envelope in situ is significantly disrupted in isolated nuclei (i.e . in vitro) . Latency of mannose-6-P hydrolysis was demonstrated to provide a quantitative measure of the degree of nuclear membrane disruption . Electron micrographs confirmed the existence of substantial regions of the envelope in vitro where the permeability barrier to EDTA was intact (i.e . an "intact component") . The kinetics of glucose-6-phosphatase catalyzed by the intact component was obtained by subtracting the contribution of enzyme in disrupted regions from the total enzymic activity of untreated nuclei . The characteristics of glucose-6-phosphatase in intact and fully disrupted membranes of nuclei were indistinguishable from microsomes with respect to (a) the kinetics of glucose-6-P hydrolysis, (b) the effects of incubations with mannose-6-P, N-ethylmaleimide, and protease from Bacillus amyloliquefaciens, (c) the extremely high latency of carbamyl phosphate:glucose phosphotransferase activity, and (d) both the patterns of response of activity and the change in latency of glucose-6-phosphatase induced by fasting, experimental diabetes, and cortisol injection . Our results show clearly that apparent differences in the glucose-6-phosphatase activity of untreated preparations of nuclei and microsomes are simply expressions of significant differences in the degree of intactness of their respective permeability barriers . Since flattened cisternae, characteristic of the rough endoplasmic reticulum in situ, are preserved in intact regions of the envelope of isolated nuclei, the present findings constitute the most direct and definitive evidence to date that the properties of glucose-6-phosphatase in the endoplasmic reticulum in situ are faithfully reproduced with intact microsomes. Biochim Biophys Acta, 1983 Oct 25, 763(3), 245 - 50 The production of oxygen-centered radicals by bacillus-Calmette-Guerin-activated macrophages . An electron paramagnetic resonance study of the response to phorbol myristate acetate; Hume DA et al.; The spin trapping with 5,5-dimethyl-1-pyrroline-N-oxide of free radicals formed from Bacillus-Calmette-Guerin elicited peritoneal macrophages stimulated with phorbol myristate acetate resulted in the formation of a superoxide and hydroxyl spin adducts . The formation of both spin adducts was inhibited by copper/zinc superoxide dismutase . Only 70% of the hydroxyl spin adduct could be inhibited by catalase or the scavenger dimethyl sulfoxide . This suggests that the production of hydroxyl radicals involves prior formation of both superoxide radicals and hydrogen peroxide, implicating a Fenton catalysed Haber-Weiss reaction . The metal scavenger desferrioxamine also reduced the hydroxyl radical signal by 70% . The unaccounted 30% hydroxyl radical-like signals are probably due to carbon-centered free radicals formed by the lipoxygenase reaction . Spin trapping in the presence of the lipid-soluble spin trap, 5-octadecyl-5,3,3-trimethyl-1-pyrroline-N-oxide, resulted in a spectrum consistent with the presence of an oxaziridine nitroxide . This results from the free radical-induced cyclisation of a nitrone with an unsaturated fatty acid. Eur J Biochem, 1983 Oct 17, 136(1), 183 - 94 Evidence for an essential histidine residue in glucose dehydrogenase from Bacillus megaterium and sequence analysis of the peptides labeled with bromoacetyl pyridine; Ulmer W et al.; Bromoacetylpyridine acts as an active-site-directed inhibitor on glucose dehydrogenase from Bacillus megaterium . The inactivation is irreversible with a Ki of 7.7 mM . The coenzyme NAD but not the substrate glucose protects the enzyme from the inactivation . It is proposed that bromoacetylpyridine modifies a residue at or nearby the active site . The inactivation is correlated with the modification of a single histidine residue . Modification of the enzyme with 3-(2-bromo{carbonyl-14C}acetyl)-pyridine and partial acid hydrolysis of the protein yielded one labeled fragment . From the arginine restricted tryptic cleavage of this fragment four radioactively labeled peptides were purified . Comparison of the specific radioactivity leads to the conclusion that the active site histidine residue must be located in the 58-residue fragment AH2-TA3 . Sequence analysis showed that only one residue is modified in this fragment and the sequence around the labeled histidine residue is -Met-Ser-Ser-Val-His-Glu-Trp-Lys-Ile-Pro-Trp-Pro- . The minor labeled arginine fragments, comprising 86, 20 and 13 residues, were also sequenced . Only lysine residues are modified in these peptides . The modification of the individual residues does not exceed 10%. Eur J Biochem, 1983 Oct 17, 136(1), 151 - 4 Inhibition of metalloendopeptidases by 2-mercaptoacetyl-dipeptides; Blumberg S et al.; A series of 2-mercaptoacetyl-dipeptides, a potential group of metalloendopeptidase inhibitors, has been synthesized by coupling the N-hydroxysuccinimide ester of S-acetyl-2-mercaptoacetic acid with hydrophobic dipeptide methyl ester hydrochlorides, followed by hydrolysis with NaOH in aqueous methanol and acidification with HCl . Thus, the 2-mercaptoacetyl derivatives of L-phenylalanyl-L-leucine, L-leucyl-L-phenylalanine and L-leucyl-D-phenylalanine were prepared . The first two compounds inhibit effectively thermolysin from Bacillus thermoproteolyticus and a metalloendopeptidase isolated from Streptomyces griseus, with Ki values in the micromolar range or below . The third compound inhibits the two enzymes only poorly, showing the stereospecificity of the inhibition process . These inhibitors should provide a useful tool for the study of bacterial and mammalian metalloendopeptidases (or dipeptidyl carboxypeptidases) and for the assessment of their physiological role. Exp Cell Res, 1983 Oct 15, 148(2), 530 - 5 W10BSmL, a mutant of Euglena gracilis var . bacillaris lacking plastids; Osafune T et al.; Organized proplastid structures are absent from dark-grown and light-grown cells of Euglena gracilis Klebs var . bacillaris Cori mutant W10BSmL, based on electron micrographs of serial sections of entire cells . Fluorescence due to normal plastid DNA is undetectable in these cells after treatment with the DNA fluorochrome 4'6-diamidino-2-phenylindole (DAPI) . Serial sections through a newly described compartmentalized osmiophilic structure in Euglena cells are presented. J Urol, 1983 Oct, 130(4), 792 - 4 Metastatic basal cell carcinoma of the scrotum; Staley TE et al.; We report a rare case of basal cell carcinoma of the scrotum presenting with distant metastases . Rationale and treatment with bacillus Calmette-Guerin immunotherapy and subsequent combination chemotherapy are detailed. J Neurosurg, 1983 Oct, 59(4), 634 - 41 Gram-negative bacillary meningitis in neurosurgical patients; Mombelli G et al.; The authors report 34 cases of Gram-negative bacillary meningitis related to traumatic cranial lesions or neurosurgery observed between 1973 and 1980 at two neurosurgical units (Institut J . Bordet, Brussels, and Inselspital, Bern) . As a typical nosocomial infection, meningitis developed after prolonged hospitalization in most patients, and was mainly due to highly resistant organisms, such as P . aeruginosa and Klebsiella sp . At least 65% of the patients were colonized with the pathogen responsible for the meningitis before the onset of the infection . Ventriculitis, including four cases of ventricular empyema, complicated meningitis in all the 17 patients in whom a ventricular tap was performed . The results of treatment were unsatisfactory . Fifty percent of the patients were cured of their infection, but only 30% survived; 15% of the patients died within 48 hours following diagnosis . The optimum treatment of postsurgical Gram-negative meningitis remains in doubt . The choice of initial antibiotics should take into account the sensitivity patterns of colonizing microorganisms . Chloramphenicol is ineffective against most pathogens commonly involved in this infection . Intrathecal aminoglycosides may fail in the presence of ventriculitis . Intraventricular aminoglycosides are probably justified in critically ill patients . The role of the newer cephalosporins and of co-trimoxazole remains to be defined. Mikrobiyol Bul, 1983 Oct, 17(4), 233 - 42 {The effects of Bacillus thuringiensis on the greater wax moth, Galleria mellonella (L.) (Lepidoptera: Galleriidae)}; Bosgelmez A et al.; The effects of Bacillus thuringiensis preparation on the greater wax moth population have been investigated under laboratory conditions . B . thuringiensis isolated from commercial insecticidal formulations such as DIPELr (Abbott Lab . USA), Tribactur BTB WP (Fabrick von Chemische Production, Holland), Bactospein (Laboratoire Roger, France) . The effective strain was used in this experiment . The applied concentrations of Bacillus on the greater wax moth larvae are 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 gram, respectively . It has been observed that 1.5, 2.0, 2.5, 3.0 gram dosages of bacteria has been effective on larvae population . Our studies indicated that young larvae are much more susceptible to lower concentrations, 0.5, 1.0 gram, of Bacillus. J Pharmacobiodyn, 1983 Oct, 6(10), 737 - 47 Purification and characterization of two types of Cytisus multiflorus hemagglutinin by affinity chromatography; Konami Y et al.; Two hemagglutinins were separated from extracts of Cytisus multiflorus seeds by successive affinity chromatographies on columns of galactose- and di- N-acetylchitobiose-Sepharose 4B . One was found to be inhibited by di- N-acetylchitobiose or tri- N-acetylchitotriose and shown to possess anti-H(O) activity {Cytisus-type anti-H(O) hemagglutinin designated as Cytisus multiflorus hemagglutinin I} . The other, which was not a blood group-specific hemagglutinin, was inhibited by galactose or lactose (hemagglutinin II) . Hemagglutinins I and II were further purified by gel filtration on Sephacryl S-300 . These preparations were homogeneous as judged by polyacrylamide gel electrophoresis and gel filtration . The molecular weights of the purified hemagglutinins I and II were found to be 86000 by sedimentation equilibrium analysis and 80000 by gel filtration . On disc gel electrophoresis in the presence of sodium dodecyl sulfate and dithiothreitol, both hemagglutinins gave a single component of a molecular weight of 42000 +/- 2000, suggesting that these hemagglutinins are dimeric proteins of two identical subunits . Hemagglutinins I and II contain 2.7% and 1.5% carbohydrate, respectively, and only very small amounts of cystine and methionine were detected, but they are rich in aspartic acid and serine . Treatment of human O erythrocytes with a purified H-decomposing enzyme (alpha-L-fucosidase from Bacillus fulminans abolished the agglutinability of the cells with hemagglutinin I . This indicates that the L-fucosyl residue is important even for the H-specificity detected by this di-N-acetylchitobiose-specific hemagglutinin I. Can J Microbiol, 1983 Oct, 29(10), 1277 - 9 {Estimation of the spectrum of the aerial dispersion of Bacillus thuringiensis}; Smirnoff WA et al.; The present paper estimates the number of viable spores of Bacillus thuringiensis per droplet and reveals the importance of this data to improve B . thuringiensis treatments . For a given diameter, droplets from Futura formula contained two times more spores than droplets from the formulas used to date . It is preferable to have B . thuringiensis droplets larger than those of chemical insecticides . A Grumman AgCat aircraft calibrated to give the desired larger droplets resulted in successful B . thuringiensis treatments. Can J Microbiol, 1983 Oct, 29(10), 1235 - 40 {Morphological aspect and chemical composition of Skeletonema costatum (Bacillariophyceae) growing in natural nutritive media with the aid of a culture system of dialysing fibers}; Marsot P et al.; The growth of Skeletonema costatum, under natural nutriment conditions, was studied using a bulk culture fiber dialyzing apparatus . The diatom displayed normal development of chain length (average cell number per chain) which coincided with the culture growth stages; that is, the cell number per colony increased during the active division period and decreased thereafter with the beginning of the prestationary phase . This morphological behaviour showed that the alga cells were not affected by such physical shocks as collision or tension occurring during repeated cell transfers from growth chambers to the dialyzing apparatus or at the time of their passage through the fiber fascicles . Measured at different growth stages, the cell contents in carbon, nitrogen, and chlorophyll confirmed the above results and showed for S . costatum a biological productivity comparable with that obtained in smaller dialyzing containers (dialyzing bags) . Through a comparison between the dialyzing culture and a static culture grown in an enriched medium, certain characteristics were determined. Avian Dis, 1983 Oct-Dec, 27(4), 1086 - 9 The effect of Bacillus natto in feed on the sheep red blood cell antibody response in chickens; Inooka S et al.; Chickens fed 10(6) or 10(7) of Bacillus natto strain BN/g of diet from hatching through 15 or 30 days of age showed an increase in ability to produce hemagglutinating antibody titer as determined by intravenous injection of sheep red blood cells, whereas no increase in antibody production ability was observed in the chickens fed 10(7) of BN/g of diet from hatching through 10 days of age. J Med Chem, 1983 Oct, 26(10), 1370 - 4 1H-2-benzopyran-1-one derivatives, microbial products with pharmacological activity . Relationship between structure and activity in 6-{{1(S)-(3(S),4- dihydro-8-hydroxy-1-oxo-1H-2-benzopyran-3-yl)-3-methylbutyl}-amino}-4(S), 5(S)-dihydroxy-6-oxo-3(S)-ammoniohexanoate; Shimojima Y et al.; In order to investigate the structural requirements for gastroprotective activity in 6-{{1(S)-(3(S),4-dihydro-8- hydroxy-1-oxo-1H-2-benzopyran-3-yl)-3-methylbutyl}amino}-4(S),5(S)-dihydroxy 6-oxo-3(S)-ammoniohexanoate {AI-77-B, 1}, a product of Bacillus pumilus AI-77, nine derivatives were prepared and then tested for protective activity against stress-induced ulcers in rats . Neither the chromophore, {1-(3,4-dihydro-8-hydroxy-1-oxo-1H-2-benzopyran-3-yl)-3-methylbutyl}ammonium chloride (2), nor the side-chain moiety, 4-amino-2,3-dihydroxyhexanedioic acid (4), as separate fragments alone showed any significant activity . Hydrolysis of the lactone ring of the 1H-2-benzopyran-1-one skeleton, to give 6-{{1-(2-carboxy-3-hydroxyphenyl)-2-hydroxy-5-methylhex-3-yl}amino}-4, 5-dihydroxy-6-oxo-3-ammoniohexanoate (5), led to a considerable decrease in activity . The formation of a gamma-lactone ring in the side chain, 4-{1-hydroxy-2-{{1-(3,4-dihydro-8-hydroxy-1-oxo-1H-2-benzopyran-3-yl) -3-methylbutyl}-amino}-2-oxoethyl}butan-4-olid-3-yl}ammonium chloride (6), resulted in a small decrease in activity . Selective acetylation at the primary amine position of 6, to give 4-{1-hydroxy-2- {{1-(3,4-dihydro-8- hydroxy-1-oxo-1H-2-benzopyran-3-yl)-3-methylbutyl}amino}-2-oxoethyl}-3- (acetylamino)butan-4-olide (7), led to a considerable decrease in activity . Both di- and triacetylated derivatives of 6, 4-{1-acetoxy-2 -{{1-(3,4-dihydro-8-hydroxy-1-oxo-1H-2-benzopyran-3-yl)-3-methylbutyl} amino}-2-oxoethyl}-3-(acetylamino)butan-4-olide (8) and 4-{1-acetoxy-2- {{1-(3,4- dihydro-8-acetoxy-1-oxo-1H-2-benzopyran-3-yl)-3-methylbutyl}amino}-2- oxoethyl}-3-(acetylamino)butan-4-olide (9), were inactive . Selective methylation of the phenolic hydroxyl group of to give 1, 6-{{1-(3,4-dihydro-8-methoxy-1-oxo-1H-2-benzopyran-3-yl) -3-methylbutyl}amino}-4,5-dihydroxy-6-oxo-3-ammoniohexanoate (15), resulted in a small decrease in activity . On the other hand, conversion of the carboxyl group of the side chain to an amide, to give {6-{{1-(3,4-dihydro-8-hydroxy-1-oxo-1H-2-benzopyran-3-yl)- 3-methylbutyl}amino}-4,5-dihydroxy-6-oxo-3-hexanamido}ammonium chloride (10), caused a considerable increase in both activity and toxicity . The findings showed that modifications at the position of the amino acid moiety of 1 significantly influenced the activity and that the 1H-2-benzopyran-1-one skeleton was also required for activity to occur. Postgrad Med, 1983 Oct, 74(4), 60 - 7 Acupuncture--cultural perspectives . 1 . The Western view; Steiner RP; While acupuncture has been popularized in the lay press for the past decade, its therapeutic efficacy has often been clouded by issues of Oriental mystique and difficulties in understanding a foreign medical system . Numerous studies have explored the mechanism by which acupuncture works . The effects of acupuncture constitute a generalized systemic reaction with far-reaching consequences . Acupuncture has numerous clinical applications in obstetrics and dentistry, as well as use in the treatment of asthma, musculoskeletal disorders, various addictions, angina pectoris, peptic ulcer disease, functional bowel disorders, and acute bacillary dysentery. J Periodontol, 1983 Oct, 54(10), 575 - 9 Monolithic tetracycline-containing fibers for controlled delivery to periodontal pockets; Goodson JM et al.; For the purpose of developing controlled delivery devices for periodontal therapy which would release over several days, six fiber types made of tetracycline-loaded biocompatible polymers were manufactured and tested . Polyethylene, polypropylene, polycaprolactone, polyurethane and cellulose acetate propionate all released their drug load within 1 day . Ethylene vinyl acetate fibers, however, provided in vitro sustained release for periods up to 9 days . A bioassay was designed to measure levels of tetracycline achieved by local delivery which used growth inhibition of Bacillus cereus as a measure of the amount of tetracycline in measured volumes of gingival sulcus fluid on filter paper strips . By this assay, fibers made from 25% loaded ethylene vinyl acetate established initial concentrations of approximately 500 micrograms/ml . The measurement of tetracycline concentration resulting from the placement of these fibers into deep periodontal pockets as a packing material provided indication that concentrations of greater than 50 micrograms/ml could be maintained for months by weekly to monthly replacement . These studies indicate that monolithic fibers made of tetracycline-loaded ethylene vinyl acetate have characteristics which could prove useful as the basis of a tetracycline delivery system for the treatment of periodontal disease. J Biochem (Tokyo), 1983 Oct, 94(4), 1077 - 84 Major proteins released by a protein-producing bacterium, Bacillus brevis 47, are derived from cell wall protein; Ohmizu H et al.; B . brevis 47 secretes a vast amount of protein consisting mainly of two kinds with approximate molecular weights of 130,000 and 150,000 . The two major extracellular proteins were indistinguishable from those of cell wall protein by SDS-polyacrylamide gel electrophoresis . Based on the results of analysis of amino acid composition, limited proteolysis followed by electrophoresis, and the cross-reactivity of antisera, we conclude that the 130K and 150K extracellular proteins are derived from the respective cell wall proteins . Furthermore, the NH2-terminal amino acid analysis suggests that the two major extracellular proteins are released from the cell wall without any modification of the NH2-terminal portion. Genetika, 1983 Oct, 19(10), 1616 - 23 {Interspecific recombinants of Bacillus thuringiensis x Bacillus cereus}; Belykh RA et al.; The possibility of interspecies recombination was shown by using protoplast fusion method . The Bacillus thuringiensis var . galleriae strain 48S Thi Nic Gua Rifr Strr and 56R Gua Rifr, and also Bac . cereus carrying the plasmid pBC16 responsible for resistance to tetracycline (150 mcg/ml) were used . Recombinants were selected on the medium containing rifampicin and tetracycline . They were shown to combine the properties of both parents . The majority of recombinants were resistant to phages Tg4 and Td15 and represented the mean level of sensitivity to phages Tg12, Tg13 and Td14 . Examination of the plasmid profiles of recombinants revealed that their resistance to tetracycline was due to the plasmid with mobility analogous to pBC16 . It was concluded that the protoplast fusion method can be used to obtain recombinants between relatively remote species of microorganisms. Biochem J, 1983 Oct 1, 215(1), 67 - 74 Competitive inhibition of the inverting beta-xylosidase of Bacillus pumilus 12 by monosaccharide derivatives of different structural and conformational types . A possible natural substrate; Marshall PJ et al.; The title enzyme is competitively inhibited by compounds, for example alpha-D-xylopyranosylpyridinium salts and 1,6-anhydro-D-glucopyranose, for which the normal 4C1 conformation of the xylopyranose ring is precluded . It is competitively inhibited by compounds, for example beta-D-xylopyranosylpyridinium salts and 1,6-anhydro-L-idopyranose, for which the 1C4 conformation is precluded, and which have no accessible conformations in common with the first set of inhibitors . It is also competitively inhibited by alpha-L-arabinofuranosides . Inhibition by 1,6-anhydroglucopyranose, 1,6-anhydro-L-idopyranose and L-arabinono-gamma-lactone is competitive with respect to each other . alpha-D-Xylopyranosyl fluoride is not a detectable substrate, by itself or in the presence of a representative of any of the three types of inhibitor . On the basis of these and literature data, it is proposed that the natural substrate is a hemicellulose fragment containing the D-Xylp beta (1 leads to 4)-{L-Araf alpha (1 leads to 3)}D-Xylp structure . Tentative inferences about the catalytic mechanism can also be drawn. J Clin Pathol, 1983 Oct, 36(10), 1091 - 6 Non-gastrointestinal Bacillus cereus infections: an analysis of exotoxin production by strains isolated over a two-year period; Turnbull PC et al.; Isolates of Bacillus cereus from 118 cases, and two maternity unit outbreaks, of non-gastrointestinal infection were grouped on the basis of their estimated probable involvement in the infections from which they were isolated: (i) high probability--48 strains; (ii) intermediate--16 strains; (iii) low--7 strains; (iv) very low ("irrelevant")--49 strains . Rabbit skin test, haemolysin and phospholipase assays were used to determine exotoxin activities of strains within each group . The results suggest a significant relation between the virulence of an isolate as reflected in the degree to which it appeared responsible for the signs and symptoms of an infection, and its toxigenicity in the skin test . This is attributed to the ability of B cereus strains to synthesise, in varying degrees, a necrotic enterotoxin, possibly in conjunction with the primary haemolysin (cereolysin) . The cases analysed in this study support the contention that B cereus, when isolated from an infection, may not be an inconsequential contaminant and should not be too readily dismissed as such. J Clin Microbiol, 1983 Oct, 18(4), 974 - 5 Pseudobacteremia due to contaminated alcohol swabs; Berger SA; Fifteen isolates of Bacillus species were recovered during a 19-day period after the introduction of an automated radiometric blood culture system . The outbreak was traced to alcohol-resistant spores present in the cotton used to disinfect blood culture bottles . The role of Bacillus species as a pathogen and a laboratory contaminant is discussed. J Bacteriol, 1983 Oct, 156(1), 264 - 72 Isolation and biochemical analysis of Mucor bacilliformis monomorphic mutants; Ruiz-Herrera J et al.; Fourteen stable mutants of Mucor bacilliformis which grew yeastlike under both aerobic and anaerobic conditions were isolated after treatment of growing mycelium with N-methyl-N'-nitro-N-nitrosoguanidine . Biochemical characterization of the mutants included determination of growth in different carbon and nitrogen sources, determination of sensitivity of respiration to cyanide and salicylhydroxamate, analysis of cytochrome spectra, determination of glutamate dehydrogenases, glutamine synthase, and ornithine decarboxylase activities, and measurement of cyclic AMP levels . Data showed that all mutants were defective in some aspect of oxidative metabolism and had low levels of ornithine decarboxylase, whereas other characters were variable . It was concluded that morphological transition in M . bacilliformis is probably associated with mitochondrial functions and expression of ornithine decarboxylase, but may be independent of cyclic AMP and glutamate dehydrogenase levels . The importance of genetic studies in the analysis of dimorphism is stressed. Biochemistry, 1983 Sep 27, 22(20), 4652 - 6 Beta-lactamase III of Bacillus cereus 569: membrane lipoprotein and secreted protein; Nielsen JB et al.; A third beta-lactamase in Bacillus cereus 569 has been identified and characterized . It corresponds to gamma-penicillinase reported by Pollock {Pollock, M . R . (1956) J . Gen . Microbiol . 