Gene, 1997 Jun 3, 191(2), 225 - 32 Porin from the halophilic species Ectothiorhodospira vacuolata: cloning, structure of the gene and comparison with other porins; Wolf E et al.; The gene coding for the anion-specific porin of the halophilic eubacterium Ectothiorhodospira (Ect.) vacuolata was cloned and sequenced, the first such gene so analyzed from a purple sulfur bacterium . It encodes a precursor protein consisting of 374 amino acid (aa)-residues including a signal peptide of 22-aa residues . Comparison with aa sequences of porins from several other members of the Proteobacteria revealed little homology . Only two regions showed local homology with the previously sequenced porins of Neisseria species, Comamonas acidovorans, Bordetella pertussis, Alcaligenes eutrophus, and Burkholderia cepacia . Genomic Southern blot hybridization studies were carried out with a probe derived from the 5' end of the gene coding for the porin of Ect . vacuolata . Two related species, Ect . haloalkaliphila and Ect . shaposhnikovii, exhibited a clear signal, while the extremely halophilic bacterium Halorhodospira (Hlr.) halophila (formerly Ect . halophila) did not show any cross-hybridization even at low stringency . This result is in good accordance with a recently proposed reassignment within the family Ectothiorhodospiraceae, which included the separation of the extremely halophilic species into the new genus Halorhodospira. FEMS Microbiol Rev, 1997 Jun, 20(1-2), 25 - 46 Biochemistry of S-layers; Messner P et al.; During evolution prokaryotes have developed different envelope structures exterior to the cell wall proper . Among these surface components are regularly arranged S-layers and capsules . The structural characterization and the detailed chemical analysis of these surface molecules is a prerequisite to understand their biosynthesis and functional role(s) at the molecular level . Of particular interest are the glycosylated S-layer proteins which belong to the first prokaryotic glycoproteins ever described . Their characterization was performed on strains belonging to the thermophilic Bacillaceae and included structural studies and experiments to learn about the pathways for the glycan biosynthesis of S-layer glycoproteins . As an example for non-glycosylated S-layer proteins those of Lactobacillus helveticus strains are described in detail . Recently, a novel type of bacterial glycoconjugate was observed in the cell envelope of the extremely halophilic archaeon Natronococcus occultus which consists of a glycosylated polyglutamyl polymer . Beside the conventional biochemical techniques for the analysis new sophisticated instrumental methods such as X-ray photoelectron spectroscopy and matrix-assisted laser desorption ionization or electrospray ionization mass spectrometry have been introduced for the analysis of the protein and glycan portions of these cell surface macromolecules. J Bacteriol, 1997 Jun, 179(11), 3632 - 8 3-hydroxy-3-methylglutaryl coenzyme A reductase of Sulfolobus solfataricus: DNA sequence, phylogeny, expression in Escherichia coli of the hmgA gene, and purification and kinetic characterization of the gene product; Bochar DA et al.; The gene (hmgA) for 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase (EC 1.1.1.34) from the thermophilic archaeon Sulfolobus solfataricus P2 was cloned and sequenced . S . solfataricus HMG-CoA reductase exhibited a high degree of sequence identity (47%) to the HMG-CoA reductase of the halophilic archaeon Haloferax volcanii . Phylogenetic analyses of HMG-CoA reductase protein sequences suggested that the two archaeal genes are distant homologs of eukaryotic genes . The only known bacterial HMG-CoA reductase, a strictly biodegradative enzyme from Pseudomonas mevalonii, is highly diverged from archaeal and eukaryotic HMG-CoA reductases . The S . solfataricus hmgA gene encodes a true biosynthetic HMG-CoA reductase . Expression of hmgA in Escherichia coli generated a protein that both converted HMG-CoA to mevalonate and cross-reacted with antibodies raised against rat liver HMG-CoA reductase . S . solfataricus HMG-CoA reductase was purified in 40% yield to a specific activity of 17.5 microU per mg at 50 degrees C by a sequence of steps that included heat treatment, ion-exchange chromatography, hydrophobic interaction chromatography, and affinity chromatography . The final product was homogeneous, as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis . The substrate was (S)- not (R)-HMG-CoA; the reductant was NADPH not NADH . The Km values for HMG-CoA (17 microM) and NADPH (23 microM) were similar in magnitude to those of other biosynthetic HMG-CoA reductases . Unlike other HMG-CoA reductases, the enzyme was stable at 90 degrees C and was optimally active at pH 5.5 and 85 degrees C. Arch Biochem Biophys, 1997 May 15, 341(2), 267 - 72 Identification of proteolipid from an extremely halophilic archaeon Halobacterium salinarum as an N,N'-dicyclohexyl-carbodiimide binding subunit of ATP synthase; Ihara K et al.; ATP synthesis in an extremely halophilic archaeon, Halobacterium salinarum, was inhibited by N-cyclohexyl-N'-{4-(dimethylamino)-alpha-naphthyl}carbodiimide (NCD-4), a fluorescent analog of N,N'-dicyclohexylcarbodiimide (DCCD) . By tracing the fluorescent signal, a hydrophobic 8-kDa protein (proteolipid) was purified from the halobacterial membrane as one of the most DCCD-reactive proteins and its N-terminal amino acid sequence was determined . The gene encoding the proteolipid was found in the region upstream of the genes encoding the two major subunits of halobacterial A-type ATPase {K . Ihara and Y.Mukohata (1991) Arch . Biochem . Biophys . 286, 111-116} . Halobacterial proteolipid was more similar in size to the proteolipid of F-type ATPase than that of V-type ATPase . However, multiple amino acid sequence alignment of proteolipids showed a higher degree of relatedness between V-type and A-type ATPase proteolipids . Together with the recent finding of a triplicate proteolipid encoding gene from the methanogenic archaeon Methanococcus jannaschii {C . J . Bult et al . (1996) Science 273, 1058-1073}, proteolipids from archaea seem to have diverse characteristics in comparison with those from eubacteria or from eukaryotes. J Biochem (Tokyo), 1997 May, 121(5), 876 - 80 Functional expression and site-directed mutagenesis of photoactive yellow protein; Mihara K et al.; The gene encoding photoactive yellow protein (PYP) was isolated from Ectothiorhodospira halophila, and a high-level expression system for PYP was constructed in Escherichia coli . The molecular weight and the absorption spectrum of PYP expressed in E . coli were identical with those of the native PYP isolated from E . halophila . The amino acid residues which might interact with the chromophore (Tyr42, Glu46, Thr50, Arg52, and Cys69) were mutated by site-directed mutagenesis and the absorption spectra of these mutants were examined to study the chromophore/protein interaction in PYP . The former three substitutions (Y42F, E46Q, and T50V) brought about red-shifts of the absorption spectra, but the substitution of Arg52 (R52Q) brought about no change and that of Cys69 (C69S) led to no formation of pigments . These results suggest that Tyr42, Glu46, and Thr50 strongly interact with the chromophore, while Arg52 does not contribute the color tuning of PYP. J Appl Microbiol, 1997 May, 82(5), 557 - 66 Pril-ampicillin-dextrin-ethanol agar for the isolation and quantification of Aeromonas spp . from polluted environmental waters; Imziln B et al.; Several selective media were evaluated for their suitability for the isolation and quantification of mesophilic Aeromonas species from naturally polluted samples . Satisfactory recoveries were obtained with most of them but only when densities of background microflora were low . When analysed samples were from highly polluted waters, results were inconsistent because they did not give quantitative recovery of mesophilic aeromonads or they did not permit ready differentiation of Aeromonas species from the competitive bacteria . A new medium was developed on the basis of the combination of some positive aspects of several published media, pril-ampicillin-dextrin-ethanol (PADE) agar . The medium employs dextrin (Merck 3006) as a fermentable carbohydrate and pril, ampicillin and ethanol as inhibitory substances . Recovery on PADE agar from suspensions of 15 tested strains of Aeromonas prepared from pure cultures was excellent . The confirmation rate of typical colonies designated Aeromonas spp . isolated from polluted samples exceeded 90% . Recoveries of stressed aeromonad strains on both PADE agar and a non-selective medium (TSA) did not show any significant difference (P > 0.05) . PADE agar was more reliable for quantitative recovery of mesophilic aeromonads than the other selective media because of its characteristics: (i) inhibition of the swarming of Proteus, (ii) good reduction of the background, (iii) inhibition of the over growth of Klebsiella spp., (iv) absence of NaCl makes it unfavourable for the growth of halophilic vibrios, (v) combination of two pH indicators permitted a very easy differentiation between Aeromonas colonies and the competitive microflora . The medium can also be used for isolation of aeromonads from various sources by membrane filtration. J Bacteriol, 1997 May, 179(10), 3146 - 53 2-Sulfotrehalose, a novel osmolyte in haloalkaliphilic archaea; Desmarais D et al.; A novel 1-->1 alpha-linked glucose disaccharide with sulfate at C-2 of one of the glucose moieties, 1-(2-O-sulfo-alpha-D-glucopyranosyl)-alpha-D-glycopyranose, was found to be the major organic solute accumulated by a Natronococcus sp . and several Natronobacterium species . The concentration of this novel disaccharide, termed sulfotrehalose, increased with increasing concentrations of external NaCl, behavior consistent with its identity as an osmolyte . A variety of noncharged disaccharides (trehalose, sucrose, cellobiose, and maltose) were added to the growth medium to see if they could suppress synthesis and accumulation of sulfotrehalose . Sucrose was the most effective in suppressing biosynthesis and accumulation of sulfotrehalose, with levels as low as 0.1 mM being able to significantly replace the novel charged osmolyte . Other common osmolytes (glycine betaine, glutamate, and proline) were not accumulated or used for osmotic balance in place of the sulfotrehalose by the halophilic archaeons. Arch Microbiol, 1997 May, 167(5), 259 - 68 Gas vesicle formation in halophilic Archaea; Pfeifer F et al.; Gas vesicles are intracellular, microbial flotation devices that consist of mainly one protein, GvpA . The formation of halobacterial gas vesicles occurs along a complex pathway involving 14 different gvp genes that are clustered in a genomic region termed the "vac region" . Various vac regions found in Halobacterium salinarum (p-vac and c-vac), Haloferax mediterranei (mc-vac), and Natronobacterium vacuolatum (nv-vac) have been investigated . Except for the latter vac region, the arrangement of the gvp genes is identical . Single gvp genes have been mutated to study the effect on gas vesicle synthesis in transformants and to determine their possible function . Each vac region exhibits a characteristic transcription pattern, and regulatory steps have been observed at the DNA, RNA, and protein level, indicating a complex regulatory network acting during gas vesicle gene expression. Microbiology, 1997 Apr, 143 ( Pt 4), 1141 - 9 Characterization of genes for the biosynthesis of the compatible solute ectoine from Marinococcus halophilus and osmoregulated expression in Escherichia coli; Louis P et al.; The genes of the biosynthetic pathway of ectoine (1,4,5,6-tetrahydro-2-methyl-4-pyrimidinecarboxylic acid) from the Gram-positive moderate halophile Marinococcus halophilus were cloned by functional expression in Escherichia coli . These genes were not only expressed, but also osmoregulated in E . coli, as demonstrated by increasing cytoplasmic ectoine concentration in response to medium salinity . Sequencing of a 4.4 kb fragment revealed four major ORFs, which were designated ectA, ectB, ectC and orfA . The significance of three of these genes for ectoine synthesis was proved by sequence comparison with known proteins and by physiological experiments . Several deletion derivatives of the sequenced fragment were introduced into E . coli and the resulting clones were investigated for their ability to synthesize ectoine or one of the intermediates in its biosynthetic pathway . It was demonstrated that ectA codes for L-2,4-diaminobutyric acid acetyltransferase, ectB for L-2,4-diaminobutyric acid transaminase and ectC for L-ectoine synthase . A DNA region upstream of ectA was shown to be necessary for the regulated expression of ectoine synthesis in response to the osmolarity of the medium. Int J Syst Bacteriol, 1997 Apr, 47(2), 515 - 21 Desulfovibrio profundus sp . nov., a novel barophilic sulfate-reducing bacterium from deep sediment layers in the Japan Sea; Bale SJ et al.; Several strains of a strictly anaerobic, vibrio-shaped or sigmoid, sulfate-reducing bacterium were isolated from deep marine sediments (depth, 80 and 500 m) obtained from the Japan Sea (Ocean Drilling Program Leg 128, site 798B) . This bacterium was identified as a member of the genus Desulfovibrio on the basis of the presence of desulfoviridin and characteristic phospholipid fatty acids (iso 17:1 omega 7 and iso 15:0), the small number of growth substrates utilized (lactate, pyruvate, and hydrogen), and 16S rRNA gene sequence analysis data . Based on data for 16S rRNA sequences (1,369 bp), all of the Japan Sea strains were identical to each other and were most closely related to Desulfovibrio salexigens and less closely related to Desulfovibrio desulfuricans (levels of similarity, 91 and 89.6%, respectively) . There were, however, considerable phenotypic differences (in temperatures, pressures, and salinities tolerated, growth substrates, and electron donors) between the Japan Sea isolates and the type strains of previously described desulfovibrios, as well as important differences among the Japan Sea isolates . The Japan Sea isolates were active (with sulfide production) over a wide temperature range (15 to 65 degrees C) and a wide sodium chloride concentration range (0.2 to 10%) (moderate halophile), and they were barophiles that were active at pressures up to about 40 MPa (400 atm) . The optimum pressures for activity corresponded to the calculated pressures at the depths from which the organisms were isolated (for isolates obtained at depths of 80 and 500 m the optimum activities occurred at 10 and 15 MPa, respectively {100 and 150 atm, respectively}) . This confirms that the organisms came from deep sediments and indicates that they are well-adapted for deep sediment conditions, which is consistent with other characteristics (utilization of hydrogen, fermentation, and utilization of ferric iron and organic sulfonates as electron acceptors) . We propose that Japan Sea isolate 500-1 is the type strain of a new species, Desulfovibrio profundus. Presse Med, 1997 Mar 8, 26(7), 316 - 8 {Primary Vibrio vulnificus septicemia . 