Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us


Chem Phys Lipids, 2003 Jan, 122(1-2), 159 - 63
Al(3+)-mediated changes on membrane fluidity affects the activity of PI-PLC but not of PLC; Verstraeten SV et al.; We investigated whether Al(3+)-mediated changes in membrane fluidity can affect the activity of prokaryotic enzymes phospholipase C (PLC) and phospholipase C-phosphatidyl inositol specific (PI-PLC) in liposomes of phosphatidyl choline (PC), PC:phosphatidyl inositol (PI), or PC and polyphosphoinositides (PPI) . Al(3+) (10-100 microM) promoted membrane rigidification, evaluated with the probes 1,6-diphenyl-1,3,5-hexatriene and Laurdan, and followed the order: PC:PPI>PC:PI>PC . Al(3+) (25 and 50 microM) did not affect PLC-mediated hydrolysis of PC, PI and PIP(2), but stimulated PIP hydrolysis (48.6%) . PI-PLC did not affect PC, PI, and PIP concentrations, but caused a 67% decrease in PIP(2) . Al(3+) significantly inhibited PIP(2) hydrolysis in a concentration-dependent (25-50 microM) manner . Results suggest that the inhibition of PIP(2) hydrolysis by Al(3+) could be partially due to a higher lipid packing induced by Al(3+) which could affect the interaction between the enzyme and its substrate.

Zhejiang Da Xue Xue Bao Yi Xue Ban, 2002 Jun 25, 31(3), 174 - 177
{Molecular cloning of human IL-7cDNA and construction of eukaryotic vector expressing hIL-7}; Cheng B et al.; OBJECTIVE: To construct a vector expressing eukaryotic human interluken-7(hIL-7) . METHODS: hIL-7 DNA was identified and cloned (cDNA) from human spleen tissue using reverse transcription polymerase chain reaction (RT-PCR) . We incorporated the cDNA into the pMD18-T plasmid . The pMD18-T plasmid was then inserted into a dual expression vector (prokaryotic and eukaryotic) pBK-CMV and called pBK-CMV-hIL-7 . We used pBK-CMV-hIL-7 vector to infect E.coli DH5alpha . The expression of the recombinant hIL-7 protein (rhIL-7) by E.coli DH5alpha was analyzed using SDS-PAGE and western blot testing . RESULTS: The genetically engineered E.coli DH5alpha did express rhIL-7 confirmed by western blot . CONCLUSION: The successful construction of genetically engineered eukaryotic gene for hIL-7 was done, This will enable further research into therapeutic uses for hIL-7.

Nucleic Acids Res, 2003 Mar 1, 31(5), 1444 - 54
The structure of full-length LysR-type transcriptional regulators . Modeling of the full-length OxyR transcription factor dimer; Zaim J et al.; The LysR-type transcriptional regulators (LTTRs) comprise the largest family of prokaryotic transcription factors . These proteins are composed of an N-terminal DNA binding domain (DBD) and a C-terminal cofactor binding domain . To date, no structure of the DBD has been solved . According to the SUPERFAMILY and MODBASE databases, a reliable homology model of LTTR DBDs may be built using the structure of the Escherichia coli ModE transcription factor, containing a winged helix- turn-helix (HTH) motif, as a template . The remote, but statistically significant, sequence similarity between ModE and LTTR DBDs and an alignment generated using SUPERFAMILY and MODBASE methods was independently confirmed by alignment of sequence profiles representing ModE and LTTR family DBDs . Using the crystal structure of the E.coli OxyR C-terminal domain and the DBD alignments we constructed a structural model of the full-length dimer of this LTTR family member and used it to investigate the mode of protein-DNA interaction . We also applied the model to interpret, in a structural context, the results of numerous biochemical studies of mutated LTTRs . A comparison of the LTTR DBD model with the structures of other HTH proteins also provides insights into the interaction of LTTRs with the C-terminal domain of the RNA polymerase alpha subunit.

J Mol Biol, 2003 Mar 7, 326(5), 1337 - 49
Characterisation of a non-canonical genetic code in the oxymonad Streblomastix strix; Keeling PJ et al.; The genetic code is one of the most highly conserved characters in living organisms . Only a small number of genomes have evolved slight variations on the code, and these non-canonical codes are instrumental in understanding the selective pressures maintaining the code . Here, we describe a new case of a non-canonical genetic code from the oxymonad flagellate Streblomastix strix . We have sequenced four protein-coding genes from S.strix and found that the canonical stop codons TAA and TAG encode the amino acid glutamine . These codons are retained in S.strix mRNAs, and the legitimate termination codons of all genes examined were found to be TGA, supporting the prediction that this should be the only true stop codon in this genome . Only four other lineages of eukaryotes are known to have evolved non-canonical nuclear genetic codes, and our phylogenetic analyses of alpha-tubulin, beta-tubulin, elongation factor-1 alpha (EF-1 alpha), heat-shock protein 90 (HSP90), and small subunit rRNA all confirm that the variant code in S.strix evolved independently of any other known variant . The independent origin of each of these codes is particularly interesting because the code found in S.strix, where TAA and TAG encode glutamine, has evolved in three of the four other nuclear lineages with variant codes, but this code has never evolved in a prokaryote or a prokaryote-derived organelle . The distribution of non-canonical codes is probably the result of a combination of differences in translation termination, tRNAs, and tRNA synthetases, such that the eukaryotic machinery preferentially allows changes involving TAA and TAG.

Exp Parasitol, 2002 Aug, 101(4), 215 - 22
Entamoeba histolytica: purification and characterization of ornithine decarboxylase; Arteaga-Nieto P et al.; Ornithine decarboxylase, a rate-limiting enzyme in polyamine biosynthesis in eukaryotes, was stabilized and purified from trophozoites of the parasite protozoan E . histolytica . Analytical electrophoresis revealed the presence in the purified preparations of a major polypeptide of 45 kDa and barely detectable amounts of two other proteins of 70 and 120 kDa . Both the 45 and 70 kDa polypeptides were recognized by a mouse anti-ODC monoclonal antibody . The major polypeptide exhibited amino terminal sequence homology in the range of 40-73% with ODCs from other organisms . The immunoreactive polypeptide of 70 kDa was not identified . The molecular masses of 216 and 45 kDa determined for the native enzyme by gel filtration and for the major polypeptide by SDS-PAGE, respectively, suggest that the amoeba ODC is a homopentamer . Dialysis against hydroxylamine rendered the enzyme activity fully dependent on pyridoxal 5'-phosphate (PLP) . As expected for an oligomeric enzyme, ODC activity exhibited sigmoidal kinetics when it was measured as a function of increasing concentrations of L-ornithine and PLP yielding S(0.5) values of 0.45 and 0.18 mM, respectively . Purified ODC was inhibited by 1,3-diaminopropane and 2,4-diamino-2-butanone but was largely insensitive to inhibition by alpha-difluoromethylornithine (DFMO), indicating that the enzyme may not be a suitable target for this anti-parasitic drug . Other features of the amoeba ODC were common with the enzyme from prokaryotes and eucaryotes.

Philos Trans R Soc Lond B Biol Sci, 2003 Jan 29, 358(1429), 223 - 30
Evolution of photosynthetic prokaryotes: a maximum-likelihood mapping approach; Raymond J et al.; Reconstructing the early evolution of photosynthesis has been guided in part by the geological record, but the complexity and great antiquity of these early events require molecular genetic techniques as the primary tools of inference . Recent genome sequencing efforts have made whole genome data available from representatives of each of the five phyla of bacteria with photosynthetic members, allowing extensive phylogenetic comparisons of these organisms . Here, we have undertaken whole genome comparisons using maximum likelihood to compare 527 unique sets of orthologous genes from all five photosynthetic phyla . Substantiating recent whole genome analyses of other prokaryotes, our results indicate that horizontal gene transfer (HGT) has played a significant part in the evolution of these organisms, resulting in genomes with mosaic evolutionary histories . A small plurality phylogenetic signal was observed, which may be a core of remnant genes not subject to HGT, or may result from a propensity for gene exchange between two or more of the photosynthetic organisms compared.

Philos Trans R Soc Lond B Biol Sci, 2003 Jan 29, 358(1429), 147 - 53; discussion 153-4
Redox and light regulation of gene expression in photosynthetic prokaryotes; Bauer C et al.; All photosynthetic organisms control expression of photosynthesis genes in response to alterations in light intensity as well as to changes in cellular redox potential . Light regulation in plants involves a well-defined set of red- and blue-light absorbing photoreceptors called phytochrome and cryptochrome . Less understood are the factors that control synthesis of the plant photosystem in response to changes in cellular redox . Among a diverse set of photosynthetic bacteria the best understood regulatory systems are those synthesized by the photosynthetic bacterium Rhodobacter capsulatus . This species uses the global two-component signal transduction cascade, RegB and RegA, to anaerobically de-repress anaerobic gene expression . Under reducing conditions, the phosphate on RegB is transferred to RegA, which then activates genes involved in photosynthesis, nitrogen fixation, carbon fixation, respiration and electron transport . In the presence of oxygen, there is a second regulator known as CrtJ, which is responsible for repressing photosynthesis gene expression . CrtJ responds to redox by forming an intramolecular disulphide bond under oxidizing, but not reducing, growth conditions . The presence of the disulphide bond stimulates DNA binding activity of the repressor . There is also a flavoprotein that functions as a blue-light absorbing anti-repressor of CrtJ in the related bacterial species Rhodobacter sphaeroides called AppA . AppA exhibits a novel long-lived photocycle that is initiated by blue-light absorption by the flavin . Once excited, AppA binds to CrtJ thereby inhibiting the repressor activity of CrtJ . Various mechanistic aspects of this photocycle will be discussed.

Philos Trans R Soc Lond B Biol Sci, 2003 Jan 29, 358(1429), 39 - 57; discussion 57-8
How big is the iceberg of which organellar genes in nuclear genomes are but the tip?
Doolittle WF, Boucher Y, Nesbo CL, Douady CJ, Andersson JO, Roger AJ.
As more and more complete bacterial and archaeal genome sequences become available, the role of lateral gene transfer (LGT) in shaping them becomes more and more clear . Over the long term, it may be the dominant force, affecting most genes in most prokaryotes . We review the history of LGT, suggesting reasons why its prevalence and impact were so long dismissed . We discuss various methods purporting to measure the extent of LGT, and evidence for and against the notion that there is a core of never-exchanged genes shared by all genomes, from which we can deduce the "true" organismal tree . We also consider evidence for, and implications of, LGT between prokaryotes and phagocytic eukaryotes.

FEMS Microbiol Lett, 2003 Feb 14, 219(1), 39 - 45
Genomics-based design of defined growth media for the plant pathogen Xylella fastidiosa; Lemos EG et al.; Based on the genetic analysis of the phytopathogen Xylella fastidiosa genome, five media with defined composition were developed and the growth abilities of this fastidious prokaryote were evaluated in liquid media and on solid plates . All media had a common salt composition and included the same amounts of glucose and vitamins but differed in their amino acid content . XDM(1) medium contained amino acids threonine, serine, glycine, alanine, aspartic acid and glutamic acid, for which complete degradation pathways occur in X . fastidiosa; XDM(2) included serine and methionine, amino acids for which biosynthetic enzymes are absent, plus asparagine and glutamine, which are abundant in the xylem sap; XDM(3) had the same composition as XDM(2) but with asparagine replaced by aspartic acid due to the presence of complete degradation pathway for aspartic acid; XDM(4) was a minimal medium with glutamine as a sole nitrogen source; XDM(5) had the same composition as XDM(4), plus methionine . The liquid and solidified XDM(2) and XDM(3) media were the most effective for the growth of X . fastidiosa . This work opens the opportunity for the in silico design of bacterial defined media once their genome is sequenced.

FEMS Microbiol Lett, 2003 Feb 14, 219(1), 1 - 7
Prokaryotes and the input of polyunsaturated fatty acids to the marine food web; Nichols DS; The investigation of prokaryotes in aquatic ecology is often limited to their role in nutrient cycling and the degradation of organic matter . While this aspect of the microbial loop is undoubtedly important, further aspects of bacterial roles in marine food webs exist which have not been fully considered in light of recent research in related fields . The concept of bacteria providing essential nutrients may derive importance from two aspects of their role in the marine environment; firstly as a primary food source for omnivorous, sestonivorous and filtering benthic animals and secondly as components of the commensal microbial communities of marine animals . Many marine organisms lack the de novo ability to produce n-3 polyunsaturated fatty acids (PUFA) and hence rely on a dietary supply of PUFA . The issue of PUFA origin in the marine food web is particularly salient in light of recent research demonstrating the influence of PUFA levels on the efficiency of energy transfer between trophic levels . The assumption that microalgae provide the bulk of de novo PUFA production for all marine food webs must be actively reviewed with respect to particular microbial niches such as sea ice, marine animals and abyssal communities.

Nat Struct Biol, 2003 Mar, 10(3), 212 - 8
The H-NS dimerization domain defines a new fold contributing to DNA recognition; Bloch V et al.; H-NS, a protein found in Gram-negative bacteria, is involved in structuring the bacterial chromosome and acts as a global regulator for the expression of a wide variety of genes . These functions are correlated with both its DNA-binding and oligomerization properties . We have identified the minimal dimerization domain of H-NS, a 46 amino acid-long N-terminal fragment, and determined its structure using heteronuclear NMR spectroscopy . The highly intertwined structure of the dimer, reminiscent of a handshake, defines a new structural fold, which may offer a possibility for discriminating prokaryotic from eukaryotic proteins in drug design . Using mutational analysis, we also show that this N-terminal domain actively contributes to DNA binding, conversely to the current paradigm . Together, our data allows us to propose a model for the action of full length H-NS.

Anal Bioanal Chem, 2003 Feb, 375(3), 344 - 9 Epub 2003 Jan 16.
HPLC assay for methylmalonyl-CoA epimerase; Bobik TA et al.; Methylmalonyl-CoA epimerase (MCE) is broadly distributed in nature and has diverse cellular roles . Many MCE homologues are represented in public databases, but the biochemical function and physiological roles of the majority of these putative proteins have not been investigated . Here, a simplified assay for MCE is described . In this assay, MCE converted (2S)-methylmalonyl-CoA to (2R)-methylmalonyl-CoA which in turn was converted to succinyl-CoA by methylmalonyl-CoA mutase, an enzyme specific for the 2 R isomer . MCE activity was quantified by measuring the disappearance of methylmalonyl-CoA by HPLC . To obtain the methylmalonyl-CoA mutase which was required as a reagent for the assay, an Escherichia coli strain was constructed that expressed high levels of this enzyme as a fusion protein with an 8x histidine tag . This allowed purification of the mutase in a single affinity chromatography step . Previously reported MCE assays required radioactive substrates and/or multiple reagent enzymes that were difficult to obtain . The assay reported here overcomes these difficulties and hence will facilitate studies of MCEs . Such enzymes play important roles in the metabolism of both prokaryotes and higher eukaryotes including humans.

Indian J Exp Biol, 2002 Jun, 40(6), 706 - 16
Inevitable glutathione, then and now; Rana SV et al.; Glutathione a predominant tripeptide thiol compound of many prokaryotes and eukaryotes, is synthesized from its precursor amino acids eg . gamma-glutamate, cysteine and glycine . It is mainly involved in detoxication mechanisms through conjugation reactions . Other functions include thiol transfer, destruction of free radicals and metabolism of various exogenous and endogenous compounds . It becomes mandatory for a cell to manage high concentration of intracellular GSH to protect itself from chemical/dug abuse . Glutathione dependent enzymes viz: glutathione-S-transferases, glutathione peroxidase, glutathione reductase and gamma-glutamate transpeptidase facilitate protective manifestations . Liver serves as a glutathione-generating factor which supplies the kidney and intestine with other constituents of glutathione resynthesis . The principal mechanism of hepatocyte glutathione turnover appears to be cellular efflux . Kidney too plays an important role in organismic GSH homeostasis . Role of GSH in organs like lung, intestine and brain has recently been described . GSH involvement in programmed cell death has also been indicated . Immense interest makes the then "thee glutathione" as "inevitable glutathione" . This article describes the role of this vital molecule in cell physiology and detoxication mechanisms in particular.

Biochim Biophys Acta, 2003 Feb 17, 1610(1), 109 - 23
Downstream coding region determinants of bacterio-opsin, muscarinic acetylcholine receptor and adrenergic receptor expression in Halobacterium salinarum; Bartus CL et al.; The aim of this work is to develop a prokaryotic system capable of expressing membrane-bound receptors in quantities suitable for biochemical and biophysical studies . Our strategy exploits the endogenous high-level expression of the membrane protein bacteriorhodopsin (BR) in the Archaeon Halobacterium salinarum . We attempted to express the human muscarinic acetylcholine (M(1)) and adrenergic (a2b) receptors by fusing the coding region of the m1 and a2b genes to nucleotide sequences known to direct bacterio-opsin (bop) gene transcription . The fusions included downstream modifications to produce non-native carboxyl-terminal amino acids useful for protein identification and purification . bop mRNA and BR accumulation were found to be tightly coupled and the carboxyl-terminal coding region modifications perturbed both . m1 and a2b mRNA levels were low, and accumulation was sensitive to both the extent of the bop gene fusion and the specific carboxyl-terminal coding sequence modifications included . Functional a2b adrenergic receptor expression was observed to be dependent on the downstream coding region . This work demonstrates that a critical determinant of expression resides in the downstream coding region of the wild-type bop gene and manipulation of the downstream coding region of heterologous genes may affect their potential for expression in H . salinarum .

Biochim Biophys Acta, 2003 Feb 17, 1610(1), 37 - 45
The expression of outer membrane proteins for crystallization; Bannwarth M et al.; The production of sufficient amounts of chemically and conformationally homogenous protein is a major requirement for successful crystallization and structure determination . With membrane proteins, this constitutes a particular problem because the membrane volume is limited and the organisms are usually very sensitive to changes in membrane properties brought about by massive protein insertion . Moreover, the extraction of membrane proteins from the membrane with detergents is generally a harsh treatment, which gives rise to conformational aberrations . A number of successful procedures for functional expression followed by purification are reviewed here together with nonfunctional expression into inclusion bodies and subsequent (re)folding to produce functional proteins . Most of the data are for prokaryotic outer membrane proteins, but the outer membrane proteins of eukaryotic organelles are also considered as they do show similar features .

Biochim Biophys Acta, 2003 Feb 17, 1610(1), 23 - 36
Practical aspects of overexpressing bacterial secondary membrane transporters for structural studies; Wang DN et al.; Membrane transporter proteins play critical physiological roles in the cell and constitute 5-10% of prokaryotic and eukaryotic genomes . High-resolution structural information is essential for understanding the functional mechanism of these proteins . A prerequisite for structural study is to overexpress such proteins in large quantities . In the last few years, over 20 bacterial membrane transporters were overexpressed at a level of 1 mg/l of culture or higher, most often in Escherichia coli . In this review, we analyzed those factors that affect the quantity and quality of the protein produced, and summarized recent progress in overexpression of membrane transporters from bacterial inner membrane . Rapid progress in genome sequencing provides opportunities for expressing several homologues and orthologues of the target protein simultaneously, while the availability of various expression vectors allows flexible experimental design . Careful optimization of cell culture conditions can drastically improve the expression level and homogeneity of the target protein . New sample preparation techniques for mass spectrometry of membrane proteins have enabled one to identity the rigid protein core, which can be subsequently overexpressed . Size-exclusion chromatography on HPLC has proven to be an efficient method in screening detergent, pH an other conditions required for maintaining the stability and monodispersity of the protein . Such high-quality preparations of membrane transporter proteins will probably lead to successful crystallization and structure determination of these proteins in the next few years .

Biochim Biophys Acta, 2003 Feb 17, 1610(1), 11 - 22
Specific lipid requirements of membrane proteins--a putative bottleneck in heterologous expression; Opekarova M et al.; Membrane proteins are mostly protein-lipid complexes . For more than 30 examples of membrane proteins from prokaryotes, yeast, plant and mammals, the importance of phospholipids and sterols for optimal activity is documented . All crystallized membrane protein complexes show defined lipid-protein contacts . In addition, lipid requirements may also be transitory and necessary only for correct folding and intercellular transport . With respect to specific lipid requirements of membrane proteins, the phospholipid and glycolipid as well as the sterol content of the host cell chosen for heterologous expression should be carefully considered . The lipid composition of bacteria, archaea, yeasts, insects,Xenopus oocytes, and typical plant and mammalian cells are given in this review . A few examples of heterologous expression of membrane proteins, where problems of specific lipid requirements have been noticed or should be thought of, have been chosen .

Bioinformatics, 2003 Feb 12, 19(3), 418 - 20
IslandPath: aiding detection of genomic islands in prokaryotes; Hsiao W et al.; Genomic islands (clusters of genes of potential horizontal origin in a prokaryotic genome) are frequently associated with a particular adaptation of a microbe that is of medical, agricultural or environmental importance, such as antibiotic resistance, pathogen virulence, or metal resistance . While many sequence features associated with such islands have been adopted separately in applications for analysis of genomic islands, including pathogenicity islands, there is no single application that integrates multiple features for island detection . IslandPath is a network service which incorporates multiple DNA signals and genome annotation features into a graphical display of a bacterial or archaeal genome, to aid the detection of genomic islands . AVAILABILITY: This application is available at and the source code is freely available, under GNU public licence, from the authors . SUPPLEMENTARY INFORMATION: An online help file, which includes analyses of the utility of IslandPath, can be found at http://www.pathogenomics.sfu.ca/islandpath/current/islandhelp.html

Theor Appl Genet, 2002 Aug, 105(2-3), 423 - 430 Epub 2002 Jun 19.
Structure and expression of the Zea mays mutS-homologs Mus1 and Mus2; Horwath M et al.; DNA mismatch repair proteins play an important role in maintaining the integrity of the genetic information during replication and homologous recombination . The MutS-homologous (MSH) and MutL-homologous (MLH) proteins are highly conserved among all prokaryotes and eukaryotes . We have isolated two mutS homologous genes from Zea mays, named Mus1 and Mus2 . Phylogenetic analysis identifies Mus1 as a member of the MSH2 protein family . Mus2 is an ortholog of the Arabidopsis thaliana MSH7 protein and belongs to a subgroup of MSH proteins that is possibly plant-specific . Mus1 and Mus2 are expressed at very low levels . Mus1 is located on chromosome 7L near locus b32B, and mus2 maps on chromosome 3S.

Nucleic Acids Res, 2003 Feb 15, 31(4), 1234 - 44
Evolution of transcription factors and the gene regulatory network in Escherichia coli; Madan Babu M et al.; The most detailed information presently available for an organism's transcriptional regulation network is that for the prokaryote Escherichia coli . In order to gain insight into the evolution of the E.coli regulatory network, we analysed information obtainable for the domains and protein families of the transcription factors and regulated genes . About three-quarters of the 271 transcription factors we identified are two-domain proteins, consisting of a DNA-binding domain along with a regulatory domain . The regulatory domains mainly bind small molecules . Many groups of transcription factors have identical domain architectures, and this implies that roughly three-quarters of the transcription factors have arisen as a consequence of gene duplication . In contrast, there is little evidence of duplication of regulatory regions together with regulated genes or of transcription factors together with regulated genes . Thirty-eight, out of the 121 transcription factors for which one or more regulated genes are known, regulate other transcription factors . This amplification effect, as well as large differences between the numbers of genes directly regulated by transcription factors, means that there are about 10 global regulators which each control many more genes than the other transcription factors.

J Biol Chem, 2003 Apr 25, 278(17), 15246 - 51 Epub 2003 Feb 11.
Folding pathway mediated by an intramolecular chaperone . A functional peptide chaperone designed using sequence databases; Yabuta Y et al.; Catalytic domains of several prokaryotic and eukaryotic protease families require dedicated N-terminal propeptide domains or "intramolecular chaperones" to facilitate correct folding . Amino acid sequence analysis of these families establishes three important characteristics: (i) propeptides are almost always less conserved than their cognate catalytic domains, (ii) they contain a large number of charged amino acids, and (iii) propeptides within different protease families display insignificant sequence similarity . The implications of these findings are, however, unclear . In this study, we have used subtilisin as our model to redesign a peptide chaperone using information databases . Our goal was to establish the minimum sequence requirements for a functional subtilisin propeptide, because such information could facilitate subsequent design of tailor-made chaperones . A decision-based computer algorithm that maintained conserved residues but varied all non-conserved residues from a multiple protein sequence alignment was developed and utilized to design a novel peptide sequence (ProD) . Interestingly, despite a difference of 5 pH units between their isoelectric points and despite displaying only 16% sequence identity with the wild-type propeptide (ProWT), ProD chaperones folding and functions as a potent subtilisin inhibitor . The computed secondary structures and hydrophobic patterns within these two propeptides are similar . However, unlike ProWT, ProD adopts a well defined alpha-beta conformation as an isolated peptide and forms a stoichiometric complex with mature subtilisin . The CD spectra of this complex is similar to ProWT.subtilisin . Our results establish that despite low sequence identity and dramatically different charge distribution, both propeptides adopt similar structural scaffolds . Hence, conserved scaffolds and hydrophobic patterns, but not absolute charge, dictate propeptide function.

Med Hypotheses, 2003 Mar, 60(3), 418 - 23
The halting arrival of left-handed Z-DNA; Gagna CE et al.; Forty-nine years ago Watson and Crick proposed a double-stranded (ds-) model for DNA . This double helix has become an icon of molecular biology . Twenty-six years later, Rich accidently discovered Z-DNA, an exotic left-handed nucleic acid . For many years thereafter, this left-handed DNA was thought to be an artifact . DNA is no longer looked upon as a static molecule but rather an extremely dynamic structure in which different conformations are in equilibrium with each other . Many researchers have spent the last two decades characterizing this novel left-handed DNA structure . Now many investigators are beginning to accept the possibility that this novel ds-DNA conformation may play a significant in vivo role within eukaryotic and prokaryotic cells . However, more research needs to be performed before it is absolutely accepted by all in the scientific community.

Theor Appl Genet, 2002 Jan, 104(1), 48 - 53
Evidence for a prokaryotic insertion-sequence contamination in eukaryotic sequences registered in different databases; Astua-Monge G et al.; An insertion-sequence of prokaryotic origin was detected in a genomic clone obtained from a Phaseolus vulgaris bacterial artificial chromosome (BAC) library . This BAC clone, characterized as part of a contig constructed near a virus resistance gene, exhibited restriction fragment length polymorphism with an overlapping clone of the contig . Restriction analysis of DNA obtained from individual colonies of the stock culture indicated the presence of a mixed population of wild-type and insertional mutants . Sequence analysis of both members of the population revealed the presence of IS 10R, an insertion-sequence from Escherichia coli . A BLAST search for IS 10-like sequences detected unexpected homologies with a large number of eukaryotic sequences from Homo sapiens, Arabidopsis thaliana, Drosophila melanogasterand Caenorhabditis elegans . Southern analysis of a random sample of BAC clones failed to detect IS 10 in the BAC DNA . However, prolonged sub-culturing of a set of 15 clones resulted in transposition into the BAC DNA . Eventually, all cultures acquired a 2.3-kb fragment that hybridized strongly with IS 10 . Sequence analysis revealed the presence of a preferred site for transposition in the BAC vector . These results indicate that a large number, if not all, of the BAC libraries from different organisms are contaminated with IS 10R . The source of this element has been identified as the DH10B strain of E . coli used as the host for BAC libraries.

Proteins, 2003 Mar 1, 50(4), 589 - 99
A path from primary protein sequence to ligand recognition; Kho R et al.; A novel method to organize protein structural information based solely on sequence is presented . The method clusters proteins into families that correlate with the three-dimensional protein structure and the conformation of the bound ligands . This procedure was applied to nicotinamide adenine dinucleotide {NAD(P)}-utilizing enzymes to identify a total of 94 sequence families, 53 of which are structurally characterized . Each of the structurally characterized proteins within a sequence family correlates to a single protein fold and to a common bound conformation of NAD(P) . A wide range of structural folds is identified that recognize NAD(P), including Rossmann folds and beta/alpha barrels . The defined sequence families can be used to identify the type and prevalence of NAD(P)-utilizing enzymes in the proteomes of sequenced organisms . The proteome of Mycobacterium tuberculosis was mined to generate a proteome-wide profile of NAD(P)-utilizing enzymes coded by this organism . This enzyme family comprises approximately 6% of the open reading frames, with the largest subgroup being the Rossmann fold, short-chain dehydrogenases . The preponderance of short-chain dehydrogenases correlates strongly with the phenotype of M . tuberculosis, which is characterized as having one of the most complex prokaryotic cell walls .

Am J Clin Oncol, 2003 Feb, 26(1), 92 - 4
Regression of lung lesions in Hodgkin's disease by antibiotics: case report and hypothesis on the etiology of Hodgkin's disease; Sauter C et al.; In this article, we propose that the pathogenesis of Hodgkin's disease is similar to the one of crown gall tumors in plants . Here a natural exchange of genetic material from (oncogenic plasmids) to plant cells induces malignant tumors in dicotyledons . The "crown gall" hypothesis for Hodgkin's disease would explain the clinical observations of a bacterial infection the behavior as a malignant tumor . The clinical consequence of this hypothesis is that antibiotic treatments of very early Hodgkin's disease may be successful before the genetic exchange between prokaryotic and eukaryotic cells has taken place . This "crown gall" hypothesis is testable (1) by looking for bacterial DNA sequences in Reed-Sternberg and Hodgkin's cells, and (2) by antibiotic treatments of Hodgkin's patients . In this communication we show a regression of Hodgkin's disease in the lung by prolonged treatment with ciprofloxacin and clarithromycin.

Microbiology, 2003 Jan, 149(Pt 1), 1 - 7
Prokaryote taxonomy of the 20th century and the impact of studies on the genus Pseudomonas: a personal view; Palleroni NJ; The taxonomic studies on the genus Pseudomonas performed in the Department of Bacteriology of the University of California at Berkeley played a significant role in the development of modern prokaryote taxonomy, which started in the 1960s . This impact was due to a revival of the method of den Dooren de Jong for the nutritional analysis of chemoorganotrophic organisms and, mostly, to the introduction of the determination of rRNA as a method of taxonomic analysis . While the introduction of the nutritional studies facilitated the characterization of Pseudomonas and other chemoorganotrophs, the applicability of the rRNA studies extended to all prokaryotes.

J Struct Biol, 2003 Jan, 141(1), 77 - 83
Bioinformatic analysis of ClpS, a protein module involved in prokaryotic and eukaryotic protein degradation; Lupas AN et al.; ClpS is a small protein, usually encoded immediately upstream of ClpA in the genomes of proteobacteria . Recent results show that it is a molecular adaptor for substrate recognition by ClpA in Escherichia coli . We analyzed ClpS by bioinformatic methods and found that ClpS homologs are also found in organisms that lack ClpA, such as actinobacteria, cyanobacteria, and plant chloroplasts . Furthermore, ClpS is homologous to a domain in the eukaryotic E3 ubiquitin ligase, N-recognin . This domain has previously been described as responsible for the recognition of type 2 N-end rule substrates . Despite very low levels of sequence similarity to proteins of known structure, there appears to be substantial structural similarity between ClpS and the C-terminal domain of ribosomal protein L7/12 (1CTF).

Hunan Yi Ke Da Xue Xue Bao, 2002 Jun 28, 27(3), 189 - 91
{Expression and purification of p11 fusion protein in E . coli and preparation of antiserum against GST-p11}; Tan ZP et al.; OBJECTIVE: To obtain p11 fusion protein and prepare specific polyclonal antibody against p11 . METHODS: A full-length human p11 gene was cloned into expression vectors, pGEX-4T-2 and pQE30, and transformed into E . coli . The expressed proteins were purified from lysates with Glutathione Sepharose 4B and the Ni-NTA agarose column, respectively . The purified GST-p11 was mixed with Freund's complete or incomplete adjuvant and immunized rabbits . RESULTS: A high level of expression of target proteins was detected after IPTG induction and purified proteins were obtained by affinity chromatography with Glutathione Sepharose 4B and the Ni-NTA agarose column, respectively . Western blotting analysis suggested that the polyclonal antibody can recognize 6xHis-p11 and GST protein . CONCLUSION: The antiserum against p11 prepared by prokaryotic expression of GST-p11 fusion protein has good specificity.

EMBO J, 2003 Feb 17, 22(4), 807 - 15
Thylakoid targeting of Tat passenger proteins shows no delta pH dependence in vivo; Finazzi G et al.; The Tat pathway is a major route for protein export in prokaryotes and for protein targeting to thylakoids in chloroplasts . Based on in vitro studies, protein translocation through this pathway is thought to be strictly dependent on a transmembrane delta pH . In this paper, we assess the delta pH sensitivity of the Tat pathway in vivo . Using Chlamydomonas reinhardtii, we observed changes in the efficiency of thylakoid targeting in vivo by mutating the Tat signal of the Rieske protein . We then employed two endogenous pH probes located on the lumen side of the thylakoid membranes to estimate spectroscopically the delta pH in vivo . Using experimental conditions in which the trans-thylakoid delta pH was almost zero, we found no evidence for a delta pH dependence of the Tat pathway in vivo . We confirmed this observation in higher plants using attached barley leaves . We conclude that the Tat pathway does not require a delta pH under physiological conditions, but becomes delta pH sensitive when probed in vitro/in organello because of the loss of some critical intracellular factors.

