Journal of Bacteriology, January 2004, p . 179-191, Vol . 186, No . 1

Fine-Tuning in Regulation of Clp Protein Content in Bacillus subtilis

Ulf Gerth,^1* Janine Kirstein,¹ Jörg Mostertz,¹ Torsten Waldminghaus,² Marcus Miethke,¹ Holger Kock,¹ and Michael Hecker¹

Institut für Mikrobiologie, Ernst-Moritz-Arndt-Universität, D-17487 Greifswald,¹ Abteilung Immunologie, Max-Planck-Institut für Infektionsbiologie, D-10117 Berlin, Germany²

Received 7 July 2003/ Accepted 3 October 2003

 
Clp-controlled proteolysis in Bacillus subtilis seems to play a substantial role, particularly under stress conditions . Calibrated Western blot analyses were used to estimate the approximate numbers of heat-inducible Clp molecules within a single cell . According to these numbers, the different Clp ATPases do not seem to compete for the proteolytic subunit ClpP . Coimmunoprecipitation experiments revealed the predicted specific ClpX-ClpP, ClpC-ClpP, and ClpE-ClpP interactions . ClpE and ClpX are rapidly degraded in wild-type cells during permanent heat stress but remained almost stable in a clpP mutant, suggesting ClpP-dependent degradation . In particular, ClpCP appeared to be involved in the degradation of the short-lived ClpE ATPase, indicating a negative "autoregulatory" circuit for this particular Clp ATPase at the posttranslational level . Analysis of the half-life of stress-inducible clp mRNAs during exponential growth and heat shock revealed precise regulation of the synthesis of each Clp protein at the posttranscriptional level as well to meet the needs of B . subtilis .

 
Generally, Clp proteins form large hetero-oligomeric complexes consisting of an ATPase component and a proteolytic component . The ATPase subunits prove the protein quality and act either as molecular chaperones for multimeric and misfolded proteins or, in cooperation with the corresponding proteolytic component, as proteases to degrade proteins (10, 11, 37, 43) . Bacillus subtilis possesses four different Clp ATPases—ClpC, ClpE, ClpX, and ClpY—all belonging to the HSP100 family . It is thought that these proteins recognize different substrates within the cell and that they deliver partially unfolded substrates to the corresponding proteolytic component (ClpP or ClpQ) for degradation (10) .

ATP-dependent proteolysis mediated by Clp proteases is very important for B . subtilis during stress and cell division and for general stationary-phase phenomena, such as exoenzyme synthesis, motility, competence development, and sporulation (8, 20, 21, 25, 26, 31, 41) . The proteolysis of ComK, the activator of the competence genes, depends on ClpCP (41) . The degradation of SpoIIAB, the anti-sigma factor of sporulation sigma factor ^F, also is mediated by ClpCP (31) . Mutations in clpP and in clpX are very pleiotropic in B . subtilis . ClpX and ClpP are required for the activation of the srf operon, encoding surfactin synthetase, and the regulatory peptide ComS, involved in competence development (26) . The spx (formerly yjbD) gene was identified as a site of mutations that suppress defects in competence conferred by clpP and clpX mutations (27) . Recently, Spx was described as a transcriptional regulator that inhibits activator-stimulated transcription (e.g., ComA or ResD) through interactions with the subunit of RNA polymerase (28) . ComA- and ResD-stimulated transcription requires the proteolytic elimination of Spx by ClpXP (28) . Furthermore, ClpXP regulates the signal peptide cleavage of secretory preproteins in B . subtilis (33) .

ClpC, ClpP, and ClpX are essential for growth at high temperatures (8, 18, 24, 25), whereas no obvious phenotype has been observed for a clpE mutant (5) . Immunogold labeling and radiolabeling experiments showed that ClpCP and ClpXP are directly involved in the degradation of misfolded proteins after heat shock or puromycin treatment (20) .

Regulation of the stress-inducible clpE, clpC, and clpP genes was found to be dependent predominantly on the transcriptional repressor, CtsR, encoded by the first gene of the clpC operon (4, 19) . However, an additional regulatory mechanism(s) must exist for clpP and clpC, because clpP and clpC are not completely derepressed in a ctsR mutant background at 37°C, in contrast to clpE (4, 21) .

The expression of the ctsR regulon is not controlled solely at the transcriptional level but also is achieved through modulation of the stability of CtsR . According to Derre et al . (6), ClpXP-dependent degradation of CtsR occurred in vivo at 37°C, and ClpCP has been implicated in CtsR degradation after heat-simulating puromycin treatment (21) . In contrast, heat shock induction of the clpX gene has not been explored in detail yet (7) . Complex formation between the different ATPases and their corresponding protease partners may be critically dependent on the intracellular concentrations of the partners and their potential interactions . We thus used a quantitative Western blot approach to estimate the concentrations of the Clp proteins and their interactions both before and after the imposition of heat stress . Here, we present evidence that the numbers of Clp proteins in B . subtilis are regulated precisely at the transcriptional, posttranscriptional, and posttranslational levels .

 
Bacterial strains and culture conditions. The bacterial strains and plasmids used in this study are listed in Table 1. Escherichia coli and B . subtilis cells were cultivated routinely under agitation at 37°C in Luria-Bertani (LB) medium . For heat stress experiments, the B . subtilis culture was divided during exponential growth (optical density at 540 nm [OD₅₄₀], 0.4); one half was kept growing at 37°C (control), and the other half was exposed to heat stress for different times (50°C) . Glucose starvation was accomplished by cultivating B . subtilis in synthetic medium with limiting amounts of glucose (0.05% [wt/vol]) (40) . Media were supplemented with the following antibiotics when necessary: ampicillin (100 µg/ml), chloramphenicol [5 µg/ml for B . subtilis and 25 µg/ml for E . coli BL21(DE3)pLysS], erythromycin (2 µg/ml), lincomycin (25 µg/ml), spectinomycin (200 µg/ml), tetracycline (17 µg/ml), and kanamycin (10 µg/ml) .

 
For determination of the in vivo stability of ClpX, ClpE, and ClpC during permanent heat stress, puromycin (60 µg/ml) was added to the cultures after 30 min at 50°C in order to stop translation, and samples were taken at various times . The stabilities of clpP, clpX, clpE, and clpC mRNAs were determined by using rifampin (100 µg/ml) to stop transcription in exponentially growing cell cultures (OD₅₄₀, 0.3; 37°C), and for heat-shocked cells (5 min at 50°C), samples were taken at various times .

