Journal of Bacteriology, January 2004, p . 90-97, Vol . 186, No . 1

Flavin Mononucleotide-Binding Flavoprotein Family in the Domain Archaea

Yan-Huai R . Ding and James G . Ferry^*

Department of Biochemistry and Molecular Biology, Eberly College of Science, The Pennsylvania State University, University Park, Pennsylvania 16802-4500

Received 6 May 2003/ Accepted 2 October 2003

 
The protein (AfpA, for archaeoflavoprotein) encoded by AF1518 in the genome of Archaeoglobus fulgidus was produced in Escherichia coli and characterized . AfpA was found to be a homodimer with a native molecular mass of 43 kDa and containing two noncovalently bound flavin mononucleotides (FMNs) . The cell extract of A . fulgidus catalyzed the CO-dependent reduction of AfpA that was stimulated by the addition of ferredoxin . Ferredoxin was found to be a direct electron donor to purified AfpA, whereas rubredoxin was unable to substitute . Neither NADH nor NADPH was an electron donor . Ferricyanide, 2,6-dichlorophenolindophenol, several quinones, ferric citrate, bovine cytochrome c, and O₂ accepted electrons from reduced AfpA, whereas coenzyme F₄₂₀ did not . The rate of cytochrome c reduction was enhanced in the presence of O₂ suggesting that superoxide is a product of the interaction of reduced AfpA with O₂ . Although AF1518 was previously annotated as encoding a decarboxylase involved in coenzyme A biosynthesis, the results establish that AfpA is an electron carrier protein with ferredoxin as the physiological electron donor . The genomes of several diverse Archaea contained afpA homologs clustered with open reading frames annotated as homologs of genes encoding reductases involved in the oxidative stress response of anaerobes from the domain Bacteria . A potential role for AfpA in coupling electron flow from ferredoxin to the putative reductases is discussed . A search of the databases suggests that AfpA is the prototype of a previously unrecognized flavoprotein family unique to the domain Archaea for which the name archaeoflavoprotein is proposed .

 
Archaeoglobus fulgidus strain VC-16 is a strictly anaerobic hyperthermophile that obtains energy for growth by oxidizing lactate and reducing sulfate to sulfide (28) . Archaeoglobus is the only known dissimilatory sulfate-reducing genus classified in the domain Archaea and is closely related to the methane-producing genus Methanosarcina in the order Methanosarcinales of the domain Archaea (1) . In A . fulgidus, lactate is oxidized to pyruvate and then acetyl-coenzyme A . The acetyl-coenzyme A is cleaved into methyl and carbonyl groups that are further oxidized to CO₂ involving enzymes and cofactors of energy-yielding pathways also operative in Methanosarcina species (21, 22) . CO-dehydrogenase/acetyl-coenzyme A synthase (CODH/ACS) cleaves acetyl-coenzyme A and oxidizes the carbonyl group to CO₂ during growth of A . fulgidus on lactate (22) and Methanosarcina species on acetate (13) . Ferredoxin is the electron acceptor for the CODH/ACS from both A . fulgidus (10) and Methanosarcina species (12) . Coenzyme F₄₂₀ is the electron acceptor for steps in oxidation of the methyl group of acetyl-coenzyme A to CO₂ in A . fulgidus except the last step, for which the electron acceptor is unknown .

Isf (for iron-sulfur flavoprotein) is an electron transfer protein first discovered in Methanosarcina thermophila and is the prototype of a family which includes homologs found in diverse anaerobic species representing all three domains (32) . A striking feature of the family is the almost universal occurrence, in individual species, of multiple isf homologs . The genomic sequence of A . fulgidus strain VC-16 reveals three isf homologs . The isf-2 (AF1519) homolog is one of three tightly clustered genes oriented in the same direction, consistent with an operon (32) . Remarkably, an isf homolog (MJ0731) in the genomic sequence of Methanocaldococcus jannaschii (Methanococcus jannaschii) is closely flanked by MJ0732 and MJ0730 with deduced sequences having 46 and 50% identity to the putative proteins encoded by AF1520 and AF1518 that flank isf-2 in A . fulgidus (32) . The M . jannaschii open reading frames (ORFs) MJ0732-MJ0731-MJ0730 are all oriented in the same direction . M . jannaschii is a methane-producing anaerobe from the order Methanococcales in the domain Archaea . The conserved arrangement of genes in A . fulgidus and M . jannaschii with corresponding high deduced sequence identity (AF1520-isf-AF1518 and MJ0732-isf-MJ0730) is consistent with related physiological functions among the gene products .

Here we present the properties of the AF1518 gene product (AfpA, archaeoflavoprotein) which show that AfpA is a flavin mononucleotide (FMN)-containing electron carrier protein linked to the CODH/ACS complex through ferredoxin . Furthermore, AfpA was shown to be the prototype of a previously unrecognized family of FMN-containing flavoproteins identified only in A . fulgidus and methane-producing species from the domain Archaea . A role for AfpA and the products of genes clustered with afpA in the oxidative stress response operons of members of the domain Archaea is discussed .