15, 154-169} but whose existence has been questioned since then . It will be called beta-lactamase III . It resembles the class A beta-lactamases but is immunologically distinct from the major class A secreted beta-lactamase I of B . cereus . As with several other Gram-positive beta-lactamases it occurs in two forms, membrane bound as a glyceride-cysteine lipoprotein and as a hydrophilic secreted protein formed by cleavage on the carboxyl side of the modified cysteine that is the membrane attachment site . It is produced in all B . cereus 569 strains tested but is absent in B . cereus 5/b . Antibody to beta-lactamase III interacts to varying degrees with all the known class A beta-lactamases, most strongly with that of B . licheniformis 749/C. Biochemistry, 1983 Sep 27, 22(20), 4647 - 51 Characterization of the membrane beta-lactamase in Bacillus cereus 569/H/9; Connolly AK et al.; The membrane-bound beta-lactamase from Bacillus cereus, strain 569/H/9, has been purified to apparent homogeneity . Nonionic detergent (0.5% Triton X-100) is required to keep the enzyme (traditionally called gamma-penicillinase and now called beta-lactamase III) in solution . Antibodies to beta-lactamase III have been prepared, and the membrane-bound enzyme is immunochemically distinct from the extracellular enzymes . beta-Lactamase III has a molecular weight of 31 500, in contrast to the extracellular enzymes beta-lactamase I and beta-lactamase II which have molecular weights of 30 000 and 22 000, respectively . The isoelectric point of beta-lactamase III is pH 6.8, whereas beta-lactamase I and beta-lactamase II have isoelectric points about 8.6 and 8.3 . The amino acid composition of beta-lactamase III differs from those of beta-lactamase I and beta-lactamase II; however, the difference index between the compositions of beta-lactamase I and beta-lactamase III (52%) suggests relatedness . beta-Lactamase III is inactivated by 6 beta-bromopenicillanic acid and by the sulfone of 6 alpha-chloropenicillanic acid, and cephalosporins are poorer substrates than penicillins . beta-Lactamase III may be a membrane-bound class A beta-lactamase. FEBS Lett, 1983 Sep 19, 161(2), 195 - 200 Bacillus cereus 569/H beta-lactamase I: cloning in Escherichia coli and signal sequence determination; Mezes PS et al.; The gene, penPC, for beta-lactamase I of Bacillus cereus 569/H has been cloned and its expression studied in Escherichia coli . The protein product from the in vitro translation of penPC was shown by gel electrophoresis to have an Mr of 36 000 which is larger than the in vivo products found in B . cereus and E . coli . The DNA sequence of the signal region was determined . It revealed that the smallest known mature form present in B . cereus culture fluids is preceded by 45-48 amino acids in pre-beta-lactamase I, considering that there are 3 initiation codons in the same reading frame, one or more of which might be initiating translation . Unlike the Bacillus licheniformis 749/C beta-lactamase, which has a membrane-bound thioether lipoprotein form, the single Cys residue in the B . cereus beta-lactamase I signal sequence is unmodified and a single processed form of the enzyme is present in E . coli cells carrying penPC. Cancer, 1983 Sep 15, 52(6), 958 - 66 Management of adult acute leukemia . A Southwest Oncology Group study; McCredie KB et al.; Five hundred forty three adult patients with acute leukemia were entered on the study designed to: (1) test efficacy of vincristine and prednisone used as primary drug therapy in patients with good prognosis as judged by a circulating blast cell count less than 30,000 cm2; (2) investigate the use of either simultaneously or sequentially administered Adriamycin plus cytosine arabinoside plus vincristine and prednisone; and (3) to assess the use of bacillus Calmette-Guerin (BCG) in the maintenance phase on both the response and duration of response . Complete remissions were seen in 21% of patients with the vincristine and prednisone arm . Complete remission rates were similar in both the simultaneously and sequentially administered chemotherapy with overall complete remission rates of 55% . Median durations of complete remission and survival were 35 and 62 weeks, respectively, for patients with AML; and 47 and 75, respectively, for patients with ALL . Toxicity was within acceptable limits . BCG administered during the maintenance phase of therapy caused no differences in duration of complete remission and survival . These results demonstrate an improved response and duration of response over previous studies done by this group. Biochem Biophys Res Commun, 1983 Sep 15, 115(2), 618 - 24 Model of the extradiol-cleaving manganese(II) dioxygenase penicillamine-manganese(II) complex; Sakurai H et al.; The structure of the green penicillamine(Pen)-Mn(II) complex prepared under air was determined from its electronic spectra, molar ratio, ESR spectra and oxygen consumptions at various pH values and by potentiometric titration . Pen bound with Mn(II) in a molar ratio of approximately 1:1 forming coordination bonds with a thiolate and an amino group, and the complex consumed about 1 mol of oxygen at pH 9-10 . Oxygen binding to this complex was found to be reversible at room temperature . The oxygen adduct complex catalysed oxidative extradiol-cleavage of catechol at pH 7.0-7.5 . The Pen-Mn(II)-02 complex seems to be a simple model of extradiol-cleaving manganese(II) dioxygenase, which was recently found in Bacillus brevis. Eur J Biochem, 1983 Sep 15, 135(2), 237 - 41 Stereochemistry of the elongation factor Tu X GTP complex; Leupold CM et al.; The geometry of the Me2+ . GTP complex at the active site of EF-Tu from Bacillus stearothermophilus has been investigated using thiophosphate analogs of GTP to inhibit the kirromycin-induced GTPase reaction at 60 mM NH4Cl . There is no reversed selectivity for the diastereomers (Rp and Sp) of guanosine 5'-O-(1-thiotriphosphate) (GTP{alpha S}) on replacing Mg2+ by Cd2+, so that the observed specifity for the Sp isomer must be due to an interaction of the pro-R oxygen of the alpha-phosphate group with the protein . With the diastereomers of GTP{beta S} low specifity for the Rp isomers is seen in the presence of Mg2+ . Moreover, both isomers are very weakly bound . In contrast, substitution of Mg2+ by Cd2+ results in a high specifity for the Sp isomer, and this is then recognized as well as Cd X GTP . These results indicate that in the EF-Tu X Me2+ X GTP complex, the pro-S oxygen of the beta-phosphate group is bound to the metal ion and the pro-R oxygen to the protein . GTP{gamma S} is a good analog of GTP regardless of the nature of the metal ion, suggesting that not all of the oxygens of the gamma-phosphate are involved in interactions to metal ion and protein . The thiophosphate analogs of GTP were also tested for their efficiency in ternary complex formation with EF-Tu and aminoacyl-tRNA and in the physiological GTPase of EF-Tu . The stereochemistry of the GTP binding site on EF-Tu in all three systems is found to be very similar. Biochim Biophys Acta, 1983 Sep 13, 759(3), 278 - 85 Uncoupled release of protein and lipid in a protein-secreting bacterium, Bacillus brevis 47; Tsukagoshi N et al.; Bacillus brevis 47 was found to release approx . 10% of the total cellular lipids into the medium, and the protein secretion process in B . brevis 47 was studied to determine whether any relationship exists with lipid synthesis or alteration in the lipid composition . B . brevis 47 contained the usual phospholipids such as phosphatidylethanolamine, phosphatidylglycerol and cardiolipin as well as diglycerides as major neutral lipids . The extracellular lipid consisted of the same constituents as the cellular lipid but with a significantly altered composition . Divalent cations such as Ca2+, which specifically inhibit protein secretion, had no effect on the lipid release . A nonprotein-secreting mutant released lipid to the same extent as wild-type cells . Based on these results, we conclude that protein secretion occurs independently of lipid release. J Biol Chem, 1983 Sep 10, 258(17), 10577 - 81 Na+-driven flagellar motors of an alkalophilic Bacillus strain YN-1; Hirota N et al.; Flagellar motors of some alkalophilic Bacillus strains have been suggested to be powered by the electrochemical potential gradient of Na+, namely the (formula: see text) (Hirota, N., Kitada, M., and Imae, Y . (1981) FEBS Lett . 132, 278-280) . In the present study, we quantitatively measured the (formula: see text) and motility of one of the strains, YN-1 . Swimming speed of YN-1 cells increased linearly with a logarithmic increase of Na+ concentration in the medium up to 100 mM . The intracellular Na+ concentration and the membrane potential of the cell were about 30 mM and -170 mV, respectively, and stayed constant irrespective of Na+ concentration in the medium . Thus, the swimming speed changed as a function of the chemical potential difference of Na+ across the cell membrane . When the membrane potential of YN-1 cells was decreased by a combination of valinomycin and various concentrations of K+ in the medium, the swimming speed of the cells decreased linearly and reached zero at around -90 mV . Under the condition, the intracellular Na+ concentration stayed constant . Thus, the membrane potential was also a determinant of the swimming speed . Furthermore, the chemical potential of Na+ and the membrane potential were found to be equivalent as the energy source for motility . Therefore, it is concluded that the (formula: see text) is the energy source for the flagellar motors of YN-1 cells . Threshold value of the (formula: see text) for motility was about -100 mV. Postgrad Med, 1983 Sep, 74(3), 73 - 5, 78 Chemotherapy for pulmonary tuberculosis . A short-course regimen and its rationale; Dall L; After years of declining incidence, pulmonary tuberculosis is increasing, owing in part to the influx of Asian refugees . An understanding of the tubercle bacillus and a knowledge of chemotherapy enable the physician to give adequate treatment . Short-course chemotherapy has been found to be 99% effective in clinical trials, leading the American Thoracic Society to recommend use of this mode of treatment. Mikrobiologiia, 1983 Sep-Oct, 52(5), 716 - 8 {Effect of temperature and aeration on Bacillus thuringiensis growth and sporulation}; Ignatenko IuN et al.; The growth of Bacillus thuringiensis was studied as a function of temperature and aeration . The vegetative growth, the yield of viable spores and their thermoresistance did not depend, for all practical purposes, on the rate of aeration within the range of 25 to 60 mg O2 per litre per minute . A rise of temperature from 20 to 35 degrees C doubled the titre of spores and increased their thermoresistance . When the temperature of cultivation was increased to 40 degrees C, the process of spore formation was inhibited. Ann Microbiol (Paris), 1983 Sep-Oct, 134B(2), 353 - 6 {Taxonomy of Bacillus circulans}; Pichinoty F et al.; Four strains of Bacillus circulans sensu stricto (ATCC 4513 (type strain), 4515, 4516, and 4530) were subjected to 236 morphological, biochemical and physiological tests, including 162 carbon source utilization tests . B . circulans s . s . is a species of facultative anaerobes able to ferment carbohydrates . Many carbohydrates and a few aliphatic acids were used as sole carbon and energy sources, but amino acids were not . The guanine-plus-cytosine content of DNA (four strains studied) was 37.2 +/- 0.4 mol% (mean +/- standard deviation). Zentralbl Bakteriol Mikrobiol Hyg {A}, 1983 Sep, 255(2-3), 336 - 9 A comparison of pathogens and contaminants based on the number of positive blood cultures in a set; Flournoy DJ et al.; A total of 2766 positive blood cultures, from the Veterans Administration Medical Center in Oklahoma City (1961-1981) were evaluated to determine the relationship of organism, pathogenicity and number of cultures (blood culture bottles) positive . Most patients had 2-4 blood cultures drawn . Organisms which are usually considered as nonpathogenic (Bacillus, Propionibacterium) were mostly found in only one of the cultures . Whereas those microorganisms which are considered pathogenic were most often found in two or more cultures . Organisms like Staphylococcus epidermidis are the most difficult to classify because they can be either pathogenic or contaminant . If an organisms which is normally considered a nonpathogen is found in two or more cultures, it should be considered as a potential pathogen until proven otherwise. Vestn Khir Im I I Grek, 1983 Sep, 131(9), 36 - 40 {Microbial flora of ulcer and its significance in the surgical treatment of the ulcer of the stomach and duodenum}; Rychagov GP; The examination of 146 patients with the ulcer disease of the stomach (26 cases) and duodenum (120 cases) has established that the ulcer was colonized by different microbes and their associations in 81,5% of cases . The colon bacillus was found almost in half the cases . The application of corresponding antibiotics in the pre- and post-operative treatment gave better immediate results. Gan To Kagaku Ryoho, 1983 Sep, 10(9), 1980 - 6 {Effect of BCG (Bacillus Calmette Guérin) sensitization on the generation of tumor specific killer T cells}; Takeuchi M et al.; Effector cells of augmented resistance against a syngeneic MC-1 tumor in C57BL/6 mice sensitized with BCG were determined by Winn test, and the following results were obtained: Sensitization of mice with BCG (1.0 mg/mouse) augmented resistance against primary and secondary inoculation of MC-1 tumor . Peritoneal exudate cells of tumor-bearing mice showed a growth-inhibitory activity against MC-1 tumor in Winn test . Sensitization with BCG augmented such an activity of PEC . Augmented resistance was ascribed to a plastic dish-nonadherent, nylon wool column-nonadherent and Thy 1.2-positive cells. Blood, 1983 Sep, 62(3), 606 - 15 Comparison of chemotherapy with immunotherapy for maintenance of acute lymphoblastic leukemia in children and adults; Stryckmans PA et al.; Two hundred and seventeen patients, 1-50 yr old, with acute lymphoblastic leukemia in complete remission were randomized to receive a 1-yr consolidation chemotherapy of either type P, comprising 7 different drugs, or type M, consisting of methotrexate interspersed with prednisone and vincristine . Thereafter, they were randomized a second time to receive a 4-yr maintenance of either chemotherapy or immunotherapy, comprised of allogeneic blasts and bacillus Calmette-Guerin (BCG) . Consolidation P caused more toxicity than consolidation M . However, comparison between the consolidation therapies P and M showed no significant difference, neither for disease-free interval nor for duration of survival . Chemotherapy showed more lethal toxicity in adults than in children . Comparison between chemotherapy (C) and immunotherapy (I) as maintenance treatment showed a significant (p = 0.016) superiority of C for disease-free interval (DFI) . The difference was even more pronounced (p = 0.009) in the group with less than 8 g/dl of hemoglobin (Hb) at diagnosis before therapy . On the other hand, for patients with more than 8 g/dl Hb at diagnosis, presumably those with T-ALL, no difference in DFI was seen . No difference has been seen so far between maintenance therapies I and C concerning the duration of survival . The patients who were receiving maintenance I when they relapsed and who were consequently retreated by chemotherapy, survived longer from relapse than those patients retreated for relapse while receiving maintenance C. Southeast Asian J Trop Med Public Health, 1983 Sep, 14(3), 324 - 9 The incidence of Bacillus cereus in foods in Central Thailand; Suksuwan M; Thirty of 53 different raw and cooked or processed foods obtained in Central Thailand were demonstrated to contain Bacillus cereus . The level of contamination was found to depend on the type of food sampled; the mean was 3.2 X 10(6) organisms/gm on raw and cooked or processed foods ready for consumption, and 2.8 X 10(8) organisms/gm on cooked or processed foods kept overnight at kitchen temperature . B . cereus was commonly found on rice (both uncooked and boiled or fried), dried chilli pepper, shrimp paste, and on certain kinds of cooked foods seasoned with these products . Most of the total of 275 B . cereus isolates were found to possess biochemical reactions typical for B . cereus . Variations were also examined among several isolates . Nineteen per cent of the isolates did not produce acid from salicin . Certain types of the food tested were also demonstrated by volunteer experiments to carry enterotoxigenic B . cereus. J Biochem (Tokyo), 1983 Sep, 94(3), 893 - 902 Classification of iron-sulfur cores in ferredoxins by 1H nuclear magnetic resonance spectroscopy; Nagayama K et al.; A 1H nuclear magnetic resonance (NMR) study was carried out on various ferredoxins which possess one of three types of iron-sulfur clusters, (2Fe-2S), (3Fe-3S), or (4Fe-4S) . In the isolated form, (2Fe-2S) ferredoxins from spinach (Spinacea oleracia), pokeweed (Phytolacca americana), a blue-green alga (Spirulina platensis), and a halobacterium (Halobacterium halobium) exhibited two broad resonances common in chemical shift at the region downfield of 10 ppm . In their reduced forms, seven contact-shifted resonances appeared spread over 30 ppm . Although the positions of the contact-shifted resonances in the reduced state differed among the four, a common trend in the temperature dependence of their resonance positions was recognized . Two (4Fe-4S) ferredoxins from Bacillus stearothermophilus and Bacillus thermoproteolyticus exhibited almost indistinguishable spectral patterns in both the oxidized and reduced forms . The ferricyanide-treated ferredoxins of B . stearothermophilus and B . thermoproteolyticus showed characteristic contact-shifted resonances distinct from the spectra of the original (4Fe-4S) ferredoxins . This corresponds to the recent finding of the interconversion of (4Fe-4S) and (3Fe-3S) clusters with ferricyanide in the ferredoxin . Based on our data together with reported NMR data on other ferredoxins, contact-shift resonances of three types of clusters were tabulated . The reliability of NMR classification increases when we compare the NMR spectra of a ferredoxin with the classification standards at the two redox states . Moreover, not only the absolute values of the chemical shifts of contact-shifted resonances but also their temperature dependence give distinctive information applicable to iron core identification. J Immunol, 1983 Sep, 131(3), 1452 - 4 Resistance of various strains of mycobacteria to killing by activated macrophages in vivo; Orme IM et al.; A variety of experimental infections with pathogenic mycobacteria are associated with the development of persistent disease, in which little or no changes in the numbers of the infectious organism can be detected . This report describes a simple experimental model designed to test the hypothesis that this persistence may reflect in part the ability of these organisms to resist the enhanced bacteriostatic and bactericidal properties acquired by host macrophages as a result of these mycobacterial infections . To examine this possibility mice were inoculated with test organisms at a time when these animals were expressing very high levels of nonspecific resistance, and hence macrophage activation, as a result of a prior intravenous infection with Mycobacterium bovis bacillus Calmette-Guerin (BCG) . The results show that the test organisms fall into three groups; (a) those, such as Mycobacterium tuberculosis, which were sensitive to the presence of activated macrophages, (b) those, such as Mycobacterium avium and Mycobacterium kansasii, which were insensitive, and (c) one organism, Mycobacterium intracellulare, in which progressive growth of the infection was significantly improved . These results are consistent with the hypothesis that some mycobacteria, particularly those associated with persistent disease, possess an intrinsic resistance to host bactericidal and bacteriostatic mechanisms in vivo. Mikrobiologiia, 1983 Sep-Oct, 52(5), 693 - 7 {Effect of amino acids and proteins on bacitracin and exoprotease synthesis by Bacillus licheniformis}; Egorov NS et al.; Amino acids and proteins were found to produce different effect on the synthesis of bacitracin and exoprotease by Bacillus licheniformis 28 KA depending on the age of the cells . The enzyme synthesis was induced by amino acids and proteins only in the cells at the exponential growth phase . No correlation could be established between the antibiotic and proteolytic activities . The optimal protease synthesis was found in a medium with isoleucine whereas the antibiotic synthesis was optimal in a medium containing no amino acids. Radiobiologiia, 1983 Sep-Oct, 23(5), 590 - 4 {Effect of MEA on the degradation of thermally-damaged DNA in gamma-irradiated bacterial cells}; Kuznetsova EA et al.; It was shown that the radioprotective action of beta-mercaptoethylamine on gamma-irradiated Bacillus stearothermophilus, with regard to survival and diminution of DNA breaks, depended upon the temperature of incubation and the presence of thermal lesions in DNA . beta-Mercaptoethylamine decreased the number of both alkali-labile sites and true single-strand DNA breaks in cells of Bacillus stearothermophilus . beta-Mercaptoethylamine decreased the number of alkali--labile sites and true single-strand breaks in DNA of Escherichia coli cells heated at 52 degrees C. Int J Clin Pharmacol Ther Toxicol, 1983 Sep, 21(9), 439 - 46 Sfericase, a novel proteolytic enzyme; Yoshida K; Sfericase, a novel protease produced by a strain of Bacillus sphaericus, has endopeptidase activity . Sfericase inhibits various experimental acute inflammations and reduces viscosity of sputum obtained from subacute bronchitic rabbits by oral treatment . A low molecular fraction of serum obtained from animals given oral sfericase also has an anti-inflammatory effect . This result suggests that a secondarily produced substance might play a role in the manifestation of anti-inflammatory action . The toxicity of sfericase is as low as that of other anti-inflammatory enzymes . Sfericase is detected in serum of animals given massive oral dosage, but not at clinical dosage . Clinical studies have been carried out in more than 900 patients . In double-blind studies with serratiopeptidase, sfericase is as useful as the reference drug . Sfericase has been proven effective in some chronic inflammations, such as chronic sinusitis and difficult expectoration associated with bronchopulmonary diseases . Moreover, it has less side effects. J Reticuloendothel Soc, 1983 Sep, 34(3), 195 - 202 Effects of Mycobacterium bovis (strain BCG) on the interstitial cells of hydronephrotic, contralateral, and normal rabbit kidneys; Thomasson DL et al.; Studies were undertaken to determine the effect of viable organisms of Mycobacterium bovis, strain Bacillus Calmette Guerin (BCG), on cell growth characteristics and phagocytic properties of cells from surgically-induced unilaterally hydronephrotic, contralateral, and normal rabbit kidneys . A single intravenous administration of 8 X 10(8) BCG organisms was given at the time of ureteral ligation . Four days after injection, explants were removed from the hydronephrotic, contralateral, and normal kidneys . Two cell types, fibroblasts and mononuclear phagocytes, grew from these explants . BCG caused a marked increase in the rate of growth of cells from the hydronephrotic and contralateral kidneys . There was no measurable effect of BCG on cells from the normal kidney. Can Med Assoc J, 1983 Sep 1, 129(5), 439 - 42 Bacille Calmette-Guérin as maintenance therapy for non-Hodgkin's lymphoma; Thomas JW et al.; Following complete remission of non-Hodgkin's lymphoma by chemotherapy, irradiation or both, 44 patients were studied to assess the value of bacille Calmette-Guerin (BCG) as maintenance therapy . Patients with stage LI, EI or EII disease were allocated at random to receive BCG or no further maintenance therapy, and those with stage LII, LIII, EIII or IV disease received BCG therapy or orally administered cyclophosphamide . BCG had no effect on the duration of remission or the overall survival from the time of randomization . However, after the first recurrence there was a significant improvement in survival in the patients who had received BCG maintenance therapy. Cancer Res, 1983 Sep, 43(9), 4183 - 90 Differences in biological activity among batches of lyophilized tice Bacillus Calmette-Guérin and their association with clinical course in Stage I lung cancer; Bennett JA et al.; Various measures of biological activity were studied in batches of lyophilized Tice Bacillus Calmette-Guerin (BCG) that have been used intrapleurally as adjuvant therapy in surgically resected Stage I lung cancer patients by our own group, the North American Lung Cancer Study Group, and the Ludwig Lung Cancer Study Group . The biological activities of BCG that were studied were: (a) inhibition of solid tumor growth in mice following s.c . inoculation of BCG admixed with methylcholanthrene-induced fibrosarcoma cells (MC 43); (b) protection against tumor colonization of lungs and prolongation of survival in mice pretreated intrapleurally with BCG and later inoculated i.v . with a lethal dose of MC 43 tumor cells; and (c) growth properties in vitro, including a determination of the relative amounts of growing and nongrowing material and the sensitivity of growing material to inhibition by isoniazid . Significant differences in biological activity among batches of BCG were found . Some batches of BCG protected mice against circulating tumor cells, while others did not . Batches of BCG which protected mice against circulating tumor cells were found to have greater sensitivity to isoniazid and higher viability than batches which did not elicit this antitumor activity . There were also trends of some batches of BCG outperforming others in the clinic . Cumulative disease-free interval of patients was longer with batches which protected mice against circulating tumor cells than with batches which did not protect mice against circulating tumor cells . The results of this study suggest that preclinical testing of BCG for antitumor activity may improve the efficacy of this agent in future clinical trials. J Exp Biol, 1983 Sep, 106, 91 - 117 Potassium ion transport ATPase in insect epithelia; Harvey WR et al.; K+ transport by the epithelia of midgut, salivary glands, Malpighian tubules, sensory sensilla, possibly rectum, and other organs of certain insects appears to use a unique K+ ATPase . Ouabain inhibition of transport-related events has not been demonstrated in these epithelia . The K+ pump is unlike the Na-K;ump but resembles the H;ump of phosphorylating membranes in its transport orientation, efficient thermodynamics, speculated two K+ per one MgATP2- stoichiometry, electrogenicity, and structure . Older electrochemical, tracer flux, and conductance evidence suggested that the K+ pump was on the apical plasma membrane of transporting cells in these epithelia . New X-ray microanalytical studies (XMA), reveal that the K+ concentration in all cells is more than 100 mM . Together with new microelectrode data these XMA results confirm the apical K+ pump location, resolve the K+ transport sport route, and suggest that the goblet cell cavity facilitates the generation of a large apical PD which may be used in nutrient absorption and pH regulation . K+ portasomes, which resemble F1-Fo ATPase particles, stud these K+ transporting apical membranes and are though to be the unit of active K+ transport . We have suggested a K+ transport mechanism in which two cations (2K+) are abandoned in an isolated domain of the portasomes during ATP2-hydrolysis and are repelled to the opposite membrane side via a K+ channel . Small peptides hydrolysed from the delta-endotoxin of Bacillus thuringiensis inhibit the K+ transport and may be useful as K+ pump inhibitors, apical membrane probes and insecticides . Goblet cell apical membrane fragments (GCAM) as well as fragments from columnar cell apical membrane (CCAM), lateral membrane (LM) and basal membranes (BM) were isolated as clean fractions using ultrasound, aspiration, and both differential and density gradient centrifugation; purification was monitored by electron microscopy . Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS PAGE) reveals that GCAM, CCAM, LM and BM have very different protein compositions . Preliminary enzymology is consistent with the K+ ATPase being on the apical plasma membrane of the goblet cells of midgut and enveloping cells of sensilla. Zh Mikrobiol Epidemiol Immunobiol, 1983 Sep, (9), 12 - 7 {Isolation of the specific endonuclease BamH1 in the multicyclic cultivation of Bacillus amyloliquefaciens}; Dubinina GP et al.; The present article deals with the study of the multicyclic process of the cultivation of B . amyloliquefaciens in a liquid medium prepared from natural raw materials and with obtaining restrictase Bam H1 from the biomass with different microbiological characteristics . The selected medium has been found to be suitable for the realization of the multicyclic cultivation process on an industrial scale . The tendency towards a drop in the level of nonspecific nucleases simultaneously with a decrease in the specific growth rate has been revealed . A simplified scheme for the purification of the restricting endonuclease is proposed. Cell Immunol, 1983 Sep, 80(2), 405 - 15 Phorbol diester-induced H2O2 production by peritoneal macrophages . Different H2O2 production by macrophages from normal and BCG-infected mice despite comparable phorbol diester receptors; Weinberg JB et al.; Mouse peritoneal macrophages respond to environmental stimuli in different ways depending on their state of differentiation . Macrophages from mice with bacillus Calmette--Guerin (BCG) infection produced large amounts of H2O2 in response to phorbol diesters (PDEs), while those from noninfected mice produced little or no H2O2 . The effects of PDEs on cells are mediated by specific cellular receptors for these ligands . The purpose of this study was to determine if the varying responses of macrophages from different groups of mice were caused by differences in their receptors for the PDE ligands . By all parameters studied, the binding of {20-3H}phorbol 12,13-dibutyrate ( {3H}PDBu) was similar in all macrophages irrespective of their ability to produce H2O2 in response to PDEs . Binding of {3H}PDBu was rapid at 23 degrees C reaching a maximum at 10-20 min with a subsequent decline to 50-60% of maximum by 30-60 min . Binding was slower at 0 degrees C reaching a maximum at 90-120 min . The binding was reversible, with dissociation kinetics paralleling association kinetics . The binding was saturable; the Kd's (45 to 91 nM) and number of binding sites (about 7-14 X 10(5)/cell or 11-12 pmol/mg protein) were essentially the same for the different classes of macrophages . The binding was specific, and analogs of PDBu inhibited {3H}PDBu binding to macrophages with potencies comparable to their potencies in causing in vivo tumor promotion and elicitation of other cellular responses in vitro . The ligands {3H}PDBu and {3H}PMA were degraded to comparable degrees by macrophages from normal or BCG-infected mice . Macrophages from C3H/HeJ and C3H/HeN mice, although known to differ in their abilities to respond to stimuli such as lymphokines and LPS, did not differ in their ability to produce H2O2 in response to PDEs or in their receptors for PDEs . Results of this study suggest that in vivo "activation" of macrophages in mice infected with BCG is not associated with a change in the cells' receptors for PDEs, but may be associated with "postreceptor" changes such as linkage of the PDE receptor with NAD(P)H oxidase, a change in NAD(P)H oxidase, or induction of synthesis of NAD(P)H oxidase. Prikl Biokhim Mikrobiol, 1983 Sep-Oct, 19(5), 599 - 602 {Effect of gramicidin D on the exoprotease activity of Bacillus thuringiensis}; Puchkov EO et al.; A treatment of Bacillus thuringiensis cells with gramicidine D in the medium containing the yeast and polysaccharides increases the lag-phase up to 12 h without a change of the rate during the logarithmic phase of the culture growth . The exoprotease activity of cells treated with gramicidine reaches a maximum value 4 h earlier in comparison with the control culture, and the activity level is increased 2-fold . At a concentration increasing the exoprotease activity, gramicidine was found to induce the permeability of Bac . thuringiensis membranes for potassium ions . An additional introduction of 250 mM KCl or NaCl into the medium inhibits only the exoprotease activity of cells treated with gramicidine . It is assumed that the ability of gramicidine to increase the exoprotease activity of Bac . thuringiensis may be due to a change in the intrabacterial ionic composition. J Hosp Infect, 1983 Sep, 4(3), 305 - 14 Low temperature steam and formaldehyde sterilization; Robertshaw RG; A standard low temperature steam/formaldehyde autoclave was tested according to the manufacturer's instructions, using a range of test pieces containing Bacillus stearothermophilus spores as the challenge organism . There were failures in killing the challenge organism and the reasons for these are discussed . A description of modifications made to the autoclave is given together with details of an improved operating cycle . The performance of the modified autoclave was greatly improved and conditions were established for reliable and consistent sterilization of all the test pieces . A commercially produced prototype autoclave similarly modified also showed effective sterilization. Prikl Biokhim Mikrobiol, 1983 Sep-Oct, 19(5), 610 - 6 {Effect of amino acids on exoprotease synthesis by Bacillus thuringiensis}; Egorov NS et al.; The influence of certain L-amino acids and their mixtures on the synthesis of exoprotease from Bacillus thuringiensis was studied . Physiological experiments showed that the mixture of 20 amino acids added to the artificial medium repressed the synthesis of exoprotease . Among the compounds studied there are both the compounds which stimulate the synthesis of exoprotease (glutamic and aspartic acids, glycine), and the compounds which repress the synthesis of the enzyme (proline, tryptophane, tyrosine, asparagine, serine, cystein) . None of the amino acids caused a change in the exoprotease activity . It has been assumed that the repression of the protease synthesis in the presence of the amino acids is accomplished by ammonium ions, which are formed when using the amino acids of Bac . thuringiensis . The glutamine synthetase activity of cells was determined during the growth of Bac . thuringiensis both on a medium containing triptone and after the addition of certain amino acids to the cell suspension . The correlation between the influence of different amino acids on the synthesis of exoprotease and the glutamine synthetase activity was demonstrated. Biochemistry, 1983 Aug 30, 22(18), 4280 - 91 Complexation and phase transfer of nucleotides by gramicidin S; Krauss EM et al.; Gramicidin S (GrS), an amphiphilic cyclosymmetric decapeptide produced by Bacillus brevis G-B and Nagano, binds nucleotides in water to yield a complex which partitions into organic solvents . The observed phase-transfer efficiencies at a given pH increase in the order AMP less than ADP less than ATP . The lipophilic complexes have well-defined stoichiometries, which were determined to be 1:1 for ADP-GrS at pH 7 and ATP-GrS at pH 3 and 1:2 for ATP-GrS at pH 7 . The interaction is primarily ionic, involving coordination of the ornithine N delta H3+ groups of the peptide and the phosphoryl groups of the nucleotide, with little contribution from the nucleoside moiety . Exchange of organic and inorganic phosphates was also found to be mediated by GrS . The nucleotide complexes are sparingly soluble in water and self-associate extensively in CHCl3, most likely by cross-beta-aggregation, to yield large, ribbonlike aggregates which give rise to broad NMR resonances . Structures for the 1:1 and 1:2 complexes are proposed . In the latter, two GrS molecules envelop the nucleotide, orienting their apolar faces externally in opposite directions, while the lateral faces retain considerable polar character and direct aggregation in organic media . The 1:1 complex possesses a single apolar face and is less lipophilic . Binding constants were estimated by simulation of the extraction data . For the 1:1 complexes, K1:1 congruent to 4 X 10(4) M-1 for either ADP or ATP . Phase transfer of the ATP complex at pH 7 could be modeled either by stochastically independent binding to two noninteracting sites on the nucleotide with K1 approximately K2 approximately K1:1 or by a sequential process with K1 approximately K1:1 and K2/K1 less than 100 . It is concluded that the apparent selectivity of GrS for ATP over ADP is a consequence of the greater lipophilicity and tendency to aggregate of the 1:2 complex, rather than an intrinsically higher binding affinity for triphosphates . GrS is, to our knowledge, the first peptide known to possess phase-transfer activity toward nucleotides; this is, in addition, the first molecular recognition process in which GrS is demonstrated to participate in vitro at physiologically active concentrations. Am J Med, 1983 Aug 29, 75(2A), 106 - 12 Efficacy of amdinocillin and lack of nephrotoxicity when combined with a second beta-lactam antibiotic for therapy of serious gram-negative bacillary infections; Sattler FR et al.; Seventy-eight patients with serious gram-negative bacillary infections were assigned at random to receive either amdinocillin or an aminoglycoside . In addition, each patient was also given a broad-spectrum penicillin or cephalosporin antibiotic . The clinical response to treatment was comparable in the two groups . Cures were effected in 35 (92 percent) of 38 patients treated with amdinocillin and a beta-lactam antibiotic, compared with 37 (93 percent) of 40 patients who were treated with an aminoglycoside/beta-lactam combination . For the entire group, only five (7 percent) of the 75 infecting organisms were resistant in vitro to the treatment beta-lactam or amdinocillin combination, and similarly only two (3 percent) organisms were resistant to the treatment aminoglycoside (p = 0.44) . Although drug-related toxicity occurred with equal frequency in the two groups, six patients treated with an aminoglycoside experienced nephrotoxicity compared with none of the patients who received amdinocillin (p = 0.034) . Thus, amdinocillin plus a broad-spectrum beta-lactam antibiotic may provide suitable empiric therapy for many patients with presumed gram-negative infection and so avoid the risk of aminoglycoside-induced nephrotoxicity. J Biol Chem, 1983 Aug 25, 258(16), 9968 - 72 Selective purification by thiol-disulfide interchange chromatography of alveolysin, a sulfhydryl-activated toxin of Bacillus alvei . Toxin properties and interaction with cholesterol and liposomes; Geoffroy C et al.; Alveolysin has been purified in milligram quantities to apparent immunochemical and electrophoretic homogeneity from the supernatant culture fluid of Bacillus alvei . Purification involved ultrafiltration with concomitant molecular sieving on Amicon hollow fibers, thiol-disulfide interchange chromatography on thiopropyl-Sepharose 6B, and gel filtration on Sephacryl S-200 and Bio-Gel P-100 . The purified toxin was found to be a single polypeptide chain of 582 amino acids (Mr = 63,000) free of carbohydrate, with alanine as NH2-terminal amino acid . Nonpolar amino acids accounted for 40% of the total residues . Immunochemical analysis of the precipitation curve of the toxin with anti-alveolysin immune sera indicated the presence of approximately 13 epitopes . The toxin exhibited a specific activity of 10(6) hemolytic units/mg of protein and behaved as an amphiphilic protein as inferred from charge-shift electrophoresis in a three-detergent system, suggesting the presence of substantial hydrophobic region(s) . The inhibitory effects of various thiol reagents and that of cholesterol and related 3 beta-hydroxysterols with aliphatic side chains at carbon 17 indicated that alveolysin is a typical member of the group of bacterial--SH-activated toxins . The stoichiometry of cholesterol-toxin interaction was apparently equimolar . The complexes between alveolysin and {3H}cholesterol were characterized by sucrose gradient ultracentrifugation . Cholesterol-containing liposomes were disrupted by the toxin. FEBS Lett, 1983 Aug 22, 160(1-2), 78 - 81 The primary structure of initiation factor IF3 from Bacillus stearothermophilus; Kimura M et al.; The complete amino acid sequence of the initiation factor IF3 from Bacillus stearothermophilus has been elucidated . This was achieved by splitting the protein with trypsin, Staphylococcus protease or cyanogen bromide . The amino acid sequence was determined by manual Edman degradation, using the DABITC/PITC double-coupling method . The IF3 molecule contains 171 amino acids and has an Mr of 19 677 . The sequence was compared to the homologous molecule from Escherichia coli; about 50% of the amino acid residues were found to be identical. FEBS Lett, 1983 Aug 22, 160(1-2), 75 - 7 Proteins of the Bacillus stearothermophilus ribosome . Crystallization of protein L6; Appelt K et al.; Crystals of ribosomal protein L6 from Bacillus stearothermophilus suitable for high resolution structural studies have been obtained . Crystals are hexagonal with space group P6122 (or the enantiomorph P6522) and cell dimensions a = b = 72.7 A, c = 124.9 A . A search for heavy atom derivatives is in progress. FEBS Lett, 1983 Aug 22, 160(1-2), 72 - 4 Proteins of the Bacillus stearothermophilus ribosome . A low resolution crystal analysis of protein L30; Appelt K et al.; The 5 A resolution crystal structure analysis of ribosomal protein L30 from Bacillus stearothermophilus is described . The molecule is shown to be compact and extend to about 25-30 A in each dimension. FEBS Lett, 1983 Aug 22, 160(1-2), 67 - 71 The sequence of an antibiotic resistance gene from an antibiotic-producing bacterium . Homologies with transposon genes; Herbert CJ et al.; The APH gene of a butirosin-producing Bacillus circulans has been cloned and sequenced; a comparison of the translated protein sequence with those from TN5 and TN903 indicates that they may have a common origin. Biochem J, 1983 Aug 15, 214(2), 653 - 5 Identification of penicillin-binding protein 5a of Bacillus megaterium KM as a DD-carboxypeptidase; Todd JA et al.; Measurement of the stabilities of DD-carboxypeptidase activity and the penicillin-binding activity of proteins 5 and 5a in membranes isolated from vegetative cells and stage-V forespores suggests that the unique sporulation-specific protein 5a may be a penicillin-sensitive DD-carboxypeptidase. Am J Obstet Gynecol, 1983 Aug 15, 146(8), 953 - 7 Pyelonephritis in pregnancy: a prospective randomized trial to prevent recurrent disease evaluating suppressive therapy with nitrofurantoin and close surveillance; Lenke RR et al.; It has been advocated that if a patient develops acute pyelonephritis during pregnancy, she should receive suppressive therapy for the remainder of the gestation to prevent a recurrence of the disease . We have prospectively evaluated 200 patients following an acute episode of pyelonephritis during pregnancy . All patients were followed in a special clinic . Half the patients received nitrofurantoin as suppressive therapy . Recurrent pyelonephritis occurred in 7% of the patients receiving suppressive therapy versus 8% of those patients receiving close surveillance in the clinic . The results cast doubt upon the need for suppressive therapy and instead dramatized the beneficial effects of close surveillance with cultures . The data also suggest, at least in a high-risk population, that patients with gram-negative bacilluria of less than 10(5) colonies/ml may have a substantial risk of developing symptomatic recurrences . Prompt treatment of even low levels of gram-negative bacilluria should be considered in patients at risk for recurrent disease. J Surg Oncol, 1983 Aug, 23(4), 228 - 35 Humoral response of melanoma patients to two different tumor-associated antigens; Chee DO et al.; Sera of 8 stage II melanoma patients undergoing surgical adjunctive immunotherapy with bacille Calmette Guerin (BCG) plus melanoma cell vaccine (MCV) were assayed for humoral response by the complement-dependent antibody cytotoxicity (CDAC) assay and by the microcomplement fixation (MCF) test . The patients developed high levels of cytotoxic (CTX) and complement-fixing (CF) antibodies to the UCLA-SO-M14 (M14) cells, one of the three melanoma cell lines in the MCV . Significant rises in CTX and CF antibodies occurred one month post-immunotherapy . While the level of CTX antibodies was maintained for 11 months thereafter, the titer of CF antibodies was sustained for seven months, then gradually declined . When the sera were absorbed with lymphoblastoid (ML14) cells which are autologous to the M14 cells, two residual peaks of CTX antibodies, one and four months postimmunotherapy and two peaks of CF antibodies, one and seven months postimmunotherapy, emerged . Two sera that exhibited high levels of CTX and CF antibodies one month postimmunotherapy were absorbed with ML14 cells and human fetal brain tissue . The reactivity of one serum in both the CDAC and MCF assays were abolished, whereas the reactivity of the other serum was not significantly diminished in either assay . These data indicate that the stage II post-surgical melanoma patients developed a humoral immune response to at least two distinct tumor antigens on the membrane of the M14 cells . One of these antigens appeared to be of fetal origin (OFA), the other M14-associated (TAA) . Both antigens, OFA and TAA, were involved in complement-dependent antibody cytotoxic and complement fixation reactions in vitro. J Neurosurg, 1983 Aug, 59(2), 201 - 7 Immunobiology of primary intracranial tumors . Part 7: Active immunization of patients with anaplastic human glioma cells: a pilot study; Mahaley MS Jr et al.; Twenty patients with malignant gliomas were selected for active immunization within 4 weeks following surgery . Each patient had a Karnofsky Functional Rating equal to or greater than 70, a peripheral blood lymphocyte count equal to or greater than 1000 cells/cu mm, skin test responses to one or more of four recall antigens, peripheral blood T-cells equal to or greater than half that of control, and was not receiving steroid therapy at the time of entry into the study . Each patient received subcutaneous inoculations with one of two human glioma tissue culture cell lines (D-54MG or U-251MG) monthly, with 500 micrograms of bacillus Calmette-Guerin cell wall (BCG-CW) being included with the first inoculation . Each patient also received levamisole, 2.5 mg/kg 3 days per week every other week . Radiotherapy and chemotherapy with BCNU were begun after the first month of immunization . Follow-up evaluations included computerized tomography brain scans, neurological examinations, Karnofsky Functional Ratings, and studies of general immune competence . No evidence of allergic encephalomyelitis was noted clinically, nor was any gross or microscopic evidence of such pathology obtained upon autopsy of three of these patients . Serial studies of general immune competence showed no alterations from those previously described with non-immunized patients . Patients who were inoculated with the U-251MG cell line have had a longer survival time compared to those inoculated with the D-54MG cell line (p less than 0.0590) or compared to 58 historical cases of glioma patients treated with levamisole, radiation therapy, and chemotherapy alone (p less than 0.02). J Immunol, 1983 Aug, 131(2), 966 - 71 Resistance to macrophage-mediated killing as a factor influencing the pathogenesis of chronic cutaneous leishmaniasis; Scott P et al.; Cutaneous leishmaniasis can be either a spontaneously healing or chronic disease, depending upon the strain of parasite and the immunological status of the host . We have investigated parasite factors responsible for the variable pathogenesis observed in leishmanial infections by testing the sensitivity of several leishmanial strains to intracellular killing in lymphokine (LK) activated mouse macrophages . Significant microbicidal activity against Leishmania tropica, a strain which heals in C57BL/6 (B6) mice, was found . In contrast, a strain (Maria) which has previously been shown to induce chronic nonhealing cutaneous lesions in B6 mice was resistant to killing in activated macrophages . This resistance to killing was observed in macrophages activated by LK obtained from either Bacille Calmette-Guerin-, L . tropica, or the Maria strain infected mice . The inability of LK activated macrophages to kill the Maria strain was shown not to be due to parasite induced inhibition of killing mechanisms, since Maria strain infected, LK treated macrophages exhibited tumoricidial activity similar to uninfected macrophages . Furthermore, LK activated macrophages simultaneously infected with the Maria strain and another intracellular pathogen, Toxoplasma gondii, killed Toxoplasma, but not the Maria strain . Temperature was also found to significantly influence the multiplication and killing of Leishmania parasites . As would be expected from their cutaneous nature, L . tropica and Maria strain parasites multiplied better at 35 degrees