Chem Phys Lipids, 2003 Jan, 122(1-2), 159 - 63 Al(3+)-mediated changes on membrane fluidity affects the activity of PI-PLC but not of PLC; Verstraeten SV et al.; We investigated whether Al(3+)-mediated changes in membrane fluidity can affect the activity of prokaryotic enzymes phospholipase C (PLC) and phospholipase C-phosphatidyl inositol specific (PI-PLC) in liposomes of phosphatidyl choline (PC), PC:phosphatidyl inositol (PI), or PC and polyphosphoinositides (PPI) . Al(3+) (10-100 microM) promoted membrane rigidification, evaluated with the probes 1,6-diphenyl-1,3,5-hexatriene and Laurdan, and followed the order: PC:PPI>PC:PI>PC . Al(3+) (25 and 50 microM) did not affect PLC-mediated hydrolysis of PC, PI and PIP(2), but stimulated PIP hydrolysis (48.6%) . PI-PLC did not affect PC, PI, and PIP concentrations, but caused a 67% decrease in PIP(2) . Al(3+) significantly inhibited PIP(2) hydrolysis in a concentration-dependent (25-50 microM) manner . Results suggest that the inhibition of PIP(2) hydrolysis by Al(3+) could be partially due to a higher lipid packing induced by Al(3+) which could affect the interaction between the enzyme and its substrate. Zhejiang Da Xue Xue Bao Yi Xue Ban, 2002 Jun 25, 31(3), 174 - 177 {Molecular cloning of human IL-7cDNA and construction of eukaryotic vector expressing hIL-7}; Cheng B et al.; OBJECTIVE: To construct a vector expressing eukaryotic human interluken-7(hIL-7) . METHODS: hIL-7 DNA was identified and cloned (cDNA) from human spleen tissue using reverse transcription polymerase chain reaction (RT-PCR) . We incorporated the cDNA into the pMD18-T plasmid . The pMD18-T plasmid was then inserted into a dual expression vector (prokaryotic and eukaryotic) pBK-CMV and called pBK-CMV-hIL-7 . We used pBK-CMV-hIL-7 vector to infect E.coli DH5alpha . The expression of the recombinant hIL-7 protein (rhIL-7) by E.coli DH5alpha was analyzed using SDS-PAGE and western blot testing . RESULTS: The genetically engineered E.coli DH5alpha did express rhIL-7 confirmed by western blot . CONCLUSION: The successful construction of genetically engineered eukaryotic gene for hIL-7 was done, This will enable further research into therapeutic uses for hIL-7. Nucleic Acids Res, 2003 Mar 1, 31(5), 1444 - 54 The structure of full-length LysR-type transcriptional regulators . Modeling of the full-length OxyR transcription factor dimer; Zaim J et al.; The LysR-type transcriptional regulators (LTTRs) comprise the largest family of prokaryotic transcription factors . These proteins are composed of an N-terminal DNA binding domain (DBD) and a C-terminal cofactor binding domain . To date, no structure of the DBD has been solved . According to the SUPERFAMILY and MODBASE databases, a reliable homology model of LTTR DBDs may be built using the structure of the Escherichia coli ModE transcription factor, containing a winged helix- turn-helix (HTH) motif, as a template . The remote, but statistically significant, sequence similarity between ModE and LTTR DBDs and an alignment generated using SUPERFAMILY and MODBASE methods was independently confirmed by alignment of sequence profiles representing ModE and LTTR family DBDs . Using the crystal structure of the E.coli OxyR C-terminal domain and the DBD alignments we constructed a structural model of the full-length dimer of this LTTR family member and used it to investigate the mode of protein-DNA interaction . We also applied the model to interpret, in a structural context, the results of numerous biochemical studies of mutated LTTRs . A comparison of the LTTR DBD model with the structures of other HTH proteins also provides insights into the interaction of LTTRs with the C-terminal domain of the RNA polymerase alpha subunit. J Mol Biol, 2003 Mar 7, 326(5), 1337 - 49 Characterisation of a non-canonical genetic code in the oxymonad Streblomastix strix; Keeling PJ et al.; The genetic code is one of the most highly conserved characters in living organisms . Only a small number of genomes have evolved slight variations on the code, and these non-canonical codes are instrumental in understanding the selective pressures maintaining the code . Here, we describe a new case of a non-canonical genetic code from the oxymonad flagellate Streblomastix strix . We have sequenced four protein-coding genes from S.strix and found that the canonical stop codons TAA and TAG encode the amino acid glutamine . These codons are retained in S.strix mRNAs, and the legitimate termination codons of all genes examined were found to be TGA, supporting the prediction that this should be the only true stop codon in this genome . Only four other lineages of eukaryotes are known to have evolved non-canonical nuclear genetic codes, and our phylogenetic analyses of alpha-tubulin, beta-tubulin, elongation factor-1 alpha (EF-1 alpha), heat-shock protein 90 (HSP90), and small subunit rRNA all confirm that the variant code in S.strix evolved independently of any other known variant . The independent origin of each of these codes is particularly interesting because the code found in S.strix, where TAA and TAG encode glutamine, has evolved in three of the four other nuclear lineages with variant codes, but this code has never evolved in a prokaryote or a prokaryote-derived organelle . The distribution of non-canonical codes is probably the result of a combination of differences in translation termination, tRNAs, and tRNA synthetases, such that the eukaryotic machinery preferentially allows changes involving TAA and TAG. Exp Parasitol, 2002 Aug, 101(4), 215 - 22 Entamoeba histolytica: purification and characterization of ornithine decarboxylase; Arteaga-Nieto P et al.; Ornithine decarboxylase, a rate-limiting enzyme in polyamine biosynthesis in eukaryotes, was stabilized and purified from trophozoites of the parasite protozoan E . histolytica . Analytical electrophoresis revealed the presence in the purified preparations of a major polypeptide of 45 kDa and barely detectable amounts of two other proteins of 70 and 120 kDa . Both the 45 and 70 kDa polypeptides were recognized by a mouse anti-ODC monoclonal antibody . The major polypeptide exhibited amino terminal sequence homology in the range of 40-73% with ODCs from other organisms . The immunoreactive polypeptide of 70 kDa was not identified . The molecular masses of 216 and 45 kDa determined for the native enzyme by gel filtration and for the major polypeptide by SDS-PAGE, respectively, suggest that the amoeba ODC is a homopentamer . Dialysis against hydroxylamine rendered the enzyme activity fully dependent on pyridoxal 5'-phosphate (PLP) . As expected for an oligomeric enzyme, ODC activity exhibited sigmoidal kinetics when it was measured as a function of increasing concentrations of L-ornithine and PLP yielding S(0.5) values of 0.45 and 0.18 mM, respectively . Purified ODC was inhibited by 1,3-diaminopropane and 2,4-diamino-2-butanone but was largely insensitive to inhibition by alpha-difluoromethylornithine (DFMO), indicating that the enzyme may not be a suitable target for this anti-parasitic drug . Other features of the amoeba ODC were common with the enzyme from prokaryotes and eucaryotes. Philos Trans R Soc Lond B Biol Sci, 2003 Jan 29, 358(1429), 223 - 30 Evolution of photosynthetic prokaryotes: a maximum-likelihood mapping approach; Raymond J et al.; Reconstructing the early evolution of photosynthesis has been guided in part by the geological record, but the complexity and great antiquity of these early events require molecular genetic techniques as the primary tools of inference . Recent genome sequencing efforts have made whole genome data available from representatives of each of the five phyla of bacteria with photosynthetic members, allowing extensive phylogenetic comparisons of these organisms . Here, we have undertaken whole genome comparisons using maximum likelihood to compare 527 unique sets of orthologous genes from all five photosynthetic phyla . Substantiating recent whole genome analyses of other prokaryotes, our results indicate that horizontal gene transfer (HGT) has played a significant part in the evolution of these organisms, resulting in genomes with mosaic evolutionary histories . A small plurality phylogenetic signal was observed, which may be a core of remnant genes not subject to HGT, or may result from a propensity for gene exchange between two or more of the photosynthetic organisms compared. Philos Trans R Soc Lond B Biol Sci, 2003 Jan 29, 358(1429), 147 - 53; discussion 153-4 Redox and light regulation of gene expression in photosynthetic prokaryotes; Bauer C et al.; All photosynthetic organisms control expression of photosynthesis genes in response to alterations in light intensity as well as to changes in cellular redox potential . Light regulation in plants involves a well-defined set of red- and blue-light absorbing photoreceptors called phytochrome and cryptochrome . Less understood are the factors that control synthesis of the plant photosystem in response to changes in cellular redox . Among a diverse set of photosynthetic bacteria the best understood regulatory systems are those synthesized by the photosynthetic bacterium Rhodobacter capsulatus . This species uses the global two-component signal transduction cascade, RegB and RegA, to anaerobically de-repress anaerobic gene expression . Under reducing conditions, the phosphate on RegB is transferred to RegA, which then activates genes involved in photosynthesis, nitrogen fixation, carbon fixation, respiration and electron transport . In the presence of oxygen, there is a second regulator known as CrtJ, which is responsible for repressing photosynthesis gene expression . CrtJ responds to redox by forming an intramolecular disulphide bond under oxidizing, but not reducing, growth conditions . The presence of the disulphide bond stimulates DNA binding activity of the repressor . There is also a flavoprotein that functions as a blue-light absorbing anti-repressor of CrtJ in the related bacterial species Rhodobacter sphaeroides called AppA . AppA exhibits a novel long-lived photocycle that is initiated by blue-light absorption by the flavin . Once excited, AppA binds to CrtJ thereby inhibiting the repressor activity of CrtJ . Various mechanistic aspects of this photocycle will be discussed. Philos Trans R Soc Lond B Biol Sci, 2003 Jan 29, 358(1429), 39 - 57; discussion 57-8 How big is the iceberg of which organellar genes in nuclear genomes are but the tip? Doolittle WF, Boucher Y, Nesbo CL, Douady CJ, Andersson JO, Roger AJ. As more and more complete bacterial and archaeal genome sequences become available, the role of lateral gene transfer (LGT) in shaping them becomes more and more clear . Over the long term, it may be the dominant force, affecting most genes in most prokaryotes . We review the history of LGT, suggesting reasons why its prevalence and impact were so long dismissed . We discuss various methods purporting to measure the extent of LGT, and evidence for and against the notion that there is a core of never-exchanged genes shared by all genomes, from which we can deduce the "true" organismal tree . We also consider evidence for, and implications of, LGT between prokaryotes and phagocytic eukaryotes. FEMS Microbiol Lett, 2003 Feb 14, 219(1), 39 - 45 Genomics-based design of defined growth media for the plant pathogen Xylella fastidiosa; Lemos EG et al.; Based on the genetic analysis of the phytopathogen Xylella fastidiosa genome, five media with defined composition were developed and the growth abilities of this fastidious prokaryote were evaluated in liquid media and on solid plates . All media had a common salt composition and included the same amounts of glucose and vitamins but differed in their amino acid content . XDM(1) medium contained amino acids threonine, serine, glycine, alanine, aspartic acid and glutamic acid, for which complete degradation pathways occur in X . fastidiosa; XDM(2) included serine and methionine, amino acids for which biosynthetic enzymes are absent, plus asparagine and glutamine, which are abundant in the xylem sap; XDM(3) had the same composition as XDM(2) but with asparagine replaced by aspartic acid due to the presence of complete degradation pathway for aspartic acid; XDM(4) was a minimal medium with glutamine as a sole nitrogen source; XDM(5) had the same composition as XDM(4), plus methionine . The liquid and solidified XDM(2) and XDM(3) media were the most effective for the growth of X . fastidiosa . This work opens the opportunity for the in silico design of bacterial defined media once their genome is sequenced. FEMS Microbiol Lett, 2003 Feb 14, 219(1), 1 - 7 Prokaryotes and the input of polyunsaturated fatty acids to the marine food web; Nichols DS; The investigation of prokaryotes in aquatic ecology is often limited to their role in nutrient cycling and the degradation of organic matter . While this aspect of the microbial loop is undoubtedly important, further aspects of bacterial roles in marine food webs exist which have not been fully considered in light of recent research in related fields . The concept of bacteria providing essential nutrients may derive importance from two aspects of their role in the marine environment; firstly as a primary food source for omnivorous, sestonivorous and filtering benthic animals and secondly as components of the commensal microbial communities of marine animals . Many marine organisms lack the de novo ability to produce n-3 polyunsaturated fatty acids (PUFA) and hence rely on a dietary supply of PUFA . The issue of PUFA origin in the marine food web is particularly salient in light of recent research demonstrating the influence of PUFA levels on the efficiency of energy transfer between trophic levels . The assumption that microalgae provide the bulk of de novo PUFA production for all marine food webs must be actively reviewed with respect to particular microbial niches such as sea ice, marine animals and abyssal communities. Nat Struct Biol, 2003 Mar, 10(3), 212 - 8 The H-NS dimerization domain defines a new fold contributing to DNA recognition; Bloch V et al.; H-NS, a protein found in Gram-negative bacteria, is involved in structuring the bacterial chromosome and acts as a global regulator for the expression of a wide variety