 
Materials. The 5- and 6-glutamylated homologs of coenzyme F₄₂₀ were a gift from Lacey Daniels, University of Iowa . 2-Hydroxyphenazine was a gift from Uwe Deppenmeier, Georg-August-Universität . A . fulgidus genomic DNA and Pyrococcus furiosus rubredoxin were gifts from Michael Adams and Francois Jenney, University of Georgia . All other enzymes and reagents were purchased from Sigma (St . Louis, Mo.) . A . fulgidus cells grown on lactate were a gift from Robert Kelly, North Carolina State University . M . jannaschii JAL-1 cells grown autotrophically were a gift from Biswarup Mukhopadhyay, Virginia Polytechnic Institute and State University . M . thermophila was grown with acetate as described (27) . Extracts of cells were prepared as described (32) .

Cloning, overexpression, purification, and reconstitution. The full-length AF1518 ORF was amplified by PCR from A . fulgidus genomic DNA with sense (ATGTTTGAAATGGAGGAAAAG) and antisense (AGATTTTCCGAAGTGTTTTC) primers (Integrated DNA Technologies, Coralville, Iowa) . The initial PCR product was amplified and cloned into the pETBlue-1 AccepTor vector (Novagen, Madison, Wis.) to generate the recombinant expression plasmid pET1518 . The AF1518 ORF contains rare codons; thus, pET1518 was transformed into Escherichia coli Rosetta (DE3)/pLacI competent cells (Novagen) for heterologous expression . The transformed cells were cultured at 37°C in Luria-Bertani broth containing 100 mg of ampicillin per liter . When the A₆₀₀ reached 0.6, the culture was induced to produce AfpA by the addition of 1 mM IPTG (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) for 16 h at 21°C . Cells were harvested by centrifugation and stored at -80°C .

All steps in the purification and reconstitution procedures were carried out anaerobically with general procedures as previously described (23) and at 21°C except where indicated . Where possible, an anaerobic chamber (Coy Laboratory Products, Ann Arbor, Mich.) was used . Thawed cells (30 g wet weight) were resuspended in 120 ml of 50 mM HEPES (pH 7.2) and lysed by passage twice through a French pressure cell at 110 MPa . Cell debris was removed by centrifugation at 74,400 x g for 20 min at 4°C, and the supernatant solution was heated at 70°C for 20 min . Denatured proteins were pelleted by centrifugation at 74,400 x g for 20 min at 4°C, and the supernatant solution filtered through a 0.4-µm filter . The filtrate was loaded onto a 5-ml cation exchange HiTrap SP column (Amersham Biosciences, Piscataway, N.J.) equilibrated with 50 mM HEPES (pH 7.2) . The column was developed with 100 ml of a 0.0 to 1.0 M NaCl linear gradient applied at 2 ml/min . The fractions showing a bright yellow color eluting between 0.2 and 0.25 M NaCl were pooled, concentrated at 4°C by ultrafiltration with a Microcon YM10 membrane (Millipore, Bedford, Mass.), and desalted with a PD-10 column (Amersham Biosciences AB, Uppsala, Sweden) . The purified AfpA was reconstituted with FMN as described previously (32) except that 50 mM HEPES (pH 7.2) was used .

Analyses. BLAST searches (4) were performed at www.ncbi.nlm.nih.gov and www.jgi.doe.gov/JGI_microbial/html/index.html . Annotations of finished genomes were obtained at www.tigr.org . Protein concentrations were determined with the bicinchoninic acid assay (26) with chymotrypsinogen A as the standard (Pierce, Rockford, Ill.) . The subunit molecular mass was estimated by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis (SDS-12% PAGE) (16) with low-molecular-weight protein standards (Sigma, St . Louis, Mo.) . The native molecular mass was determined by size exclusion chromatography with a calibrated Superose-12 gel filtration column (Amersham Biosciences, Piscataway, N.J.) developed with 50 mM HEPES (pH 7.0) containing 200 mM NaCl . The native molecular mass was also determined by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry with a PerSeptive Voyager DE-RP (PerSeptive BioSystems, Framingham, Mass.) instrument at the Pennsylvania State University Mass Spectrometry Center . The matrix was a saturated solution of -cyano-4-hydroxycinnamic acid in 50% (vol/vol) acetonitrile and 0.1% (vol/vol) trifluoroacetic acid .

The N-terminal amino acid sequence was determined with a model 477A protein sequencer (PE Biosystems, Inc., Foster City, Calif.) at the Macro Facility of the Pennsylvania State University Hershey Medical Center . The UV-visible absorbance spectra were recorded with a Beckman DU7400 diode array spectrophotometer equipped with a circulating water bath for temperature control . Flavin extraction, identification, and quantification were performed as described previously (17) .

Spectrophotometric assays. Reduced AfpA reacted rapidly with O₂ necessitating strict anaerobic conditions under an N₂ gas phase, except when O₂ was the electron acceptor . The oxidation of NADH or NADPH (₃₄₀ = 6220 M^-1 cm^-1) by AfpA was determined with either O₂ or K₃Fe(CN)₆ as the electron acceptor . The assay mixture (0.5 ml) contained 50 mM HEPES (pH 7.2, at 21°C and 70°C), 0.2 mM NADPH plus H⁺ or NADH plus H⁺, 0.25 mM K₃Fe(CN)₆ or air-saturated buffer . The reaction was initiated with 1.0 or 10.0 µg of AfpA .