C than at 37 degrees C . Also consistent with the failure of cutaneous strains to visceralize in immunocompetent mice was the observation that the killing of leishmanial parasites was enhanced at the higher temperature . Thus, the temperature dependent growth capacity and sensitivity to killing of a given leishmanial strain in macrophages may be important factors influencing the pathogenesis of cutaneous leishmaniasis. Cesk Patol, 1983 Aug, 19(3), 164 - 77 {Regional proliferative changes in the intestines and intestinal adenocarcinoma and lymphoma in golden hamsters with "wet tail"}; Jelinek F et al.; A group of 637 golden hamsters {Mesocricetus auratus} was studied and 64 of them found suffering from wet tail syndrome . They had a regional epithelial proliferation of the gut often reminding of a tumour associated with unspecified bacilliform organisms in enterocytes . Three adult females showed a similar lesion lacking of microbes with intestinal adenocarcinoma instead . Its diffuse growth reaching mesentery was combined with secondaries in mesenteric lymph nodes . Nine older hamsters showed a malignant intestinal lymphoma in similar conditions . Mutual relations of the findings were discussed . Wet tail syndrome seemed to be an intestinal precancer. Appl Environ Microbiol, 1983 Aug, 46(2), 312 - 5 Toxicity of Bacillus thuringiensis subsp . israelensis to adult Aedes aegypti mosquitoes; Klowden MJ et al.; Adult female Aedes aegypti mosquitoes were killed by the parasporal crystals of Bacillus thuringiensis subsp . israelensis (ONR-60A) when the crystals were introduced into the insect midgut as an enema . The 50% lethal dose for intact parasporal crystals was 0.21 microgram/mg of mosquito (wet weight), and for solubilized crystals the 50% lethal dose was 0.04 microgram/mg . These values were compared with 50% lethal concentrations in a free-feeding larval mosquito bioassay of 0.018 and 1.28 microgram/ml for intact and solubilized crystals, respectively . Preparations from B . thuringiensis subsp . kurstaki were ineffective against both adult and larval mosquitoes . An adult mosquito bioassay is suggested as a direct means of screening potential mosquito control agents. Postgrad Med J, 1983 Aug, 59(694), 525 - 6 Kingella kingae causing septic arthritis in Felty's syndrome; Lewis DA et al.; A case of septic arthritis of the elbow caused by Kingella kingae, a Gram-negative bacillus, is described . The patient had long-standing, severe rheumatoid arthritis and Felty's syndrome . This appears to be the first report from the United Kingdom of Kingella kingae as the aetiological agent of septic arthritis. J Bacteriol, 1983 Aug, 155(2), 872 - 7 Megacinogenic plasmids of Bacillus megaterium; Von Tersch MA et al.; Megacins A-216 and A-19213 in Bacillus megaterium are plasmid encoded, as shown by analysis of cured, non-megacinogenic (Meg-) derivatives of strains 216 and ATCC 19213 and by polyethylene glycol-mediated protoplast transformation of Meg- bacteria with plasmid DNA . The results of both techniques implicated a 31-megadalton plasmid, pBM309, in megacin A-216 production and a 29-megadalton plasmid, pBM113, in megacin A-19213 production. J Bacteriol, 1983 Aug, 155(2), 866 - 71 Bacteriocin from Bacillus megaterium ATCC 19213: comparative studies with megacin A-216; Von Tersch MA et al.; A bacteriocin produced by Bacillus megaterium ATCC 19213 was identified, purified, and compared with megacin A from B . megaterium 216 . The ATCC 19213 bacteriocin was inducible with mitomycin C and showed phospholipase A activity . Both megacin A-216 and megacin A-19213 contained two dissimilar polypeptide subunits . Megacin A-216 contains a 30,000-dalton alpha subunit and a 15,000-dalton beta subunit . Megacin A-19213 is composed of an alpha subunit 18,000 daltons in mass and a beta subunit about 7,500 daltons in mass . No sequence similarities between alpha and beta subunits of either megacin were detected . The two megacins were further distinguished by quantitative differences in activity spectra and by immunodiffusion analyses. Biokhimiia, 1983 Aug, 48(8), 1365 - 73 {Subtilisin-like proteinase SSPB from Streptomyces spheroides, strain 35}; Kreier VG et al.; A serine proteinase possessing a fibrinolytic activity was isolated from a culture filtrate of Streptomyces spheroides, strain 35 . A consecutive use of affinity chromatography on bacillichin-silochrome and bacitracin-sepharose and ion-exchange chromatography on anionie PAP and cationic KMT resulted in a homogeneous proteinase with 1060-fold purification and 19% yield . The enzyme has a molecular weight of 28000; its amino acid composition is Asp31, Ser28, Thr29, Glu9, Pro14, Gly35, Ala42, Val26, Ile14, Leu13, Met2, Tyr9, Phe4, Trp3, His6, Lys4, Arg10 . The enzyme has a pI at pH greater than 10 and the activity optimum against Z-L-Ala-L-Ala-L-Leu-pNA at pH 10-11 . The enzyme is stable within the pH range of 4-11 and in 6 M guanidinium chloride pH 8.0 in the presence of Ca2+ . The enzyme is inhibited by diisopropylfluorophosphate and benzylsulfofluoride, specific inhibitors of serine proteinases as well as by potato proteinase inhibitor . The serine proteinase SSPB isolated from Str . spheroides, strain 35 can be related to subtilisin-like serine proteinase, especially to those of SGPD and SGPE of Str . griseus. Biochem J, 1983 Aug 1, 213(2), 331 - 8 Temperature-dependence of intramolecular coupling of active sites in pyruvate dehydrogenase multienzyme complexes; Packman LC et al.; Intramolecular coupling of active sites in the pyruvate dehydrogenase multienzyme complexes of Escherichia coli, ox heart and Bacillus stearothermophilus was measured at various temperatures . As the temperature was raised, the extent of active-site coupling was found to increase, approaching a maximum near the physiological growth temperature of the organism . Under these conditions, a single pyruvate dehydrogenase (lipoamide) dimer appeared able to cause a rapid (20s) reductive acetylation of probably all 24 polypeptide chains in the dihydrolipoamide acetyltransferase core of the enzyme complex from E . coli at 37 degrees C, and of most if not all of the 60 polypeptide chains in the dihydrolipoamide acetyltransferase cores of the enzymes from ox heart and B . stearothermophilus at 37 degrees C and 60 degrees C respectively . Experiments designed to measure the inter-core and intra-core migration of enzyme subunits suggested that, in the bacterial enzymes at least, this was not a major contributor to active-site coupling. Eur J Immunol, 1983 Aug, 13(8), 620 - 7 Desensitization of macrophages to stimuli which induce secretion of superoxide anion . Down-regulation of receptors for phorbol myristate acetate; Berton G et al.; The ability of cultivated mouse peritoneal macrophages (M phi) to release superoxide anion (O-2) after repeated stimulation by phorbol myristate acetate (PMA) or serum-treated zymosan (STZ) has been studied . After a maximal first stimulus bacillus Calmette-Guerin (BCG)-activated M phi released high levels of O-2, 2-fold more than thioglycollate-elicited M phi and the response ceased within 4 h . Both populations either responded again to a second challenge or displayed a refractory state which varied in duration and selectivity . Desensitization by STZ pretreatment was transient and selective whereas PMA could render M phi refractory for 3 days to PMA alone or to both agents, depending on the amount of PMA used and the conditions of stimulation . PMA induced a selective loss of specific saturable receptors for {3H}phorbol dibutyrate, a closely related agent, and receptor activity recovered with the ability to release O-2 . Loss of receptors did not account for concomitant loss of the response to STZ after nonselective deactivation . Such M phi were fully viable and able to endocytose various soluble and particulate ligands vigorously, but without stimulation of the hexose monophosphate shunt or release of O-2 . Our studies indicate that M phi activities can be profoundly altered by prior stimulation, that specific receptors play a role in ligand-induced desensitization and that agents such as PMA can selectively eliminate the cells' ability to generate a second respiratory burst. Immunology, 1983 Aug, 49(4), 693 - 704 Superoxide release by peritoneal and bone marrow-derived mouse macrophages . Modulation by adherence and cell activation; Berton G et al.; Macrophages (M phi) activated by BCG and other immune stimuli differ from thioglycollate-elicited M phi (TPM) in releasing O-2 upon initial contact with a foreign substratum . During adherence and spreading, activated M phi release approximately 50% of O-2 levels triggered by phorbol myristate acetate (PMA) . The response requires divalent cations (Ca++ or Mg++) and is sensitive to lignocaine, a reversible inhibitor of adhesion . These features distinguish this reaction from the response to PMA, which also triggers substantial release of O-2 from TPM, 60-80% of bacille Calmette--Guerin-activated peritoneal M phi (BCG-PM) activity . During prolonged cultivation as monolayers, peritoneal and bone marrow derived M phi (BMDM) progressively lose their ability to release O-2 in response to PMA and serum-treated zymosan (STZ), although the cells continue to secrete other products and to phagocytose STZ . This loss can be prevented by maintaining peritoneal and BMDM as non-adherent cells in teflon beakers or poly-(2-hydroxyethylmethacrylate) (poly HEMA) coated vessels . High levels of O-2 activity were observed after cultivating TPM on poly-HEMA (300 nmoles O-2/mg/hr after PMA), 10-fold more than adherent controls . BMDM could be induced to release four-fold more O-2, greater than 100 nmoles O-2/mg/hr, after cultivation as non-adherent cells in the absence of L cell-conditioned medium . Our results show that heterogeneity in M phi respiratory burst activity depends on (i) intrinsic differences between populations, (ii) differential responses by activated and non-activated M phi to selective surface stimuli and (iii) modulation by environmental factors which control adherence and growth. J Bacteriol, 1983 Aug, 155(2), 657 - 63 The penicillinase of Bacillus licheniformis is an outer membrane protein in Escherichia coli; Sarvas MO et al.; The cloned gene coding for Bacillus licheniformis penicillinase (penP) was introduced into Escherichia coli in a heat-inducible lambda Qam vector . After induction, significant amounts of penicillinase were synthesized in the new host . The cellular location of the penicillinase was found to be almost exclusively the outer membrane fraction of E . coli, and virtually no soluble penicillinase was found . According to sodium dodecyl sulfate-gel electrophoresis, the size of the penicillinase from E . coli was identical to that of the membrane-bound form of the B . licheniformis penicillinase . Gel filtration in the presence of Triton X-100 suggested that the penicillinase from E . coli had amphiphilic properties, as does B . licheniformis membrane penicillinase . These results show that the export of the penicillinase to the outer membrane of E . coli involves the cleavage of the signal peptide from the prepenicillinase, giving an outer membrane component indistinguishable from the membrane penicillinase of B . licheniformis. Antibiotiki, 1983 Aug, 28(8), 605 - 8 {Lyophilization of the spores and vegetative cells of Bacillus brevis var . G-B.--producer of gramicidin S}; Zarubina AP et al.; Viability, antibiotic properties and variation of 4 variants of Bac . brevis var . G.-B . were studied after lyophilization and storage for a year in the lyophilized state . It was shown that the spores and vegetative cells of S and P- variants not synthesizing gramicidin S were somewhat more stable than the spores and cells of R and P+ variants producing the antibiotic . The latter dissociated by 10 per cent towards the cells producing and not producing gramicidin . The developmental rate of the lyophilized vegetative cells was higher than that of the lyophilized spores . Under analogous cultivation conditions they produced higher amounts of the biomass and antibiotic . The lyophilization method described may be recommended for the maintenance of viability and stability of the spores and vegetative cells of Bacillus brevis var . G.-B . producing gramicidin S. Biochem Biophys Res Commun, 1983 Jul 29, 114(2), 677 - 83 Synthesis of alpha-amylase and alpha-glucosidase by membrane bound ribosomes from Bacillus licheniformis; Thirunavukkarasu M et al.; Alpha-glucosidase was membrane bound during exponential growth of Bacillus licheniformis but was released into the medium during stationary phase . It could be partially removed from exponential phase cells by washing with NaCl (0.5 M) . Alpha-Amylase was exclusively extracellular and could not be detected in cells . Polysomes were prepared from exponential phase cells and separated into membrane bound and soluble fractions . In vitro chain completion and immunoprecipitation showed that alpha-glucosidase and alpha-amylase were synthesized by membrane bound and not by soluble ribosomes. Biochemistry, 1983 Jul 19, 22(15), 3581 - 6 Site-directed mutagenesis as a probe of enzyme structure and catalysis: tyrosyl-tRNA synthetase cysteine-35 to glycine-35 mutation; Wilkinson AJ et al.; Oligodeoxynucleotide-directed mutagenesis has been used on the gene of tyrosyl-tRNA synthetase from Bacillus stearothermophilus to produce mutant enzymes altered at the adenosine 5'-triphosphate (ATP) binding site . Deliberate attempts were made to alter rather than destroy enzymic activity so that kinetic measurements may be made to identify the subtle roles of the enzyme-substrate interactions in catalysis . Cys-35, the -SH group of which is involved in binding the 3'-OH of the ribose ring of ATP, has been mutated to a serine residue {Winter, G., Fersht, A . R., Wilkinson, A . J., Zoller, M., & Smith, M . (1982) Nature (London) 299, 756-758} or glycine residue . The mutant enzymes are less active than the wild type, and the reduction in activity can be attributed to a decrease in the value of kcat and an increase in KM . Thus, the interaction energy of the side chain of Cys-35 with the substrate is not fully realized in the enzyme-substrate complex but is used preferentially to stabilize the transition state . Relative to its absence in the Gly-35 mutant, the side chain of Cys-35 is calculated to stabilize the transition state for pyrophosphate exchange by 1.2 kcal/mol and the transition state for aminoacylation by 1.0 kcal/mol. FEBS Lett, 1983 Jul 11, 158(1), 63 - 7 A third DNA-dependent ATPase from Bacillus cereus free of ATP-dependent DNase activity; Ohlbaum A et al.; The purification of ATP-dependent DNase from Bacillus cereus led to the isolation and characterization of a third DNA-dependent ATPase . The enzyme called ATPase III has been purified free of nuclease activity . None of the expected ATPases proved to be identical with ATP-dependent DNase-DNA-dependent ATPase . Separation of ATPase I, II and III and a DNase specific for single-stranded DNA from the same source excludes the possibility of ATP-dependent DNase being the action of a single enzyme molecule. Med J Aust, 1983 Jul 9, 2(1), 39 - 40 A probable case of Chromobacterium violaceum infection in Australia; Wilkey IS et al.; A case of a north-Queensland Aboriginal child, who died of a septicaemic illness probably caused by Chromobacterium violaceum, is reported . This organism is a Gram-negative bacillus found in soil and water . Human and animal infections are very rare, but have been reported from various tropical and subtropical areas of the world . Most of these have been fatal, although survival after recognition, appropriate antibiotic therapy, and surgical intervention has also been reported. Biochem Int, 1983 Jul, 7(1), 63 - 70 Changes in phospholipid vesicles size induced by amphipathic antibiotics of iturin group; Quentin MJ et al.; As shown by gel filtration and freeze-fracture, amphipathic antibiotics, iturin A and bacillomycin L, increased by about five fold the size of small unilamellar vesicles of saturated lecithins, above their transition temperature. G Batteriol Virol Immunol, 1983 Jul-Dec, 76(7-12), 187 - 99 Lipases production by Bacillus circulans under mesophilic and osmophilic conditions . Factors affecting lipases production; Elwan SH et al.; A facultative osmophilic bacterium able to produce lipases (isolated from bee honey) was identified as Bacillus circulans . Factors affecting lipases production by such isolate were studied . Dox's liquid medium supplied with 2 and/or 30% sucrose was used as a basal medium, under static culture condition, for such a purpose . Results have showed that the optimal sucrose concentration at which the isolate produced its maximal yield of lipases was 30% after an incubation period of 24 hours at 40 degrees C, and this was corresponding to an incubation period of 48 hours at 40 degrees C in presence of 2% sucrose . The optimal pH value was 7 in the first case while, 6.5 in the second . Furthermore production of extracellular lipases by such isolate was achieved in presence and absence of tributyrin as a carbon source instead of sucrose when supplied to Dox's liquid medium . Also the production of extracellular lipases by such isolate was not enhanced in presence of tributyrin as a supplement to Dox's liquid medium when supplied with 2 and/or 30% sucrose as carbon sources . This might suggest that the extracellular lipases of such isolate is constitutive in nature. Mikrobiologiia, 1983 Jul-Aug, 52(4), 663 - 6 {Synthetic medium for cultivating Bacillus thuringiensis}; Kuznetsov LE et al.; Bacillus thuringiensis subsp . galleriae 69/6 was cultivated in a synthetic medium containing 5 amino acids and nicotinic acid . The dynamics of the culture growth and amino acid assimilation were studied in this medium and in a medium containing yeast extract . The phase of spore germination increased, the yield decreased and the maximal growth rate became higher when the culture grew in the synthetic medium . The percentage of thermoresistant spores was slightly lower in the synthetic medium comparing to the medium with yeast extract. Mikrobiologiia, 1983 Jul-Aug, 52(4), 625 - 8 {Electron microscopic study of Bacillus stearothermophilus lysis in stab cultivation}; Imshenetskii AA et al.; Both vegetative Bacillus stearothermophilus cells 3 and cells with mature spores undergo lysis during submerged cultivation in media with starch and maltose as was shown by light and electron microscopy . This can be caused by enzymes lysing cell wall and synthesized at the beginning of the culture growth . The fine structure of the strain 3 spore has certain peculiarities: it contains no exosporium and the inner envelope has a heterogeneous structure. J Infect, 1983 Jul, 7(1), 51 - 62 The protean manifestations of Legionnaires' disease; Van Arsdall JA 2nd et al.; The protean manifestations of Legionnaires' disease are described in an analysis of 12 sporadic cases . Two forms of the disease have been delineated . One variant (Group A) consisted of six patients who had a mild form of non-progressive pneumonia with minimum extra-pulmonary involvement . Six patients (Group B) were differentiated by rapidly progressive pulmonary infiltrates, severe hypoxia and respiratory failure, plus a higher frequency of band neutrophils and extra-pulmonary manifestations . Particularly notable were evidence of severe myositis (elevated creatinine phosphokinase and lactate dehydrogenase), anaemia, and neurological findings which included alterations in the sensorium, meningitis, and convulsions . Cerebrospinal fluid (CSF) abnormalities were seen frequently in patients with neurological manifestations, and necropsy findings in one patient suggested that the Legionnaires' bacillus was capable of producing a fatal leucoencephalitis . Renal findings included haematuria, proteinuria and oliguric renal failure . Hepatic transaminases (SGPT, SGOT) were elevated in six patients and serum bilirubin was abnormal in five . Alkaline phosphatase values were normal to minimally elevated . The gastrointestinal symptoms commonly considered to be a frequent initial manifestation of Legionnaires' disease were rare in this series . Recommendations for instituting empirical therapy, based upon recognition of a clinical syndrome which should suggest the diagnosis of Legionnaires' disease, are included. Antibiotiki, 1983 Jul, 28(7), 494 - 7 {Sporulation in Bacillus licheniformis during altered bacitracin synthesis}; Lukin AA et al.; Sporulation in different strains of Bacillus licheniformis, 10716 and 1001 in connection with changes in synthesis of bacitracin was studied . It was shown that the sporulation efficiency did not depend on the synthesis of the antibiotic: in some strains with low potency for the antibiotic production, the sporulation level was lowered, while in the others, it was not lowered . Moreover, normal sporulation was also observed, when the synthesis of bacitracin was inhibited . Therefore, it is suggested that there is no correlation between the sporulation and antibiotic production. J Antibiot (Tokyo), 1983 Jul, 36(7), 793 - 8 The antibiotic edeine . XII . Isolation and structure of edeine F; Wojciechowska H et al.; The peptide antibiotic edeine F produced by Bacillus brevis Vm4, one of the components of edeine antibiotics complex, was isolated from a fermentation broth and was also obtained by amidination of edeine D . Edeine F is composed of amino acids: (S)-beta-phenyl-beta-alanine, (S)-isoserine, (S)-2,3-diaminopropionic acid, (2R,6S)-diamino-(7R)-hydroxyazelaic acid, glycine and a polyamine guanidylspermidine . Enzymatic degradation of antibiotic with carboxypeptidase B, dinitrophenylation of edeine and of its enzymatic degradation products and synthesis of edeine F from edeine D of known structure permitted to postulate the chemical structure for edeine F. J Urol, 1983 Jul, 130(1), 166 - 70 Chemoimmunoprophylaxis of an experimental bladder cancer with retinoids and Bacillus Calmette Guérin; Pang AS et al.; The prophylactic effect of 2 retinoids (Ro 4-3780 and Ro 10-9359), either alone or in combination with Bacillus Calmette Guerin (BCG), was studied in an experimental murine bladder tumor model . The incidence of tumor takes in all treatment groups was lower than in the control group . Both BCG and Ro 10-9359 were effective in decreasing the percentage of tumor takes and the simultaneous use of these agents was more effective than either one alone . Ro 10-9359 was found to possess more antitumor activity than Ro 4-3780 in this tumor model . Treatment of mice with a combination of Ro 10-9359 and BCG resulted in an 83.3 per cent incidence of complete tumor regression within 80 days . Results suggest that vitamin A derivatives may be useful in the prevention and treatment of bladder cancer and that the activity is likely potentiated by nonspecific stimulation. Hoppe Seylers Z Physiol Chem, 1983 Jul, 364(7), 911 - 21 {Isolation and characterization of glycerol dehydrogenase from bacillus megaterium}; Scharschmidt M et al.; Glycerol dehydrogenase of high purity was isolated from Bacillus megaterium . The enzyme has a pH optimum of 9 and dehydrogenizes in presence of NAD+ glycerol as well as 1,2-propanediol and, to a smaller extent, erythritol . The Michaelis constant for glycerol is 1.4 X 10(-3)M and for NAD+ 3 X 10(-4)M . With the application of different methods (density gradient centrifugation, gel electrophoresis and gel chromatography) relative molecular masses of 156 000-160 000 were ascertained . In the dodecyl sulfate electrophoresis we found a molecular mass of 38 000 per subunit, so that the native enzyme is existent in the tetrameric form . By means of fluorescence titration one NADH binding site per subunit could be estimated . The amino-acid composition was determined . The enzyme is stable only in the presence of high thiol concentrations . Heavy metal ions and chelating agents inhibit the activity of the enzyme . Zinc, presumably, is the natural heavy metal in the active center, but other divalent metal ions can also activate the apoenzyme . With the help of chemical modification reactions, the probable presence of one essential thiol group and one essential tyrosine residue per subunit could be demonstrated. Hoppe Seylers Z Physiol Chem, 1983 Jul, 364(7), 839 - 44 Limited proteolysis of glucose dehydrogenase from Bacillus megaterium by proteinase K; Jany KD et al.; Glucose dehydrogenase from B . megaterium is subjected to proteolysis with proteinase K . Upon proteolysis the enzyme is inactivated and the polypeptide chain is cleaved into two distinct fragments . These components designated as K-protein and K-peptide have molecular masses of 26 000 and 3 000 Da, respectively . Under native conditions the K-protein and K-peptide remain associated and the tetrameric structure of the proteolytically