Hybrid Hybridomics, 2002 Dec, 21(6), 415 - 20
Genetic engineering of streptavidin-binding peptide tagged single-chain variable fragment antibody to Venezuelan equine encephalitis virus; Hu WG et al.; A recombinant gene encoding a single-chain variable fragment (scFv) antibody against Venezuelan equine encephalitis virus (VEE) was cloned into a prokaryotic T7 RNA polymerase-regulated expression vector . A streptavidin-binding peptide gene fused to a 6His tag was attached downstream to the scFv gene . The recombinant fusion protein was expressed in bacteria as inclusion bodies that were subsequently solubilized with 8 M urea and renatured by an arginine system . Purification of the fusion protein was achieved by immobilized metal affinity chromatography . Enzyme-linked immunosorbent assay (ELISA) and Western blotting results revealed that the fusion protein not only retained VEE antigen binding and specificity properties similar to those of its parent native monoclonal antibody (MAb), but also possessed streptavidin-binding activity . This experimental approach can eliminate the need for chemical biotinylation of antibodies and the risk associated of antibody denaturation and can provide a stable and reproducible reagent for rapid and efficient immunoassay of VEE when detected by horseradish peroxidase (HRP)-conjugated streptavidin.

DNA Cell Biol, 2002 Dec, 21(12), 869 - 77
In vivo DNA electrotransfer; Trezise AE; The use of electrotransfer for DNA delivery to prokaryotic cells, and eukaryotic cells in vitro, has been well known and widely used for many years . However, it is only recently that electric fields have been used to enhance DNA transfer to animal cells in vivo, and this is known as DNA electrotransfer or in vivo DNA electroporation . Some of the advantages of this method of somatic cell gene transfer are that it is a simple method that can be used to transfer almost any DNA construct to animal cells and tissues in vivo; multiple constructs can be co-transfected; it is equally applicable to dividing and nondividing cells; the DNA of interest does not need to be subcloned into a specific viral transfer vector and there is no need for the production of high titre viral stocks; and, as no viral genes are expressed there is less chance of an adverse immunologic reaction to vector sequences . The ease with which efficient in vivo gene transfer can be achieved with in vivo DNA electrotransfer is now allowing genetic analysis to be applied to a number of classic animal model systems where transgenic and embryonic stem cell techniques are not well developed, but for which a wealth of detailed descriptive embryological information is available, or surgical manipulation is much more feasible . As well as exciting applications in developmental biology, in vivo DNA electrotransfer is also being used to transfer genes to skeletal muscle and drive expression of therapeutically active proteins, and to examine exogenous gene and protein function in normal adult cells situated within the complex environment of a tissue and organ system in vivo . Thus, in effect providing the in vivo equivalent of the in vitro transient transfection assay . As the widespread use of in vivo electroporation has really only just begun, it is likely that the future will hold many more applications for this technology in basic research, biotechnology and clinical research areas.

Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi, 2001, 19(1), 22 - 5
{Cloning and expression of the gene encoding Schistosoma japonicum tropomyosin}; Cao JP et al.; OBJECTIVE: To clone and express the cDNA encoding Schistosoma japonicum tropomyosin . METHODS: The cDNA was amplified by reverse transcription-polymerase chain reaction (RT-PCR) . The PCR products were ligated with pGEM-T vectors and then for transformations . After characterization of white clones by agarose gel electrophoresis, endonucleases digestion and PCR, some recombinant plasmids with inserts were used for sequencing . Then the gene was subcloned into prokaryotic expression vector pQE30 and expression was induced by IPTG . RESULTS: The PCR products was 823 bp judged by agarose gel electrophoresis and sequencing . A cDNA encoding S . japonicum tropomyosin, except for 14 amino acids at the amino terminus and 2 at the carboxyl terminus, has been constructed and cloned successfully . The colony, designated pGSjcTM12, was sequenced and shown to be 91.1% identical at the nuclei acid level and 98.1% identical in deduced amino acid sequence to that of S . mansoni tropomyosin . The gene was subcloned into pQE30 and an expressed protein of about 32 kDa was obtained . CONCLUSION: The cloning and expression of the gene encoding S . japonicum tropomyosin had been successfully made.

Mini Rev Med Chem, 2003 Feb, 3(1), 1 - 9
Did quadruplex DNA play a role in the evolution of the eukaryotic linear chromosome?
Arthanari H, Bolton PH.
The current evidence on prokaryotic linear chromosomes, the eukaryotes that do not use telomerase and quadruplex DNA has been considered . This has lead to the suggestion that quadruplex DNA may have played a role in the evolution of the protection linear chromosomes rather than in overcoming the end replication problem.

Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi, 1999 Jun 30, 13(2), 124 - 7
{Expression of human prp gene in prokaryotic cells using GST fusion protein expression system}; Zhao X et al.; OBJECTIVE: To study the biological features of cell-surface protein PrPc, which is thought to be involved in the prion-associated diseases after converting to a proteinase-resistant isoform PrPSc posttranslationally, and to establish an effective immunologic diagnostic method using PrPc as antigen . METHODS: Amplifying and cloning the human prp gene from lymphocytes of two normal Chinese, after confirmed by DNA sequence analysis, the genes were separately subcloned into a GST-fusion expression plasmid . RESULTS: Sequence analysis showed that one contatined a point mutation that induced the 65th amino acid "Trp" inverting to a stop codon "TAG", whereas the other had the same sequence as the published standard prp gene . Both the standard and the mutated prp genes were separately subcloned into a GST fusion protein expression vector and expressed in the prokaryotic cells effectively . Western blot assay revealed that both of them expressed GST-PrP fusion proteins and could be recognized by PrP specific monoclonal antibody . CONCLUSION: It suggests that human PrP protein can be expressed in the GST fusion protein expression system and the expressed proteins hold good immune-reactivity.

Gene, 2003 Jan 30, 304, 77 - 86
Comprehensive analysis of transmembrane topologies in prokaryotic genomes; Arai M et al.; We analysed comprehensively transmembrane (TM) topologies of TM proteins of 50 selected prokaryotic genomes, by discriminating between TM and soluble proteins by using SOSUI, then detecting and removing signal peptides by applying 'DetecSig', and finally predicting TM topologies by employing 'ConPred' . Estimated fraction of TM proteins in proteome averaged over the 50 genomes is approximately 22% . About 13% of TM proteins were predicted to have a signal peptide, and the fraction of soluble proteins with signal peptide (secretory proteins) ranges from 8 to 18% for most majority of the genomes . The N(in)-type TM proteins with 2-, 4-, 6- and 12-tms (number of transmembrane segments) are predominant among multi-spanning TM proteins, and correspondingly, significantly higher fractions of N(out)-type TM proteins with 1-, 3-, 5- and 11-tms have a signal peptide . It is also found that the TM proteins with signal peptide tend to have a long N-tail loop . The averaged sequence length of TM proteins increases linearly with the increase of the number of TM segments, with the increasing rate of about 35 residues, suggesting a possibility that TM topologies might have been evolved by the 'internal gene duplication' mechanism . Datasets of TM topologies predicted in this study are available at approximately TMPinGS/.

Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi, 2002, 20(2), 76 - 8
{Construction and expression of an eukaryotic recombinant plasmid from a hybrid gene of antigen for Plasmodium falciparum}; Yao L et al.; OBJECTIVE: To construct an eukaryotic recombinant plasmid with HGFSP, a hybrid gene encoding the antigen epitopes of MSA1, MSA2, RESA and CSP in different developing stages of Plasmodium falciparum (P . f.) . METHODS: HGFSP was sub-cloned into an eukaryotic expression plasmid pcDNA3 from a prokaryotic recombinant plasmid pSK-HGFSP to construct the eukaryotic recombinant expression plasmid pc-HGFSP . The identified recombinant was then transfected into HepG2 cells with liposome-mediated method . The G418-selected positive cell clones were tested to identify the immunogenicity of HGFSP-expressing antigen . RESULTS: It was evidenced that HGFSP was correctly inserted into pcDNA3 by restriction enzymes map analysis . HGFSP-expressing antigen-specific fluorescent response was observed in pc-HGFSP-transfected HepG2 cells . The results of SDS-PAGE and Western-blotting showed that there was a 23 kD protein band, which can be specifically recognized by anti-sera of HGFSP-expressing protein in pc-HGFSP-transfected HepG2 cell lysis . CONCLUSION: Pc-HGFSP, an eukaryotic recombinant plasmid encoding hybrid antigen epitopes of P . f., was constructed successfully and the antigenicity of pc-HGFSP-expressing protein was confirmed.

J Biol Chem, 2003 Apr 18, 278(16), 13784 - 8 Epub 2003 Feb 02.
Apparent cooperative assembly of the bacterial cell division protein FtsZ demonstrated by isothermal titration calorimetry; Caplan MR et al.; The assembly dynamics of FtsZ, a prokaryotic homolog of tubulin, are important for their role in bacterial cytokinesis . Here we used isothermal titration calorimetry (ITC) to measure the heat of FtsZ self-association under various conditions . The measurements were designed to test whether FtsZ protofilaments are assembled by an isodesmic (linear aggregates in which each bond has an identical equilibrium constant) or a cooperative (aggregates only become stable after forming a oligomeric nucleus) assembly process . The isodesmic model can fit the assembly in GDP closely but cannot fit the assembly in GTP . FtsZ-GTP without Mg(2+) exhibits an apparent critical concentration, which is indicative of cooperative assembly, near 2.9 microm . With 2.5 mm Mg(2+) (which allows FtsZ to hydrolyze GTP) the critical concentration is reduced 10-fold to approximately 0.31 microm . Both with and without Mg(2+) there is no evidence for assembly below the critical concentration, but there is an abrupt transition to full assembly above . The ITC data are highly suggestive of a cooperative assembly, although this is difficult to reconcile with the 1-subunit-thick protofilaments observed by electron microscopy.

Genome Res, 2003 Feb, 13(2), 145 - 58
Evolutionary implications of microbial genome tetranucleotide frequency biases; Pride DT et al.; We compared nucleotide usage pattern conservation for related prokaryotes by examining the representation of DNA tetranucleotide combinations in 27 representative microbial genomes . For each of the organisms studied, tetranucleotide usage departures from expectations (TUD) were shared between related organisms using both Markov chain analysis and a zero-order Markov method . Individual strains, multiple chromosomes, plasmids, and bacteriophages share TUDs within a species . TUDs varied between coding and noncoding DNA . Grouping prokaryotes based on TUD profiles resulted in relationships with important differences from those based on 16S rRNA phylogenies, which may reflect unequal rates of evolution of nucleotide usage patterns following divergence of particular organisms from a common ancestor . By both symmetrical tree distance and likelihood analysis, phylogenetic trees based on TUD profiles demonstrate a level of congruence with 16S rRNA trees similar to that of both RpoA and RecA trees . Congruence of these trees indicates that there exists phylogenetic signal in TUD patterns, most prominent in coding region DNA . Because relationships demonstrated in TUD-based analyses utilize whole genomes, they should be considered complementary to phylogenies based on single genetic elements, such as 16S rRNA.

Biochem Biophys Res Commun, 2003 Feb 7, 301(2), 480 - 7
Flavonoid glycoside: a new inhibitor of eukaryotic DNA polymerase alpha and a new carrier for inhibitor-affinity chromatography; Mizushina Y et al.; Two flavonoid glycosides, kaempferol 3-O-(6"-acetyl)-beta-glucopyranoside (KAG) and quercetin 3-O-(6"-acetyl)-beta-glucopyranoside (QAG), were found to be inhibitors of eukaryotic DNA polymerases from a Japanese vegetable, Petasites japonicus . These compounds inhibited the activities of mammalian replicative DNA polymerases (i.e., pol alpha, delta, and epsilon), but not other pol beta, eta, kappa, and lambda activities . KAG was a stronger inhibitor and more selective to pol alpha than QAG . The IC(50) values of KAG for pol alpha, delta, and epsilon were 41, 164, and 127 microM, respectively . The pol alpha inhibition by KAG was non-competitive with respect to both the DNA template-primer and the dNTP substrate . KAG and QAG did not influence the activities of prokaryotic DNA polymerases or other mammalian DNA metabolic enzymes such as human immunodeficiency virus type 1 reverse transcriptase, human telomerase, human DNA topoisomerase I and II, T7 RNA polymerase, and bovine deoxyribonuclease I . Therefore, we concluded that these flavonoid glycosides are moderate replicative DNA polymerase inhibitors leaning more relatively to pol alpha, and could be used as chromatographic carriers to purify the DNA polymerases rather than cytotoxic agents . We then made a KAG-conjugated column such as the epoxy-activated Sepharose 6B . In the column, pol alpha was selectively adsorbed and eluted.

J Bacteriol, 2003 Feb, 185(4), 1478 - 83
Prokaryotic utilization of the twin-arginine translocation pathway: a genomic survey; Dilks K et al.; The twin-arginine translocation (Tat) pathway, which has been identified in plant chloroplasts and prokaryotes, allows for the secretion of folded proteins . However, the extent to which this pathway is used among the prokaryotes is not known . By using a genomic approach, a comprehensive list of putative Tat substrates for 84 diverse prokaryotes was established . Strikingly, the results indicate that the Tat pathway is utilized to highly varying extents . Furthermore, while many prokaryotes use this pathway predominantly for the secretion of redox proteins, analyses of the predicted substrates suggest that certain bacteria and archaea secrete mainly nonredox proteins via the Tat pathway . While no correlation was observed between the number of Tat machinery components encoded by an organism and the number of predicted Tat substrates, it was noted that the composition of this machinery was specific to phylogenetic taxa.

J Bacteriol, 2003 Feb, 185(4), 1266 - 72
Molecular characteristics of spontaneous deletions in the hyperthermophilic archaeon Sulfolobus acidocaldarius; Grogan DW et al.; Prokaryotic genomes acquire and eliminate blocks of DNA sequence by lateral gene transfer and spontaneous deletion, respectively . The basic parameters of spontaneous deletion, which are expected to influence the course of genome evolution, have not been determined for any hyperthermophilic archaeon . We therefore screened a number of independent pyrimidine auxotrophs of Sulfolobus acidocaldarius for deletions and sequenced those detected . Deletions accounted for only 0.4% of spontaneous pyrE mutations, corresponding to a frequency of about 10(-8) per cell . Nucleotide sequence analysis of five independent deletions showed no significant association of the endpoints with short direct repeats, despite the fact that several such repeats occur within the pyrE gene and that duplication mutations in pyrE reverted at high frequencies . Endpoints of the spontaneous deletions did not coincide with short inverted repeats or potential stem-loop structures . No consensus sequence common to all the deletions could be identified, although two deletions showed the potential of being stabilized by octanucleotide sequences elsewhere in pyrE, and another pair of deletions shared an octanucleotide at their 3' ends . The unusually low frequency and low sequence dependence of spontaneous deletions in the S . acidocaldarius pyrE gene compared to other genetic systems could not be explained in terms of possible constraints imposed by the 5-fluoroorotate selection.

J Biol Chem, 2003 Apr 18, 278(16), 13757 - 64 Epub 2003 Jan 31.
Maize C4 NADP-malic enzyme . Expression in Escherichia coli and characterization of site-directed mutants at the putative nucleoside-binding sites; Detarsio E et al.; Malic enzymes catalyze the oxidative decarboxylation of l-malate to yield pyruvate, CO(2), and NAD(P)H in the presence of a bivalent metal ion . In plants, different isoforms of the NADP-malic enzyme (NADP-ME) are involved in a wide range of metabolic pathways . The C(4)-specific NADP-ME has evolved from C(3)-type malic enzymes to represent a unique and specialized form of NADP-ME as indicated by its particular kinetic and regulatory properties . In the present study, the mature C(4)-specific NADP-ME of maize was expressed in Escherichia coli . The recombinant enzyme has essentially the same physicochemical properties and K(m) for the substrates as those of the naturally occurring NADP-ME previously characterized . However, the k(cat) was almost 7-fold higher, which may suggest that the previously purified enzyme from maize leaves was partially inactive . The recombinant NADP-ME also has a very low intrinsic NAD-dependent activity . Five mutants of NADP-ME at the postulated putative NADP-binding site(s) (Gsite5V, Gsite2V, A392G, A387G, and R237L) were constructed by site-directed mutagenesis and purified to homogeneity . The participation of these residues in substrate binding and/or the catalytic reaction was inferred by kinetic measurements and circular dichroism and intrinsic fluorescence spectra . The results obtained were compared with a predicted three-dimensional model of maize C(4) NADP-ME based on crystallographic studies of related animal NAD(P)-MEs . The data presented here represent the first prokaryotic expression of a plant NADP-ME and reveals valuable insight regarding the participation of the mutated amino acids in the binding of substrates and/or catalysis.

Sheng Wu Gong Cheng Xue Bao, 2002 Sep, 18(5), 536 - 40
{High expression and identification of DNA mismatch repair gene mutS in Escherichia coli}; Bi LJ et al.; DNA mismatch repair gene mutS (2.56 kb) was PCR modified and cloned into a secretive prokaryotic expression vector pET32a (+) which carries a N-terminal His.tag + and thioredoxin sequence . MutS protein was expressed with high level after IPTG induction using the strain E . coli AD494(DE3) . SDS-PAGE revealed that the expected protein with a molecular weight of 108 kD which is about 35% of the total bacterial proteins is almost soluble . The expected protein was purified directly by immobilized metal (Ni2+) chelation affinity chromatography and the purity is over 90% . MutS protein activity verified using mismatch DNA showed that the expression product can recognize and bind to base-pair mismatch specifically.

Vaccine, 2003 Mar 7, 21(11-12), 1205 - 12
Immunity to East Coast fever in cattle induced by a polypeptide fragment of the major surface coat protein of Theileria parva sporozoites; Bishop R et al.; Full-length recombinant versions of p67, the 709 amino acid major surface protein of Theileria parva sporozoites, induce immunity to East Coast fever (ECF) in cattle . We show that a soluble Escherichia coli recombinant version of p67 (p67(635)), in which a prokaryotic signal peptide replaces the eukaryotic one, confers protection comparable to that induced by the full-length molecule, but is unstable . Peptides encoding 80 (p67C) and 205 (p67N) amino acid fragments of p67, containing epitopes recognised by sporozoite neutralising monoclonal antibodies, exhibit improved stability in E . coli . Antibodies raised against the central region of p67 (p67M) neutralise sporozoite infectivity in vitro . The p67C peptide induced immunity against ECF in cattle, at a level equivalent to p67(635), suggesting that a synthetic peptide vaccine might be achievable .

Wei Sheng Wu Xue Bao, 2002 Aug, 42(4), 448 - 52
{Cloning and prokaryotic expression of viral binding protein(VBP) gene from endosybiotic bacterium of Rhopalosiphum padi}; Wu Y et al.; Viral binding protein gene from Rhopalosiphum padi Yangling biotype was amplified by PCR method and then cloned . The complete nucleotide sequence of the gene was determined, It has 1647 nucleotides encoding 548 amino acids . Comparison showed this gene has 97% identity on nucleotide level with Buchnera groEL-AM gene of Rhopalosiphum padi American biotype, while has 97.4% identity on amino acid level was found between this two genes . The VBP gene was ligated into pBV221 and pET30a expression vector and expressed the aim protein 63 kD and 69 kD.

Wei Sheng Wu Xue Bao, 1999 Jun, 39(3), 234 - 40
{Prokaryotic expressed trichosanthin and other two proteins have anti-fungal activity in vitro}; Hu P et al.; DNAs encoding Trichosanthin, tobacco class I Chitinase and tobacco class I beta-1, 3-Glucanase were expressed in E . coli, respectively . The expression products were assayed for their anti-fungal activity . All of three kinds of proteins show anti-fungal activity . When two of them combined, this activity was enhanced greatly . When three of them combined, the stronger anti-fungal activity was observed.

EMBO J, 2003 Feb 3, 22(3), 651 - 6
In vivo evidence for the prokaryotic model of extended codon-anticodon interaction in translation initiation; Esposito D et al.; Initiation codon context is an important determinant of translation initiation rates in both prokaryotes and eukaryotes . Such sequences include the Shine- Dalgarno ribosome-binding site, as well as other motifs surrounding the initiation codon . One proposed interaction is between the base immediately preceding the initiation codon (-1 position) and the nucleotide 3' to the tRNAf(Met) anticodon, at position 37 . Adenine is conserved at position 37, and a uridine at -1 has been shown in vitro to favor initiation . We have tested this model in vivo, by manipulating the chloroplast of the green alga Chlamydomonas reinhardtii, where the translational machinery is prokaryotic in nature . We show that translational defects imparted by mutations at the petA -1 position can be suppressed by compensatory mutations at position 37 of an ectopically expressed tRNA(fMet) . The mutant tRNAs are fully aminoacylated and do not interfere with the translation of other proteins . Although this extended base pairing is not an absolute requirement for initiation, it may convey added specificity to transcripts carrying non-standard initiation codons, and/or preserve translational fidelity under certain stress conditions.

Proc Natl Acad Sci U S A, 2003 Feb 4, 100(3), 1256 - 61 Epub 2003 Jan 27.
Two Hsp70 family members expressed in atherosclerotic lesions; Han Z et al.; Gene expression profiling was carried out comparing Con A elicited peritoneal macrophages from C57BL6 and FVBN wild-type and apolipoprotein (apo)E knockout mice . An EST, was expressed at higher levels in C57BL6 compared with FVBN mice . mapped to an atherosclerosis susceptibility locus on chromosome 19 revealed in an intercross between atherosclerosis-susceptible C57BL6 and atherosclerosis-resistant FVBN apoE knockout mice . A combination of database search and Northern analysis confirmed that corresponded to 3'-UTR of a hitherto predicted gene, named HspA12A . Blasting the National Center for Biotechnology Information database revealed a closely related homologue, HspA12B . HspA12A and -B have very close human homologues . TaqMan analysis confirmed the increased HspA12A expression (2.6-fold) in elicited peritoneal macrophages from C57BL6 compared with FVBN mice . TaqMan analysis also revealed increased HspA12A and HspA12B expression (87- and 6-fold, respectively) in lesional versus nonlesional portions of the thoracic aorta from C57BL6 apoE knockout mice on a chow diet . In situ hybridization confirmed that both genes were expressed within lesions but not within nonlesional aortic tissue . Blasting of HspA12A and HspA12B against the National Center for Biotechnology Information database (NR) revealed a hit with the Conserved Domain database for Hsp70 (pfam00012.5, Hsp70) . Both genes appear to contain an atypical Hsp70 ATPase domain . The BLAST search also revealed that both genes were more similar to primitive eukaryote and prokaryote than mammalian Hsp70s, making these two genes distant members of the mammalian Hsp70 family . In summary, we describe two genes that code for a subfamily of Hsp70 proteins that may be involved in atherosclerosis susceptibility.

Biochemistry, 2003 Feb 4, 42(4), 932 - 9
Mitochondrial methionyl-tRNAfMet formyltransferase from Saccharomyces cerevisiae: gene disruption and tRNA substrate specificity; Vial L et al.; Initiation of protein synthesis in bacteria, mitochondria, and chloroplasts involves a formylated methionyl-tRNA species . Formylation of this tRNA is catalyzed by a methionyl-tRNA(f)(Met) formyltransferase (formylase) . Upon inactivation of the gene encoding formylase, the growth rate of Escherichia coli is severely decreased . This behavior underlines the importance of formylation to give tRNA(Met) an initiator identity . Surprisingly, however, recent data {Li, Y., Holmes, W . B., Appling, D . R., and RajBhandary, U . L . (2000) J . Bacteriol . 182, 2886-2892} showed that the respiratory growth of Saccharomyces cerevisiaewas not sensitive to deprivation of the mitochondrial formylase . In the present study, we report conditions of temperature or of growth medium composition in which inactivation of the formylase gene indeed impairs the growth of a S . cerevisiae haploid strain . Therefore, some selective advantage can eventually be associated to the existence of a formylating activity in the fungal mitochondrion under severe growth conditions . Finally, the specificity toward tRNA of S . cerevisiae mitochondrial formylase was studied using E . coli initiator tRNA and mutants derived from it . Like its bacterial counterpart, this formylase recognizes nucleotidic features in the acceptor stem of mitochondrial initiator tRNA . This behavior markedly distinguishes the mitochondrial formylase of yeast from that of animals . Indeed, it was shown that bovine mitochondrial formylase mainly recognizes the side chain of the esterified methionine plus a purine-pyrimidine base pair in the D-stem of tRNA {Takeuchi, N., Vial, L., Panvert, M., Schmitt, E., Watanabe, K., Mechulam, Y., and Blanquet, S . (2001) J . Biol . Chem . 276, 20064-20068} . Distinct tRNA recognition mechanisms adopted by the formylases of prokaryotic, fungal, or mammalian origins are likely to reflect coevolution of these enzymes with their tRNA substrate . Each mechanism appears well suited to an efficient selection of the substrate within the pool of all tRNAs.

Shi Yan Sheng Wu Xue Bao, 2001 Jun, 34(2), 143 - 6
{Cloning and efficient expression of cytokine human MK in E . coli}; Huang J et al.; For cloning the cytokine human Midkine (MK) gene, we designed by PCgene program and synthesized a pair of PCR specific primers according to the reported human MK cDNA sequence . Total cellular RNA was extracted from a human hepatoblastoma cell line HepG2, and then the target DNA fragment was obtained by RT-PCR and subcloned into plasmid pUC118 . Checked with radioisotope sequencing and ABI 377A sequencer, the nucleotide sequence of the cloned MK cDNA was identical with the reported one . A prokaryotic expression vector, named pBV220, was used to express the MK protein efficiently in E . coli strain TG1 and a predicted band of 16.5 kD in Mr by 15% SDS-PAGE was found . The expressed recombinant protein was found in insoluble aggregated form and accounted for about 31.21% of the total cellular proteins . The first 15 N-terminal amino acid sequence analysis of this protein by Edman degradation method showed that it was accordant with that predicted from the cDNA sequence . The activity of neurite outgrowth-promoting of the MK crude samples was tested with brain cells isolated from 18-day embryos of SD rat.

Shi Yan Sheng Wu Xue Bao, 2000 Dec, 33(4), 301 - 7
{Prokaryote expression and western analysis of BcpLH gene of Chinese cabbage}; Yu XH et al.; BcpLH gene preferentially expressed in folding leaf of Chinese cabbage contains dsRNA-binding domains . The cDNA of BcpLH gene was cloned into a His-fusion expression vector pET-28a (+) and was induced to express in E . coli strain BL21 (DE3) . Then, the specific protein was partially purified and the rabbit was immunized to prepare the anti-serum . Meanwhile BcpLH cDNA was cloned into the pMAL-c2 containing the solubizing partner, and then the soluble protein generated . It was demonstrated from Western dot assay that the BcpLH protein was specific . The BcpLH active protein and its anti-serum made it possible to study RNA-binding activity and regulation mechanism in plant development.

Biopolymers, 2003 Feb, 68(2), 234 - 49
Assembly of the 30S ribosomal subunit; Culver GM; Ribosomes are large macromolecular complexes responsible for cellular protein synthesis . The smallest known cytoplasmic ribosome is found in prokaryotic cells; these ribosomes are about 2.5 MDa and contain more than 4000 nucleotides of RNA and greater than 50 proteins . These components are distributed into two asymmetric subunits . Recent advances in structural studies of ribosomes and ribosomal subunits have revealed intimate details of the interactions within fully assembled particles . In contrast, many details of how these massive ribonucleoprotein complexes assemble remain elusive . The goal of this review is to discuss some crucial aspects of 30S ribosomal subunit assembly .

Nat Struct Biol, 2003 Mar, 10(3), 168 - 74
Structure of Mycobacterium tuberculosis PknB supports a universal activation mechanism for Ser/Thr protein kinases; Young TA et al.; A family of eukaryotic-like Ser/Thr protein kinases occurs in bacteria, but little is known about the structures and functions of these proteins . Here we characterize PknB, a transmembrane signaling kinase from Mycobacterium tuberculosis . The intracellular PknB kinase domain is active autonomously, and the active enzyme is phosphorylated on residues homologous to regulatory phospho-acceptors in eukaryotic Ser/Thr kinases . The crystal structure of the PknB kinase domain in complex with an ATP analog reveals the active conformation . The predicted fold of the PknB extracellular domain matches the proposed targeting domain of penicillin-binding protein 2x . The structural and chemical similarities of PknB to metazoan homologs support a universal activation mechanism of Ser/Thr protein kinases in prokaryotes and eukaryotes.

Ann N Y Acad Sci, 2002 Dec, 981, 154 - 88
On the roles of repetitive DNA elements in the context of a unified genomic-epigenetic system; von Sternberg R; Repetitive DNA sequences comprise a substantial portion of most eukaryotic and some prokaryotic chromosomes . Despite nearly forty years of research, the functions of various sequence families as a whole and their monomer units remain largely unknown . The inability to map specific functional roles onto many repetitive DNA elements (REs), coupled with the taxon-specificity of sequence families, have led many to speculate that these genomic components are "selfish" replicators generating genomic "junk." The purpose of this paper is to critically examine the selfishness, evolutionary effects, and functionality of REs . First, a brief overview of the range of ideas pertaining to RE function is presented . Second, the argument is presented that the selfish DNA "hypothesis" is actually a narrative scheme, that it serves to protect neo-Darwinian assumptions from criticism, and that this story is untestable and therefore not a hypothesis . Third, attempts to synthesize the selfish DNA concept with complex systems models of the genome and RE functionality are critiqued . Fourth, the supposed connection between RE-induced mutations and macroevolutionary events are stated to be at variance with empirical evidence and theoretical considerations . Hypotheses that base phylogenetic transitions in repetitive sequence changes thus remain speculative . Fifth and finally, the case is made for viewing REs as integrally functional components of chromosomes, genomes, and cells . It is argued throughout that a new conceptual framework is needed for understanding the roles of repetitive DNA in genomic/epigenetic systems, and that neo-Darwinian "narratives" have been the primary obstacle to elucidating the effects of these enigmatic components of chromosomes.

Vaccine, 2003 Feb 14, 21(9-10), 897 - 901
Immunopotentiating heat shock proteins: negotiators between innate danger and control of autoimmunity; van Eden W et al.; Heat shock proteins (hsps) are known to be immunodominant antigens of bacteria . Hsps are evolutionarily strongly conserved proteins present in all eukaryotic and prokaryotic cellular organisms and upregulated by several forms of stress . Despite (the paradigm of) self-tolerance, hsp-epitopes homologous to endogenous host hsp sequences have been implicated as T cell epitopes to endow crossreactive, hsp-specific T cells with the capacity to regulate inflammation, such as in experimentally induced autoimmune diseases . Such T cells were found to produce regulatory cytokines like IL10, in contrast to T cells induced with other conserved microbial proteins that are not upregulated by stress . Hsps have been implicated in immune regulation not only as upregulated targets of adaptive immunity during inflammatory stress, but recently also as triggering factors for innate immunity through activation via Toll-like receptors (TLRs).

Trends Genet, 2003 Feb, 19(2), 75 - 9
Functional determinants of transcription factors in Escherichia coli: protein families and binding sites; Madan Babu M et al.; DNA-binding transcription factors regulate the expression of genes near to where they bind . These factors can be activators or repressors of transcription, or both . Thus, a fundamental question is what determines whether a transcription factor acts as an activator or a repressor? Previous research into this question found that a protein's regulatory function is determined by one or more of the following factors: protein-protein contacts, position of the DNA-binding domain in the protein primary sequence, altered DNA structure, and the position of its binding site on the DNA relative to the transcription start site . Although there are many aspects specific to different transcription factors, in this work we demonstrate that, in general, in the prokaryote Escherichia coli, a transcription factor's protein family is not indicative of its regulatory function, but the position of its binding site on the DNA is.

Curr Biol, 2003 Jan 21, 13(2), R53 - 4
Gene transfer: gene swapping craze reaches eukaryotes; Gogarten JP; Recent studies have provided evidence for gene transfers from prokaryotes to eukaryotes and between eukaryotes . The mechanisms and frequencies of these transfers remain the subject of speculation, but the findings provide ample reason to seriously consider interspecies gene transfer as an important evolutionary process in eukaryotes.

Curr Biol, 2003 Jan 21, 13(2), 94 - 104
Phylogenetic analyses of diplomonad genes reveal frequent lateral gene transfers affecting eukaryotes; Andersson JO et al.; BACKGROUND: Lateral gene transfer (LGT) is an important evolutionary mechanism among prokaryotes . The situation in eukaryotes is less clear; the human genome sequence failed to give strong support for any recent transfers from prokaryotes to vertebrates, yet a number of LGTs from prokaryotes to protists (unicellular eukaryotes) have been documented . Here, we perform a systematic analysis to investigate the impact of LGT on the evolution of diplomonads, a group of anaerobic protists.RESULTS: Phylogenetic analyses of 15 genes present in the genome of the Atlantic Salmon parasite Spironucleus barkhanus and/or the intestinal parasite Giardia lamblia show that most of these genes originated via LGT . Half of the genes are putatively involved in processes related to an anaerobic lifestyle, and this finding suggests that a common ancestor, which most probably was aerobic, of Spironucleus and Giardia adapted to an anaerobic environment in part by acquiring genes via LGT from prokaryotes . The sources of the transferred diplomonad genes are found among all three domains of life, including other eukaryotes . Many of the phylogenetic reconstructions show eukaryotes emerging in several distinct regions of the tree, strongly suggesting that LGT not only involved diplomonads, but also involved other eukaryotic groups.CONCLUSIONS: Our study shows that LGT is a significant evolutionary mechanism among diplomonads in particular and protists in general . These findings provide insights into the evolution of biochemical pathways in early eukaryote evolution and have important implications for studies of eukaryotic genome evolution and organismal relationships . Furthermore, "fusion" hypotheses for the origin of eukaryotes need to be rigorously reexamined in the light of these results.

Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai), 2003 Feb, 35(2), 172 - 6
{Cloning, expression of the lectin-EGF domain of P-selectin, and preparation of its monoclonal antibody}; Zhou T et al.; To prepare monoclonal antibody specific to P-selectin lectin-EGF domain, the gene for lectin-EGF domain of P-selectin L-EGF was amplified from normal human platelets by RT-PCR, then was cloned into prokaryotic vector pET42b(+) . The recombinant plasmid was transformed into E . coli DH5 alpha strain for further screening and characterization, and was expressed in E . coli BL21 strain . Expressed protein was purified by chromatography on a Ni(2+)-NTA superflow agarose column and eluted with pH 8.0-4.5 urea gradient . Then the mAb anti-lectin-EGF was prepared with classical hybridoma technique, and 3 hybridoma cell lines (B10, F3 and H5) were obtained with Ig subclasses of these mAbs were IgG(2), IgG(1), and IgG(3) respectively, and their light chains were all kappa chain . Immuofluorescence and FACS assays demonstrated that mAbs could specifically recognize P-selectin expressed on ECV (endothelial cell line) stimulated by LPS . Meanwhile, the role of mAbs to P-selectin lectin-EGF domain was studied, and it was proved that the mAbs markedly inhibited adhesion between platelets and neutrophils in vitro . These monoclonal antibodies can specifically recognize the natural P-selectin and markedly inhibit adhesion between platelets and neutrophils in vitro.

Mol Cell Proteomics, 2002 Dec, 1(12), 983 - 95
Abundance and distributions of eukaryote protein simple sequences; Sim KL et al.; Protein simple sequences are a subclass of low complexity regions of sequence that are highly enriched in one or a few residue types . Such sequences are common in transcription regulatory proteins, in structural proteins, in proteins involved in nucleic acid interactions, and in mediating protein-protein interactions . Simple sequences of 10 or more residues, containing >/=50% of a single residue type are surveyed in this work . Both eukaryote and prokaryote proteomes are investigated with emphasis on the eukaryotes . Very large numbers of such sequences are found in all organisms surveyed . It is found that eukaryotes possess far more simple sequences per protein than do the prokaryotes . Prokaryotes display a linear relationship between number of proteins containing simple sequences and proteome size, whereas it is not clear that such a relationship holds for eukaryotes . Strikingly, it is found that each eukaryote possesses its own unique distribution of simple sequences . Within those distributions it is found that simple sequences enriched in certain residue types are clearly favored, whereas others are just as clearly discriminated against . The preferences observed are not correlated with residue occurrence . An analysis of classes of proteins of known function suggests that simple sequence occurrence and distribution may be related to protein function . Based upon this analysis, the large number of simple sequences found above that would be expected from a simple statistical model, plus the known functional importance of numerous such sequences, it is postulated that eukaryotes have evolved to not only tolerate large numbers of simple sequences but also to require them.

Mol Cell Proteomics, 2002 Dec, 1(12), 956 - 66
Proteomics of Synechocystis sp . strain PCC 6803: identification of plasma membrane proteins; Huang F et al.; Cyanobacteria are unique prokaryotes since they in addition to outer and plasma membranes contain the photosynthetic membranes (thylakoids) . The plasma membranes of Synechocystis 6803, which can be completely purified by density centrifugation and polymer two-phase partitioning, have been found to be more complex than previously anticipated, i.e . they appear to be essential for assembly of the two photosystems . A proteomic approach for the characterization of cyanobacterial plasma membranes using two-dimensional gel electrophoresis and mass spectrometry analysis revealed a total of 57 different membrane proteins of which 17 are integral membrane spanning proteins . Among the 40 peripheral proteins 20 are located on the periplasmic side of the membrane, while 20 are on the cytoplasmic side . Among the proteins identified are subunits of the two photosystems as well as Vipp1, which has been suggested to be involved in vesicular transport between plasma and thylakoid membranes and is thus relevant to the possibility that plasma membranes are the initial site for photosystem biogenesis . Four subunits of the Pilus complex responsible for cell motility were also identified as well as several subunits of the TolC and TonB transport systems . Several periplasmic and ATP-binding proteins of ATP-binding cassette transporters were also identified as were two subunits of the F(0) membrane part of the ATP synthase.

Antimicrob Agents Chemother, 2003 Feb, 47(2), 676 - 81
Genome-wide screening of Saccharomyces cerevisiae to identify genes required for antibiotic insusceptibility of eukaryotes; Blackburn AS et al.; The adverse reactions provoked by many antibiotics in humans are well documented but are generally poorly understood at the molecular level . To elucidate potential genetic defects that could give rise to susceptibility to prokaryote-specific antibiotics in eukaryotes, we undertook genome-wide screens using the yeast Saccharomyces cerevisiae as a model of eukaryotes; our previous work with a small number of yeast mutants revealed some specific gene functions required for oxytetracycline resistance . Here, the complete yeast deletion strain collection was tested for growth in the presence of a range of antibiotics . The sensitivities of mutants revealed by these screens were validated in independent tests . None of the approximately 4,800 defined deletion strains tested were found to be sensitive to amoxicillin, penicillin G, rifampin, or vancomycin . However, two of the yeast mutants were tetracycline sensitive and four were oxytetracycline sensitive; encompassed among the latter were mutants carrying deletions in the same genes that we had characterized previously . Seventeen deletion strains were found to exhibit growth defects in the presence of gentamicin, with MICs for the strains being as low as 32 micro g ml(-1) (the wild type exhibited no growth defects at any gentamicin concentration tested up to 512 micro g ml(-1)) . Strikingly, 11 of the strains that were most sensitive to gentamicin carried deletions in genes whose products are all involved in various aspects of vacuolar and Golgi complex (or endoplasmic reticulum) function . Therefore, these and analogous organelles, which are also the principal sites of gentamicin localization in human cells, appear to be essential for normal resistance to gentamicin in eukaryotes . The approach and data described here offer a new route to gaining insight into the potential genetic bases of antibiotic insusceptibilities in eukaryotes.

Antimicrob Agents Chemother, 2003 Feb, 47(2), 458 - 66
Biological properties of novel antistaphylococcal quinoline-indole agents; Oliva B et al.; The antibacterial properties of novel quinoline-indole (QI) agents were examined . QI agents demonstrated potent bactericidal activities against Staphylococcus aureus, killing by lytic and nonlytic mechanisms . S . aureus mutants resistant to a lytic QI agent (SEP 155342) and a nonlytic QI agent (SEP 118843) arose at frequencies of 1.4 x 10(-9) and 1.2 x 10(-8), respectively, by selection at four times the MICs . Mutants resistant to QI agent SEP 155342 were unstable, but mutants resistant to QI agent SEP 118843 displayed stable resistance . Mutants resistant to QI agent SEP 118843 were not cross resistant to other inhibitors, including QI agent SEP 155342 . Addition of QI agents SEP 118843 and SEP 155342 at four times the MIC caused nonspecific inhibition of several macromolecular biosynthetic pathways in S . aureus . Within 10 min, QI agents SEP 118843 and SEP 155342 both interfered with bacterial membrane integrity, as measured by uptake of propidium iodide . Agents from the two classes of the QI agents probably kill staphylococci by separate mechanisms which, nevertheless, both involve interference with cytoplasmic membrane function . Precise structure-activity relationships for the division of QI agents into two classes could not be determined . However, lytic activity was often associated with substitution of a basic amine at position 4 of the quinoline nucleus, whereas compounds with nonlytic activity usually contained an aromatic ring with or without a methoxy substituent at position 4 . Nonlytic QI agents such as SEP 118843 may possess selective activity against the prokaryotic membrane since this compound failed to lyse mouse erythrocytes when it was added at a concentration equivalent to four times the MIC for S . aureus.

Hunan Yi Ke Da Xue Xue Bao, 2001 Dec 28, 26(6), 495 - 8
{Study on the fusion expression of FBXO30: a novel member of F-box protein family}; Li ZH et al.; OBJECTIVE: The cDNA sequence of the coding region of FBXO30 (F-box only protein 30), which is a novel member of F-box protein family, was cloned into the mammalian expression vector pEGFP-C2 by non-directional cloning method and introduced into the NIH 3T3 cells by liposome transfection . Observation under the fluorescent microscopy after transfection showed that EGFP (enhanced green fluorescent protein)/FBXO30 was expressed and existed mainly in the cytoplasm . At the same time, the cDNA sequence of the coding region of FBXO30 was cloned into prokaryotic expression vector pGEX-4T-2 by directional cloning strategy . The GST (glutathione S-transferase)/FBXO30 fusion protein was expressed under the induction of IPTG (isopropylthio-beta-D-galactoside) in E . coli . A new band (approximately 65.5 kD) was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting . Purification of the GST-fused FBXO30 was carried out by affinity chromatography with glutathione sepharose 4B . The fusion expression of FBXO30 indicates that: FBXO30 protein is a cytoplasmic soluble protein, and the stable fusion expression of FBXO30 in the prokaryotic expression system can provide a base for the preparation of the specific antibody of FBXO30 and further functional study of FBXO30.

Appl Microbiol Biotechnol, 2003 Jan, 60(5), 495 - 506 Epub 2002 Dec 03.
Sterols in microorganisms; Volkman JK; Sterols are vital components of all eukaryotic cells . This review describes the variety of sterol structures found in microalgae, yeasts, fungi, protozoans and microheterotrophs . Reports of the occurrence of sterols in prokaryotic cells are critically assessed . Methylotrophic bacteria contain unusual 4-methylsterols, but reports of 4-desmethyl sterols in cyanobacteria and other bacteria are limited and many of these seem dubious . Possible application areas for sterols derived from mass culture of microalgae and other microorganisms are highlighted.

Cancer Lett, 2003 Feb 10, 190(1), 1 - 12
Histidine kinases and histidine phosphorylated proteins in mammalian cell biology, signal transduction and cancer; Steeg PS et al.; Intensive investigation of protein tyrosine, serine and threonine phosphorylation has lead to advances in signal transduction research and cancer treatment . This feature summarizes research on mammalian proteins exhibiting histidine phosphorylation . Histidine kinases are well known in prokaryotic and lower eukaryotic systems where they form the 'two-component' signal transduction system . The relative invisibility of histidine phosphorylation in mammalian cells may result from technical obstacles such as its acid lability, which precludes detection in electrophoretic systems, amino acid sequencing, etc . Emerging data have identified mammalian histidine kinases for the kinase suppressor of ras, a scaffold molecule for the Map kinase pathway, as well as histone H4, aldolase C and the beta-subunit of heterotrimeric G proteins . Additional mammalian proteins of interest to signal transduction and cancer research exhibit histidine phosphorylation, including P-selectin, annexin I and the 20S proteasome . Other candidate histidine phosphorylated proteins are identified . These data suggest the existence of another series of phosphorylation patterns in signal transduction.

Mol Cell, 2003 Jan, 11(1), 225 - 35
Excision of the Drosophila mariner transposon Mos1 . Comparison with bacterial transposition and V(D)J recombination; Dawson A et al.; It has been proposed that the modern immune system has evolved from a transposon in an ancient vertebrate . While much is known about the mechanism by which bacterial transposable elements catalyze double-strand breaks at their ends, less is known about how eukaryotic transposable elements carry out these reactions . We have examined the mechanism by which mariner, a eukaryotic transposable element, performs DNA cleavage . We show that the nontransferred strand is cleaved initially, unlike prokaryotic transposons which cleave the transferred strand first . First strand cleavage is not tightly coupled to second strand cleavage and can occur independently of synapsis, as happens in V(D)J recombination but not in transposition of prokaryotic transposons . Unlike V(D)J recombination, however, second strand cleavage of mariner does not occur via a hairpin intermediate.

Mol Cell, 2003 Jan, 11(1), 59 - 67
Identification of a new cryptochrome class . Structure, function, and evolution; Brudler R et al.; Cryptochrome flavoproteins, which share sequence homology with light-dependent DNA repair photolyases, function as photoreceptors in plants and circadian clock components in animals . Here, we coupled sequencing of an Arabidopsis cryptochrome gene with phylogenetic, structural, and functional analyses to identify a new cryptochrome class (cryptochrome DASH) in bacteria and plants, suggesting that cryptochromes evolved before the divergence of eukaryotes and prokaryotes . The cryptochrome crystallographic structure, reported here for Synechocystis cryptochrome DASH, reveals commonalities with photolyases in DNA binding and redox-dependent function, despite distinct active-site and interaction surface features . Whole genome transcriptional profiling together with experimental confirmation of DNA binding indicated that Synechocystis cryptochrome DASH functions as a transcriptional repressor.

Clin Exp Allergy, 2003 Jan, 33(1), 28 - 34
Cloning and expression of Blo t 1, a novel allergen from the dust mite Blomia tropicalis, homologous to cysteine proteases; Mora C et al.; BACKGROUND: House dust mite allergens have been shown to be a very important stimulus in the causation of asthma and triggers for the exacerbation of symptoms . Therefore, characterization of mite-derived allergens at the molecular level is an important step for the development of effective diagnostic and therapeutic approaches, as well as for epidemiological studies . OBJECTIVE: To clone, express and characterize at the molecular level the cysteine protease from Blomia tropicalis (Bt) . METHODS: A full-length cDNA encoding Blo t 1 was cloned from a Bt cDNA library using a PCR and RACE-based strategy . The cDNA was PCR-amplified, sequenced and subcloned into a prokaryotic expression vector . The allergenicity of the recombinant Blo t 1 was evaluated for IgE reactivity by Western blot . RESULTS: Blo t 1 cDNA encodes a 221 amino acids polypeptide with an estimated molecular weight of 25 kDa . The recombinant protein is 35% identical to other mite cysteine proteases . Recombinant Blo t 1 (rBlo t 1) bound IgE from 62% of Bt skin test-positive serum . Dermatophagoides pteronyssinus (Dp) skin test-positive sera did not react with rBlo t 1, indicating the possible presence of unique IgE epitopes on the rBlo t 1 molecule . A three-dimensional image of Blo t 1, constructed based on predicted analysis, showed conserved secondary and tertiary structure with other cysteine proteases . CONCLUSION: We report the cloning, expression and IgE reactivity of Blo t 1, a novel allergen from the domestic mite Blomia tropicalis (Bt), highly homologous to cysteine proteases . This putative cysteine protease, designated Blo t 1, may play a major role as an immunodominant allergen involved in dust mite-specific IgE-mediated hypersensitivity.

Nucleic Acids Res, 2003 Jan 15, 31(2), 779 - 89
Fingerprinting of prokaryotic 16S rRNA genes using oligodeoxyribonucleotide microarrays and virtual hybridization; Reyes-Lopez MA et al.; An oligonucleotide microarray hybridization system to differentiate microbial species was designed and tested . Seven microbial species were studied, including one Bacillus and six Pseudomonas strains . DNA sequences near the 5' end of 16S rRNA genes were aligned and two contiguous regions of high variability, flanked by highly conserved sequences, were found . The conserved sequences were used to design PCR primers which efficiently amplified these polymorphic regions from all seven species . The amplicon sequences were used to design 88 9mer hybridization probes which were arrayed onto glass slides . Single-stranded, fluorescence-tagged PCR products were hybridized to the microarrays at 15 degrees C . The experimental results were compared with the DeltaG(0) values for all matched and mismatched duplexes possible between the synthetic probes and the 16S target sequences of the seven test species, calculated using a 'virtual hybridization' software program . Although the observed hybridization patterns differed significantly from patterns predicted solely on the basis of perfect sequence matches, a unique hybridization fingerprint was obtained for each of the species, including closely related Pseudomonas species, and there was a reasonable correlation between the intensity of observed hybridization signals and the calculated DeltaG(0) values . The results suggest that both perfect and mismatched pairings can contribute to microbial identification by hybridization fingerprinting.

Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi, 2001 Mar, 15(1), 20 - 3
{Prokaryotic expression of hepatitis C virus envelope 1 gene and application of the expressed product}; Gao J et al.; OBJECTIVE: To express the HCV E1 gene in E . coli cells and to demonstrate its clinical significance in detection of anti-HCV E1 antibodies . METHODS: The expression vector was constructed by ligation of HCV E1 sequence, which was amplified by RT-PCR methods from 50 microliters of HCV RNA positive serum using primers specific to the HCV E1 sequence, to the prokaryotic expression vector PMS-31b transfected POP2136 at 16 degrees C for 16 hours . The recombinant plasmid was screened out and characterized by restriction enzyme analysis . The bacteria containing the recombinant plasmid was induced at 42 degrees C for 4 hours, and the recombinant protein was visualized by SDS-PAGE . The specificity of the recombinant protein was determined by Western blot assay . After purification of the expressed protein, this protein was coated on the plate with the concentration of 2 micrograms/ml in pH 9.6 buffer at 4 degrees C for overnight, and the serum specimen was tested at the dilution of 1:20 by ELISA . RESULTS: There were 2 fragments could be seen on the SDS-PAGE after digestion of the RT-PCR product with Sma I . And there emerged one fragment of 356 bp after digesting the recombinant plasmid with Sma I and Xba I . A band of 30,000 could be seen on the SDS-PAGE after the induction of bacteria containing the recombinant plasmid pMS-E1 at 42 degrees C for 4 hours . The Western blot assay showed that the expressed band could react with the anti-HCV positive serum . The ELISA result indicated that there were 28.9% (26/90) anti-HCV positive serum were anti-HCV E1 positive, but 3.9% (3/76) were positive in the anti-HCV negative serum . CONCLUSION: The HCV E1 sequence from HCV RNA positive serum has been expressed in E . coli . The expression rate is about 17% of the total protein of the bacteria . This protein possessed good specificity and may be used in the diagnosis of HCV infection.

Ai Zheng, 2002 Nov, 21(11), 1167 - 72
Analysis of bromodomain of BRD-7 gene and its prokaryotic expression; Peng C et al.; BACKGROUND & OBJECTIVE: BRD-7 is a novel gene (AF: 152604), containing a bromodomain, was cloned in our lab . Previous studies showed that BRD-7 plays an obviously suppressive role on NPC cell growth . In order to clarify the function mechanism of this gene, we investigate an important motif of BRD-7, the bromodomain . METHODS: The bromodomain of BRD-7 was analyzed by homology-based amino sequence and secondary structure analysis . In addition, we constructed a prokaryotic expression vector of bromodomain . Western blot analysis was used to confirm the expression of the bromodomain protein in Escherichia coli . RESULTS: Homology-based sequence analysis revealed that the bromodomain of BRD-7 possibly contains four alpha helices (Z, A, B and C), and a hydrophobic pocket which is an important structure to recognize acetylated histone peptide . This bromodomain encoding a 12.8 kD protein, was introduced into Escherichia coli using the pGEX-4T-2 expression vector . After isopropyl beta-D-thiogalactopyranoside(IPTG) induction, a new anticipated protein of 38.8 kD appeared on SDS-PAGE and the result was confirmed by Western blot analysis . CONCLUSION: BRD-7 of bromodomain protein is similar to three proteins containing known structural bromodomain motif by bio-informatics analysis, suggesting the bromodomain of BRD-7 should belong to co-activator subgroup and may have similar function that can selectively interact with acetylated histone peptide.

Mikrobiologiia, 2002 Nov-Dec, 71(6), 725 - 40
{Proterozoic history and present state of cyanobacteria}; Sergeev VN et al.; The paper delves into the main regularities of the distribution of fossil microorganisms in Precambrian rocks, beginning from the Archean Eon about 3.5 billion years ago and ending in the Cambrian Period about 0.5 billion years ago . The paper analyzes facial peculiarities in the lateral differentiation of microfossils in Proterozoic basins and the main stages of temporal changes in fossil cyanobacterial communities, which are based on the irreversible succession of physicochemical conditions on the Earth and the evolution of eukaryotic microorganisms and their incorporation into prokaryotic ecosystems . To gain insight into Proterozoic fossil records, modern stratified cyanobacterial mats built up from layers of prokaryotes are considered . The analysis of phosphatization, carbonatization, and silification processes in modern algal-bacterial communities suggests that analogous processes took place in Proterozoic microbiotas . A comparison of modern and Precambrian living forms confirms the inference that cyanobacterial communities are very conservative and have changed insignificantly both morphologically and physiologically during the past two billion years.

Biochemistry, 2003 Jan 21, 42(2), 320 - 30
Backbone dynamics of reduced plastocyanin from the cyanobacterium Anabaena variabilis: regions involved in electron transfer have enhanced mobility; Ma L et al.; The dynamics of the backbone of the electron-transfer protein plastocyanin from the cyanobacterium Anabaena variabilis were determined from the (15)N and (13)C(alpha) R(1) and R(2) relaxation rates and steady-state {(1)H}-(15)N and {(1)H}-(13)C nuclear Overhauser effects (NOEs) using the model-free approach . The (13)C relaxation studies were performed using (13)C in natural abundance . Overall, it is found that the protein backbone is rigid . However, the regions that are important for the function of the protein show moderate mobility primarily on the microsecond to millisecond time scale . These regions are the "northern" hydrophobic site close to the metal site, the metal site itself, and the "eastern" face of the molecule . In particular, the mobility of the latter region is interesting in light of recent findings indicating that residues also on the eastern face of plastocyanins from prokaryotes are important for the function of the protein . The study also demonstrates that relaxation rates and NOEs of the (13)C(alpha) nuclei of proteins are valuable supplements to the conventional (15)N relaxation measurements in studies of protein backbone dynamics.

EMBO Rep, 2003 Jan, 4(1), 37 - 41
Strategies for helicase recruitment and loading in bacteria; Konieczny I; DNA replication initiation in prokaryotes and eukaryotes requires the recruitment and loading of a helicase at the replication origin . To subsequently unwind the double-stranded DNA, the helicase must be properly positioned on the separated DNA strands . Several studies have revealed similarities and differences in the mechanisms used by different autonomously replicating DNA elements (replicons) for recruitment and activation of the appropriate helicase . Of particular interest are plasmid replicons that are adapted for replication in diverse bacterial hosts and are therefore intriguingly able to exploit the helicases of distantly related bacterial species . The different molecular mechanisms by which replicons recruit and load helicases are only just beginning to be understood.

Annu Rev Nutr, 2003, 23, 17 - 40 Epub 2003 Jan 08.
Mechanism and regulation of selenoprotein synthesis; Driscoll DM et al.; Selenium is an essential trace element that is incorporated into proteins as selenocysteine (Sec), the twenty-first amino acid . Sec is encoded by a UGA codon in the selenoprotein mRNA . The decoding of UGA as Sec requires the reprogramming of translation because UGA is normally read as a stop codon . The translation of selenoprotein mRNAs requires cis-acting sequences in the mRNA and novel trans-acting factors dedicated to Sec incorporation . Selenoprotein synthesis in vivo is highly selenium-dependent, and there is a hierarchy of selenoprotein expression in mammals when selenium is limiting . This review describes emerging themes from studies on the mechanism, kinetics, and efficiency of Sec insertion in prokaryotes . Recent developments that provide mechanistic insight into how the eukaryotic ribosome distinguishes between UGA/Sec and UGA/stop codons are discussed . The efficiency and regulation of mammalian selenoprotein synthesis are considered in the context of current models for Sec insertion.

Annu Rev Biochem, 2003, 72, 111 - 35 Epub 2003 Jan 09.
Protein disulfide bond formation in prokaryotes; Kadokura H et al.; Disulfide bonds formed between pairs of cysteines are important features of the structure of many proteins . Elaborate electron transfer pathways have evolved Escherichia coli to promote the formation of these covalent bonds and to ensure that the correct pairs of cysteines are joined in the final folded protein . These transfers of electrons consist, in the main, of cascades of disulfide bond formation or reduction steps between a series of proteins (DsbA, DsbB, DsbC, and DsbD) . A surprising variety of mechanisms and protein structures are involved in carrying out these steps.

Mol Cells, 2002 Dec 31, 14(3), 404 - 10
Identification of non-telomeric G4-DNA binding proteins in human, E . coli, yeast, and Arabidopsis; Kang SG et al.; G4-DNA binding proteins of E . coli, Saccharomyces cerevisiae, Arabidopsis, and human have been identified by a synthetic non-telomeric G4-DNA oligo 5'-d(ACTGTCGTACTTGATATGGGGGT)-3' using gel mobility shift assays . G4-DNA binding proteins are specific to G4-DNA, a four-stranded guanine-DNA structure . Bound complexes of G4-DNA and proteins were identified in nuclear extracts of all examined organisms in this study . In humans, three different G4-DNA and protein complexes were identified . However, human telomeric G-quadruplex oligo did not compete with G4-DNA oligo in the competition assays, suggesting that the identified G4-DNA binding proteins may be different from the known human telomeric G4-DNA binding proteins . We discovered two complexes of G4-DNA and protein in Arabidopsis identified in mobility shift assays . Interestingly, two complexes of G4-DNA and proteins were identified from E . coli, which have a circular genomic DNA structure . Results of this investigation suggest that non-telomeric G4-DNA structure and its binding proteins may be involved in important functional roles in both prokaryotes and eukaryotes.

Nucleic Acids Res, 2003 Jan 1, 31(1), 442 - 3
The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy; Cole JR et al.; The Ribosomal Database Project-II (RDP-II) pro-vides data, tools and services related to ribosomal RNA sequences to the research community . Through its website , RDP-II offers aligned and annotated rRNA sequence data, analysis services, and phylogenetic inferences (trees) derived from these data . RDP-II release 8.1 contains 16 277 prokaryotic, 5201 eukaryotic, and 1503 mitochondrial small subunit rRNA sequences in aligned and annotated format . The current public beta release of 9.0 debuts a new regularly updated alignment of over 50 000 annotated (eu)bacterial sequences . New analysis services include a sequence search and selection tool (Hierarchy Browser) and a phylogenetic tree building and visualization tool (Phylip Interface) . A new interactive tutorial guides users through the basics of rRNA sequence analysis . Other services include probe checking, phylogenetic placement of user sequences, screening of users' sequences for chimeric rRNA sequences, automated alignment, production of similarity matrices, and services to plan and analyze terminal restriction fragment polymorphism (T-RFLP) experiments . The RDP-II email address for questions or comments is rdpstaff@msu.edu.

Nucleic Acids Res, 2003 Jan 1, 31(1), 429 - 31
Noncoding regulatory RNAs database; Szymanski M et al.; The noncoding RNAs database is a collection of currently available sequence data on RNAs, which have no protein-coding capacity and have been implicated in regulation of cellular processes . The RNAs included in the database form very heterogenous group of molecules that act on different levels of information transmission in the cell . It includes RNAs acting on the level of chromatin structure, transcriptional and translational regulation of gene expression, modulation of protein function and regulation of subcellular distribution of RNAs and proteins . Those RNAs, with potential regulatory functions have been identified in prokaryotic, animal and plant cells . The database can be accessed at http://biobases.ibch.poznan.pl/ncRNA/.

Nucleic Acids Res, 2003 Jan 1, 31(1), 410 - 3
PEP: Predictions for Entire Proteomes; Carter P et al.; PEP is a database of Predictions for Entire Proteomes . The database contains summaries of analyses of protein sequences from a range of organisms representing all three major kingdoms of life: eukaryotes, prokaryotes and archaea . All proteins publicly available for organisms were aligned against SWISS-PROT, TrEMBL and PDB . Additionally, the following annotations are provided: secondary structure, transmembrane helices, coiled coils, regions of low complexity, signal peptides, PROSITE motifs, nuclear localization signals and classes of cellular function . Proteins that contain long regions without regular secondary structure are also identified . We have produced a related database of structural domain-like fragments derived from PEP and clusters based on homology between all fragments . The PEP database, fragments and clusters are distributed freely as a set of flat files and have been integrated into SRS . The PEP group of databases can be accessed from: http://cubic.bioc.columbia.edu/pep.

Nucleic Acids Res, 2003 Jan 1, 31(1), 258 - 61
STRING: a database of predicted functional associations between proteins; von Mering C et al.; Functional links between proteins can often be inferred from genomic associations between the genes that encode them: groups of genes that are required for the same function tend to show similar species coverage, are often located in close proximity on the genome (in prokaryotes), and tend to be involved in gene-fusion events . The database STRING is a precomputed global resource for the exploration and analysis of these associations . Since the three types of evidence differ conceptually, and the number of predicted interactions is very large, it is essential to be able to assess and compare the significance of individual predictions . Thus, STRING contains a unique scoring-framework based on benchmarks of the different types of associations against a common reference set, integrated in a single confidence score per prediction . The graphical representation of the network of inferred, weighted protein interactions provides a high-level view of functional linkage, facilitating the analysis of modularity in biological processes . STRING is updated continuously, and currently contains 261 033 orthologs in 89 fully sequenced genomes . The database predicts functional interactions at an expected level of accuracy of at least 80% for more than half of the genes; it is online at http://www.bork.embl-heidelberg.de/STRING/.

Nucleic Acids Res, 2003 Jan 1, 31(1), 187 - 9
HGT-DB: a database of putative horizontally transferred genes in prokaryotic complete genomes; Garcia-Vallve S et al.; The Horizontal Gene Transfer DataBase (HGT-DB) is a genomic database that includes statistical parameters such as G+C content, codon and amino-acid usage, as well as information about which genes deviate in these parameters for prokaryotic complete genomes . Under the hypothesis that genes from distantly related species have different nucleotide compositions, these deviated genes may have been acquired by horizontal gene transfer . The current version of the database contains 88 bacterial and archaeal complete genomes, including multiple chromosomes and strains . For each genome, the database provides statistical parameters for all the genes, as well as averages and standard deviations of G+C content, codon usage, relative synonymous codon usage and amino-acid content . It also provides information about correspondence analyses of the codon usage, plus lists of extraneous group of genes in terms of G+C content and lists of putatively acquired genes . With this information, researchers can explore the G+C content and codon usage of a gene when they find incongruities in sequence-based phylogenetic trees . A search engine that allows searches for gene names or keywords for a specific organism is also available . HGT-DB is freely accessible at http://www.fut.es/~debb/HGT.

Nucleic Acids Res, 2003 Jan 1, 31(1), 106 - 8
MICdb: database of prokaryotic microsatellites; Sreenu VB et al.; The MICdb (Microsatellites Database) is a comprehensive relational database of non-redundant microsatellites extracted from fully sequenced prokaryotic genomes . The current version (1.0) of the database has been compiled from 83 genomes belonging to different phylogenetic groups . This database has been linked to MICAS, the web-based Microstatellite Analysis Server . MICAS provides a user-friendly front-end to systematically extract data on microsatellite tracts from genomes . The database contains the following information pertaining to the microsatellites: the regions (coding/non-coding, if coding, their GenBank annotations) containing microsatellite tracts; the frequencies of their occurrences, the size and the number of repeating motifs; and the sequences of the tracts . MICAS also provides an interface to Autoprimer, a primer design program to automatically design primers for selected microsatellite loci.

Nucleic Acids Res, 2003 Jan 1, 31(1), 75 - 7
An improved version of the DNA Methylation database (MethDB); Amoreira C et al.; Cytosine methylation is a characteristic property of prokaryotic and eukaryotic genomes . In the latter, it is indispensable for a healthy development of the organism and uncontrolled changes in the distribution of 5-methylcytosine (5mC) have been linked to severe disorders, in particular cancer . The growing scientific interest in DNA methylation has led to a considerable amount of data about this epigenetic phenomenon . In order to make these data readily available, we have established a dedicated database . The DNA Methylation database (MethDB) is currently the only public database for DNA methylation . This constantly growing database has become a key resource in the field of DNA methylation research . The database contains currently methylation patterns, profiles and total methylation content data for 46 species, 160 tissues and 72 phenotypes coming from a total of 6667 experiments (as of September 4, 2002) . About 14% of the data have not been published elsewhere . These data can be conveniently searched and represented in different ways . Recently, we have included an on-line submission tool that permits the scientific public to directly enter new data into MethDB.

Mol Microbiol, 2003 Jan, 47(2), 561 - 71
A novel regulatory gene for light-induced carotenoid synthesis in the bacterium Myxococcus xanthus; Fontes M et al.; Myxococcus xanthus cells respond to blue light by producing carotenoids . Light triggers a network of regulatory actions that lead to the transcriptional activation of the carotenoid genes . By screening the colour phenotype of a collection of Tn5-lac insertion mutants, we have isolated a new mutant devoid of carotenoid synthesis . We map the transposon insertion, which co-segregates with the mutant phenotype, to a previously unknown gene designated here as carF . An in frame deletion within carF causes the same phenotype as the Tn5-lac insertion . The carF deletion prevents the activation of the normally light-inducible genes, without affecting the expression of any of the regulatory genes known to be expressed in a light-independent manner . Until now, the switch that sets off the regulatory cascade had been identified with light-driven inactivation of protein CarR, an antisigma factor . The exact mechanism of this inactivation has remained elusive . We show by epistatic analysis that the carF gene product participates in the light-dependent inactivation of CarR . The predicted CarF amino acid sequence reveals no known prokaryotic homologues . On the other hand, CarF is remarkably similar to Kua, a family of proteins of unknown function that is widely distributed among eukaryotes.

Mol Microbiol, 2003 Jan, 47(2), 471 - 81
Steroid biosynthesis in prokaryotes: identification of myxobacterial steroids and cloning of the first bacterial 2,3(S)-oxidosqualene cyclase from the myxobacterium Stigmatella aurantiaca; Bode HB et al.; Steroids, such as cholesterol, are synthesized in almost all eukaryotic cells, which use these triterpenoid lipids to control the fluidity and flexibility of their cell membranes . Bacteria rarely synthesize such tetracyclic compounds but frequently replace them with a different class of triterpenoids, the pentacyclic hopanoids . The intriguing mechanisms involved in triterpene biosynthesis have attracted much attention, resulting in extensive studies of squalene-hopene cyclase in bacteria and (S)-2,3-oxidosqualene cyclases in eukarya . Nevertheless, almost nothing is known about steroid biosynthesis in bacteria . Only three steroid-synthesizing bacterial species have been identified before this study . Here, we report on a variety of sterol-producing myxobacteria . Stigmatella aurantiaca is shown to produce cycloartenol, the well-known first cyclization product of steroid biosynthesis in plants and algae . Additionally, we describe the cloning of the first bacterial steroid biosynthesis gene, cas, encoding the cycloartenol synthase (Cas) of S . aurantiaca . Mutants of cas generated via site-directed mutagenesis do not produce the compound . They show neither growth retardation in comparison with wild type nor any increase in ethanol sensitivity . The protein encoded by cas is most similar to the Cas proteins from several plant species, indicating a close evolutionary relationship between myxobacterial and eukaryotic steroid biosynthesis.