The CO-dependent reduction of AfpA catalyzed by cell extracts was performed as described (17) with the following modifications . The reaction mixture (0.5 ml, 50°C) contained 200 µg of cell extract protein in 50 mM HEPES (pH 7.2) equilibrated with 1.0 atm of either CO or N₂ . Where indicated, ferredoxin from Clostridium pasteurianum was added to the A . fulgidus cell extract . The reaction was initiated by the addition of 200 µg of AfpA and monitored at 457 nm . Assays in which the headspace gas was N₂ showed no detectable reduction of AfpA . CO dehydrogenase activity was assayed as previously described (30) . A coupled enzyme assay was used to determine if ferredoxin or rubredoxin acted as electron donors to AfpA as previously described (9) with the following modifications . The reaction mixture (0.5 ml, 40°C) contained 20 µg of spinach ferredoxin-NADPH oxidoreductase, C . pasteurianum ferredoxin, or P . furiosus rubredoxin at the final concentrations indicated, and 0.2 mM NADPH plus H⁺ in 50 mM HEPES (pH 7.2) . The reaction was initiated by the addition of 200 µg of AfpA and monitored at 457 nm . No detectable reduction of AfpA occurred in the absence of ferredoxin or rubredoxin .

The ability of AfpA to donate electrons to electron carriers was determined by generating reduced AfpA in the ferredoxin-NADPH oxidoreductase-coupled assay as described above except that spinach ferredoxin was used in place of C . pasteurianum ferredoxin . The reaction mixture was heated at 80°C for 5 min to inactivate ferredoxin and ferredoxin-NADPH oxidoreductase . The reaction was initiated by addition of the electron carrier and monitored by following the oxidation of reduced AfpA at 457 nm for each carrier except 2,6-dichlorophenolindophenol (₆₀₀ = 20.0 mM^-1 cm^-1) and cytochrome c (₅₅₀ = 22.6 mM^-1 cm^-1), for which reduction was monitored at 600 and 550 nm, respectively . The assays were determined at 70°C except for the reduction of cytochrome c, which was assayed at 21°C .

 
Analysis of sequences with identity to AfpA. For reasons described below, we propose afpA (archaeoflavoprotein) as the gene designation for AF1518 . A BLAST search of all nonredundant databases, which included finished and unfinished genomes, was conducted with the entire amino acid sequence deduced from afpA as the query . Figure 1A shows alignments of AfpA with the first five sequences having the highest identity to AfpA that were returned by the BLAST search . The total residues for each of the sequences closely approximated that for AfpA and ranged from 44 to 54% identity to AfpA . A total of 50 residues were identified that are strictly conserved and uniformly distributed in all the sequences . The five sequences returned by the BLAST search were annotated as either a conserved protein, a hypothetical protein, or an unspecified flavoprotein . Except for the six sequences shown in Fig . 1B, none of the remaining 94 sequences returned by the search had greater than 20% overall identity with AfpA .

 
The AF1518 ORF is annotated as encoding both a conserved hypothetical protein and a homolog of dfp encoding an enzyme (DNA-pantothenate flavoprotein) in the pathway of coenzyme A biosynthesis catalyzing the decarboxylation of 4'-phosphopantothenate to 4'-phosphopantotheine (14) . The BLAST search showed the deduced sequence of AF1518 with significant identity to regions in the N-terminal domains of Dfp enzymes; however, Dfp is typically greater than 400 residues in length compared to the 192 residues for AfpA . Indeed, AF1645 of A . fulgidus is annotated as Dfp and the deduced sequence is 404 residues, consistent with a valid annotation for AF1645 and an invalid annotation for AF1518 . Furthermore, absent from the sequences in Fig . 1A is the catalytically essential motif (PXMNXXMW) and the substrate recognition clamp motif (P/TX₆C/G/EX₃G/AXG) present in the N-terminal domain of Dfp and other enzymes in the homo-oligomeric flavin-containing cysteine decarboxylase (HFCD) superfamily (14) . On the other hand, the sequences in Fig . 1A all have the distinctive motifs (bold residues) which bind FMN in the HFCD superfamily (6) . The FMN binding site in the HFCD superfamily is unique among flavoproteins in that the flavin is sandwiched between subunits and the re side of the isoalloxazine ring is exposed to solvent (3, 6) . This novel FMN binding site is a prominent feature which distinguishes the HFCD superfamily from other flavoproteins; thus, sequence analyses of the AfpA homologs are consistent with only a structural relationship to the HFCD superfamily .

In summary, the above results establish that the putative proteins in Fig . 1A represent a previously unrecognized flavoprotein family . Homologs of afpA were identified in all the genomic sequences available for methane-producing species in the domain Archaea except for Methanopyrus kandleri AV19 . With the exception of A . fulgidus, no afpA homologs were identified in any of the genomic sequences available for all other species in the domain Archaea or species in the domain Bacteria . Thus, afpA homologs were only found in the available genomes of anaerobic species from the domain Archaea except for one methanogen (M . kandleri) and all the nonmethanogenic species (P . furiosus, "Pyrococcus abyssi," Pyrococcus horikoshi, and Pyrobaculum aerophilum) .