General methods. DNA manipulations and transformation of E . coli were performed according to standard protocols (35) . Transformation of competent B . subtilis cells with plasmids or chromosomal DNA was carried out by a two-step protocol (12) . For nonradioactive protein analysis, cells were resuspended and washed in 10 mM Tris (pH 8.0)-1 mM EDTA buffer containing 1 mM phenylmethylsulfonyl fluoride (a protease inhibitor) and then disrupted in a French pressure cell (12,000 lb/in²; SLM Aminco) or sonicated three times for 1 min each time at 55 W (Labsonic U; Braun) . The protein concentrations in crude extracts were determined with a Roti-Nanoquant assay (Roth GmbH, Karlsruhe, Germany); bovine serum albumin served as a standard . Protein extracts usually were separated by standard sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) with Mini-Protean cells (Bio-Rad) . Two-dimensional (2-D) PAGE was carried out as described earlier (8) with Immobiline dry strips (IPG pHs 4 to 7; Amersham Biosciences) in the first dimension .

Purification of His₆-tagged proteins and antibody production. For overproduction of B . subtilis ClpP, ClpX, ClpE, and ClpC in E . coli BL21(DE3)/pLysS, the genes were amplified by PCR with Taq DNA polymerase (Promega) and the following forward and reverse primer pairs (restriction enzyme recognition sites are underlined): CLPPFOR, 5'-GGAGGATCCATGAATTTAATACCTACAGTC-3'; CLPPREV, 5'-CGGAATTCTTACTTTTTGTCTTCTGTGTG-3'; CLPXFOR, 5'-GGAGGATCCATGTTTAAATTTAAGGAGGA-3'; CLPXREV, 5'-CGGGGTACCTTATGCAGATGTTTTATCTT-3'; CLPEFOR, 5'-GGAGGATCCATGCGTTGTCAACATTGTCA-3'; CLPEREV, 5'-CGGAATTCTTATTTGCTCGCACTTTGA-3'; CLPCFOR, 5'-GGAGGATCCATGATGTTTGGAAGATTTAC-3'; and CLPCREV, 5'-CGGAATTCTTAATTCGTTTTAGCAGTCG-3' .

The obtained PCR fragments were digested with either BamHI-EcoRI or BamHI-KpnI and cloned into appropriate prepared pRSETA overexpression vectors (Invitrogen) containing the codons for six N-terminal histidine residues and a linker region fused to the target protein . Recombinant His-tagged proteins (His₆-ClpP, His₆-ClpX, His₆-ClpE, and His₆-ClpC) were expressed in E . coli at least 1 h after the addition of 1 mM isopropyl-ß-D-thiogalactopyranoside (IPTG) and purified by Ni-nitrilotriacetic acid chelate affinity chromatography under native conditions according to the standard procedures recommended by the manufacturer (Qiagen) . The purified His₆-Clp proteins were used for custom antibody production in rabbits by a standard immunization protocol (Pineda, Berlin, Germany) .

Western blot experiments. Polyclonal antisera raised against B . subtilis ClpC, ClpE, ClpX, and ClpP were diluted 1:100,000, 1:25,000, 1:25,000, and 1:200,000, respectively . The secondary antibody (goat anti-rabbit immunoglobulin G) conjugated with alkaline phosphatase was used at a 1:100,000 dilution (Sigma) . Immunoblots were developed with either CDP-Star (Perkin-Elmer) as a chemiluminescence substrate or nitroblue tetrazolium-5-bromo-4-chloro-3-indolylphosphate as a color substrate (35) . The cellular levels of ClpC, ClpE, ClpX, and ClpP were estimated by comparison of the B . subtilis intracellular Clp protein content with a dilution series of purified His-tagged Clp proteins expressed in E . coli . The cells were counted in a Thoma chamber immediately before preparation of the intracellular protein extracts . Chemiluminescence immunoblots were quantified by using a LUMI-Imager (Roche Diagnostics), and colored immunoblots were quantified densitometrically by using scanned images and ImageQuant software .

In order to localize ClpX on a 2-D gel, 400 µg of total soluble protein was separated in the first dimension as described earlier (8) . From the 18-cm IPG strip (pHs 4 to 7), a 6-cm piece (pHs 5 to 4) was cut, equilibrated, and placed on top of an 8% polyacrylamide gel . After a 1-h run at 150 V, the gel was blotted in a Mini-Trans-Blot cell (Bio-Rad) for 1 h at 250 mA onto a polyvinylidene difluoride membrane; the membrane then was treated with ClpX-specific antiserum as described above .

Protein-protein interactions analyzed by coimmunoprecipitation. A suspension of 100 µl of protein A-coated Dynabeads (Dynal) was used to bind the ClpC-, ClpE-, or ClpX-specific antiserum . The Dynabeads were washed three times in 1 ml of 0.1 M phosphate-buffered saline (PBS) (pH 7.4), resuspended in 75 µl of the same buffer, incubated with 25 µl of polyclonal antiserum by slow-tilt rotation mixing for 1 h at room temperature, and washed again three times in PBS . Binding of the antigen and interacting proteins was carried out for 1 h at 4°C with 500 µl of crude protein extract (approximately 5 mg in 0.1 M PBS [pH 7.4]) from B . subtilis wild-type cells which had been grown exponentially at 37°C (for ClpX capture) or at 50°C for 15 min (for ClpC and ClpE capture) . Beads were washed three times in 1 ml of PBS containing 0.1% Triton X-100 . Interacting proteins were eluted by resuspension and boiling in SDS sample buffer . Beads without immobilized antibody, beads with an antibody directed against the B . subtilis SigA protein (kindly supplied by M . Yudkin, Oxford University), and beads with an immobilized anti-Clp ATPase antibody together with the corresponding Clp ATPase mutant protein extract served as negative controls and yielded no specific signals in the elution lanes . After electrophoretic separation (12% PAGE), specific interactions were detected by Western blot analysis .