Curr Opin Cell Biol, 2003 Feb, 15(1), 14 - 22
Structural insights into actin-binding, branching and bundling proteins; Winder SJ; Structural advances in our understanding of the functions of the actin cytoskeleton have come from diverse sources . On the one hand, the determination of the structure of a bacterial actin-like protein MreB reveals the prokaryotic origins of the actin cytoskeleton, whereas on the other, cryo-electron microscopy and crystallography have yielded reconstructions of many actin crosslinking, regulatory and binding proteins in complex with F-actin . Not least, a high-resolution structure of the Arp2/3 complex and a reconstruction with F-actin provides considerable insight into the eukaryotic machinery, vital for the formation of new F-actin barbed ends, a prerequisite for rapid actin polymerisation involved in cell shape change and motility.

Trends Biochem Sci, 2003 Jan, 28(1), 9 - 12
A conserved domain in prokaryotic bifunctional FAD synthetases can potentially catalyze nucleotide transfer; Krupa A et al.; Biosynthesis of flavin adenine dinucleotides in most prokaryotes is catalyzed by a family of bifunctional flavin adenine dinucleotide (FAD) synthetases . These enzymes carry out the dual functions of phosphorylation of flavin mononucleotide (FMN) and its subsequent adenylylation to generate FAD . Using various sequence analysis methods, a new domain has been identified in the N-terminal region that is well conserved in all the bacterial FAD synthetases . We also identify remote similarity of this domain to the nucleotidyl transferases and, hence, this domain is suggested to be invloved in the adenylylation reaction of FAD synthetases.

BMC Evol Biol . 2003 Jan 06;3(1):2.
Algorithms for computing parsimonious evolutionary scenarios for genome evolution, the last universal common ancestor and dominance of horizontal gene transfer in the evolution of prokaryotes; Mirkin BG et al.; BACKGROUND: Comparative analysis of sequenced genomes reveals numerous instances of apparent horizontal gene transfer (HGT), at least in prokaryotes, and indicates that lineage-specific gene loss might have been even more common in evolution . This complicates the notion of a species tree, which needs to be re-interpreted as a prevailing evolutionary trend, rather than the full depiction of evolution, and makes reconstruction of ancestral genomes a non-trivial task . RESULTS: We addressed the problem of constructing parsimonious scenarios for individual sets of orthologous genes given a species tree . The orthologous sets were taken from the database of Clusters of Orthologous Groups of proteins (COGs) . We show that the phyletic patterns (patterns of presence-absence in completely sequenced genomes) of almost 90% of the COGs are inconsistent with the hypothetical species tree . Algorithms were developed to reconcile the phyletic patterns with the species tree by postulating gene loss, COG emergence and HGT (the latter two classes of events were collectively treated as gene gains) . We prove that each of these algorithms produces a parsimonious evolutionary scenario, which can be represented as mapping of loss and gain events on the species tree . The distribution of the evolutionary events among the tree nodes substantially depends on the underlying assumptions of the reconciliation algorithm, e.g . whether or not independent gene gains (gain after loss after gain) are permitted . Biological considerations suggest that, on average, gene loss might be a more likely event than gene gain . Therefore different gain penalties were used and the resulting series of reconstructed gene sets for the last universal common ancestor (LUCA) of the extant life forms were analysed . The number of genes in the reconstructed LUCA gene sets grows as the gain penalty increases . However, qualitative examination of the LUCA versions reconstructed with different gain penalties indicates that, even with a gain penalty of 1 (equal weights assigned to a gain and a loss), the set of 572 genes assigned to LUCA might be nearly sufficient to sustain a functioning organism . Under this gain penalty value, the numbers of horizontal gene transfer and gene loss events are nearly identical . This result holds true for two alternative topologies of the species tree and even under random shuffling of the tree . Therefore, the results seem to be compatible with approximately equal likelihoods of HGT and gene loss in the evolution of prokaryotes . CONCLUSIONS: The notion that gene loss and HGT are major aspects of prokaryotic evolution was supported by quantitative analysis of the mapping of the phyletic patterns of COGs onto a hypothetical species tree . Algorithms were developed for constructing parsimonious evolutionary scenarios, which include gene loss and gain events, for orthologous gene sets, given a species tree . This analysis shows, contrary to expectations, that the number of predicted HGT events that occurred during the evolution of prokaryotes might be approximately the same as the number of gene losses . The approach to the reconstruction of evolutionary scenarios employed here is conservative with regard to the detection of HGT because only patterns of gene presence-absence in sequenced genomes are taken into account . In reality, horizontal transfer might have contributed to the evolution of many other genes also, which makes it a dominant force in prokaryotic evolution.

RNA, 2002 Dec, 8(12), 1558 - 71
The influence of viral coding sequences on pestivirus IRES activity reveals further parallels with translation initiation in prokaryotes; Fletcher SR et al.; Classical swine fever virus (CSFV) is a member of the pestivirus family, which shares many features in common with hepatitis C virus (HCV) . It is shown here that CSFV has an exceptionally efficient cis-acting internal ribosome entry segment (IRES), which, like that of HCV, is strongly influenced by the sequences immediately downstream of the initiation codon, and is optimal with viral coding sequences in this position . Constructs that retained 17 or more codons of viral coding sequence exhibited full IRES activity, but with only 12 codons, activity was approximately 66% of maximum in vitro (though close to maximum in transfected BHK cells), whereas with just 3 codons or fewer, the activity was only approximately 15% of maximum . The minimal coding region elements required for high activity were exchanged between HCV and CSFV . Although maximum activity was observed in each case with the homologous combination of coding region and 5' UTR, the heterologous combinations were sufficiently active to rule out a highly specific functional interplay between the 5' UTR and coding sequences . On the other hand, inversion of the coding sequences resulted in low IRES activity, particularly with the HCV coding sequences . RNA structure probing showed that the efficiency of internal initiation of these chimeric constructs correlated most closely with the degree of single-strandedness of the region around and immediately downstream of the initiation codon . The low activity IRESs could not be rescued by addition of supplementary eIF4A (the initiation factor with ATP-dependent RNA helicase activity) . The extreme sensitivity to secondary structure around the initiation codon is likely to be due to the fact that the eIF4F complex (which has eIF4A as one of its subunits) is not required for and does not participate in initiation on these IRESs.

Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi, 1998 Jun, 12(2), 169 - 72
{Cloning, sequencing and expression of hepatitis E virus structural gene in E . coli and application of the recombinant products for diagnosis}; Rong G et al.; The prokaryotic expression vector PEGX-3X was used to express hepatitis E virus (HEV) open reading frame 2(ORF2 402-660) . The recombinant protein was soluble in PBS buffer and was purified by the glutathione Sepharose 4B affinity column . When the purified recombinant protein was applied to detect HEV antibodies in sera of clinical patients, the results were quite consistent with the HEV diagnostic kit from Diagnostic Biotechnology Ltd(DBL), Singapore . The recombinant protein was more reactive with HEV antibodies than DBL reagent.

Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi, 1998 Jun, 12(2), 136 - 8
{High-level expression of human immunodeficiency virus type 1 gp120 protein in E . coli}; Bi L et al.; In order to improve protein expression and to produce good and cheap diagnostic antigen, the gene fragment (560bp) in N-terminal of gp120 of HIV-1 LAV strain was amplified by PCR . After digested by EcoR I and Sal I, the fragment was cloned into a high-level expression vector pET28a . The recombinant plasmid pET/120 transfecting BL21 (DE3) produced the protein with high-level expression in the host cell BL21(DE3), which was further proved having good antigenicity and high specificity by indirect ELISA and Western-blot assay . The protein expressed was about 50% of the total bacterial protein by SDS-PAGE electrophoresis test . It was highly expressed in the prokaryotic expression system.

Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi, 1998 Mar, 12(1), 29 - 32
{Construction of the prokaryotic expression plasmid pYNenv encoding the gp120 env gene of human immunodeficiency virus type 1 of yunnan strain}; Wang B et al.; The recombinant envelope protein of human immunodeficiency virus type 1(HIV-1) of Chinese Yunan epidemic strain was expressed in E . coli for confirming the antigenic domains of the protein . The recombinant prokaryotic expressive plasmid pYNenv was constructed by inserting the env DNA fragment which encode the gp120 of HIV-1 Yunnan strain into pBV220 . The env DNA fragment was obtained by nested polymerase chain reaction with the HIV-1 infected patients peripheral blood macrophage and monocyte genomes from Yunan HIV-1 epidemic area as template . The recombinant plasmid pYNenv was confirmed by restriction enzyme analysis . The recombinant protein was expressed in E . coli DH10b by pYNenv after vibration culture at 30 degrees C for 20 hours then at 42 degrees C for 5 hours and confirmed by SDS-PAGE electrophoresis . The protein can specifically react with the serum of HIV-1 infected patient from Yunan epidemic area by Western blot assay . The result showed that the recombinant protein can be used as antigen for detection of HIV-1 membrane glycoprotein antibody as well as for the further study of the role of envelope protein in pathology.

J Biol Chem, 2003 Apr 18, 278(16), 14299 - 305 Epub 2003 Jan 03.
Cell cycle regulation and p53 activation by protein phosphatase 2C alpha; Ofek P et al.; Protein phosphatase 2C (PP2C) dephosphorylates a broad range of substrates, regulating stress response and growth-related pathways in both prokaryotes and eukaryotes . We now demonstrate that PP2C alpha, a major mammalian isoform, inhibits cell growth and activates the p53 pathway . In 293 cell clones, in which PP2C alpha expression is regulated by a tetracycline-inducible promoter, PP2C alpha overexpression led to G(2)/M cell cycle arrest and apoptosis . Furthermore, PP2C alpha induced the expression of endogenous p53 and the p53-responsive gene p21 . Activation of the p53 pathway by PP2C alpha took place both in cells harboring endogenous p53, as well as in p53-null cells transfected with exogenous p53 . Induction of PP2C alpha resulted in an increase in the overall levels of p53 protein as well as an augmentation of p53 transcription activity . The dephosphorylation activity of PP2C alpha is essential to the described phenomena, as none of these effects was detected when an enzymatically inactive PP2C alpha mutant was overexpressed . p53 plays an important role in PP2C alpha-directed cell cycle arrest and apoptosis because perturbation of p53 expression in human 293 cells by human papillomavirus E6 led to a significant increase in cell survival . The role of PP2C alpha in p53 activation is discussed.

EMBO J, 2003 Jan 15, 22(2), 246 - 51
Regulatable killing of eukaryotic cells by the prokaryotic proteins Kid and Kis; de la Cueva-Mendez G et al.; Plasmid R1 inhibits growth of bacteria by synthesizing an inhibitor of cell proliferation, Kid, and a neutralizing antidote, Kis, which binds tightly to the toxin . Here we report that this toxin and antidote, which have evolved to function in bacteria, also function efficiently in a wide range of eukaryotes . Kid inhibits cell proliferation in yeast, Xenopus laevis and human cells, whilst Kis protects . Moreover, we show that Kid triggers apoptosis in human cells . These effects can be regulated in vivo by modulating the relative amounts of antidote and toxin using inducible eukaryotic promoters for independent transcriptional control of their genes . These findings allow highly regulatable, selective killing of eukaryotic cells, and could be applied to eliminate cancer cells or specific cell lineages in development.

EMBO J, 2003 Jan 15, 22(2), 175 - 82
Termination of translation: interplay of mRNA, rRNAs and release factors?
Kisselev L, Ehrenberg M, Frolova L.
Termination of translation in eukaryotes has focused recently on functional anatomy of polypeptide chain release factor, eRF1, by using a variety of different approaches . The tight correlation between the domain structure and different functions of eRF1 has been revealed . Independently, the role of prokaryotic RF1/2 in GTPase activity of RF3 has been deciphered, as well as RF3 function itself.

Zhongguo Shi Yan Xue Ye Xue Za Zhi, 2002 Dec, 10(6), 508 - 11
{Cloning, expression and biological activity identification of a cDNA encoding the extracellular region of human b7-2}; Yuan ZH et al.; As one important member of B7/CD28/CTLA-4 costimulatory signal pathway, B7-2 molecule plays a critical role in regulating T-cell response . In order to further explore its effects on regulation of T cell activation, proliferation and associated signal pathways, the cDNA encoding extracellular region of human B7-2 was amplified via PCR and subcloned into some prokaryotic expression vectors to express target protein in host strains . The expressed protein was identified with Western blot and MTT . Results showed that after screening, the expression level of the protein of interest attained the yield of over 20% total bacterial protein by using pGEX-4T-2 vector and E . coli BL21 (DE3)-CodonPlus-RIL host cells . The recombinant protein could specially react with B7-2 McAb and could stimulate T-cell proliferation combined with anti-CD3 antibody . In conclusion, the recombinant protein was bioactive, therefore the study will make it possible for the research of relationship between B7-2 structure and its function.

Folia Biol (Praha), 2002, 48(6), 246 - 9
DicodonUse: the programme for dicodon bias visualization in prokaryotes; Paces J et al.; The DicodonUse programme is aimed at a fast and simple assessment of genes present in prokaryotic nucleotide sequences . It identifies open reading frames that are not genes, and it distinguishes the genes that inherently belong to the genome in question from the genes that were inserted into the genome in the course of evolution . The programme is based on frequencies of dicodons used by the organism.

J Bacteriol, 2003 Jan, 185(2), 654 - 9
A cka-gfp transcriptional fusion reveals that the colicin K activity gene is induced in only 3 percent of the population; Mulec J et al.; In prokaryotes, only a few examples of differential gene expression in cell populations have been described . Colicin production in natural populations of Escherichia coli, while providing a competitive advantage in the natural habitat, also leads to lysis of the toxin-producing cell . Colicin K synthesis has been found to be induced due to an increase in ppGpp (I . Kuhar, J . P . van Putten, D . Zgur-Bertok, W . Gaastra, and B . J . Jordi, Mol . Microbiol . 41:207-216) . Using two transcriptional fusions, cka-gfp and cki-gfp, we show that at the single-cell level, the colicin K activity gene cka is expressed in only 3% of the bacterial population upon induction by nutrient starvation . In contrast, the immunity gene cki is expressed in the large majority of the cells . Expression of the cka-gfp fusion in a lexA-defective strain and in a relA spoT mutant strain indicates that differential expression of cka is established primarily at the level of transcription.

J Bacteriol, 2003 Jan, 185(2), 475 - 81
Combinatorial redesign of the DNA binding specificity of a prokaryotic helix-turn-helix repressor; Fromknecht K et al.; Redesign of the bacteriophage 434 Cro repressor was accomplished by using an in vivo genetic screening system to identify new variants that specifically bound previously unrecognized DNA sequences . Site-directed, combinatorial mutagenesis of the 434 Cro helix-turn-helix (HTH) motif generated libraries of new variants which were screened for binding to new target sequences . Multiple mutations of 434 Cro that functionally converted wild-type (wt) 434 Cro DNA binding-sequence specificity to that of a lambda bacteriophage-specific repressor were identified . The libraries contained variations within the HTH sequence at only three positions . In vivo and in vitro analysis of several of the identified 434 Cro variants showed that the relatively few changes in the recognition helix of the HTH motif of 434 Cro resulted in specific and tight binding of the target DNA sequences . For the best 434 Cro variant identified, an apparent K(d) for lambda O(R)3 of 1 nM was observed . In competition experiments, this Cro variant was observed to be highly selective . We conclude that functional 434 Cro repressor variants with new DNA binding specificities can be generated from wt 434 Cro by mutating just the recognition helix . Important characteristics of the screening system responsible for the successful identifications are discussed . Application of the techniques presented here may allow the identification of DNA binding protein variants that functionally affect DNA regulatory sequences important in disease and industrial and biotechnological processes.

Plant Cell, 2003 Jan, 15(1), 195 - 205
Unique architecture of the plastid ribosomal RNA operon promoter recognized by the multisubunit RNA polymerase in tobacco and other higher plants; Suzuki JY et al.; Expression of the plastid rRNA operon (rrn) during development is highly regulated at the level of transcription . The plastid rrn operon in most higher plants is transcribed by the plastid-encoded RNA polymerase (PEP), the multisubunit plastid RNA polymerase from PrrnP1, a sigma(70)-type promoter with conserved -10 and -35 core promoter elements . To identify functionally important sequences, the tobacco PrrnP1 was dissected in vivo and in vitro . Based on in vivo deletion analysis, sequences upstream of nucleotide -83 do not significantly contribute to promoter function . The in vitro analyses identified an essential hexameric sequence upstream of the -35 element (GTGGGA; the rRNA operon upstream activator {RUA}) that is conserved in monocot and dicot species and suggested that the -10 element plays only a limited role in PrrnP1 recognition . Mutations in the initial transcribed sequence (+9 to +14) enhanced transcription, the characteristic of strong promoters in prokaryotes . We propose that sigma interaction with the -10 element in PrrnP1 is replaced in part by direct PEP-RUA (protein-DNA) interaction or by protein-protein interaction between the PEP and an RUA binding transcription factor.

DNA Repair (Amst), 2002 Jul 17, 1(7), 517 - 29
A novel human DNA glycosylase that removes oxidative DNA damage and is homologous to Escherichia coli endonuclease VIII; Bandaru V et al.; Prokaryotes and lower eukaryotes possess redundant activities that remove the plethora of oxidative DNA base damages produced during normal oxidative metabolism and which have been associated with cancer and aging . Thus far, only one oxidized pyrimidine-specific DNA glycosylase has been identified in humans, hNthl . Here, we report the identification of three new putative human DNA glycosylases that are phylogenetically members of the Fpg/Nei family primarily found in the bacterial kingdom . We have characterized one of these, hNEI1, and show it to be functionally homologous to bacterial Nei, that is, its principal substrates are oxidized pyrimidines, it undergoes a lyase reaction by, beta,delta-elimination and traps a Schiff base with a substrate containing thymine glycol (Tg) . Furthermore, inactivation of active site residues shown to be important in Escherichia coli Nei inactivate the human enzyme . The hNEI1 gene is located on the long arm of chromosome 15 that is frequently deleted in human cancers .

Ai Zheng, 2002 Sep, 21(9), 957 - 60
{Prokaryotic expression of endostatin and preparation of polyclonal antibody}; Zhang YM et al.; BACKGROUND & OBJECTIVE: The aim of this study was to express and purify human endostatin and to prepare polyclonal antibody of mouse anti-human endostatin . METHODS: The cDNA of endostatin was amplified by PCR, then recombined into prokaryotic expression vector and transformed into Escherichia coli BL21 for expression; the mice were immunized with purified products . RESULTS: Prokaryotic expression vector pQE-30 of human endostatin was successfully constructed; the expression product was gained after pQE-30 was transferred into BL21 . After purified by Ni affinity chromatography, the product was identified to be a single component by SDS-PAGE . Western blot analysis showed that high titer mouse anti-human endostatin polyclonal antibody was successfully prepared . CONCLUSION: Highly purified expression product and prepared polyclonal antibody provide the necessary material for further study.

Biochim Biophys Acta, 2003 Jan 10, 1609(1), 115 - 25
The general protein secretory pathway: phylogenetic analyses leading to evolutionary conclusions; Cao TB et al.; We have identified all homologues in the current databases of the ubiquitous protein constituents of the general secretory (Sec) pathway . These prokaryotic/eukaryotic proteins include (1) SecY/Sec61alpha, (2) SecE/Sec61gamma, (3) SecG/Sec61beta, (4) Ffh/SRP54 and (5) FtsY/SRP receptor subunit-alpha . Phylogenetic and sequence analyses lead to major conclusions concerning (1) the ubiquity of these proteins in living organisms, (2) the topological uniformity of some but not other Sec constituents, (3) the orthologous nature of almost all of them, (4) a total lack of paralogues in almost all organisms for which complete genome sequences are available, (5) the occurrence of two or even three paralogues in a few bacteria, plants, and yeast, depending on the Sec constituent, and (6) a tremendous degree of sequence divergence in bacteria compared with that in archaea or eukaryotes . The phylogenetic analyses lead to the conclusion that with a few possible exceptions, the five families of Sec constituents analyzed generally underwent sequence divergence in parallel but at different characteristic rates . The results provide evolutionary insights as well as guides for future functional studies . Because every organism with a fully sequenced genome exhibits at least one orthologue of each of these Sec proteins, we conclude that all living organisms have relied on the Sec system as their primary protein secretory/membrane insertion system . Because most prokaryotes and many eukaryotes encode within their genomes only one of each constituent, we also conclude that strong evolutionary pressure has minimized gene duplication events leading to the establishment of Sec paralogues . Finally, the sequence diversity of bacterial proteins as compared with their archaeal and eukaryotic counterparts is in agreement with the suggestion that bacteria were the evolutionary predecessors of archaea and eukaryotes.

Biochem Biophys Res Commun, 2003 Jan 17, 300(3), 725 - 30
Molecular cloning, expression, and functional characterization of a novel zebrafish cytosolic sulfotransferase; Sugahara T et al.; By searching the zebrafish expressed sequence tag (EST) database, we have identified a cDNA clone encoding a putative zebrafish cytosolic sulfotransferase (ST) . This cDNA was isolated and subjected to nucleotide sequencing . Analysis of the sequence data revealed that this novel zebrafish ST displays 32-35% amino acid sequence identity to members of all major cytosolic ST gene families . Therefore, this zebrafish ST, while belonging to the cytosolic ST gene superfamily, appears to be independent from all known constituent ST gene families . Recombinant zebrafish ST, expressed using the pET23c prokaryotic expression vector and purified from transformed Escherichia coli cells, migrated as a 34-kDa protein upon sodium dodecyl sulfate-polyacrylamide gel electrophoresis . Purified zebrafish ST displayed sulfating activities toward dopamine and thyroid hormones (T(3) and T(4)), with a pH optimum spanning 7-9 . The enzyme also exhibited activities toward a number of xenobiotics including some flavonoids, isoflavonoids, and other phenolic compounds . A thermostability experiment revealed the enzyme to be relatively stable over a temperature range between 20 and 48 degrees C . Among 10 divalent metal cations tested, Fe(++), Hg(++), Co(++), Zn(++), Cu(++), and Cd(++) exhibited dramatic inhibitory effects on the activity of the enzyme . These results constitute a first study on the cloning, expression, and characterization of a zebrafish cytosolic ST.

Virology, 2003 Jan 5, 305(1), 31 - 43
A shine-dalgarno-like sequence mediates in vitro ribosomal internal entry and subsequent scanning for translation initiation of coxsackievirus B3 RNA; Yang D et al.; Translation initiation of coxsackievirus B3 (CVB3) RNA is directed by an internal ribosome entry site (IRES) within the 5' untranslated region . However, the details of ribosome-template recognition and subsequent translation initiation are still poorly understood . In this study, we have provided evidence to support the hypothesis that 40S ribosomal subunits bind to CVB3 RNA via basepairing with 18S rRNA in a manner analogous to that of the Shine-Dalgarno (S-D) sequence in prokaryotic systems . We also identified a new site within both the 18S rRNA and the polpyrimidine-tract sequence of the IRES that allows them to form stronger sequence complementation . All these data were obtained from in vitro translation experiments using mutant RNAs containing either an antisense IRES core sequence at the original position or site-directed mutations or deletions in the polypyrimidine tract of the IRES . The mutations significantly reduced translation efficiency but did not abolish protein synthesis, suggesting that the S-D-like sequence is essential, but not sufficient for ribosome binding . To determine how ribosomes reach the initiation codon after internal entry, we created additional mutants: when the authentic initiation codon at nucleotide (nt) 742 was mutated, a 180-nt downstream in-frame AUG codon at nt 922 is able to produce a truncated smaller protein . When this mutation was introduced into the full-length cDNA of CVB3, the derived viruses were still infectious . However, their infectivity was much weaker than that of the wild-type CVB3 . In addition, when a stable stem-loop was inserted upstream of the initiation codon in the bicistronic RNA, translation was strongly inhibited . These data suggest that ribosomes reach the initiation codon from the IRES likely by scanning along the viral RNA.

Int Microbiol, 2002 Dec, 5(4), 195 - 200 Epub 2002 Aug 22.
Studying marine microorganisms from space; Pedros-Alio C et al.; Microorganisms are but a few micrometers in diameter and are not visible to the naked eye . Yet, the large numbers of microorganisms present in the oceans and the global impact of their activities make it possible to observe them from space . Here a few examples of how microorganisms can be studied from satellites are presented . The first case is the best known: the main pigment used in photosynthesis (chlorophyll a) can be determined from satellites . These kinds of studies have contributed a tremendous amount of understanding about the distribution and dynamics of primary production in the oceans . Two other examples will concern analysis of heterotrophic prokaryotic production and estimates of dimethyl sulfide (DMS) concentration and flux to the atmosphere . These three processes are of fundamental importance for the functioning of the biosphere . Marine microbes carry out about half of the total primary production in the planet . A substantial fraction of the respiration in the oceans is due to the activity of heterotrophic prokaryotes . Finally, the flux of DMS to the atmosphere is believed to constitute one of the mechanisms by which the biota can regulate climate . The global implications of microbial processes in the oceans can only be addressed with the help of satellites.

J Biol Chem, 2003 Mar 7, 278(10), 8804 - 8 Epub 2002 Dec 21.
Aspartate dehydrogenase, a novel enzyme identified from structural and functional studies of TM1643; Yang Z et al.; The open reading frame TM1643 of Thermotoga maritima belongs to a large family of proteins, with homologues in bacteria, archaea, and eukaryotes . TM1643 is found in an operon with two other genes that encode enzymes involved in the biosynthesis of NAD . In several bacteria, the gene in the position occupied by TM1643 encodes an aspartate oxidase (NadB), which synthesizes iminoaspartate as a substrate for NadA, the next enzyme in the pathway . The amino acid sequence of TM1643 does not share any recognizable homology with aspartate oxidase or with other proteins of known functions or structures . To help define the biological functions of TM1643, we determined its crystal structure at 2.6A resolution and performed a series of screens for enzymatic function . The structure reveals the presence of an N-terminal Rossmann fold domain with a bound NAD(+) cofactor and a C-terminal alpha+beta domain . The structural information suggests that TM1643 may be a dehydrogenase and the active site of the enzyme is located at the interface between the two domains . The enzymatic characterization of TM1643 revealed that it possesses NAD or NADP-dependent dehydrogenase activity toward l-aspartate but no aspartate oxidase activity . The product of the aspartate dehydrogenase activity is also iminoaspartate . Therefore, our studies demonstrate that two different enzymes, an oxidase and a dehydrogenase, may have evolved to catalyze the first step of NAD biosynthesis in prokaryotes . TM1643 establishes a new class of amino acid dehydrogenases.

J Biol Chem, 2003 Mar 7, 278(10), 7949 - 55 Epub 2002 Dec 18.
Delineation of the hydroxyapatite-nucleating domains of bone sialoprotein; Tye CE et al.; Bone sialoprotein (BSP) is a highly modified, anionic phosphoprotein that is expressed almost exclusively in mineralizing connective tissues and has been shown to be a potent nucleator of hydroxyapatite (HA) . Two polyglutamic acid (poly{E}) regions, predicted to be in an alpha-helical conformation and located in the amino-terminal half of the molecule, are believed to be responsible for this activity . Using a prokaryotic expression system, full-length rat BSP was expressed and tested for HA nucleating activity in a steady-state agarose gel system . The unmodified protein is less potent than native bone BSP, indicating a role for the post-translational modifications in HA nucleation . Site-directed mutagenesis of the poly{E} regions in full-length BSP was performed, replacing the poly{E} with either polyaspartic acid (poly{D}) or polyalanine (poly{A}) to examine role of charge and conformation, respectively, in HA nucleation . Replacement of single domains with either poly{A} or poly{D} did not alter nucleating activity nor did replacement of both domains with poly{D} . Replacement of both domains with poly{A}, however, significantly decreased nucleating activity . In addition, two recombinant peptides, each encompassing one of the two poly{E} domains, were expressed and tested for nucleating activity . Whereas the peptide encompassing the second poly{E} domain was capable of nucleating HA, the first domain peptide showed no activity . The conformation of the wild-type and mutated proteins and peptides were studied by circular dichroism and small angle x-ray scattering, and no secondary structure was evident . These results demonstrate that a sequence of at least eight contiguous glutamic acid residues is required for the nucleation of HA by BSP and that this nucleating "site" is not alpha-helical in conformation.

Nucleic Acids Res, 2002 Dec 15, 30(24), 5382 - 90
Comparative analysis of ribosomal proteins in complete genomes: an example of reductive evolution at the domain scale; Lecompte O et al.; A comprehensive investigation of ribosomal genes in complete genomes from 66 different species allows us to address the distribution of r-proteins between and within the three primary domains . Thirty-four r-protein families are represented in all domains but 33 families are specific to Archaea and Eucarya, providing evidence for specialisation at an early stage of evolution between the bacterial lineage and the lineage leading to Archaea and Eukaryotes . With only one specific r-protein, the archaeal ribosome appears to be a small-scale model of the eukaryotic one in terms of protein composition . However, the mechanism of evolution of the protein component of the ribosome appears dramatically different in Archaea . In Bacteria and Eucarya, a restricted number of ribosomal genes can be lost with a bias toward losses in intracellular pathogens . In Archaea, losses implicate 15% of the ribosomal genes revealing an unexpected plasticity of the translation apparatus and the pattern of gene losses indicates a progressive elimination of ribosomal genes in the course of archaeal evolution . This first documented case of reductive evolution at the domain scale provides a new framework for discussing the shape of the universal tree of life and the selective forces directing the evolution of prokaryotes.

Chin Med J (Engl), 2002 Oct, 115(10), 1465 - 9
Cloning of cDNA encoding Schistosoma japonicum tropomyosin and its expression in Escherichia coli; Cao J et al.; OBJECTIVE: To perform cloning of the gene encoding Chinese Schistosoma japonicum tropomyosin (SjcTM) and its expression in Escherichia coli . METHODS: SjcTM cDNA fragment, except for 14 amino acids at the amino terminus, was obtained by reverse transcriptase-polymerase chain reaction (RT-PCR) with total RNA extracted from adult worms of S . japonicum . The RT-PCR product was cloned into T vector and sequenced . The SjcTM cDNA, derived from the constructed TA clone pGEM-SjcTM, was then subcloned into the expressing vector pBV220 . After characterization by agarose gel electrophoresis, endonucleases digestion and PCR, the resultant recombinant plasmid was used for expression under the temperature-dependent condition . RESULTS: The RT-PCR product, cloned into a T vector, was sequenced and shown to be 96.5% identical at the nuclei acid level and 98.1% identical in deduced amino acid sequence to that of S . mansoni tropomyosin . The target DNA fragment was then subcloned into a prokaryotic vector pBV220 . Induced expression in E . coli DH5alpha cells resulted in a constant level of recombinant protein production . The results of SDS-PAGE and Western blot revealed that the molecular weight of non-fusion recombinant protein (rSjcTM) was approximately 32 kDa and could be recognized specifically by a polyclonal antiserum specific for native S . japonicum tropomyosin (SjcTM) . CONCLUSION: The engineering of the cDNA encoding S . japonicum tropomyosin and its bacterial expression was successfully made.

Biol Cell, 2002 Sep, 94(4-5), 243 - 9
Elemental characterization of microorganism granules by EFTEM in the tube wall of a deep-sea vent invertebrate; Lechaire JP et al.; Microorganisms colonizing the exoskeletons of the tube worm Riftia pachyptila are described at the ultrastructural level . The prokaryotic cells from the worm tube wall differ from those colonizing the exoskeleton outer surface in the presence of an electron dense granule . The morphology and distribution of these bacteria-like cells are described . Prokaryotic organisms are assembled in nodules which increased in size in the oldest part of the exoskeleton . The aspect, location and elemental composition of the intracellular granules are determined . Most of them (100 nm in diameter) are located close to the cell membrane and exhibit a homogeneous and amorphous content . EDX and EFTEM microanalyses show that these structures contain phosphorus, oxygen and iron . All together these data suggest that these granules are iron polyphosphates . These structures may act as energy sources for making ATP during anoxic conditions as existing in hydrothermal environments.