Figure 1B shows the next six sequences with the greatest identity to AfpA that were returned by the BLAST search . These sequences were found to share between 28 and 37% overall identity with AfpA and to share the same features described above for AfpA except for an insert of 52 to 56 residues containing two CX₂CX₂CX_3-5CP sequences characteristic of 4Fe-4S binding motifs (5) . All of the returned sequences in Fig . 1B were annotated as either a hypothetical protein or an unspecified flavoprotein . Except for the sequences in Fig . 1A, none of the remaining 93 deduced sequences returned by the BLAST search had greater than 20% overall identity . These results are consistent with the sequences in Fig . 1B belonging to yet another previously unrecognized group related to AfpA that also appears to be restricted to A . fulgidus and methane-producing species in the domain Archaea .

Organization of afpA homologs. The afpA gene (AF1518) and flanking ORFs, one of which is an isf homolog (AF1519), were found in close proximity and oriented in the same direction (Fig . 2); indeed, the ORFs overlap by 3 and 7 bp . Although not overlapping, homologs of AF1518 and AF1520 were found to be in close proximity and have the same arrangement and orientation (Fig . 2) in the methane-producing archaeon M . jannaschii, presenting the possibility that the gene products have related functions . ORFs AF1520 and MJ0732 are annotated as putative homologs of fprA, which encodes a flavoprotein from Methanothermobacter thermoautotrophicus (Methanobacterium thermoautotrophicum) that is hypothesized to have a role in oxidative stress (31) .

 
Recently, it was shown that the deduced sequences of AF1520 and MJ0732 cluster with the hemoflavoprotein rubredoxin-oxygen oxidoreductase from Desulfovibrio gigas in a phylogenetic tree of rubredoxin-oxygen oxidoreductase orthologs (25) . Rubredoxin-oxygen oxidoreductase is the terminal oxidase of a soluble electron transport chain coupling NADH oxidation and the reduction of O₂ to water (8), a postulated mechanism for O₂ detoxification (15, 25) .

Other ORFs clustered with afpA in M . jannaschii are annotated as homologs of genes encoding proteins involved in the oxidative stress response of other microbes (Fig . 2) . Rubredoxin, encoded by rd, is the direct electron donor to rubredoxin-oxygen oxidoreductase in D . gigas (7) . The ahp gene in E . coli encodes alkyl hydroperoxide reductase, which is the primary scavenger of endogenous hydrogen peroxide, reducing it to water (24) . Rubrerythrin from Desulfovibrio vulgaris, encoded by rr, also reduces hydrogen peroxide to water (18) . Homologs of isf were found adjacent to afpA homologs in the genomes of Methanosarcina acetivorans and Methanosarcina mazei with arrangements and orientations identical to those in A . fulgidus and M . jannaschii (Fig . 2) . Furthermore, the isf and afpA homologs in the Methanosarcina species clustered with at least one ORF annotated as the putative homolog of a gene encoding an enzyme that functions in the oxidative stress response of other anaerobes . ORFs clustered with afpA in both Methanosarcina species are annotated as dfx which encodes desulfoferrodoxin from Desulfovibrio species that is a two-iron superoxide reductase producing hydrogen peroxide and is proposed to function in the oxidative stress response of anaerobes (2) (15) .

Although not clustered with the afpA homolog (MTH0697) of M . thermoautotrophicus (Fig . 1A), the genome is annotated with homologs of isf (MTH1670 and MTH0122) fprA (MTH1350, MTH0220, and MTH0157) and dfx (MTH0795) . The M . mazei genome is also annotated with three fprA homologs (MM0891, MM0893, and MM4466), although remote from the afpA homolog (MM0635) . Finally, the genomes of A . fulgidus and M . jannaschii are annotated with dfx (AF0833 and MJ0741) although they are not clustered with afpA homologs (AF1518 and MJ0730) identified in the respective species . Thus, all the sequenced genomes identified with afpA homologs also contain ORFs annotated as dfx and fprA .

Heterologous production, purification, and characterization of AfpA. None of the putative gene products in Fig . 1A or Fig. 1B have been purified and characterized . AfpA produced in E . coli was purified to apparent homogeneity as determined by SDS-PAGE (Fig . 3) . SDS-PAGE indicated a subunit molecular mass of approximately 23 kDa, in close agreement with the value (21.6 kDa) predicted by the deduced sequence . N-terminal sequencing of the first five residues confirmed that the protein was encoded by AF1518 . Native gel filtration chromatography yielded a single peak corresponding to 48 kDa, which approximated the value (43.12 kDa) obtained for the native protein by mass spectrometry and indicates that AfpA is a homodimer (data not shown) .