Northern analysis. RNA isolation and Northern analysis were carried out as described previously (13) . In order to compare the stabilities of certain mRNAs, rifampin (100 µg/ml) was added to exponentially growing cells and to a heat-shocked cell culture, and samples were taken at various times . Five micrograms of total RNA was used per lane of 1.2% formaldehyde-containing Northern gels, transferred to positively charged nylon membranes (Pall Corporation) by vacuum blotting, and hybridized with digoxigenin-labeled antisense RNA probes specific for clpP, clpX, clpC, and clpE mRNAs . The antisense RNA probes were synthesized by in vitro transcription with T7 RNA polymerase and clp-specific PCR products containing a T7 promoter extension . PCR synthesis was performed with the following primer pairs (the T7 promoter extension is underlined): T7clpPrev, CTAATACGACTCACTATAGGGAGTTACTTTTTGTCTTCTGTGT; clpPATGfor, ATGAATTTAATACCTACAGT; T7clpXrev, CTAATACGACTCACTATAGGGAGTTATGCAGATGTTTTATCTTGGC; clpXATGfor, ATGTTTAAATTTAACGAGGA; T7clpCrev, CTAATACGACTCACTATAGGGAGTTAATTCGTTTTAGCAGTCG; clpCATGfor, ATGATGTTTGGAAGATTTAC; T7clpErev, CTAATACGACTCACTATAGGGAGAATAGCCTGTTCAATTGAAGG; and clpEfor, TTCCGTTCATAAACAGATGG .

Signals on Northern blot filters were detected by using a digoxigenin-specific antibody conjugated with alkaline phosphatase (Roche) and CDP-Star as a chemiluminescence substrate . Northern blot filters were exposed and quantified by using a LUMI-Imager .

Construction of a conditional clpP mutant. To create a conditional mutant, a 310-bp PCR fragment containing the ribosome-binding site and the N-terminus-encoding part of clpP was amplified by PCR with the following primers (restriction enzyme recognition sites are underlined): clpPforX2BamHI, CGGGATCCACCTAAAAGGTGAAGGAGGAG; and clpP4revBamHI, CGGGATCCCCGATACAAATTGTAGATACC . The fragment was BamHI digested and ligated with BamHI-digested plasmid pX2 to create pX2clpP (16) . Upon transformation into B . subtilis 168, pX2clpP should integrate into the chromosome via Campbell-type integration, disrupt the clpP gene, and place a second copy of clpP under the control of a xylose-inducible promoter (P_xyl) . Chloramphenicol-resistant colonies were selected on agar plates containing 5 µg of chloramphenicol/ml . The integration of pX2clpP into clpP was verified by PCR, and the induction of ClpP by xylose was determined by Western blotting with a ClpP-specific antibody (data not shown) .

Construction of clpX-bgaB fusions and determination of BgaB enzyme activity. BgaB reporter gene fusions to the clpX promoter were constructed by cloning EcoRI-BamHI-digested PCR fragments amplified with Taq DNA polymerase and the following primer pairs into vector pDL (45): XBfor1 (5'-GGAATTCCGGCTGAAGCATACAACATGC-3') and XBrev1 (5'-CGGGATCCCGAACGAGCATTTTAATTGTCC-3') to generate a fragment carrying both promoters (wild-type situation) and XBfor1 and XBrev3 (5'-CGGGATCCCTGACTTGCACATTCTATATG-3') to generate a fragment carrying only the upstream promoter . The nucleotide sequences of the PCR fragments were confirmed with a ThermoSequenase cycle sequencing kit (Amersham Biosciences) . Recombinant plasmids were linearized by PstI digestion and transformed into B . subtilis for integration at the amyE site of the chromosome by a double crossover . Chromosomal bgaB fusions in amyE were screened for the expression of thermostable ß-galactosidase at 50°C and a deficiency of -amylase activity . Transformants were plated on LB agar containing 1% (wt/vol) starch . Starch degradation was detected by pouring iodine onto the plates . BgaB activity was determined as described earlier (8) .

Primer extension experiments. A primer complementary to the 5' coding region of clpX (5'-CGAACCTGATCTTGTG-3'; 100 ng/µl) was labeled with 4 U of polynucleotide kinase (Roche) and 1.85 kBq of [-³²P]ATP (111 TBq/mmol; NEN DuPont) . Total RNA was isolated from wild-type B . subtilis and BUG2 before (control) and 10 min after heat shock (50°C) . The labeled primer was annealed to 10 µg of cellular RNA at 55°C for 1 h, and reverse transcription was carried out with Superscript II RNase H^- reverse transcriptase (Invitrogen) as recommended by the manufacturer . Samples were precipitated with ethanol, vacuum dried, and resuspended in 10 µl of stop mixture (U.S . Biochemical Corp.) . After heat denaturation, 3-µl samples were immediately loaded onto a 6% polyacrylamide-urea sequencing gel for electrophoresis (Sequi-Gen cell; Bio-Rad) . A ³⁵S-labeled DNA sequencing ladder obtained with the same primer and a ThermoSequenase cycle sequencing kit served as a standard to identify the transcriptional start site .

 
Occurrence of ClpC, ClpE, ClpX, and ClpP during growth into the stationary phase and after heat shock. Despite the repression of clpC and clpP by CtsR, significant levels of ClpC, ClpP, and ClpX, which is not controlled by CtsR, were present during exponential growth in B . subtilis (Fig . 1) . ClpE was hardly detectable under standard growth conditions (37°C), but expression was markedly induced for a short period after heat stress, with a maximum at 10 min (Fig . 2) .

 
The levels of ClpX and ClpC remained constant during exponential growth and glucose starvation, but the ClpP levels increased during the stationary phase, probably due to relatively weak CtsR repression and activation of ^B during glucose starvation (Fig . 1) . Interestingly, ClpX seems to exist in at least two or three different forms depending on the resolution of the polyacrylamide gels . These forms were also identified in gels when ClpX was expressed with an N-terminal His tag in E . coli or with a C-terminal His tag in B . subtilis by matrix-assisted laser desorption ionization-time-of-flight mass spectrometry analysis (D . Becher, unpublished observations) . While the positions of ClpP, ClpC, and ClpE on the B . subtilis 2-D map were already known, we also identified ClpX in 2-D gels by 2-D Western blotting . Surprisingly, the 46-kDa ClpX protein, with an isoelectric point of 4.6, was located in a row of multiple spots comparable to ClpC but in a group of other proteins in the EF-Tu region (data not shown) . The nature of these modified forms is currently under investigation .