Environ Mol Mutagen, 2002, 40(4), 266 - 76
Evaluation of the clastogenic, DNA intercalative, and topoisomerase II-interactive properties of bioflavonoids in Chinese hamster V79 cells; Snyder RD et al.; Bioflavonoids are naturally occurring polyphenols with intriguing and varied therapeutic and chemoprotective activities generally ascribed to their antioxidant properties . However, many flavonoids have also been shown to be genotoxic in a variety of prokaryotic, eukaryotic, and in vivo systems . The mechanistic basis for this genotoxicity has not been fully elucidated, although structure-activity relationship studies have identified requisite flavonoid structural features . We utilized Chinese hamster V79 cells to evaluate the relationships between DNA intercalation ability, topoisomerase II interactions, reactive oxygen species (ROS) generation, and clastogenicity in a series of 14 bioflavonoids . Five of the flavonoids examined, luteolin, quercetin, genistein, apigenin, and acacetin, were strongly clastogenic . This clastogenicity was shown to require DNA intercalation (with the exception of genistein) and was substantially reduced by catalytic inhibitors of DNA topoisomerase II . The transition metals Cu(II) and Mn(II) formed chelates with and/or modified the structure and biological activity of some flavonoids but no consistent relationship could be demonstrated between metal reactivity and clastogenicity . There was no clear association between generation of ROS and clastogenicity . The data presented herein are consistent with a model in which the genotoxicity of most flavonoids arises via DNA intercalation and topo II poisoning, likely mediated through metabolism to flavonoid quinones . Interestingly, other flavonoids such as myricetin, daidzein, baicalein, fisetin, and galangin were catalytic topo II inhibitors, rather than poisons . These studies further validate the use of cell-based approaches for detecting drug/topo II interactions and raise interesting questions relating to biological and chemical mechanisms of flavonoids .

J Mol Biol, 2003 Jan 10, 325(2), 259 - 74
Characterization of the ABCA transporter subfamily: identification of prokaryotic and eukaryotic members, phylogeny and topology; Peelman F et al.; An alignment of the mammalian ABCA transporters enabled the identification of sequence segments, specific to the ABCA subfamily, which were used as queries to search for eukaryotic and prokaryotic homologues . Thirty-seven eukaryotic half and full-length transporters were found, and a close relationship with prokaryotic subfamily 7 transporters was detected . Each half of the ABCA full-transporters is predicted to comprise a membrane-spanning domain (MSD) composed of six helices and a large extracellular loop, followed by a nucleotide-binding domain (NBD) and a conserved cytoplasmic 80-residue sequence, which might have a regulatory function . The topology predicted for the ABCA transporters was compared to the crystal structures of the MsbA and BtuCD bacterial transporters . The alignment of the MSD and NBD domains provided an estimate of the degree of residue conservation in the cytoplasmic, extracellular and transmembrane domains of the ABCA transporter subfamily . The phylogenic tree of eukaryotic ABCA transporters based upon the NBD sequences, consists of three major clades, corresponding to the half-transporter single NBDs and to the full-transporter NBDls and NBD2s . A phylogenic tree of prokaryotic transporters and the eukaryotic ABCA transporters confirmed the evolutionary relationship between prokaryotic subfamily 7 transporters and eukaryotic ABCA half and full-transporters.

DNA Seq, 2002 Aug, 13(4), 195 - 202
Cloning and prokaryotic expression of a salt-induced cDNA encoding a chloroplastic fructose-1,6-diphosphate aldolase in Dunaliella salina (Chlorophyta); Zhang XN et al.; A salt-induced fructose-1,6-diphosphate (FDP) aldolase cDNA (DsALDP) in Dunaliella salina was cloned by suppression subtractive hybridization (SSH) and rapid amplification of cDNA ends (RACE) techniques . Sequence analysis of DsALDP revealed that the 1520 bp cDNA had an open reading frame (ORF) of 327 amino acid residues . BLAST Search showed that DsALDP shared an amino acid identity (73-66%) with AldP in other plants . Alignment with homologues in other plants indicated that all the conserved substrate-specific binding sites could also be found in DsALDP . Phylogenetic analysis further confirmed the deduced amino acid sequence of the D . salina DsALDP gene belonged to the same subfamily to AldP of other green algae . Southern blot analysis suggested possible presence of the D . salina DsALDP gene as a few copies and Northern blot analysis confirmed salt-induced expression pattern at the transcriptional level . A 62 kDa fusion protein generated by adding a Trx-His.tag at the N-terminal of DsALDP was induced by IPTG in Escherichia coli BL21 . An improvement of salt tolerance in E . coli expressing DsALDP fusion protein was observed.

EMBO J, 2002 Dec 16, 21(24), 6935 - 43
F-actin-like filaments formed by plasmid segregation protein ParM; van den Ent F et al.; It was the general belief that DNA partitioning in prokaryotes is independent of a cytoskeletal structure, which in eukaryotic cells is indispensable for DNA segregation . Recently, however, immunofluorescence microscopy revealed highly dynamic, filamentous structures along the longitudinal axis of Escherichia coli formed by ParM, a plasmid-encoded protein required for accurate segregation of low-copy-number plasmid R1 . We show here that ParM polymerizes into double helical protofilaments with a longitudinal repeat similar to filamentous actin (F-actin) and MreB filaments that maintain the cell shape of non-spherical bacteria . The crystal structure of ParM with and without ADP demonstrates that it is a member of the actin family of proteins and shows a domain movement of 25 degrees upon nucleotide binding . Furthermore, the crystal structure of ParM reveals major differences in the protofilament interface compared with F-actin, despite the similar arrangement of the subunits within the filaments . Thus, there is now evidence for cytoskeletal structures, formed by actin-like filaments that are involved in plasmid partitioning in E.coli.

Zhonghua Zhong Liu Za Zhi, 2002 Sep, 24(5), 448 - 50
{Cloning, purification and biological activity of human vascular endothelial growth factor fragment in E . coli}; Li X et al.; OBJECTIVE: To observe the effect of human vascular endothelial growth factor (VEGF) fragment (3 approximately 4 exon) in E . coli on anti-angiogenesis . METHODS: Through RT-PCR amplification, endonuclease cut and DNA sequence analysis identification, hVEGF fragment cDNA was inserted into E . coli expression vector pTrcHis2A . The prokaryotic expression plasmid pTrcHis2A/VEGF(3 approximately 4) was constructed and transformed into TOP10F . RESULTS: After 8hr isopropy-beta-D-thiogalactoside (IPTG) induction, VEGF fragment was expressed in 15% of total proteins through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) . The expressed protein was highly antigenic and specific . The VEGF fragment was further purified by affinity, which could inhibit HUVEC proliferation and neovascularization of the chick chorioallantoic membrane . CONCLUSION: VEGF fragment is anti-angiogenetic, which may potentially be used in oncologico-biological targeting therapy.

Biochemistry, 2002 Dec 24, 41(51), 15342 - 9
Extended conformation of mammalian translation elongation factor 1A in solution; Budkevich TV et al.; The conformation of mammalian elongation factor eEF1A in solution was examined by the small angle neutron scattering and scanning microcalorimetry . We have found that in contrast to the bacterial analogue the eEF1A molecule has no fixed rigid structure in solution . The radius of gyration of the eEF1A molecule (5.2 nm) is much greater than that of prokaryotic EF1A . The specific heat of denaturation is considerably lower for eEF1A than for EF1A, suggesting that the eEF1A conformation is significantly more disordered . Despite its flexible conformation, eEF1A is found to be highly active in different functional tests . According to the neutron scattering data, eEF1A becomes much more compact in the complex with uncharged tRNA . The absence of a rigid structure and the possibility of large conformational change upon interaction with a partner molecule could be important for eEF1A functioning in channeled protein synthesis and/or for the well-known capability of the protein to interact with different ligands besides the translational components.

Mol Cell Biol, 2003 Jan, 23(1), 414 - 23
A novel domain within the DEAD-box protein DP103 is essential for transcriptional repression and helicase activity; Yan X et al.; Members of the DEAD-box family of helicases, distinguished by a core characteristic sequence of Asp-Glu-Ala-Asp, are expressed in a wide range of prokaryotes and eukaryotes and exhibit diverse cellular functions, including DNA transcription, recombination and repair, RNA processing, translation, and posttranslational regulation . Although ubiquitous, the function of most DEAD-box proteins is unknown . We and others have recently cloned DP103, which harbors conserved DEAD-box, helicase, and ATPase domains in its N terminus . DP103 (also termed Gemin3 and DDX20) interacts with SF-1, SMN, EBNA2, and EBNA3C in mammalian cells . Here we demonstrate that a discrete domain within the nonconserved C-terminal region of DP103 directly interacts with SF-1 . This domain exhibits an autonomous repression function and is necessary and sufficient for repressing the transcriptional activity of SF-1 . Furthermore, intact DP103 exhibits helicase activity . Importantly, the C-terminal domain is obligatory but not sufficient for this unwinding activity of DP103 . Together, our results support a novel paradigm for transcriptional repression and demonstrate the bifunctional role of the C-terminal domain of DP103.

Curr Opin Biotechnol, 2002 Dec, 13(6), 557 - 64
Biotransformations using prokaryotic P450 monooxygenases; Urlacher V et al.; Recent studies on microbial cytochrome P450 enzymes have covered several new areas . Advances have been made in structure-function analysis and new non-enzymatic/electrochemical systems for the replacement of NAD(P)H in biocatalysis have been developed . Furthermore, the properties of some enzymes have been re-engineered by site-directed mutagenesis or by methods of directed evolution and new P450s have been functionally expressed and characterized . It is thought that a combination of these approaches will facilitate the use of isolated P450 monooxygenases in biocatalysis.

Cell Stress Chaperones, 2002 Jul, 7(3), 250 - 7
Hsp70 expression in thermally stressed Ostrea edulis, a commercially important oyster in Europe; Piano A et al.; Synthesis of heat shock proteins (Hsps) in response to elevated temperatures and other denaturing agents is a common feature of prokaryotic and eukaryotic cells . The heat-induced expression of Hsp70 family members in the gills and mantle of Ostrea edulis, a highly valued fisheries resource inhabiting primarily estuarine environments, has been studied . O edulis is exposed to a variety of natural and anthropogenic stresses in the environment . Two isoforms of about 72 kDa and 77 kDa were constitutively present in unstressed organisms, reflecting the housekeeping function performed by these proteins under normal circumstances . Their expression in animals undergoing thermal stress was highly variable, and on the average, little change occurred under different experimental conditions . A third isoform of about 69 kDa was induced in both tissues after exposure to > or = 32 degrees C; its synthesis was detected within 4 hours of poststress recovery at 15 degrees C, reaching the maximum expression after 24 hours in the gills and after 48 hours in the mantle and declining thereafter . Hsp69 expression was low at 38 degrees C, a temperature lethal for about 50% of the individuals tested . Densitometric analysis of Western blots revealed that Hsp69 was mostly responsible for the significant heat-induced overexpression of Hsp70s in O edulis . Comparison with heat shock responses in tissues of Crassostrea gigas indicated a similar pattern of Hsp70 expression . In this organism, however, Hsp69 was induced after exposure to > or = 38 degrees C . We conclude that tissue expression of Hsp69 in O edulis, and possibly other bivalves, is an early sign of thermal stress; determining whether these changes also correlate with other major environmental stresses is the goal of ongoing studies.

Plant Physiol, 2002 Dec, 130(4), 2019 - 26
Molecular characterization of an Arabidopsis acyl-coenzyme a synthetase localized on glyoxysomal membranes; Hayashi H et al.; In higher plants, fat-storing seeds utilize storage lipids as a source of energy during germination . To enter the beta-oxidation pathway, fatty acids need to be activated to acyl-coenzyme As (CoAs) by the enzyme acyl-CoA synthetase (ACS; EC 6.2.1.3) . Here, we report the characterization of an Arabidopsis cDNA clone encoding for a glyoxysomal acyl-CoA synthetase designated AtLACS6 . The cDNA sequence is 2,106 bp long and it encodes a polypeptide of 701 amino acids with a calculated molecular mass of 76,617 D . Analysis of the amino-terminal sequence indicates that acyl-CoA synthetase is synthesized as a larger precursor containing a cleavable amino-terminal presequence so that the mature polypeptide size is 663 amino acids . The presequence shows high similarity to the typical PTS2 (peroxisomal targeting signal 2) . The AtLACS6 also shows high amino acid identity to prokaryotic and eukaryotic fatty acyl-CoA synthetases . Immunocytochemical and cell fractionation analyses indicated that the AtLACS6 is localized on glyoxysomal membranes . AtLACS6 was overexpressed in insect cells and purified to near homogeneity . The purified enzyme is particularly active on long-chain fatty acids (C16:0) . Results from immunoblot analysis revealed that the expression of both AtLACS6 and beta-oxidation enzymes coincide with fatty acid degradation . These data suggested that AtLACS6 might play a regulatory role both in fatty acid import into glyoxysomes by making a complex with other factors, e.g . PMP70, and in fatty acid beta-oxidation activating the fatty acids.

FEMS Microbiol Lett, 2002 Dec 17, 217(2), 249 - 54
Establishment of uncharacterized plasmids in Escherichia coli by in vitro transposition; Agron PG et al.; We present a simple approach that permits any circular plasmid, such as uncharacterized plasmids from diverse prokaryotes, to be established in Escherichia coli, thereby facilitating subsequent structural and functional studies . An in vitro transposition reaction is used to introduce a well-characterized replicon and selectable marker into purified plasmids, which are then used to transform E . coli . The approach was demonstrated using a small 3.4-kb archaeal plasmid and a large 60-kb uncharacterized plasmid from a Gram-negative bacterium . Replicon function in E . coli was tested for each plasmid, and direct sequencing of the large plasmid revealed similarity to restriction-modification systems .

FEMS Microbiol Lett, 2002 Dec 17, 217(2), 155 - 65
Genomic analysis of protein kinases, protein phosphatases and two-component regulatory systems of the cyanobacterium Anabaena sp . strain PCC 7120; Wang L et al.; Anabaena sp . PCC 7120 is a cyanobacterium capable of performing several important biological functions: photosynthesis, nitrogen fixation, cell differentiation, cell-cell communication, etc . These activities require an extensive signaling capability in order to respond to the changing environment . Based on the genomic data, we have retrieved several gene families encoding signaling components . It is estimated that 211 genes encode two-component signaling elements, and 66 genes encode Ser/Thr kinases and phosphatases . These genes together represent 4.2% of the coding capacity of the whole genome, making Anabaena PCC 7120 a leading member among prokaryotes in terms of its signaling potential . It is known that two-component systems are composed of a few basic modules that can arrange into different structures best adapted for each signaling system . Many proteins in Anabaena PCC 7120 have incorporated both modules of two-component systems and catalytic domains of either Ser/Thr kinases or phosphatases . A family of 13 genes encode proteins with both a Ser/Thr kinase domain and a His kinase domain, and another four genes were also found whose products have both a response regulator domain and a Ser/Thr phosphatase domain . Of all the signaling proteins in Anabaena PCC 7120, about one third (35%) are conserved in the genome of the unicellular cyanobacterium strain Synechocystis sp . PCC 6803 . Interestingly, one subfamily of His kinases and two subfamilies of response regulators are found in Anabaena PCC 7120 but are absent in Synechocystis PCC 6803 . This study constitutes a basis for analyses of signal transduction in Anabaena PCC 7120 using functional genomic approaches .

Int J Biochem Cell Biol, 2003 Feb, 35(2), 203 - 11
The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins; Tchorzewski M et al.; The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells . In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached to the ribosome through the P0 protein . The "stalk" is essential for the ribosome activity, taking part in the interaction with elongation factors.In this report, we have shown that the subcellular distribution of the human P proteins does not fall into standard behavior of regular ribosomal proteins . We have used two approaches to assess the distribution of the P proteins, in vivo experiments with GFP fusion proteins and in vitro one with anti-P protein antibodies . In contrast to standard r-proteins, the P1 and P2 proteins are not actively transported into the nucleus compartment, remaining predominantly in the cytoplasm (the perinuclear compartment) . The P0 protein was found in the cytoplasm, as well as in the nucleus; however, the nucleoli were excluded . This protein was scattered around the nuclei, and the distribution might reflect association with the so-called nuclear bodies . This is the first example of r-proteins that are not actively transported into the nucleus; moreover, this might imply that the "stalk" constituents are assembled onto the ribosomal particle at the very last step of ribosomal maturation, which takes part in the cell cytoplasm.

J Virol, 2003 Jan, 77(1), 123 - 34
A direct transposon insertion tool for modification and functional analysis of viral genomes; Vilen H et al.; Advances in DNA transposition technology have recently generated efficient tools for various types of functional genetic analyses . We demonstrate here the power of the bacteriophage Mu-derived in vitro DNA transposition system for modification and functional characterization of a complete bacterial virus genome . The linear double-stranded DNA genome of Escherichia coli bacteriophage PRD1 was studied by insertion mutagenesis with reporter mini-Mu transposons that were integrated in vitro into isolated genomic DNA . After introduction into bacterial cells by electroporation, recombinant transposon-containing virus clones were identified by autoradiography or visual blue-white screening employing alpha-complementation of E . coli beta-galactosidase . Additionally, a modified transposon with engineered NotI sites at both ends was used to introduce novel restriction sites into the phage genome . Analysis of the transposon integration sites in the genomes of viable recombinant phage generated a functional map, collectively indicating genes and genomic regions essential and nonessential for virus propagation . Moreover, promoterless transposons defined the direction of transcription within several insert-tolerant genomic regions . These strategies for the analysis of viral genomes are of a general nature and therefore may be applied to functional genomics studies in all prokaryotic and eukaryotic cell viruses.

Eukaryot Cell, 2002 Dec, 1(6), 847 - 55
Cellulose synthase (CesA) genes in the green alga Mesotaenium caldariorum; Roberts AW et al.; Cellulose, a microfibrillar polysaccharide consisting of bundles of beta-1,4-glucan chains, is a major component of plant and most algal cell walls and is also synthesized by some prokaryotes . Seed plants and bacteria differ in the structures of their membrane terminal complexes that make cellulose and, in turn, control the dimensions of the microfibrils produced . They also differ in the domain structures of their CesA gene products (the catalytic subunit of cellulose synthase), which have been localized to terminal complexes and appear to help maintain terminal complex structure . Terminal complex structures in algae range from rosettes (plant-like) to linear forms (bacterium-like) . Thus, algal CesA genes may reveal domains that control terminal complex assembly and microfibril structure . The CesA genes from the alga Mesotaenium caldariorum, a member of the order Zygnematales, which have rosette terminal complexes, are remarkably similar to seed plant CesAs, with deduced amino acid sequence identities of up to 59% . In addition to the putative transmembrane helices and the D-D-D-QXXRW motif shared by all known CesA gene products, M . caldariorum and seed plant CesAs share a region conserved among plants, an N-terminal zinc-binding domain, and a variable or class-specific region . This indicates that the domains that characterize seed plant CesAs arose prior to the evolution of land plants and may play a role in maintaining the structures of rosette terminal complexes . The CesA genes identified in M . caldariorum are the first reported for any eukaryotic alga and will provide a basis for analyzing the CesA genes of algae with different types of terminal complexes.

Comp Biochem Physiol B Biochem Mol Biol, 2002 Dec, 133(4), 477 - 91
Inferring protein function from genomic sequence: Giardia lamblia expresses a phosphatidylinositol kinase-related kinase similar to yeast and mammalian TOR; Morrison HG et al.; Functional assays of genes have historically led to insights about the activities of a protein or protein cascade . However, the rapid expansion of genomic and proteomic information for a variety of diverse taxa is an alternative and powerful means of predicting function by comparing the enzymes and metabolic pathways used by different organisms . As part of the Giardia lamblia genome sequencing project, we routinely survey the complement of predicted proteins and compare those found in this putatively early diverging eukaryote with those of prokaryotes and more recently evolved eukaryotic lineages . Such comparisons reveal the minimal composition of conserved metabolic pathways, suggest which proteins may have been acquired by lateral transfer, and, by their absence, hint at functions lost in the transition from a free-living to a parasitic lifestyle . Here, we describe the use of bioinformatic approaches to investigate the complement and conservation of proteins in Giardia involved in the regulation of translation . We compare an FK506 binding protein homologue and phosphatidylinositol kinase-related kinase present in Giardia to those found in other eukaryotes for which complete genomic sequence data are available . Our investigation of the Giardia genome suggests that PIK-related kinases are of ancient origin and are highly conserved.

J Theor Biol, 2003 Feb 7, 220(3), 323 - 43
Evolution was chemically constrained; Williams RJ et al.; The objective of this paper is to present a systems view of the major features of biological evolution based upon changes in internal chemistry and uses of cellular space, both of which it will be stated were dependent on the changing chemical environment . The account concerns the major developments from prokaryotes to eukaryotes, to multi-cellular organisms, to animals with nervous systems and a brain, and finally to human beings and their uses of chemical elements in space outside themselves . It will be stated that the changes were in an inevitable progression, and were not just due to blind chance, so that "random searching" by a coded system to give species had a fixed overall route . The chemical sequence is from a reducing to an ever-increasingly oxidizing environment, while organisms retained reduced chemicals . The process was furthered recently by human beings who have also increased the range of reduced products trapped on Earth in novel forms . All the developments are brought about from the nature of the chemicals which organisms accumulate using the environment and its changes . The relationship to the manner in which particular species (gene sequences) were coincidentally changed, the molecular view of evolution, is left for additional examination.There is a further issue in that the changes of the chemistry of the environment developed largely at equilibrium due to the relatively fast reactions there of the available inorganic chemicals . Inside cells, some of these same chemicals also came to equilibrium within compounds . All such equilibria reduced the variance (degrees of freedom) of the total environmental/biological system and its possible development . However, the more sophisticated organic chemistry, almost totally inside cells until humans evolved, is kinetically controlled and limited by the demands of cellular reduction necessary to produce essential chemicals and by the availability of certain elements and energy . Hence the variability of reductive cellular organic chemistry and its limitations in cells have to be considered separately . While as a whole they drive the oxidation of the environment, they also allow speciation within the major changes of organisms . Human beings have introduced recently new, virtually irreversible, inorganic and organic chemistry in the environment, much of it new modes of irreversible storage of reduced chemicals, and this is, we state, the last possible step of chemical evolution . We must attempt to evaluate its effect on organisms generally.It must be clear that all the changes and the original life forms are dependent upon energy as well as material capture and flow . We shall have to consider in which forms energy was available over the period of evolution, how it was usefully transformed, and the ways in which its sources changed.

Gene, 2002 Oct 30, 300(1-2), 97 - 104
A simple and species-independent coding measure; Carpena P et al.; We present a coding measure which is based on the statistical properties of the stop codons, and that is able to estimate accurately the variation of coding content along an anonymous sequence . As the stop codons play the same role in all the genomes (with very few exceptions) the measure turns out to be species-independent . We show results both for prokaryotic and for eukaryotic genomes, indicating, first, the accuracy of the measure, and, second, that better prediction is achieved if the measure is applied on homogeneous, isochore-like sequences than if it is applied following the standard moving window approach . Finally, we discuss on some of the possible applications of the measure.

Int J Biochem Cell Biol, 2003 Jan, 35(1), 22 - 31
Triplex-forming oligonucleotides as modulators of gene expression; Guntaka RV et al.; Triplex-forming oligonucleotides (TFOs) have gained prominence in the recent years because of their potential applications in antigene therapy . In particular they have been used as (i) inducers of site-specific mutations, (ii) reagents that selectively and specifically cleave target DNA, and (iii) as modulators of gene expression . In this mini-review, we have made an attempt to highlight the characteristics of these TFOs and the effects of various modifications in the phosphate backbone as well as in the purine and pyrimidine moieties, which contribute to the stability and efficiency of triplex formation . Studies to explore the mechanism of down-regulation of transcription of various genes suggest that at least some TFOs exert their effect by inhibiting binding of specific transcription factors to their cognate cis-acting elements . Recent reports indicate the presence of these potential triplex-forming DNA structures in the genomes of prokaryotes and eukaryotes that may play a major role in target site selection and chromosome segregation as well as in the cause of heritable diseases . Finally, some potential problems in the development of these TFOs as antigene therapeutic agents have also been discussed.

Structure (Camb), 2002 Dec, 10(12), 1687 - 96
Crystal structure of SANOS, a bacterial nitric oxide synthase oxygenase protein from Staphylococcus aureus; Bird LE et al.; Prokaryotic genes related to the oxygenase domain of mammalian nitric oxide synthases (NOSs) have recently been identified . Although they catalyze the same reaction as the eukaryotic NOS oxygenase domain, their biological function(s) are unknown . In order to explore rationally the biochemistry and evolution of the prokaryotic NOS family, we have determined the crystal structure of SANOS, from methicillin-resistant Staphylococcus aureus (MRSA), to 2.4 A . Haem and S-ethylisothiourea (SEITU) are bound at the SANOS active site, while the intersubunit site, occupied by the redox cofactor tetrahydrobiopterin (H(4)B) in mammalian NOSs, has NAD(+) bound in SANOS . In common with all bacterial NOSs, SANOS lacks the N-terminal extension responsible for stable dimerization in mammalian isoforms, but has alternative interactions to promote dimer formation.

Structure (Camb), 2002 Dec, 10(12), 1637 - 48
Structure of the monomeric isocitrate dehydrogenase: evidence of a protein monomerization by a domain duplication; Yasutake Y et al.; NADP(+)-dependent isocitrate dehydrogenase is a member of the beta-decarboxylating dehydrogenase family and catalyzes the oxidative decarboxylation reaction from 2R,3S-isocitrate to yield 2-oxoglutarate and CO(2) in the Krebs cycle . Although most prokaryotic NADP(+)-dependent isocitrate dehydrogenases (IDHs) are homodimeric enzymes, the monomeric IDH with a molecular weight of 80-100 kDa has been found in a few species of bacteria . The 1.95 A crystal structure of the monomeric IDH revealed that it consists of two distinct domains, and its folding topology is related to the dimeric IDH . The structure of the large domain repeats a motif observed in the dimeric IDH . Such a fusional structure by domain duplication enables a single polypeptide chain to form a structure at the catalytic site that is homologous to the dimeric IDH, the catalytic site of which is located at the interface of two identical subunits.

Nucleic Acids Res, 2002 Dec 1, 30(23), 5193 - 204
Regulation of site-specific recombination by the C-terminus of lambda integrase; Kazmierczak RA et al.; Site-specific recombination catalyzed by bacteriophage lambda integrase (Int) is essential for establishment and termination of the viral lysogenic life cycle . Int is the archetype of the tyrosine recombinase family whose members are responsible for DNA rearrangement in prokaryotes, eukaryotes and viruses . The mechanism regulating catalytic activity during recombination is incompletely understood . Studies of tyrosine recombinases bound to their target substrates suggest that the C-termini of the proteins are involved in protein-protein contacts that control the timing of DNA cleavage events during recombination . We investigated an Int truncation mutant (W350) that possesses enhanced topoisomerase activity but greater than 100-fold reduced recombination activity . Alanine scanning mutagenesis of the C-terminus indicates that two mutants, W350A and I353A, cannot perform site-specific recombination although their DNA binding, cleavage and ligation activities are at wild-type levels . Two other mutants, R346A and R348A, are deficient solely in the ability to cleave DNA . To explain these results, we have constructed a homology-threaded model of the Int structure using a Cre crystal structure . We propose that residues R346 and R348 are involved in orientation of the catalytic tyrosine that cleaves DNA, whereas W350 and I353 control and make intermolecular contacts with other Int proteins in the higher order recombination structures known as intasomes . These results suggest that Int and the other tyrosine recombinases have evolved regulatory contacts that coordinate site-specific recombination at the C-terminus.

Essays Biochem, 2002, 38, 65 - 78
Methionine aminopeptidases and angiogenesis; Bradshaw RA et al.; The initiator methionine residue of proteins is removed during synthesis by a specific and ubiquitous enzyme, methionine aminopeptidase (MetAP) . Prokaryotes have a single gene, while eukaryotes have two isoforms . This family of metalloenzymes generally cleaves substrates in which the penultimate residue is one of the seven smaller amino acids (glycine, alanine, serine, threonine, proline, cysteine and valine) . One of the eukaryotic isoforms (MetAP2) has an additional non-proteolytic function and is the principle target of a family of anti-angiogenic drugs that are related to fumagillin . The resulting covalent modification inhibits the protease activity of MetAP2 and blocks cell-cycle function in endothelial and some cancer cells . The role of MetAP2 in the mitogenic activity of these cells is unknown.

Annu Rev Entomol, 2003, 48, 425 - 53 Epub 2002 Jun 04.
Biochemistry and molecular biology of de novo isoprenoid pheromone production in the Scolytidae; Seybold SJ et al.; Recent application of biochemical and molecular techniques to study the genesis of scolytid aggregation pheromones has revealed that bark beetles are primarily responsible for the endogenous synthesis of widely occurring pheromone components such as ipsenol, ipsdienol, and frontalin . Because many of the chemical signals are isoprenoids, the roles of the mevalonate biosynthetic pathway and the enzyme HMG-CoA reductase (HMG-R) have been investigated . This has led to the identification of endothelial cells in the anterior midgut as the site of synthesis and to the concept that de novo pheromone biosynthesis is regulated in part by the positive effect of juvenile hormone III (JHIII) on gene expression for HMG-R . Both the pronounced regulation by JHIII and the expression pattern of eukaryotic HMG-R argue against synthesis of these pheromones by prokaryotes . As the mevalonate pathway and its regulation have been studied in few other insects, broader issues addressed through the study of scolytid pheromone biosynthesis include major step versus coordinate regulation of the pathway and a genomics approach to elucidating the entire pathway and the mode of action of JHIII.

Plasmid, 2002 Nov, 48(3), 213 - 21
Approaches to investigating the ecology of plasmids in marine bacterial communities; Sobecky PA; To better understand prokaryotic gene flux in marine ecosystems and to determine whether or not environmental parameters can effect the composition and structure of plasmid populations in marine bacterial communities, information on the distribution, diversity, and ecological traits of marine plasmids is necessary . This mini-review highlights recent insights gained into the molecular diversity and ecology of plasmids occurring in marine microbial communities.

Plasmid, 2002 Nov, 48(3), 165 - 73
Antisense RNAs in plasmids: control of replication and maintenance; Brantl S; The search for small RNAs which might act as riboregulators became successful over the past two years both in prokaryotes and in eukaryotes . Moreover, artificially designed antisense RNAs have become powerful tools to downregulate the expression of targeted genes . It seems that antisense RNAs as regulatory molecules are most likely to be found everywhere . However, the first naturally occuring antisense RNAs were identified in plasmids and other prokaryotic accessory DNA elements . The thorough and detailed analyses of these systems have provided deep insights into structure and function of prokaryotic antisense RNAs and the kinetics of antisense/sense RNA interaction . Here, I focus on the role of antisense RNAs in plasmid replication and maintenance.

Environ Microbiol, 2002 Nov, 4(11), 758 - 63
Prokaryotic phylogenetic diversity and corresponding geochemical data of the brine-seawater interface of the Shaban Deep, Red Sea; Eder W et al.; The interface between the hypersaline brine and the overlying sea-water (brine-seawater interface) of the Shaban Deep, northern Red Sea was investigated for the presence of microorganisms using the 16S rRNA gene as a molecular marker . Samples of the south and east basin (depth: 1331 m and 1332 m respectively) were selected to ascertain the microbial diversity of this extreme and, so far, unexplored environment . Phylogenetic analysis revealed novel lineages within the Bacteria, the Crenarchaeota and the Euryarchaeota . Novel representatives of the KB1 sequence group (Eder et al., 1999 Arch Microbiol 172: 213-218) were detected indicating a widespread distribution of the corresponding Bacteria in Deep Sea brine pools . Our results contribute to the understanding of the hitherto unknown microbial diversity at the chemical gradient of the Shaban Deep, and suggest the presence of novel Bacteria and Archaea thriving under extreme environmental conditions.

Environ Microbiol, 2002 Nov, 4(11), 644 - 53
Synchronized expression of ftsZ in natural Prochlorococcus populations of the Red Sea; Holtzendorff J et al.; The expression of ftsZ, encoding the initiating protein of the prokaryotic cell division was analysed in natural Prochlorococcus populations in the Gulf of Aqaba, northern Red Sea . During the seasonal Prochlorococcus bloom in September 2000, picoplankton was collected from the deep chlorophyll maximum (DCM) at 2-4 h intervals over 3 consecutive days . Flow cytometric measurements as well as DNA sequence analyses showed that Prochlorococcus was the dominant photosynthetic organism . Cell densities peaked as high as 1.4 x 10(5) cells ml(-1) . This DCM population mainly consisted of brightly red fluorescing Prochlorococcus cells, corresponding to low light-adapted 'ecotypes' (sensu Moore et al., 1998, Nature 393: 464-467) . Prochlorococcus populations grew in a highly synchronized fashion with DNA replication in the afternoon and cell division during the night . The ftsZ mRNA level reached maximum values within the replication phase between 14.00 and 16.00 hours, and minimum values between 02.00 and 06.00 hours . Thus, the transcriptional regulation of ftsZ could be a major factor triggering the synchronized cell division of Prochlorococcus populations . This is the first application of quantitative reverse transcriptase-coupled real-time polymerase chain reaction (PCR) to natural populations of an environmentally relevant marine organism.

Environ Microbiol, 2002 Nov, 4(11), 628 - 33
Approaches to prokaryotic biodiversity: a population genetics perspective; Rodriguez-Valera F; The study of prokaryotic diversity has blossomed during the last 10-15 years as a result of the introduction of molecular identification, mostly based on direct 16S rRNA gene polymerase chain reaction (PCR) amplification and sequencing from natural samples . A large amount of information exists about the diversity of this specific gene . However, data from the field of bacterial population genetics and genomics make questionable the value of information regarding just one gene . Even if we accept 16S rRNA genes as useful for species identification, intraspecific variation in bacteria is so high that species catalogues are often of little value . The gene pools represented by an operational species are yet impossible to predict . On the other hand, adaptive features in prokaryotes are often coded in gene clusters (genomic islands) that can be cloned directly from the environment, sequenced and even expressed in a surrogate host . Thus, the study of the environmental genome or metagenome appears as an alternative that could eventually lead to a more realistic understanding of prokaryotic biodiversity, provide biotechnology with new tools and maybe even contribute to develop a model of prokaryotic evolution.