of genes . These functions are correlated with both its DNA-binding and oligomerization properties . We have identified the minimal dimerization domain of H-NS, a 46 amino acid-long N-terminal fragment, and determined its structure using heteronuclear NMR spectroscopy . The highly intertwined structure of the dimer, reminiscent of a handshake, defines a new structural fold, which may offer a possibility for discriminating prokaryotic from eukaryotic proteins in drug design . Using mutational analysis, we also show that this N-terminal domain actively contributes to DNA binding, conversely to the current paradigm . Together, our data allows us to propose a model for the action of full length H-NS. Anal Bioanal Chem, 2003 Feb, 375(3), 344 - 9 Epub 2003 Jan 16. HPLC assay for methylmalonyl-CoA epimerase; Bobik TA et al.; Methylmalonyl-CoA epimerase (MCE) is broadly distributed in nature and has diverse cellular roles . Many MCE homologues are represented in public databases, but the biochemical function and physiological roles of the majority of these putative proteins have not been investigated . Here, a simplified assay for MCE is described . In this assay, MCE converted (2S)-methylmalonyl-CoA to (2R)-methylmalonyl-CoA which in turn was converted to succinyl-CoA by methylmalonyl-CoA mutase, an enzyme specific for the 2 R isomer . MCE activity was quantified by measuring the disappearance of methylmalonyl-CoA by HPLC . To obtain the methylmalonyl-CoA mutase which was required as a reagent for the assay, an Escherichia coli strain was constructed that expressed high levels of this enzyme as a fusion protein with an 8x histidine tag . This allowed purification of the mutase in a single affinity chromatography step . Previously reported MCE assays required radioactive substrates and/or multiple reagent enzymes that were difficult to obtain . The assay reported here overcomes these difficulties and hence will facilitate studies of MCEs . Such enzymes play important roles in the metabolism of both prokaryotes and higher eukaryotes including humans. Indian J Exp Biol, 2002 Jun, 40(6), 706 - 16 Inevitable glutathione, then and now; Rana SV et al.; Glutathione a predominant tripeptide thiol compound of many prokaryotes and eukaryotes, is synthesized from its precursor amino acids eg . gamma-glutamate, cysteine and glycine . It is mainly involved in detoxication mechanisms through conjugation reactions . Other functions include thiol transfer, destruction of free radicals and metabolism of various exogenous and endogenous compounds . It becomes mandatory for a cell to manage high concentration of intracellular GSH to protect itself from chemical/dug abuse . Glutathione dependent enzymes viz: glutathione-S-transferases, glutathione peroxidase, glutathione reductase and gamma-glutamate transpeptidase facilitate protective manifestations . Liver serves as a glutathione-generating factor which supplies the kidney and intestine with other constituents of glutathione resynthesis . The principal mechanism of hepatocyte glutathione turnover appears to be cellular efflux . Kidney too plays an important role in organismic GSH homeostasis . Role of GSH in organs like lung, intestine and brain has recently been described . GSH involvement in programmed cell death has also been indicated . Immense interest makes the then "thee glutathione" as "inevitable glutathione" . This article describes the role of this vital molecule in cell physiology and detoxication mechanisms in particular. Biochim Biophys Acta, 2003 Feb 17, 1610(1), 109 - 23 Downstream coding region determinants of bacterio-opsin, muscarinic acetylcholine receptor and adrenergic receptor expression in Halobacterium salinarum; Bartus CL et al.; The aim of this work is to develop a prokaryotic system capable of expressing membrane-bound receptors in quantities suitable for biochemical and biophysical studies . Our strategy exploits the endogenous high-level expression of the membrane protein bacteriorhodopsin (BR) in the Archaeon Halobacterium salinarum . We attempted to express the human muscarinic acetylcholine (M(1)) and adrenergic (a2b) receptors by fusing the coding region of the m1 and a2b genes to nucleotide sequences known to direct bacterio-opsin (bop) gene transcription . The fusions included downstream modifications to produce non-native carboxyl-terminal amino acids useful for protein identification and purification . bop mRNA and BR accumulation were found to be tightly coupled and the carboxyl-terminal coding region modifications perturbed both . m1 and a2b mRNA levels were low, and accumulation was sensitive to both the extent of the bop gene fusion and the specific carboxyl-terminal coding sequence modifications included . Functional a2b adrenergic receptor expression was observed to be dependent on the downstream coding region . This work demonstrates that a critical determinant of expression resides in the downstream coding region of the wild-type bop gene and manipulation of the downstream coding region of heterologous genes may affect their potential for expression in H . salinarum . Biochim Biophys Acta, 2003 Feb 17, 1610(1), 37 - 45 The expression of outer membrane proteins for crystallization; Bannwarth M et al.; The production of sufficient amounts of chemically and conformationally homogenous protein is a major requirement for successful crystallization and structure determination . With membrane proteins, this constitutes a particular problem because the membrane volume is limited and the organisms are usually very sensitive to changes in membrane properties brought about by massive protein insertion . Moreover, the extraction of membrane proteins from the membrane with detergents is generally a harsh treatment, which gives rise to conformational aberrations . A number of successful procedures for functional expression followed by purification are reviewed here together with nonfunctional expression into inclusion bodies and subsequent (re)folding to produce functional proteins . Most of the data are for prokaryotic outer membrane proteins, but the outer membrane proteins of eukaryotic organelles are also considered as they do show similar features . Biochim Biophys Acta, 2003 Feb 17, 1610(1), 23 - 36 Practical aspects of overexpressing bacterial secondary membrane transporters for structural studies; Wang DN et al.; Membrane transporter proteins play critical physiological roles in the cell and constitute 5-10% of prokaryotic and eukaryotic genomes . High-resolution structural information is essential for understanding the functional mechanism of these proteins . A prerequisite for structural study is to overexpress such proteins in large quantities . In the last few years, over 20 bacterial membrane transporters were overexpressed at a level of 1 mg/l of culture or higher, most often in Escherichia coli . In this review, we analyzed those factors that affect the quantity and quality of the protein produced, and summarized recent progress in overexpression of membrane transporters from bacterial inner membrane . Rapid progress in genome sequencing provides opportunities for expressing several homologues and orthologues of the target protein simultaneously, while the availability of various expression vectors allows flexible experimental design . Careful optimization of cell culture conditions can drastically improve the expression level and homogeneity of the target protein . New sample preparation techniques for mass spectrometry of membrane proteins have enabled one to identity the rigid protein core, which can be subsequently overexpressed . Size-exclusion chromatography on HPLC has proven to be an efficient method in screening detergent, pH an other conditions required for maintaining the stability and monodispersity of the protein . Such high-quality preparations of membrane transporter proteins will probably lead to successful crystallization and structure determination of these proteins in the next few years . Biochim Biophys Acta, 2003 Feb 17, 1610(1), 11 - 22 Specific lipid requirements of membrane proteins--a putative bottleneck in heterologous expression; Opekarova M et al.; Membrane proteins are mostly protein-lipid complexes . For more than 30 examples of membrane proteins from prokaryotes, yeast, plant and mammals, the importance of phospholipids and sterols for optimal activity is documented . All crystallized membrane protein complexes show defined lipid-protein contacts . In addition, lipid requirements may also be transitory and necessary only for correct folding and intercellular transport . With respect to specific lipid requirements of membrane proteins, the phospholipid and glycolipid as well as the sterol content of the host cell chosen for heterologous expression should be carefully considered . The lipid composition of bacteria, archaea, yeasts, insects,Xenopus oocytes, and typical plant and mammalian cells are given in this review . A few examples of heterologous expression of membrane proteins, where problems of specific lipid requirements have been noticed or should be thought of, have been chosen . Bioinformatics, 2003 Feb 12, 19(3), 418 - 20 IslandPath: aiding detection of genomic islands in prokaryotes; Hsiao W et al.; Genomic islands (clusters of genes of potential horizontal origin in a prokaryotic genome) are frequently associated with a particular adaptation of a microbe that is of medical, agricultural or environmental importance, such as antibiotic resistance, pathogen virulence, or metal resistance . While many sequence features associated with such islands have been adopted separately in applications for analysis of genomic islands, including pathogenicity islands, there is no single application that integrates multiple features for island detection . IslandPath is a network service which incorporates multiple DNA signals and genome annotation features into a graphical display of a bacterial or archaeal genome, to aid the detection of genomic islands . AVAILABILITY: This application is available at and the source code is freely available, under GNU public licence, from the authors . SUPPLEMENTARY INFORMATION: An online help file, which includes analyses of the utility of IslandPath, can be found at http://www.pathogenomics.sfu.ca/islandpath/current/islandhelp.html Theor Appl Genet, 2002 Aug, 105(2-3), 423 - 430 Epub 2002 Jun 19. Structure and expression of the Zea mays mutS-homologs Mus1 and Mus2; Horwath M et al.; DNA mismatch repair proteins play an important role in maintaining the integrity of the genetic information during replication and homologous recombination . The MutS-homologous (MSH) and MutL-homologous (MLH) proteins are highly conserved among all prokaryotes and eukaryotes . We have isolated two mutS homologous genes from Zea mays, named Mus1 and Mus2 . Phylogenetic analysis identifies Mus1 as a member of the MSH2 protein family . Mus2 is an ortholog of the Arabidopsis thaliana MSH7 protein and belongs to a subgroup of MSH proteins that is possibly plant-specific . Mus1 and Mus2 are expressed at very low levels . Mus1 is located on chromosome 7L near locus b32B, and mus2 maps on chromosome 3S. Nucleic Acids Res, 2003 Feb 15, 31(4), 1234 - 44 Evolution of transcription factors and the gene regulatory network in Escherichia coli; Madan Babu M et al.; The most detailed information presently available for an organism's transcriptional regulation network is that for the prokaryote Escherichia coli . In order to gain insight into the evolution of the E.coli regulatory network, we analysed information obtainable for the domains and protein families of the transcription factors and regulated genes . About three-quarters of the 271 transcription factors we identified are two-domain proteins, consisting of a DNA-binding domain along with a regulatory domain . The regulatory domains mainly bind small molecules . Many groups of transcription factors have identical domain architectures, and this implies that roughly three-quarters of the transcription factors have arisen as a consequence of gene duplication . In contrast, there is little evidence of duplication of regulatory regions together with regulated genes or of transcription factors together with regulated genes . Thirty-eight, out of the 121 transcription factors for which one or more regulated genes are known, regulate other transcription factors . This amplification effect, as well as large differences between the numbers of genes directly regulated by transcription factors, means that there are about 10 global regulators which each control many more genes than the other transcription factors. J Biol Chem, 2003 Apr 25, 278(17), 15246 - 51 Epub 2003 Feb 11. Folding pathway mediated by an intramolecular chaperone . A functional peptide chaperone designed using sequence databases; Yabuta Y et al.; Catalytic domains of several prokaryotic and eukaryotic protease families require dedicated N-terminal propeptide domains or "intramolecular chaperones" to facilitate correct folding . Amino acid sequence analysis of these families establishes three important characteristics: (i) propeptides are almost always less conserved than their cognate catalytic domains, (ii) they contain a large number of charged amino acids, and (iii) propeptides within different protease families display insignificant sequence similarity . The implications of these findings are, however, unclear . In this study, we have used subtilisin as our model to redesign a peptide chaperone using information databases . Our goal was to establish the minimum sequence requirements for a functional subtilisin propeptide, because such information could facilitate subsequent design of tailor-made chaperones . A decision-based computer algorithm that maintained conserved residues but varied all non-conserved residues from a multiple protein sequence alignment was developed and utilized to design a novel peptide sequence (ProD) . Interestingly, despite a difference of 5 pH units between their isoelectric points and despite displaying only 16% sequence identity with the wild-type propeptide (ProWT), ProD chaperones folding and functions as a potent subtilisin inhibitor . The computed secondary structures and hydrophobic patterns within these two propeptides