 
The UV-visible spectrum of the purified protein showed absorbance maxima at 272, 379, and 457 with a pronounced shoulder at 480 nm, indicative of a flavin cofactor (Fig . 4) . Exposure to air for 1 h had no effect on the spectrum (data not shown), indicating that the flavin cofactor was completely oxidized in the purified protein . After trichloroacetic acid extraction, the flavin was identified as FMN by HPLC analysis (data not shown) . The FMN content was found to be 0.8 mol per mol of dimer before reconstitution with FMN and 1.7 mol per mol of dimer after reconstitution, suggesting two noncovalently bound FMN per dimer . Addition of dithionite decreased the absorbance at wavelengths between 300 to 525 nm (Fig. 4) that was completely reversed on exposure to air (not shown) . These results show that AfpA is an FMN-containing redox protein . No absorbance was detected at wavelengths above 525 nm during reduction and reoxidation, suggesting that the flavin semiquinone is not stabilized by the protein environment . The molar absorption coefficients for the FMN-reconstituted homodimer at 457 and 375 nm were determined to be 20.8 and 17.3 mM^-1 cm^-1, respectively . The BLAST search results suggest that AfpA is the prototype of a previously unrecognized family in the domain Archaea for which we propose the name archaeoflavoprotein based on the biochemical analyses .

 
Neither NADH nor NADPH was a direct electron donor for AfpA . Ferredoxin-NADPH oxidoreductase coupled the oxidation of NADPH and reduction of AfpA which was strictly dependent on the presence of ferredoxin (Fig . 5), indicating that ferredoxin is a direct electron donor to AfpA . Rubredoxin was unable to substitute for ferredoxin . Cell extract from lactate-grown A . fulgidus catalyzed the CO-dependent reduction of AfpA (Table 1), and the rate was enhanced by the addition of up to 4 µM ferredoxin (Fig . 6) . These results establish that AfpA functions as an electron carrier with ferredoxin as the physiological electron donor .

 
Several compounds were tested as electron acceptors for AfpA by the addition to reaction mixtures containing 18 µM of reduced AfpA and spectrophotometrically monitoring either the oxidation of reduced AfpA or reduction of electron acceptor (data not shown) . Reduced AfpA was not oxidized by F₄₂₀ (50 µM) . Reduced AfpA was fully oxidized by the following electron acceptors (5 and 20 µM) in less than 5 s, which precluded an estimation of rates: 2,3-dimethyl-1,4-naphthoquinone; 2,3-dimethoxy-5-methyl-1,4-benzoquinone; 2-methyl-1,4-naphthoquinone (menadione); 2-hydroxyphenazine; and K₃Fe(CN)_6. The addition of air-saturated buffer (260 µM O₂, final concentration) fully oxidized 9 µM reduced AfpA in less than 5 s, also precluding an estimation of the rate . Reduced AfpA was oxidized by ferric citrate (500 µM) at a rate of 22.2 ± 5.2 µM per min . Cytochrome c (40 µM) and 2,6-dichlorophenolindophenol (40 µM) were reduced at rates of 87 ± 11 µM and 191 ± 47 µM per min, respectively . However, the simultaneous addition of 20 µM cytochrome c and 260 µM O₂ to 9 µM reduced AfpA produced a total of 18.5 ± 1.2 µM reduced cytochrome c within 5 s, after which no additional reduction was observed . The accelerated rate of cytochrome c reduction in the presence of O₂ precluded a rate determination; nonetheless, the results indicate a rate of at least 222 µM cytochrome c per min, which was more than twofold greater than in the absence of O₂ .

These results suggest that superoxide is at least one of the products of O₂ reduction by reduced AfpA and that the superoxide rapidly reduced cytochrome c as described for several flavoproteins (19) . The same experiment, except with 20 units of superoxide dismutase added per ml, produced 9.5 µM reduced cytochrome c within 5 s, after which no further reduction was observed . This result is consistent with the depletion of superoxide available for reduction of cytochrome c catalyzed by the dismutase, which further supports that superoxide is a product of the interaction of O₂ with reduced AfpA .

 
The results presented here establish that AF1518 encodes an FMN-containing electron carrier protein (AfpA) with a distinctive FMN-binding motif . The AF1518 ORF was originally annotated as encoding a putative Dfp enzyme . Dfp catalyzes the synthesis of the coenzyme A precursor 4'-phosphopantothenate and is a member of the HFCD superfamily (14) . Although sequence analyses indicates that AfpA is related to the HFCD superfamily, the absence of essential motifs indicates that AfpA is not Dfp . Furthermore, the length of AfpA is approximately one-half that of Dfp enzymes, and AfpA is a homodimer, whereas Dfp enzymes are homotrimers (14) . Although the cofactor content and size of AfpA are consistent with the properties of a flavodoxin, AfpA clearly is not a flavodoxin . Flavodoxin was not included in the 100 sequences returned by the BLAST search, and AfpA has an FMN binding motif distinct from that of the flavodoxins . Furthermore, flavodoxins are usually monomeric, whereas AfpA is a homodimer .

AfpA is also not a member of the A-type flavoprotein family . The A-type flavoprotein family, with members in both the Archaea and Bacteria domains, consists of protein sequences (385 to 597 residues) that are greater than twice the length of AfpA and contain signature flavodoxin FMN-binding motifs (31) . Moreover, none of the sequences returned by the BLAST search contained members of the A-type flavoprotein family . These results indicate that AfpA is the prototype of a previously unrecognized family of FMN-containing flavoproteins for which the name archaeoflavoprotein is proposed .