1st documented case in the French West Indies}; Lamaury I et al.; BACKGROUND: Vibrio vulnificus is a non-choleric halophilic vibrion widely distributed in marine environments . Contamination in humans is uncommon except in coastal areas of the United States and Asia . We report the first documented case in the French West Indies . CASE REPORT: A 57-year-old native with alcoholic cirrhosis was hospitalized for septic shock . The infectious syndrome began suddenly a few hours earlier with fever, diarrhea, and intense pain in the calf muscles . In the absence of a suspected agent, a wide spectrum antibiotic was prescribed . On day 3, bullae developed over the legs and progressed, despite early surgical debridement, to bilateral rapidly extensive necrosing cellulitis . An above the knee amputation was required but did not prevent death on day 9 due to irreversible multiple organ failure . Blood cultures were positive for V . vulnificus . DISCUSSION: Primary septicemia due to V . vulnificus is mainly observed in subjects with an underlying liver disease and usually occurs after ingestion of contamined raw halieutic products such as oysters . The clinical presentation is characteristic with secondary necrotic ulcerations on the lower limbs . Improvement in the extremely poor prognosis of these infections depends on early initiation of an effective antibiotic with wide exeresis of necrotic tissue . Physicians should be aware of this severe infection despite its low frequency. J Biol Chem, 1997 Mar 7, 272(10), 6261 - 9 Characterization and subunit structure of the ATP synthase of the halophilic archaeon Haloferax volcanii and organization of the ATP synthase genes; Steinert K et al.; The archaeal ATPase of the halophile Haloferax volcanii synthesizes ATP at the expense of a proton gradient, as shown by sensitivity to the uncoupler carboxyl cyanide p-trifluoromethoxyphenylhydrazone, to the ionophore nigericin, and to the proton channel-modifying reagent N,N'-dicyclohexylcarbodiimide . The conditions for an optimally active ATP synthase have been determined . We were able to purify the enzyme complex and to identify the larger subunits with antisera raised against synthetic peptides . To identify additional subunits of this enzyme complex, we cloned and sequenced a gene cluster encoding five hydrophilic subunits of the A1 part of the proton-translocating archaeal ATP synthase . Initiation, termination, and ribosome-binding sequences as well as the result of a single transcript suggest that the ATPase genes are organized in an operon . The calculated molecular masses of the deduced gene products are 22 . 0 kDa (subunit D), 38.7 kDa (subunit C), 11.6 kDa (subunit E), 52.0 kDa (subunit B), and 64.5 kDa (subunit A) . The described operon contains genes in the order D, C, E, B, and A; it contains no gene for the hydrophobic, so-called proteolipid (subunit c, the proton-conducting subunit of the A0 part) . This subunit has been isolated and purified; its molecular mass as deduced by SDS-polyacrylamide gel electrophoresis is 9.7 kDa. Zh Mikrobiol Epidemiol Immunobiol, 1997 Mar-Apr, (2), 11 - 4 {Phagovars of halophilic vibrios}; Khaitovich AB et al.; The results of the phage typing of 164 halophilic vibrios revealed the most frequent combinations of lysing monophages, denoted by numbers: 1 (A, B, C, D), 2 (B, C, D), 3 (B, C) and 4 (C) . In accordance with the proposed scheme, the phage typing of 398 cultures from different ecosystems was carried out . Phagovar was determined in 77.1% of the cultures . Most frequently occurred phagovars 1 (31.9%), 4 (15.8%), 3 (6%), and 2 (3.7%) . Their proportion was 61% . 11 other phage combination causing the lysis of the cultures constituted 16.1%; 22.9% of the cultures could not be types . The use of the proposed scheme of phage typing permitted the determination of the temporal, regional, ecosystemic features of the circulation of halophilic vibrios in different ecosystems and regions, which was important for epidemiological analysis. Microbiol Mol Biol Rev, 1997 Mar, 61(1), 90 - 104 Evolutionary divergence and salinity-mediated selection in halophilic archaea; Dennis PP et al.; Halophilic (literally salt-loving) archaea are a highly evolved group of organisms that are uniquely able to survive in and exploit hypersaline environments . In this review, we examine the potential interplay between fluctuations in environmental salinity and the primary sequence and tertiary structure of halophilic proteins . The proteins of halophilic archaea are highly adapted and magnificently engineered to function in an intracellular milieu that is in ionic balance with an external environment containing between 2 and 5 M inorganic salt . To understand the nature of halophilic adaptation and to visualize this interplay, the sequences of genes encoding the L11, L1, L10, and L12 proteins of the large ribosome subunit and Mn/Fe superoxide dismutase proteins from three genera of halophilic archaea have been aligned and analyzed for the presence of synonymous and nonsynonymous nucleotide substitutions . Compared to homologous eubacterial genes, these halophilic genes exhibit an inordinately high proportion of nonsynonymous nucleotide substitutions that result in amino acid replacement in the encoded proteins . More than one-third of the replacements involve acidic amino acid residues . We suggest that fluctuations in environmental salinity provide the driving force for fixation of the excessive number of nonsynonymous substitutions . Tinkering with the number, location, and arrangement of acidic and other amino acid residues influences the fitness (i.e., hydrophobicity, surface hydration, and structural stability) of the halophilic protein . Tinkering is also evident at halophilic protein positions monomorphic or polymorphic for serine; more than one-third of these positions use both the TCN and the AGY serine codons, indicating that there have been multiple nonsynonymous substitutions at these positions . Our model suggests that fluctuating environmental salinity prevents optimization of fitness for many halophilic proteins and helps to explain the unusual evolutionary divergence of their encoding genes. Biochim Biophys Acta, 1997 Feb 8, 1337(2), 276 - 86 Purification and analysis of an extremely halophilic beta-galactosidase from Haloferax alicantei; Holmes ML et al.; As a first step in the development of a reporter system for gene expression in halophilic archaea, a beta-galactosidase was purified 140-fold from Haloferax alicantei (previously phenon K, strain Aa2.2) . An overproducing mutant was first isolated by UV mutagenesis and screening on agar plates containing X-Gal substrate . Cytoplasmic extracts of the mutant contained 25-fold higher enzyme levels than the parent . Purification of the active enzyme was greatly facilitated by the ability of sorbitol to stabilise enzyme activity in the absence of salt, which allowed conventional purification methods (e.g., ion-exchange chromatography) to be utilised . The enzyme was optimally active at 4 M NaCl and was estimated to be 180 +/- 20 kDa in size, consisting of two monomers (each 78 +/- 3 kDa) . It cleaves several different beta-galactoside substrates such as ONP-Gal, X-Gal and lactulose, but not lactose, and also has beta-D-fucosidase activity . No beta-glucosidase, beta-arabinosidase or beta-xylosidase activity could be detected . The amino-acid sequence at the N-terminus and of four proteolytic products has been determined. Mol Microbiol, 1997 Feb, 23(4), 791 - 7 Construction and analysis of a recombination-deficient (radA) mutant of Haloferax volcanii; Woods WG et al.; By deleting the radA open reading frame of an extreme halophile, Haloferax volcanii, we created and characterized a recombination-deficient archaeon . This strain, Hf . volcanii DS52, has no detectable DNA recombination, is more sensitive to DNA damage by UV light and ethylmethane sulfonate, and has a slower growth rate than the wild type . These characteristics are similar to those observed in recombination mutants of Eukarya and Bacteria, and show that the radA gene belongs in the recA/RAD51 family by function as well as sequence homology . In addition, strain DS52 was not transformable by plasmids pWL102 or pUBP2 (which contain pHV2 and pHH1 replicons, respectively), although it was readily transformed by plasmids containing a pHK2 replicon, indicating a role for radA in the maintenance or replication of some halobacterial plasmids . Despite its slower growth rate, Hf . volcanii DS52 was still easy to culture and transform, and should be suitable for use in studies where a recombination-deficient background is desired. Naunyn Schmiedebergs Arch Pharmacol, 1997 Feb, 355(2), 150 - 60 Expression of beta 2-adrenoceptors in halobacteria; Sohlemann P et al.; Halobacteria are halophilic representatives of the recently defined domain, the Archaea . Halobacterium salinarium belongs to this group of microorganisms and contains large amounts of bacteriorhodopsin in its membrane . Bacteriorhodopsin is a seven-transmembrane protein that consists of bacterio-opsin (BO), and the chromophore retinal, which is covalently attached to BO . We have investigated whether the expression machinery for BO can be utilized for synthesis of the human beta 2-adrenoceptor (beta 2-AR), a protein with a similar seven-transmembrane-helix topology . An expression vector for BO synthesis was modified to express beta 2-ARs under the control of BO regulatory clements in H . salinarium . Homologous recombination into the genome was verified by polymerase chain reactions . Northern blots revealed transcripts of the calculated size and significant amounts of epitope-tagged beta 2-ARs were detected in Western blots . However, binding of the beta-AR antagonist 125I-cyanopindolol revealed low levels of functional receptors, and the ligand binding properties of these receptors were altered when compared to native receptors . Expression of chimeras containing larger amino terminal portions of BO did not result in higher receptor levels . Expression of beta 2-AR in Haloferax volcanii, another member of halobacteria, was achieved with a vector carrying the ferredoxin promoter . The levels of functional receptor as determined by 125I-cyanopindolol binding were 180 fmol/mg protein . The beta-AR ligands isoprenaline and propranolol showed affinities expected for functional beta 2-ARs . Thus, functional human beta 2-ARs were expressed in halobacteria, constituting a first approach for expression of a eukaryotic protein in the domain of Archaea. FEMS Microbiol Lett, 1997 Feb 1, 147(1), 81 - 8 Haloanaerobium congolense sp . nov., an anaerobic, moderately halophilic, thiosulfate- and sulfur-reducing bacterium from an African oil field; Ravot G et al.; A strictly anaerobic, moderately halophilic, Gram-negative, non-motile rod-shaped bacterium was isolated from an oil-well head sample of an offshore Congolese oil field . The strain, designated SEBR 4224T (T = type strain), grew optimally at 42 degrees C and pH 7.0 in a complex medium containing 10% NaCl with a generation time of 2.5 h . Strain SEBR 4224T grew on a range of carbohydrates including fructose, galactose, D-glucose, maltose, D-mannose, D-ribose, sucrose, and trehalose . Yeast extract and/or bio-Trypcase was required for growth on carbohydrates and could not be replaced with amino acids and/or vitamins . The end-products from glucose fermentation were acetate, H2, and CO2 . Thiosulfate and elemental sulfur were used as electron acceptors . Thiosulfate improved carbohydrate utilization and biomass yields . The G + C content of the isolate was 34 mol% . Ribosomal 16S rRNA sequence analysis showed that strain SEBR 4224T is a new member of the genus Haloanaerobium . The lack of DNA homology with H . acetoethylicum, its closest relative, as determined by DNA-DNA hybridization supports the designation of strain SEBR 4224T as a new species, Haloanaerobium congolense sp . nov . The type strain is SEBR 4224T (= DSM 11287). J Bacteriol, 1997 Feb, 179(4), 1180 - 5 Biochemical and serological evidence for an RNase E-like activity in halophilic Archaea; Franzetti B et al.; Endoribonuclease RNase E appears to control the rate-limiting step that mediates the degradation of many mRNA species in bacteria . In this work, an RNase E-like activity in Archaea is described . An endoribonucleolytic activity from the extreme halophile Haloarcula marismortui showed the same RNA substrate specificity as the Escherichia coli RNase E and cross-reacted with a monoclonal antibody raised against E . coli RNase E . The archaeal RNase E activity was partially purified from the extreme halophilic cells and shown, contrary to the E . coli enzyme, to require a high salt concentration for cleavage specificity and stability . These data indicate that a halophilic RNA processing enzyme can specifically recognize and cleave mRNA from E . coli in an extremely salty environment (3 M KCI) . Having recently been shown in mammalian cells (A . Wennborg, B . Sohlberg, D . Angerer, G . Klein, and A . von Gabain, Proc . Natl . Acad . Sci . USA 92:7322-7326, 1995), RNase E-like activity has now been identified in all three evolutionary domains: Archaea, Bacteria, and Eukarya . This strongly suggests that mRNA decay mechanisms are highly conserved despite quite different environmental conditions. Curr Microbiol, 1997 Feb, 34(2), 85 - 90 Salt-Sensitive and Auxotrophic Mutants of Halomonas elongata and H . meridiana by Use of Hydroxylamine Mutagenesis Cánovas D, Vargas C, Ventosa A, Nieto JJ. The killing action and induced mutagenicity inhydroxylamine (HA)-treated cells