Determination of the numbers of ClpC, ClpE, ClpX, and ClpP molecules per cell. In order to determine the numbers of ClpC, ClpE, ClpX, and ClpP molecules within a B . subtilis cell, quantitative Western blot analyses were performed with Clp-specific antibodies . The numbers of these molecules were calculated for exponentially growing cells and cells exposed to heat shock (50°C) . Maximal heat induction occurred for ClpC after 20 min, for ClpE after 10 min, and for ClpP after 30 min, whereas ClpX appeared to be virtually non-heat inducible at the protein level . Different concentrations of purified His-tagged ClpC, ClpE, ClpX, and ClpP proteins were analyzed in Western blot experiments, and the signal intensities were compared with those obtained from total soluble protein (Fig . 2) . Provided that antibodies react similarly with His-tagged and native proteins, the approximate numbers of molecules per cell can be determined .

Assuming the same oligomeric structure as in E . coli, B . subtilis possesses, per cell, approximately 1,200 ClpP tetradecamers, 1,400 ClpX hexamers, 250 ClpC hexamers, and only 100 (if the suggested oligomeric status is proved correct) ClpE hexamers (or 600 monomers) during exponential growth . These values correspond to 0.44% ClpP, 0.5% ClpX, 0.4% ClpC, and approximately 0.02% ClpE relative to total soluble protein at 37°C . However, after heat shock, the numbers increase maximally up to 2,500 ClpP tetradecamers (2-fold induction), 1,000 ClpC hexamers (4-fold induction), and 450 ClpE hexamers (or 2,700 monomers; 4.5-fold induction), whereas the number of hexameric ClpX molecules remains constant at 1,400 . There was no induction of ClpX at the translational level, although clpX was induced about threefold by heat stress at the transcriptional level when measured with bgaB fusions and four- to eightfold when measured with a clpX antisense RNA probe (7; see Discussion) . Therefore, only the amounts of ClpP, ClpC, and ClpE rose to 0.8, 1.6, and 0.09% total soluble protein after heat shock . Actually, the numbers of Clp molecules in the cells will probably be much higher after heat stress due to the formation of Clp-occupied inclusion bodies (20), which are normally not found in the soluble protein fraction .

Evidence for direct ClpX-ClpP, ClpC-ClpP, and ClpE-ClpP interactions. In order to test whether ClpX, ClpC, and ClpE were able to interact specifically with ClpP in B . subtilis, coimmunoprecipitation experiments were performed with protein A-coated magnetic beads . Protein A shows a high specificity for rabbit immunoglobulin G and was used to immobilize either ClpX-, ClpC-, ClpE-, or ClpP-specific antibodies . Interactions were tested in two ways: (i) immobilization of either ClpX-, ClpC-, or ClpE-specific antibodies and checking for interactions with ClpP and (ii) immobilization of the ClpP-specific antibody and checking for interactions with either ClpX, ClpC, or ClpE . The bead-antibody complexes were incubated with B . subtilis soluble proteins extracted from either exponentially growing or heat-shocked cells . After 1 h of incubation at 4°C, the beads were captured, washed, and eluted with SDS sample buffer . After electrophoresis and Western blotting, specific ClpX-ClpP, ClpC-ClpP, and ClpE-ClpP interactions were detected with the corresponding antibodies (Fig . 3) .

 
Degradation of ClpE and ClpX by ClpP. The stability of Clp ATPase proteins was investigated during heat stress (50°C) and subsequent puromycin treatment to inhibit further protein synthesis in wild-type as well as clpP mutant cells . As shown in Fig. 4, ClpE as well as ClpX was rapidly degraded in wild-type cells during permanent heat stress but remained almost stable in clpP mutant cells, suggesting that degradation depends on ClpP . On the contrary, the ClpC ATPase appeared rather stable under heat stress conditions in wild-type cells . Figure 5 shows that ClpE accumulated in the soluble protein fraction of clpP conditional mutant cells in the absence of xylose at 37°C . The amount of ClpP in the cells can be adjusted via a xylose-inducible promoter (16), and the disappearance of ClpE coincided exactly with the induction of ClpP in the presence of xylose (Fig . 5) . Different Clp ATPase mutations were used in combination with the clpP conditional mutant, elucidating which ATPase is responsible for ClpE degradation . As expected, ClpE was rapidly degraded in the clpP conditional mutant in the presence of xylose after heat shock in the soluble as well as the "insoluble" (inclusion body) protein fraction (data not shown) . However, ClpE was remarkably stabilized in a clpC clpP conditional double mutant and to a much lesser extent in a clpX clpP conditional double mutant in the presence of xylose, indicating that both ClpCP and ClpXP proteolytic complexes are involved in ClpE degradation, but with ClpCP acting as the primary protease (data not shown) .

 
Enhanced basal expression of ClpP in a clpX mutant and vice versa. Comparative 2-D PAGE revealed that the silver-stained amount as well as the synthesis of [³⁵S]methionine-radiolabeled ClpP was increased in a clpX mutant (Fig . 6) . Furthermore, a higher ClpX protein content was detected in clpP mutant cells than in wild-type cells by Western analysis (data not shown) . In order to examine whether these observed effects originated from the transcriptional or the translational level, Northern blot analyses were carried out . A higher clpP mRNA level was detected in clpX mutant cells than in wild-type cells at 37°C, showing that the effect occurred at the transcriptional level (Fig . 7A) . However, only a slightly higher clpC mRNA level and no clpE mRNA signal were observed in a clpX mutant at 37°C . These results clearly indicate that the CtsR repressor was still active and able to prevent transcription from the clpE promoter and partially from the clpC promoter . Similar results were obtained for the levels of clpX, clpC, and clpE mRNAs in a clpP mutant at 37°C (Fig . 7B) . As already known, the synthesis of clpP, clpC, clpE, and clpX mRNAs was induced after 5 and 10 min of heat shock, but to different levels (Fig . 7) .