are similar . However, unlike ProWT, ProD adopts a well defined alpha-beta conformation as an isolated peptide and forms a stoichiometric complex with mature subtilisin . The CD spectra of this complex is similar to ProWT.subtilisin . Our results establish that despite low sequence identity and dramatically different charge distribution, both propeptides adopt similar structural scaffolds . Hence, conserved scaffolds and hydrophobic patterns, but not absolute charge, dictate propeptide function. Med Hypotheses, 2003 Mar, 60(3), 418 - 23 The halting arrival of left-handed Z-DNA; Gagna CE et al.; Forty-nine years ago Watson and Crick proposed a double-stranded (ds-) model for DNA . This double helix has become an icon of molecular biology . Twenty-six years later, Rich accidently discovered Z-DNA, an exotic left-handed nucleic acid . For many years thereafter, this left-handed DNA was thought to be an artifact . DNA is no longer looked upon as a static molecule but rather an extremely dynamic structure in which different conformations are in equilibrium with each other . Many researchers have spent the last two decades characterizing this novel left-handed DNA structure . Now many investigators are beginning to accept the possibility that this novel ds-DNA conformation may play a significant in vivo role within eukaryotic and prokaryotic cells . However, more research needs to be performed before it is absolutely accepted by all in the scientific community. Theor Appl Genet, 2002 Jan, 104(1), 48 - 53 Evidence for a prokaryotic insertion-sequence contamination in eukaryotic sequences registered in different databases; Astua-Monge G et al.; An insertion-sequence of prokaryotic origin was detected in a genomic clone obtained from a Phaseolus vulgaris bacterial artificial chromosome (BAC) library . This BAC clone, characterized as part of a contig constructed near a virus resistance gene, exhibited restriction fragment length polymorphism with an overlapping clone of the contig . Restriction analysis of DNA obtained from individual colonies of the stock culture indicated the presence of a mixed population of wild-type and insertional mutants . Sequence analysis of both members of the population revealed the presence of IS 10R, an insertion-sequence from Escherichia coli . A BLAST search for IS 10-like sequences detected unexpected homologies with a large number of eukaryotic sequences from Homo sapiens, Arabidopsis thaliana, Drosophila melanogasterand Caenorhabditis elegans . Southern analysis of a random sample of BAC clones failed to detect IS 10 in the BAC DNA . However, prolonged sub-culturing of a set of 15 clones resulted in transposition into the BAC DNA . Eventually, all cultures acquired a 2.3-kb fragment that hybridized strongly with IS 10 . Sequence analysis revealed the presence of a preferred site for transposition in the BAC vector . These results indicate that a large number, if not all, of the BAC libraries from different organisms are contaminated with IS 10R . The source of this element has been identified as the DH10B strain of E . coli used as the host for BAC libraries. Proteins, 2003 Mar 1, 50(4), 589 - 99 A path from primary protein sequence to ligand recognition; Kho R et al.; A novel method to organize protein structural information based solely on sequence is presented . The method clusters proteins into families that correlate with the three-dimensional protein structure and the conformation of the bound ligands . This procedure was applied to nicotinamide adenine dinucleotide {NAD(P)}-utilizing enzymes to identify a total of 94 sequence families, 53 of which are structurally characterized . Each of the structurally characterized proteins within a sequence family correlates to a single protein fold and to a common bound conformation of NAD(P) . A wide range of structural folds is identified that recognize NAD(P), including Rossmann folds and beta/alpha barrels . The defined sequence families can be used to identify the type and prevalence of NAD(P)-utilizing enzymes in the proteomes of sequenced organisms . The proteome of Mycobacterium tuberculosis was mined to generate a proteome-wide profile of NAD(P)-utilizing enzymes coded by this organism . This enzyme family comprises approximately 6% of the open reading frames, with the largest subgroup being the Rossmann fold, short-chain dehydrogenases . The preponderance of short-chain dehydrogenases correlates strongly with the phenotype of M . tuberculosis, which is characterized as having one of the most complex prokaryotic cell walls . Am J Clin Oncol, 2003 Feb, 26(1), 92 - 4 Regression of lung lesions in Hodgkin's disease by antibiotics: case report and hypothesis on the etiology of Hodgkin's disease; Sauter C et al.; In this article, we propose that the pathogenesis of Hodgkin's disease is similar to the one of crown gall tumors in plants . Here a natural exchange of genetic material from (oncogenic plasmids) to plant cells induces malignant tumors in dicotyledons . The "crown gall" hypothesis for Hodgkin's disease would explain the clinical observations of a bacterial infection the behavior as a malignant tumor . The clinical consequence of this hypothesis is that antibiotic treatments of very early Hodgkin's disease may be successful before the genetic exchange between prokaryotic and eukaryotic cells has taken place . This "crown gall" hypothesis is testable (1) by looking for bacterial DNA sequences in Reed-Sternberg and Hodgkin's cells, and (2) by antibiotic treatments of Hodgkin's patients . In this communication we show a regression of Hodgkin's disease in the lung by prolonged treatment with ciprofloxacin and clarithromycin. Microbiology, 2003 Jan, 149(Pt 1), 1 - 7 Prokaryote taxonomy of the 20th century and the impact of studies on the genus Pseudomonas: a personal view; Palleroni NJ; The taxonomic studies on the genus Pseudomonas performed in the Department of Bacteriology of the University of California at Berkeley played a significant role in the development of modern prokaryote taxonomy, which started in the 1960s . This impact was due to a revival of the method of den Dooren de Jong for the nutritional analysis of chemoorganotrophic organisms and, mostly, to the introduction of the determination of rRNA as a method of taxonomic analysis . While the introduction of the nutritional studies facilitated the characterization of Pseudomonas and other chemoorganotrophs, the applicability of the rRNA studies extended to all prokaryotes. J Struct Biol, 2003 Jan, 141(1), 77 - 83 Bioinformatic analysis of ClpS, a protein module involved in prokaryotic and eukaryotic protein degradation; Lupas AN et al.; ClpS is a small protein, usually encoded immediately upstream of ClpA in the genomes of proteobacteria . Recent results show that it is a molecular adaptor for substrate recognition by ClpA in Escherichia coli . We analyzed ClpS by bioinformatic methods and found that ClpS homologs are also found in organisms that lack ClpA, such as actinobacteria, cyanobacteria, and plant chloroplasts . Furthermore, ClpS is homologous to a domain in the eukaryotic E3 ubiquitin ligase, N-recognin . This domain has previously been described as responsible for the recognition of type 2 N-end rule substrates . Despite very low levels of sequence similarity to proteins of known structure, there appears to be substantial structural similarity between ClpS and the C-terminal domain of ribosomal protein L7/12 (1CTF). Hunan Yi Ke Da Xue Xue Bao, 2002 Jun 28, 27(3), 189 - 91 {Expression and purification of p11 fusion protein in E . coli and preparation of antiserum against GST-p11}; Tan ZP et al.; OBJECTIVE: To obtain p11 fusion protein and prepare specific polyclonal antibody against p11 . METHODS: A full-length human p11 gene was cloned into expression vectors, pGEX-4T-2 and pQE30, and transformed into E . coli . The expressed proteins were purified from lysates with Glutathione Sepharose 4B and the Ni-NTA agarose column, respectively . The purified GST-p11 was mixed with Freund's complete or incomplete adjuvant and immunized rabbits . RESULTS: A high level of expression of target proteins was detected after IPTG induction and purified proteins were obtained by affinity chromatography with Glutathione Sepharose 4B and the Ni-NTA agarose column, respectively . Western blotting analysis suggested that the polyclonal antibody can recognize 6xHis-p11 and GST protein . CONCLUSION: The antiserum against p11 prepared by prokaryotic expression of GST-p11 fusion protein has good specificity. EMBO J, 2003 Feb 17, 22(4), 807 - 15 Thylakoid targeting of Tat passenger proteins shows no delta pH dependence in vivo; Finazzi G et al.; The Tat pathway is a major route for protein export in prokaryotes and for protein targeting to thylakoids in chloroplasts . Based on in vitro studies, protein translocation through this pathway is thought to be strictly dependent on a transmembrane delta pH . In this paper, we assess the delta pH sensitivity of the Tat pathway in vivo . Using Chlamydomonas reinhardtii, we observed changes in the efficiency of thylakoid targeting in vivo by mutating the Tat signal of the Rieske protein . We then employed two endogenous pH probes located on the lumen side of the thylakoid membranes to estimate spectroscopically the delta pH in vivo . Using experimental conditions in which the trans-thylakoid delta pH was almost zero, we found no evidence for a delta pH dependence of the Tat pathway in vivo . We confirmed this observation in higher plants using attached barley leaves . We conclude that the Tat pathway does not require a delta pH under physiological conditions, but becomes delta pH sensitive when probed in vitro/in organello because of the loss of some critical intracellular factors. Hybrid Hybridomics, 2002 Dec, 21(6), 415 - 20 Genetic engineering of streptavidin-binding peptide tagged single-chain variable fragment antibody to Venezuelan equine encephalitis virus; Hu WG et al.; A recombinant gene encoding a single-chain variable fragment (scFv) antibody against Venezuelan equine encephalitis virus (VEE) was cloned into a prokaryotic T7 RNA polymerase-regulated expression vector . A streptavidin-binding peptide gene fused to a 6His tag was attached downstream to the scFv gene . The recombinant fusion protein was expressed in bacteria as inclusion bodies that were subsequently solubilized with 8 M urea and renatured by an arginine system . Purification of the fusion protein was achieved by immobilized metal affinity chromatography . Enzyme-linked immunosorbent assay (ELISA) and Western blotting results revealed that the fusion protein not only retained VEE antigen binding and specificity properties similar to those of its parent native monoclonal antibody (MAb), but also possessed streptavidin-binding activity . This experimental approach can eliminate the need for chemical biotinylation of antibodies and the risk associated of antibody denaturation and can provide a stable and reproducible reagent for rapid and efficient immunoassay of VEE when detected by horseradish peroxidase (HRP)-conjugated streptavidin. DNA Cell Biol, 2002 Dec, 21(12), 869 - 77 In vivo DNA electrotransfer; Trezise AE; The use of electrotransfer for DNA delivery to prokaryotic cells, and eukaryotic cells in vitro, has been well known and widely used for many years . However, it is only recently that electric fields have been used to enhance DNA transfer to animal cells in vivo, and this is known as DNA electrotransfer or in vivo DNA electroporation . Some of the advantages of this method of somatic cell gene transfer are that it is a simple method that can be used to transfer almost any DNA construct to animal cells and tissues in vivo; multiple constructs can be co-transfected; it is equally applicable to dividing and nondividing cells; the DNA of interest does not need to be subcloned into a specific viral transfer vector and there is no need for the production of high titre viral stocks; and, as no viral genes are expressed there is less chance of an adverse immunologic reaction to vector sequences . The ease with which efficient in vivo gene transfer can be achieved with in vivo DNA electrotransfer is now allowing genetic analysis to be applied to a number of classic animal model systems where transgenic and embryonic stem cell techniques are not well developed, but for which a wealth of detailed descriptive embryological information is available, or surgical manipulation is much more feasible . As well as exciting applications in developmental biology, in vivo DNA electrotransfer is also being used to transfer genes to skeletal muscle and drive expression of therapeutically active proteins, and to examine exogenous gene and protein function in normal adult cells situated within the complex environment of a tissue and organ system in vivo . Thus, in effect providing the in vivo equivalent of the in vitro transient transfection assay . As the widespread use of in vivo electroporation has really only just begun, it is likely that the future will hold many more applications for this technology in basic research, biotechnology and clinical research areas. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi, 2001, 19(1), 22 - 5 {Cloning and expression of the gene encoding Schistosoma japonicum tropomyosin}; Cao JP et al.; OBJECTIVE: To clone and express the cDNA encoding Schistosoma japonicum tropomyosin . METHODS: The cDNA was amplified by reverse transcription-polymerase chain reaction (RT-PCR) . The PCR products were ligated with pGEM-T vectors and then for transformations . After characterization of white clones by agarose gel electrophoresis, endonucleases digestion and PCR, some recombinant plasmids with inserts were used for sequencing . Then the gene was subcloned into prokaryotic expression vector pQE30 and expression was induced by IPTG . RESULTS: The PCR products was 823 bp judged by agarose gel electrophoresis and sequencing . A cDNA encoding S . japonicum tropomyosin, except for 14 amino acids at the amino terminus and 2 at the carboxyl terminus, has been constructed and cloned successfully . The colony, designated pGSjcTM12, was sequenced and shown to be 91.1% identical at the nuclei acid level and 98.1% identical in deduced amino acid sequence to that of S . mansoni tropomyosin . The gene was subcloned into pQE30 and an expressed protein of about 32 kDa was obtained . CONCLUSION: The cloning and expression of the gene encoding S . japonicum tropomyosin had been successfully made. Mini Rev Med Chem, 2003 Feb, 3(1), 1 - 9 Did quadruplex DNA play a role in the evolution of the eukaryotic linear chromosome? Arthanari H, Bolton PH. The current evidence on prokaryotic linear chromosomes, the eukaryotes that do not use telomerase and quadruplex DNA has been considered . This has lead to the suggestion that quadruplex DNA may have played a role in the evolution of the protection linear chromosomes rather than in overcoming the end replication problem. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi, 1999 Jun 30, 13(2), 124 - 7 {Expression of human prp gene in prokaryotic cells using GST fusion protein expression system}; Zhao X et al.; OBJECTIVE: To study the biological features of cell-surface protein PrPc, which is thought to be involved in the prion-associated diseases after converting to a proteinase-resistant isoform PrPSc posttranslationally, and to establish an effective immunologic diagnostic method using PrPc as antigen . METHODS: Amplifying and cloning the human prp gene from lymphocytes of two normal Chinese, after confirmed by DNA sequence analysis, the genes were separately subcloned into a GST-fusion expression plasmid . RESULTS: Sequence analysis showed that one contatined a point mutation that induced the 65th amino acid "Trp" inverting to a stop codon "TAG", whereas the other had the same sequence as the published standard prp gene . Both the standard and the mutated prp genes were separately subcloned into a GST fusion protein expression vector and expressed in the prokaryotic cells effectively . Western blot assay revealed that both of them expressed GST-PrP fusion proteins and could be recognized by PrP specific monoclonal antibody . CONCLUSION: It suggests that human PrP protein can be expressed in the GST fusion protein expression system and the expressed proteins hold good immune-reactivity. Gene, 2003 Jan 30, 304, 77 - 86 Comprehensive analysis of transmembrane topologies in prokaryotic genomes; Arai M et al.; We analysed comprehensively transmembrane (TM) topologies of TM proteins of 50 selected prokaryotic genomes, by discriminating between TM and soluble proteins by using SOSUI, then detecting and removing signal peptides by applying 'DetecSig', and finally predicting TM topologies by employing 'ConPred' . Estimated fraction of TM proteins in proteome averaged over the 50 genomes is approximately 22% . About 13% of TM proteins were predicted to have a signal peptide, and the fraction of soluble proteins with signal peptide (secretory proteins) ranges from 8 to 18% for most majority of the genomes . The N(in)-type TM proteins with 2-, 4-, 6- and 12-tms (number of transmembrane segments) are predominant among multi-spanning TM proteins, and correspondingly, significantly higher fractions of N(out)-type TM proteins with 1-, 3-, 5- and 11-tms have a signal peptide . It is also found that the TM proteins with signal peptide tend to have a long N-tail loop . The averaged sequence length of TM proteins increases linearly with the increase of the number of TM segments, with the increasing rate of about 35 residues, suggesting a possibility that TM topologies might have been evolved by the 'internal gene duplication' mechanism . Datasets of TM topologies predicted in this study are available at approximately TMPinGS/. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi, 2002, 20(2), 76 - 8 {Construction and expression of an eukaryotic recombinant plasmid from a hybrid gene of antigen for Plasmodium falciparum}; Yao L et al.; OBJECTIVE: To construct an eukaryotic recombinant plasmid with HGFSP, a hybrid gene encoding the antigen epitopes of MSA1, MSA2, RESA and CSP in different developing stages of Plasmodium falciparum (P . f.) . METHODS: HGFSP was sub-cloned into an eukaryotic expression plasmid pcDNA3 from a prokaryotic recombinant plasmid pSK-HGFSP to construct the eukaryotic recombinant expression plasmid pc-HGFSP . The identified recombinant was then transfected into HepG2 cells with liposome-mediated method . The G418-selected positive cell clones were tested to identify the immunogenicity of HGFSP-expressing antigen . RESULTS: It was evidenced that HGFSP was correctly inserted into pcDNA3 by restriction enzymes map analysis . HGFSP-expressing antigen-specific fluorescent response was observed in pc-HGFSP-transfected HepG2 cells . The results of SDS-PAGE and Western-blotting showed that there was a 23 kD protein band, which can be specifically recognized by anti-sera of HGFSP-expressing protein in pc-HGFSP-transfected HepG2 cell lysis . CONCLUSION: Pc-HGFSP, an eukaryotic recombinant plasmid encoding hybrid antigen epitopes of P . f., was constructed successfully and the antigenicity of pc-HGFSP-expressing protein was confirmed. J Biol Chem, 2003 Apr 18, 278(16), 13784 - 8 Epub 2003 Feb 02. Apparent cooperative assembly of the bacterial cell division protein FtsZ demonstrated by isothermal titration calorimetry; Caplan MR et al.; The assembly dynamics of FtsZ, a prokaryotic homolog of tubulin, are important for their role in bacterial cytokinesis . Here we used isothermal titration calorimetry (ITC) to measure the heat of FtsZ self-association under various conditions . The measurements were designed to test whether FtsZ protofilaments are assembled by an isodesmic (linear aggregates in which each bond has an identical equilibrium constant) or a cooperative (aggregates only become stable after forming a oligomeric nucleus) assembly process . The isodesmic model can fit the assembly in GDP closely but cannot fit the assembly in GTP . FtsZ-GTP without Mg(2+) exhibits an apparent critical concentration, which is indicative of cooperative assembly, near 2.9 microm . With 2.5 mm Mg(2+) (which allows FtsZ to hydrolyze GTP) the critical concentration is reduced 10-fold to approximately 0.31 microm . Both with and without Mg(2+) there is no evidence for assembly below the critical concentration, but there is an abrupt transition to full assembly above . The ITC data are highly suggestive of a cooperative assembly, although this is difficult to reconcile with the 1-subunit-thick protofilaments observed by electron microscopy. Genome Res, 2003 Feb, 13(2), 145 - 58 Evolutionary implications of microbial genome tetranucleotide frequency biases; Pride DT et al.; We compared nucleotide usage pattern conservation for related prokaryotes by examining the representation of DNA tetranucleotide combinations in 27 representative microbial genomes . For each of the organisms studied, tetranucleotide usage departures from expectations (TUD) were shared between related organisms using both Markov chain analysis and a zero-order Markov method . Individual strains, multiple chromosomes, plasmids, and bacteriophages share TUDs within a species . TUDs varied between coding and noncoding DNA . Grouping prokaryotes based on TUD profiles resulted in relationships with important differences from those based on 16S rRNA phylogenies, which may reflect unequal rates of evolution of nucleotide usage patterns following divergence of particular organisms from a common ancestor . By both symmetrical tree distance and likelihood analysis, phylogenetic trees based on TUD profiles demonstrate a level of congruence with 16S rRNA trees similar to that of both RpoA and RecA trees . Congruence of these trees indicates that there exists phylogenetic signal in TUD patterns, most prominent in coding region DNA . Because relationships demonstrated in TUD-based analyses utilize whole genomes, they should be considered complementary to phylogenies based on single genetic elements, such as 16S rRNA. Biochem Biophys Res Commun, 2003 Feb 7, 301(2), 480 - 7 Flavonoid glycoside: a new inhibitor of eukaryotic DNA polymerase alpha and a new carrier for inhibitor-affinity chromatography; Mizushina Y et al.; Two flavonoid glycosides, kaempferol 3-O-(6"-acetyl)-beta-glucopyranoside (KAG) and quercetin 3-O-(6"-acetyl)-beta-glucopyranoside (QAG), were found to be inhibitors of eukaryotic DNA polymerases from a Japanese vegetable, Petasites japonicus . These compounds inhibited the activities of mammalian replicative DNA polymerases (i.e., pol alpha, delta, and epsilon), but not other pol beta, eta, kappa, and lambda activities . KAG was a stronger inhibitor and more selective to pol alpha than QAG . The IC(50) values of KAG for pol alpha, delta, and epsilon were 41, 164, and 127 microM, respectively . The pol alpha inhibition by KAG was non-competitive with respect to both the DNA template-primer and the dNTP substrate . KAG and QAG did not influence the activities of prokaryotic DNA polymerases or other mammalian DNA metabolic enzymes such as human immunodeficiency virus type 1 reverse transcriptase, human telomerase, human DNA topoisomerase I and II, T7 RNA polymerase, and bovine deoxyribonuclease I . Therefore, we concluded that these flavonoid glycosides are moderate replicative DNA polymerase inhibitors leaning more relatively to pol alpha, and could be used as chromatographic carriers to purify the DNA polymerases rather than cytotoxic agents . We then made a KAG-conjugated column such as the epoxy-activated Sepharose 6B . In the column, pol alpha was selectively adsorbed and eluted. J Bacteriol, 2003 Feb, 185(4), 1478 - 83 Prokaryotic utilization of the twin-arginine translocation pathway: a genomic survey; Dilks K et al.; The twin-arginine translocation (Tat) pathway, which has been identified in plant chloroplasts and prokaryotes, allows for the secretion of folded proteins . However, the extent to which this pathway is used among the prokaryotes is not known . By using a genomic approach, a comprehensive list of putative Tat substrates for 84 diverse prokaryotes was established . Strikingly, the results indicate that the Tat pathway is utilized to highly varying extents . Furthermore, while many prokaryotes use this pathway predominantly for the secretion of redox proteins, analyses of the predicted substrates suggest that certain bacteria and archaea secrete mainly nonredox proteins via the Tat pathway . While no correlation was observed between the number of Tat machinery components encoded by an organism and the number of predicted Tat substrates, it was noted that the composition of this machinery was specific to phylogenetic taxa. J Bacteriol, 2003 Feb, 185(4), 1266 - 72 Molecular characteristics of spontaneous deletions in the hyperthermophilic archaeon Sulfolobus acidocaldarius; Grogan DW et al.; Prokaryotic genomes acquire and eliminate blocks of DNA sequence by lateral gene transfer and spontaneous deletion, respectively . The basic parameters of spontaneous deletion, which are expected to influence the course of genome evolution, have not been determined for any hyperthermophilic archaeon . We therefore screened a number of independent pyrimidine auxotrophs of Sulfolobus acidocaldarius for deletions and sequenced those detected . Deletions accounted for only 0.4% of spontaneous pyrE mutations, corresponding to a frequency of about 10(-8) per cell . Nucleotide sequence analysis of five independent deletions showed no significant association of the endpoints with short direct repeats, despite the fact that several such repeats occur within the pyrE gene and that duplication mutations in pyrE reverted at high frequencies . Endpoints of the spontaneous deletions did not coincide with short inverted repeats or potential stem-loop structures . No consensus sequence common to all the deletions could be identified, although two deletions showed the potential of being stabilized by octanucleotide sequences elsewhere in pyrE, and another pair of deletions shared an octanucleotide at their 3' ends . The unusually low frequency and low sequence dependence of spontaneous deletions in the S . acidocaldarius pyrE gene compared to other genetic systems could not be explained in terms of possible constraints imposed by the 5-fluoroorotate selection. J Biol Chem, 2003 Apr 18, 278(16), 13757 - 64 Epub 2003 Jan 31. Maize C4 NADP-malic enzyme . Expression in Escherichia coli and characterization of site-directed mutants at the putative nucleoside-binding sites; Detarsio E et al.; Malic enzymes catalyze the oxidative decarboxylation of l-malate to yield pyruvate, CO(2), and NAD(P)H in the presence of a bivalent metal ion . In plants, different isoforms of the NADP-malic enzyme (NADP-ME) are involved in a wide range of metabolic pathways . The C(4)-specific NADP-ME has evolved from C(3)-type malic enzymes to represent a unique and specialized form of NADP-ME as indicated by its particular kinetic and regulatory properties . In the present study, the mature C(4)-specific NADP-ME of maize was expressed in Escherichia coli . The recombinant enzyme has essentially the same physicochemical properties and K(m) for the substrates as those of the naturally occurring NADP-ME previously characterized . However, the k(cat) was almost 7-fold higher, which may suggest that the previously purified enzyme from maize leaves was partially inactive . The recombinant NADP-ME also has a very low intrinsic NAD-dependent activity . Five mutants of NADP-ME at the postulated putative NADP-binding site(s) (Gsite5V, Gsite2V, A392G, A387G, and R237L) were constructed by site-directed mutagenesis and purified to homogeneity . The participation of these residues in substrate binding and/or the catalytic reaction was inferred by kinetic measurements and circular dichroism and intrinsic fluorescence spectra . The results obtained were compared with a predicted three-dimensional model of maize C(4) NADP-ME based on crystallographic studies of related animal NAD(P)-MEs . The data presented here represent the first prokaryotic expression of a plant NADP-ME and reveals valuable insight regarding the participation of the mutated amino acids in the binding of substrates and/or catalysis. Sheng Wu Gong Cheng Xue Bao, 2002 Sep, 18(5), 536 - 40 {High expression and identification of DNA mismatch repair gene mutS in Escherichia coli}; Bi LJ et al.; DNA mismatch repair