of two moderately halophilic species of thegenus Halomonas, H . elongata and H . meridiana, wereinvestigated . A high sensitivity of H . elongata and especially ofH . meridiana to HA was found . The efficiency of the mutagenicityobtained with the HA treatment was tested at different salinities . Optimalexperimental conditions for HA mutagenesis of these two moderate halophileswere determined . A clear, efficient mutagenicity of both H . elongataand H . meridiana after HA mutagenesis was achieved . The optimalprocedures yielded a number of useful auxotrophic mutants of H.elongata as well as different salt-sensitive mutants of H.elongata and H . meridiana for further studies . Some of theselatter mutants appeared to be affected in the synthesis of compatiblesolutes. Arch Microbiol, 1997 Jan 29, 167(1), 11 - 8 Chromatium glycolicum sp . nov., a moderately halophilic purple sulfur bacterium that uses glycolate as substrate Caumette P, Imhoff JF, Suling J, Matheron R. From the microbial mats that develop in Solar Lake, a new purple sulfur bacterium was isolated . This strain (Chromatium strain SL 3201) was morphologically similar to Chromatium gracile and Chromatium minutissimum . Chromatium SL 3201 was found to be a moderate halophile with a growth range between 2 and 20% NaCl (optimum 4-5% NaCl) and was able to grow photo-organotrophically using glycolate and glycerol . It is the first described phototrophic sulfur bacterium able to use glycolate . According to NaCl requirements and utilization of organic compounds, the strain is not related to any known species of the genus Chromatium . On the basis of its 16S rRNA gene sequence, it clusters with other Chromatium species and is most similar to Chromatium salexigens and Chr . gracile, but it is sufficiently separated to be considered as a new species of the genus . It is, therefore, described as Chromatium glycolicum sp . nov. Eur J Biochem, 1997 Jan 15, 243(1-2), 141 - 50 Seryl-tRNA synthetase from the extreme halophile Haloarcula marismortui--isolation, characterization and sequencing of the gene and its expression in Escherichia coli; Taupin CM et al.; The seryl-tRNA synthetase from the extreme halophilic archaebacterium Haloarcula marismortui, belonging to the group Euryarchaeota, has been purified and its hyperhalophilic behavior demonstrated by activity and stability tests in KCl, NaCl and MgCl2 solutions . Although the natural external environment of this archaebacterium is rich in sodium ions and poor in potassium ions, the converse being the case in the bacterial cytosol . there is no large significant difference in activity and stability in vitro of the enzyme between solutions of NaCl and KCl . Low, but not high, concentrations of MgCl2 stabilize the enzyme . The enzyme aminoacylates tRNA from Escherichia coli even under the high salt conditions of the assay . A fluorescence study indicated that low salt denaturation of the hyperhalophilic enzyme is a biphasic process . The hyperhalophilic enzyme demonstrated immunological reactivity with antisera against the catalytic domain of the homologous E . coli enzyme . The gene coding for the H . marismortui enzyme has been isolated and sequenced . The derived amino acid sequence is the first of a hyperhalophilic aminoacyl-tRNA synthetase . The wild-type gene and a mutant gene with a deletion of the halophile-specific insertion were expressed in E . coli using the T7 RNA polymerase and the Thiofusion expression systems . None of the expressed proteins were enzymically active . A structural model has been produced by comparison with other seryl-tRNA synthetases which illustrates the high negative-charge density of the surface of the hyperhalophilic enzyme. Protein Sci, 1997 Jan, 6(1), 156 - 61 3-Hydroxy-3-methylglutaryl-coenzyme A reductase of Haloferax volcanii: role of histidine 398 and attenuation of activity by introduction of negative charge at position 404; Bischoff KM et al.; Mutant 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductases of the halophilic archaeon Haloferax volcanii were constructed to test the proposed mechanism that phosphorylation downregulates the activity of higher eukarya HMG-CoA reductases via charge-charge interaction with the active site histidine . To first verify the sequence-based inference that His 398 is the catalytic histidine of the H . volcanii enzyme, enzyme H398Q was constructed, purified, and assayed for catalysis of three reactions: {1} reductive deacylation of HMG-CoA, {2} reduction of mevaldehyde, and {3} oxidative acylation of mevaldehyde . Enzyme H398Q had low activity for catalysis of reaction {1} or {3}, but readily catalyzed mevaldehyde reduction . By analogy to hamster HMG-CoA reductase, we conclude that His 398 is the active site histidine . Mutant forms of the 403-residue H . volcanii enzyme were constructed to model phosphorylation and infer whether attenuated activity involved interaction with His 398 . Chimeric H . volcanii-hamster enzymes constructed in an effort to create an active, phosphorylatable chimeric enzyme were inactive or not phosphorylated . We therefore added Asp at position 404 to mimic the introduction of negative charge that would accompany phosphorylation . Enzyme 404D/H398Q was inactive for reaction {1} or {3}, but catalyzed reaction {2} at 35% the wild-type rate . These observations are consistent with the model that attenuation of catalytic activity results from an ionic interaction between the imidazolium cation of His 398 and the carboxylate anion of Asp 404. Int J Syst Bacteriol, 1997 Jan, 47(1), 122 - 6 Thermonema rossianum sp . nov., a new thermophilic and slightly halophilic species from saline hot springs in Naples, Italy; Tenreiro S et al.; Six slightly halophilic, thermophilic bacterial strains were isolated from saline hot springs along the Bay of Naples, Italy . These strains produce bright yellow colonies and have a filamentous morphology and an optimum growth temperature of about 60 degrees C . Lipid composition and 16S ribosomal DNA sequence analyses showed that these strains belong to the genus Thermonema, a member of the cytophaga-flavobacter-bacteroides phylum . Growth was observed in medium containing 1 to 3% NaCl . The DNA G + C content was 50.9 mol% . DNA-DNA hybridization studies showed that these strains represent a new species of the genus Thermonema . We propose that strain NR-27T (T = type strain) and the other strains represent a new species, Thermonema rossianum . Strain NR-27 (= DSM 10300) is the type strain of this species. Int J Syst Bacteriol, 1997 Jan, 47(1), 73 - 7 Haloarcula argentinensis sp . nov . and Haloarcula mukohataei sp . nov., two new extremely halophilic archaea collected in Argentina; Ihara K et al.; Strains arg-1T (T = type strain) and arg-2T, two new strains of extremely halophilic archaea, were isolated from the soils of the Argentine salt flats . The taxonomic features of arg-1T were similar to, but distinct from, those of the type strain of Haloarcula vallismortis and other Haloarcula species . On the 16S rRNA phylogenetic tree, strain arg-1T formed a cluster together with Haloarcula species . Strain arg-2T differed in its glycolipid composition but still was more closely related to the genus Haloarcula than to other established genera . We propose that strain arg-1T be classified as a member of a new species, Haloarcula argentinensis, and that strain arg-2T be classified as a member of Haloarcula mukohataei sp . nov., although arg-2T may belong to a new genus or a subgenus of the genus Haloarcula . The type strain of H . argentinensis is strain arg-1 (= JCM 9737), and the type strain of H . mukohataei is strain arg-2 (= JCM 9738). J Bacteriol, 1997 Jan, 179(2), 548 - 51 Isolation, sequence, and expression of the gene encoding halocin H4, a bacteriocin from the halophilic archaeon Haloferax mediterranei R4; Cheung J et al.; The first gene to encode a haloarchaeal bacteriocin (halocin H4) has been cloned and sequenced from Haloferax mediterranei R4 . Both the signal sequence in the halocin H4 preprotein and the monocistronic halH4 gene have some unusual features . The physiology of halH4 expression reveals that although halH4 transcripts are present at low basal levels during exponential growth, halocin H4 activity first appears as the culture enters stationary phase . As halocin activity levels increase, so do transcript levels, but then activity levels decrease precipitously while transcript levels remain elevated. J Inorg Biochem, 1997 Jan, 65(1), 35 - 43 Mn-superoxide dismutase from the halophilic halotolerant bacterium Ba1--isolation and active site spectroscopic studies; Yorkovsky Y et al.; The superoxide-dismutase (SOD) enzyme, isolated from the halophilic halotolerant bacterium Ba1, was found to be a dimer with a molecular weight of 40 kD and a subunit weight of 23.5 kD . The partial N-terminal sequence showed significant homology to SODs isolated from various sources . Metal analysis showed that SOD from Ba1 contains manganese and iron with the following stoichiometries: 0.9 +/- 0.4 Mn/dimer and 0.6 +/- 0.2 Fe/dimer . Two bands were obtained by isoelectric-focusing, at pI of 4.45 and at 4.40 . Native SOD from Ba1 at room temperature was ESR silent . An ESR spectrum of hydrated Mn(II) was obtained from denaturated enzyme . Native enzyme cooled to 97 K showed an ESR spectrum identified as being due to Fe(III) . The spectrum was pH-independent . SOD from Ba1 was not inactivated by H2O2 . On the basis of these observations, SOD from Ba1 was characterized as MnSOD . The excitation fluorescence spectrum of SOD from Ba1 showed four main peaks in the visible region . The effects on the spectra of KSCN, NaN3, NaF, and ascorbate were examined . Measurements of H2(17)O-nmr relaxation times T1 and T2, for solutions containing E . coli MnSOD and FeSOD, showed no paramagnetic contribution . These results support the assumption that the water molecule at the active site is strongly bound. Carbohydr Res, 1996 Dec 13, 295, 147 - 56 The structure of the exopolysaccharide produced by the halophilic Archaeon Haloferax mediterranei strain R4 (ATCC 33500); Parolis H et al.; The halophilic Archaeon Haloferax mediterranei exudes into the growth medium a high molecular weight sulfated polysaccharide . The structure of the repeating unit of this polymer was determined by a combination of glycose, methylation, and sulfate analysis, periodate oxidation, and 1D and 2D NMR spectroscopic analysis of the native and periodate-oxidised/reduced polysaccharides . The location of the sulfate group was established from the 1H and 13C NMR data . The structure of the repeating unit of the polysaccharide may be written as {formula: see text} J Mol Biol, 1996 Dec 6, 264(3), 567 - 84 Ectothiorhodospira halophila ferrocytochrome c551: solution structure and comparison with bacterial cytochromes c; Bersch B et al.; The solution structure of the Ectothiorhodospira halophila ferrocytochrome c551 has been determined . This molecule belongs to a separate class of small bacterial cytochromes c for which no 3D structure has been reported so far . It is characterized by a very low redox potential (58 mV) and is isolated from the periplasm of halophilic purple phototrophic bacteria . For the 78 residue protein, 1445 NOE derived distance constraints were used in a combined simulated annealing/restrained molecular dynamics calculation . The final ensemble of 37 structures presents a backbone r.m.s.d . of less than 0.5 A compared to the mean structure . The physical viability of these structures was investigated by subjecting eight of them to a constraint free molecular dynamics simulation . No systematic conformational change was observed and the average backbone r.m.s.d . compared to the initial structures was less than 1.5 A . The structure of the E . halophila cytochrome c551 shows a striking resemblance to Azotobacter vinelandii cytochrome c5 . Significant differences in backbone conformations occur in three small regions which are implicated in solvent protection of the heme propionates and thiomethyl-8(1) . Comparison with Pseudomonas aeruginosa cytochrome c551 reveals that only the common cytochrome c core, i.e . three helices, is conserved . The folding of the protein chain around the heme propionates is very different and results in more efficient solvent protection in Ps . aeruginosa . The electrostatic surface of E . halophila cytochrome c551 was found to be significantly different from mitochondrial cytochromes c and bacterial cytochromes c2 but similar to that of Ps . aeruginosa cytochrome c551. Arch Microbiol, 1996 Dec, 166(6), 394 - 8 Taxonomic relationships of Thiobacillus halophilus, T . aquaesulis, and other species of Thiobacillus, as determined using 16S rDNA sequencing; McDonald IR et al.; Total base sequences of the 16S rRNA genes of Thiobacillus halophilus and Thiobacillus aquaesulis show that these bacteria fall into the gamma- and beta-subdivisions, respectively of the Proteobacteria . The closest relative of T . halophilus is Thiobacillus hydrothermalis (with 98.7% similarity), and the closest relative of T . aquaesulis is Thiobacillus thioparus (93.2% similarity) . Physiological properties and mol% G+C content of their DNA serve to confirm that these four organisms are all distinct species . It is reiterated that the species currently assigned to the genus Thiobacillus are clearly so diverse that they need reclassification into several genera . The type species, T . thioparus, is unequivocally placed in the beta-subdivision of the Proteobacteria, thus requiring that the use of the genus name Thiobacillus be restricted to the chemolithoautotrophic species falling into that group . T . aquaesulis and T . thioparus may thus be regarded as true species of Thiobacillus . The relatively large number of obligately chemolithoautotrophic Thiobacillus species falling in the gamma-subdivision of the Proteobacteria need further study in order to assess the case for reclassification into one or more new or different genera. Microbiologia, 1996 Dec, 12(4), 571 - 84 Free-living spirochetes from Cape Cod microbial mats detected by electron microscopy; Teal TH et al.; Spirochetes from microbial mats and anaerobic mud samples collected in salt marshes were studied by light microscopy, whole mount and thin section transmission electron microscopy . Enriched in cellobiose-rifampin medium, selective for Spirochaeta bajacaliforniensis, seven