 
Induction of clpX in a clpX mutant. In several bacteria, including E . coli, clpP and clpX are found adjacent to each other on the chromosome and are cotranscribed in a bicistronic operon under certain circumstances (9, 22, 44) . In B . subtilis, these genes are not adjacent and therefore are transcribed independently . The B . subtilis clpX gene was heat inducible, as already demonstrated (7) . Although clpX showed a relatively high basal level of expression (approximately 25 Miller units), even under standard growth conditions (37°C), compared to the lower level of expression of a clpP-bgaB fusion (approximately 10 Miller units) (8), transcription was induced two- to threefold after heat shock, as measured with bgaB fusions (Fig . 8) . No CtsR DNA-binding motif (a tandem heptanucleotide repeat [A/GGTCAAA/T]) (4), typically located in promoter regions of clpP, clpC, and clpE, was found in the clpX regulatory region (Fig. 9) .

 
In order to test the influence of CtsR, SigB, and ClpX on clpX transcription, clpX promoter fragments were constructed, fused to the thermostable bgaB gene, and integrated into the nonessential B . subtilis amyE site (Fig . 8) . Quasi-identical transcriptional induction patterns were observed with wild-type cells and ctsR mutant cells (Fig . 8, diagram 1), confirming that CtsR seemingly was not involved in clpX regulation . The clpP gene and the clpC operon are preceded by ^B and ^A tandem promoter sequences (8, 18) . Analogous to the situation for clpC and clpP, a second weak, heat-inducible promoter located upstream of the putative ^A-dependent clpX promoter showed some similarity to ^B-dependent promoters . The activities of the potential ^B-dependent promoter alone and of both promoters in the wild-type and ^B mutant backgrounds were measured (Fig . 8, diagrams 1 and 2) . On the basis of similar expression profiles for both strains, ^B does not seem to play a role in the expression of clpX . In contrast to clpP and clpC, which are members of the ^B regulon, clpX was very weakly heat inducible at a second, but ^B-independent promoter . However, the transcription of clpX increased remarkably under standard growth condition (37°C) when the bgaB measurements were performed in a clpX mutant background, indicating an involvement of ClpX in its own transcription (Fig. 8, diagram 1) .

In order to verify whether the putative ^A-dependent promoter drives elevated transcription in the clpX mutant, primer extension experiments were performed with RNAs isolated from wild-type and clpX mutant cells (Fig . 9) . As expected, transcriptional initiation of clpX mRNA synthesis occurred at a putative ^A-dependent promoter in wild-type cells and increased clearly after 10 min of heat shock (50°C) . However, clpX was already highly expressed from the same promoter in a clpX mutant background even under standard conditions (37°C) (Fig . 9) . There was almost no further increase in clpX transcription after heat shock in a clpX mutant and in a clpP mutant, in contrast to what was found for clpP . Due to the derepression of CtsR after heat stress, clpP was still heat inducible in a clpX mutant . In conclusion, clpX appears to be negatively autoregulated at the transcriptional level .

Regulation at the posttranscriptional level, determined on the basis of the t_1/2s of clp mRNAs. Rifampin experiments combined with Northern blot analyses were performed to determine the half-lives (t_1/2s) of specific clp mRNAs under standard growth conditions and after heat shock . As shown in Fig . 10, clpP mRNA appeared to be not very stable at 37°C but more stable at 50°C, with t_1/2s of 85 and 117 s, respectively . Under heat stress, clpP mRNA (t_1/2, 2 min) obviously ensures a continuation of ClpP protein synthesis, suggesting the importance of ClpP for the survival of cells under these conditions . clpX mRNA appeared to be fairly stable, with a t_1/2 of 1 min, at 37°C but rather unstable at 50°C (t_1/2, 15 s), probably preventing the accumulation of the ClpX protein during heat stress . Interestingly, the t_1/2s of clpC mRNA, a tetracistronic transcript with the genes ctsR-mcsA-mcsB-clpC, and clpE mRNA, with two monocistronic transcripts, ranged between 20 and 30 s at 37°C as well as at 50°C . The relatively rapid turnover of clpC and clpE mRNAs under the tested conditions may reflect a fine-tuning process whereby the synthesis of their gene products is carefully regulated at the posttranscriptional level .

 
The amounts of B . subtilis ClpX and ClpC do not seem to change dramatically in the soluble protein fraction during exponential growth and starvation, whereas that of ClpP continues to rise with entry into the glucose deprivation-induced stationary phase . This result is probably due to relatively weak CtsR repression and activation of the alternative stress and starvation sigma factor ^B . ClpE, a short-lived heat shock protein, was barely detectable under these conditions owing to complete repression by the CtsR repressor . Interestingly, different time-dependent induction peaks were found for the heat-inducible Clp proteins in B . subtilis . Calibrated Western analyses allowed estimation of the number of Clp molecules per cell . Approximately 650 to 1,300 active hexameric ClpC complexes were described for B . subtilis during competence development (41) . These and our data are on the same order of magnitude as results obtained for Caulobacter crescentus, which possesses approximately 1,650 tetradecameric ClpP structures and 830 ClpX rings in the exponential growth phase and about 3,000 ClpP and 1,500 ClpX oligomers in the stationary phase (30) . Provided that the B . subtilis Clp ATPases are able to bind to both sides of the ClpP core, as indicated by in vitro experiments (29), there is obviously no competition between the different ATPases for the proteolytic subunit ClpP in B . subtilis, either under standard growth conditions or in the presence of heat shock, because ClpP possesses more potential ATPase-binding sites than there are Clp ATPases . According to this scheme, a maximum of approximately 75% of the total ATPase-binding sites in ClpP can be occupied by ATPase subunits during standard growth (37°C), and only about 60% can be occupied after heat shock, even if all ATPases are present at their maximal levels at the same time . However, this is not the case . Moreover, one should keep in mind that Clp ATPase subunits alone play an important role as chaperones in protein folding and remodeling after heat stress without ClpP association . Substantial amounts of Clp ATPases also were found in the inclusion body protein fraction after heat stress (H . Kock, unpublished observations) .

Coimmunoprecipitation experiments revealed the assumed ClpX-ClpP, ClpC-ClpP, and ClpE-ClpP interactions, which seemingly depend on a specific tripeptide sequence, IGF for ClpX and VGF for ClpE and ClpC, as part of the surface loop of the ATPase (17) . These data are the first to show physically a ClpE-ClpP interaction . It appears likely that these different Clp complexes recognize different substrates, although in some instances we observed overlapping substrate specificities for ClpCP and ClpXP . Whether there are complexes with ClpP and different ATPase subunits, such as ClpC-ClpP-ClpX, remains to be determined; however, mass calculations from gel filtration experiments suggested a hetero-oligomeric ClpX-ClpP-ClpE complex (J . Kirstein, unpublished observations) .