gene mutS (2.56 kb) was PCR modified and cloned into a secretive prokaryotic expression vector pET32a (+) which carries a N-terminal His.tag + and thioredoxin sequence . MutS protein was expressed with high level after IPTG induction using the strain E . coli AD494(DE3) . SDS-PAGE revealed that the expected protein with a molecular weight of 108 kD which is about 35% of the total bacterial proteins is almost soluble . The expected protein was purified directly by immobilized metal (Ni2+) chelation affinity chromatography and the purity is over 90% . MutS protein activity verified using mismatch DNA showed that the expression product can recognize and bind to base-pair mismatch specifically. Vaccine, 2003 Mar 7, 21(11-12), 1205 - 12 Immunity to East Coast fever in cattle induced by a polypeptide fragment of the major surface coat protein of Theileria parva sporozoites; Bishop R et al.; Full-length recombinant versions of p67, the 709 amino acid major surface protein of Theileria parva sporozoites, induce immunity to East Coast fever (ECF) in cattle . We show that a soluble Escherichia coli recombinant version of p67 (p67(635)), in which a prokaryotic signal peptide replaces the eukaryotic one, confers protection comparable to that induced by the full-length molecule, but is unstable . Peptides encoding 80 (p67C) and 205 (p67N) amino acid fragments of p67, containing epitopes recognised by sporozoite neutralising monoclonal antibodies, exhibit improved stability in E . coli . Antibodies raised against the central region of p67 (p67M) neutralise sporozoite infectivity in vitro . The p67C peptide induced immunity against ECF in cattle, at a level equivalent to p67(635), suggesting that a synthetic peptide vaccine might be achievable . Wei Sheng Wu Xue Bao, 2002 Aug, 42(4), 448 - 52 {Cloning and prokaryotic expression of viral binding protein(VBP) gene from endosybiotic bacterium of Rhopalosiphum padi}; Wu Y et al.; Viral binding protein gene from Rhopalosiphum padi Yangling biotype was amplified by PCR method and then cloned . The complete nucleotide sequence of the gene was determined, It has 1647 nucleotides encoding 548 amino acids . Comparison showed this gene has 97% identity on nucleotide level with Buchnera groEL-AM gene of Rhopalosiphum padi American biotype, while has 97.4% identity on amino acid level was found between this two genes . The VBP gene was ligated into pBV221 and pET30a expression vector and expressed the aim protein 63 kD and 69 kD. Wei Sheng Wu Xue Bao, 1999 Jun, 39(3), 234 - 40 {Prokaryotic expressed trichosanthin and other two proteins have anti-fungal activity in vitro}; Hu P et al.; DNAs encoding Trichosanthin, tobacco class I Chitinase and tobacco class I beta-1, 3-Glucanase were expressed in E . coli, respectively . The expression products were assayed for their anti-fungal activity . All of three kinds of proteins show anti-fungal activity . When two of them combined, this activity was enhanced greatly . When three of them combined, the stronger anti-fungal activity was observed. EMBO J, 2003 Feb 3, 22(3), 651 - 6 In vivo evidence for the prokaryotic model of extended codon-anticodon interaction in translation initiation; Esposito D et al.; Initiation codon context is an important determinant of translation initiation rates in both prokaryotes and eukaryotes . Such sequences include the Shine- Dalgarno ribosome-binding site, as well as other motifs surrounding the initiation codon . One proposed interaction is between the base immediately preceding the initiation codon (-1 position) and the nucleotide 3' to the tRNAf(Met) anticodon, at position 37 . Adenine is conserved at position 37, and a uridine at -1 has been shown in vitro to favor initiation . We have tested this model in vivo, by manipulating the chloroplast of the green alga Chlamydomonas reinhardtii, where the translational machinery is prokaryotic in nature . We show that translational defects imparted by mutations at the petA -1 position can be suppressed by compensatory mutations at position 37 of an ectopically expressed tRNA(fMet) . The mutant tRNAs are fully aminoacylated and do not interfere with the translation of other proteins . Although this extended base pairing is not an absolute requirement for initiation, it may convey added specificity to transcripts carrying non-standard initiation codons, and/or preserve translational fidelity under certain stress conditions. Proc Natl Acad Sci U S A, 2003 Feb 4, 100(3), 1256 - 61 Epub 2003 Jan 27. Two Hsp70 family members expressed in atherosclerotic lesions; Han Z et al.; Gene expression profiling was carried out comparing Con A elicited peritoneal macrophages from C57BL6 and FVBN wild-type and apolipoprotein (apo)E knockout mice . An EST, was expressed at higher levels in C57BL6 compared with FVBN mice . mapped to an atherosclerosis susceptibility locus on chromosome 19 revealed in an intercross between atherosclerosis-susceptible C57BL6 and atherosclerosis-resistant FVBN apoE knockout mice . A combination of database search and Northern analysis confirmed that corresponded to 3'-UTR of a hitherto predicted gene, named HspA12A . Blasting the National Center for Biotechnology Information database revealed a closely related homologue, HspA12B . HspA12A and -B have very close human homologues . TaqMan analysis confirmed the increased HspA12A expression (2.6-fold) in elicited peritoneal macrophages from C57BL6 compared with FVBN mice . TaqMan analysis also revealed increased HspA12A and HspA12B expression (87- and 6-fold, respectively) in lesional versus nonlesional portions of the thoracic aorta from C57BL6 apoE knockout mice on a chow diet . In situ hybridization confirmed that both genes were expressed within lesions but not within nonlesional aortic tissue . Blasting of HspA12A and HspA12B against the National Center for Biotechnology Information database (NR) revealed a hit with the Conserved Domain database for Hsp70 (pfam00012.5, Hsp70) . Both genes appear to contain an atypical Hsp70 ATPase domain . The BLAST search also revealed that both genes were more similar to primitive eukaryote and prokaryote than mammalian Hsp70s, making these two genes distant members of the mammalian Hsp70 family . In summary, we describe two genes that code for a subfamily of Hsp70 proteins that may be involved in atherosclerosis susceptibility. Biochemistry, 2003 Feb 4, 42(4), 932 - 9 Mitochondrial methionyl-tRNAfMet formyltransferase from Saccharomyces cerevisiae: gene disruption and tRNA substrate specificity; Vial L et al.; Initiation of protein synthesis in bacteria, mitochondria, and chloroplasts involves a formylated methionyl-tRNA species . Formylation of this tRNA is catalyzed by a methionyl-tRNA(f)(Met) formyltransferase (formylase) . Upon inactivation of the gene encoding formylase, the growth rate of Escherichia coli is severely decreased . This behavior underlines the importance of formylation to give tRNA(Met) an initiator identity . Surprisingly, however, recent data {Li, Y., Holmes, W . B., Appling, D . R., and RajBhandary, U . L . (2000) J . Bacteriol . 182, 2886-2892} showed that the respiratory growth of Saccharomyces cerevisiaewas not sensitive to deprivation of the mitochondrial formylase . In the present study, we report conditions of temperature or of growth medium composition in which inactivation of the formylase gene indeed impairs the growth of a S . cerevisiae haploid strain . Therefore, some selective advantage can eventually be associated to the existence of a formylating activity in the fungal mitochondrion under severe growth conditions . Finally, the specificity toward tRNA of S . cerevisiae mitochondrial formylase was studied using E . coli initiator tRNA and mutants derived from it . Like its bacterial counterpart, this formylase recognizes nucleotidic features in the acceptor stem of mitochondrial initiator tRNA . This behavior markedly distinguishes the mitochondrial formylase of yeast from that of animals . Indeed, it was shown that bovine mitochondrial formylase mainly recognizes the side chain of the esterified methionine plus a purine-pyrimidine base pair in the D-stem of tRNA {Takeuchi, N., Vial, L., Panvert, M., Schmitt, E., Watanabe, K., Mechulam, Y., and Blanquet, S . (2001) J . Biol . Chem . 276, 20064-20068} . Distinct tRNA recognition mechanisms adopted by the formylases of prokaryotic, fungal, or mammalian origins are likely to reflect coevolution of these enzymes with their tRNA substrate . Each mechanism appears well suited to an efficient selection of the substrate within the pool of all tRNAs. Shi Yan Sheng Wu Xue Bao, 2001 Jun, 34(2), 143 - 6 {Cloning and efficient expression of cytokine human MK in E . coli}; Huang J et al.; For cloning the cytokine human Midkine (MK) gene, we designed by PCgene program and synthesized a pair of PCR specific primers according to the reported human MK cDNA sequence . Total cellular RNA was extracted from a human hepatoblastoma cell line HepG2, and then the target DNA fragment was obtained by RT-PCR and subcloned into plasmid pUC118 . Checked with radioisotope sequencing and ABI 377A sequencer, the nucleotide sequence of the cloned MK cDNA was identical with the reported one . A prokaryotic expression vector, named pBV220, was used to express the MK protein efficiently in E . coli strain TG1 and a predicted band of 16.5 kD in Mr by 15% SDS-PAGE was found . The expressed recombinant protein was found in insoluble aggregated form and accounted for about 31.21% of the total cellular proteins . The first 15 N-terminal amino acid sequence analysis of this protein by Edman degradation method showed that it was accordant with that predicted from the cDNA sequence . The activity of neurite outgrowth-promoting of the MK crude samples was tested with brain cells isolated from 18-day embryos of SD rat. Shi Yan Sheng Wu Xue Bao, 2000 Dec, 33(4), 301 - 7 {Prokaryote expression and western analysis of BcpLH gene of Chinese cabbage}; Yu XH et al.; BcpLH gene preferentially expressed in folding leaf of Chinese cabbage contains dsRNA-binding domains . The cDNA of BcpLH gene was cloned into a His-fusion expression vector pET-28a (+) and was induced to express in E . coli strain BL21 (DE3) . Then, the specific protein was partially purified and the rabbit was immunized to prepare the anti-serum . Meanwhile BcpLH cDNA was cloned into the pMAL-c2 containing the solubizing partner, and then the soluble protein generated . It was demonstrated from Western dot assay that the BcpLH protein was specific . The BcpLH active protein and its anti-serum made it possible to study RNA-binding activity and regulation mechanism in plant development. Biopolymers, 2003 Feb, 68(2), 234 - 49 Assembly of the 30S ribosomal subunit; Culver GM; Ribosomes are large macromolecular complexes responsible for cellular protein synthesis . The smallest known cytoplasmic ribosome is found in prokaryotic cells; these ribosomes are about 2.5 MDa and contain more than 4000 nucleotides of RNA and greater than 50 proteins . These components are distributed into two asymmetric subunits . Recent advances in structural studies of ribosomes and ribosomal subunits have revealed intimate details of the interactions within fully assembled particles . In contrast, many details of how these massive ribonucleoprotein complexes assemble remain elusive . The goal of this review is to discuss some crucial aspects of 30S ribosomal subunit assembly . Nat Struct Biol, 2003 Mar, 10(3), 168 - 74 Structure of Mycobacterium tuberculosis PknB supports a universal activation mechanism for Ser/Thr protein kinases; Young TA et al.; A family of eukaryotic-like Ser/Thr protein kinases occurs in bacteria, but little is known about the structures and functions of these proteins . Here we characterize PknB, a transmembrane signaling kinase from Mycobacterium tuberculosis . The intracellular PknB kinase domain is active autonomously, and the active enzyme is phosphorylated on residues homologous to regulatory phospho-acceptors in eukaryotic Ser/Thr kinases . The crystal structure of the PknB kinase domain in complex with an ATP analog reveals the active conformation . The predicted fold of the PknB extracellular domain matches the proposed targeting domain of penicillin-binding protein 2x . The structural and chemical similarities of PknB to metazoan homologs support a universal activation mechanism of Ser/Thr protein kinases in prokaryotes and eukaryotes. Ann N Y Acad Sci, 2002 Dec, 981, 154 - 88 On the roles of repetitive DNA elements in the context of a unified genomic-epigenetic system; von Sternberg R; Repetitive DNA sequences comprise a substantial portion of most eukaryotic and some prokaryotic chromosomes . Despite nearly forty years of research, the functions of various sequence families as a whole and their monomer units remain largely unknown . The inability to map specific functional roles onto many repetitive DNA elements (REs), coupled with the taxon-specificity of sequence families, have led many to speculate that these genomic components are "selfish" replicators generating genomic "junk." The purpose of this paper is to critically examine the selfishness, evolutionary effects, and functionality of REs . First, a brief overview of the range of ideas pertaining to RE function is presented . Second, the argument is presented that the selfish DNA "hypothesis" is actually a narrative scheme, that it serves to protect neo-Darwinian assumptions from criticism, and that this story is untestable and therefore not a hypothesis . Third, attempts to synthesize the selfish DNA concept with complex systems models of the genome and RE functionality are critiqued . Fourth, the supposed connection between RE-induced mutations and macroevolutionary events are stated to be at variance with empirical evidence and theoretical considerations . Hypotheses that base phylogenetic transitions in repetitive sequence changes thus remain speculative . Fifth and finally, the case is made for viewing REs as integrally functional components of chromosomes, genomes, and cells . It is argued throughout that a new conceptual framework is needed for understanding the roles of repetitive DNA in genomic/epigenetic systems, and that neo-Darwinian "narratives" have