distinguishable spirochete morphotypes were observed . Their diameters ranged from 0.17 micron to > 0.45 micron . Six of these morphotypes came from southwest Cape Cod, Massachusetts: five from Microcoleus-dominated mat samples collected at Sippewissett salt marsh and one from anoxic mud collected at School Street salt marsh (on the east side of Eel Pond) . The seventh morphotype was enriched from anoxic mud sampled from the north central Cape Cod, at the Sandy Neck salt marsh . Five of these morphotypes are similar or identical to previously described spirochetes (Leptospira, Spirochaeta halophila, Spirochaeta bajacaliforniensis, Spirosymplokos deltaeiberi and Treponema), whereas the other two have unique features that suggest they have not been previously described . One of the morphotypes resembles Spirosymplokos deltaeiberi (the largest free-living spirochete described), in its large variable diameter (0.4-3.0 microns), cytoplasmic granules, and spherical (round) bodies with composite structure . This resemblance permits its tentative identification as a Sippewissett strain of Spirosymplokos deltaeiberi . Microbial mats samples collected in sterile Petri dishes and stored dry for more than four years yielded many organisms upon rewetting, including small unidentified spirochetes in at least 4 out of 100 enrichments. Plant Physiol, 1996 Dec, 112(4), 1693 - 702 Primary structure and effect of pH on the expression of the plasma membrane H(+)-ATPase from Dunaliella acidophila and Dunaliella salina; Weiss M et al.; The plasma membrane H(+)-ATPase gene was cloned and sequenced from the extremely acidophilic green alga Dunaliella acidophila and from the extremely halotolerant Dunaliella salina . A special feature of the Dunaliella H(+)-ATPase is an extended C-terminal domain . The deduced amino acid sequences of the two proteins are 75% identical but differ in their C terminus . A hydrophilic loop within this domain in D . salina, which presumably faces the cell exterior, has a high ratio of acidic over basic amino acids, typical of halophilic proteins . The amount of the ATPase protein in plasma membranes and the level of its mRNA transcript in D . acidophila are far higher than in D . salina, suggesting that D . acidophila overexpresses the enzyme . A pH shift from 9.0 to 7.0 induces in D . salina a large increase in the level of the H(+)-ATPase mRNA and in the amount of the H(+)-ATPase protein . This suggests that the expression of the H(+)-ATPase in D . salina is pH-regulated at the transcriptional level . The implications of these findings are discussed with respect to the adaptive pressures imposed on these algal species by their exceptional environmental conditions. J Bacteriol, 1996 Dec, 178(24), 7221 - 6 Osmoprotectants in Halomonas elongata: high-affinity betaine transport system and choline-betaine pathway; Canovas D et al.; The osmoregulatory pathways of the moderately halophilic bacterium Halomonas elongata DSM 3043 have been investigated . This strain grew optimally at 1.5 to 2 M NaCl in M63 glucose-defined medium . It required at least 0.5 M NaCl for growth, which is a higher concentration than that exhibited by the H . elongata type strain ATCC 33173 . Externally provided betaine, choline, or choline-O-sulfate (but not proline, ectoine, or proline betaine) enhanced the growth of H . elongata on 3 M NaCl-glucose-M63 plates, demonstrating the utilization of these compounds as osmoprotectants . Moreover, betaine and choline stimulated the growth of H . elongata DSM 3043 over the entire range of salinity, although betaine was more effective than choline at salinities below and above the optimum . We found that H . elongata DSM 3043 has at least one high-affinity transport system for betaine (K(m) = 3.06 microM and Vmax = 9.96 nmol of betaine min(-1) mg of protein(-1)) . Competition assays demonstrated that proline betaine and ectoine, but not proline, choline, or choline-O-sulfate, are also transported by the betaine permease . Finally, thin-layer chromatography and 13C-nuclear magnetic resonance analysis showed that exogenous choline was taken up and transformed to betaine by H . elongata, demonstrating the existence of a choline-glycine betaine pathway in this moderately halophilic bacterium. Biochemistry, 1996 Nov 12, 35(45), 14047 - 53 Photoreaction cycle of photoactive yellow protein from Ectothiorhodospira halophila studied by low-temperature spectroscopy; Imamoto Y et al.; The photocycle of photoactive yellow protein (PYP) from Ectothiorhodospira halophila was studied by low-temperature spectroscopy . Irradiation of PYP at -190 degrees C produced a photo-steady-state mixture composed of bathochromic and hypsochromic photoproducts (PYPB and PYPH) . Upon warming, PYPH was thermally converted to a slightly blue-shifted intermediate (PYPHL) above -150 degrees C and then to a red-shifted one (PYPL) above -80 degrees C . PYPB was thermally converted to the blue-shifted intermediate (PYPBL) above -180 degrees C and then to PYPL above -90 degrees C . PYPL thermally reverted to PYP above -50 degrees C, completing the photocycle . The spectral properties of PYPL formed at low temperature suggest that it corresponds to the red-shifted photoproduct detected in the nano- to microsecond time scale at room temperature (A465) . The absolute absorption spectra of PYPH, PYPB, and PYPL were estimated, and their absorption maxima were determined to be 442 and 489 nm at -190 degrees C and 456 nm at -80 degrees C, respectively . Although a near-UV intermediate (A355) is observed in the recovery process of PYP from A465 at room temperature, it was not detected at low temperatures, probably due to the effects of temperature and the presence of glycerol . A scheme of the photocycle of PYP is presented. Int J Food Microbiol, 1996 Nov, 33(1), 121 - 37 Microbiological spoilage of fish and fish products; Gram L et al.; Spoilage of fresh and lightly preserved fish products is caused by microbial action . This paper reviews the current knowledge in terms of the microbiology of fish and fish products with particular emphasis on identification of specific spoilage bacteria and the qualitative and quantitative biochemical indicators of spoilage . Shewanella putrefaciens and Pseudomonas spp . are the specific spoilage bacteria of iced fresh fish regardless of the origin of the fish . Modified atmosphere stored marine fish from temperate waters are spoiled by the CO2 resistant Photobacterium phosphoreum whereas Gram-positive bacteria are likely spoilers of CO2 packed fish from fresh or tropical waters . Fish products with high salt contents may spoil due to growth of halophilic bacteria (salted fish) or growth of anaerobic bacteria and yeasts (barrel salted fish) . Whilst the spoilage of fresh and highly salted fish is well understood, much less is known about spoilage of lightly preserved fish products . It is concluded that the spoilage is probably caused by lactic acid bacteria, certain psychotrophic Enterobacteriaceae and/or Photobacterium phosphoreum . However, more work is needed in this area. Gene, 1996 Oct 17, 176(1-2), 27 - 33 Protein-encoding genes in the sulfothermophilic archaea Sulfolobus and Pyrococcus; De Vendittis E et al.; A number of unrelated protein-encoding genes from sulfothermophilic archaea, Sulfolobus acidocaldarius, Sulfolobus solfataricus, Pyrococcus furiosus and Pyrococcus woesei, has been analyzed . In the Sulfolobus genus, the content of A + T is significantly higher than that of C + G and the base usage follows the order, A > T > G > C . In Pyrococcus, the A + T content is also higher than that of C + G, but with lower values; in the order of base usage, G precedes T . The codon usage of these sulfothermophiles has been determined; alternative start codons are frequently used in both genera; codon preferences reflect the rich A + T composition of the corresponding genomes; for both genera the codon bias is particularly evident within the different arginine triplets, where AGA and AGG are predominant . From the similarities in the codon usage, close taxonomic relationships become evident within the Sulfolobus or the Pyrococcus genus; a lower, but significant similarity is also clear between these genera . The synonymous codon usage of these sulfothermophiles shows similarities with that of Saccharomyces cerevisiae and bovine mitochondria, whereas clear divergences are observed with the halophilic archaeal genus, Halobacterium, or the eubacterium, Escherichia coli . The unrelated proteins of the considered sulfothermophiles have been analyzed for the content of hydrophobic residues; the comparison with mesophiles reveals a significant increase in the average hydrophobicity of amino acid residues . This finding could indicate a mechanism of adaptation of proteins in organisms living under extreme environments . It is noteworthy that an opposite trend, i.e . a decreased average hydrophobicity, occurs in unrelated halophilic proteins. Eur J Biochem, 1996 Oct 15, 241(2), 440 - 52 The solution structure refinement of the paramagnetic reduced high-potential iron-sulfur protein I from Ectothiorhodospira halophila by using stable isotope labeling and nuclear relaxation; Bertini I et al.; The reduced high-potential iron sulfur protein I from Ectothiorhodospira halophila which contains the {4Fe-4S}2+ polymetallic center has been fully labeled with 15N and 13C . The protein is paramagnetic, the nuclear relaxation times of nuclei close to the paramagnetic ion are drastically shortened and some strategic dipolar connectivities are lost . Notwithstanding, the solution structure has been reported {Banci, L., Bertini, I., Eltis, L . D., Felli, I . C., Kastrau, D . H . W., Luchinat, C., Piccioli, M., Pierattelli, R . & Smith, M . (1994) Eur . J . Biochem . 225, 715-725} . We have performed classical HNHA, HNCA soft-COSY, soft-HCCH E . COSY and 15N-1H correlated NOESY experiments in order to obtain a set of 3J scalar coupling constants . Some experiments have been optimized to counterbalance the effect of paramagnetism . From heteronuclear single-quantum experiments preceded by a 180 degrees pulse and variable delay times, the non-selective magnetization recovery has been followed from which the contribution to dipolar relaxation of nuclei due to the interaction with the paramagnetic metal ions (rho para) has been estimated . Finally, the intensities of NOEs have been corrected for the presence of paramagnetic metal ions and these corrected values together with 3J values and rho para data have been used to obtain a well defined solution structure . The aim is that of obtaining a structure with enough constraints to be well resolved all over the protein, including the vicinity of the paramagnetic metal cluster, which is anchored to the protein through the rho para constraints . In total, 1226 corrected NOESY crosspeaks (of which 945 were found to be meaningful), 37 one-dimensional NOEs, 39 3JHNH alpha and 37 3JHNC' (providing 45 phi dihedral angle constraints) 54 3JH alpha H beta and 31 3JNH beta (providing 26 chi 1 dihedral angle constraints), 4 chi 2 dihedral angle constraints of the coordinated cysteines, obtained from the hyperfine shifts of the beta CH protons, and 58 rho para constraints, have been used for structure calculation . Restrained molecular dynamics simulations have also been performed to provide the final family of structures . This research demonstrates that stable isotope labeling provides specific advantages for the NMR investigation of paramagnetic molecules, as the small magnetic moment of heteronuclei minimizes the paramagnetic influence of unpaired electrons. Biochim Biophys Acta, 1996 Oct 2, 1284(1), 79 - 85 Voltage-dependent absorbance change of carotenoids in halophilic archaebacteria; Seki SI et al.; Membrane vesicles of wild-type Halobacterium sp . mex strain show a wavy absorbance change which has not been so far reported in halophilic archaebacteria . A white mutant strain lacking carotenoids did not show the wavy absorbance change . The wavy absorbance change in the range of 440-590 nm was induced by a red flash (600-640 nm), which photoexcited electrogenic ion pumps, mex bacteriorhodopsin and mex halorhodopsin but not carotenoids . The wavy change was also caused by K+ diffusion potentials without light . These results suggest that the wavy absorbance change in the membrane vesicles is the voltage-dependent absorbance change of the carotenoids. Appl Environ Microbiol, 1996 Oct, 62(10), 3779 - 86 Phylogenetic analyses of some extremely halophilic archaea isolated from Dead Sea water, determined on the basis of their 16S rRNA sequences; Arahal DR et al.; Twenty-two extremely halophilic aerobic archaeal strains were isolated from enrichments prepared from Dead Sea water samples collected 57 years ago . The isolates were phenotypically clustered into five different groups, and a representative from each group was chosen for further study . Almost the entire sequences of the 16S rRNA genes of these representatives, and of Haloarcula hispanica ATCC 33960, were determined to establish their phylogenetic positions . The sequences of these strains were compared to previously published sequences of 27 reference halophilic archaea (members of the family Halobacteriaceae) and two other archaea, Methanobacterium formicicum DSM 1312 and Methanospirillum hungatei DSM 864 . Phylogenetic analysis using approximately 1,400 base comparisons of 16S rRNA-encoding gene sequences demonstrated that the five isolates clustered closely to species belonging to three different genera--Haloferax, Halobacterium, and Haloarcula . Strains E1 and E8 were closely related and identified as members of the species Haloferax volcanii, and strain E12 was closely related and identified as a member of the species Halobacterium salinarum . However, strains E2 and E11 clustered in the Haloarcula branch with Haloarcula hispanica as the closest relative at 98.9 and 98.8% similarity, respectively . Strains E2 and E11 could represent two new species of the genus Haloarcula . However, because strains of these two new species were isolated from a single source, they will not be named until additional strains are isolated from other sources and fully characterized. Mutat Res, 1996 Sep 2, 364(1), 25 - 32 The repair of ultraviolet light-induced DNA damage in the halophilic archaebacteria, Halobacterium cutirubrum, Halobacterium halobium and Haloferax