JAMA, 2002 Dec 4, 288(21), 2724 - 31
Chlamydia pneumoniae as an emerging risk factor in cardiovascular disease; Kalayoglu MV et al.; Recent appreciation of atherosclerosis as a chronic, inflammatory disease has rekindled efforts to examine the role that infectious agents may play in atherogenesis . In particular, much interest has focused on infection with Chlamydia pneumoniae . The possibility that a prokaryote contributes to atherogenesis has high clinical interest, as C pneumoniae infection may be a treatable risk factor . To review the evidence implicating C pneumoniae in the pathogenesis of atherosclerosis, we searched MEDLINE for articles published between January 1966 and October 2002 on the association of C pneumoniae and atherosclerosis . We also used online resources, texts, meeting abstracts, and expert opinion . We included 5 types of studies (epidemiological, pathology based, animal model, cell biology, and human antibiotic treatment trials) and extracted diagnostic, pathophysiologic, and therapeutic information from the selected literature; consensus was reached on interpretation discrepancies . Chlamydia pneumoniae is associated with atherosclerosis by epidemiological and pathology-based studies . Animal model and cell biology studies suggest that the pathogen can modulate atheroma biology, including lipid- and inflammatory-related processes . Although some preliminary antibiotic treatment trials in patients with coronary artery disease indicated a reduction in recurrent coronary events, larger studies have not shown benefits in individuals with stable coronary artery disease . It is unlikely that C pneumoniae infection is necessary to initiate atherosclerosis . Furthermore, conventional antibiotic therapy may not eradicate the organism or reduce mortality in individuals with atherosclerotic vascular disease . Nevertheless, the current body of evidence establishes this pathogen as a plausible, potentially modifiable risk factor in cardiovascular disease.

FEBS Lett, 2002 Dec 4, 532(1-2), 36 - 44
HIV-1 TAT-mediated protein transduction and subcellular localization using novel expression vectors; Yang Y et al.; Several novel prokaryotic and eukaryotic expression vectors were constructed for protein transduction and subcellular localization . These vectors employed an N-terminal stretch of 11 basic amino acid residues (47-57) from the human immunodeficiency virus type 1 (HIV-1) TAT protein transduction domain (PTD) for protein translocation and cellular localization . The vectors also contained a six-histidine (His(6)) tag at the N- or C-terminus for convenient purification and detection, and a multiple cloning site for easy insertion of foreign genes . Some heterologous genes including HSV-TK, Bcl-rambo, Smac/DIABLO and GFP were fused in-frame to TAT PTD and successfully overexpressed in Escherichia coli . The purified TAT-GFP fusion protein was able to transduce into the mammalian cells and was found to locate mainly in the cytosol when exogenously added to the cell culture medium . However, using a transfection system, mammalian-expressed TAT-GFP predominantly displayed a nuclear localization and nucleolar accumulation in mammalian cell lines . This discrepancy implies that the exact subcellular localization of transduced protein may depend on cell type, the nature of imported proteins and delivery approach . Taken together, our results demonstrate that a TAT PTD length of 11 amino acids was sufficient to confer protein internalization and its subsequent cellular localization . These novel properties allow these vectors to be useful for studying protein transduction and nuclear import.

Mutat Res, 2002 Dec 29, 510(1-2), 141 - 52
Cell-selfish modes of evolution and mutations directed after transcriptional bypass; Holmquist GP; During transcription, prokaryotic and eukaryotic RNA polymerases bypass and misread (transcriptional mutagenesis) several classes of DNA lesions . For example, misreading of 8-OH-dG generates mRNAs containing G to T transversions . After translation, if the mutant protein briefly allowed the cell a growth-DNA replication advantage, then precocious DNA replication would bypass that unrepaired 8-OH-dG and misinsert dA opposite the directing DNA lesion with a higher probability than would be experienced for 8-OH-G lesions at other positions in otherwise identical neighboring cells . Such retromutations would have been tested for their imparted growth advantage as mRNA before they became heritable DNA mutations . The logical properties of a mode of evolution that utilizes directed-retromutagenesis were compared one by one with those of the standard neo-Darwinian mode . The retromutagenesis mode, while minimizing mutational load, is cell-selfish; fitness is for an immediate growth advantage rather than future reproductive potential . In prokaryotes, an evolutionary mode that involves standard Darwinian fitness testing of novel alleles in the genetic background of origin followed by clonal expansion also favors cell-selfish allele combinations when linkage disequilibrium is practiced . For metazoa and plants to have evolved organized tissues, cell-selfish modes of evolution represent systems-poisons that must be totally suppressed . The feedback loops that allow evolution to be cell-serving in prokaryotes are actively blocked in eukaryotes by traits that restrict fitness to future reproductive potential . These traits include (i) delay of fitness testing until after the mutation is made permanently heritable, (ii) diploidy to further delay fitness testing, (iii) segregation of somatic lines from germ lines, (iv) testing of novel alleles against randomized allele combinations constructed by obligate sex, and (v) obligate genetic death to insure that that the most basic systems unit of selfish allele combinatorial uniqueness is the species instead of the cell . The analyses indicate that modes of evolution in addition to our neo-Darwinian one could have existed utilizing known molecular mechanisms . The evolution of multicellularity was as much the discarding of old cell-selfish habits as the acquisition of new altruistic ones.

Proc Natl Acad Sci U S A, 2002 Dec 10, 99(25), 15908 - 13 Epub 2002 Nov 27.
An mRNA structure that controls gene expression by binding FMN; Winkler WC et al.; The RFN element is a highly conserved domain that is found frequently in the 5'-untranslated regions of prokaryotic mRNAs that encode for flavin mononucleotide (FMN) biosynthesis and transport proteins . We report that this domain serves as the receptor for a metabolite-dependent riboswitch that directly binds FMN in the absence of proteins . Our results also indicate that in Bacillus subtilis, the riboswitch most likely controls gene expression by causing premature transcription termination of the ribDEAHT operon and precluding access to the ribosome-binding site of ypaA mRNA . Sequence and structural analyses indicate that the RFN element is a natural FMN-binding aptamer, the allosteric character of which is harnessed to control gene expression.

Microbiol Mol Biol Rev, 2002 Dec, 66(4), 630 - 70, table of contents
Role of RAD52 epistasis group genes in homologous recombination and double-strand break repair; Symington LS; The process of homologous recombination is a major DNA repair pathway that operates on DNA double-strand breaks, and possibly other kinds of DNA lesions, to promote error-free repair . Central to the process of homologous recombination are the RAD52 group genes (RAD50, RAD51, RAD52, RAD54, RDH54/TID1, RAD55, RAD57, RAD59, MRE11, and XRS2), most of which were identified by their requirement for the repair of ionizing-radiation-induced DNA damage in Saccharomyces cerevisiae . The Rad52 group proteins are highly conserved among eukaryotes, and Rad51, Mre11, and Rad50 are also conserved in prokaryotes and archaea . Recent studies showing defects in homologous recombination and double-strand break repair in several human cancer-prone syndromes have emphasized the importance of this repair pathway in maintaining genome integrity . Although sensitivity to ionizing radiation is a universal feature of rad52 group mutants, the mutants show considerable heterogeneity in different assays for recombinational repair of double-strand breaks and spontaneous mitotic recombination . Herein, I provide an overview of recent biochemical and structural analyses of the Rad52 group proteins and discuss how this information can be incorporated into genetic studies of recombination.

Front Biosci, 2003 Jan 01, 8, d279 - 85
Transcription factor as a topological homeostat; Muskhelishvili G et al.; Abundant prokaryotic chromatin architectural proteins often function also as global transcriptional regulators . In addition, some of this class of proteins modulate the activity of cellular topoisomerases and hence, the superhelical density of DNA . The relationships between the global effect of these proteins on DNA topology and their local effects exerted on particular promoter regions remain largely unexplored . One of the best-characterised examples of this class of proteins is the pleiotropic regulator of metabolism FIS, which reduces the activity of DNA gyrase and counteracts the increase of the overall superhelicity of DNA during early exponential growth phase . Binding of FIS to supercoiled DNA molecules in vitro leads to the formation of branched structures and consequent multiplication of apical loops, whereas on bending the upstream regions of stable RNA promoters FIS acts as a topological homeostat maintaining high local levels of supercoiling required for promoter activity . We argue that the coordinated effects of FIS on the global and local DNA architecture optimise gene expression by channelling the free energy of negative supercoiling to specific, biologically relevant sites.

Front Biosci, 2003 Jan 01, 8, d193 - 209
Nitric oxide synthases: domain structure and alignment in enzyme function and control; Ghosh DK et al.; Nitric Oxide Synthases are a family of enzymes that produce NO from arginine, oxygen and reducing power in the form of NADPH; they function as signal generators and as producers of cytotoxic levels of NO (e.g., in immune defense) . Evolution of eukaryotic NOS from prokaryotic antecedents involved a series of gene fusion events, producing a modular enzyme, and the concomitant development of sophisticated control mechanisms that are isoform specific and tailored to the role of enzymes in signal transduction or immune response . Recent information on the structures of NOS isoforms at all levels from primary amino acid sequence to high resolution crystallography allows a deepening understanding of many aspects of these important proteins including interdomain interactions, dimerization, cofactor, substrate, and isoform specific inhibitor binding as well catalysis and control . The details of the NOS reaction mechanism and its control through the regulation of electron transfer by CaM binding and other mechanisms are still being elucidated and are well worth further examination . The alignment of the molecular surfaces of the independently folded domains is a central feature of structure, catalysis and control in these important enzymes, and will be the focus of the present review.

Front Biosci, 2003 Jan 01, 8, d1 - 8
Regulation of plasminogen receptors; Herren T et al.; Many eukaryotic and prokaryotic cells bind plasminogen in a specific and saturable manner . When plasminogen is bound to cell-surface proteins with C-terminal lysines via its lysine binding sites, its activation to plasmin is accelerated, and cell-bound plasmin is protected from inactivation by natural inhibitors . Plasmin mediates direct or indirect degradation of the extracellular matrix, and bound plasmin is used by cells to facilitate migration through extracellular matrices . Since cell migration and tissue remodelling are the underpinnings of many physiological and pathological responses, the modulation of plasminogen receptors may serve as a primary regulatory mechanism for control of many cellular responses . Specific examples of cell types on which plasminogen receptors undergo modulation include: fibroblasts, where modulation may contribute to cartilage and bone destruction in rheumatoid arthritis; leukemic cells, where enhanced plasminogen binding may contribute to the heightened fibrinolytic state in the patients; other tumor cells, where up-regulation may support invasion and metastasis; bacteria, where enhanced plasminogen binding may facilitate tissue destruction and invasion; platelets, where up-regulation of plasminogen binding may play a role in regulating clot lysis; and adipocytes, where the modulation of plasminogen receptor expression may regulate cell differentiation and fat accumulation . Two pathways for modulation of plasminogen receptors have been characterized: A protease-dependent pathway can either up-regulate or down-regulate plasminogen binding to cells by changing the availability of plasminogen-binding proteins with C-terminal lysines . New receptors may be generated by trypsin-like proteases, including plasmin, which create new C-terminal lysines; other enzymes may expose existing membrane proteins by altering the cell surface; or receptor function may be lost by removal of C-terminal lysines . The basic carboxypeptidases of blood carboxypeptidase N and plasma carboxypeptidase B (TAFI) mediate such down-regulation . A non-protease dependent pathway for modulation of plasminogen receptors may be initiated by growth factors, chemokines or cytokines that alter the cell membrane and/or cytoskeleton architectures to expose plasminogen binding sites . Many examples of the modulation of plasminogen receptors have been demonstrated in vitro, and the development of knock-out mice may soon lead to incisive evaluations of the significance of the regulation of plasminogen receptors in vivo.

Eukaryot Cell, 2002 Apr, 1(2), 304 - 10
Evolutionary analyses of the small subunit of glutamate synthase: gene order conservation, gene fusions, and prokaryote-to-eukaryote lateral gene transfers; Andersson JO et al.; Lateral gene transfer has been identified as an important mode of genome evolution within prokaryotes . Except for the special case of gene transfer from organelle genomes to the eukaryotic nucleus, only a few cases of lateral gene transfer involving eukaryotes have been described . Here we present phylogenetic and gene order analyses on the small subunit of glutamate synthase (encoded by gltD) and its homologues, including the large subunit of sulfide dehydrogenase (encoded by sudA) . The scattered distribution of the sudA and sudB gene pair and the phylogenetic analysis strongly suggest that lateral gene transfer was involved in the propagation of the genes in the three domains of life . One of these transfers most likely occurred between a prokaryote and an ancestor of diplomonad protists . Furthermore, phylogenetic analyses indicate that the gene for the small subunit of glutamate synthase was transferred from a low-GC gram-positive bacterium to a common ancestor of animals, fungi, and plants . Interestingly, in both examples, the eukaryotes encode a single gene that corresponds to a conserved operon structure in prokaryotes . Our analyses, together with several recent publications, show that lateral gene transfers from prokaryotes to unicellular eukaryotes occur with appreciable frequency . In the case of the genes for sulfide dehydrogenase, the transfer affected only a limited group of eukaryotes--the diplomonads--while the transfer of the glutamate synthase gene probably happened earlier in evolution and affected a wider range of eukaryotes.

Eukaryot Cell, 2002 Apr, 1(2), 181 - 90
Evidence for lateral transfer of genes encoding ferredoxins, nitroreductases, NADH oxidase, and alcohol dehydrogenase 3 from anaerobic prokaryotes to Giardia lamblia and Entamoeba histolytica; Nixon JE et al.; Giardia lamblia and Entamoeba histolytica are amitochondriate, microaerophilic protists which use fermentation enzymes like those of bacteria to survive anaerobic conditions within the intestinal lumen . Genes encoding fermentation enzymes and related electron transport peptides (e.g., ferredoxins) in giardia organisms and amebae are hypothesized to be derived from either an ancient anaerobic eukaryote (amitochondriate fossil hypothesis), a mitochondrial endosymbiont (hydrogen hypothesis), or anaerobic bacteria (lateral transfer hypothesis) . The goals here were to complete the molecular characterization of giardial and amebic fermentation enzymes and to determine the origins of the genes encoding them, when possible . A putative giardia {2Fe-2S}ferredoxin which had a hypothetical organelle-targeting sequence at its N terminus showed similarity to mitochondrial ferredoxins and the hydrogenosomal ferredoxin of Trichomonas vaginalis (another luminal protist) . However, phylogenetic trees were star shaped, with weak bootstrap support, so we were unable to confirm or rule out the endosymbiotic origin of the giardia {2Fe-2S}ferredoxin gene . Putative giardial and amebic 6-kDa ferredoxins, ferredoxin-nitroreductase fusion proteins, and oxygen-insensitive nitroreductases each tentatively supported the lateral transfer hypothesis . Although there were not enough sequences to perform meaningful phylogenetic analyses, the unique common occurrence of these peptides and enzymes in giardia organisms, amebae, and the few anaerobic prokaryotes suggests the possibility of lateral transfer . In contrast, there was more robust phylogenetic evidence for the lateral transfer of G . lamblia genes encoding an NADH oxidase from a gram-positive coccus and a microbial group 3 alcohol dehydrogenase from thermoanaerobic prokaryotes . In further support of lateral transfer, the G . lamblia NADH oxidase and adh3 genes appeared to have an evolutionary history distinct from those of E . histolytica.

Int Rev Cytol, 2002, 221, 191 - 255
Protein transport into secondary plastids and the evolution of primary and secondary plastids; Kroth PG; Chloroplasts are key organelles in algae and plants due to their photosynthetic abilities . They are thought to have evolved from prokaryotic cyanobacteria taken up by a eukaryotic host cell in a process termed primary endocytobiosis . In addition, a variety of organisms have evolved by subsequent secondary endocytobioses, in which a heterotrophic host cell engulfed a eukaryotic alga . Both processes dramatically enhanced the complexity of the resulting cells . Since the first version of the endosymbiotic theory was proposed more than 100 years ago, morphological, physiological, biochemical, and molecular data have been collected substantiating the emerging picture about the origin and the relationship of individual organisms with different primary or secondary chloroplast types . Depending on their origin, plastids in different lineages may have two, three, or four envelope membranes . The evolutionary success of endocytobioses depends, among other factors, on the specific exchange of molecules between the host and endosymbiont . This raises questions concerning how targeting of nucleus-encoded proteins into the different plastid types occurs and how these processes may have developed . Most studies of protein translocation into plastids have been performed on primary plastids, but in recent years more complex protein-translocation systems of secondary plastids have been investigated . Analyses of transport systems in different algal lineages with secondary plastids reveal that during evolution existing translocation machineries were recycled or recombined rather than being developed de novo . This review deals with current knowledge about the evolution and function of primary and secondary plastids and the respective protein-targeting systems.

Eukaryot Cell, 2002 Oct, 1(5), 725 - 35
Aspergillus nidulans catalase-peroxidase gene (cpeA) is transcriptionally induced during sexual development through the transcription factor StuA; Scherer M et al.; Catalases, peroxidases, and catalase-peroxidases are important enzymes to cope with reactive oxygen species in pro- and eukaryotic cells . In the filamentous fungus Aspergillus nidulans three monofunctional catalases have been described, and a fourth catalase activity was observed in native polyacrylamide gels . The latter activity is probably due to the bifunctional enzyme catalase-peroxidase, which we characterized here . The gene, named cpeA, encodes an 81-kDa polypeptide with a conserved motif for heme coordination . The enzyme comprises of two similar domains, suggesting gene duplication and fusion during evolution . The first 439 amino acids share 22% identical residues with the C terminus . Homologous proteins are found in several prokaryotes, such as Escherichia coli and Mycobacterium tuberculosis (both with 61% identity) . In fungi the enzyme has been noted in Penicillium simplicissimum, Septoria tritici, and Neurospora crassa (69% identical amino acids) but is absent from Saccharomyces cerevisiae . Expression analysis in A . nidulans revealed that the gene is transcriptionally induced upon carbon starvation and during sexual development, but starvation is not sufficient to reach high levels of the transcript during development . Besides transcriptional activation, we present evidence for posttranscriptional regulation . A green fluorescent protein fusion protein localized to the cytoplasm of Hulle cells . The Hulle cell-specific expression was dependent on the developmental regulator StuA, suggesting an activating function of this helix-loop-helix transcription factor.

Curr Drug Targets Infect Disord, 2001 Aug, 1(2), 201 - 13
E . Coli MurG: a paradigm for a superfamily of glycosyltransferases; Ha S et al.; MurG is an essential bacterial glycosyltransferase that is involved in the biosynthesis of peptidoglycan . The enzyme is found in all organisms that synthesize peptidoglycan and is a target for the design of new antibiotics . A direct assay to study MurG was reported recently, followed shortly by the crystal structure of E . coli MurG . This first MurG structure, combined with sequence data on other glycosyltransferases, has revealed that MurG is a paradigm for a large family of metal ion-independent glycosyltransferases found in both eukaryotes and prokaryotes . A better understanding of MurG could lead to the development of new drugs to combat antibiotic resistant infections, and may also shed light on a broad class of glycosyltransferases.

J Theor Biol, 2003 Jan 7, 220(1), 1 - 18
Sequence-based analysis of metabolic demands for protein synthesis in prokaryotes; Allen TE et al.; Constraints-based models for microbial metabolism can currently be constructed on a genome-scale . These models do not account for RNA and protein synthesis . A scalable formalism to describe translation and transcription that can be integrated with the existing metabolic models is thus needed . Here, we developed such a formalism . The fundamental protein synthesis network described by this formalism was analysed via extreme pathway and flux balance analyses . The protein synthesis network exhibited one extreme pathway per messenger RNA synthesized and one extreme pathway per protein synthesized . The key parameters in this network included promoter strengths, messenger RNA half-lives, and the availability of nucleotide triphosphates, amino acids, RNA polymerase, and active ribosomes . Given these parameters, we were able to calculate a cell's material and energy expenditures for protein synthesis using a flux balance approach . The framework provided herein can subsequently be integrated with genome-scale metabolic models, providing a sequence-based accounting of the metabolic demands resulting from RNA and protein polymerization .

Mol Microbiol, 2002 Dec, 46(5), 1353 - 66
Activation of 6-phosphofructokinase via phosphorylation by Pkn4, a protein Ser/Thr kinase of Myxococcus xanthus; Nariya H et al.; Myxococcus xanthus is a Gram-negative bacterium that exhibits a communal lifestyle during vegetative growth and multicellular development, forming fruiting bodies filled with spores . It contains at least 13 eukaryotic-like protein Ser/Thr kinases (PSTKs from Pkn1 to Pkn13) . In the present report, we demonstrate that Pkn4, the gene located 18 bp downstream of the gene for 6-phosphofructokinase (PFK), is a PSTK for M . xanthus PFK (Mx-PFK), the key regulatory enzyme in glycolysis . Both Pkn4 and Mx-PFK were expressed in Escherichia coli and purified . Mx-PFK was found to be phosphorylated by Pkn4 at Thr-226, which is presumed to be located in the allosteric effector site of the PFK . The phosphorylation of Mx-PFK enhanced its activity 2.7-fold, indicating that Pkn4 plays an important role in glucose metabolism . Although PFKs from other organisms are known to be tetrameric enzymes, Mx-PFK is composed of an octamer and is dissociated to tetramers in the presence of phosphoenolpyruvate (PEP), an allosteric inhibitor for PFK . Furthermore, phosphorylation of PFK by Pkn4 is almost completely inhibited by PEP . Mx-PFK is associated with the regulatory domain of Pkn4, and this association is inhibited by PEP . This is the first demonstration that a prokaryotic PFK is regulated by phosphorylation by PSTK in prokaryotes.

Ann Med, 2002, 34(5), 394 - 400
Human clock genes; Piggins HD; Rhythmic variations in physiological and behavioural processes are mediated by both endogenous and exogenous factors . Endogenous factors include self-sustaining biological pacemakers or clocks which in the absence of strong external influences self-sustain periodic rhythms in such diverse physiological and psychological processes as core body temperature, food intake, cognitive performance and mood . Clocks with endogenous periods near or at 24 h (called circadian clocks from the Latin, circa dies, meaning about one day) have been documented from prokaryotes to single cell eukaryotes to multi-cellular, complex animals such as flies, rodents and humans . Over the past few years, a revolution in the understanding of the molecular basis of these clocks has led to the identification of a number of core clock genes and their proteins, and the development of elegant feedback models to explain the molecular gears of circadian clocks . At least eight human orthologs of mouse core clock genes have been identified, and polymorphisms in two of these, hClock and hPer2, have been implicated in human sleep disorders . Remarkably, knowledge of these core clock genes and the development of sophisticated reporter systems to monitor clock gene promoter activity have led to the astonishing observation that our body is actually composed of millions of cellular clocks and oscillators whose co-ordinated activity gives rise to pronounced daily, monthly, and seasonal rhythms in physiology and behaviour . An idea that is gaining favour is that our physical and mental well-being is probably determined by the appropriate phasing of these millions of cellular clocks with recurring, meaningful events in the environment.

Appl Environ Microbiol, 2002 Dec, 68(12), 6129 - 37
Composition and function of sulfate-reducing prokaryotes in eutrophic and pristine areas of the Florida Everglades; Castro H et al.; As a result of agricultural activities in regions adjacent to the northern boundary of the Florida Everglades, a nutrient gradient developed that resulted in physicochemical and ecological changes from the original system . Sulfate input from agricultural runoff and groundwater is present in soils of the Northern Everglades, and sulfate-reducing prokaryotes (SRP) may play an important role in biogeochemical processes such as carbon cycling . The goal of this project was to utilize culture-based and non-culture-based approaches to study differences between the composition of assemblages of SRP in eutrophic and pristine areas of the Everglades . Sulfate reduction rates and most-probable-number enumerations revealed SRP populations and activities to be greater in eutrophic zones than in more pristine soils . In eutrophic regions, methanogenesis rates were higher, the addition of acetate stimulated methanogenesis, and SRP able to utilize acetate competed to a limited degree with acetoclastic methanogens . A surprising amount of diversity within clone libraries of PCR-amplified dissimilatory sulfite reductase (DSR) genes was observed, and the majority of DSR sequences were associated with gram-positive spore-forming Desulfotomaculum and uncultured microorganisms . Sequences associated with Desulfotomaculum fall into two categories: in the eutrophic regions, 94.7% of the sequences related to Desulfotomaculum were associated with those able to completely oxidize substrates, and in samples from pristine regions, all Desulfotomaculum-like sequences were related to incomplete oxidizers . This metabolic selection may be linked to the types of substrates that Desulfotomaculum spp . utilize; it may be that complete oxidizers are more versatile and likelier to proliferate in nutrient-rich zones of the Everglades . Desulfotomaculum incomplete oxidizers may outcompete complete oxidizers for substrates such as hydrogen in pristine zones where diverse carbon sources are less available.

Mikrobiologiia, 2002 Sep-Oct, 71(5), 675 - 80
{New criteria for evaluation of soil bacterial complexes}; Polianskii AM et al.; The initial concentration of prokaryotic microorganisms, the type of their growth, doubling time, and the growth dynamics of bacteria and actinomycetes in three types of soil (meadow, chestnut, and soddy forest) were evaluated by the luminescence microscopic analysis of soil samples incubated in a humid chamber for 1 day . Soddy forest and chestnut soils differed in most of the parameters analyzed . Meadow soil was close to soddy forest soil in some parameters and to chestnut soil in other parameters . All soil suspensions exhibited high growth rates of bacteria and actinomycetes, indicating that the fraction of viable microorganisms in the soils was high.

Antonie Van Leeuwenhoek, 2002 Aug, 81(1-4), 257 - 61
Synergistic interactions in the microbial world; Schink B; After several decades of microbiological research has focused on pure cultures, synergistic effects between different types of microorganisms find increasing interest . Interspecies interactions between prokaryotic cells have been studied into depth mainly with respect to syntrophic cooperations involved in methanogenic degradation of electron-rich substrates such as fatty acids, alcohols, and aromatics . Partners involved in these processes have to run their metabolism at minimal energy increments, with only fractions of an ATP unit synthesized per substrate molecule metabolized, and their cooperation is intensified by close proximity of the partner cells . New examples of such syntrophic activities are anaerobic methane oxidation by presumably methanogenic and sulfate-reducing prokaryotes, and microbially mediated pyrite formation . Syntrophic relationships have also been discovered to be involved in the anaerobic metabolization of amino acids and sugars where energetical restrictions do not necessarily force the partner organisms into strict interdependencies . The most highly developed cooperative systems among prokaryotic cells appear to be the structurally organized phototrophic consortia of the Chlorochromatium and Pelochromatium type in which phototrophic and chemotrophic bacteria not only exchange metabolites but also interact at the level of growth coordination and tactic behaviour.

Science, 2002 Nov 22, 298(5598), 1616 - 20
Whole-genome analysis of photosynthetic prokaryotes; Raymond J et al.; The process of photosynthesis has had profound global-scale effects on Earth; however, its origin and evolution remain enigmatic . Here we report a whole-genome comparison of representatives from all five groups of photosynthetic prokaryotes and show that horizontal gene transfer has been pivotal in their evolution . Excluding a small number of orthologs that show congruent phylogenies, the genomes of these organisms represent mosaics of genes with very different evolutionary histories . We have also analyzed a subset of "photosynthesis-specific" genes that were elucidated through a differential genome comparison . Our results explain incoherencies in previous data-limited phylogenetic analyses of phototrophic bacteria and indicate that the core components of photosynthesis have been subject to lateral transfer.

Mol Biol Evol, 2002 Dec, 19(12), 2226 - 38
Prokaryotic evolution in light of gene transfer; Gogarten JP et al.; Accumulating prokaryotic gene and genome sequences reveal that the exchange of genetic information through both homology-dependent recombination and horizontal (lateral) gene transfer (HGT) is far more important, in quantity and quality, than hitherto imagined . The traditional view, that prokaryotic evolution can be understood primarily in terms of clonal divergence and periodic selection, must be augmented to embrace gene exchange as a creative force, itself responsible for much of the pattern of similarities and differences we see between prokaryotic microbes . Rather than replacing periodic selection on genetic diversity, gene loss, and other chromosomal alterations as important players in adaptive evolution, gene exchange acts in concert with these processes to provide a rich explanatory paradigm-some of whose implications we explore here . In particular, we discuss (1) the role of recombination and HGT in giving phenotypic "coherence" to prokaryotic taxa at all levels of inclusiveness, (2) the implications of these processes for the reconstruction and meaning of "phylogeny," and (3) new views of prokaryotic adaptation and diversification based on gene acquisition and exchange.

Mol Biol Evol, 2002 Dec, 19(12), 2199 - 210
Molecular evolution of the equilibrative nucleoside transporter family: identification of novel family members in prokaryotes and eukaryotes; Acimovic Y et al.; Equilibrative nucleoside transporters (ENTs) are integral membrane proteins which enable the movement of hydrophilic nucleosides and nucleoside analogs down their concentration gradients across cell membranes . ENTs were only recently characterized at the molecular level, and little is known about the tertiary structure or distribution of these proteins in nonmammalian organisms . To identify conserved regions, residues, and motifs of ENTs that may indicate functionally important parts of the protein and to better understand the evolutionary history of this protein family, we conducted an exhaustive analysis to characterize and compare ENTs in taxonomically diverse organisms . We have identified novel ENT family members in humans, mice, fish, tunicates, slime molds, and bacteria . This greatly extends our knowledge on the distribution of the ENTs in eukaryotes, and we have identified, for the first time, family members in bacteria . The prokaryote ENTs are attractive models for future studies on transporter tertiary structure and mechanism of substrate translocation . Using sequence similarities, we have identified regions, residues, and motifs that are conserved across all family members . These areas are presumably correlated with function and therefore are important targets for future analysis . Finally, we propose an evolutionary history for the ENT family which clarifies the origin(s) of multiple isoforms in different taxa.

J Immunol Methods, 2002 Dec 20, 271(1-2), 177 - 84
Improved generation of HLA class I/peptide tetramers; Sato Y et al.; As a tetrameric major histocompatibility complex (MHC) class I-peptide complex (tetramer) is capable of detecting antigen-specific cytotoxic T lymphocyte (CTL) by flow cytometry, significant information about the generation of in vivo immunity can be obtained . It is, however, difficult to make a soluble wild type of MHC class I heavy chain by the prokaryotic expression system . Therefore, we developed a new method for making soluble mutant HLA-A*2402 heavy chain . In this method, signal sequences were deleted, and the codon was changed to silent mutated nucleotide sequences that bacteria could use as preferable codon . When purified mutant HLA-A*2402 molecules were examined for the protein generation by SDS-polyacrylamide gel electrophoresis (PAGE) and western blotting using anti-HLA class I monoclonal antibody (mAb) as compared with wild type, a large amount of mutant heavy chain could be detected . In contrast, the expression of wild-type stable HLA-A*2402 heavy chain molecule was not detected in this system . Consequently, by using mutant HLA-A*2402/peptide tetramers, CTL precursors (CTLp) that specifically recognize antigenic peptide derived from the X;18 chromosomal translocations of synovial sarcoma were detected in patients' PBL.

FEMS Microbiol Lett, 2002 Nov 19, 217(1), 1 - 7
Antibacterial properties of cationic steroid antibiotics; Savage PB et al.; Cationic steroid antibiotics have been developed that display broad-spectrum antibacterial activity . These compounds are comprised of steroids appended with amine groups arranged to yield facially amphiphilic morphology . Examples of these antibiotics are highly bactericidal, while related compounds effectively permeabilize the outer membranes of Gram-negative bacteria sensitizing these organisms to hydrophobic antibiotics . Cationic steroid antibiotics exhibit various levels of eukaryote vs . prokaryote cell selectivity, and cell selectivity can be increased via charge recognition of prokaryotic cells . Studies of the mechanism of action of these antibiotics suggest that they share mechanistic aspects with cationic peptide antibiotics.

Comp Biochem Physiol A Mol Integr Physiol, 2002 Nov, 133(3), 689 - 93
Transport and detoxification systems for transition metals, heavy metals and metalloids in eukaryotic and prokaryotic microbes; Rosen BP; Transition metals, heavy metals and metalloids are usually toxic in excess, but a number of transition metals are essential trace elements . In all cells there are mechanisms for metal ion homeostasis that frequently involve a balance between uptake and efflux systems . This review will briefly describe ATP-coupled resistance pumps . ZntA and CadA are bacterial P-type ATPases that confers resistance to Zn(II), Cd(II) and Pb(II) . Homologous copper pumps include the Menkes and Wilson disease proteins and CopA, an Escherichia coli pump that confers resistance to Cu(I) . For resistance to arsenicals and antimonials there are several different families of transporters . In E . coli the ArsAB ATPase is a novel system that confers resistance to As(III) and Sb(III) . Eukaryotic arsenic resistance transporters include Acr3p and Ycf1p of Saccharomyces cerevisiae . These systems provide resistance to arsenite {As(III)} . Arsenate {As(V)} detoxification involves reduction of As(V) to As(III), a process catalyzed by arsenate reductase enzymes . There are three families of arsenate reductases, two found in bacterial systems and a third identified in S . cerevisiae.

Proteomics, 2002 Nov, 2(11), 1494 - 503
Comparative proteome bioinformatics: identification of a whole complement of putative protein tyrosine kinases in the model flowering plant Arabidopsis thaliana; Carpi A et al.; Phosphorylation by protein tyrosine kinases is crucial to the control of growth and development of multicellular eukaryotes, including humans, and it also seems to play an important role in multicellular prokaryotes . A plant tyrosine-specific kinase has not been identified yet; hence, plants have been suggested to share with unicellular eukaryote yeast a tyrosine phosphorylation system where a limited number of stress proteins are tyrosyl-phosphorylated only by a few dual-specificity (serine/threonine and tyrosine) kinases . However, preliminary evidence obtained so far suggests that tyrosine phosphorylation in plants depends on the developmental conditions . Since sequencing of the genome of the model flowering plant Arabidopsis thaliana has been recently completed, we have performed a bioinformatic screening of the whole Arabidopsis proteome to identify a model complement of bona fide protein tyrosine kinases . In silico analyses suggest that < 4% of Arabidopsis kinases are tyrosine-specific kinases, whose gene expression has been assessed by a preliminary polymerase chain reaction screening of an Arabidopsis cDNA library . Finally, immunological evidence confirms that the number of Arabidopsis proteins specifically phosphorylated on tyrosine residues is much higher than in yeast.