been the primary obstacle to elucidating the effects of these enigmatic components of chromosomes. Vaccine, 2003 Feb 14, 21(9-10), 897 - 901 Immunopotentiating heat shock proteins: negotiators between innate danger and control of autoimmunity; van Eden W et al.; Heat shock proteins (hsps) are known to be immunodominant antigens of bacteria . Hsps are evolutionarily strongly conserved proteins present in all eukaryotic and prokaryotic cellular organisms and upregulated by several forms of stress . Despite (the paradigm of) self-tolerance, hsp-epitopes homologous to endogenous host hsp sequences have been implicated as T cell epitopes to endow crossreactive, hsp-specific T cells with the capacity to regulate inflammation, such as in experimentally induced autoimmune diseases . Such T cells were found to produce regulatory cytokines like IL10, in contrast to T cells induced with other conserved microbial proteins that are not upregulated by stress . Hsps have been implicated in immune regulation not only as upregulated targets of adaptive immunity during inflammatory stress, but recently also as triggering factors for innate immunity through activation via Toll-like receptors (TLRs). Trends Genet, 2003 Feb, 19(2), 75 - 9 Functional determinants of transcription factors in Escherichia coli: protein families and binding sites; Madan Babu M et al.; DNA-binding transcription factors regulate the expression of genes near to where they bind . These factors can be activators or repressors of transcription, or both . Thus, a fundamental question is what determines whether a transcription factor acts as an activator or a repressor? Previous research into this question found that a protein's regulatory function is determined by one or more of the following factors: protein-protein contacts, position of the DNA-binding domain in the protein primary sequence, altered DNA structure, and the position of its binding site on the DNA relative to the transcription start site . Although there are many aspects specific to different transcription factors, in this work we demonstrate that, in general, in the prokaryote Escherichia coli, a transcription factor's protein family is not indicative of its regulatory function, but the position of its binding site on the DNA is. Curr Biol, 2003 Jan 21, 13(2), R53 - 4 Gene transfer: gene swapping craze reaches eukaryotes; Gogarten JP; Recent studies have provided evidence for gene transfers from prokaryotes to eukaryotes and between eukaryotes . The mechanisms and frequencies of these transfers remain the subject of speculation, but the findings provide ample reason to seriously consider interspecies gene transfer as an important evolutionary process in eukaryotes. Curr Biol, 2003 Jan 21, 13(2), 94 - 104 Phylogenetic analyses of diplomonad genes reveal frequent lateral gene transfers affecting eukaryotes; Andersson JO et al.; BACKGROUND: Lateral gene transfer (LGT) is an important evolutionary mechanism among prokaryotes . The situation in eukaryotes is less clear; the human genome sequence failed to give strong support for any recent transfers from prokaryotes to vertebrates, yet a number of LGTs from prokaryotes to protists (unicellular eukaryotes) have been documented . Here, we perform a systematic analysis to investigate the impact of LGT on the evolution of diplomonads, a group of anaerobic protists.RESULTS: Phylogenetic analyses of 15 genes present in the genome of the Atlantic Salmon parasite Spironucleus barkhanus and/or the intestinal parasite Giardia lamblia show that most of these genes originated via LGT . Half of the genes are putatively involved in processes related to an anaerobic lifestyle, and this finding suggests that a common ancestor, which most probably was aerobic, of Spironucleus and Giardia adapted to an anaerobic environment in part by acquiring genes via LGT from prokaryotes . The sources of the transferred diplomonad genes are found among all three domains of life, including other eukaryotes . Many of the phylogenetic reconstructions show eukaryotes emerging in several distinct regions of the tree, strongly suggesting that LGT not only involved diplomonads, but also involved other eukaryotic groups.CONCLUSIONS: Our study shows that LGT is a significant evolutionary mechanism among diplomonads in particular and protists in general . These findings provide insights into the evolution of biochemical pathways in early eukaryote evolution and have important implications for studies of eukaryotic genome evolution and organismal relationships . Furthermore, "fusion" hypotheses for the origin of eukaryotes need to be rigorously reexamined in the light of these results. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai), 2003 Feb, 35(2), 172 - 6 {Cloning, expression of the lectin-EGF domain of P-selectin, and preparation of its monoclonal antibody}; Zhou T et al.; To prepare monoclonal antibody specific to P-selectin lectin-EGF domain, the gene for lectin-EGF domain of P-selectin L-EGF was amplified from normal human platelets by RT-PCR, then was cloned into prokaryotic vector pET42b(+) . The recombinant plasmid was transformed into E . coli DH5 alpha strain for further screening and characterization, and was expressed in E . coli BL21 strain . Expressed protein was purified by chromatography on a Ni(2+)-NTA superflow agarose column and eluted with pH 8.0-4.5 urea gradient . Then the mAb anti-lectin-EGF was prepared with classical hybridoma technique, and 3 hybridoma cell lines (B10, F3 and H5) were obtained with Ig subclasses of these mAbs were IgG(2), IgG(1), and IgG(3) respectively, and their light chains were all kappa chain . Immuofluorescence and FACS assays demonstrated that mAbs could specifically recognize P-selectin expressed on ECV (endothelial cell line) stimulated by LPS . Meanwhile, the role of mAbs to P-selectin lectin-EGF domain was studied, and it was proved that the mAbs markedly inhibited adhesion between platelets and neutrophils in vitro . These monoclonal antibodies can specifically recognize the natural P-selectin and markedly inhibit adhesion between platelets and neutrophils in vitro. Mol Cell Proteomics, 2002 Dec, 1(12), 983 - 95 Abundance and distributions of eukaryote protein simple sequences; Sim KL et al.; Protein simple sequences are a subclass of low complexity regions of sequence that are highly enriched in one or a few residue types . Such sequences are common in transcription regulatory proteins, in structural proteins, in proteins involved in nucleic acid interactions, and in mediating protein-protein interactions . Simple sequences of 10 or more residues, containing >/=50% of a single residue type are surveyed in this work . Both eukaryote and prokaryote proteomes are investigated with emphasis on the eukaryotes . Very large numbers of such sequences are found in all organisms surveyed . It is found that eukaryotes possess far more simple sequences per protein than do the prokaryotes . Prokaryotes display a linear relationship between number of proteins containing simple sequences and proteome size, whereas it is not clear that such a relationship holds for eukaryotes . Strikingly, it is found that each eukaryote possesses its own unique distribution of simple sequences . Within those distributions it is found that simple sequences enriched in certain residue types are clearly favored, whereas others are just as clearly discriminated against . The preferences observed are not correlated with residue occurrence . An analysis of classes of proteins of known function suggests that simple sequence occurrence and distribution may be related to protein function . Based upon this analysis, the large number of simple sequences found above that would be expected from a simple statistical model, plus the known functional importance of numerous such sequences, it is postulated that eukaryotes have evolved to not only tolerate large numbers of simple sequences but also to require them. Mol Cell Proteomics, 2002 Dec, 1(12), 956 - 66 Proteomics of Synechocystis sp . strain PCC 6803: identification of plasma membrane proteins; Huang F et al.; Cyanobacteria are unique prokaryotes since they in addition to outer and plasma membranes contain the photosynthetic membranes (thylakoids) . The plasma membranes of Synechocystis 6803, which can be completely purified by density centrifugation and polymer two-phase partitioning, have been found to be more complex than previously anticipated, i.e . they appear to be essential for assembly of the two photosystems . A proteomic approach for the characterization of cyanobacterial plasma membranes using two-dimensional gel electrophoresis and mass spectrometry analysis revealed a total of 57 different membrane proteins of which 17 are integral membrane spanning proteins . Among the 40 peripheral proteins 20 are located on the periplasmic side of the membrane, while 20 are on the cytoplasmic side . Among the proteins identified are subunits of the two photosystems as well as Vipp1, which has been suggested to be involved in vesicular transport between plasma and thylakoid membranes and is thus relevant to the possibility that plasma membranes are the initial site for photosystem biogenesis . Four subunits of the Pilus complex responsible for cell motility were also identified as well as several subunits of the TolC and TonB transport systems . Several periplasmic and ATP-binding proteins of ATP-binding cassette transporters were also identified as were two subunits of the F(0) membrane part of the ATP synthase. Antimicrob Agents Chemother, 2003 Feb, 47(2), 676 - 81 Genome-wide screening of Saccharomyces cerevisiae to identify genes required for antibiotic insusceptibility of eukaryotes; Blackburn AS et al.; The adverse reactions provoked by many antibiotics in humans are well documented but are generally poorly understood at the molecular level . To elucidate potential genetic defects that could give rise to susceptibility to prokaryote-specific antibiotics in eukaryotes, we undertook genome-wide screens using the yeast Saccharomyces cerevisiae as a model of eukaryotes; our previous work with a small number of yeast mutants revealed some specific gene functions required for oxytetracycline resistance . Here, the complete yeast deletion strain collection was tested for growth in the presence of a range of antibiotics . The sensitivities of mutants revealed by these screens were validated in independent tests . None of the approximately 4,800 defined deletion strains tested were found to be sensitive to amoxicillin, penicillin G, rifampin, or vancomycin . However, two of the yeast mutants were tetracycline sensitive and four were oxytetracycline sensitive; encompassed among the latter were mutants carrying deletions in the same genes that we had characterized previously . Seventeen deletion strains were found to exhibit growth defects in the presence of gentamicin, with MICs for the strains being as low as 32 micro g ml(-1) (the wild type exhibited no growth defects at any gentamicin concentration tested up to 512 micro g ml(-1)) . Strikingly, 11 of the strains that were most sensitive to gentamicin carried deletions in genes whose products are all involved in various aspects of vacuolar and Golgi complex (or endoplasmic reticulum) function . Therefore, these and analogous organelles, which are also the principal sites of gentamicin localization in human cells, appear to be essential for normal resistance to gentamicin in eukaryotes . The approach and data described here offer a new route to gaining insight into the potential genetic bases of antibiotic insusceptibilities in eukaryotes. Antimicrob Agents Chemother, 2003 Feb, 47(2), 458 - 66 Biological properties of novel antistaphylococcal quinoline-indole agents; Oliva B et al.; The antibacterial properties of novel quinoline-indole (QI) agents were examined . QI agents demonstrated potent bactericidal activities against Staphylococcus aureus, killing by lytic and nonlytic mechanisms . S . aureus mutants resistant to a lytic QI agent (SEP 155342) and a nonlytic QI agent (SEP 118843) arose at frequencies of 1.4 x 10(-9) and 1.2 x 10(-8), respectively, by selection at four times the MICs . Mutants resistant to QI agent SEP 155342 were unstable, but mutants resistant to QI agent SEP 118843 displayed stable resistance . Mutants resistant to QI agent SEP 118843 were not cross resistant to other inhibitors, including QI agent SEP 155342 . Addition of QI agents SEP 118843 and SEP 155342 at four times the MIC caused nonspecific inhibition of several macromolecular biosynthetic pathways in S . aureus . Within 10 min, QI agents SEP 118843 and SEP 155342 both interfered with bacterial membrane integrity, as measured by uptake of propidium iodide . Agents from the two classes of the QI agents probably kill staphylococci by separate mechanisms which, nevertheless, both involve interference with cytoplasmic membrane function . Precise structure-activity relationships for the division of QI agents into two classes could not be determined . However, lytic activity was often associated with substitution of a basic amine at position 4 of the quinoline nucleus, whereas compounds with nonlytic activity usually contained an aromatic ring with or without a methoxy substituent at position 4 . Nonlytic QI agents such as SEP 118843 may possess selective activity against the prokaryotic membrane since this compound failed to lyse mouse erythrocytes when it was added at a concentration equivalent to four times the MIC for S . aureus. Hunan Yi Ke Da Xue Xue Bao, 2001 Dec 28, 26(6), 495 - 8 {Study on the fusion expression of FBXO30: a novel member of F-box protein family}; Li ZH et al.; OBJECTIVE: The cDNA sequence of the coding region of FBXO30 (F-box only protein 30), which is a novel member of F-box protein family, was cloned into the mammalian expression vector pEGFP-C2 by non-directional cloning method and introduced into the NIH 3T3 cells by liposome transfection . Observation under the fluorescent microscopy after transfection showed that EGFP (enhanced green fluorescent protein)/FBXO30 was expressed and existed mainly in the cytoplasm . At the same time, the cDNA sequence of the coding region of FBXO30 was cloned into prokaryotic expression vector