volcanii; McCready S; Extremely halophilic archaebacteria have been reported to have no capacity for dark repair (excision repair) of ultraviolet damage and to rely on very efficient photoreactivation for recovery after UVC irradiation . Post-UV incubation in the light restores 100% survival in these organisms . This has been taken to indicate that cyclobutane dimers are the only significant UV-induced lesions and that they are completely repaired by photoreactivation . However, in all organisms studied to date, pyrimidine (6-4) pyrimidone photoproducts are a significant cytotoxic and mutagenic lesion and constitute 10-30% of UV photoproducts . The question arises, therefore--are 6-4 photoproducts induced in the halophilic archaebacteria and, if they are, how are they repaired? This paper shows that both cyclobutane dimers and 6-4 photoproducts are induced in the extremely halophilic archaebacteria, Halobacterium cutirubrum, Halobacterium halobium and Haloferax volcanii, at similar levels as in other organisms . Furthermore, contrary to previous reports, there is dark repair of both lesions . As in other organisms, 6-4 photoproducts are removed more efficiently than cyclobutane dimers in the dark . In the light, cyclobutane dimers are repaired very rapidly and there is also photoenhanced repair of 6-4 photoproducts . This work confirms that organisms such as Halobacterium and Haloferax which live in conditions of high exposure to sunlight have very efficient rates of repair of UV lesions in the light. Arch Microbiol, 1996 Sep, 166(3), 169 - 75 The porins from the halophilic species Ectothiorhodospira shaposhnikovii and Ectothiorhodospira vacuolata; Wolf E et al.; Major outer membrane proteins with porin activity were isolated from cell envelopes of the halophilic strains Ectothiorhodospira shaposhnikovii N1 and Ectothiorhodospira vacuolata beta1 . The porins were obtained as oligomers . They dissociated into monomers by heat or EDTA treatment . The molecular masses of the monomers were determined by mass spectrometry to be 39,285 and 37,160 Da for E . shaposhnikovii N1 and E . vacuolata beta1, respectively . Both were shown by analytical ultracentrifugation to be trimers of about 112, 000 Da . Circular dichroism spectra indicated predominantly beta-sheet structure . The 18 N-terminal amino acid sequences of the two porins were identical except for the amino acids in positions 12 and 14 . No sequence similarity with the primary structure of known porins was found . In reconstitution experiments with lipid bilayers, the porins of E . shaposhnikovii N1 and E . vacuolata beta1 formed channels with a single-channel conductance of 1.5 and 0.7 nS, respectively, in 1 M KCl . The single-channel conductance saturated with increasing salt concentration, indicating a putative binding-site for anions in the channel since both porins exhibited anion-selectivity . For the porin of E . vacuolata beta1, but not for that of E . shaposhnikovii N1, an influence of detergent concentration on the single-channel conductance was observed. J Biol Chem, 1996 Aug 16, 271(33), 19724 - 31 Isolation and chromosomal distribution of natural Z-DNA-forming sequences in Halobacterium halobium; Kim J et al.; Conditions favoring left-handed Z-DNA such as high salinity (> 4 ), high negative DNA supercoiling, and GC-rich DNA {statistically favoring d(CG)n repeat sequences}, are all found in the extremely halophilic archaeum (archaebacterium) Halobacterium halobium . In order to identify and study Z-DNA regions of the H . halobium genome, an affinity chromatography method with high Z-DNA selection efficiency was developed . Supercoiled plasmids were incubated with a Z-DNA-specific antibody (Z22) and passed over a protein A-agarose column, and the bound plasmids were eluted using an ethidium bromide gradient . In control experiments using mixtures of pUC12 (Z-negative) and a d(CG)5-containing (Z-positive) pUC12 derivative, up to 4,000-fold enrichment of the Z-DNA-containing plasmid was demonstrated per cycle of the Z-DNA selection procedure . The selection efficiency was determined by transformation of Escherichia coli DH5alpha with eluted plasmids and blue-white screening on X-gal plates . Twenty recombinant plasmids containing Z-DNA-forming sequences of H . halobium were isolated from a genomic library using affinity chromatography . Z-DNA-forming sequences in selected plasmids were identified by bandshift and antibody footprinting assays using Z22 monoclonal antibody . Alternating purine-pyrimidine sequences ranging from 8 base pairs (bp) to 13 bp with at least a 6-bp alternating d(GC) stretch were found in the Z22 antibody binding regions of isolated plasmids . The distribution of Z-DNA-forming sequences in the Halobacterium salinarum GRB chromosome was analyzed by dot-blot hybridization of an ordered cosmid library using the cloned H . halobium Z-DNA segments as probe . Among the 11 Z-DNA segments tested, five were found to be clustered in a 100-kilobase pair region of the genome, whereas six others were distributed throughout the rest of the genome. Biodegradation, 1996 Aug, 7(4), 297 - 302 Bacterial influence on partitioning rate during the biodegradation of styrene in a biphasic aqueous-organic system; Osswald P et al.; The degradation by a consortium of slightly-halophile marine bacteria of styrene initially dissolved in silicone oil was monitored in batch reactors stirred at 75, 125 and 500 rpm, respectively . In the 75 and 125 rpm cases, the styrene biodegradation rate was higher than the rate of spontaneous partitioning of styrene from the oil to the water, determined under abiotic conditions . Abiotic transfer tests carried out after biodegradation runs revealed that bacterial activity had resulted in a significant increase in the rate of styrene partitioning between the two liquid phases . Even though bacterial adsorption was noticeable at the oil-water interface, this effect appeared to be due to the release by the bacteria of chemicals in the aqueous phase . Similarity with observations made with Triton X-100 suggested that the chemicals released may have been biosurfactants or solubilizing agents. Mol Microbiol, 1996 Aug, 21(4), 683 - 93 Photobiology of microorganisms: how photosensors catch a photon to initialize signalling; Hellingwerf KJ et al.; Photobiological processes are relevant for microorganisms for energy generation, protection against excess and/or damaging radiation, and for signalling . In this review we give an overview of the knowledge on the functioning of photosensors in microorganisms, with special emphasis on the conformational changes that lead to signal generation and transduction . Light is absorbed by specific chromophores, which are tuned, by their proteinaceous environment, to function optimally . These chromophores belong to three classes: tetrapyrroles, polyenes and aromatics . The chemical structure of photosensing pigment/protein complexes has been resolved for many of the photobiological processes that have a characteristic sensitivity in the visible and infrared part of the spectrum of (solar) radiation . However, knowledge about the structure of photoreceptors responsible for several physiologically well-characterized photoresponses to UV- and blue light is still lacking . For a limited number of phototransduction processes, the details of light-induced signal transfer are beginning to be understood in atomic detail . This applies particularly to two photosensors involved in phototactic responses in bacteria: sensory rhodopsin I (SR-I) from Halobacterium salinarium and photoactive yellow protein (PYP) from Ectothiorhodospira halophila . The SR-1 system is of special interest because the transducer accepting the signal from SR-1 was recently identified as Htr-1, a homologue of the methyl-accepting chemotaxis proteins which have been characterized in Escherichia coli . PYP, on the other hand, may be the first photosensor to actually reveal all relevant details of the kinetics, thermodynamics, and molecular motion of light-induced signal generation, through an understanding of how the photo-isomerization of the chromophore forces the sensor protein into the signalling state . Here we compare these photosensors and discuss common themes in the initiation of photosensory signal transduction in microorganisms in terms of the molecular properties of photosensors and their signalling state. J Bacteriol, 1996 Aug, 178(15), 4737 - 41 Conserved sequence elements involved in regulation of ribosomal protein gene expression in halophilic archaea; Shimmin LC et al.; A region of the Haloferax volcanii genome encoding ribosomal proteins L11e, L1e, L10e, and L12e was cloned and sequenced, and the transcripts derived from the cluster were characterized . Flanking and noncoding regions of the sequence were analyzed phylogenetically by comparison with the homologous sequences from two other halophilic archaea, i.e., Halobacterium cutirubrum and Haloarcula marismortui . Motifs, identified by high-level sequence conservation, include both transcriptional and translational regulatory elements and other elements of unknown function. J Biol Chem, 1996 Jul 26, 271(30), 17718 - 23 A salt-resistant plasma membrane carbonic anhydrase is induced by salt in Dunaliella salina; Fisher M et al.; The mechanisms allowing proliferation of the unicellular green alga Dunaliella salina in up to saturating NaCl concentrations are only partially understood at present . Previously, the level of a plasma membrane Mr 60,000 protein, p60, was found to increase with rising external salinities . Based on cDNA cloning and enzymatic assays, it is now shown that p60 is an internally duplicated carbonic anhydrase, with each repeat homologous to animal and Chlamydomonas reinhardtii carbonic anhydrases, but exceptional in the excess of acidic over basic residues . Increasing salinities, alkaline shift, or removal of bicarbonate induced in D . salina parallel increases in the levels of p60, its mRNA, and external carbonic anhydrase activity . Moreover, purified p60 exhibited carbonic anhydrase activity comparable to other carbonic anhydrases . A p60-enriched soluble preparation showed maximal carbonic anhydrase activity at approximately 1.0 M NaCl and retained considerable activity at higher salt concentrations . In contrast, a similar preparation from C . reinhardtii was approximately 90% inhibited in 0.6 M NaCl . These results identified p60 as a structurally novel carbonic anhydrase transcriptionally regulated by CO2 availability and exhibiting halophilic-like characteristics . This enzyme is potentially suited to optimize CO2 uptake by cells growing in hypersaline media. FEMS Microbiol Lett, 1996 Jul 15, 141(1), 59 - 63 NADP-glutamate dehydrogenase from the halophilic archaeon Haloferax mediterranei: enzyme purification, N-terminal sequence and stability; Ferrer J et al.; An NADP(H)-specific glutamate dehydrogenase of Haloferax mediterranei has been purified to apparent homogeneity and characterised . The purified enzyme was stabilized by glycerol in absence of salt . Glutamate dehydrogenase from Hf . mediterranei is a hexameric enzyme with a native molecular mass of 320 kDa composed of monomers each with a molecular mass of 55 kDa . At pH 8.5 the enzyme has Kms of 0.018, 0.34 and 4.2 mM for NADP+, 2-oxoglutarate and ammonium, respectively . Amino acid composition and sequence of the first 16 residues of the N-terminus have been determined. Microb Drug Resist, 1996 Summer, 2(2), 269 - 72 beta-Lactamases are absent from Archaea (archaebacteria); Martin HH et al.; beta-Lactamases, enzymes that hydrolyze and inactive beta-lactam antibiotics, are of widespread occurrence in Bacteria and are related to the metabolism of bacterial cell wall murein . So far, no information exists on beta-lactamases in Archaea, a separate domain of prokaryotes with diverse types of unique cell wall polymers . Different mesophilic methanogenic and extremely halophilic Archaea containing methanochondroitin, pseudomurein, or S-layer protein or glycoprotein cell walls, were tested for beta-lactamase activity with the chromogenic beta-lactam nitrocefin as substrate . Also tested were representative microbial Eucarya from algae, yeasts, and protozoa . No beta-lactamase activity was detected in any of the archaeal and eukaryotic organisms . This supports the view that beta-lactamases are restricted to the domain of Bacteria. Biophys J, 1996 Jul, 71(1), 365 - 80 Protein folding thermodynamics applied to the photocycle of the photoactive yellow protein; Van Brederode ME et al.; Two complementary aspects of the thermodynamics of the photoactive yellow protein (PYP), a new type of photoreceptor that has been isolated from Ectothiorhodospira halophila, have been investigated . First, the thermal denaturation of PYP at pH 3.4 has been examined by global analysis of the temperature-induced changes in the UV-VIS absorbance spectrum of this chromophoric protein . Subsequently, a thermodynamic model for protein (un)folding processes, incorporating heat capacity changes, has been applied to these data . The second aspect of PYP that has been studied is the temperature dependence of its photocycle kinetics, which have been reported to display an unexplained deviation from normal Arrhenius behavior . We have extended these measurements in two solvents with different hydrophobicities and have analyzed the number of rate constants needed to describe these data . Here we show that the resulting temperature dependence of the rate constants can be quantitatively explained by the application of a thermodynamic model which assumes that heat capacity changes are associated with the two transitions in the photocycle of PYP . This result is the first example of an enzyme catalytic cycle being described by a thermodynamic model including heat capacity changes . It is proposed that a strong link exists between the processes occurring during the photocycle of PYP and protein (un)folding processes . This permits a thermodynamic analysis of the light-induced, physiologically relevant, conformational changes occurring in this photoreceptor protein. Int J Syst Bacteriol, 1996 Jul, 46(3), 817 - 21 Analysis of 16S rRNA gene sequences of Vibrio costicola strains: description of Salinivibrio costicola gen . nov., comb . nov; Mellado E et al.; The phylogenetic positions of six Vibrio costicola strains were determined by direct sequencing