The database search also returned a group of deduced sequences with significant identity to AfpA, including the distinctive FMN-binding motif, except for inserts of 52 to 56 residues containing Cys motifs with the potential to ligate two 4Fe-4S clusters (5) . Although biochemical characterization is necessary to draw conclusions, these results are at least consistent with a previously unrecognized family of iron-sulfur flavoproteins related to the archaeoflavoprotein family .

The AF1518 ORF was annotated as an enzyme in the pathway of coenzyme A biosynthesis; however, the results presented here clearly establish a physiological role for the gene product (AfpA) as an electron carrier . Moreover, the results establish a physiological role for AfpA in an electron transport chain in A . fulgidus for which electrons originating from the CODH/ACS complex are transferred to AfpA mediated by ferredoxin . This role is supported by the results showing that ferredoxin is the direct electron donor to AfpA, and cell extracts of lactate-grown A . fulgidus catalyze the CO-dependent reduction of AfpA that is stimulated by the addition of ferredoxin . During growth of A . fulgidus with lactate, the CODH/ACS complex oxidizes the carbonyl group of acetyl-coenzyme A, reducing ferredoxin (10), and also oxidizes CO, which substitutes for the carbonyl group .

The results presented here further suggest that the electron transport chain demonstrated for A . fulgidus is also operable in acetate-grown Methanosarcina species . Extracts of acetate-grown M . thermophila which contain the CODH/ACS complex (30) were shown to catalyze the CO-dependent reduction of AfpA . Furthermore, it is reported (29) that the CODH/ACS complex from M . thermophila oxidizes CO and reduces ferredoxin . Finally, the CODH/ACS complex is downregulated during growth of M . thermophila on methanol and trimethylamine (30); thus, the inability of extracts from cells grown on these substrates to catalyze the CO-dependent reduction of AfpA is consistent with a role for the CODH/ACS complex in the proposed electron transport chain .

Electrons from the oxidation of lactate by A . fulgidus are transferred to a membrane-bound electron transport chain with sulfate as the terminal electron acceptor, generating a proton gradient which drives ATP synthesis . The inventory electron carriers involved are incompletely understood; thus, it would appear that AfpA could have an electron transfer role in energy generation . However, afpA homologs were identified in M . thermoautotrophicus and M . jannaschii, for which the CODH/ACS complex is not a component of energy-yielding pathways (11) . Furthermore, although cytochrome c and quinones were found to be electron acceptors for AfpA, these electron carriers are not present in M . thermoautotrophicus and M . jannaschii; thus, the physiological significance of these electron acceptors for AfpA is questionable .

Remarkably, homologs of afpA were found only in anaerobic species from the domain Archaea, consistent with an electron transport role in a more general process common to these anaerobic species . Indeed, afpA in the genome of A . fulgidus and the genomes of metabolically diverse methanogenic Archaea are clustered with ORFs annotated as encoding enzymes and proteins known to be involved in the oxidative stress response of anaerobes from the domain Bacteria . One potential function for AfpA is the reduction of O₂ to less reactive products, which appears to be the preferred approach to the oxidative stress response in anaerobes (2, 15); however, the results presented here suggest that superoxide is a product of the interaction of AfpA with O₂ which argues against a role in reduction of O₂ . Nonetheless, the annotated oxidative stress genes dfx and fprA clustered with afpA are putative reductases; thus, a more plausible function for AfpA is that during oxidative stress of A . fulgidus, electrons derived from oxidation of the carboxyl group of acetyl-coenzyme A by CODH/ACS are diverted from ferredoxin to AfpA, which participates in electron transport to the reductases .

The clustering of afpA with ORFs annotated as dfx or fprA in methanogenic species implies the same role for AfpA in supplying electrons to the putative reductases in these species . Although the ferredoxin-dependent CODH/ACS complex is not a component in the pathways for conversion of methanol or trimethylamine to methane in Methanosarcina species, the final step in the oxidative branch of the pathways generates reduced ferredoxin (20), affording a potential role for AfpA to participate in supplying electrons to the putative reductases during growth on these substrates . Reduced ferredoxin is also generated by the Ech hydrogenase complex in the first step of the CO₂ reduction pathway for methanogenesis in M . thermoautotrophicus and M . jannaschii (20), supporting a potential role for AfpA in electron transport to the putative reductases of these species .

Thus, all of the species for which afpA homologs have been identified also have mechanisms for generating reduced ferredoxin, consistent with the proposed function for AfpA in coupling the transfer of electrons from ferredoxin to reductases involved in the oxidative stress response . Furthermore, the genomes of all the species in which afpA homologs were identified also have annotations for both dfx and fprA, which is also consistent with an electron transport role for AfpA in the oxidative stress response . Finally, the finding that isf homologs are directly adjacent to afpA in A . fulgidus and several methanogenic species implies electron transport roles for both Isf and AfpA .

The results presented here suggest that AfpA is confined to a subset of anaerobes in the domain Archaea which is unexplained; however, one consideration is that the putative reductases, AfpA, and other components of an oxidative stress response metabolon coevolved with a high degree of specificity in the last common ancestor to the methanogenic Archaea and Archaeoglobus species, which have a close phylogenetic and metabolic relationship with the methanogenic Archaea (21) . Indeed, the genomes of species of anaerobic Archaea in which afpA homologs were not found (M . kandleri, P . furiosus, "P . abyssi," P . horikoshi, and P . aerophilum) are also without annotations for dfx or fprA, the only exception being "P . abyssi."