pGEX-4T-2 by directional cloning strategy . The GST (glutathione S-transferase)/FBXO30 fusion protein was expressed under the induction of IPTG (isopropylthio-beta-D-galactoside) in E . coli . A new band (approximately 65.5 kD) was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting . Purification of the GST-fused FBXO30 was carried out by affinity chromatography with glutathione sepharose 4B . The fusion expression of FBXO30 indicates that: FBXO30 protein is a cytoplasmic soluble protein, and the stable fusion expression of FBXO30 in the prokaryotic expression system can provide a base for the preparation of the specific antibody of FBXO30 and further functional study of FBXO30. Appl Microbiol Biotechnol, 2003 Jan, 60(5), 495 - 506 Epub 2002 Dec 03. Sterols in microorganisms; Volkman JK; Sterols are vital components of all eukaryotic cells . This review describes the variety of sterol structures found in microalgae, yeasts, fungi, protozoans and microheterotrophs . Reports of the occurrence of sterols in prokaryotic cells are critically assessed . Methylotrophic bacteria contain unusual 4-methylsterols, but reports of 4-desmethyl sterols in cyanobacteria and other bacteria are limited and many of these seem dubious . Possible application areas for sterols derived from mass culture of microalgae and other microorganisms are highlighted. Cancer Lett, 2003 Feb 10, 190(1), 1 - 12 Histidine kinases and histidine phosphorylated proteins in mammalian cell biology, signal transduction and cancer; Steeg PS et al.; Intensive investigation of protein tyrosine, serine and threonine phosphorylation has lead to advances in signal transduction research and cancer treatment . This feature summarizes research on mammalian proteins exhibiting histidine phosphorylation . Histidine kinases are well known in prokaryotic and lower eukaryotic systems where they form the 'two-component' signal transduction system . The relative invisibility of histidine phosphorylation in mammalian cells may result from technical obstacles such as its acid lability, which precludes detection in electrophoretic systems, amino acid sequencing, etc . Emerging data have identified mammalian histidine kinases for the kinase suppressor of ras, a scaffold molecule for the Map kinase pathway, as well as histone H4, aldolase C and the beta-subunit of heterotrimeric G proteins . Additional mammalian proteins of interest to signal transduction and cancer research exhibit histidine phosphorylation, including P-selectin, annexin I and the 20S proteasome . Other candidate histidine phosphorylated proteins are identified . These data suggest the existence of another series of phosphorylation patterns in signal transduction. Mol Cell, 2003 Jan, 11(1), 225 - 35 Excision of the Drosophila mariner transposon Mos1 . Comparison with bacterial transposition and V(D)J recombination; Dawson A et al.; It has been proposed that the modern immune system has evolved from a transposon in an ancient vertebrate . While much is known about the mechanism by which bacterial transposable elements catalyze double-strand breaks at their ends, less is known about how eukaryotic transposable elements carry out these reactions . We have examined the mechanism by which mariner, a eukaryotic transposable element, performs DNA cleavage . We show that the nontransferred strand is cleaved initially, unlike prokaryotic transposons which cleave the transferred strand first . First strand cleavage is not tightly coupled to second strand cleavage and can occur independently of synapsis, as happens in V(D)J recombination but not in transposition of prokaryotic transposons . Unlike V(D)J recombination, however, second strand cleavage of mariner does not occur via a hairpin intermediate. Mol Cell, 2003 Jan, 11(1), 59 - 67 Identification of a new cryptochrome class . Structure, function, and evolution; Brudler R et al.; Cryptochrome flavoproteins, which share sequence homology with light-dependent DNA repair photolyases, function as photoreceptors in plants and circadian clock components in animals . Here, we coupled sequencing of an Arabidopsis cryptochrome gene with phylogenetic, structural, and functional analyses to identify a new cryptochrome class (cryptochrome DASH) in bacteria and plants, suggesting that cryptochromes evolved before the divergence of eukaryotes and prokaryotes . The cryptochrome crystallographic structure, reported here for Synechocystis cryptochrome DASH, reveals commonalities with photolyases in DNA binding and redox-dependent function, despite distinct active-site and interaction surface features . Whole genome transcriptional profiling together with experimental confirmation of DNA binding indicated that Synechocystis cryptochrome DASH functions as a transcriptional repressor. Clin Exp Allergy, 2003 Jan, 33(1), 28 - 34 Cloning and expression of Blo t 1, a novel allergen from the dust mite Blomia tropicalis, homologous to cysteine proteases; Mora C et al.; BACKGROUND: House dust mite allergens have been shown to be a very important stimulus in the causation of asthma and triggers for the exacerbation of symptoms . Therefore, characterization of mite-derived allergens at the molecular level is an important step for the development of effective diagnostic and therapeutic approaches, as well as for epidemiological studies . OBJECTIVE: To clone, express and characterize at the molecular level the cysteine protease from Blomia tropicalis (Bt) . METHODS: A full-length cDNA encoding Blo t 1 was cloned from a Bt cDNA library using a PCR and RACE-based strategy . The cDNA was PCR-amplified, sequenced and subcloned into a prokaryotic expression vector . The allergenicity of the recombinant Blo t 1 was evaluated for IgE reactivity by Western blot . RESULTS: Blo t 1 cDNA encodes a 221 amino acids polypeptide with an estimated molecular weight of 25 kDa . The recombinant protein is 35% identical to other mite cysteine proteases . Recombinant Blo t 1 (rBlo t 1) bound IgE from 62% of Bt skin test-positive serum . Dermatophagoides pteronyssinus (Dp) skin test-positive sera did not react with rBlo t 1, indicating the possible presence of unique IgE epitopes on the rBlo t 1 molecule . A three-dimensional image of Blo t 1, constructed based on predicted analysis, showed conserved secondary and tertiary structure with other cysteine proteases . CONCLUSION: We report the cloning, expression and IgE reactivity of Blo t 1, a novel allergen from the domestic mite Blomia tropicalis (Bt), highly homologous to cysteine proteases . This putative cysteine protease, designated Blo t 1, may play a major role as an immunodominant allergen involved in dust mite-specific IgE-mediated hypersensitivity. Nucleic Acids Res, 2003 Jan 15, 31(2), 779 - 89 Fingerprinting of prokaryotic 16S rRNA genes using oligodeoxyribonucleotide microarrays and virtual hybridization; Reyes-Lopez MA et al.; An oligonucleotide microarray hybridization system to differentiate microbial species was designed and tested . Seven microbial species were studied, including one Bacillus and six Pseudomonas strains . DNA sequences near the 5' end of 16S rRNA genes were aligned and two contiguous regions of high variability, flanked by highly conserved sequences, were found . The conserved sequences were used to design PCR primers which efficiently amplified these polymorphic regions from all seven species . The amplicon sequences were used to design 88 9mer hybridization probes which were arrayed onto glass slides . Single-stranded, fluorescence-tagged PCR products were hybridized to the microarrays at 15 degrees C . The experimental results were compared with the DeltaG(0) values for all matched and mismatched duplexes possible between the synthetic probes and the 16S target sequences of the seven test species, calculated using a 'virtual hybridization' software program . Although the observed hybridization patterns differed significantly from patterns predicted solely on the basis of perfect sequence matches, a unique hybridization fingerprint was obtained for each of the species, including closely related Pseudomonas species, and there was a reasonable correlation between the intensity of observed hybridization signals and the calculated DeltaG(0) values . The results suggest that both perfect and mismatched pairings can contribute to microbial identification by hybridization fingerprinting. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi, 2001 Mar, 15(1), 20 - 3 {Prokaryotic expression of hepatitis C virus envelope 1 gene and application of the expressed product}; Gao J et al.; OBJECTIVE: To express the HCV E1 gene in E . coli cells and to demonstrate its clinical significance in detection of anti-HCV E1 antibodies . METHODS: The expression vector was constructed by ligation of HCV E1 sequence, which was amplified by RT-PCR methods from 50 microliters of HCV RNA positive serum using primers specific to the HCV E1 sequence, to the prokaryotic expression vector PMS-31b transfected POP2136 at 16 degrees C for 16 hours . The recombinant plasmid was screened out and characterized by restriction enzyme analysis . The bacteria containing the recombinant plasmid was induced at 42 degrees C for 4 hours, and the recombinant protein was visualized by SDS-PAGE . The specificity of the recombinant protein was determined by Western blot assay . After purification of the expressed protein, this protein was coated on the plate with the concentration of 2 micrograms/ml in pH 9.6 buffer at 4 degrees C for overnight, and the serum specimen was tested at the dilution of 1:20 by ELISA . RESULTS: There were 2 fragments could be seen on the SDS-PAGE after digestion of the RT-PCR product with Sma I . And there emerged one fragment of 356 bp after digesting the recombinant plasmid with Sma I and Xba I . A band of 30,000 could be seen on the SDS-PAGE after the induction of bacteria containing the recombinant plasmid pMS-E1 at 42 degrees C for 4 hours . The Western blot assay showed that the expressed band could react with the anti-HCV positive serum . The ELISA result indicated that there were 28.9% (26/90) anti-HCV positive serum were anti-HCV E1 positive, but 3.9% (3/76) were positive in the anti-HCV negative serum . CONCLUSION: The HCV E1 sequence from HCV RNA positive serum has been expressed in E . coli . The expression rate is about 17% of the total protein of the bacteria . This protein possessed good specificity and may be used in the diagnosis of HCV infection. Ai Zheng, 2002 Nov, 21(11), 1167 - 72 Analysis of bromodomain of BRD-7 gene and its prokaryotic expression; Peng C et al.; BACKGROUND & OBJECTIVE: BRD-7 is a novel gene (AF: 152604), containing a bromodomain, was cloned in our lab . Previous studies showed that BRD-7 plays an obviously suppressive role on NPC cell growth . In order to clarify the function mechanism of this gene, we investigate an important motif of BRD-7, the bromodomain . METHODS: The bromodomain of BRD-7 was analyzed by homology-based amino sequence and secondary structure analysis . In addition, we constructed a prokaryotic expression vector of bromodomain . Western blot analysis was used to confirm the expression of the bromodomain protein in Escherichia coli . RESULTS: Homology-based sequence analysis revealed that the bromodomain of BRD-7 possibly contains four alpha helices (Z, A, B and C), and a hydrophobic pocket which is an important structure to recognize acetylated histone peptide . This bromodomain encoding a 12.8 kD protein, was introduced into Escherichia coli using the pGEX-4T-2 expression vector . After isopropyl beta-D-thiogalactopyranoside(IPTG) induction, a new anticipated protein of 38.8 kD appeared on SDS-PAGE and the result was confirmed by Western blot analysis . CONCLUSION: BRD-7 of bromodomain protein is similar to three proteins containing known structural bromodomain motif by bio-informatics analysis, suggesting the bromodomain of BRD-7 should belong to co-activator subgroup and may have similar function that can selectively interact with acetylated histone peptide. Mikrobiologiia, 2002 Nov-Dec, 71(6), 725 - 40 {Proterozoic history and present state of cyanobacteria}; Sergeev VN et al.; The paper delves into the main regularities of the distribution of fossil microorganisms in Precambrian rocks, beginning from the Archean Eon about 3.5 billion years ago and ending in the Cambrian Period about 0.5 billion years ago . The paper analyzes facial peculiarities in the lateral differentiation of microfossils in Proterozoic basins and the main stages of temporal changes in fossil cyanobacterial communities, which are based on the irreversible succession of physicochemical conditions on the Earth and the evolution of eukaryotic microorganisms and their incorporation into prokaryotic ecosystems . To gain insight into Proterozoic fossil records, modern stratified cyanobacterial mats built up from layers of prokaryotes are considered . The analysis of phosphatization, carbonatization, and silification processes in modern algal-bacterial communities suggests that analogous processes took place in Proterozoic microbiotas . A comparison of modern and Precambrian living forms confirms the inference that cyanobacterial communities are very conservative and have changed insignificantly both morphologically and physiologically during the past two billion years. Biochemistry, 2003 Jan 21, 42(2), 320 - 30 Backbone dynamics of reduced plastocyanin from the cyanobacterium Anabaena variabilis: regions involved in electron transfer have enhanced mobility; Ma L et al.; The dynamics of the backbone of the electron-transfer protein plastocyanin from the cyanobacterium Anabaena variabilis were determined from the (15)N and (13)C(alpha) R(1) and R(2) relaxation rates and steady-state {(1)H}-(15)N and {(1)H}-(13)C nuclear Overhauser effects (NOEs) using the model-free approach . The (13)C relaxation studies were performed using (13)C in natural abundance . Overall, it is found that the protein backbone is rigid . However, the regions that are important for the function of the protein show moderate mobility primarily on the microsecond to millisecond time scale . These regions are the "northern" hydrophobic site close to the metal site, the metal site itself, and the "eastern" face