and analysis of their PCR-amplified 16S ribosomal DNAs . A comparative analysis of the sequence data revealed that the moderate halophile V . costicola forms a monophyletic branch that is distinct from other Vibrio species and from moderately halophilic species of other genera . These results complement phenotypic and genotypic data determined previously . The molecular evidence, together with several phenotypic differences, distinguishes V . costicola from species of the genus Vibrio and other species belonging to the gamma subclass of the Proteobacteria and indicates that V . costicola should be placed in a new and separate genus . The name Salinivibrio costicola gen . nov., comb . nov . is proposed for this bacterium . The guanine-plus-cytosine content of the DNA is 49.4 to 50.5 mol% . The type strain of S . costicola is strain NCIMB 701 (= ATCC 33508). Int J Syst Bacteriol, 1996 Jul, 46(3), 710 - 5 Desulfovibrio gabonensis sp . nov., a new moderately halophilic sulfate-reducing bacterium isolated from an oil pipeline; Tardy-Jacquenod C et al.; Two moderately halophilic sulfate-reducing bacteria were isolated from an African oil pipeline and designated strains SEBR 3640 and SEBR 2840T (T = type strain) . Both of these strains possess traits that define the genus Desulfovibrio . The cells of both isolates were motile curved rods that had a single polar flagellum and contained desulfoviridin, and both isolates utilized lactate, pyruvate, malate, fumarate, succinate, and ethanol in the presence of sulfate . Sulfite, thiosulfate, and elemental sulfur were also used as an electron acceptors in the presence of lactate . However, both strains tolerated higher concentrations of NaCl (up to 17%) than all other Desulfovibrio species except Desulfovibrio halophilus, which tolerated a similar level of NaCl . The results of a 16S rRNA gene sequence analysis also placed the designated type strain, strain SEBR 2840, in the genus Desulfovibrio but revealed that this organism was significantly different from D . halophilus and all other validly described Desulfovibrio species . On the basis of our results, we propose that strain SEBR 2840T is a member of a new species of the genus Desulfovibrio, Desulfovibrio gabonensis . The type strain of D . gabonensis is strain SEBR 2840 (= DSM 10636). Appl Environ Microbiol, 1996 Jul, 62(7), 2673 - 5 Identification of Vibrio proteolyticus with a differential medium and a specific probe; Muniesa-Perez M et al.; A differential medium (VP8) and a specific probe, based on the variable region V3 of the 16S rRNA gene, for the detection of Vibrio proteolyticus are defined . The medium contains 8% NaCl, which allows selective growth of moderately halophilic Vibrio strains . D-Sorbitol, as the main carbon source, differentiates the species that can ferment it by the pH indicators cresol red and bromothymol blue . V . proteolyticus and 8 of 418 strains studied grew on the medium and used the D-sorbitol, forming bright yellow colonies . An oligonucleotide, based on the variable region V3 of the 16S rRNA gene (5'CGCTAACGTCAAATAATGCATCTA3'), was used as the specific probe (V3VPR) . Only three strains of Vibrio sp . and one strain identified as V . natriegens cross-hybridized with the probe . However, unlike V . proteolyticus, none of the strains grew on VP8 . The combined use of VP8 medium and the probe allowed an unequivocal identification of V . proteolyticus. Microbiology, 1996 Jul, 142 ( Pt 7), 1715 - 23 Influence of salt on the transcription of the gas-vesicle genes of Haloferax mediterranei and identification of the endogenous transcriptional activator gene; Roder R et al.; The transcription of the 14 gvp genes of the gas-vesicle-encoding mc-vac region was investigated, using RNA from 25% and 15% (w/v) salt cultures of the moderately halophilic archaeon Haloferax mediterranei . Transcription occurred only from two promoters, located in front of the mc-gvpA and mc-gvpD genes . In both cultures transcripts spanning the entire mc-gvpDEFGHIJKLM transcription unit were formed only during the exponential growth phase . Amounts of these transcripts were larger in the 25% salt culture, in which the 2.0 kb mc-gvpD transcripts were also synthesized during the stationary phase . The levels of the mc-gvpD transcripts and of the 324 nt mc-gvpA mRNA increased in parallel during the stationary phase of the 25% salt culture . Only under these conditions were mRNAs spanning the entire mc-gvpACNO transcription unit observed, and gas-vesicles were formed . Investigation of the influence of the mc-gvpDE genes on both mc-vac promoters in transformants revealed that by themselves they were nearly inactive . The addition of mc-gvpE, however, resulted in a high level of constitutively produced mc-gvpA and mc-gvpD mRNA, indicating a transcriptional activator function for the mc-gvpE product. J Appl Bacteriol, 1996 Jul, 81(1), 109 - 12 Phylogenetic characterization of a novel salt-tolerant Bacillus species: description of Bacillus dipsosauri sp . nov; Lawson PA et al.; The taxonomic position of a novel halophilic endospore-forming bacterium previously isolated from a desert iguana was investigated by 16S rRNA gene sequencing . Comparative sequence analyses showed the unidentified bacterium to be phylogenetically loosely associated with some other spore-forming (Bacillus pantothenticus, Sporosarcina halophila) and non-spore-forming (Marinococcus albus) halotolerant bacteria . Based on the phenotypic and phylogenetic distinctiveness of the unidentified bacterium, it is proposed that it is classified in the genus Bacillus as a new species, Bacillus dipsosauri. EMBO J, 1996 Jul 1, 15(13), 3209 - 18 The xanthopsins: a new family of eubacterial blue-light photoreceptors; Kort R et al.; Photoactive yellow protein (PYP) is a photoreceptor that has been isolated from three halophilic phototrophic purple bacteria . The PYP from Ectothiorhodospira halophila BN9626 is the only member for which the sequence has been reported at the DNA level . Here we describe the cloning and sequencing of the genes encoding the PYPs from E.halophila SL-1 (type strain) and Rhodospirillum salexigens . The latter protein contains, like the E.halophila PYP, the chromophore trans p-coumaric acid, as we show here with high performance capillary zone electrophoresis . Additionally, we present evidence for the presence of a gene encoding a PYP homolog in Rhodobacter sphaeroides, the first genetically well-characterized bacterium in which this photoreceptor has been identified . An ORF downstream of the pyp gene from E.halophila encodes an enzyme, which is proposed to be involved in the biosynthesis of the chromophore of PYP . The pyp gene from E.halophila was used for heterologous overexpression in both Escherichia coli and R.sphaeroides, aimed at the development of a holoPYP overexpression system (an intact PYP, containing the p-coumaric acid chromophore and displaying the 446 nm absorbance band) . In both organisms the protein could be detected immunologically, but its yellow color was not observed . Molecular genetic construction of a histidine-tagged version of PYP led to its 2500-fold overproduction in E.coli and simplified purification of the heterologously produced apoprotein . HoloPYP could be reconstituted by the addition of p-coumaric anhydride to the histidine-tagged apoPYP (PYP lacking its chromophore) . We propose to call the family of photoactive yellow proteins the xanthopsins, in analogy with the rhodopsins. Appl Environ Microbiol, 1996 Jun, 62(6), 1897 - 902 Gram-positive, catalase-positive cocci from dry cured Iberian ham and their enterotoxigenic potential; Rodriguez M et al.; Iberian ham is an uncooked, cured meat product ripened under natural uncontrolled conditions for 18 to 24 months . Gram-positive, catalase-positive cocci are the main microbial population in Iberian ham for most of the ripening time . Since some of these organisms are able to produce enterotoxins, adequate characterization and toxicological study are needed . For this, 1,327 gram-positive, catalase-positive cocci, isolated from Iberian hams at different stages and locations, were characterized by physiological and biochemical tests . Selected isolates were further characterized by guanine-cytosine (G+C) content and restriction enzyme analysis of genes coding for 16S rRNA . The toxigenic potential of these organisms was tested with specific DNA gene probes for staphylococcal enterotoxins A, B, C, and D and confirmed by semiquantitative sandwich enzyme immunoassay . The majority of the isolates were identified as Staphylococcus spp . and Micrococcus spp . Non-identified gram-positive, catalase-positive cocci which were moderately halophilic and showed a 42 to 52% G+C content were detected . A great variety of staphylococcal strains were found within the different species at any sampling time . Two strains of Staphylococcus xylosus, one Staphylococcus cohnii strain, and four of the non-identified organisms with 42 to 52% G+C contents hybridized with some of the DNA probes for C and D staphylococcal enterotoxin genes . S . xylosus hybridizing with C-enterotoxin probe reacted with both C and D enterotoxins in the immunological test . In addition, enterotoxin D was confirmed in the nonidentified strains . Some toxigenic organisms were isolated from the final product, posing a health hazard for the consumer. Nucleic Acids Res, 1996 Jun 1, 24(11), 2125 - 32 recA-like genes from three archaean species with putative protein products similar to Rad51 and Dmc1 proteins of the yeast Saccharomyces cerevisiae; Sandler SJ et al.; The process of homologous recombination has been documented in bacterial and eucaryotic organisms . The Escherichia coli RecA and Saccharomyces cerevisiae Rad51 proteins are the archetypal members of two related families of proteins that play a central role in this process . Using the PCR process primed by degenerate oligonucleotides designed to encode regions of the proteins showing the greatest degree of identity, we examined DNA from three organisms of a third phylogenetically divergent group, Archaea, for sequences encoding proteins similar to RecA and Rad51 . The archaeans examined were a hyperthermophilic acidophile, Sulfolobus sofataricus (Sso); a halophile, Haloferax volcanii (Hvo); and a hyperthermophilic piezophilic methanogen, Methanococcus jannaschii (Mja) . The PCR generated DNA was used to clone a larger genomic DNA fragment containing an open reading frame (orf), that we refer to as the radA gene, for each of the three archaeans . As shown by amino acid sequence alignments, percent amino acid identities and phylogenetic analysis, the putative proteins encoded by all three are related to each other and to both the RecA and Rad51 families of proteins . The putative RadA proteins are more similar to the Rad51 family (approximately 40% identity at the amino acid level) than to the RecA family (approximately 20%) . Conserved sequence motifs, putative tertiary structures and phylogenetic analysis implied by the alignment are discussed . The 5' ends of mRNA transcripts to the Sso radA were mapped . The levels of radA mRNA do not increase after treatment with UV irradiation as do recA and RAD51 transcripts in E.coli and S.cerevisiae . Hence it is likely that radA in this organism is a constitutively expressed gene and we discuss possible implications of the lack of UV-inducibility. Curr Microbiol, 1996 Jun, 32(6), 308 - 13 Process of Carbonate Precipitation by Deleya halophila Rivadeneyra MA, Ramos-Cormenzana A, Delgado G, Delgado R. Scanning electron microscopy and X-ray dispersive energy microanalysis were used to investigate the formation of carbonate crystals by Deleya halophila . The formation of calcium carbonate crystals (polymorphous aragonite) by D . halophila is a sequential process that commences with a nucleus formed by the aggregation of a few calcified bacterial cells and the subsequent accumulation of more calcified cells and carbonate, which acts to weld the bacteria together . The process leads to the formation of spherical bioliths measuring approximately 50 &mgr;m in diameter . The mechanism of carbonate precipitation by D . halophila under our working conditions represents a process of induced biomineralization. J Bacteriol, 1996 Jun, 178(11), 3044 - 8 Dihydrolipoamide dehydrogenase from the halophilic archaeon Haloferax volcanii: homologous overexpression of the cloned gene; Jolley KA et al.; The gene encoding dihydrolipoamide dehydrogenase from the halophilic archaeon, Haloferax volcanii, has been subcloned and overexpressed in the parent organism by using the halophilic archaeal rRNA promoter . The recombinant protein has been purified to homogeneity and characterized with respect to its kinetic, molecular, and salt-dependent properties . A dihydrolipoamide dehydrogenase-minus mutant of H . volcanii has been created by homologous recombination with the subcloned gene after insertion of the mevinolin resistance determinant into the protein-coding region . To explore the physiological function of the dihydrolipoamide dehydrogenase, the growth properties of the mutant halophile have been examined. Biochim Biophys Acta, 1996 May 23, 1294(2), 159 - 67 Halolysin R4, a serine proteinase from the halophilic archaeon Haloferax mediterranei; gene cloning, expression and structural studies; Kamekura M et al.; A gene encoding a halophilic serine proteinase, halolysin R4, from a halophilic archaeon Haloferax mediterranei strain R4 was cloned, its nucleotide sequence determined, and expressed in Haloferax volcanii WFD11 . The deduced amino-acid sequence (403 aa in length) showed the highest similarity to halolysin 172P1, produced by another halophilic archaeon, strain 172P1 (now designated as Natrialba asiatica) . Both halolysins belong to the thermitase branch of class I subtilases, but show long C-terminal extensions of 117 and 123 amino acids, respectively . Removal of this "tail' region from halolysin R4 abolished proteinase activity, indicating it provides an essential (but as yet unknown) function . Substitution of the two cysteine residues in the C-terminal extension with serine decreased enzyme stability in hypotonic solutions, possibly owing to disruption of potential disulfide bonds or perturbation of calcium binding site(s). Microbiology, 1996 May, 142 ( Pt 5), 1115 - 22 Degradation of 2,4-dichlorophenoxyacetic acid by haloalkaliphilic