Conclusions. The incorrect annotation of AF1518 in A . fulgidus has been rectified and it has been shown that the ORF encodes an electron carrier protein (AfpA) with a distinctive FMN-binding motif . A physiological role for AfpA in A . fulgidus has been established by showing that it is linked to the CODH/ACS complex by ferredoxin . Furthermore, genomic analyses imply a broader physiological role for AfpA in responding to oxidative stress . Finally, the results show that AfpA is the prototype of a novel family of flavoproteins, for which the name archaeoflavoprotein is proposed, that appears to be confined to A . fulgidus and methane-producing species from the domain Archaea .

 
We thank Frank Cruz for assistance in determination of FMN content and Andrea Gorrell for assistance in generation of the figures .

This work was supported by DOE grant DE-FG02-95ER20198 and NASA-Ames Cooperative Agreement NCC2-1057 to the Pennsylvania State University Astrobiology Research Center .

 
* Corresponding author . Mailing address: Department of Biochemistry and Molecular Biology, Eberly College of Science, The Pennsylvania State University, 205 South Frear Laboratory, University Park, PA 16802-4500 . Phone: (814) 863-5721 . Fax: (814) 863-6217 . E-mail: jgf3@psu.edu .

1. Achenbach-Richter, L., K . O . Stetter, and C . R . Woese. 1987 . A possible biochemical missing link among archaebacteria . Nature 327:348-349.
2. Adams, M . W., F . E . Jenney, Jr., M . D . Clay, and M . K . Johnson. 2002 . Superoxide reductase: fact or fiction? J . Biol . Inorg . Chem . 7:647-652.
3. Albert, A., M . Martinez-Ripoll, A . Espinosa-Ruiz, L . Yenush, F . A . Culianez-Macia, and R . Serrano. 2000 . The X-ray structure of the FMN-binding protein AtHal3 provides the structural basis for the activity of a regulatory subunit involved in signal transduction . Structure Fold . Des . 8:961-969.
4. Altschul, S . F., T . L . Madden, A . A . Schaffer, J . Zhang, Z . Zhang, W . Miller, and D . J . Lipman. 1997 . Gapped BLAST and PSI-BLAST: a new generation of protein database search programs . Nucleic Acids Res . 25:3389-3402 .
5. Beinert, H., R . H . Holm, and E . Munck. 1997 . Iron-sulfur clusters: nature's modular, multipurpose structures . Science 277:653-659 .
6. Blaesse, M., T . Kupke, R . Huber, and S . Steinbacher. 2000 . Crystal structure of the peptidyl-cysteine decarboxylase EpiD complexed with a pentapeptide substrate . EMBO J . 19:6299-6310 .
7. Chen, L., M . Y . Liu, J . Legall, P . Fareleira, H . Santos, and A . V . Xavier. 1993 . Purification and characterization of an NADH-rubredoxin oxidoreductase involved in the utilization of oxygen by Desulfovibrio gigas . Eur . J . Biochem . 216:443-448.
8. Chen, L., M . Y . Liu, J . LeGall, P . Fareleira, H . Santos, and A . V . Xavier. 1993 . Rubredoxin oxidase, a new flavo-hemo-protein, is the site of oxygen reduction to water by the "strict anaerobe" Desulfovibrio gigas . Biochem . Biophys . Res . Commun . 193:100-105.
9. Coulter, E . D., and D . M . Kurtz, Jr. 2001 . A role for rubredoxin in oxidative stress protection in Desulfovibrio vulgaris: catalytic electron transfer to rubrerythrin and two-iron superoxide reductase . Arch . Biochem . Biophys . 394:76-86.
10. Dai, Y . R., D . W . Reed, J . H . Millstein, P . L . Hartzell, D . A . Grahame, and E . DeMoll. 1998 . Acetyl-coenzyme A decarbonylase/synthase complex from Archaeoglobus fulgidus . Arch . Microbiol . 169:525-529.
11. Deppenmeier, U., V . Muller, and G . Gottschalk. 1996 . Pathways of energy conservation in methanogenic archaea . Arch . Microbiol . 165:149-163.
12. Ferry, J . G. 1995 . CO dehydrogenase . Annu . Rev . Microbiol . 49:305-333.
13. Ferry, J . G. 1997 . Enzymology of the fermentation of acetate to methane by Methanosarcina thermophila . BioFactors 6:25-35.
14. Kupke, T. 2001 . Molecular characterization of the 4'-phosphopantothenoylcysteine decarboxylase domain of bacterial Dfp flavoproteins . J . Biol . Chem . 276:27597-27604 .
15. Kurtz, D . M. 2003 . Oxygen and anaerobes, p . 128-142 . In L . G . Ljungdahl, M . W . Adams, L . L . Barton, J . G . Ferry, and M . K . Johnson (ed.), Biochemistry and physiology of anaerobic bacteria . Springer-Verlag, New York, N.Y.
16. Laemmli, U . K. 1970 . Cleavage of structural proteins during the assembly of the head of bacteriophage T4 . Nature 227:680-685.