modified enzyme is preserved . The K-protein and K-peptide were isolated and characterised . The cleavage occurs in the C-terminal region of the polypeptide chain . -Leu Ala decreases Ser-Ser-Glu is proposed as the cleavage site. Genetika, 1983 Jul, 19(7), 1091 - 6 {Capacity of Bacillus mesentericus for certain kinds of genetic exchange}; Malkov SV et al.; Some strains of Bacillus mesentericus have an ability for transformation, transfection and transduction . The efficiency of transduction was within the same range as in Bac . subtilis 168, the efficiency of transformation being significantly lower . A fragment of Bac . mesentericus DNA coding for indole glycerophosphate synthetase synthesis was cloned in Bac . subtilis cells . In this case, manifestation of TrpC2 mutation inhibiting synthesis of this enzyme in Bac . subtilis, was abolished . This suggests that some enzymes of Bac . mesentericus were active in Bac . subtilis cells. Biochem J, 1983 Jul 1, 213(1), 53 - 9 Citrate synthase from a Gram-positive bacterium . Purification and characterization of the Bacillus megaterium enzyme; Robinson MS et al.; Citrate synthase was purified to homogeneity from a Gram-positive bacterium (Bacillus megaterium) for the first time . The Mr of the native enzyme was determined to be 84 000 (S.E.M . +/- 5000) . Sodium dodecyl sulphate/polyacrylamide-gel electrophoresis and gel filtration in guanidinium chloride revealed a single protein species of Mr 40 300 (S.E.M . +/- 4400), indicating a dimeric enzyme . This dimeric structure was confirmed by cross-linking the native enzyme with dimethyl suberimidate and with glutaraldehyde, followed by electrophoretic analysis . The enzyme follows Michaelis-Menten kinetics with respect to both substrates, acetyl-CoA and oxaloacetate, and is sensitive to non-specific inhibition by a range of adenine nucleotides . In both molecular and catalytic properties the citrate synthase closely resembles the enzyme from eukaryotic sources and contrasts markedly with the larger, hexameric, enzyme from Gram-negative bacteria. Mikrobiologiia, 1983 Jul-Aug, 52(4), 569 - 72 {Effect of proteins on exoprotease synthesis by Bacillus thuringiensis}; Egorov NS et al.; Bacillus thuringiensis was shown to grow better in media with albumin, gelatin and casein than in a chemically defined medium; proteins did not induce the synthesis of exoprotease . Two maxima were found in the enzyme synthesis: the first one at the exponential phase of the cultural growth, and the second one during spore formation by the culture . The synthesis at the exponential growth phase was susceptible to nitrogen metabolite repression while the synthesis of exoprotease at the stationary phase of growth was not repressed in the presence of high concentrations of ammonium ions in the medium. Vet Q, 1983 Jul, 5(3), 127 - 30 Keratoconjunctivitis infectiosa ovis (KIO), 'pink eye' or 'zere oogjes' (a survey); Konig CD; The occurrence of keratoconjunctivitis infectiosa ovis (KIO) in the Netherlands was reported by Hofland et al . in 1969 for the first time . At present the disease is well known in the Netherlands . Nevertheless there are still questions about the causative agent and the most effective and easiest therapy . Most authors suppose that the disease is caused by Colesiota conjunctivae, although others mention infections by other chlamydia, Mycoplasma conjunctivae, Mycoplasma ovipneumoniae, Acholeplasma oculi and a wide variety of bacteria . The diagnosis can be made on the basis of the symptoms and the detection of the agent in conjunctival scrapings . The bacilliform bodies can be found in conjunctival smears in the cytoplasm (Giemsa, Stamp) . Many therapies are used topically, parenterally or orally . Locally used eye-ointments must be effective against Colesiota; antimicrobial drugs administered by injection must be effective against the latter and also provide a sufficient cell tissue penetration with excretion into the lacrimal fluids . Injections have proved to be easier to administer, especially in serious outbreaks, but such outbreaks are exceptional (18) . Some therapies have been evaluated in small scale experiments (28) as well as in field trials (17). J Antimicrob Chemother, 1983 Jul, 12 Suppl A, 101 - 10 A randomized study of ceftazidime compared to ceftazidime and tobramycin for the treatment of infections in cancer patients; Fainstein V et al.; Three hundred and twenty-one febrile episodes in cancer patients were treated with ceftazidime alone or in combination with tobramycin . Patients were grouped according to their neutrophil count into neutropenic and non-neutropenic (less than 1000 and greater than 1000/mm3) respectively . Two hundred and seventy-five episodes were evaluated . The overall response rate in 83 episodes of infection treated with ceftazidime alone was 60 and 73% in those who received the combination . In those bacteriologically proven the response rate was 72% in both groups of the study . The overall response rate in septicaemia was 75% with ceftazidime alone and 85% with the combination . High response rates were obtained in Gram-negative bacillary septicaemias in both groups even in neutropenic patients treated with ceftazidime alone . Pneumonias in neutropenic patients responded equally well . However, patients with adequate neutrophil counts responded better to the combination than to single-agent therapy . The response rate for Gram-positive infections was 41% for ceftazidime alone and 57% for the combination, which was inferior to the results obtained for Gram-negative infections (P = 0.001) . The rates of superinfection and toxicity were very low . Ceftazidime is a useful antibiotic against Gram-negative infections in cancer patients . It should be combined with an agent active against Gram-positive pathogens in neutropenic patients. Appl Environ Microbiol, 1983 Jul, 46(1), 293 - 5 Increased production of alpha-amylase by Bacillus amyloliquefaciens in the presence of glycine; Zhang Q et al.; The production of alpha-amylase by Bacillus amyloliquefaciens increased by a factor of 300 when glycine was added to a chemically defined simple medium at the early-logarithmic phase of growth . Glycine was not metabolized to a significant extent under the conditions used, but it considerably prevented the lowering of the pH of the culture. Biochim Biophys Acta, 1983 Jun 29, 745(3), 292 - 300 Bacillus cereus 569/H penicillinase serine-44 acylation by diazotized 6-aminopenicillanic acid; Heckler TG et al.; Penicillinase from Bacillus cereus 569/H was purified to homogeneity . Its active site was probed by use of an affinity label generated in situ by the diazotization of 6-aminopenicillanic acid, a catalytically poor substrate for this enzyme . The loss of activity arising during the inactivation is dependent upon pH and the penicillin:sodium nitrite ratio used . Optimal inactivation was obtained at pH 4.7 and reactivation could be prevented if subsequent purification and manipulations were performed at low pH . Inactivation by diazotized 6-aminopenicillanic acid was characterized further by tryptic and chymotryptic digestion of the inactivated enzyme and peptide mapping of the resulting digests . Amino acid analysis of the chymotryptic labeled peptide yielded a composition which corresponds to residues 41-46 (Ala-Phe-Ala-Ser-Thr-Tyr) in the published partial sequence of the enzyme (Thatcher, D . (1975) Biochem . J . 147, 313-326) . Further digestion of this chymotryptic peptide with carboxypeptidase A reveals that serine-44 is modified in this affinity labeling procedure . Mass spectral analysis of the modified serine residue and alkali-released label, and comparison with spectra of model compounds indicates that the inactivation occurs with rearrangement of the beta-lactamthiazolidine structure to a dihydrothiazine. FEBS Lett, 1983 Jun 27, 157(1), 31 - 6 Accumulation of glyceride-modified pre-penicillinase of Bacillus licheniformis in Escherichia coli treated with globomycin; Hussain M et al.; The membrane penicillinase of Bacillus licheniformis is a glyceride-cysteine lipoprotein whose NH2 terminus is analogous to the major outer membrane lipoprotein of Escherichia coli . When E . coli cells producing B . licheniformis penicillinase were treated with the antibiotic, globomycin, a precursor of the penicillinase, pre-penicillinase, accumulated in the cell . It could be immunoprecipitated with anti-penicillinase antibodies; it contained palmitate; and one of its two cysteine residues was modified by glycerol . The action of globomycin, probably indirectly, also activates protease which acts differently on the pre-penicillinase than does the signal peptidase . The results strongly indicate that the pre-penicillinase is processed by the globomycin-sensitive signal peptidase in E . coli, and the modification of precursor by lipid precedes removal of the signal peptide as it does with the membrane lipoproteins of E . coli. Carbohydr Res, 1983 Jun 16, 117, 1 - 11 Cyclodextrin glycosyltransferases from Klebsiella pneumoniae M 5 al and Bacillus macerans: quantitative analysis by high-performance liquid chromatography of the (1 leads to 4)-alpha-D-glucopyranosyl transfer-products from some linear and cyclic substrates; Bender H; The analysis of the (1 leads to 4)-alpha-D-glucopyranosyl transfer-products from some linear and cyclic substrates by quantitative h.p.l.c . illuminated the mode of action of the cyclodextrin glycosyltransferases {1 leads to 4)-alpha-D-glucan:{(1 leads to 4)-alpha-D-glucopyranosyl}transferase (cyclising), EC 2.4.1.19) from Klebsiella pneumoniae M 5 al and Bacillus macerans . D-Glucopyranosyl transfer, obligatory for maltose (poor substrate), was preferred for maltotriose (good substrate) . The lengths of linear disproportionation-products increased with the lengths of the linear substrates . Cyclodextrins were produced from maltotriose and maltopentaose, but not from maltose . The cyclodextrins were substrates in the absence of acceptors . The cyclodextrin transformation started without the formation of detectable amounts of linear transfer-products . The cyclodextrin composition of long-term digests was nearly the same with all the cyclic substrates, cycloheptaamylose being the main cyclic compound . The linear carbohydrate was uniformly distributed from maltose up to at least maltononaose . The enzyme from Bacillus macerans was the least active, but long-term digests yielded results comparable to those obtained with the enzyme from Klebsiella pneumoniae M 5 al. Can Med Assoc J, 1983 Jun 15, 128(12), 1385 - 8 Nonspecific and selective stimulation of the immune system in the treatment of carcinoma in humans; Falk RE et al.; The experience of the Toronto General Hospital in the use of nonspecific stimulation of the immune system with bacille Calmette-Guerin (BCG) for the treatment of cancer of the gastrointestinal tract, malignant melanoma and breast cancer is described . The results are presented in terms of survival curves . The use of BCG administered intraperitoneally in a randomized study of patients with gastric, pancreatic and colorectal cancer proved of no benefit . On the other hand, when BCG was given orally in a randomized study of patients with resectable cancer of the colon and in nonrandomized consecutive studies of patients with malignant melanoma and stage IV carcinoma of the breast survival was increased . In a group of patients with advanced gastrointestinal cancer selective stimulation of the immune system with NED 137 produced a significant increase in survival when compared with the survival of historical controls (the patients given BCG intraperitoneally along with 5-fluorouracil for gastrointestinal cancer) . The results of these studies suggest the need for a more rational approach in manipulating the immune response that would combine chemotherapy with selective stimulation of the immune system. J Biochem (Tokyo), 1983 Jun, 93(6), 1717 - 9 Complete purification of phosphatidylinositol-specific phospholipase C from a strain of Bacillus thuringiensis; Ikezawa H et al.; A phosphatidylinositol-specific phospholipase C was purified from the culture broth of Bacillus thuringiensis IAM 12077 to a homogeneous state as revealed by polyacrylamide gel electrophoresis . The specific activity of the purified enzyme was 559 units/mg and recovery of the enzyme activity was 31% . Molecular and physiological properties of the purified enzyme, including molecular weight (22,000), isoelectric point (pI = 4.9) and its ectoenzyme-releasing activity, were studied in comparison with those other known enzymes of bacterial origin. Can J Microbiol, 1983 Jun, 29(6), 704 - 9 Production of Bacillus sphaericus strain 1593 primary powder on media made from locally obtainable Nigerian agricultural products; Obeta JA et al.; Five media, formulated from dried cow blood, mineral salts, and seeds from four species of legumes, were assessed for growth, sporulation, and insecticidal properties of Bacillus sphaericus strain 1593 . Bacterial powders, prepared from broth, were assayed against Culex quinquefasciatus, Anopheles gambiae, and Aedes aegypti . Good growth and sporulation were obtained with all the media . The highest number of viable cells and spores per mililitre (8.6 X 10(8) and 8.1 X 10(8} were obtained in media containing ground seeds of Vignia unguiculata, Voandzeia subterranean, and Arachis hypogea . All powders were effective against C . quinquefasciatus and A . gambiae . Powders from media containing Arachis hypogea were the most effective with LC50's of 4.344 X 10(-3) +/- 1.650 X 10(-4) and 0.193 +/- 1.376 X 10(-2) micrograms/mL for C . quinquefasciatus and A . gambiae, respectively . Aedes aegypti larvae were only slightly susceptible to the powders . This investigation shows that these media can be used for the production of B . sphaericus 1593 primary powder. J Antibiot (Tokyo), 1983 Jun, 36(6), 625 - 33 Bu-2470, a new peptide antibiotic complex . I . Production, isolation and properties of Bu-2470 A, B1 and B2; Konishi M et al.; A strain of Bacillus circulans produced a complex of basic peptide antibiotics designated Bu-2470, which was found to contain four active components, A, B1, B2a and B2b . Bu-2470 A specifically inhibited various Pseudomonas species including P . aeruginosa, P . maltophilia and P . putida, but otherwise its antibacterial spectrum was limited to certain Gram-negative organisms . Bu-2470 B1 and B2 (B2a + B2b) showed broad antibiotic activity against Gram-positive and Gram-negative bacteria including Pseudomonas species . The physicochemical and biological properties of Bu-2470 B1 and B2 are very similar to those of the octapeptin group of antibiotics. J Reticuloendothel Soc, 1983 Jun, 33(6), 457 - 65 A comparison of three-dimensional growth characteristics of cultured primitive marrow stroma derived from genetically anemic and normal mice; Daniels E; This study examines the ultrastructure of mouse defective marrow stroma when cultured as a three-dimensional organization of cells . Gelfoam sponges impregnated with agar medium allowed the three-dimensional organization of newly formed stromal cells derived from the crevices of marrow-depleted bones of Steel mutant mice (Sl/Sld) with defective stroma and also from mice with normal stroma (Sl +/+, W/Wv, and W +/+ . Ultrastructural comparisons of 5- to 14-day cultures revealed that the mutant defective stromal cells developed normally, viz . i) proliferated and formed a three-dimensional organization of stroma, ii) stimulated residual hemopoietic precursors to form myeloid cells, and iii) formed a variety of stromal cell types characterized by variable quantities of Golgi bodies and ER, glycogen, filaments, and round cytoplasmic granules . The Steel-Dickie strain, however, included bacilliform electron-dense granules in both normal and mutant stroma . The only ultrastructural deficiency in Sl/Sld stroma was the absence of a category of "activated" cells that occurred within normal cell populations. Arch Surg, 1983 Jun, 118(6), 746 - 9 Contaminated street heroin . Relationship to clinical infections; Moustoukas NM et al.; Thirty-one samples of street heroin were analyzed bacteriologically and chemically as to their microbial burden and chemical adulterants (fillers) . Sixty-one percent of the samples were positive for microbial growth . Many species were isolated from the positive samples with Bacillus sp (79%) and Aspergillus sp (10%) predominating . The level of contamination ranged from 1.6 X 10(2) to 3.7 X 10(4) organisms per gram . We obtained cultures from 16 addicts from the Chicago area and 21 from the New Orleans area who had soft-tissue infections related to their habit . Infections in this group of patients were usually polymicrobial; however, there was no correlation between the organisms recovered from street heroin and the addicts' infections . Most drug-related infections appear to be related to the addicts' own oral and dermal microflora . No correlation was observed between the chemical fillers and the bacteria recovered from the heroin. P N G Med J, 1983 Jun, 26(2), 99 - 101 Vaccination coverage in Northern Province, Papua New Guinea; Mirou P et al.; PIP: A survey was conducted in the Northern Province of Papua New Guinea to assess immunization coverage against tuberculosis, diphtheria, pertussis, tetanus, and poliomyelitis among a random sample of 211 childred, aged 6-23 months . The national government's Expanded Programme on Immunization calls for immunizing at least 80% of the country's childred, and specifically calls for administering Bacille Calmette Guerine (BCG) vaccine to infants as soon as possible following birth; a 1st dose of Sabin for poliomyelitis and a 1st dose triple antigen (TA) against diphtheria, pertussis, and tetanus 2 months following birth; and a 2nd dose of Sabin and of TA at 4 months of age . 3rd doses of Sabin and TA were recommended by the government, but 3rd doses were not specific targets of the program . The current study assessed the degree to which coverage was achieved in the Northern Province . The sample of 7 childred from 30 population clusters was selected according to a method recommended by the World Health Organization . 30 population clusters were randomly drawn from census field counts of the inhabitants of the Northern Province . Random technics were used to pick a starting household in each cluster, and succeeding households were identified by selecting the household located nearest to the previously contacted household . Households in each cluster were contacted until 7 children, aged 3-23 months were identified . These 7 children in each of the 30 clusters constituted the sample . A responsible member of the houshold was asked for information on the child in regard to name, sex, birth date, and type and date of vaccination . Verbal reports were then verified by checking records at the rural health centers . This survey methodology proved to be an efficient and practical means for collecting immunization data . The survey revealed that 39% of the 211 children, aged 6-23 months were completely vaccinated, i.e., they had received the BCG vaccine and 2 doses of Sabin and TA . Of those completely vaccinated 77% had been completely vaccinated before they were 12 months old . When the immunization data obtained in the survey were compared to immunization data obtained from routine immunization records maintained by the health centers, the routine recordings were found to be acceptably accurate . Therefore, the recommendation was made that an examination of these routine records every 6 months at the district, provincial, and national level would provide an accurate technique for periodically assessing progress toward the country's immunization goals . Surveys should also be undertaken, but less frequently . Findings indicated that coverage in the Northern Province was less than the overall national coverage . Nationwide 64% of the children under the age of 1 year have received BCG, 49% 2 doses of Sabin and 50% 2 doses of TA . Respective fiquers for the Northern Province were 56%, 41%, and 46% . There is a need a greatly increase immunization efforts throughout the nation but there is even a greater need to do so in the Northern Province . Zentralbl Bakteriol Mikrobiol Hyg {B}, 1983 Jun, 177(5), 412 - 8 {Effect of the addition of DMSO and EDTA on the activity of formaldehyde and hydrogen peroxide against Bacillus cereus spores}; Bohm R et al.; The question was investigated if DMSO in concentrations between 1 and 6% and 0.1% EDTA could improve the effect of the sporocidal disinfectants formaldehyde and hydrogen-peroxide . In suspension-tests with spores of Bac . cereus it was found, that the sporocidal activity of a 1.2 and 3% formaldehyde solution did not increase, in contrary it decreased significantly if EDTA or DMSO were present in the solution . The same effect could be found with 0.8-5% hydrogenperoxide in combination with the above mentioned substances . These results are not in agreement with the observations of other authors working with vegetative bacteria . It is supposed that DMSO rather reactivates injured spores than that it acts as a carrier for the respective disinfectant . This effect seems to mask a relatively faint increase of the permeability for the disinfectants . Concerning EDTA it could be possible, that it did not succeed in removing the Ca++ from the cortex, in contrary it seems, that it binds itself to the calciumdipicolinate thus stabilizing the spore structure. Genetika, 1983 Jun, 19(6), 1036 - 8 {Transformation of Bacillus licheniformis by plasmid DNA}; Zvenigorodskii VI et al.; A system for obtaining regenerating protoplasts of highly active Bacillus licheniformis 1001 strain was developed . Transformation of protoplasts by pUB110 and pminiKC plasmids (constructed from plasmids pUB110 and pC194) leading to the expression of kanamycine resistance, was demonstrated . It is supposed that in Bac licheniformis, the pminiKC plasmid is integrated into cellular chromosome, in contrast to pUB110 and parental Bac subtilis (pminiKC) strain . Still, the integrated plasmid seems to be not completely under control of the host chromosome . As a result of such integration, the plasmid conversion takes place, resulting in alteration of cytokinesis (filament formation) and sporulation, but not interfering with the ability to produce antibiotic bacitracin. Appl Environ Microbiol, 1983 Jun, 45(6), 1733 - 40 Distribution of heterogeneous and homologous plasmids in Bacillus spp; Yoshimura K et al.; A total of 75 strains (including 5 reference strains) of Bacillus amyloliquefaciens, B . cereus, B . circulans, B . licheniformis, B . megaterium, B . pumilus, B . sphaericus, B . subtilis, and B . thuringiensis and 36 species-unidentified Bacillus strains were surveyed for plasmids by cesium chloride-ethidium bromide equilibrium centrifugation of cell lysates in a study of antibiotic resistance in host cells . Of the 111 strains, 13 (including 3 reference strains) were found to harbor plasmids, and 5 of the 13 showed antibiotic resistance . This antibiotic resistance appeared not to be due to the plasmids, however, because the trait was not cured by cultivation of cells in nutrient medium containing ethidium bromide (1 microgram/ml), sodium dodecyl sulfate (0.2 micrograms/ml), or novobiocin (1 microgram/ml), except in one strain, in which kanamycin and streptomycin resistances were cured by novobiocin . One strain of B . amyloliquefaciens, S294, was found to harbor a plasmid, pFTB14, which differed from the plasmid species of classes 1 to 6 in B . subtilis and B . amyloliquefaciens, as determined by restriction analysis and DNA contour length determination . However, in DNA-DNA hybridization on a filter after Southern blotting from an agarose gel, the pFTB14 DNA hybridized with plasmids of classes 1 to 5 . Three strains of B . thuringiensis each carried at least 4 to 11 plasmid species, whereas no plasmids were detected in four strains of B . cereus, which, in relation to B . thuringiensis, is closely related taxonomically and has highly homologous DNA sequences . The plasmid DNAs prepared from species other than B . subtilis and B . amyloliquefaciens did not hybridize with that of pFTB14. Isr J Med Sci, 1983 Jun, 19(6), 546 - 51 Meningitis and bacteremia due to Bacillus cereus . A case report and a review of Bacillus infections; Siegman-Igra Y et al.; A patient with meningitis and bacteremia due to Bacillus cereus is described . The patient had transsphenoidal hypophysectomy for chromophobe adenoma, complicated by rhinorrhea, which was corrected by subarachnoid drainage . Three weeks after removal of the drain, the patient presented with meningitis and died the following day . The causative organism was identified as B . cereus . The literature on Bacillus infections is reviewed with special attention to severe infections . A modified classification is proposed, dividing infections into superficial, closed-space and systemic ones . Sixty-one previously reported cases of systemic Bacillus infections are reviewed according to type of infection (endocarditis, meningitis or pulmonary infection), and the underlying conditions, ways of acquiring the infection, clinical picture and mortality are discussed. Zentralbl Bakteriol Mikrobiol Hyg {B}, 1983 Jun, 177(5), 419 - 35 {Dependency of a microbiological test of a formaldehyde gas sterilization procedure on the shape of objects to be sterilized}; Spicher G et al.; During the last decade, a number of procedures have been developed by different firms for the sterilization of heat-sensitive instruments using a mixture of formaldehyde and water vapor at a temperature of approximately 60 degrees C as means of sterilization . Instruments to be sterilized by this technique as e.g . sounds and catheters normally have long narrow cavities . Therefore, the formaldehyde gas sterilization procedures have to be tested primarily for their capability of achieving a sufficient microbicidal effect within those cavities . For this purpose, the bioindicators are placed into special test pieces . The test pieces commonly in use differ widely in their construction, shape, and size . They mostly consist of some hollow cylinder with an attached capillary or a tube (see Table 1) . The authors demonstrated by means of models that the variety of test pieces in use meant that the sterilization procedures had to meet quite different requirements . The models consisted of flexible tubes differing in diameter and length and were connected to short glass tubes . These glass tubes having identical or wider inner diameters than the flexible tubes served as receptacles containing the bioindicators . Spores of Bacillus stearothermophilus served as test organisms . The spores were suspended in defibrinated sheep blood and dried on filter paper . The efficiency of the sterilization technique was measured in terms of the relative number of indicator strips with surviving germs (i.e . non-sterilized indicators) after treatment of the test pieces with the formaldehyde gas . At first, the test results were examined as to their dependency on the length of the flexible tubes . These tubes were 3 mm wide and 5 to 100 cm long, each being sealed at one end and with the bioindicators placed near the sealed end . The percentage of indicators with surviving germs increased with the length of the tubes . After the sterilization process, nearly all indicators (92%) contained in the 1 m tubes proved to be non-sterile (see Table 2) . The same results were obtained with tubes open at both ends, with the bioindicators located in the middle section of the tubes (see Table 3) . Using tubes of 1 m length, the dependency of the test results on the inner diameter of the test pieces was demonstrated . While all indicators placed into tubes of 3 mm inner diameter still contained surviving germs, those in the tubes of 9 mm inner diameter were all sterile (see Table 4).