bacteria; Maltseva O et al.; Three 2,4-dichlorophenoxyacetic acid (2,4-D)-degrading bacterial isolates were obtained from the highly saline and alkaline Alkali Lake site in southwestern Oregon contaminated with 2,4-D production wastes . While similar in most respects, the three isolates differed significantly in 2,4-D degradation rates, with the most active strain, I-18, demonstrating an ability to degrade up to 3000 mg 2,4-D I-1 in 3 d . This strain was well adapted to the extreme environment from which it was isolated, growing optimally on 2,4-D at pH 8.4-9.4 and at sodium ion concentrations of 0.6-1.0 M . According to its optimum salt concentration and pH for growth, this isolate was a moderately halophilic, alkaliphilic bacterium . The 16S RNA gene sequence (303 nt) was identical for all three isolates and most closely resembled those of the moderately halophilic eubacteria of the family Halomonadaceae (91% identity) . Biochemical and genetic examination revealed strain I-18 utilizes the same 2,4-D degradation pathway as most of the 2,4-D-degrading bacteria from non-extreme environments . Hybridization data and comparison of the partial sequences of the tfdA gene from the Alkali Lake isolates with those of bacteria from non-extreme environments suggested a common genetic origin of the 2,4-D degradation pathway in the two groups of micro-organisms. Nat Struct Biol, 1996 May, 3(5), 452 - 8 Insights into protein adaptation to a saturated salt environment from the crystal structure of a halophilic 2Fe-2S ferredoxin; Frolow F et al.; Haloarcula marismortui is an archaebacterium that flourishes in the world's saltiest body of water, the Dead Sea . The cytosol of this organism is a supersaturated salt solution in which proteins are soluble and active . The crystal structure of a 2Fe-2S ferredoxin from H . marismortui determined at 1.9 A is similar to those of plant-type 2Fe-2S ferredoxins of known structure, with two important distinctions . The entire surface of the protein is coated with acidic residues except for the vicinity of the iron-sulphur cluster, and there is an insertion of two amphipathic helices near the N-terminus . These form a separate hyperacidic domain whose postulated function to provide extra surface carboxylates for solvation . These data and the fact that bound surface water molecules have on the average 40% more hydrogen bonds than in a typical non-halophilic protein crystal structure support the notion that haloadaptation involves better water binding capacity. J Biol Chem, 1996 Apr 19, 271(16), 9340 - 6 Analysis of left-handed Z-DNA formation in short d(CG)n sequences in Escherichia coli and Halobacterium halobium plasmids . Stabilization by increasing repeat length and DNA supercoiling but not salinity; Kim J et al.; To evaluate the relative importance of alternating d(CG) sequence length, DNA supercoiling, and salt in left-handed Z-DNA formation, plasmids containing short d(CG)n sequences (n = 3-17) with the capability of replicating in either Escherichia coli or the halophilic archaeum Halobacterium halobium were constructed . Z-DNA conformation in the d(CG)n sequences was assayed by (i) a band shift assay using the Z-DNA-specific Z22 monoclonal antibody (ZIBS assay); (ii) an S1 nuclease cleavage-primer extension assay to map B-Z junctions; and (iii) a BssHII restriction inhibition assay . Using the ZIBS assay on plasmids purified from E . coli, the transition from B-DNA to Z-DNA occurred from d(CG)4, to d(CG)5, with 20% of d(CG)4, and 90% of d(CG)5 in Z-DNA conformation . These findings were consistent with the results of S1 nuclease cleavage observed at B-Z junctions flanking d(CG)4 and d(CG)5 sequences . Resistance to BssHII restriction endonuclease digestion was observed only in supercoiled plasmids containing d(CG)8 or longer sequences, indicating that shorter d(CG)n sequences are in dynamic equilibrium between B- and Z-DNA conformations . When a plasmid containing d(CG)4, was isolated from a topA mutant of E . coli, it contained 25% greater linking deficiency and 40% greater Z-DNA conformation in the alternating d(CG) region . In plasmids purified from H . halobium, which showed 30% greater linking deficiency than from E . coli, 20-40% greater Z-DNA formation was found in d(CG)4-6 sequences . Surprisingly, no significant difference in Z-DNA formation could be detected in d(CG)3-17 sequences in plasmids from either E . coli or H . halobium in the NaCl concentration range of 0.1-4 M. Gene, 1996 Apr 17, 170(1), 77 - 80 Vectors using the phospho-alpha-(1,1)-glucosidase-encoding gene treA of Bacillus subtilis as a reporter; Schock F et al.; The intracellular phospho-alpha-(1,1)-glucosidase, TreA, from Bacillus subtilis (Bs) hydrolyses trehalose 6-phosphate into glucose and glucose 6-phosphate . The enzyme is also able to cleave p-nitrophenyl alpha-D-glucopyranoside (PNPG) . This enzymatic reaction can be easily monitored in a beta-galactosidase analogous enzyme assay . The vectors we have constructed can be used to study promoter activity in transcriptional treA fusions and may prove especially useful under high-salt conditions due to the halophilic character of TreA . The treA gene is useful as a reporter in either Bs or Escherichia coli (Ec) . Such fusions can be integrated in the Bs amyE locus and selected on either kanamycin or chloramphenicol, or used as plasmids in Ec . As an example of the general utility, we demonstrate treA expression under xylA-operator-promoter control. FEBS Lett, 1996 Apr 1, 383(3), 227 - 9 Glucose dehydrogenase from the halophilic Archaeon Haloferax mediterranei: enzyme purification, characterisation and N-terminal sequence; Bonete MJ et al.; An NAD(P)-glucose dehydrogenase from the extremely halophilic Archaeon, Haloferax mediterranei, has been purified to electrophoretic homogeneity . The purified enzyme has been characterised with respect to its cofactor specificity, subunit composition and its salt and thermal stability . The N-terminal amino acid sequence has been determined and N-terminus alignment with sequences of other glucose dehydrogenases shows that the halophilic enzyme most closely resembles the NAD(P)-linked glucose dehydrogenase from the thermophilic Archaeon Thermoplasma acidophilum . However, the halophilic glucose dehydrogenase appears to be a dimeric protein, in contrast to the tetrameric enzyme from the thermophile. Microbiologia, 1996 Mar, 12(1), 75 - 84 Optimization of the production of a bacteriocin from Haloferax mediterranei Xia3; Platas G et al.; The optimal conditions for the production of the halocin H1, a 31 kDa bacteriocin-like molecule produced by the extreme halophilic Archaea Haloferax mediterranei Xia3 active against Gram-negative haloarchaea, was characterized . The physico-chemical conditions required for the optimal production of halocin H1 are similar to those found in the habitat in which the microorganism was isolated: 20% salt concentration and temperature range between 37 and 42 degrees C . Optimal antimicrobial activity was obtained using 0.5% of N-Z amine E as nutrient. Microbiologia, 1996 Mar, 12(1), 55 - 60 {Effect of nutritional conditions on the viscosity and emulsifying capacity of V2-7 biopolymer from Volcaniella eurihalina}; Martinez-Checa F et al.; Volcaniella eurihalina is a moderately halophilic bacterium able to produce an exopolysaccharide (EPS) under different culture conditions . Rheological behavior of 1% EPS solutions varied depending on the conditions under which EPS were produced . The maximum viscosity was reached when maltose was used as carbon source . Limitations of phosphorus and sulfur also increased its viscosity power . On the other hand, the addition of residual oil products to the culture medium enhanced the production of this biosurfactant polymer. Appl Environ Microbiol, 1996 Mar, 62(3), 766 - 71 Diversity of uncultured microorganisms associated with the seagrass Halophila stipulacea estimated by restriction fragment length polymorphism analysis of PCR-amplified 16S rRNA genes; Weidner S et al.; The diversity of microorganisms associated with the leaves of the seagrass Halophila stipulacea in the northern Gulf of Elat was examined by culture-independent analysis . Microorganisms were harvested by a sonication treatment for total-community genomic DNA isolation . Oligonucleotides complementary to conserved regions in the 16S rRNA-encoding DNA (rDNA) of bacteria were used for PCR amplification . The 16S rDNA PCR products were subcloned and further characterized by a restriction fragment length analysis termed ARDRA (amplified rDNA restriction analysis) . These analyses were carried out after reamplifying the cloned fragments with two primers binding symmetrically to the plasmid immediately on both sides of the cloned insert . Computer-aided clustering was performed after separate restriction analysis with enzymes HinfI and HpaII . By this method, 103 cloned 16S rDNA fragments were clustered into a total of 58 different groups . Sequence analysis of clones with an identical ARDRA pattern confirmed that members of an ARDRA group were closely related to each other . The sequenced clones were found to be affiliated with a marine snow-associated plastid-like rRNA clone and with a marine Hyphomonas strain, respectively . The method applied in this study could be useful for the routine study of other microbial communities of interest. J Bacteriol, 1996 Mar, 178(5), 1320 - 7 Isolation of an ftsZ homolog from the archaebacterium Halobacterium salinarium: implications for the evolution of FtsZ and tubulin; Margolin W et al.; We have isolated a homolog of the cell division gene ftsZ from the extremely halophilic archaebacterium Halobacterium salinarium . The predicted protein of 39 kDa is divergent relative to eubacterial homologs, with 32% identity to Escherichia coli FtsZ . No other eubacterial cell division gene homologs were found adjacent to H . salinarium ftsZ . Expression of the ftsZ gene region in H . salinarium induced significant morphological changes leading to the loss of rod shape . Phylogenetic analysis demonstrated that the H . salinarium FtsZ protein is more related to tubulins than are the FtsZ proteins of eubacteria, supporting the hypothesis that FtsZ may have evolved into eukaryotic tubulin. Biochemistry, 1996 Feb 27, 35(8), 2526 - 34 Sequence evidence for strong conservation of the photoactive yellow proteins from the halophilic phototrophic bacteria Chromatium salexigens and Rhodospirillum salexigens; Koh M et al.; The photoactive yellow proteins (PYP) have been found to date only in three species of halophilic purple phototrophic bacteria . They have photochemical activity remarkably similar to that of the bacteria rhodopsins . In contrast to rhodopsins, however, the PYPs are small water-soluble proteins . We now report the complete amino acid sequences of Rhodospirillum salexigens and Chromatium salexigens PYP which allow comparison with the known sequence and three-dimensional structure of the prototypic protein from Ectothiorhodospira halophila . Although isolated from three different families of bacteria, the PYP sequences are 70-76% identical . All three contain 125 amino acid residues, and no insertions or deletions are necessary for alignment . This is a remarkable result when it is considered that electron transfer proteins from these purple bacterial species are only 25-40% identical and that insertions and deletions are needed for their proper alignment . It thus appears that PYP has the same important function in each of the purple bacteria and that most of the amino acid residues are necessary to maintain structure and function . By most standards, PYP would be called a "slowly evolving protein" . R . salexigens PYP is uniquely degraded by proteolysis at low ionic strength, probably as a consequence of unfolding due to electrostatic repulsion of the excess negative charge . Therefore it may also be classified as a "halophilic protein". Biochim Biophys Acta, 1996 Feb 9, 1289(1), 14 - 24 NAD-glutamate dehydrogenase from Halobacterium halobium: inhibition and activation by TCA intermediates and amino acids; Bonete MJ et al.; A variety of metabolites have been found to elicit a form of inhibition or activation on an NAD-specific glutamate dehydrogenase (NAD-GDH, EC 1.4.1.2) from Halobacterium halobium . The purified halophilic enzyme was tested with several compounds known to be allosteric modifiers of mammalian glutamate dehydrogenases to determine their effects on enzyme activity . GTP, ATP, ADP and AMP did not affect the enzyme, so these effectors of bovine glutamate dehydrogenase do not play a role in the regulation of the halophilic enzyme . However, the halophilic enzyme was subject to strong inhibition by TCA intermediates . When measuring the initial rate of the reaction, the oxidative deamination of L-glutamate was inhibited by TCA metabolites such as: fumarate, oxalacetate, succinate and malate; by substrate analogues such as: NADP+, D-glutamate and glutarate; and by dicarboxylic compounds such as adipate . On the other hand, all the amino acids tested were activators of this enzyme, except the D-isomer of the substrate L-glutamate that acted as an inhibitor . The relative effectiveness of each inhibitor or activator (Ki or Ka values) was correlated with the dipole moment (mu), HOMO and LUMO molecular orbital energies, optimal distance between two carboxyl groups, and hydrophobicity . Compounds with high dipole moment acted as good activators while compounds with low dipole moment were inhibitors . We have also found that the best activators were amino acids with no polar lateral chain. Proteins, 1996 Feb, 24(2), 158 - 64 A complete relaxation matrix refinement of the solution structure of a paramagnetic metalloprotein: reduced HiPIP I from Ectothiorhodospira halophila; Bertini I et al.; We have accounted for the effect of paramagnetism on the intensities of NOEs in a 73-residue paramagnetic metalloprotein, the reduced high-potential iron sulfur protein ISO I from Ectothiorhodospira halophila, whose solution structure had been recently solved by us . The paramagnetic effects were dealt with through a suitably modified complete relaxation matrix approach . We have then recalculated the structure through a distance geometry program by minimizing the difference between the sixth roots of the calculated and experimental NOEs . The average RMSD, calculated on residues 4-71, within