Protein Sci, 2002 Dec, 11(12), 2974 - 80
Prediction of partial membrane protein topologies using a consensus approach; Nilsson J et al.; We have developed a method to reliably identify partial membrane protein topologies using the consensus of five topology prediction methods . When evaluated on a test set of experimentally characterized proteins, we find that approximately 90% of the partial consensus topologies are correctly predicted in membrane proteins from prokaryotic as well as eukaryotic organisms . Whole-genome analysis reveals that a reliable partial consensus topology can be predicted for approximately 70% of all membrane proteins in a typical bacterial genome and for approximately 55% of all membrane proteins in a typical eukaryotic genome . The average fraction of sequence length covered by a partial consensus topology is 44% for the prokaryotic proteins and 17% for the eukaryotic proteins in our test set, and similar numbers are found when the algorithm is applied to whole genomes . Reliably predicted partial topologies may simplify experimental determinations of membrane protein topology.

Protein Sci, 2002 Dec, 11(12), 2774 - 91
Transmembrane helix predictions revisited; Chen CP et al.; Methods that predict membrane helices have become increasingly useful in the context of analyzing entire proteomes, as well as in everyday sequence analysis . Here, we analyzed 27 advanced and simple methods in detail . To resolve contradictions in previous works and to reevaluate transmembrane helix prediction algorithms, we introduced an analysis that distinguished between performance on redundancy-reduced high- and low-resolution data sets, established thresholds for significant differences in performance, and implemented both per-segment and per-residue analysis of membrane helix predictions . Although some of the advanced methods performed better than others, we showed in a thorough bootstrapping experiment based on various measures of accuracy that no method performed consistently best . In contrast, most simple hydrophobicity scale-based methods were significantly less accurate than any advanced method as they overpredicted membrane helices and confused membrane helices with hydrophobic regions outside of membranes . In contrast, the advanced methods usually distinguished correctly between membrane-helical and other proteins . Nonetheless, few methods reliably distinguished between signal peptides and membrane helices . We could not verify a significant difference in performance between eukaryotic and prokaryotic proteins . Surprisingly, we found that proteins with more than five helices were predicted at a significantly lower accuracy than proteins with five or fewer . The important implication is that structurally unsolved multispanning membrane proteins, which are often important drug targets, will remain problematic for transmembrane helix prediction algorithms . Overall, by establishing a standardized methodology for transmembrane helix prediction evaluation, we have resolved differences among previous works and presented novel trends that may impact the analysis of entire proteomes.

Biochem Soc Trans, 2002 Nov, 30(Pt 6), 925 - 9
Allergens of the cupin superfamily; Mills EN et al.; The cupin family comprises a family of proteins possessing a common beta-barrel structure that is thought to have originated in a prokaryotic ancestor . This structural motif is found as a single domain in fungal spherulins, fern sporulins and the germins/oxalate oxidase proteins of plants, while the globular storage proteins of plants, called legumins (11 S) and euvicilins (7 S), are two-domain cupins . The 11 S globulins are hexameric heteroligomeric proteins of M (r) approximately 360000, with each subunit comprising an acidic 30000-40000- M (r) polypeptide that is disulphide-linked to a 20000- M (r) basic polypeptide . A number of cupins have been identified as major plant food allergens, including the 7 S globulins of soybean (beta-conglycinin), peanut (conarachin; Ara h 1), walnut (Jug r 2) and lentil, and the 11 S globulins of peanut (arachin; Ara h 3), soybean (glycinin) and possibly also coconut and walnut . Other members of the cupin superfamily have not been identified as allergens, with the exception of one germin (germination-specific protein) from pepper . Cupins are generally very stable proteins . A summary of our current knowledge of allergenic seed storage globulins will be presented, together with an overview of cupin structure and stability properties, as illustrated by the allergenic soya globulins, glycinin and beta-conglycinin.

Biochem Cell Biol, 2002, 80(5), 623 - 38
Molecular biology and regulation of nucleoside and nucleobase transporter proteins in eukaryotes and prokaryotes; Cabrita MA et al.; The molecular cloning of cDNAs encoding nucleoside transporter proteins has greatly advanced understanding of how nucleoside permeants are translocated across cell membranes . The nucleoside transporter proteins identified thus far have been categorized into five distinct superfamilies . Two of these superfamilies, the equilibrative and concentrative nucleoside transporters, have human members and these will be examined in depth in this review . The human equilibrative nucleoside transporters translocate nucleosides and nucleobases bidirectionally down their concentration gradients and are important in the uptake of anticancer and antiviral nucleoside drugs . The human concentrative nucleoside transporters cotranslocate nucleosides and sodium unidirectionally against the nucleoside concentration gradients and play a vital role in certain tissues . The regulation of nucleoside and nucleobase transporters is being studied more intensely now that more tools are available . This review provides an overview of recent advances in the molecular biology and regulation of the nucleoside and nucleobase transporters.

World J Gastroenterol, 2002 Dec, 8(6), 1088 - 93
Establishment of a simple assay in vitro for hepatitis C virus NS3 serine protease based on recombinant substrate and single-chain protease; Du GX et al.; AIM: To establish a simple and convenient assay in vitro for the Hepatitis C virus NS3 serine protease based on the recombinant protease and substrate, and to evaluate its feasibility in screening the enzyme inhibitors . METHODS: Based on the crystallographic structure of hepatitis C virus (HCV) serine protease, a novel single-chain serine protease was designed, in which the central sequence of cofactor NS4A was linked to the N-terminus of NS3 serine protease domain via a flexible linker GSGS . The fusion gene was obtained by two-step PCR that was carried out with three primers and then cloned into the prokaryotic expression vector pQE30, and the recombinant clone was verified by DNA sequencing . The single-chain recombinant protease was expressed when the E.coli was induced with IPTG and the expression conditions were optimized to produce large amount of soluble protease . The recombinant substrate NS5ab that covers the cleavage point NS5A/B was also expressed in E.coli . Both of the protease and substrate were purified by using Ni-NTA agarose metal affinity resin, then they were mixed together in a specific buffer, and the mixture was analyzed by SDS-PAGE . The cleavage system was used to evaluate some compounds for their inhibitory activity on serine protease . RESULTS: The single-chain recombinant protease was over-expressed as soluble protein when the E.coli was induced at a low dosage of IPTG (0.2 mM) and cultured at a low temperature (15 degrees ) . The protease was purified by using Ni-NTA agarose metal affinity resin (the purity is over 95 %) . The recombinant substrate NS5ab was expressed in an insoluble form and could refold successfully after purification and dialysis . A simple and convenient assay in vitro was established, in which the purified single-chain serine protease could cleave the recombinant substrate NS5ab into two fragments that were visualized by SDS-PAGE . PMSF had an effect on inhibiting activity of serine protease, while EDTA had not . CONCLUSION: A simple and convenient assay in vitro for hepatitis C virus NS3 serine protease is based on recombinant substrate NS5ab and single-chain serine protease . This assay can be used in screening of enzyme inhibitors.

Proc Natl Acad Sci U S A, 2002 Nov 26, 99(24), 15327 - 32 Epub 2002 Nov 18.
Escherichia coli RecO protein anneals ssDNA complexed with its cognate ssDNA-binding protein: A common step in genetic recombination; Kantake N et al.; We present biochemical evidence for the functional similarity of Escherichia coli RecO protein and bacteriophage T4 UvsY protein to eukaryotic Rad52 protein . Although Rad52 protein is conserved in eukaryotes, no sequence homologue has been found in prokaryotes or archeabacteria . Rad52 protein has two unique activities: facilitation of replication protein-A (RPA) displacement by Rad51 protein and annealing of RPA-single-stranded DNA (ssDNA) complexes . Both activities require species-specific interaction between Rad52 protein and RPA . Both RecO and UvsY proteins also possess the former property with regard to their cognate ssDNA-binding protein . Here, we report that RecO protein anneals ssDNA that is complexed with only its cognate ssDNA-binding protein, suggesting the involvement of species-specific interactions . Optimal activity for RecO protein occurs after formation of a 1:1 complex with SSB protein . RecR protein, which is known to stimulate RecO protein to facilitate SSB protein displacement by RecA protein, inhibits annealing by RecO protein, suggesting that RecR protein may regulate the choice between the DNA strand invasion versus annealing pathways . In addition, we show that UvsY protein anneals ssDNA; furthermore, ssDNA, which is complexed only with its cognate ssDNA-binding protein, is annealed in the presence of UvsY protein . These results indicate that RecO and possibly UvsY proteins are functional counterparts of Rad52 protein . Based on the conservation of these functions, we propose a modified double-strand break repair model that includes DNA annealing as an important intermediate step.

Proc Natl Acad Sci U S A, 2002 Nov 26, 99(24), 15554 - 9 Epub 2002 Nov 15.
Identification of the gene responsible for the cblA complementation group of vitamin B12-responsive methylmalonic acidemia based on analysis of prokaryotic gene arrangements; Dobson CM et al.; Vitamin B(12) (cobalamin) is an essential cofactor of two enzymes, methionine synthase and methylmalonyl-CoA mutase . The conversion of the vitamin to its coenzymes requires a series of biochemical modifications for which several genetic diseases are known, comprising eight complementation groups (cblA through cblH) . The objective of this study was to clone the gene responsible for the cblA complementation group thought to represent a mitochondrial cobalamin reductase . Examination of bacterial operons containing genes in close proximity to the gene for methylmalonyl-CoA mutase and searching for orthologous sequences in the human genome yielded potential candidates . A candidate gene was evaluated for deleterious mutations in cblA patient cell lines, which revealed a 4-bp deletion in three cell lines, as well as an 8-bp insertion and point mutations causing a stop codon and an amino acid substitution . These data confirm that the identified gene, MMAA, corresponds to the cblA complementation group . It is located on chromosome 4q31.1-2 and encodes a predicted protein of 418 aa . A Northern blot revealed RNA species of 1.4, 2.6, and 5.5 kb predominating in liver and skeletal muscle . The deduced amino acid sequence reveals a domain structure, which belongs to the AAA ATPase superfamily that encompasses a wide variety of proteins including ATP-binding cassette transporter accessory proteins that bind ATP and GTP . We speculate that we have identified a component of a transporter or an accessory protein that is involved in the translocation of vitamin B(12) into mitochondria.

J Virol, 2002 Dec, 76(24), 12900 - 7
Conjugate-based targeting of recombinant adeno-associated virus type 2 vectors by using avidin-linked ligands; Ponnazhagan S et al.; The development of targeted vectors, capable of tissue-specific transduction, remains one of the important aspects of vector modification for gene therapy applications . Recombinant adeno-associated virus type 2 (rAAV-2)-based vectors are nonpathogenic, have relatively low immunogenicity, and are capable of long-term transgene expression . AAV-2 vectors bind primarily to heparan sulfate proteoglycan (HSPG), a receptor that is present in many tissues and cell types . Because of the widespread expression of HSPG on many tissues, targeted transduction in vivo appears to be limited with AAV-2 vectors . Thus, development of strategies to achieve transductional targeting will have a profound benefit in the future application of these vectors . We report here a novel conjugate-based targeting method to enhance tissue-specific transduction of AAV-2-based vectors . The present report utilized a high-affinity biotin-avidin interaction as a molecular bridge to cross-link purified targeting ligands, produced genetically as fusion proteins to core-streptavidin, in a prokaryotic expression system . Conjugation of the bispecific targeting protein to the vector was achieved by biotinylating purified rAAV-2 without abolishing the capsid structure, internalization, and subsequent transgene expression . The tropism-modified vectors, targeted via epidermal growth factor receptor (EGFR) or fibroblast growth factor 1alpha receptor (FGFR1alpha), resulted in a significant increase in transduction efficiency of EGFR-positive SKOV3.ip1 cells and FGFR1alpha-positive M07e cells, respectively . Further optimization of this method of targeting should enhance the potential of AAV-2 vectors in ex vivo and in vivo gene therapy and may form the basis for developing targeting methods for other AAV serotype capsids.

Mol Cell Proteomics, 2002 Oct, 1(10), 781 - 90
Chemical strategies for functional proteomics; Adam GC et al.; With complete genome sequences now available for several prokaryotic and eukaryotic organisms, biological researchers are charged with the task of assigning molecular and cellular functions to thousands of predicted gene products . To address this problem, the field of proteomics seeks to develop and apply methods for the global analysis of protein expression and protein function . Here we review a promising new class of proteomic strategies that utilizes synthetic chemistry to create tools and assays for the characterization of protein samples of high complexity . These approaches include the development of chemical affinity tags to measure the relative expression level and post-translational modification state of proteins in cell and tissue proteomes . Additionally, we discuss the emerging field of activity-based protein profiling, which aims to synthesize and apply small molecule probes that monitor dynamics in protein function in complex proteomes.

J Biol Chem, 2003 Jan 31, 278(5), 3227 - 34 Epub 2002 Nov 15.
Cytosolic aconitase and ferritin are regulated by iron in Caenorhabditis elegans; Gourley BL et al.; Iron regulatory protein-1 (IRP-1) is a cytosolic RNA-binding protein that is a regulator of iron homeostasis in mammalian cells . IRP-1 binds to RNA structures, known as iron-responsive elements, located in the untranslated regions of specific mRNAs, and it regulates the translation or stability of these mRNAs . Iron regulates IRP-1 activity by converting it from an RNA-binding apoprotein into a {4Fe-4S} cluster protein exhibiting aconitase activity . IRP-1 is widely found in prokaryotes and eukaryotes . Here, we report the biochemical characterization and regulation of an IRP-1 homolog in Caenorhabditis elegans (GEI-22/ACO-1) . GEI-22/ACO-1 is expressed in the cytosol of cells of the hypodermis and the intestine . Like mammalian IRP-1/aconitases, GEI-22/ACO-1 exhibits aconitase activity and is post-translationally regulated by iron . Although GEI-22/ACO-1 shares striking resemblance to mammalian IRP-1, it fails to bind RNA . This is consistent with the lack of iron-responsive elements in the C . elegans ferritin genes, ftn-1 and ftn-2 . While mammalian ferritin H and L mRNAs are translationally regulated by iron, the amounts of C . elegans ftn-1 and ftn-2 mRNAs are increased by iron and decreased by iron chelation . Excess iron did not significantly alter worm development but did shorten their life span . These studies indicated that iron homeostasis in C . elegans shares some similarities with those of vertebrates.

J Biomol Struct Dyn, 2002 Dec, 20(3), 413 - 20
Distribution of rare triplets along mRNA and their relation to protein folding; Makhoul CH et al.; It is believed that pausing during mRNA translation plays some role in ensuring proper folding of newly synthesized sections of a protein chain . Such pausing occurs when rare triplets are encountered in the mRNA, as it takes additional time for the corresponding rare species of tRNA to be delivered . To determine whether pause sites are non-randomly distributed along prokaryotic mRNA (cDNA), we have located clusters of rare triplets in cDNA sequences from 21 different bacteria . From the individual profiles of local codon frequencies calculated with various windows, the positions of the clusters of the rarest codons were taken for generation of the combined histograms of positional preferences of the pause sites . The histograms show that in the prokaryotic sequences, the pause sites are located preferentially at the start positions and at about 155 triplets from the starts . To verify the generality of these observations, the data are grouped in six independent sets about 500 sequences each, all revealing the same features . A less prominent maximum is also seen at the triplet position 75 . Judging by the amplitude of the peak at 155 triplets, an optimal cluster size is estimated to equal 18 triplets . The distance 155 closely corresponds to the sizes of typical protein folds and to earlier estimated prokaryotic protein sequence segments . This supports the suggestion of a role for translation pausing in the cotranslational folding of protein domains . The profiles of rare codons in mRNA can serve in the detection or prediction of boundaries between protein domains.

Prog Brain Res, 2002, 139, 163 - 77
Expression of human vasopressin and oxytocin receptors in Escherichia coli; Mouillac B et al.; In order to produce large amounts of human vasopressin and oxytocin receptors compatible with direct structural biology approaches such as X-ray crystallography, NMR or mass spectrometry, we have expressed these neurohypophysial hormone receptors in Escherichia coli . To facilitate the level of expression, the coding sequence for the V1a vasopressin receptor and the oxytocin receptor were first optimized for bacterial expression . The resulting 'bacterial receptor cDNAs' were then subcloned into pET/T7-driven prokaryotic expression vectors . Different constructs have been prepared: each cDNA was incorporated alone or in fusion with a T7 tag sequence or a glutathione-S-transferase tag sequence at the N-terminus end . Moreover, a 6 x His tag sequence has been added at the C-terminus end for one-step purification of the receptors . Screening of BL21(DE3) and BL21(DE3)pLysS bacterial strains transformed with the different constructions was achieved by Coomassie blue-stained SDS-polyacrylamide gels and by 6 x His antibody Western blotting . Several clones were selected for purification of the receptors . Expression levels of the receptors are now encouraging and will be optimized for further structural and functional studies . Moreover, at the same time, the construction of the bacterial-optimized sequence of the V2 vasopressin receptor and its expression will be performed.

Biochem J, 2003 Feb 15, 370(Pt 1), 299 - 305
A sulphoquinovosyl diacylglycerol is a DNA polymerase epsilon inhibitor; Mizushina Y et al.; Sulphoquinovosyl diacylglycerol (SQDG) was reported as a selective inhibitor of eukaryotic DNA polymerases alpha and beta {Hanashima, Mizushina, Ohta, Yamazaki, Sugawara and Sakaguchi (2000) Jpn . J . Cancer Res . 91, 1073-1083} and an immunosuppressive agent {Matsumoto, Sahara, Fujita, Shimozawa, Takenouchi, Torigoe, Hanashima, Yamazaki, Takahashi, Sugawara et al . (2002) Transplantation 74, 261-267} . The purpose of this paper is to elucidate the biochemical properties of the inhibition more precisely . As expected, SQDG could inhibit the activities of mammalian DNA polymerases such as alpha, delta, eta and kappa in vitro in the range of 2-5 micro M, and beta and lambda in vitro in the range of 20-45 micro M . However, SQDG could inhibit only mammalian DNA polymerases epsilon (pol epsilon) activity at less than 0.04 micro M . SQDG bound more tightly to mammalian pol epsilon than the other mammalian polymerases tested . Moreover, SQDG could inhibit the activities of all the polymerases from animals such as fish and insect, but not of the polymerases from plant and prokaryotes . SQDG should, therefore, be called a mammalian pol epsilon-specific inhibitor or animal polymerase-specific inhibitor . To our knowledge, this represents the first report about an inhibitor specific to mammalian pol epsilon.

Int Immunopharmacol, 2002 Oct, 2(11), 1557 - 66
Antiviral and antitumoral effects of recombinant chicken myelomonocytic growth factor in virally induced lymphoma; Djeraba A et al.; Chicken myelomonocytic growth factor (cMGF) is a 27-kDa glycoprotein that stimulates the growth and activation of cells from the monocyte/macrophage lineage . Recombinant cMGF was produced in a prokaryotic (Escherichia coli) expression system and purified via a C-terminal His-tag . Treatment of 2-week-old histocompatible B(13)/B(13) chickens highly susceptible to Marek's disease (MD) with rcMGF (two daily injections of 50 microg rcMGF per chicken) enhanced background and LPS-inducible systemic NO (NO3- + NO2-) responses 3 days later . NO has antiviral activity on Marek's disease virus (MDV), a herpesvirus specifically inducing T cell-lymphomas in chickens . When the very virulent strain of MDV RBI-B was inoculated 3 days after treatment with rcMGF, MDV viremia was significantly inhibited and development of visceral tumors was drastically reduced . Combination of rcMGF with partially protective vaccination using a herpesvirus of turkey (HVT) further reducedtumor burden and significantly delayed mortality, but only in very young birds . In conclusion, rcMGF might be worth considering as a stimulator of innate immune response in chickens, such as activation of macrophages and NO production, and thus be beneficial for its antiviral and antitumoral effects in vaccination against MD lymphoma.

J Mol Microbiol Biotechnol, 2002 Sep, 4(5), 467 - 77
Predatory prokaryotes: an emerging research opportunity; Martin MO; Predatory prokaryotes have evolved a unique strategy of obtaining energy and biosynthetic materials from their surroundings: acquiring them from other living bacterial cells . These types of microbes have been found in a diverse variety of environments, and may play an important role in modulating microbial population structure and dynamics, as has been hypothesized for marine viruses and possibly protists . Only one genus of predatory bacterium, Bdellovibrio, has been extensively described and studied, though several other examples have been reported in the literature . In this review, the four basic strategies used by currently described predatory prokaryotes will be discussed: "wolfpack" group predation, epibiotic attachment, direct cytoplasmic invasion, and periplasmic invasion . Special adaptations to each approach will be considered, and compared overall to the genetic and biochemical characteristics of symbiotic or pathogenic prokaryotes living within eukaryotic cells . Two specific examples of predatory microbes, Bdellovibrio and Ensifer, will be described in terms of predation strategy, association with host cells, and host range . The prospects for bringing to bear the tools of molecular microbial genetics to the study of predatory prokaryotes will be explored, using current research with Bdellovibrio and Ensifer as examples.

J Exp Bot, 2002 Dec, 53(379), 2325 - 31
The novel ethylene-regulated gene OsUsp1 from rice encodes a member of a plant protein family related to prokaryotic universal stress proteins; Sauter M et al.; Using subtractive hybridization a submergence-induced gene was identified from deepwater rice, OsUsp1, that encodes a homologue of the bacterial universal stress protein family . Sequence analysis revealed that OsUSP1 is most closely related to the bacterial MJ0577-type of ATP-binding USP proteins which have been suggested to act as a molecular switch . USP protein homologues appear to be ubiquitous in plants and are encoded by gene families, but are absent in animal species . In the youngest internode of deepwater rice plants, OsUsp1 expression was very strongly induced within 1 h of submergence . Elevated transcript levels were observed in dividing cells, in expanding cells and in differentiated tissue indicating that USP1 mediates a general process . Gene induction was shown to be regulated by ethylene with a highly similar expression pattern to that observed with submergence treatment . Based on sequence information and on expression data it is hypothesized that OsUSP1 plays a role in ethylene-mediated stress adaptation in rice.

J Anat, 2002 Oct, 201(4), 281 - 304
Structure, function and evolution of the gas exchangers: comparative perspectives; Maina JN; Over the evolutionary continuum, animals have faced similar fundamental challenges of acquiring molecular oxygen for aerobic metabolism . Under limitations and constraints imposed by factors such as phylogeny, behaviour, body size and environment, they have responded differently in founding optimal respiratory structures . A quintessence of the aphorism that 'necessity is the mother of invention', gas exchangers have been inaugurated through stiff cost-benefit analyses that have evoked transaction of trade-offs and compromises . Cogent structural-functional correlations occur in constructions of gas exchangers: within and between taxa, morphological complexity and respiratory efficiency increase with metabolic capacities and oxygen needs . Highly active, small endotherms have relatively better-refined gas exchangers compared with large, inactive ectotherms . Respiratory structures have developed from the plain cell membrane of the primeval prokaryotic unicells to complex multifunctional ones of the modern Metazoa . Regarding the respiratory medium used to extract oxygen from, animal life has had only two choices--water or air--within the biological range of temperature and pressure the only naturally occurring respirable fluids . In rarer cases, certain animals have adapted to using both media . Gills (evaginated gas exchangers) are the primordial respiratory organs: they are the archetypal water breathing organs . Lungs (invaginated gas exchangers) are the model air breathing organs . Bimodal (transitional) breathers occupy the water-air interface . Presentation and exposure of external (water/air) and internal (haemolymph/blood) respiratory media, features determined by geometric arrangement of the conduits, are important features for gas exchange efficiency: counter-current, cross-current, uniform pool and infinite pool designs have variably developed.

Plant Physiol, 2002 Nov, 130(3), 1121 - 31
Function of a plant stress-induced gene, HVA22 . Synthetic enhancement screen with its yeast homolog reveals its role in vesicular traffic; Brands A et al.; Expression of the barley (Hordeum vulgare) HVA22 gene is induced by environmental stresses, such as dehydration, salinity, and extreme temperatures, and by a plant stress hormone, abscisic acid . Genes sharing high level of sequence similarities with HVA22 exist in diverse eukaryotic organisms, including animals, plants, and fungi, but not in any prokaryotic organisms . The yeast (Saccharomyces cerevisiae) HVA22 homolog, Yop1p, has been shown to interact with the GTPase-interacting protein, Yip1p . Deletion of YOP1 led to only a modest reduction of the stationary phase titer at 37C . A synthetic enhancement mutant screen was performed in the yop1 deletion background to identify genes interacting with YOP1 . The open reading frame YOR165W (renamed SEY1 for synthetic enhancement of YOP1) was identified as a YOP1-dependent complementation gene . The yeast SEY1 is a homolog of the Arabidopsis RHD3 gene whose mutations cause the accumulation of transport vesicles near the tips of defective root hairs . The yeast double mutant of yop1 and sey1 is defective in vesicular traffic as evidenced by the accumulation of transport vesicles and the decrease in invertase secretion . Based on these observations, we suggest that Yop1p/HVA22 regulates vesicular traffic in stressed cells either to facilitate membrane turnover, or to decrease unnecessary secretion.

EMBO J, 2002 Nov 15, 21(22), 6257 - 66
Solution structure and DNA-binding properties of the C-terminal domain of UvrC from E.coli; Singh S et al.; The C-terminal domain of the UvrC protein (UvrC CTD) is essential for 5' incision in the prokaryotic nucleotide excision repair process . We have determined the three-dimensional structure of the UvrC CTD using heteronuclear NMR techniques . The structure shows two helix-hairpin-helix (HhH) motifs connected by a small connector helix . The UvrC CTD is shown to mediate structure-specific DNA binding . The domain binds to a single-stranded-double-stranded junction DNA, with a strong specificity towards looped duplex DNA that contains at least six unpaired bases per loop ("bubble DNA") . Using chemical shift perturbation experiments, the DNA-binding surface is mapped to the first hairpin region encompassing the conserved glycine-valine-glycine residues followed by lysine-arginine-arginine, a positively charged surface patch and the second hairpin region consisting of glycine-isoleucine-serine . A model for the protein-DNA complex is proposed that accounts for this specificity.

Environ Health Perspect, 2002 Oct, 110 Suppl 5, 745 - 8
Arsenate reductases in prokaryotes and eukaryotes; Mukhopadhyay R et al.; The ubiquity of arsenic in the environment has led to the evolution of enzymes for arsenic detoxification . An initial step in arsenic metabolism is the enzymatic reduction of arsenate {As(V)} to arsenite {As(III)} . At least three families of arsenate reductase enzymes have arisen, apparently by convergent evolution . The properties of two of these are described here . The first is the prokaryotic ArsC arsenate reductase of Escherichia coli . The second, Acr2p of Saccharomyces cerevisiae, is the only identified eukaryotic arsenate reductase . Although unrelated to each other, both enzymes receive their reducing equivalents from glutaredoxin and reduced glutathione . The structure of the bacterial ArsC has been solved at 1.65 A . As predicted from its biochemical properties, ArsC structures with covalent enzyme-arsenic intermediates that include either As(V) or As(III) were observed . The yeast Acr2p has an active site motif HC(X)(5)R that is conserved in protein phosphotyrosine phosphatases and rhodanases, suggesting that these three groups of enzymes may have evolved from an ancestral oxyanion-binding protein.

J Eukaryot Microbiol, 2002 Sep-Oct, 49(5), 393 - 401
Sequence survey of the genome of the opportunistic microsporidian pathogen, Vittaforma corneae; Mittleider D et al.; The microsporidian Vittaforma corneae has been reported as a pathogen of the human stratum corneum, where it can cause keratitis, and is associated with systemic infections . In addition to this direct role as an infectious, etiologic agent of human disease, V . corneae has been used as a model organism for another microsporidian, Enterocytozoon bieneusi, a frequent and problematic pathogen of HIV-infected patients that, unlike V . corneae, is difficult to maintain and to study in vitro . Unfortunately, few molecular sequences are available for V . corneae . In this study, seventy-four genome survey sequences (GSS) were obtained from genomic DNA of spores of laboratory-cultured V . corneae . Approximately, 41 discontinuous kilobases of V . corneae were cloned and sequenced to generate these GSS . Putative identities were assigned to 44 of the V . corneae GSS based on BLASTX searches, representing 21 discrete proteins . Of these 21 deduced V . corneae proteins, only two had been reported previously from other microsporidia (until the recent report of the Encephalitozoon cuniculi genome) . Two of the V . corneae proteins were of particular interest, reverse transcriptase and topoisomerase IV (parC) . Since the existence of transposable elements in microsporidia is controversial, the presence of reverse transcriptase in V . corneae will contribute to resolution of this debate . The presence of topoisomerase IV was remarkable because this enzyme previously had been identified only from prokaryotes . The 74 GSS included 26.7 kilobases of unique sequences from which two statistics were generated: GC content and codon usage . The GC content of the unique GSS was 42%, lower than that of another microsporidian, E . cuniculi (48% for protein-encoding regions), and substantially higher than that predicted for a third microsporidian, Spraguea lophii (28%) . A comparison using the Pearson correlation coefficient showed that codon usage in V . corneae was similar to that in the yeasts, Saccharomyces cerevisiae (r = 0.79) and Shizosaccharomyces pombe (r = 0.70), but was markedly dissimilar to E . cuniculi (r = 0.19).

Biochimie, 2002 May-Jun, 84(5-6), 455 - 64
The pore-forming domain of colicin A fused to a signal peptide: a tool for studying pore-formation and inhibition; Duche D; Pore-forming colicins are plasmid-encoded bacteriocins that kill Escherichia coli and closely related bacteria . They bind to receptors in the outer membrane and are translocated across the cell envelope to the inner membrane where they form voltage-dependent ion-channels . Colicins are composed of three domains, with the C-terminal domain responsible for pore-formation . Isolated C-terminal pore-forming domains produced in the cytoplasm of E . coli are inactive due to the polarity of the transmembrane electrochemical potential, which is the opposite of that required . However, the pore-forming domain of colicin A (pfColA) fused to a prokaryotic signal peptide (sp-pfColA) is transported across and inserts into the inner membrane of E . coli from the periplasmic side, forming a functional channel . Sp-pfColA is specifically inhibited by the colicin A immunity protein (Cai) . This construct has been used to investigate colicin A channel formation in vivo and to characterise the interaction of pfColA with Cai within the inner membrane . These points will be developed further in this review.

Biochimie, 2002 May-Jun, 84(5-6), 381 - 9
Killing of E coli cells by E group nuclease colicins; James R et al.; The process by which the endonuclease domain of colicin E9 is translocated across the outer membrane, the periplasmic space and the cytoplasmic membrane to reach the cytoplasm of E . coli cells, resulting in DNA degradation and cell death, is a unique event in prokaryotic biology . Although considerable information is known about the role of the BtuB outer membrane receptor, as well as the mostly periplasmic Tol proteins that are essential for the translocation process, the precise nature of the interactions between colicin E9 and these proteins remains to be elucidated . In this review, we consider our current understanding of the key events in this process, concentrating on recent findings concerning receptor-binding, translocation and the mechanism of cytotoxicity.

Genome Res, 2002 Nov, 12(11), 1642 - 50
Signatures of domain shuffling in the human genome; Kaessmann H et al.; To elucidate the role of exon shuffling in shaping the complexity of the human genome/proteome, we have systematically analyzed intron phase distributions in the coding sequence of human protein domains . We found that introns at the boundaries of domains show high excess of symmetrical phase combinations (i.e., 0-0, 1-1, and 2-2), whereas nonboundary introns show no excess symmetry . This suggests that exon shuffling has primarily involved rearrangement of structural and functional domains as a whole . Furthermore, we found that domains flanked by phase 1 introns have dramatically expanded in the human genome due to domain shuffling and that 1-1 symmetrical domains and domain families are nonrandomly distributed with respect to their age . The predominance and extracellular location of 1-1 symmetrical domains among domains specific to metazoans suggests that they are associated with the rise of multicellularity . On the other hand, 0-0 symmetrical domains tend to be over-represented among ancient protein domains that are shared between the eukaryotic and prokaryotic kingdoms, which is compatible with the suggestion of primordial domain shuffling in the progenote . To see whether the human data reflect general genomic patterns of metazoans, similar analyses were done for the nematode Caenorhabditis elegans . Although the C . elegans data generally concur with the human patterns, we identified fewer intron-bounded domains in this organism, consistent with the lower complexity of C . elegans genes . {The following individuals kindly provided reagents, samples, or unpublished information as indicated in the paper: Z . Gu and R . Stevens.}

J Mol Biol, 2002 Nov 15, 324(1), 137 - 50
Structure of prokaryotic SECIS mRNA hairpin and its interaction with elongation factor SelB; Fourmy D et al.; In prokaryotes, the recoding of a UGA stop codon as a selenocysteine codon requires a special elongation factor (EF) SelB and a stem-loop structure within the mRNA called a selenocysteine insertion sequence (SECIS) . Here, we used NMR spectroscopy to determine the solution structure of the SECIS mRNA hairpin and characterized its interaction with the mRNA-binding domain of SelB . Our structural and biochemical data identified the conserved structural features important for binding to EF SelB within different SECIS RNA sequences . In the free SECIS mRNA structure, conserved nucleotides are strongly exposed for recognition by SelB . Binding of the C-terminal domain of SelB stabilizes the RNA secondary structure . In the protein-RNA complex, a Watson-Crick loop base-pair leaves a GpU sequence accessible for SelB recognition . This GpU sequence at the tip of the capping tetraloop and a bulge uracil five Watson-Crick base-pairs apart from the GpU are essential for interaction with SelB.