Regulation at the posttranslational level seems to play an important role in the maintenance of a specific Clp protein equilibrium in B . subtilis . Degradation of ClpE and ClpX depends on ClpP being under permanent heat stress, indicating a negative autoregulatory mechanism . Proteolysis of the short-lived ClpE requires mainly a functional ClpCP complex . Obviously, there is only a short time window after heat stress for ClpE to act, as it is usually strongly repressed by CtsR at 37°C . To our knowledge, no ClpE target protein is known at this time . clpE mutant cells exhibit no obvious phenotype and tolerate heat stress in the same way as wild-type cells do (5) .

2-D PAGE, Northern analysis, reporter gene, and primer extension experiments revealed that ClpP and ClpX were involved in the expression of clpP and clpX at the transcriptional level but were only weakly involved in clpC expression and not at all in clpE expression . clpP and the CtsR-independent clpX showed clearly increased basal levels at 37°C in either a clpP or a clpX mutant background compared to a wild-type background . Therefore, it seems that ClpP and ClpX are negatively involved in their own basal transcription . Whether this activity is due to a direct or an indirect effect remains an unanswered question . Residual repression of clpP was reported for a ctsR mutant (4) . Searching for additional regulators of clpP expression with a transposon mutagenesis approach, these authors identified ClpC as a potential regulator . They explained this finding with a presumptive chaperone effect of ClpC on CtsR (refolding of CtsR) . With 2-D gels, we also found that the synthesis of [³⁵S]methionine-labeled ClpP was dramatically increased in a clpC mutant even during growth at 37°C (data not shown) . B . subtilis clpP expression increased not only in a ctsR mutant and in a clpC mutant but also in a clpP mutant and in a clpP clpC double mutant; however, this increase was not seen in clpE mutant cells (6) .

All these findings can be interpreted in two ways . First, clpP, clpX, or clpC mutations or combined mutations cause the intracellular accumulation of aggregated proteins, leading to partial derepression of the CtsR regulon and to increased transcription of ctsR-independent clpX . The members of the CtsR regulon (clpE, clpC, and clpP) are repressed to different degrees by CtsR in the order clpE (strong), clpC (intermediate), and clpP (weak) . Microarray analysis of exponentially growing Streptococcus pneumoniae cells revealed that members of the CtsR regulon as well as of the HrcA regulon were derepressed in a clpP mutant (34) . Second, it is also plausible to argue for a negative role (direct or indirect negative autoregulation) of ClpX, ClpC, and ClpP with regard to their own expression through degradation of a putative activator or through activation of a still unknown repressor . Whether the first or second hypothesis will prove to be true remains uncertain .

The regulatory DNA sequences of clpX from B . subtilis, B . anthracis, B . cereus, and B . halodurans all share highly conserved ribosome-binding sites and putative transcriptional start sites (TACATA [start site underlined]; with the exception of B . halodurans clpX) . A nontypical Shine-Dalgarno sequence (AAGGGGTG) (42) was identified at various distances from the start codon for all clpX mRNAs in these four species . A conserved TACATA sequence usually was found several times in clpX regulatory regions and surprisingly also around the B . subtilis clpP transcriptional start site (TACATA; start site underlined) . A TA-rich inverted repeat located between the transcriptional and the translational start sites seems not to play an important role in clpX regulation, because site-directed mutagenesis, as well as partial and complete deletion, did not change the expression pattern significantly (data not shown) . When the B . subtilis clpX sequence upstream of the -35 region was removed, very low basal expression of clpX at 37°C and almost no heat induction were observed in reporter gene assays, suggesting a role for a putative activator in directing the RNA polymerase to the weakly conserved -35 promoter region (data not shown) .

Furthermore, the t_1/2s of the different clp mRNAs vary considerably, particularly for clpP and clpX under standard growth conditions and after heat shock . Posttranscriptional control appears to be an additional control element for the maintenance of a specific intracellular Clp protein content . clpX mRNA was found to be very unstable at 50°C, with a t_1/2 of 15 s, preventing the accumulation of the ClpX protein under these conditions; in comparison, the t_1/2s of clpP, clpC, and clpE mRNAs were 2 min, 27 s, and 28 s, respectively . This finding probably explains why ClpX is not induced after heat shock at the translational level . Tight regulation of clpX expression is not limited to C . crescentus (3, 15, 22, 32, 44), where both the depletion and the overexpression of ClpX were highly toxic for cells, resulting in a cessation of growth and a loss of viability (30) . ClpX is involved in the regulated proteolysis of CtrA, a cell division inhibitor, during the developmental cycle in C . crescentus (14) and in the degradation of the stationary-phase sigma factor ^S in E . coli (2, 36, 46) . In B . subtilis, ClpX is necessary for the postexponential induction of ^H-dependent genes (26) and is proposed to function indirectly in the displacement of ^A from core RNA polymerase and to act directly in the stimulation of ^H-dependent transcription in sporulating cells (23) . Nevertheless, B . subtilis ClpX was nearly constantly expressed during exponential growth as well as during the stationary phase because of glucose starvation . ClpC but not ClpX accumulated after heat stress, suggesting that ClpX is the major ATPase at 37°C and that ClpC exerts its function mainly during heat shock . In summary, we demonstrate here that B . subtilis Clp protein content is regulated precisely not only at the transcriptional level but also at the posttranscriptional and posttranslational levels .

 
We are grateful to Q . Pan and R . Losick (Harvard University) for providing the B . subtilis clpC deletion mutant . We thank E . Krüger (Charite Berlin, Berlin, Germany) and H . Ludwig (GSF, Neuherberg, Germany) for the clpX deletion strain and V . Brözel (University of Pretoria, Pretoria, South Africa), U . Völker (Universität Greifswald, Greifswald, Germany), and J . Thomas (University of Western Australia, Crawley, Australia) for critical reading of the manuscript and helpful suggestions . Furthermore, we appreciate the help of G . Homuth (Universität Greifswald) in performing Northern analyses and A . Tschirner for excellent technical assistance . We are indebted to R . Sopko (University of Toronto, Toronto, Canada) and D . Stanley (University of Melbourne, Melbourne, Australia) for help during the initial stages of this study .