17. Latimer, M . T., M . H . Painter, and J . G . Ferry. 1996 . Characterization of an iron-sulfur flavoprotein from Methanosarcina thermophila . J . Biol . Chem . 271:24023-24028 .
18. Lumppio, H . L., N . V . Shenvi, A . O . Summers, G . Voordouw, and D . M . Kurtz. 2001 . Rubrerythrin and rubredoxin oxidoreductase in Desulfovibrio vulgaris: a novel oxidative stress protection system . J . Bacteriol . 183:101-108 .
19. Massey, V., S . Strickland, S . G . Mayhew, L . G . Howell, P . C . Engel, R . G . Matthews, M . Schuman, and P . A . Sullivan. 1969 . The production of superoxide anion radicals in the reaction of reduced flavins and flavoproteins with molecular oxygen . Biochem . Biophys . Res . Commun . 36:891-897.
20. Meuer, J., H . C . Kuettner, J . K . Zhang, R . Hedderich, and W . W . Metcalf. 2002 . Genetic analysis of the archaeon Methanosarcina barkeri Fusaro reveals a central role for Ech hydrogenase and ferredoxin in methanogenesis and carbon fixation Proc . Natl . Acad . Sci . 99:5632-5637 .
21. Moller-Zinkhan, D., G . Borner, and R . K . Thauer. 1989 . Function of methanofuran, tetrahydromethanopterin, and coenzyme-F₄₂₀ in Archaeoglobus fulgidus . Arch . Microbiol . 152:362-368.
22. Moller-Zinkhan, D., and R . K . Thauer. 1990 . Anaerobic lactate oxidation to 3 CO₂ by Archaeoglobus fulgidus via the carbon monoxide dehydrogenase pathway . Demonstration of the acetyl-coenzyme A carbon-carbon cleavage reaction in cell extracts . Arch . Microbiol . 153:215-218.
23. Schauer, N . L., and J . G . Ferry. 1980 . Metabolism of formate in Methanobacterium formicicum . J . Bacteriol . 142:800-807.
24. Seaver, L . C., and J . A . Imlay. 2001 . Alkyl hydroperoxide reductase is the primary scavenger of endogenous hydrogen peroxide in Escherichia coli . J . Bacteriol . 183:7173-7181 .
25. Silva, G., S . Oliveira, J . LeGall, A . V . Xavier, and C . Rodrigues-Pousada. 2001 . Analysis of the Desulfovibrio gigas transcriptional unit containing rubredoxin (rd) and rubredoxin-oxygen oxidoreductase (roo) genes and upstream ORFs . Biochem . Biophys . Res . Commun. 280:491-502.
26. Smith, P . K., R . I . Krohn, G . T . Hermanson, A . K . Mallia, F . H . Gartner, M . D . Provenzano, E . K . Fujimoto, N . M . Goeke, B . J . Olson, and D . C . Klenk. 1985 . Measurement of protein with bicinchoninic acid . Anal . Biochem . 150:76-85.
27. Sowers, K . R., M . J . K . Nelson, and J . G . Ferry. 1984 . Growth of acetotrophic, methane-producing bacteria in a pH auxostat . Curr . Microbiol . 11:227-230.
28. Stetter, K . O., G . Lauerer, M . Thomm, and A . Neuner. 1987 . Isolation of extremely thermophilic sulfate reducers: evidence for a novel branch of archaebacteria . Science 236:822-823.
29. Terlesky, K . C., and J . G . Ferry. 1988 . Ferredoxin requirement for electron transport from the carbon monoxide dehydrogenase complex to a membrane-bound hydrogenase in acetate-grown Methanosarcina thermophila . J . Biol . Chem . 263:4075-4079 .
30. Terlesky, K . C., M . J . K . Nelson, and J . G . Ferry. 1986 . Isolation of an enzyme complex with carbon monoxide dehydrogenase activity containing a corrinoid and nickel from acetate-grown Methanosarcina thermophila . J . Bacteriol . 168:1053-1058.
31. Wasserfallen, A., S . Ragettli, Y . Jouanneau, and T . Leisinger. 1998 . A family of flavoproteins in the domains Archaea and Bacteria . Eur . J . Biochem . 254:325-332.
32. Zhao, T., F . Cruz, and J . G . Ferry. 2001 . Iron-sulfur flavoprotein (Isf) from Methanosarcina thermophila is the prototype of a widely distributed family . J . Bacteriol . 183:6225-6233 .

Free Online Full-text Article

What Is Bioassay?, What Is Antibiotic?, What Is Bioreactor?, What Is Amino Acid?, What Is Biotechnology?, c, Bacteriology, a, Bacterium, s, Microorganisms, s, Microorganism, e, Microbes, o, S. cerevisiae, i, Vibriosis, o, Escherichia coli, e, Staphylococcus, a, Fermentations, a, S. cerevisiae, a, Streptococcal, i, Fermentations, s, Prokaryotes, o, Bacillus, a, Staphylococcus aureus, c, Microbial, i, Escherichia coli, n, Aeromonades, n, Escherichia coli, e, Biodegradation, c, Microorganisms, c, Culture medium, s, Culture medium, i, Corynebacter, o, Escherichia coli




 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005