of the molecule . In particular, the mobility of the latter region is interesting in light of recent findings indicating that residues also on the eastern face of plastocyanins from prokaryotes are important for the function of the protein . The study also demonstrates that relaxation rates and NOEs of the (13)C(alpha) nuclei of proteins are valuable supplements to the conventional (15)N relaxation measurements in studies of protein backbone dynamics. EMBO Rep, 2003 Jan, 4(1), 37 - 41 Strategies for helicase recruitment and loading in bacteria; Konieczny I; DNA replication initiation in prokaryotes and eukaryotes requires the recruitment and loading of a helicase at the replication origin . To subsequently unwind the double-stranded DNA, the helicase must be properly positioned on the separated DNA strands . Several studies have revealed similarities and differences in the mechanisms used by different autonomously replicating DNA elements (replicons) for recruitment and activation of the appropriate helicase . Of particular interest are plasmid replicons that are adapted for replication in diverse bacterial hosts and are therefore intriguingly able to exploit the helicases of distantly related bacterial species . The different molecular mechanisms by which replicons recruit and load helicases are only just beginning to be understood. Annu Rev Nutr, 2003, 23, 17 - 40 Epub 2003 Jan 08. Mechanism and regulation of selenoprotein synthesis; Driscoll DM et al.; Selenium is an essential trace element that is incorporated into proteins as selenocysteine (Sec), the twenty-first amino acid . Sec is encoded by a UGA codon in the selenoprotein mRNA . The decoding of UGA as Sec requires the reprogramming of translation because UGA is normally read as a stop codon . The translation of selenoprotein mRNAs requires cis-acting sequences in the mRNA and novel trans-acting factors dedicated to Sec incorporation . Selenoprotein synthesis in vivo is highly selenium-dependent, and there is a hierarchy of selenoprotein expression in mammals when selenium is limiting . This review describes emerging themes from studies on the mechanism, kinetics, and efficiency of Sec insertion in prokaryotes . Recent developments that provide mechanistic insight into how the eukaryotic ribosome distinguishes between UGA/Sec and UGA/stop codons are discussed . The efficiency and regulation of mammalian selenoprotein synthesis are considered in the context of current models for Sec insertion. Annu Rev Biochem, 2003, 72, 111 - 35 Epub 2003 Jan 09. Protein disulfide bond formation in prokaryotes; Kadokura H et al.; Disulfide bonds formed between pairs of cysteines are important features of the structure of many proteins . Elaborate electron transfer pathways have evolved Escherichia coli to promote the formation of these covalent bonds and to ensure that the correct pairs of cysteines are joined in the final folded protein . These transfers of electrons consist, in the main, of cascades of disulfide bond formation or reduction steps between a series of proteins (DsbA, DsbB, DsbC, and DsbD) . A surprising variety of mechanisms and protein structures are involved in carrying out these steps. Mol Cells, 2002 Dec 31, 14(3), 404 - 10 Identification of non-telomeric G4-DNA binding proteins in human, E . coli, yeast, and Arabidopsis; Kang SG et al.; G4-DNA binding proteins of E . coli, Saccharomyces cerevisiae, Arabidopsis, and human have been identified by a synthetic non-telomeric G4-DNA oligo 5'-d(ACTGTCGTACTTGATATGGGGGT)-3' using gel mobility shift assays . G4-DNA binding proteins are specific to G4-DNA, a four-stranded guanine-DNA structure . Bound complexes of G4-DNA and proteins were identified in nuclear extracts of all examined organisms in this study . In humans, three different G4-DNA and protein complexes were identified . However, human telomeric G-quadruplex oligo did not compete with G4-DNA oligo in the competition assays, suggesting that the identified G4-DNA binding proteins may be different from the known human telomeric G4-DNA binding proteins . We discovered two complexes of G4-DNA and protein in Arabidopsis identified in mobility shift assays . Interestingly, two complexes of G4-DNA and proteins were identified from E . coli, which have a circular genomic DNA structure . Results of this investigation suggest that non-telomeric G4-DNA structure and its binding proteins may be involved in important functional roles in both prokaryotes and eukaryotes. Nucleic Acids Res, 2003 Jan 1, 31(1), 442 - 3 The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy; Cole JR et al.; The Ribosomal Database Project-II (RDP-II) pro-vides data, tools and services related to ribosomal RNA sequences to the research community . Through its website , RDP-II offers aligned and annotated rRNA sequence data, analysis services, and phylogenetic inferences (trees) derived from these data . RDP-II release 8.1 contains 16 277 prokaryotic, 5201 eukaryotic, and 1503 mitochondrial small subunit rRNA sequences in aligned and annotated format . The current public beta release of 9.0 debuts a new regularly updated alignment of over 50 000 annotated (eu)bacterial sequences . New analysis services include a sequence search and selection tool (Hierarchy Browser) and a phylogenetic tree building and visualization tool (Phylip Interface) . A new interactive tutorial guides users through the basics of rRNA sequence analysis . Other services include probe checking, phylogenetic placement of user sequences, screening of users' sequences for chimeric rRNA sequences, automated alignment, production of similarity matrices, and services to plan and analyze terminal restriction fragment polymorphism (T-RFLP) experiments . The RDP-II email address for questions or comments is rdpstaff@msu.edu. Nucleic Acids Res, 2003 Jan 1, 31(1), 429 - 31 Noncoding regulatory RNAs database; Szymanski M et al.; The noncoding RNAs database is a collection of currently available sequence data on RNAs, which have no protein-coding capacity and have been implicated in regulation of cellular processes . The RNAs included in the database form very heterogenous group of molecules that act on different levels of information transmission in the cell . It includes RNAs acting on the level of chromatin structure, transcriptional and translational regulation of gene expression, modulation of protein function and regulation of subcellular distribution of RNAs and proteins . Those RNAs, with potential regulatory functions have been identified in prokaryotic, animal and plant cells . The database can be accessed at http://biobases.ibch.poznan.pl/ncRNA/. Nucleic Acids Res, 2003 Jan 1, 31(1), 410 - 3 PEP: Predictions for Entire Proteomes; Carter P et al.; PEP is a database of Predictions for Entire Proteomes . The database contains summaries of analyses of protein sequences from a range of organisms representing all three major kingdoms of life: eukaryotes, prokaryotes and archaea . All proteins publicly available for organisms were aligned against SWISS-PROT, TrEMBL and PDB . Additionally, the following annotations are provided: secondary structure, transmembrane helices, coiled coils, regions of low complexity, signal peptides, PROSITE motifs, nuclear localization signals and classes of cellular function . Proteins that contain long regions without regular secondary structure are also identified . We have produced a related database of structural domain-like fragments derived from PEP and clusters based on homology between all fragments . The PEP database, fragments and clusters are distributed freely as a set of flat files and have been integrated into SRS . The PEP group of databases can be accessed from: http://cubic.bioc.columbia.edu/pep. Nucleic Acids Res, 2003 Jan 1, 31(1), 258 - 61 STRING: a database of predicted functional associations between proteins; von Mering C et al.; Functional links between proteins can often be inferred from genomic associations between the genes that encode them: groups of genes that are required for the same function tend to show similar species coverage, are often located in close proximity on the genome (in prokaryotes), and tend to be involved in gene-fusion events . The database STRING is a precomputed global resource for the exploration and analysis of these associations . Since the three types of evidence differ conceptually, and the number of predicted interactions is very large, it is essential to be able to assess and compare the significance of individual predictions . Thus, STRING contains a unique scoring-framework based on benchmarks of the different types of associations against a common reference set, integrated in a single confidence score per prediction . The graphical representation of the network of inferred, weighted protein interactions provides a high-level view of functional linkage, facilitating the analysis of modularity in biological processes . STRING is updated continuously, and currently contains 261 033 orthologs in 89 fully sequenced genomes . The database predicts functional interactions at an expected level of accuracy of at least 80% for more than half of the genes; it is online at http://www.bork.embl-heidelberg.de/STRING/. Nucleic Acids Res, 2003 Jan 1, 31(1), 187 - 9 HGT-DB: a database of putative horizontally transferred genes in prokaryotic complete genomes; Garcia-Vallve S et al.; The Horizontal Gene Transfer DataBase (HGT-DB) is a genomic database that includes statistical parameters such as G+C content, codon and amino-acid usage, as well as information about which genes deviate in these parameters for prokaryotic complete genomes . Under the hypothesis that genes from distantly related species have different nucleotide compositions, these deviated genes may have been acquired by horizontal gene transfer . The current version of the database contains 88 bacterial and archaeal complete genomes, including multiple chromosomes and strains . For each genome, the database provides statistical parameters for all the genes, as well as averages and standard deviations of G+C content, codon usage, relative synonymous codon usage and amino-acid content . It also provides information about correspondence analyses of the codon usage, plus lists of extraneous group of genes in terms of G+C content and lists of putatively acquired genes . With this information, researchers can explore the G+C content and codon usage of a gene when they find incongruities in sequence-based phylogenetic trees . A search engine that allows searches for gene names or keywords for a specific organism is also available . HGT-DB is freely accessible at http://www.fut.es/~debb/HGT. Nucleic Acids Res, 2003 Jan 1, 31(1), 106 - 8 MICdb: database of prokaryotic microsatellites; Sreenu VB et al.; The MICdb (Microsatellites Database) is a comprehensive relational database of non-redundant microsatellites extracted from fully sequenced prokaryotic genomes . The current version (1.0) of the database has been compiled from 83 genomes belonging to different phylogenetic groups . This database has been linked to MICAS, the web-based Microstatellite Analysis Server . MICAS provides a user-friendly front-end to systematically extract data on microsatellite tracts from genomes . The database contains the following information pertaining to the microsatellites: the regions (coding/non-coding, if coding, their GenBank annotations) containing microsatellite tracts; the frequencies of their occurrences, the size and the number of repeating motifs; and the sequences of the tracts . MICAS also provides an interface to Autoprimer, a primer design program to automatically design primers for selected microsatellite loci. Nucleic Acids Res, 2003 Jan 1, 31(1), 75 - 7 An improved version of the DNA Methylation database (MethDB); Amoreira C et al.; Cytosine methylation is a characteristic property of prokaryotic and eukaryotic genomes . In the latter, it is indispensable for a healthy development of the organism and uncontrolled changes in the distribution of 5-methylcytosine (5mC) have been linked to severe disorders, in particular cancer . The growing scientific interest in DNA methylation has led to a considerable amount of data about this epigenetic phenomenon . In order to make these data readily available, we have established a dedicated database . The DNA Methylation database (MethDB) is currently the only public database for DNA methylation . This constantly growing database has become a key resource in the field of DNA methylation research . The database contains currently methylation patterns, profiles and total methylation content data for 46 species, 160 tissues and 72 phenotypes coming from a total of 6667 experiments (as of September 4, 2002) . About 14% of the data have not been published elsewhere . These data can be conveniently searched and represented in different ways . Recently, we have included an on-line submission tool that permits the scientific public to directly enter new data into MethDB. Mol Microbiol, 2003 Jan, 47(2), 561 - 71 A novel regulatory gene for light-induced carotenoid synthesis in the bacterium Myxococcus xanthus; Fontes M et al.; Myxococcus xanthus cells respond to blue light by producing carotenoids . Light triggers a network of regulatory actions that lead to the transcriptional activation of the carotenoid genes . By screening the colour phenotype of a collection of Tn5-lac insertion mutants, we have isolated a new mutant devoid of carotenoid synthesis . We map the transposon insertion, which co-segregates with the mutant phenotype, to a previously unknown gene designated here as carF . An in frame deletion within carF causes the same phenotype as the Tn5-lac insertion . The carF deletion prevents the activation of the normally light-inducible genes, without affecting the expression of any of the regulatory genes known to be expressed in a light-independent manner . Until now, the switch that sets off the regulatory cascade had been identified with light-driven inactivation of protein CarR, an antisigma factor . The exact mechanism of this inactivation has remained elusive . We show by epistatic analysis that the carF gene product participates in the light-dependent inactivation of CarR . The predicted CarF amino acid sequenc