(ABSTRACT TRUNCATED AT 400 WORDS) Environ Res, 1983 Jun, 31(1), 201 - 11 Effects of acute nitrogen dioxide exposure on cellular immunity after lung immunization; Hillam RP et al.; The effects of acute NO2 exposure on antigen-specific cell-mediated lung immunity in Fischer 344 rats were evaluated . Animals were exposed for 24 hr to either room air or 5, 10, or 26 ppm NO2 before intratracheal immunization with 10(8) sheep red blood cells (SRBC) . Cellular immunity was evaluated by antigen-specific lymphocyte stimulation assays of pooled lymphoid cell suspensions from either the thoracic lymph nodes or spleens . Elevated cellular immunity was observed after exposure to NO2 . The ability of the 26 ppm NO2 exposure to increase cellular immunity seemed to parallel, and in some cases even exceed, that seen in control animals immunized with SRBC mixed with 2 X 10(7) heat-killed Bacillus Calmette-Guerin . These results support the theory that lung damage, and/or alterations of regulatory populations of immune cells, induced by agents such as NO2 can be responsible for the production of abnormally elevated immune responses to antigens deposited in the damaged lung. Can Med Assoc J, 1983 Jun 1, 128(11), 1291 - 5 Adjuvant BCG immunotherapy for stage I and II malignant melanoma; Silver HK et al.; Initial adjuvant immunotherapy trials have demonstrated a greater disease-free interval in patients treated with bacille Calmette-Guerin (BCG) compared with historical controls . In this study 149 patients at high risk of recurrence after surgical treatment of local or regional malignant melanoma were given BCG for 2 years and were followed up for a median of 28 months from the start of immunotherapy . The 36 patients in the comparison group had a higher rate of recurrence than the patients treated with BCG, and the rate in the treatment group was close to that reported from a similar study at the University of California at Los Angeles . The relatively long disease-free interval for the high-risk comparison patients in this study suggests that the control groups at other centres may have included patients with unrecognized additional risk . The rates of survival in the Canadian treatment group were also comparable to those reported by other centres . However, reports of a favourable BCG-mediated pattern of recurrence could not be confirmed . Therefore, the routine use of adjuvant BCG immunotherapy is not recommended. Proc Natl Acad Sci U S A, 1983 Jun, 80(11), 3250 - 4 Cloning of the gene for C protein, a low molecular weight spore-specific protein from Bacillus megaterium; Curiel-Quesada E et al.; The structural gene for C protein, a low molecular weight spore-specific protein from Bacillus megaterium, has been cloned in Escherichia coli . Expression of the C-protein gene in E . coli requires an external transcription promoter and prevention of termination of transcription prior to transcription of all or part of the sequence coding for the C protein . The gene for the C protein is within a 5-kilobase DNA fragment, but this fragment does not code for either of the other two major low molecular weight spore proteins, suggesting that the structural genes for these proteins are not tightly linked. J Immunol, 1983 Jun, 130(6), 2987 - 92 Synergistic effects of active specific immunotherapy and chemotherapy in guinea pigs with disseminated cancer; Key ME et al.; Sewall Wright strain 2 guinea pigs bearing pulmonary metastases of the syngeneic line 10 (L10) hepatocarcinoma were treated with a vaccine composed of 10(7) bacillus Calmette-Guerin admixed with 10(7) x-irradiated L10 tumor cells beginning 10 days after tumor inoculation . Although this treatment failed to cure most of the guinea pigs of their metastatic disease, histologic examination of the pulmonary tumors in the vaccinated guinea pigs provided evidence of a cell-mediated hypersensitivity response that disrupted the normally compact architecture seen in control tumors . When a monoclonal antibody against the L10 tumor was injected i.v . to evaluate the vascular permeability of the tumors, significantly more antibody localized in tumors of vaccinated guinea pigs than in tumors of untreated controls . These results suggested that blood-borne substances could be delivered more efficiently to L10 metastases after the tumor-bearing guinea pigs had been treated with vaccine . To determine whether such increased vascular permeability would enhance the antitumor effects of chemotherapeutic agents, combined immunotherapy and chemotherapy studies were performed . Although cyclophosphamide treatment by itself did not cure L10-bearing guinea pigs, cyclophosphamide used in conjunction with prior immunotherapy increased the survival rate of animals to more than twice that of animals treated with immunotherapy alone (74 vs 33%) . These results suggest that one mechanism by which active specific immunotherapy enhances chemotherapy of disseminated tumors is by rendering tumor foci more permeable to subsequently administered cytotoxic drugs. Boll Ist Sieroter Milan, 1983 May 31, 62(2), 125 - 9 {Possible applications of living BCG and the BCG cell wall in immunotherapy}; Canti GF et al.; BCG, Bacillus Calmette-Guerin, has an immunostimulant capacity and antitumor activity against both experimental and human tumors . Its mechanism of action has not yet been well clarified; maybe it involves one or more immune cell populations: in fact BCG has been reported to loose its activity in immunosuppressed animals . A limiting factor for systemic use of living BCG is its high toxicity: therefore BCG-derivatives have been introduced in both the experimental and the clinical fields . For experimental use one of the most interesting of these products is BCG-cell wall: when used in laboratory animals it demonstrated an efficient dose-dependent antitumor activity and lack of toxicity . On the contrary living BCG was notably toxic and ineffective when used in high doses . An interesting approach in antineoplastic therapy is the use of BCG with tumor cells as a vaccine against micrometastases remaining after surgery, chemotherapy or radiotherapy . A vaccine containing BCG-cell wall and tumor cells (either living or x-irradiated) gave very encouraging experimental results for a possible clinical use in the treatment of tumor metastases. Lancet, 1983 May 21, 1(8334), 1123 - 6 Randomised, controlled trial of the comparative efficacy, auditory toxicity, and nephrotoxicity of tobramycin and netilmicin; Lerner AM et al.; 254 patients with serious gram-negative bacillary infections were enrolled into a multicentre, randomised, blind clinical trial and treated with tobramycin-ticarcillin or netilmicin-ticarcillin . The two treatment groups were similar as to sex, age, and weight . The mean daily dose of netilmicin (237 mg) was higher than that of tobramycin (211 mg), p less than 0.01, but the mean duration of therapy was longer with tobramycin (9.4 days versus 8.7 days), p less than 0.01 . The netilmicin cohort also had more serious underlying diseases, p less than 0.028 . Clinical (tobramycin, 93% and netilmicin, 91%) and bacteriological responses (tobramycin, 87% and netilmicin, 89%) were similar . 84 tobramycin and 73 netilmicin patients had serial audiograms . Eighth nerve deficits developed in 10 (12%) tobramycin and two (3%) netilmicin patients, p = 0.037 . Drug-related renal dysfunction developed in 5 (4%) of 114 tobramycin patients whose renal function was monitored and in 1 (1%) of 116 netilmicin patients, p = 0.12. Biochem Biophys Res Commun, 1983 May 16, 112(3), 927 - 34 Cytochrome P-450 revealed: the effect of the respiratory cytochromes on the spectrum of bacterial cytochrome P-450; Stevenson PM et al.; Soluble extracts of Bacillus megaterium ATCC 14581 prepared by centrifuging a sonicated cell suspension at 40,000 xg for 30 min apparently contained no cytochrome P-450 unless the culture had been grown in the presence of an inducer: a reduced+CO minus reduced spectrum was used to measure cytochrome P-450 concentration . When the 40,000 xg supernatants from the uninduced cultures were recentrifuged at 105,000 xg the respiratory cytochromes, including one like cytochrome a1, were sedimented, and cytochrome P-450 was observed to be 100 nM or 30 +/- 9 p mol cytochrome P-450/mg protein (n=9) . Measurements of cytochrome P-450 in cultures induced with phenobarbital were always higher after ultracentrifugation . There was soluble cytochrome o in all extracts . When cytochrome a1 was present a deep trough at 441 nm developed in the reduced +CO minus reduced difference spectrum of the 40,000 xg supernatant of both the uninduced and the induced cultures . The 40,000 xg supernatant obtained after lysing protoplasts of B . megaterium did not contain cytochrome a1 and always gave a good measure of cytochrome P-450. Eur J Biochem, 1983 May 2, 132(2), 383 - 7 The amino acid sequence of the tyrosyl-tRNA synthetase from Bacillus stearothermophilus; Winter G et al.; The primary structure of the tyrosyl-tRNA synthetase (TyrTS) of Bacillus stearothermophilus has been deduced from the nucleotide sequence of the cloned gene and from the amino acid sequence of peptides isolated from the purified enzyme . TyrTS (B . stearothermophilus) has a molecular weight of 47316 and the sequence is 56% homologous with that of TyrTS (Escherichia coli) . The binding domain for the substrate intermediate tyrosyl adenylate is located in the N-terminal portion of the polypeptide and is highly conserved in both enzymes . Several lysine residues, which are shielded from acetylation in the TyrTS-tRNATyr complex, are also located in a stretch of highly conserved sequence. Pediatr Infect Dis, 1983 May-Jun, 2(3), 187 - 92 Significance of viral infections in severe combined immunodeficiency disease; Jarvis WR et al.; An analysis of a prospective study of viral infections in 12 patients with severe combined immunodeficiency is presented . Infections of viral etiology were common, with pulmonary and gastrointestinal infections being most frequent . Fourteen of 25 infections (56%) were nonsocomially acquired and 10 of 25 (40%) were community-acquired . The period of symptomatology and the duration of viral excretion were usually prolonged beyond those associated with disease in the general pediatric population . Pulmonary infections were associated with considerable morbidity and mortality . Gastrointestinal infections disrupted gastrointestinal function and possibly played a role in enteric Gram-negative bacillary sepsis . The inability of these patients to eradicate these viruses in the absence of immunologic reconstitution resulted in significant morbidity, often with a fatal outcome. J Bacteriol, 1983 May, 154(2), 870 - 8 Characterization of intracellular inclusions formed by Pseudomonas oleovorans during growth on octane; de Smet MJ et al.; The growth of Pseudomonas oleovorans on n-octane was characterized by the formation of intracellular structures . These inclusions were isolated and characterized . Morphologically, they resembled the poly-beta-hydroxybutyrate granules found in Bacillus cereus, as shown by freeze-fracture electron microscopy . The elemental analysis of isolated granules showed, however, that they do not contain poly-beta-hydroxybutyric acid . Instead, the analysis was consistent with a C8 polyester, which interpretation was supported by the fatty acid analysis of hydrolyzed granules . From the evidence presented here, we conclude that P . oleovorans forms poly-beta-hydroxyoctanoate granules when grown on n-octane. Infect Immun, 1983 May, 40(2), 608 - 12 Specificities of monoclonal antibodies against the activated delta-endotoxin of Bacillus thuringiensis var . thuringiensis; Huber-Lukac M et al.; Eight hybrid cell lines secreting monoclonal antibodies directed against the activated delta-endotoxin of Bacillus thuringiensis var . thuringiensis were grown in BALB/c mice . Ascites fluids were collected, and the antibodies were purified by antigen-affinity chromatography . The specificity of each monoclonal antibody for the toxin and protoxin was established by the indirect enzyme-linked immunosorbent assay . All the antibodies consisted of gamma 1 heavy and kappa light chains . They were reactive with both the native toxin and the protoxin . In contrast to specific goat antiserum, they failed, however, to bind to heat and sodium dodecyl sulfate denatured antigen . These eight cloned cell lines gave rise to five kinds of antibodies distinguished by isoelectric focusing . Competitive antibody binding studies revealed that these five antibodies recognize at least four distinct antigenic determinants of the native toxin and the protoxin . Two of the epitopes are unrelated, whereas three antibodies compete for binding to their antigenic determinants . In the bioassay with larvae of Pieris brassicae, one antibody was found to block the toxin and protoxin activity completely . A second inhibited it partially, whereas the other three antibodies did not affect it at all. Ann Microbiol (Paris), 1983 May-Jun, 134A(3), 365 - 81 {Action of the delta-endotoxin of Bacillus thuringiensis var . israelensis on cultured cells from Aedes aegypti L.}; Charles JF; The effects of Bacillus thuringiensis var . israelensis delta-endotoxin were investigated on a cell culture of Aedes aegypti with the electron microscope . The ultrastructural changes following intoxication were: disintegration of endoplasmic reticula by the formation of spherical structures; condensation and then swelling of mitochondria with disappearance of internal cristae; frequent dilatation of the perinuclear space; cellular lysis . The action of a metabolic inhibitor, 2,6-dibromophenol (2,6-DBP), was tested for comparison: beyond condensation of mitochondria, no changes in other cell structures were observed . These data seem to indicate that the mode of action of delta-endotoxin is quite different from that of 2,6 DBP. Mikrobiologiia, 1983 May-Jun, 52(3), 370 - 4 {Microorganisms destroying a number of nonionogenic surface-active substances}; Udod VM et al.; Microorganisms destroying nonionogenic surfactants (NS) were selected . The isolated cultures were assigned to the genera Pseudomonas and Bacillus . Biodestruction of 19 NS was studied in Erlenmeyer flasks with shaking and in the course of continuous cultivation . The rate of destruction was shown to depend on the chemical structure of a substance: block-copolymers of ethylene and propylene oxides were more resistant to the action of microorganisms . The results indicate that sewage waters containing NS (at an initial concentration of 50 to 500 mg/l) can be purified on local installations using microbial cultures or their complexes. Burns Incl Therm Inj, 1983 May, 9(5), 355 - 7 Bacillus cereus infection in burns; Attwood AI et al.; Two patients are reported in whom severe toxicity developed about 4 days after relatively minor burn injuries and in whom the burn areas then appeared to enlarge . In both patients, B . cereus and Staph . aureus were isolated and the affected burn areas had subcutaneous thrombosis and necrosis . The management is outlined and the dramatic rapidity of onset of toxicity emphasized, with special reference to increasing pain, lividity and extension of the burns. Int J Radiat Oncol Biol Phys, 1983 May, 9(5), 643 - 50 Treatment of locoregionally advanced breast cancer with surgery, radiotherapy, and combination chemoimmunotherapy; Hortobagyi GN et al.; Fifty-two patients with locally advanced primary breast cancer (T3, T4, N2, N3) but no evidence of distant metastases were treated with three cycles of combination chemotherapy . The regimen consisted of 5-fluorouracil, Adriamycin, cyclophosphamide, and Bacillus Calmette-Guerin (FAC-BCG), followed by local therapy (simple mastectomy and/or radiotherapy to the breast/chest wall and the regional lymphatic system) and adjuvant chemotherapy for two full years . The results were compared with those in an historical control group of 52 patients matched for initial stage of disease who were treated by a simple mastectomy and postoperative radiotherapy only . Forty-nine (94%) of 52 FAC-treated patients and 48 (92%) of the control patients became free of clinically detectable disease . At the median follow-up time of 56 months, 37.5% of the FAC-treated patients and 19.5% of the control patients had remained free of disease . FAC-treated patients who completed 2 years of therapy and in whom adjuvant chemotherapy was started promptly after local treatment had a 48% disease-free survival rate of 4 years . In those in whom the initial manifestation was supraclavicular involvement, the estimated 5-year disease-free survival rate was 42% for patients treated with FAC and 9% for control patients . There were local recurrences in 25% of FAC-treated patients and 23% of control patients (not significant) . Distant metastases developed in 50% of FAC-treated patients and 77% of control patients (p less than 0.01) . The median disease-free interval was 25 months in the FAC-treated group and 11 months in the control group (p = 0.025) . The greatest improvement in prognosis was in patients with supraclavicular involvement; the median disease-free survival was 26 months in FAC-treated patients and 6 months in the control group (p = 0.007) . This multimodal approach effectively renders the majority of patients with locoregionally advanced breast cancer free of disease and prolongs the disease-free survival period. Br J Dermatol, 1983 May, 108(5), 555 - 60 Separation of the epidermal sheet by dispase; Kitano Y et al.; Dispase is a bacterial neutral protease which is obtained from the culture filtrate of Bacillus polymyxa . After 24-h treatment of the human skin with 500 and 1000 U/ml dispase, the epidermal sheet was easily peeled from the dermis, and its undersurface retained rete ridges . Electron microscopic observation showed that the basal surface was composed of cells with numerous slender villi and cytoplasmic projections . Although the intercellular spaces of the spinous as well as the basal layers were wide, all desmosomes were intact with their accompanying tonofilaments . An epidermal cell suspension was obtained by incubating the dispase-separated epidermal sheet in trypsin solution for 15 min and the viability of the cells was more than 95% as measured by the trypan blue dye exclusion test . A culture of keratinocytes was established by seeding the dissociated cells in the usual way. Cancer, 1983 May 1, 51(9), 1587 - 92 Reduction in mortality from gram-negative sepsis in neutropenic patients receiving trimethoprim/sulfamethoxazole therapy; Riben PD et al.; The causes of death were reviewed in 53 patients from two prospective randomized trials on the efficacy of trimethoprim/sulfamethoxazole as prophylaxis of gram-negative bacillary infection in granulocytopenic patients . Twenty-nine deaths occurred in patients treated with TMP/SMX prophylaxis while 24 occurred in patients who served as controls in the first trial . The two groups were similar, with the exception that more patients in the TMP/SMX group had acute leukemia (82 versus 50%; P less than 0.02) . Microbiologically documented gram-negative rod infection preceeded death in 8/24 control patients as compared to 2/29 TMP/SMX recipients (P less than 0.02) . This decrease in gram-negative related deaths was most pronounced in the patients with acute leukemia . Fatal gram-negative rod infection occurred in 7/12 control leukemic patients as compared to 2/24 TMP/SMX treated patients . Despite the reduction in numbers of gram-negative rod-related deaths, infectious deaths accounted for 16/24 and 15/29 patients in control and TMP/SMX treated patients, respectively . Similar numbers of fungal, viral, and gram-positive bacterial infections occurred in each group . Fever with pulmonary infiltrates but without proven etilogic agents were included in the category of "clinically documented infections;" 6/7 patients with fever and undiagnosed pulmonary infiltrates were in the TMP/SMX group . Prophylactic administration or oral trimethoprim/sulfamethoxazole reduces the frequency of fatal gram-negative rod infections in neutropenic patients. J Biochem (Tokyo), 1983 May, 93(5), 1221 - 30 The action of sphingomyelinase of Bacillus cereus on bovine erythrocyte membrane and liposomes . Specific adsorption onto these membranes; Tomita M et al.; Sphingomyelinase of Bacillus cereus was specifically adsorbed onto sphingomyelin liposome in the presence of Ca2+ or with the coexistence of Ca2+ and Mg2+, but not onto the liposome of phosphatidylcholine . In the presence of Ca2+, the enzyme adsorption onto bovine erythrocytes and liposome increased with an increase in the amount of sphingomyelin . These results support that the major binding site for sphingomyelinase in the erythrocytes is sphingomyelin . The temperature-dependence of enzyme adsorption was not influenced by a change in ATP content of bovine erythrocytes . After treatment of red cells with neuraminidase or pronase, enzyme adsorption at 0 degrees C lower than that at 37 degrees C was observed . In unsealed or right-side-out ghosts, the difference between the enzyme adsorption at 37 degrees C and that at 0 degrees C became less pronounced than in the erythrocytes . Furthermore, the extent of enzyme adsorption onto sphingomyelin liposome at 0 degrees C was almost equal to that at 37 degrees C . The enzyme adsorption onto the erythrocyte membrane and liposome was always enhanced in the presence of Ca2+; in the presence of Mg2+ alone, adsorption was observed only for erythrocyte ghosts and the adsorbed enzyme was released from the membrane after extensive degradation of sphingomyelin by sphingomyelinase . With the coexistence of Ca2+ and Mg2+, the enzymatic hydrolysis of sphingomyelin proceeded rapidly for the attack against liposome and all the membranes tested, whereas in the presence of Mg2+ alone, hydrolysis was observed only for the action of liposome and ghosts . No appreciable hydrolysis of sphingomyelin was observed in the presence of Ca2+ nor in the absence of divalent metal ions. Arch Biochem Biophys, 1983 May, 223(1), 202 - 12 Adsorption of sphingomyelinase of Bacillus cereus onto erythrocyte membranes; Tomita M et al.; Sphingomyelinase of Bacillus cereus proved to be specifically adsorbed onto mammalian erythrocyte membranes in the presence of either Ca2+ or Ca2+ plus Mg2+ in the order of sphingomyelin content; i.e., sheep, bovine greater than porcine greater than rat erythrocytes . No appreciable adsorption was observed in the presence of Mg2+ alone nor in the absence of divalent metal ions . The enzyme adsorption onto bovine erythrocytes was dependent upon the incubation temperature . By shifting the temperature from 37 to 0 degrees C, sphingomyelinase once adsorbed onto the surface of bovine erythrocytes was released into the supernatant . Ca2+ proved to be an essential factor for the enzyme adsorption: The addition of 1 mM Ca2+ enhanced the adsorptive process, but inhibited sphingomyelin hydrolysis and hot or hot-cold hemolysis of erythrocytes, while the addition of 1 mM Ca2+ plus 1 mM Mg2+ enhanced sphingomyelin breakdown and hemolysis as well as the enzyme adsorption . However, when the amount of sphingomyelin fell off to 0.2-0.7 nmol/ml or less by the action of sphingomyelinase, the enzyme once adsorbed was completely released from the surface of erythrocytes . The result indicates that the major binding site for sphingomyelinase is sphingomyelin . In the presence of 1 mM Mg2+ alone, the enzymatic hydrolysis of sphingomyelin and hemolysis proceeded whereas the enzyme adsorption was not encountered during 60 min incubation at 37 degrees C . The change in the molar ratio of Ca2+ to Mg2+ affected the enzyme adsorption and sphingomyelin breakdown; the higher Ca2+ enhanced the adsorption whereas the higher Mg2+ stimulated sphingomyelin hydrolysis. Surg Neurol, 1983 May, 19(5), 453 - 5 Prevention of glioma induction in rats by simultaneous intracerebral inoculation of avian sarcoma virus plus bacillus Calmette-Guerin cell-wall preparation; Mahaley MS Jr et al.; Bacillus Calmette-Guerin cell-wall preparation was injected along with avian sarcoma virus in the brains of newborn Fischer 344 rats, and subsequent glioma induction was compared with rats injected with avian sarcoma virus alone . The percentage of glioma induction and survival were found to be directly related to avian sarcoma virus concentration (10(0), 10(-1), 10(-2), and 10(-3)) . A significant reduction in glioma induction occurred when BCG cell-wall preparation was injected with 10(-2) ASV concentration . Above that concentration of ASV, the tumor induction was not significantly affected by bacillus Calmette-Guerin cell-wall preparation; below that concentration, the tumor induction was too low with avian sarcoma virus alone to evaluate an effect. J Cell Physiol, 1983 May, 115(2), 208 - 16 Comparative biochemical and cytochemical studies on superoxide and peroxide in mouse macrophages; Badwey JA et al.; Maximal rates of superoxide (O-2) release, and the cytochemical locales of peroxide staining in resident, elicited, and activated macrophages have been determined . Macrophages elicited into the peritoneum with either casein (1.2% w/v) or proteose-peptone (10.0% w/v) release about twice as much O-2 as macrophages activated by infection of the animals with either Listeria monocytogenes, or Bacille Calmette-Guerin (BCG) followed by immune boosting with Purified Protein Derivative (PPD) (i.e., about 35 vs . 