This work was supported by grants from the EU (QLK3-CT-1999-00413), the BMBF (031U107A/031U207A), and the Fonds der Chemischen Industrie to M.H .

 
* Corresponding author . Mailing address: Ernst-Moritz-Arndt-Universität, Institut für Mikrobiologie, F.-L.-Jahn-Str . 15, D-17487 Greifswald, Germany . Phone: 49-3834-864216 . Fax: 49-3834-864202 . E-mail: Ulf.Gerth@biologie.uni-greifswald.de .

This article is dedicated to Sierd Bron (University of Groningen, Groningen, The Netherlands) for his great contribution to Bacillus subtilis genetics .

1. Anagnostopoulos, C., and J . Spizizen. 1961 . Requirements for transformation in Bacillus subtilis . J . Bacteriol . 81:741-746.
2. Becker, G., E . Klauck, and R . Hengge-Aronis. 1999 . Regulation of RpoS proteolysis in Escherichia coli: the response regulator RssB is a recognition factor that interacts with the turnover element in RpoS . Proc . Natl . Acad . Sci . USA 96:6439-6444 .
3. de Crecy-Lagard, V., P . Servant-Moisson, J . Viala, C . Grandvalet, and P . Mazodier. 1999 . Alteration of the synthesis of the Clp ATP-dependent protease affects morphological and physiological differentiation in Streptomyces . Mol . Microbiol . 32:505-517.
4. Derre, I., G . Rapoport, and T . Msadek. 1999 . CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in Gram-positive bacteria . Mol . Microbiol. 31:117-131.
5. Derre, I., G . Rapoprt, K . Devine, M . Rose, and T . Msadek. 1999 . ClpE, a novel type of HSP100 ATPase, is part of the CtsR heat shock regulon of Bacillus subtilis . Mol . Microbiol . 32:581-593.
6. Derre, I., G . Rapoport, and T . Msadek. 2000 . The CtsR regulator of stress response is active as a dimer and specifically degraded in vivo at 37^oC . Mol . Microbiol . 38:335-347.
7. Gerth, U., A . Wipat, C . R . Harwood, N . Carter, P . T . Emmerson, and M . Hecker. 1996 . Sequence and transcriptional analysis of clpX, a class-III heat-shock gene of Bacillus subtilis . Gene 181:77-83.
8. Gerth, U., E . Krüger, I . Derre, T . Msadek, and M . Hecker. 1998 . Stress induction of the Bacillus subtilis clpP gene encoding a homologue of the proteolytic component of the Clp protease and the involvement of ClpP and ClpX in stress tolerance . Mol . Microbiol . 28:787-802.
9. Gottesman, S., W . P . Clark, V . de Crecy-Lagard, and M . R . Maurizi. 1993 . ClpX, an alternative subunit for the ATP-dependent Clp protease of Escherichia coli . Sequence and in vivo activities . J . Biol . Chem . 268:22618-22626 .
10. Gottesman, S. 1996 . Proteases and their targets in Escherichia coli . Annu . Rev . Genet . 30:465-506.
11. Grimaud, R., M . Kessel, F . Beuron, A . C . Steven, and M . R . Maurizi. 1998 . Enzymatic and structural similarities between the Escherichia coli ATP-dependent proteases, ClpXP and ClpAP . J . Biol . Chem. 273:12476-12481 .
12. Hoch, J . A. 1991 . Genetic analysis in Bacillus subtilis . Methods Enzymol . 204:305-320.
13. Homuth, G., S . Masuda, A . Mogk, Y . Kobayashi, and W . Schumann. 1997 . The dnaK operon of Bacillus subtilis is heptacistronic . J . Bacteriol . 179:1153-1164.
14. Jenal, U., and T . Fuchs. 1998 . An essential protease involved in bacterial cell-cycle control . EMBO J . 17:5658-5669 .
15. Jobin, M . P., D . Garmyn, C . Divies, and J . Guzzo. 1999 . The Oenococcus oeni clpX homologue is a heat shock gene preferentially expressed in exponential growth phase . J . Bacteriol . 181:6634-6641 .
16. Kim, L., Mogk, A., and W . Schumann. 1996 . A xylose-inducible Bacillus subtilis integration vector and its application . Gene 181:71-76.
17. Kim, Y.-I., I . Levchenko, K . Fraczkowska, R . V . Woodruff, R . T . Sauer, and T . Baker. 2001 . Molecular determinants of complex formation between Clp/Hsp100 ATPases and the ClpP peptidase . Nat . Struct . Biol . 8:230-233.
18. Krüger, E., T . Msadek, and M . Hecker. 1996 . Alternate promoters direct stress-induced transcription of the Bacillus subtilis clpC operon . Mol . Microbiol . 20:713-723.
19. Krüger, E., and M . Hecker. 1998 . The first gene of the Bacillus subtilis clpC operon, ctsR, encodes a negative regulator of its own operon and other class III heat shock genes . J . Bacteriol . 180:6681-6688 .
20. Krüger, E., E . Witt, S . Ohlmeier, R . Hanschke, and M . Hecker. 2000 . The Clp proteases of Bacillus subtilis are directly involved in degradation of misfolded proteins . J . Bacteriol . 182:3259-3265 .
21. Krüger, E., D . Zühlke, E . Witt, H . Ludwig, and M . Hecker. 2001 . Clp-mediated proteolysis in Gram-positive bacteria is autoregulated by the stability of a repressor . EMBO J . 20:852-863 .
22. Li, C., Y . P . Tao, and L . D . Simon. 2000 . Expression of different-size transcripts from the clpP-clpX operon of Escherichia coli during carbon deprivation . J . Bacteriol . 182:6630-6637 .
23. Liu, J., and P . Zuber. 2000 . The ClpX protein of Bacillus subtilis indirectly influences RNA polymerase holoenzyme composition and directly stimulates ^H-dependent transcription . Mol . Microbiol . 37:885-897.
24. Msadek, T., Kunst, F., and G . Rapoport. 1994 . MecB of Bacillus subtilis, a member of the ClpC ATPase family, is a pleiotropic regulator controlling competence gene expression and growth at high temperature . Proc . Natl . Acad . Sci . USA 91:5788-5792.