the structures constituting the two families decreased from 0.67 to 0.46 angstrom for backbone atoms and from 1.23 to 1.06 angstroms for all heavy atoms . The structures in the new family are for the most part within the indetermination of the previous, less resolved, family . A few specific differences are detected and related to the presence of non-negligible paramagnetic effects, which are now properly evaluated. Arch Microbiol, 1996 Feb, 165(2), 97 - 105 Primary structure and properties of the formyltransferase from the mesophilic Methanosarcina barkeri: comparison with the enzymes from thermophilic and hyperthermophilic methanogens; Kunow J et al.; The ftr gene encoding formylmethanofuran: tetrahydromethanopterin formyltransferase (Ftr) from Methanosarcina barkeri was cloned, sequenced, and functionally expressed in Escherichia coli . The overproduced enzyme was purified eightfold to apparent homogeneity, and its catalytic properties were determined . The primary structure and the hydropathic character of the formyltransferase from Methanosarcina barkeri were compared with those of the enzymes from Methanobacterium thermoautotrophicum, Methanothermus fervidus, and Methanopyrus kandleri . The amino acid sequence of the enzyme from Methanosarcina barkeri was 64%, 61%, and 59% identical to that of the enzyme from Methanobacterium thermoautotrophicum, Methanothermus fervidus, and Methanopyrus kandleri, respectively . A negative correlation between the hydrophobicity of the enzymes and both the growth temperature optimum and the intracellular salt concentration of the four organisms was observed . The hydrophobicity of amino acid composition was +21.6 for the enzyme from Methanosarcina barkeri (growth temperature optimum 37 degrees C, intracellular salt concentrationapproximately 0.3 M), +9.9 for the enzyme from Methanobacterium thermoautotrophicum (65 degrees C,approximately 0.7 M), -20.8 for the enzyme from Methanothermus fervidus (83 degrees C,approximately 1.0 M) and -31.4 for the enzyme from Methanopyrus kandleri (98 degrees C, > 1.1 M) . Generally, a positive correlation between hydrophobicity and thermophilicity of enzymes and a negative correlation between hydrophobicity and halophilicity of enzymes are observed . The findings therefore indicate that the hydropathic character of the formyltransferases compared is mainly determined by the intracellular salt concentration rather than by temperature . Sequence similarities between the formyltransferases from methanogens and an open reading frame from Methylobacterium extorquens AM1 are discussed. Arch Microbiol, 1996 Feb, 165(2), 106 - 13 The phylogenetic relationship among Ectothiorhodospiraceae: a reevaluation of their taxonomy on the basis of 16S rDNA analyses; Imhoff JF et al.; Sequences of the 16S rRNA gene were determined from all type strains of the recognized Ectothiorhodospira species and from a number of additional strains . For the first time, these data resolve the phylogenetic relationships of the Ectothiorhodospiraceae in detail, confirm the established species, and improve the classification of strains of uncertain affiliation . Two major groups that are recognized as separate genera were clearly established . The extremely halophilic species were removed from the genus Ectothiorhodospira and reassigned to the new genus Halorhodospira gen . nov., to recognize that the most halophilic eubacteria are species of this genus . These species are Halorhodospira halophila comb . nov., Halorhodospira halochloris comb . nov., and Halorhodospira abdelmalekii comb . nov . Among the slightly halophilic Ectothiorhodospira species, the classification of strains belonging to Ectothiorhodospira mobilis and Ectothiorhodospira shaposhnikovii was improved . Several strains that were tentatively identified as Ectothiorhodospira mobilis form a separate cluster on the basis of their 16S rDNA sequences and are recognized as two new species: Ectothiorhodospira haloalkaliphila sp . nov., which includes the most alkaliphilic strains originating from strongly alkaline soda lakes, and Ectothiorhodospira marina, describing isolates from the marine environment. Biochemistry, 1996 Jan 30, 35(4), 1274 - 81 Chemical reactivity and spectroscopy of the thiol ester-linked p-coumaric acid chromophore in the photoactive yellow protein from Ectothiorhodospira halophila; Hoff WD et al.; We have recently identified p-coumaric acid as the chromophore of the photoactive yellow protein (PYP) from the purple sulfur bacterium Ectothiorhodospira halophila, a blue-light photoreceptor with rhodopsin-like photochemistry {Hoff, W . D., Dux, P., Hard, K., Nugteren-Roodzant, I . M., Crielaard, W., Boelens, R., Kaptein, R., Van Beeumen, J., & Hellingwerf, K . J . (1994) Biochemistry 33, 13959-13962} . Here we report on the chemistry of the linkage of this new photoactive cofactor to apoPYP: (i) Analysis of chromophore-peptide conjugates of PYP by high-resolution mass spectrometry unambiguously shows that the p-coumaric acid molecule is bound to Cys 69 via a thiol ester bond . The PYP chromophore is the first cofactor known to be stably thiol ester-linked to its apoprotein . (ii) The chemical reactivity of this thiol ester bond with respect to dithiothreitol, performic acid, and high pH is similar to that of disulfide bridges . These treatments result in the cleavage of the thiol ester bond, concomitant with strong shifts in the UV/vis absorbance band of the chromophore . (iii) The spectral properties of the PYP chromophore under different conditions are related to the structural integrity of the protein, the presence of the thiol ester bond, and the ionization state of the phenolic proton of the chromophore . These results are important for the general problem of spectral tuning in photoreceptor proteins. FEBS Lett, 1996 Jan 22, 379(1), 43 - 6 Evidence for farnesol-mediated isoprenoid synthesis regulation in a halophilic archaeon, Haloferax volcanii; Tachibana A et al.; Farnesol strongly inhibited growth of a halophilic archaeon, Haloferax volcanii, with an IC50 value of only 2 microM (0.4 microgram/ml) in rich medium and 50 nM (0.01 microgram/ml) in minimal medium without lysis . Other isoprenoid alcohols such as isopentenol, dimethylallyl alcohol, geraniol, and geranylgeraniol at 500 microM did not affect its growth . Mevalonate, which is the precursor of all isoprenoid membrane lipids in archaea, led to recovery of the growth inhibition of H . volcanii, but acetate had no such effect . Farnesol inhibited incorporation of acetate, but not mevalonate, into the lipid fraction . These results suggest that farnesol inhibited the biosynthetic pathway from acetate (acetyl-CoA) to mevalonate . Farnesol is known to be derived from the important intermediate of isoprenoids, farnesyl diphosphate (FPP), and found in neutral lipid fraction from this archaeon . Moreover, the cell-free extracts from H . volcanii could phosphorylate farnesol with ATP to generate farnesyl monophosphate and FPP . We conclude that farnesol-mediated isoprenoid synthesis regulation system by controlling farnesol concentration is present in H . volcanii. Biochim Biophys Acta, 1996 Jan 4, 1292(1), 140 - 4 Total reconstitution of active small ribosomal subunits of the extreme halophilic archaeon Haloferax mediterranei; Sanchez ME et al.; The small ribosomal subunit of the halophilic archaeon Haloferax mediterranei has been reconstituted from its dissociated rRNA and protein components . Efficient reconstitution of particles, fully active in poly(U)-dependent polyphenylalanine synthesis, occurs after 2 h of incubation at 36 degrees C in the presence of 1.5 M of (NH4)2SO4, 100 mM of MgAc2, 20 mM Tris-HCl (pH 8.2) and 6 mM 2-mercaptoethanol . Important differences in the optimal ionic conditions for the reconstitution of the 30S and the 50S ribosomal subunits from Haloferax mediterranei have been found . K+ and NH4+ ions have differing abilities to promote the reconstitution of the particles . The assembly of 30S ribosomal subunits of H . mediterranei has a higher tolerance to ionic strength than the assembly of the 50S subunits and it is independent of the Mg2+ concentration present in the system. Biochimie, 1996, 78(6), 488 - 501 Enzymatic conversion of adenosine to inosine and to N1-methylinosine in transfer RNAs: a review; Grosjean H et al.; Inosine (6-deaminated adenosine) is a characteristic modified nucleoside that is found at the first anticodon position (position 34) of several tRNAs of eukaryotic and eubacterial origins, while N1-methylinosine is found exclusively at position 37 (3' adjacent to the anticodon) of eukaryotic tRNA(Ala) and at position 57 (in the middle of the psi loop) of several tRNAs from halophilic and thermophilic archaebacteria . Inosine has also been recently found in double-stranded RNA, mRNA and viral RNAs . As for all other modified nucleosides in RNAs, formation of inosine and inosine derivative in these RNA is catalysed by specific enzymes acting after transcription of the RNA genes . Using recombinant tRNAs and T7-runoff transcripts of several tRNA genes as substrates, we have studied the mechanism and specificity of tRNA-inosine-forming enzymes . The results show that inosine-34 and inosine-37 in tRNAs are both synthesised by a hydrolytic deamination-type reaction, catalysed by distinct tRNA:adenosine deaminases . Recognition of tRNA substrates by the deaminases does not strictly depend on a particular "identity' nucleotide . However, the efficiency of adenosine to inosine conversion depends on the nucleotides composition of the anticodon loop and the proximal stem as well as on 3D-architecture of the tRNA . In eukaryotic tRNA(Ala), N1-methylinosine-37 is formed from inosine-37 by a specific SAM-dependent methylase, while in the case of N1-methylinosine-57 in archaeal tRNAs, methylation of adenosine-57 into N1-methyladenosine-57 occurs before the deamination process . The T psi-branch of fragmented tRNA is the minimalist substrate for the N1-methylinosine-57 forming enzymes . Inosine-34 and N1-methylinosine-37 in human tRNA(Ala) are targets for specific autoantibodies which are present in the serum of patients with inflammatory muscle disease of the PL-12 polymyositis type . Here we discuss the mechanism, specificity and general properties of the recently discovered RNA:adenosine deaminases/editases acting on double-stranded RNA, intron-containing mRNA and viral RNA in relation to those of the deaminases acting on tRNAs. J Clin Lab Anal, 1996, 10(2), 70 - 3 Purification, characterization, and pathogenicity of urease produced by Vibrio parahaemolyticus; Cai Y et al.; Vibrio parahaemolyticus is a halophilic bacterium associated with gastroenteritis and traveller's diarrhea . The urease-positive, Kanagawa-negative V . parahaemolyticus had been isolated from patients and the environment in the Pacific Northwest, first reported by Kelly et al . (5) . Recently, we purified the urease produced by a clinical isolated of V . parahaemolyticus, and its characterization and pathogenicity has been studied . The urease isolation procedure included a water extraction and anion exchange chromatography . The molecular weight for the native enzyme was 275 KDa, and the three subunits of 85 KDa, 59 KDa, and 33 KDa were determined . The isoelectric focusing of urease was 5.2 . The purified urease also can cause intestinal fluid accumulation and demonstrate a positive result in the suckling mouse test . These results suggested that the urease produced by V . parahaemolyticus may be another important indicator for the pathogenesis of the bacteria. Z Naturforsch {C}, 1996 Jan-Feb, 51(1-2), 29 - 39 Isolation, characterization, and substrate specificity of the plasma membrane ATPase of the hlophilic achaeon Haloferax volcanii; Steinert K et al.; Isolated membranes of the moderate halophilic bacterium Haloferax volcanii are able to hydrolyze ATP via an ATPase, which needs the presence of Mg2+ or Mn2+, high concentrations of NaCl, a pH value of 9, and high temperatures with an optimum at 60 degrees C . We have not found any phosphatase activity in the preparations . We developed a purification method for the isolated enzyme with an enrichment factor of 90 . SDS-gel electrophoresis of the partially purified enzyme of Haloferax volcanii showed putative ATPase subunits of 63, 51, 37, and 12 kDa . N-ethylmaleimide (NEM) a specific inhibitor for V-ATPases, which alkylates cyteines, inhibited the enzyme slightly . Binding of tritiated NEM to the isolated ATPase fractions resulted in labelling of the 63 and 51 kDa peptides . Using PCR with degenerate oligonucleotides, we could clone and sequence a gene cluster encoding the A1 part of the halophilic ATPase . The described genes are organized in an operon in the order D, C, E, B, A, named alphabetically according to their decreasing size . The deduced products of 64.5, 52, 38.7, 22, and 11.6 kDa confirm the results of the partial purification of the ATPase . Biochemical characterization of the Haloferax volcanii ATPase gave the following results: In presence of Mn2+ higher rates of ATP hydrolysis could be observed than in presence of Mg2+, but free manganese ions inhibited the enzyme activity of the ATPase . Calculation of the true concentrations of the complex between ATP and the respective divalent metal ion led to determination of Michaelis-Menten constants for ATP in the hydrolysis direction of 1 mM in presence of MgCl2 and 0.24 mM in presence of MnCl2 . Sodium chloride concentrations in the molar range induce changes in KM by a factor of about 10 . The enzyme is specific for ATP; other nucleotides including GTP and ADP are competitive inhibitors of ATP hydrolysis. Plant Mol Biol, 1996 Jan, 30(1), 65 - 75 Higher-plant chloroplast and cytosolic 3-phosphoglycerate kinases: a case of endosymbiotic gene replacement; Brinkmann H et al.; Previous studies indicated that plant nuclear genes for chloroplast and cytosolic isoenzymes of 3-phosphoglycerate kinase (PGK) arose through recombination between a preexisting gene of the eukaryotic host nucleus for the cytosolic enzyme and an endosymbiont-derived gene for the chloroplast enzyme . We readdressed the evolution of eukaryotic pgk genes through isolation and characterisation of a pgk gene from the extreme halophilic, photosynthetic archaebacterium Haloarcula vallismortis and analysis of PGK sequences from the three urkingdoms . A very high calculated net neg