14-18 nmol O-2/min/10(7) cells) . Macrophages elicited with thioglycollate (3.0% w/v) and resident macrophages produce negligible amounts of O-2 upon stimulation with PMA . These data are compared with those reported by other investigators who used different procedures . A cytochemical procedure for localizing peroxide has been modified for use with murine macrophages . No production of H2O2 by macrophages is detected cytochemically in the absence of stimulation . Upon exposure to PMA, resident macrophages are still largely unresponsive . Approximately 20% of the casein elicited macrophages and BCG-PPD activated macrophages exhibit H2O2 staining, which is largely restricted to the cytoplasmic vesicles and channels induced by PMA in these cells . The only exception to this staining pattern is a small population (about 2%) of activated macrophages which exhibits H2O2 staining in the cytoplasmic vesicles and channels and on the plasmalemma as well. J Gen Microbiol, 1983 May, 129 (Pt 5), 1309 - 16 Sporulation and spore properties of Bacillus brevis and its gramicidin S-negative mutant; Piret JM et al.; The function(s) of the peptide antibiotic, gramicidin S, in its producer, Bacillus brevis Nagano, was investigated . Particular attention was paid to the possible role of gramicidin S in sporulation and spore properties . Sporulation was similar in both the gramicidin S-producing parental strain and a gramicidin S-negative mutant of this strain . Mature parental and mutant spores were equally resistant to UV irradiation, solvents (reported previously) and heat . Thus, the lack of gramicidin S synthesis impairs none of these properties . Contrary to results reported by others, we also found no difference in heat resistance between spores of B . brevis ATCC 8185 and its linear gramicidin-negative mutant, Ml. Biokhimiia, 1983 May, 48(5), 818 - 26 {Structuro-functional properties of the bacteria Bacillus brevis in relation to the accumulation of gramicidin S in cells}; Vostroknutova GN et al.; The culture of Bacillus brevis var . G-B R-form was grown in the presence of beta-phenyl-beta-alanine, the inhibitor of gramicidin S synthesis, is characterized by enhanced endogenous respiration and the DPI-reductase activity as compared to the culture synthezising antibiotic . The increased synthesis of the antibiotic in the region of the culture transition from the logarithmic growth phase to the linear one is associated with a decrease in the number of viable cells despite the fact that the culture on the whole does not die but continues to grow . The membranes prepared from young gramicidin S-free cells and from the cells enriched with the antibiotic possess identical electron micrograph images, IR spectra and protein sets as determined by polyacrylamide gel electrophoresis in a Na-DS system . However, in young cell membranes NADH and succinate dehydrogenase are insensitive to gramicidin S and only malate dehydrogenase is inhibited by this antibiotic . In aged cell membranes the activities of all mentioned dehydrogenases are suppressed . Malate dehydrogenase from young cells is weakly inhibited by thyrotrycin obtained from Bac . brevis ATCC 10068; succinate dehydrogenase is entirely insensitive to this antibiotic, while NADH-dehydrogenase is almost completely inhibited by it . The specificity of action on the respiratory chain of peptide antibiotics synthesized by the cells of one strain of Bac . brevis is suggestive of a possible regulatory role of these peptides in the metabolism of the producent . Hence the accumulation of gramicidin S which is adsorbed on the membrane and destroys the respiratory chain function to the cause of the low rate of oxygen uptake by the culture of Bac . brevis var . G-B R-form and of the low activities of DPI-reductases. Am J Clin Pathol, 1983 May, 79(5), 637 - 43 Xanthogranulomatous pseudotumor of the vagina: evidence of a local response to an unusual bacterium (mucoid Escherichia coli); Strate SM et al.; Utilization of nonconventional bacterial strains and electron microscopy occasionally may aid in the recognition of unusual microorganisms which fail to be demonstrated by more conventional bacterial stains . We report an unusual case of recurrent vaginal polyps, initially thought by physical examination to represent a malignant neoplasm and histologically to represent a granular cell tumor . The lesions were comprised microscopically of sheets of large, polygonal, histiocytic-like cells with abundant eosinophilic granular cytoplasm . With the Dieterle silver stain, the cytoplasm of these cells contained large numbers of intracellular rod-shaped bacilliform bodies thought to be microorganisms . These organisms stained not at all or very poorly with more conventional bacterial stains, such as Gram and Giemsa stains . Electron microscopy was employed to confirm the presence of intra- and extracellular bacilliform bodies and the absence of large numbers of cytosegresomes, the latter characteristically seen in typical granular cell tumors . Cultures of tissue from the biopsy documented a pure strain of a mucoid form of Escherichia coli . We were unable to identify any prior report describing a similar recurrent inflammatory vaginal lesion in which mucoid E . coli was demonstrated . We discuss possible pathogenesis of this case, and relate it to morphologically similar diseases, such as Whipple's disease and malakoplakia, in which there appears to be defective clearance of bacteria from a variety of tissues. Biochem Biophys Res Commun, 1983 Apr 29, 112(2), 578 - 85 Sequence of tRNALeu CmAA from Bacillus stearothermophilus; Pixa G et al.; The primary structure of Bacillus stearothermophilus tRNALeu was determined and found to be :pGCCGAUGs4UGGCGGAAUDGGCAGm1ACGCGCACGACUCmAAms2i6AA psi CGUGUGGGCUUUGCCCGUGUGGGT psi CGACUCCCACCAUCGGCACCA . The molecule has a large extraloop and contains only 8 minor nucleotides . There is a G at position 21 like in all other sequenced bacterial tRNAsLeu.m1A is in position 22, just before the D stem like in several other procaryotic tRNAs . The anticodon is CmAA and is adjacent to a ms2i6A in the 3'-direction. FEBS Lett, 1983 Apr 18, 154(2), 362 - 8 Mechanism of action of Bacillus thuringiensis var israelensis insecticidal delta-endotoxin; Thomas WE et al.; Bacillus thuringiensis var israelensis delta-endotoxin protein active against mosquitoes was inactivated by prior incubation with lipids extracted from Aedes albopictus cells . Experiments with lipid dispersions and multilamellar liposomes showed that the toxin binds to phosphatidyl choline, sphingomyelin and phosphatidyl ethanolamine provided these lipids contain unsaturated fatty acids . Phosphatidyl serine binds toxin less efficiently and phosphatidyl inositol, cardiolipin, cerebroside and cholesterol show no affinity for the toxin . The results suggest an insecticidal mechanism in which interaction of toxin with affinity for the toxin . The results suggest an insecticidal mechanism in which interaction of toxin with specific plasma membrane lipids causes a detergent-like rearrangement of the lipids, leading to disruption of membrane integrity and eventual cytolysis. Eur J Biochem, 1983 Apr 15, 132(1), 207 - 13 Structure of teichoic-acid--glycopeptide complexes from cell walls of Bacillus cereus AHU 1030; Sasaki Y et al.; From lysozyme digests of N-acetylated cell walls of Bacillus cereus AHU 1030, two acidic polymer fractions with molecular weights of about 24000 and 45000 were isolated by ion-exchange chromatography and gel chromatography . These polymer fractions, containing glycerol, phosphorus and glucose in a molar ratio of 1.00:1.00:0.85 together with small amounts of glycopeptide components and mannosamine, were characterized as teichoic-acid-glycopeptide complexes with one and two teichoic acid chains made of 60-65 repeating glycerol phosphate units that were mostly glucosylated . Mild alkali treatment of the complexes yielded a disaccharide-linked glycopeptide . The disaccharide was liberated from the glycopeptide by mild acid treatment and identified as N-acetylmannosaminyl(beta 1 leads to 4)N-acetylglucosamine . On the other hand, the same disaccharide linked to the teichoic acid chain was obtained by direct heating of the cell walls at pH 2.5 . These results lead to a conclusion that in the cell walls of this strain the glycerol teichoic acid chain is attached to the glycan chain of peptidoglycan through this disaccharide unit . The disaccharide is linked at its reducing and nonreducing ends to the glycan chain and the teichoic acid chain, respectively, through phosphodiester bridges. Can Med Assoc J, 1983 Apr 15, 128(8), 929 - 33 Randomized controlled trial of adjuvant chemoimmunotherapy with DTIC and BCG after complete excision of primary melanoma with a poor prognosis or melanoma metastases; Coenzyme binding in crystals of glyceraldehyde-3-phosphate dehydrogenase; Apo-glyceraldehyde-3-phosphate dehydrogenase from Bacillus stearothermophilus and the partially saturated holo-enzyme can be crystallized isomorphously with the entire tetramer occupying the crystal asymmetric unit . For crystals that contain one molecule of NAD+ per tetramer the coenzyme is bound uniquely in one of the four available sites . The presence of NAD+ gives rise to nonequivalence in the binding of a heavy-atom compound to the subunits of the tetramer while for the apo-enzyme this binding is clearly symmetric . These results suggest that NAD binding gives rise to sequential ligand-induced structural changes of the tetramer, which may be responsible for the observed negative cooperativity in coenzyme binding. FEBS Lett, 1983 Apr 5, 154(1), 201 - 4 DNA from alkalophilic Bacillus can transform B . subtilis to alkalophily; Takinishi H et al.; On incubation of B . subtilis RM125(arg 15 leuA8 rM- mM-) with DNA from alkalophilic Bacillus, the transformants (Arg+Leu- or Leu-Arg+) appeared at pH 10 . The transformants were able to grow even at pH 7 . Alkalophilic Bacillus was resistant to bacteriophages o105D1C2.1012 grown on B . subtilis 1012(r-mM+) and o105D1C2.ISMR4 grown on B . subtilis ISMR4(rM+rR+mM+mR+), but the recipient B . subtilis and the transformant(Arg+Leu-) were susceptible to both of the bacteriophages . The results indicate that the transformant is a B . subtilis derivative and that alkalophilicity of alkalophilic Bacillus was transferred to B . subtilis. Biochem J, 1983 Apr 1, 211(1), 155 - 62 Asymmetry of lipid organization in cholinergic synaptic vesicle membranes; Michaelson DM et al.; The lipid composition of purified Torpedo cholinergic synaptic vesicles was determined and their distribution between the inner and outer leaflets of the vesicular membrane was investigated . The vesicles contain cholesterol and phospholipids at a molar ratio of 0.63 . The vesicular phospholipids are (mol% of total phospholipids): phosphatidylcholine (40.9); phosphatidylethanolamine (24.6); plasmenylethanolamine (11.5); sphingomyelin (12); phosphatidylserine (7.3); phosphatidylinositol (3.7) . The asymmetry of the synaptic vesicle membranes was investigated by two independent approaches: (a) determining accessibility of the amino lipids to the chemical label trinitrobenzenesulphonic acid (TNBS); (b) determining accessibility of the vesicular glycerophospholipids to phospholipase C (Bacillus cereus) . TNBS was found to render the vesicles leaky and thus cannot be used reliably to determine the asymmetry of Torpedo synaptic vesicle membranes . Incubation of the vesicles with phospholipase C (Bacillus cereus) results in biphasic hydrolysis of the vesicular glycerophospholipids . About 45% of the phospholipids are hydrolysed in less than 1 min, during which no vesicular acetylcholine is released . In the second phase, the hydrolysis of the phospholipids slows down markedly and is accompanied by loss of all the vesicular acetylcholine . These findings suggest that the lipids hydrolysed during the first phase are those comprising the outer leaflet . Analysis of the results thus obtained indicate that the vesicular membrane is asymmetric: all the phosphatidylinositol, 77% of the phosphatidylethanolamine, 47% of the plasmenylethanolamine and 58% of the phosphatidylcholine were found to reside in the outer leaflet . Since phosphatidylserine is a poor substrate for phospholipase C (B . cereus), its distribution between the two leaflets of the synaptic vesicle membrane is only suggestive. Anal Biochem, 1983 Apr 1, 130(1), 266 - 70 A spectrophotometric method for the determination of aminopeptidase activity with leucine dehydrogenase; Takamiya S et al.; L-Leucine dehydrogenase purified from Bacillus megaterium and Bacillus sphearicus was used for the determination of serum aminopeptidase activity with L-leucinamide as a substrate . L-Leucine produced by aminopeptidase was determined by measurement of the increase in absorbance at 340 nm caused by the formation of NADH . This method is useful for the kinetic studies of the aminopeptidase and the enzyme assay of a large number of samples . The serum aminopeptidase can be characterized to give some valuable information in clinical diagnosis by comparison of the results obtained by the present method with those by the conventional method with L-leucyl-p-nitroanilide as a substrate. Zh Mikrobiol Epidemiol Immunobiol, 1983 Apr, (4), 53 - 8 {Epidemiology of bacillary dysentery in Algeria . II . The seasonality of dysentery}; Shkarin VV et al.; Morbidity rises during the period of summer and autumn are characteristic of bacterial dysentery in Algeria . During the last 18 years no essential changes in the seasonal character of bacterial dysentery were observed in the country taken as a whole . However, in different climatic and geographical zones of the country the seasonal character of dysentery greatly varies from one zone to another and essentially differs from the seasonal character of dysentery morbidity, typical of the country as a whole for many years . The most pronounced manifestations of seasonal rises are observed in the Sahara zone . The seasonal character of dysentery is formed mainly by morbidity among patients belonging to 3 age groups . The seasonal rises of dysentery can be probably explained by the complex of social and climatic factors, as well as by the biological features of the causative agents of this disease. J Bacteriol, 1983 Apr, 154(1), 419 - 28 Diversity of locations for Bacillus thuringiensis crystal protein genes; Kronstad JW et al.; The location of crystal protein genes in 22 crystalliferous Bacillus thuringiensis strains representing 14 subspecies was investigated by hybridization of an intragenic restriction fragment from a cloned crystal protein gene to whole plasmid preparations . Hybridization was found to a single plasmid in eight strains, to more than one plasmid in seven strains, and to one or both of two large, unresolved plasmids in two strains . The sizes of the hybridized plasmids ranged from 33 to over 150 megadaltons . In one additional subspecies, hybridization was only to linear DNA fragments, suggesting a chromosomal crystal protein gene, and for four other subspecies, not reported to be toxic to lepidopteran insects, no hybridization was found to either plasmids or to total cell DNA . Hybridization to restriction digests of plasmids and total cell DNA of several strains of subspecies thuringiensis and kurstaki revealed that all homology to the cloned crystal protein gene was plasmid associated and that several of these strains contained multiple regions of homology, implying the presence of multiple crystal protein genes. J Bacteriol, 1983 Apr, 154(1), 330 - 5 Respiratory chain of the alkalophilic bacterium Bacillus firmus RAB and its non-alkalophilic mutant derivative; Kitada M et al.; The membrane-bound respiratory chain components of alkalophilic Bacillus firmus RAB were studied by difference spectroscopy and oxidation-reduction potentiometric titrations . Cytochromes with the following midpoint potentials were identified at pH 9.0: a-type cytochromes, +110 and +210 mV; b-type cytochromes, +20, -120, -280, and -400 mV; and cytochrome c, +60 mV . Only the higher-potential cytochrome a showed an upward shift in midpoint potential when titrated at pH 7.0 . Parallel studies of a non-alkalophilic mutant derivative of B . firmus RAB, strain RABN, revealed the presence of only one species each of a-, b-, and c-type cytochromes which exhibited midpoint potentials of +110, -150, and +160 mV, respectively, at pH 7.0 . Membranes of both strains were found to contain menaquinone . At pH 9.0, NADH caused the reduction of essentially all of the cytochromes that were seen in fully reduced preparations of wild-type B . firmus RAB membranes . By contrast, at pH 7.0, NADH failed to appreciably reduce the b-type cytochromes . These findings may relate to our recent proposal that an inadequacy in energy transduction (production of a proton motive force) by the alkalophilic respiratory chain at pH 7.0 is what precludes the growth of B . firmus RAB at a neutral pH. J Bacteriol, 1983 Apr, 154(1), 294 - 303 Products of phospholipid metabolism in Bacillus stearothermophilus; Card GL et al.; The products of phospholipid turnover in Bacillus stearothermophilus were determined in cultures labeled to equilibrium and with short pulses of {32P}phosphate and {2-3H}glycerol . Label lost from the cellular lipid pool was recovered in three fractions: low-molecular-weight extracellular products, extracellular lipid, and lipoteichoic acid (LTA) . The low-molecular-weight turnover products were released from the cells during the first 10 to 20 min of a 60-min chase period and appeared to be derived primarily from phosphatidylglycerol turnover . Phosphatidylethanolamine, which appeared to be synthesized in part from the phosphatidyl group of phosphatidylglycerol, was released from the cell but was not degraded . The major product of phospholipid turnover was LTA . Essentially all of the label lost from the lipid pool during the final 40 min of the chase period was recovered as extracellular LTA . The LTA appeared to be derived primarily from the turnover of cardiolipin and the phosphatidyl group of phosphatidylglycerol . Three types of LTA were isolated; an extracellular LTA was recovered from the culture medium, and two types of LTA were extracted from membrane preparations or whole-cell lysates by the hot phenol-water procedure . Cells contained 1.5 to 2.5 mg of cellular LTA per g of cells (dry weight), over 50% of which remained associated with the membrane when cells were fractionated . Over 75% of the 3H label incorporated into the cellular LTA pool during a 90-min labeling period was released from the cells during the first cell doubling after the chase . Label lost from the lipid pool was incorporated into cellular LTA which was then modified and released into the culture medium. Genetika, 1983 Apr, 19(4), 517 - 24 {Experiments with Bacillus thuringiensis protoplasts . I . Isolation of protoplasts and their reversion to bacillary form}; Tsenin AN et al.; A method for protoplastization of crystal- and spore-forming Bacillus thuringiensis bacterian and consequent cell wall regeneration on a solid hypertonic medium is presented . Up to 50% of the protoplasts prepared were viable and formed colonies under special conditions; at the same time, less than 0,01% of the cells treated with lysozyme were resistant to the osmotic shock; bacterial autolytic system takes part in protoplasts formation . Electron microscopic studies of protoplasts and cells confirm the fact of cell wall removal and support the proposed mechanism of protoplast formation. Proc Natl Acad Sci U S A, 1983 Apr, 80(7), 2031 - 5 Macrophage activation: dissociation of cytotoxic activity from Ia-A antigen expression; Blumenthal EJ et al.; Peritoneal macrophages were obtained from DBA/2 mice that were untreated or after the injection of bacillus Calmette-Guerin (BCG), thioglycollate broth, proteose-peptone broth, or gamma-irradiated P-815 tumor cells . These macrophages were "activated" to become cytotoxic for a fibroblast cell line (L 929) by the addition of lymphokines (LKs), lipopolysaccharide (LPS), or fibroblast interferon (IFN-beta), and the expression of I region-associated antigens (Ia-Ad) on the macrophages was examined both before and after activation . Thioglycollate-elicited macrophages became Ia-A+ when activated by LKs, but they remained Ia-A- when activated by LPS or IFN-beta . Resident macrophages and proteose-peptone-elicited macrophages remained Ia-A- when activated with LKs . Macrophages from BCG-infected mice were both Ia-A+ and cytotoxic for tumor cells without further treatment . In contrast, macrophages from mice injected with gamma-irradiated P-815 mastocytoma cells were Ia-A+ but not cytotoxic, and these macrophages could not be made cytotoxic by incubation with LKs . The cultured macrophage-like cell lines P388D1 and WEHI-3 became Ia-A+ after incubation with LKs, and this treatment amplified the cytotoxicity of both cell lines . We conclude that a number of factors are important in determining whether Ia-A expression accompanies macrophage activation and that Ia-A is irrelevant as a surface marker for macrophage activation. J Gen Microbiol, 1983 Apr, 129 (Pt 