25. Msadek, T., V . Dartois, F . Kunst, M.-L . Herbaud, F . Denizot, and G . Rapoport. 1998 . ClpP of Bacillus subtilis is required for competence development, degradative enzyme synthesis, motility, growth at high temperature and sporulation . Mol . Microbiol . 27:899-914.
26. Nakano, M . M., Y . Zhu, J . Liu, D . Y . Reyes, H . Yoshikawa, and P . Zuber. 2000 . Mutations conferring amino acid residue substitutions in the carboxy-terminal domain of RNA polymerase alpha can suppress clpX and clpP with respect to developmentally regulated transcription in Bacillus subtilis . Mol . Microbiol . 37:869-884.
27. Nakano, S., G . Zheng, M . M . Nakano, and P . Zuber. 2002 . Multiple pathways of Spx (YjbD) proteolysis in Bacillus subtilis . J . Bacteriol . 184:3664-3670 .
28. Nakano, S., M . M . Nakano, Y . Zhang, M . Leelakriangsak, and P . Zuber. 2003 . A regulatory protein that interferes with activator-stimulated transcription in bacteria . Proc . Natl . Acad . Sci . USA 100:4233-4238 .
29. Ortega, J., Lee, H . S., Maurizi, M . R., and A . C . Steven. 2002 . Alternating translocation of protein substrates from both ends of ClpXP protease . EMBO J . 21:4938-4949 .
30. Osteras, M., A . Stotz, S . Schmid Nuoffer, and U . Jenal. 1999 . Identification and transcriptional control of the genes encoding the Caulobacter crescentus ClpXP protease . J . Bacteriol . 181:3039-3050 .
31. Pan, Q., Garsin, D . A., and R . Losick. 2001 . Self-reinforcing activation of a cell-specific transcription factor by proteolysis of an anti-sigma factor in B . subtilis . Mol . Cell 8:873-883.
32. Periago, P . M., Abee, T., and J . A . Wouters. 2002 . Analysis of the heat-adaptive response of psychrotrophic Bacillus weihenstephanensis . Int . J . Food Microbiol . 79:17-26.
33. Pummi, T., S . Leskela, E . Wahlstrom, U . Gerth, H . Tjalsma, M . Hecker, M . Sarvas, and V . P . Kontinen. 2002 . ClpXP protease regulates the signal peptide cleavage of secretory preproteins in Bacillus subtilis with a mechanism distinct from that of the Ecs ABC transporter . J . Bacteriol. 184:1010-1018 .
34. Robertson, G . T., W . L . Ng, J . Foley, R . Gilmour, and M . E . Winkler. 2002 . Global transcriptional analysis of clpP mutations of type 2 Streptococcus pneumoniae and their effects on physiology and virulence . J . Bacteriol . 184:3508-3520 .
35. Sambrook, J., E . F . Fritsch, and T . Maniatis. 1989 . Molecular cloning: a laboratory manual, 2nd ed . Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
36. Schweder, T., K . H . Lee, O . Lomovskaya, and A . Matin. 1996 . Regulation of Escherichia coli starvation sigma factor (sigma S) by ClpXP protease . J . Bacteriol . 178:470-476.
37. Singh, S . K., R . Grimaud, J . R . Hoskins, S . Wickner, and M . R . Maurizi. 2000 . Unfolding and internalization of proteins by the ATP-dependent proteases ClpXP and ClpAP . Proc . Natl . Acad . Sci . USA 97:8898-8903 .
38. Smith, I., P . Paress, K . Cabane, and E . Dubnau. 1980 . Genetics and physiology of the rel system of Bacillus subtilis . Mol . Gen . Genet . 178:271-279.
39. Studier, F . W., A . H . Rosenberg, J . J . Dunn, and J . W . Dubendorff. 1990 . Use of T7 RNA polymerase to direct expression of cloned genes . Methods Enzymol . 185:60-89.
40. Stülke, J., R . Hanschke, and M . Hecker. 1993 . Temporal activation of b-glucanase synthesis in Bacillus subtilis is mediated by the GTP pool . J . Gen . Microbiol . 139:2041-2045.
41. Turgay, K., J . Hahn, J . Burghoorn, and D . Dubnau. 1998 . Competence in Bacillus subtilis is controlled by regulated proteolysis of a transcription factor . EMBO J . 17:6730-6738 .
42. Vellanoweth, R . L., and J . C . Rabinowitz. 1992 . The influence of ribosome-binding-site elements on translational efficiency in Bacillus subtilis and Escherichia coli in vivo . Mol . Microbiol . 6:1105-1114.
43. Wang, J., J . A . Hartling, and J . M . Flanagan. 1997 . The structure of ClpP at 2.3 A resolution suggests a model for ATP-dependent proteolysis . Cell 91:447-456.
44. Yoo, S . J., J . H . Seol, M . S . Kang, D . B . Ha, and C . H . Chung. 1994 . clpX encoding an alternative ATP-binding subunit of protease Ti (Clp) can be expressed independently from clpP in Escherichia coli . Biochem . Biophys . Res . Commun . 203:798-804.
45. Yuan, G., and S.-L . Wong. 1995 . Regulation of groE expression in Bacillus subtilis: the involvement of the s^A-like promoter and the roles of the inverted repeat sequence (CIRCE) . J . Bacteriol. 177:5427-5433.
46. Zhou, Y., and S . Gottesman. 1998 . Regulation of proteolysis of the stationary-phase sigma factor RpoS . J . Bacteriol . 180:1154-1158 .

Free Online Full-text Article

What Is Anthrax?, What Is Biofilter?, What Is Activated Sludge?, What Is Bioassay?, What Is Staphylococcus Aureus?, e, Microbes, s, Microorganism, s, Bacteriology, n, Microbiology, e, Bacteria, i, S. cerevisiae, n, Streptococci, e, Escherichia coli, n, Staphylococcus aureus, c, Fermentations, c, S. cerevisiae, a, Staphylococcus, r, Fermentations, e, Penicillin, o, Bacillus, i, Shigella, n, Microorganism, r, Escherichia coli, i, Yeasts, i, Culture medium, a, Antimicrobial, o, Bacteriological, n, Corynebacter, a, Denitrifying, r, Cell cultures, e, Escherichia coli




 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005