4), 1239 - 42 Penetration of oxygen into bacterial colonies; Wimpenny JW et al.; Previous estimates of the depth of oxygen penetration into bacterial colonies were made after measuring actual and potential respiration rates of whole colonies, or by calculation from kinetic values determined from the growth of bacteria in liquid culture . This paper reports the use of microelectrodes to measure oxygen penetration directly . Oxygen became undetectable 25-30 microns below the surface of a 120 microns deep, 18 h colony of Bacillus cereus . The colony was grown on a nutrient-rich agar medium incubated at 30 degrees C in a water-saturated atmosphere. Biochimie, 1983 Apr-May, 65(4-5), 239 - 45 {Action of Bacillus sphaericus endopeptidases on bacterial peptidoglycans and peptidoglycan fragments}; Valentin C et al.; Two endopeptidases have been characterized in Bacillus sphaericus 9602: a gamma-D-glutamyl-(L) meso-diaminopimelate endopeptidase (endopeptidase I) and a gamma-D-glutamyl-L-diaminoacid endopeptidase (endopeptidase II) . They are active on the peptide moieties of some bacterial peptidoglycans . Their specificities have been studied on peptides or monomeric glycopeptides derived from peptidoglycans . Their study was attempted on dimeric and polymeric fragments of a E . coli radioactive peptidoglycan . Those compounds are specifically labelled on the meso-diaminopimelate residues and are listed below. Genetika, 1983 Apr, 19(4), 525 - 31 {Experiments with Bacillus thuringiensis protoplasts . II . Study of the potential interspecies fusion of bacterial protoplasts: Bacillus thuringiensis and Bacillus megaterium}; Tsenin AN et al.; In the present study the possibility of obtaining interspecific bacterial hybrids by polyethylene glycol-assisted fusion of protoplasts from Bacillus thuringiensis and Bac . megaterium has been examined . Electron microscopic and genetic data allow to confirm with great probability that cytological fusion takes place . However, genetic analysis revealed that neither of methods applied for protoplast fusion gave stable recombinants . Apparently, it is due to the lack of recombination or the death of recombinants that follows the functioning of the cell correction system . The mechanism of protoplast fusion and its most important steps are also studied in the present work. Int J Pept Protein Res, 1983 Apr, 21(4), 369 - 73 Amino acid composition and zinc content of milk-clotting protease from Bacillus mesentericus strain 76; Mesrob BK et al.; The milk-clotting protease from Bacillus mesentericus strain 76 is free of carbohydrate and lacks cysteine and cystine . The amino acid composition indicates a single peptide chain with 304 residues . Five amino acids--aspartic acid, threonine, serine, glycine and alanine--represent one-half of the total residues . The enzyme contains 35 aromatic amino acids and 103 ionic amino acids . The observed constant value of the ratio Menzyme:Azinc is 1:1 for active and acid denatured enzyme preparations, indicating that 0.1 M acetic acid causes denaturation of the enzyme but it can not eliminate the zinc ions. J Hyg (Lond), 1983 Apr, 90(2), 241 - 52 Contaminated first-aid dressings: report of a working party of the PHLS; Marples RR; In a collaborative study 12 Public Health Laboratory Service laboratories and the Division of Hospital Infection, Central Public Health Laboratory, investigated the degree of contamination of standard dressings produced by manufacturers in India or in England by a comparison of the results of culture of 25 sterilized dressings with those of 25 untreated dressings . Of the 38 batches of dressings made in India 27 (71%) were judged contaminant and another six could be so judged when Bacillus species were examined . In two batches laboratory contamination precluded a judgement and only three batches passed the test . Of the 27 batches made in England, only three gave any evidence of contamination at the lowest level of significance . Repeat investigation of one of these batches gave no evidence of contamination . Organisms of the genus Bacillus and fungi were associated with contamination; micrococci and propionibacteria were laboratory contaminants . There was evidence for both failure and sterilization and of contamination after sterilization during the manufacture of dressings. Cancer Res, 1983 Apr, 43(4), 1611 - 5 Reduction of bladder tumor growth in mice treated with intravesical Bacillus Calmette-Guérin and its correlation with Bacillus Calmette-Guérin viability and natural killer cell activity; Shapiro A et al.; The effect of intravesical Bacillus Calmette-Guerin (BCG; Pasteur strain) treatment on the frequency of implantation and growth rate of the murine transitional cell carcinoma of the bladder, MBT-2, was studied . MBT-2 cells were instilled into the bladder immediately after electrocauterization, and BCG instillations (40, 80, and 160 micrograms/instillation) were initiated 24 hr later and continued on a weekly basis for 4 weeks . BCG treatment significantly (p less than 0.0002) reduced the incidence of tumor implantation in a dose-dependent manner and resulted in significantly (p less than 0.0001) smaller tumors when they appeared in BCG-treated mice . The therapeutic effect of BCG correlated with augmentation of natural killer cell (NK) activity and positive purified protein derivative (PPD) footpad reactions . In experiments in which treatment was initiated with rapidly growing BCG organisms (10(7) colony-forming units/mg), tumor implantation was inhibited, there was a dose-dependent increase in NK activity, and mice had positive footpad reactions in PPD . In experiments in which BCG with reduced viability (10(6) colony-forming units/mg) and slower growth rates was used for treatment, no significant inhibition of tumor implantation was observed, NK activity was depressed, and PPD footpad tests were uniformly negative . The results suggest that the therapeutic effects of BCG therapy in this murine model correlate with augmentation of NK activity and positive footpad reactions to PPD and further suggest that the viability and growth rate of BCG organisms are important factors in determining the efficacy of intravesical BCG therapy. J Biol Chem, 1983 Mar 25, 258(6), 4003 - 6 On the DNA binding protein II from Bacillus stearothermophilus . I . Purification, studies in solution, and crystallization; Dijk J et al.; DNA binding protein II from Bacillus stearothermophilus has been purified as a single species from the nonribosomal cell fraction by a combination of gel filtration and ion exchange chromatography . The protein occurs in solution as a tetramer and is able to bind to 30 S, 50 S, and 70 S ribosomal particles . Circular dichroism studies show that the protein has approximately 45% alpha-helix . The secondary structure of the Bacillus protein is considerably more resistant to the effects of increasing temperature and urea concentration than the homologous protein (NS1 and NS2) from Escherichia coli . Proton magnetic resonance experiments show that the protein has a well folded, compact tertiary structure . The DNA binding protein has been crystallized from several precipitants as monoclinic needles and triclinic plates . The monoclinic form diffracts to at least 3.5 A and oscillation data from the native crystals have been collected . The protein is able to bind to both single- and double-stranded oligodeoxyribonucleotides . Upon binding, several changes occur in the protein NMR spectrum which may be used for further analysis of the mechanism of interaction. Cancer, 1983 Mar 15, 51(6), 1083 - 90 Improved complete remission rates and survival for patients with large cell lymphoma treated with chemoimmunotherapy . A Southwest Oncology Group Study; Jones SE et al.; Between 1974 and 1977, 652 patients with non-Hodgkin's lymphoma without prior chemotherapy were randomized to 1 of 3 combination chemotherapy programs designed to induce complete remission (CR): COP-bleomycin (180 patients), CHOP-bleomycin (232 patients) or CHOP plus immunotherapy with Bacillus Calmette Guerin (BCG) (240 patients) . With mature follow-up, the major effect of BCG immunotherapy was observed in patients with large cell lymphomas (diffuse or nodular "histiocytic") and not in other common lymphoma subtypes . CR rate for 65 patients with large cell lymphoma treated with CHOP-BCG was 68% compared to 48% in 61 patients treated with CHOP-bleomycin (P = 0.02) (two-tailed test) or 44% for 45 patients treated with COP-bleomycin (P = 0.02) . CR duration for both CHOP-based regimens was similar and superior to that produced by COP-bleomycin (P = 0.03) . Survival of patients with large cell lymphoma treated with CHOP-BCG was better than that observed with CHOP-bleomycin (P = 0.02) or COP-Bleomycin (P = 0.002) . Although the explanation for the favorable effect of BCG remains unclear, further clinical trials to evaluate the combination of chemotherapy and other "biologic response modifiers" is warranted for patients with lymphoma. J Cell Sci, 1983 Mar, 60, 181 - 97 Bacillus thuringiensis var israelensis crystal delta-endotoxin: effects on insect and mammalian cells in vitro and in vivo; Thomas WE et al.; Bacillus thuringiensis var israelensis parasporal crystal delta-endotoxin was purified by ultracentrifugation on a discontinuous sucrose gradient . Native delta-endotoxin crystals showed no detectable toxicity in the vitro and in vivo systems that are described . By contrast alkali-solubilized crystal delta-endotoxin caused rapid cytological and cytopathological changes in Aedes albopictus, Choristoneura fumiferana 63 CF1, Spodoptera frugiperda and Trichoplusia ni cell lines as observed by phase-contrast microscopy and vital staining . Mouse fibroblasts, primary pig lymphocytes and three mouse epithelial carcinoma cell types showed a similar response to the alkali-soluble crystal delta-endotoxin . In addition the soluble crystal delta-endotoxin protein caused haemolysis of rat, mouse, sheep, horse and human erythrocytes . Intravenous administration of the alkali-soluble crystal delta-endotoxin to Balb . c mice at a dose rate of 15-30 micrograms of protein per gram body weight resulted in rapid paralysis followed by death within 12h . Subcutaneous inoculation of 15-30 micrograms of protein per gram body weight resulted in death of suckling mice in 2-3 h . The alkali-solubilized crystal delta-endotoxin was not toxic however, when administered per os . A comparison is made with a similar alkali-soluble fraction from the parasporal crystal delta-endotoxin of B . thuringiensis var kurstaki . With the exception of the Lepidopteran cell line, Choristoneura fumiferana 63 CF1, this soluble crystal delta-endotoxin protein showed no in vitro or in vivo toxicity, and no haemolytic activity. Ann Microbiol (Paris), 1983 Mar-Apr, 134A(2), 197 - 218 {Action of crystals of Bacillus thuringiensis var . israelensis on the midgut of Aedes aegypti L . larvae, studied by electron microscopy}; Charles JF et al.; Ingestion of Bacillus thuringiensis var . israelensis crystals by Aedes aegypti larvae is followed by midgut epithelium disruption . Earliest ultrastructural changes consist of an enlargement of intra- and intercellular spaces in the basal region of the cell . Endoplasmic reticula disintegrate by forming spherical structures which increase in size during intoxication . Mitochondria are transformed at first into a condensed form, then become swollen with the disappearance of internal cristae . In the cardia cells, which secrete the peritrophic membrane, the Golgi apparatus may produce electron-dense secretion vesicles; in this event, the peritrophic membrane assumes an abnormal configuration . Before complete breakdown, a cellular hypertrophy is observed: few cells become balloon-like . At the same time, the microvilli decrease in size, widen and then disappear after a few hours exposure to crystal delta-endotoxin. J Antibiot (Tokyo), 1983 Mar, 36(3), 208 - 12 Ro 22-5417, a new clavam antibiotic from Streptomyces clavuligerus . I . Discovery and biological activity; Pruess DL et al.; Streptomyces clavuligerus NRRL 3585, a culture which produces a variety of beta-lactam antibiotics in the penicillin, cephalosporin and clavam families, was found to produce a new beta-lactam antibiotic, Ro 22-5417 . The compound, which was neither a substrate for nor inhibitor of several beta-lactamases, showed antimicrobial activity in defined minimal medium but little or no inhibitory activity in nutrient-rich medium . The activity was bacteriostatic against Bacillus species ATCC 27860 and was antagonized by D- and L-methionine, L-cystathionine, L-homocystine and O-acetyl-L-homoserine but not by L-homoserine, L-aspartate, L-cysteine or other common amino acids, vitamins and nucleosides . Our results are consistent with Ro 22-5417 acting as an inhibitor in methionine biosynthesis. Int Arch Allergy Appl Immunol, 1983 Mar, 70(3), 252 - 60 Mechanism of BCG-activated macrophage-induced tumor cell cytotoxicity: evidence for both oxygen-dependent and independent mechanisms; DiStefano JF et al.; Activated peritoneal macrophages have been shown to be cytotoxic to cancer cells . Bacillus Calmette-Guerin (BCG)-activated rat peritoneal macrophages have a basal cytolytic potential for 3H-thymidine-labelled Walker 256 cancer cells in vitro that can be markedly enhanced by digitonin . This stimulation of cytotoxicity can be partially inhibited by catalase and the combination of superoxide dismutase plus catalase . This suggests that digitonin stimulates activated macrophages to produce superoxide, hydrogen peroxide and possibly other free radicals which can augment macrophage-induced tumor cell cytotoxicity . After a 2-hour incubation with digitonin, macrophages are no longer stimulated by digitonin . However, after a 2-hour drug preincubation period, inhibitors of serine protease activity (DFP, TLCK, SBTI) and inhibitors of protein synthesis (cycloheximide) are potent inhibitors of basal macrophage-induced tumor cytotoxicity . We suggest that BCG-activated macrophages have two mechanisms for destroying cancer cells: one mediated by proteolytic activity, and a second mechanism dependent on the generation of oxygen-derived free radicals. Clin Obstet Gynecol, 1983 Mar, 26(1), 138 - 42 Chancroid and granuloma inguinale; Schwarz RH; PIP: Chancroid, also known as soft chancre, is seen infrequently and is manifested locally rather than systemically . The causative organism, Hemophilus ducreyi, is a short nonmotile bacillus, non-acid-fast, and usually gram-negative . Culture of the organism is difficult because contamination by other organisms inhibits the growth of H . ducreyi . Chancroid is relatively rare in the US but is more common in developing countries . It is a disease of the sexually promiscuous and is associated with poor hygiene . The lesions are usually obvious in the male but may be undetected in women . The incubation period is 3-5 days and the typical lesion is a soft nonindurated ulcer with a dirty exudate at the base, which is painful and exquisitely tender to palpation . Bubo formation is common and about half suppurate . Diagnosis depends on differentiation from other genital ulcers . The characteristics of the lesions and the nature of lymph node involvement are diagnostic features; smears and cultures are also involved but the organism may be difficult to isolate and the diagnosis must often be established on clinical grounds alone . In many instances no specific therapy other than cleansing with soap and water may be required . The sulfonamides, tetracycline, or a combination may be utilized . Prevention is usually a function of hygiene; condoms offer good protection . Granuloma inguinale, a disease of tropical and subtropical countries, is caused by the gram-negative, pleomorphic and microaerophilic bacterium Calymmatobacterium granulomatis . The mode of transmission is probably sexual but sexual transmission has been questioned on the basis that the disease is not very contagious . It is likely that a break in the skin or mucosa is necessary for the disease to become established . Lesions occur a few days to 3 months after inoculation in the form of 1 or more indurated papules which gradually break down to form ulcers . The ulceration may spread to the entire genitocrural area if untreated, but systemic disease is very rare . The diagnosis is usually suggested by the history and physical findings but confirmation can be obtained by smears of biopsy and histologic examination . The condition is responsive to a wide variety of antibiotics . Personal hygiene is the most effective means of prevention . Cancer, 1983 Mar 1, 51(5), 763 - 8 Multimodal treatment of locoregionally advanced breast cancer; Hortobagyi GN et al.; Fifty-two patients with locally advanced primary breast cancer (T3, T4/N2, N3) without distant metastases were treated with three cycles of combination chemotherapy consisting of 5-FU, Adriamycin and cyclophosphamide (FAC) and immunotherapy with Bacillus Calmette-Guerin (BCG) followed by local therapy (simple mastectomy and/or radiotherapy to breast/chest wall and regional lymphatics) and adjuvant chemotherapy to complete two years of treatment . Forty-nine of 52 (94%) patients were rendered free of clinically detectable disease . The median disease-free interval was 24 months . At a median follow-up time of 60 months, 40% of patients remained free of disease, off all therapy . Those patients who completed two years of therapy and started adjuvant chemotherapy promptly after local treatment had a 48% disease-free survival at five years . Local recurrences were observed in 21% of patients . Distant metastases developed in 40% of patients . Despite good tolerance, treatment compliance was poor . The complete remission rate with this multimodal approach is high and long-term disease-free survival is achieved in a considerable number of patients. Genetika, 1983 Mar, 19(3), 509 - 11 {Participation of temperate phages LP52 and BL20 in the control of bacitracin synthesis in Bacillus licheniformis}; Lukin AA et al.; The synthesis of the antibiotic bacitracin in lysogenic and nonlysogenic strains of Bacillus licheniformis 1001 and ATCC10716 has been studied . The antibiotic activity was shown to be about 20% less in lysogens, as compared to nonlysogens . However, the level of bacitracin production was completely restored when temperate bacteriophages BL20 and LP52 were reintroduced into the nonlysogenic strains by virtue of genetic transformation with DNA from lysogenic strains or by transduction with LP52 . This may indicate that both phages take part in control of the synthesis of bacitracin . For the time being, the mechanism of regulation is not known . It is likely to be either direct (provided that prophage DNA contains "bacitracin" genes), or indirect. Southeast Asian J Trop Med Public Health, 1983 Mar, 14(1), 101 - 5 A small scale field trial with Bacillus thuringiensis against culicine mosquitoes, Kelang, Malaysia; Rampal L et al.; Bacillus thuringiensis israeliensis (BTI) against culicine mosquitoes was tried out in cement sullage drains in Kelang municipal area at a dosage of 0.15 ppm . and 0.6 ppm . The results of the trial showed that at 0.15 ppm . the BTI was not effective, but at 0.6 ppm . it was effective giving about 95% kill . There was no residual effect and treatment had to be repeated weekly. Pathol Res Pract, 1983 Mar, 176(2-4), 103 - 14 Demonstration of T lymphocytes in leprous granuloma using the acid alpha naphtyl acetate esterase activity . An attempt at quantitative analysis; Gaulier A et al.; In nine leprosy patients (1 TT, 1 BT, 4 BL and 3 LLp), esterase positive lymphocytes (T Lymphocytes) were studied in frozen sections of skin biopsies by alpha naphtyl acetate esterase pH 5.8 method (ANAE) Four patients had never been treated previously and five patients exhibited clinical and bacteriological evidence of relapse for inadequate therapy at first biopsy . There was an increase in ANAE (+) lymphocyte density in granulomas when second biopsies were done after efficient treatment, evaluated by bacillary index for the eight bacilliferous patients, and clinical improvement . The significance of T cells in granulomas is discussed. Appl Environ Microbiol, 1983 Mar, 45(3), 942 - 9 Lactoferrin and transferrin fragments react with nitrite to form an inhibitor of Bacillus cereus spore outgrowth; Custer MC et al.; Tryptone is a pancreatic digest of casein which contains a heterogeneous mixture of substances that react with nitrite when heated in the presence of sodium thioglycolate to form a bacteriostatic agent which inhibits outgrowth of Bacillus cereus T spores . The substances which are precursors to the bacteriostatic agent can be fractionated on the basis of molecular size and charge and have properties which indicate that they are fragments of lactoferrin, an iron-binding glycoprotein . The bacteriostatic agent could also be formed directly from purified lactoferrin after it had been subjected to proteolysis . Transferrin, an analogous iron-binding protein found in animal serum, also showed these same properties . This system may be a useful model for studies of the mechanism and site of nitrite bacteriostatic action. Genetika, 1983 Mar, 19(3), 440 - 6 {Phenotypic expression of plasmid pPL7065 in Bacillus pumilus in free and integrated states}; Lukin AA et al.; There are about 20 copies of pPL7065 plasmid in cells of Bacillus pumilus ATCC7065 with molecular weight of 4.7 X 10(6) daltons . A spontaneous purine dependent mutant LK1 was isolated which contained no autonomous plasmid . However, the presence of the plasmid in LK1 cells was proved by DNA - DNA hybridization . To accomplish this, hybrid plasmid p1G1 was constructed by cloning pPL7065 on a vector pBR322 and multiplying it in Escherichia coli C600 . The plasmid then was hybridized with chromosomal DNA of Bac . pumilus LK1 . A pur+ revertant has been obtained from LK1 containing autonomous plasmid pPL7065, similar to the parental strain ATCC7065 . These results are indicative of pPL7065 integrated into the chromosome of LK1 . Bacteria having the autonomous plasmid are oligosporogeneous and produce specific antibiotics . Integration of the plasmid into bacteria causes pur phenotype, normal sporulation and a change in antibiotic synthesis and resistance . LK3 strain which lost pPL7065, sporulates normally and produces the antibiotic that inhibits growth of Bac . pumilus ATCC7065. Zh Mikrobiol Epidemiol Immunobiol, 1983 Mar, (3), 49 - 53 {Epidemiology of bacillary dysentery in Algeria . I . The epidemiological aspects of dysentery in Algeria}; Shkarin VV et al.; Bacterial dysentery plays an important role among infectious diseases in Algeria . A tendency to the growth of the morbidity rate has been observed . Dysentery is irregularly spread in different zones of the country . The highest morbidity rate is registered in the Sahara zone and in the eastern part of the country . The morbidity rate among the urban population is higher than among the rural population . S . flexneri prevail in the etiological structure of dysentery infection . Of all age groups, the highest morbidity rate is observed among children during the first 2 years of life . In recent years lethality varies between 2.9% and 7.5% . Patients are hospitalized mainly on the basis of clinical symptoms. Tubercle, 1983 Mar, 64(1), 1 - 13 Changes in BCG strains; Osborn TW; BCG originated from a virulent bovine strain of the tubercle bacillus after prolonged serial subculture on a potato medium . Since attenuation was achieved, the BCG strain has been distributed to a large number of centres where BCG vaccine is produced . Many of these production laboratories have maintained their BCG lines by continuing serial transfers, but have employed a variety of media for this purpose, and have produced BCG vaccine by a variety of techniques . Distinct differences have developed between some of the daughter strains of BCG, but the mechanism through which these changes have occurred has not been clear . In recent years methods have been developed which have enabled changes taking place within some BCG strains during experimental serial subculture to be monitored . In this survey the relationship of the changes observed to the different techniques employed for the maintenance of BCG lines and for the preparation of vaccine is considered . It is suggested that selection of minority populations within BCG strains noted during experimental studies may provide an analogy with the mechanism through which the original attenuation of the virulent bovine strain was brought about . The relevance of small-scale laboratory investigations to full-scale production procedures is also discussed, and finally some additional measures that might be taken to minimise changes in BCG strains are proposed.
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||