J Biol Chem, 2003 Jan 17, 278(3), 1472 - 9 Epub 2002 Nov 01.
Functional dissection of the eukaryotic-specific tRNA-interacting factor of lysyl-tRNA synthetase; Francin M et al.; In the cytoplasm of higher eukaryotic cells, aminoacyl-tRNA synthetases (aaRSs) have polypeptide chain extensions appended to conventional prokaryotic-like synthetase domains . The supplementary domains, referred to as tRNA-interacting factors (tIFs), provide the core synthetases with potent tRNA-binding capacities, a functional requirement related to the low concentration of free tRNA prevailing in the cytoplasm of eukaryotic cells . Lysyl-tRNA synthetase is a component of the multi-tRNA synthetase complex . It exhibits a lysine-rich N-terminal polypeptide extension that increases its catalytic efficiency . The functional characterization of this new type of tRNA-interacting factor has been conducted . Here we describe the systematic substitution of the 13 lysine or arginine residues located within the general RNA-binding domain of hamster LysRS made of 70 residues . Our data show that three lysine and one arginine residues are major building blocks of the tRNA-binding site . Their mutation into alanine led to a reduced affinity for tRNA(3)(Lys) or minimalized tRNA mimicking the acceptor-TPsiC stem-loop of tRNA(3)(Lys) and a decrease in catalytic efficiency similar to that observed after a complete deletion of the N-terminal domain . Moreover, covalent continuity between the tRNA-binding and core domain is a prerequisite for providing LysRS with a tRNA binding capacity . Thus, our results suggest that the ability of LysRS to promote tRNA(Lys) networking during translation or to convey tRNA(3)(Lys) into the human immunodeficiency virus type 1 viral particles rests on the addition in evolution of this tRNA-interacting factor.

FEBS Lett, 2002 Nov 6, 531(2), 204 - 8
Cleavage of a DNA-RNA-DNA/DNA chimeric substrate containing a single ribonucleotide at the DNA-RNA junction with prokaryotic RNases HII; Haruki M et al.; We have analyzed the cleavage specificities of various prokaryotic Type 2 ribonucleases H (RNases H) on chimeric DNA-RNA-DNA/DNA substrates containing one to four ribonucleotides . RNases HII from Bacillus subtilis and Thermococcus kodakaraensis cleaved all of these substrates to produce a DNA segment with a 5'-monoribonucleotide . Consequently, these enzymes cleaved even the chimeric substrate containing a single ribonucleotide at the DNA-RNA junction (5'-side of the single ribonucleotide) . In contrast, Escherichia coli RNase HI and B . subtilis RNase HIII did not cleave the chimeric substrate containing a single ribonucleotide . These results suggest that bacterial and archaeal RNases HII are involved in excision of a single ribonucleotide misincorporated into DNA.

Nat Rev Mol Cell Biol, 2002 Nov, 3(11), 836 - 47
Formation and transfer of disulphide bonds in living cells; Sevier CS et al.; Protein disulphide bonds are formed in the endoplasmic reticulum of eukaryotic cells and the periplasmic space of prokaryotic cells . The main pathways that catalyse the formation of protein disulphide bonds in prokaryotes and eukaryotes are remarkably similar, and they share several mechanistic features . The recent identification of new redox-active proteins in humans and yeast that mechanistically parallel the more established redox-active enzymes indicates that there might be further uncharacterized redox pathways throughout the cell.

Proc Natl Acad Sci U S A, 2002 Nov 12, 99(23), 15112 - 7 Epub 2002 Nov 01.
Analysis of optimality in natural and perturbed metabolic networks; Segre D et al.; An important goal of whole-cell computational modeling is to integrate detailed biochemical information with biological intuition to produce testable predictions . Based on the premise that prokaryotes such as Escherichia coli have maximized their growth performance along evolution, flux balance analysis (FBA) predicts metabolic flux distributions at steady state by using linear programming . Corroborating earlier results, we show that recent intracellular flux data for wild-type E . coli JM101 display excellent agreement with FBA predictions . Although the assumption of optimality for a wild-type bacterium is justifiable, the same argument may not be valid for genetically engineered knockouts or other bacterial strains that were not exposed to long-term evolutionary pressure . We address this point by introducing the method of minimization of metabolic adjustment (MOMA), whereby we test the hypothesis that knockout metabolic fluxes undergo a minimal redistribution with respect to the flux configuration of the wild type . MOMA employs quadratic programming to identify a point in flux space, which is closest to the wild-type point, compatibly with the gene deletion constraint . Comparing MOMA and FBA predictions to experimental flux data for E . coli pyruvate kinase mutant PB25, we find that MOMA displays a significantly higher correlation than FBA . Our method is further supported by experimental data for E . coli knockout growth rates . It can therefore be used for predicting the behavior of perturbed metabolic networks, whose growth performance is in general suboptimal . MOMA and its possible future extensions may be useful in understanding the evolutionary optimization of metabolism.

BMC Evol Biol . 2002 Nov 01;2(1):20.
The relationship of protein conservation and sequence length; Lipman DJ et al.; BACKGROUND: In general, the length of a protein sequence is determined by its function and the wide variance in the lengths of an organism's proteins reflects the diversity of specific functional roles for these proteins . However, additional evolutionary forces that affect the length of a protein may be revealed by studying the length distributions of proteins evolving under weaker functional constraints . RESULTS: We performed sequence comparisons to distinguish highly conserved and poorly conserved proteins from the bacterium Escherichia coli, the archaeon Archaeoglobus fulgidus, and the eukaryotes Saccharomyces cerevisiae, Drosophila melanogaster, and Homo sapiens . For all organisms studied, the conserved and nonconserved proteins have strikingly different length distributions . The conserved proteins are, on average, longer than the poorly conserved ones, and the length distributions for the poorly conserved proteins have a relatively narrow peak, in contrast to the conserved proteins whose lengths spread over a wider range of values . For the two prokaryotes studied, the poorly conserved proteins approximate the minimal length distribution expected for a diverse range of structural folds . CONCLUSIONS: There is a relationship between protein conservation and sequence length . For all the organisms studied, there seems to be a significant evolutionary trend favoring shorter proteins in the absence of other, more specific functional constraints.

Mol Microbiol, 2002 Nov, 46(3), 879 - 87
Mutants in flaI and flaJ of the archaeon Methanococcus voltae are deficient in flagellum assembly; Thomas NA et al.; The fla gene locus of Methanococcus voltae encodes the major structural components of the flagellum as well as other flagellar-related proteins . The flaHIJ genes have been found in all flagellated archaea, suggesting a central role in flagella biogenesis . FlaI shares similarity with the type II and type IV secretion NTPases (such as PilB, VirB11 and TadA), and FlaJ exhibits similarity to putative bacterial integral membrane proteins involved in type IV pilus biogenesis such as TadB . In this study, reverse transcription polymerase chain reaction (RT-PCR) and Northern blotting data revealed that flaHIJ are co-transcribed with the upstream structural flagellin genes, thus demonstrating the expression of the entire fla gene cluster in vivo . Non-polar mutants in flaI and flaJ of M . voltae were isolated using insertional inactivation via a novel mutagenic vector . These mutants were non-motile and non-flagellated by microscopy, demonstrating the involvement of FlaI and FlaJ in flagella biogenesis . Interestingly, all the mutants maintained the ability to produce and localize flagellins to the cytoplasmic membrane . Amino-terminal sequencing of flagellins produced by the flaJ mutant strain revealed that the flagellins did not have their cognate leader peptides, thus indicating that preflagellin processing had occurred in vivo . This result was confirmed using an in vitro processing assay . The fla- phenotype and protein secretion characteristics of the flaI and flaJ mutants therefore implicate these respective genes in archaeal flagellin secretion and assembly . These findings further support a model describing the archaeal flagellum as a novel prokaryotic motility structure.

Mol Microbiol, 2002 Nov, 46(3), 719 - 29
Characterization of interaction sites in the Saccharomyces cerevisiae ribosomal stalk components; Lalioti VS et al.; The interactions among the yeast stalk components (P0, P1alpha, P1beta, P2alpha and P2beta) and with EF-2 have been explored using immunoprecipitation, affinity chromatography and the two-hybrid system . No stable association was detected between acidic proteins of the same type . In contrast, P1alpha and P1beta were found to interact with P2beta and P2alpha respectively . An interaction of P0 with P1 proteins, but not with P2 proteins, was also detected . This interaction is strongly increased with the P0 carboxyl end, which is able to form a pentameric complex with the four acidic proteins . The P1/P2 binding site has been located between residues 212 and 262 using different C-terminal P0 fragments . Immunoprecipitation shows the association of EF-2 with protein P0 . However, the interaction is stronger with the P1/P2 proteins than with P0 in the two-hybrid assay . This interaction improves using the 100-amino-acid-long C-end of P0 and is even higher with the last 50 amino acids . The data indicate a specific association of P1alpha with P2beta and of P1beta with P2alpha rather than the dimerization of the acidic proteins found in prokaryotes . In addition, they suggest that stalk assembly begins by the interaction of the P1 proteins with P0 . Moreover, as functional interactions of the complete P0 were found to increase using protein fragments, the data suggest that some active sites are exposed in the ribosome as a result of conformational changes that take place during stalk assembly and function.

J Exp Zool, 2002 Nov 1, 293(6), 617 - 23
Identification of the 48-kDa G11 protein from guinea pig testes as sperad; Ilayperuma I; A protein found specifically in the membrane of spermatozoa called G11 has been implicated in sperm-egg binding and fusion . This study describes purification and identification of the G11 antigen . The G11 protein was purified using anion exchange chromatography, immunoaffinity chromatography and preparative SDS-PAGE and was subjected to amino acid microsequencing by tandem mass spectrometry . Internal amino acid sequence data derived from the 48-kDa G11 protein revealed that G11 is the recently discovered guinea pig sperm protein, sperad . Sperad is a transmembrane protein present in the periacrosomal plasma membrane of guinea pig sperm . The cytoplasmic domain of sperad was amplified from a guinea pig testes cDNA expression library by polymerase chain reaction and cloned into a prokaryotic gene expression vector, pGEX-2T . The recombinant glutathione S-transferase fusion protein was immunoblotted with monoclonal antibody G11 . The results obtained from this study confirmed the monoclonal antibody G11 epitope location on the cytoplasmic domain of sperad .

BioDrugs, 2002, 16(5), 331 - 7
Bacterial genomics: potential for antimicrobial drug discovery; Fritz B et al.; The sequencing of entire bacterial genomes is becoming increasingly routine, promising to revolutionise approaches to identifying putative antimicrobial drug targets . In silico methods can be used to identify putative gene products by comparing sequences of biochemically characterised enzymes and proteins with data produced by sequencing projects . Comparative genomics between a pathogenic bacterium versus nonpathogen as well as pathogen versus host can identify molecular targets that would be ideal for future investigation . The aim of these comparisons would be to identify genes that code for pathogenicity factors in the bacterium or genes essential for bacterial survival . The latter set of genes includes those that are nonfunctional or redundant in the host as well as genes absent from the host but essential in the pathogen . The products of these genes would be ideal targets for antimicrobial compounds . If compounds could be generated that disrupt the pathogen's ability to thrive but not affect the host, since there is a lack of the targeted protein, they could prove to be powerful therapeutics . An elegant example illustrating the power of comparative genomics involves comparison of the pathways of bacterial and eukaryotic aminoacyl-tRNA synthesis . Comparison of pathogenic bacterial genomes shows that many bacteria lack the genes encoding either one or two specific aminoacyl-tRNA synthetases, enzymes involved in ensuring correct aminoacylation of tRNA for subsequent translation of the genetic code . Bacteria have an alternative pathway by which amide aminoacyl-tRNAs are formed . Comparative genomics has demonstrated that this pathway is uniquely prokaryotic/archaeal and also relatively widely found in pathogenic bacteria, indicating the potential of the catalytic enzymes of the pathway as targets for novel antimicrobial drugs.

J Gen Physiol, 2002 Nov, 120(5), 663 - 76
Coupling between voltage sensors and activation gate in voltage-gated K+ channels; Lu Z et al.; Current through voltage-gated K+ channels underlies the action potential encoding the electrical signal in excitable cells . The four subunits of a voltage-gated K+ channel each have six transmembrane segments (S1-S6), whereas some other K+ channels, such as eukaryotic inward rectifier K+ channels and the prokaryotic KcsA channel, have only two transmembrane segments (M1 and M2) . A voltage-gated K+ channel is formed by an ion-pore module (S5-S6, equivalent to M1-M2) and the surrounding voltage-sensing modules . The S4 segments are the primary voltage sensors while the intracellular activation gate is located near the COOH-terminal end of S6, although the coupling mechanism between them remains unknown . In the present study, we found that two short, complementary sequences in voltage-gated K+ channels are essential for coupling the voltage sensors to the intracellular activation gate . One sequence is the so called S4-S5 linker distal to the voltage-sensing S4, while the other is around the COOH-terminal end of S6, a region containing the actual gate-forming residues.

Mol Microbiol, 2002 Oct, 46(2), 331 - 47
Two transcriptional regulators GlnR and GlnRII are involved in regulation of nitrogen metabolism in Streptomyces coelicolor A3(2); Fink D et al.; Streptomyces coelicolor has an unusually large arsenal of glutamine synthetase (GS) enzymes: a prokaryotic GSI-beta-subtype enzyme (encoded by glnA), three annotated glnA-like genes of the GSI-alpha-subtype and a eukaryote-like glutamine synthetase II (encoded by glnII) . Under all tested conditions, GSI was found to represent the dominant glutamine synthetase activity . A significant heat-labile GSII activity, which is very low to undetectable in liquid-grown cultures, was only detected in morphologically differentiating S . coelicolor cultures . Analysis of glnA and glnII transcription by S1 nuclease mapping and egfp fusions revealed that, on nitrogen-limiting solid medium, glnII but not glnA expression is upregulated . An OmpR-like regulator protein, GlnR, has previously been implicated in transcriptional control of glnA expression . Gel retardation analysis revealed that GlnR is a DNA-binding protein, which interacts with the glnA promoter . It is not autoregulatory and does not bind to the upstream regions of the glnA-like genes of the alpha-subfamily, nor to the glnII promoter in vitro . A second GlnR target was identified upstream of the amtB gene, encoding a putative ammonium transporter . amtB forms an operon with glnK (encoding a PII protein) and glnD (encoding a putative PII nucleotidylyltransferase) shown by S1 nuclease protection analysis and reverse transcription-polymerase chain reaction (RT-PCR) . An amtB and glnA promoter alignment revealed a putative GlnR operator structure . Downstream of glnII, a gene encoding for another OmpR-like regulator, GlnRII, was identified, with strong similarity to GlnR . Gel shifts with GlnRII showed that the promoters recognized by GlnR are also targets of GlnRII . However, GlnRII also interacted with the glnII upstream region . Only inactivation of glnR resulted in a glutamine auxotrophic phenotype, whereas the glnRII mutant can grow on minimal medium without glutamine.

Biometals, 2002 Dec, 15(4), 341 - 6
Chemistry for an essential biological process: the reduction of ferric iron; Pierre JL et al.; In biological systems, the predominant form of iron is the trivalent Fe(III) form, which is potentially not readily bioavailable because of its hydrolysis and polymerization to insoluble forms . It is also the easiest of the two predominant forms of iron to chelate selectively . In a short overview of iron chemistry, we point out some of the pitfalls using standard redox potentials, comment on the interaction of ferric complexes with hydrogen peroxide to give hydroxyl radicals and address the release of iron from ferrisiderophores . In biological systems there are two classes of ferric reductases, the soluble flavin reductases found in prokaryotes, and the membrane-bound cytochrome b-like reductases found in eukaryotes . Finally the role of dissimilatory ferric reduction in microbial respiration and biomineralization is discussed.

RNA, 2002 Oct, 8(10), 1267 - 79
Inhibition of protein synthesis by aminoglycoside-arginine conjugates; Carriere M et al.; Inhibition of translation by small molecule ligands has proven to be a useful tool for understanding this complex cellular mechanism, as well as providing drugs of significant medical importance . Many small molecule ligands inhibit translation by binding to RNA or RNA/protein components of the ribosomal subunits and usurping their function . A class of peptidomimetics {aminoglycoside-arginine conjugates (AAC)} has recently been designed to inhibit HIV TAR/tat interaction and in experiments aimed at assessing the inhibitory effects of AACs on TAR-containing transcripts, we found that AACs are general inhibitors of translation . Experiments reported herein aim at characterizing these novel properties of AACs . We find that AACs are inhibitors of eukaryotic and prokaryotic translation and exert their effects by blocking peptide chain elongation . Structure/activity relationship studies suggest that inhibition of translation by AACs is directly related to the number of arginine groups present on the aminoglycoside backbone and to the nature of the core aminoglycoside . AACs are therefore attractive tools for understanding and probing ribosome function.

RNA, 2002 Oct, 8(10), 1253 - 66
Two proteins that form a complex are required for 7-methylguanosine modification of yeast tRNA; Alexandrov A et al.; 7-methylguanosine (m7G) modification of tRNA occurs widely in eukaryotes and bacteria, is nearly always found at position 46, and is one of the few modifications that confers a positive charge to the base . Screening of a Saccharomyces cerevisiae genomic library of purified GST-ORF fusion proteins reveals two previously uncharacterized proteins that copurify with m7G methyltransferase activity on pre-tRNA(Phe) . ORF YDL201w encodes Trm8, a protein that is highly conserved in prokaryotes and eukaryotes and that contains an S-adenosylmethionine binding domain . ORF YDR165w encodes Trm82, a less highly conserved protein containing putative WD40 repeats, which are often implicated in macromolecular interactions . Neither protein has significant sequence similarity to yeast Abd1, which catalyzes m7G modification of the 5' cap of mRNA, other than the methyltransferase motif shared by Trm8 and Abd1 . Several lines of evidence indicate that both Trm8 and Trm82 proteins are required for tRNA m7G-methyltransferase activity: Extracts derived from strains lacking either gene have undetectable m7G methyltransferase activity, RNA from strains lacking either gene have much reduced m7G, and coexpression of both proteins is required to overproduce activity . Aniline cleavage mapping shows that Trm8/Trm82 proteins modify pre-tRNAPhe at G46, the site that is modified in vivo . Trm8 and Trm82 proteins form a complex, as affinity purification of Trm8 protein causes copurification of Trm82 protein in approximate equimolar yield . This functional two-protein family appears to be retained in eukaryotes, as expression of both corresponding human proteins, METTL1 and WDR4, is required for m7G-methyltransferase activity.

Bioelectrochemistry, 2002 Nov, 58(1), 41 - 6
Role of lipid membrane-nucleic acid interactions, DNA-membrane contacts and metal (II) cations in origination of initial cells and in evolution of prokaryotes to eukaryotes; Zhdanov RI et al.; The problems of the origin of primary cells and eukaryotic cells are discussed in terms of possible role of interactions between nucleic acids with lipid membrane according to corresponding original hypothesis . We propose that there are two main hypotheses of the origin of primary cells: (a) . RNA appeared before proteins and DNA {Nature 213 (1967) 119}; (b) . it is needed for the appearance of a primary cell, the volume closed by the lipid membrane . There was no information about the ways on how RNA appeared inside that volume for saving the reaction products around . Our hypothesis suggests that one of the starting points in the origination of primary cells was the interaction of nucleic acid and lipid membrane bubbles in the presence of metal (II) ions (which existed in high concentrations in prebiotic conditions), and this resulted in the enclosing of the pro-RNAs inside the lipid membrane . This hypothesis is formulated by us on the basis of experimental biochemical and biophysical studies of the DNA/RNA-phospholipid vesicles interactions in the presence of metal ions (II) fulfilled in the Institute of Biomedical Chemistry, RAMS, Moscow and Institute of Biophysics, RAS, Pushchino . Our belief is that DNA-membrane contacts (DNA-MCs) played an important role in the prokaryotes-to-eukaryotes transition . The model of the confluence of four prokaryotic cells may explain the prokaryotes-to-eukaryotes transition by the way of eukaryotic nuclear pore formation from prokaryotic Bayer' contacts . The main requirement for the following fusion of prokaryotic cells must be their mutual orientation . After possible association, the division of the formed cell is begun . The great advantage of the model of four prokaryotic cells is the profit in the metabolism and the possibility of the intensive growth of intercellular membrane structures.

Bioelectrochemistry, 2002 Nov, 58(1), 23 - 30
DNA-bound lipids of normal and tumor cells: retrospective and outlooks for functional genomics; Struchkov VA et al.; By very soft phenol method, the high-molecular-mass natural DNA complexes (10(8)-10(9) Da), which contain 1-3% specific lipids, were isolated from different eukaryotic and prokaryotic cells . Two pools of DNA-bound lipids were isolated: loosely bound (extracted with 35% ethanol) and tightly bound lipids (extracted after additional treatment DNAse I) . The composition of these two lipid pools of different sources (rat thymus, liver, regenerating liver, loach sperm, pigeon erythrocytes, Zajdel ascites hepatoma, Ehrlich ascites carcinoma, sarcoma 37, Escherichia coli B, T2 phage) was studied . The DNA-bound lipid pools consist of neutral lipids (NL) and phospholipids (PL), moreover NL is always in a few fold more than PL . The composition of these lipid pools of eukaryotes distinguishes between themselves, mainly, by free cholesterol (minor fraction), cardiolipin (major fraction), and by phosphatidylcholine . Only the tightly bound lipid pool was present in T2 phage DNA . The dramatic redistribution effect between all fractions of NL pools (free and ester cholesterol, free fatty acids, diglycerides) was observed in DNA synthesis phase of cell cycle on the background of the unchanged composition of PL pools . Comparative analysis of DNA-bound lipid pools of normal and cancer cells was carried out . The DNA-bound lipid pools of transformed cells significantly differ from the same normal cells both by PL composition (cardiolipin) and by the presence of additional fractions (mono- and triglycerides) as well . The possible functions of DNA-bound lipid pools, especially of cardiolipin and cholesterol at the attachment of DNA loops to the nuclear matrix, DNA replicon organization, replication, and transcription are discussed.

J Bacteriol, 2002 Nov, 184(22), 6100 - 8
A DNA methyltransferase can protect the genome from postdisturbance attack by a restriction-modification gene complex; Takahashi N et al.; In prokaryotic genomes, some DNA methyltransferases form a restriction-modification gene complex, but some others are present by themselves . Dcm gene product, one of these orphan methyltransferases found in Escherichia coli and related bacteria, methylates DNA to generate 5'-C(m)CWGG just as some of its eukaryotic homologues do . Vsr mismatch repair function of an adjacent gene prevents C-to-T mutagenesis enhanced by this methylation but promotes other types of mutation and likely has affected genome evolution . The reason for the existence of the dcm-vsr gene pair has been unclear . Earlier we found that several restriction-modification gene complexes behave selfishly in that their loss from a cell leads to cell killing through restriction attack on the genome . There is also increasing evidence for their potential mobility . EcoRII restriction-modification gene complex recognizes the same sequence as Dcm, and its methyltransferase is phylogenetically related to Dcm . In the present work, we found that stabilization of maintenance of a plasmid by linkage of EcoRII gene complex, likely through postsegregational cell killing, is diminished by dcm function . Disturbance of EcoRII restriction-modification gene complex led to extensive chromosome degradation and severe loss of cell viability . This cell killing was partially suppressed by chromosomal dcm and completely abolished by dcm expressed from a plasmid . Dcm, therefore, can play the role of a "molecular vaccine" by defending the genome against parasitism by a restriction-modification gene complex.

J Biol Chem, 2003 Jan 3, 278(1), 645 - 50 Epub 2002 Oct 23.
Co-translational incorporation of trans-4-hydroxyproline into recombinant proteins in bacteria; Buechter DD et al.; Trans-4-hydroxyproline (Hyp) in eukaryotic proteins arises from post-translational modification of proline residues . Because the modification enzyme is not present in prokaryotes, no natural means exists to incorporate Hyp into proteins synthesized in Escherichia coli . We show here that under appropriate culture conditions Hyp is incorporated co-translationally directly at proline codons in genes expressed in E . coli . The use of Hyp by E . coli protein synthesis machinery under typical culture conditions is not adequate to support protein synthesis; however, intracellular concentrations of Hyp sufficient to compensate for the poor use are achieved in media with hyperosmotic sodium chloride concentrations . Hyp incorporation was demonstrated in several recombinant proteins including human Type I collagen polypeptides . A fragment of the human collagen Type I (alpha1) polypeptide with global Hyp for Pro substitution forms a triple helix . Our results demonstrate a remarkable pliancy in the biosynthetic apparatus of bacteria that may be used more generally to incorporate novel amino acids into recombinant proteins.

J Mol Med, 2002 Oct, 80(10), 648 - 54 Epub 2002 Aug 28.
Linear closed mini DNA generated by the prokaryotic cleaving-joining enzyme TelN is functional in mammalian cells; Heinrich J et al.; For application of DNA in gene medicine plasmid or viral DNA is usually used as a vector for the gene of interest . To generate DNA with a minimum of foreign DNA sequences, we used the prokaryotic telomerase, protelomerase TelN, of bacteriophage N15 . This is a novel enzyme with cleaving-joining activity, which is required for the formation of linear prophage DNA with closed ends in lysogenic bacteria . Acting on a telomere resolution site telRL, the protelomerase converts circular plasmid DNA into linear covalently closed dumbbell-shaped molecules ("doggybones") in a single-step enzyme reaction . Two such sites were inserted into an expression plasmid flanking a gene of interest . This is cleaved and joined by means of the protelomerase, yielding linear closed mini DNA coding for green fluorescent protein (EGFP) or interleukin-12 (IL-12) . Upon transient transfection of human embryonal kidney cells, EGFP was expressed at higher levels from linear closed molecules than from linear open molecules generated by restriction endonucleases for comparison . The level of transcription was comparable to that observed for the parental plasmid DNA . To test whether the linear closed mini DNA molecules are functional in vivo the B16F10/C57BL/6 melanoma metastasis model was applied, where injection of IL-12-expressing DNA inhibits metastasis formation in the lung . The anti-metastatic effect of the IL-12-expressing linear closed DNA was equal or higher than that of the parental plasmid DNA . Therefore, the TelN/ telRL system is well suited to generate linear closed mini DNA with high stability and a minimum of foreign nucleotide sequences.

BMC Mol Biol . 2002 Sep 03;3(1):13.
Retroviral vectors for establishing tetracycline-regulated gene expression in an otherwise recalcitrant cell line; Kenny PA et al.; BACKGROUND: Tetracycline-regulated systems have been used to control the expression of heterologous genes in such diverse organisms as yeast, plants, flies and mice . Adaptation of this prokaryotic regulatory system avoids many of the problems inherent in other inducible systems . There have, however, been many reports of difficulties in establishing functioning stable cell lines due to the cytotoxic effects of expressing high levels of the tetracycline transactivator, tTA, from a strong viral promoter . RESULTS: Here we report the successful incorporation of tetracycline-mediated gene expression in a mouse mammary epithelial cell line, HC11, in which conventional approaches failed . We generated retroviruses in which tTA expression was controlled by one of three promoters: a synthetic tetracycline responsive promoter (TRE), the elongation factor 1-alpha promoter (EF1alpha) or the phosphoglycerate kinase-1 promoter (PGK), and compared the resulting cell lines to one generated using a cytomegalovirus immediate early gene promoter (CMV) . In contrast to cells produced using the CMV and PGK promoters, those produced using the EF1alpha and TRE promoters expressed high levels of beta-galactosidase in a tetracycline-dependent manner . CONCLUSIONS: These novel retroviral vectors performed better than the commercially available system and may have a more general utility in similarly recalcitrant cell lines.

Di Yi Jun Yi Da Xue Xue Bao, 2002 Jan, 22(1), 3 - 5
Study on the cloning, expression and the immunogenicity of helicobacter pylori heat shock protein 60 gene; Bai Y et al.; OBJECTIVE: To construct a recombinant strain of bacteria expressing heat shock protein of (Hsp) Helicobacter pylori (Hp) and study the immunogenicity of Hsp60.METHODS: PCR amplification of Hsp60 DNA was performed before it was inserted into the prokaryotic expression vector pET-22b(+) to transform BL21(DE3) E.coli strain . Hsp60 expressed by the recombinant E.coli was collected and purified for immunogenicity assessment in mice . RESULTS: DNA sequence analysis showed identical DNA sequence of Hsp60 thus produced to that published in Genbank . Accounting for a ratio of 27.2% among the total protein production in the bacterium, recombinant Hsp60 protein was recognized by the serum from Hp-infected patients and produced corresponding antibody in Balb/c mice in response to immunization . CONCLUSION: Recombinant Hsp60 protein can be used potentially as a vaccine for controlling and treating Hp infection.

Di Yi Jun Yi Da Xue Xue Bao, 2002 Mar, 22(3), 227 - 30
Construction of the recombinant plasmid FasAD-pTYB2 capable of Fas activation domain fusion expression; Feng XQ et al.; OBJECTIVE: To construct the recombinant plasmid FasAD-pTYB2 for the fusion expression of Fas activation domain (FasAD) . METHODS: FasAD cDNA was cloned by semi-nested reverse transcriptase-polymerase chain reaction (RT-PCR), and then inserted into the universal vector of pGEM-T for the identification of its DNA sequence . The target DNA fragment was inserted into the prokaryote vector pTYB2 that expressed intein to construct the plasmid recombinant FasAD-pTYB2 which was induced by isopropylthio-beta-D-galactoside for the expression of the fusion protein . RESULTS: DNA sequence analysis confirmed sequence of FasAD cDNA previously cloned, and expression of the fusion protein by the recombinant plasmid was achieved, the product recognizable by rabbit anti-human Fas polyclonal antibody as demonstrated by Western blotting analysis . CONCLUSION: The recombinant plasmid FasAD-pTYB2 constructed in this study is capable of expressing the fusion protein of FasAD and intein, which may be significant for further study of the epitope and function of Fas antigen.

J Biomed Sci, 1997, 4(5), 229 - 234
Divergent Subcellular Locations of HTLV-I Tax and Int-6: A Contrast between in vitro Protein-Protein Binding and Intracellular Protein Colocalization; Neuveut C et al.; Protein-protein interactions define many important molecular and cellular processes in prokaryotic and eukaryotic biology . In trying to delineate the contact between two proteins, the yeast two-hybrid assay has emerged as a powerful technique . Complementing the yeast two-hybrid assay are in vitro techniques (e.g . GST-fusion-protein chromatography) that can also yield information on protein-protein associations . However, unambiguous functional significance to these interactions is best supported through a finding of colocalization of two proteins inside cells . In instances where two proteins interact in vitro but have divergent localizations within cells one needs to reconsider the biological importance of the former finding . Here, we present evidence for different subcellular locations of HTLV-I Tax and the Int-6 protein . We suggest a reexploration of the functional significance between Tax and Int-6 in cellular transformation.

Sheng Wu Gong Cheng Xue Bao, 2002 Jul, 18(4), 415 - 9
{Modification of Chinese hamster ovary cells}; Lai DZ et al.; Chinese hamster ovary cells (CHO) are preferable to prokaryotic, yeast or insect cells as hosts for biopharmaceutical production due to the products are more similar to their natural conformation . However, CHO cells confront tremendous difficulties when cultured in large scale such as mal-adaptation to serum-free medium, apoptosis and over-growth without limitation . So in addition to optimizing CHO system in respect of medium, environment and expression vector, modification of CHO cells themselves has drawn more and more attention . Here the main progress in CHO-modification is reviewed.

Nature, 2002 Oct 17, 419(6908), 715 - 8
A biological role for prokaryotic ClC chloride channels; Iyer R et al.; An unexpected finding emerging from large-scale genome analyses is that prokaryotes express ion channels belonging to molecular families long studied in neurons . Bacteria and archaea are now known to carry genes for potassium channels of the voltage-gated, inward rectifier and calcium-activated classes, ClC-type chloride channels, an ionotropic glutamate receptor and a sodium channel . For two potassium channels and a chloride channel, these homologues have provided a means to direct structure determination . And yet the purposes of these ion channels in bacteria are unknown . Strong conservation of functionally important sequences from bacteria to vertebrates, and of structure itself, suggests that prokaryotes use ion channels in roles more adaptive than providing high-quality protein to structural biologists . Here we show that Escherichia coli uses chloride channels of the widespread ClC family in the extreme acid resistance response . We propose that the channels function as an electrical shunt for an outwardly directed virtual proton pump that is linked to amino acid decarboxylation.

Nucleic Acids Res, 2002 Oct 15, 30(20), 4329 - 38
Biochemical characterisation of the clamp/clamp loader proteins from the euryarchaeon Archaeoglobus fulgidus; Seybert A et al.; Replicative polymerases of eukaryotes, prokaryotes and archaea obtain processivity using ring-shaped DNA sliding clamps that are loaded onto DNA by clamp loaders {replication factor C (RFC) in eukaryotes} . In this study, we cloned the two genes for the subunits of the RFC homologue of the euryarchaeon Archaeoglobus fulgidus . The proteins were expressed and purified from Escherichia coli both individually and as a complex . The afRFC subunits form a heteropentameric complex consisting of one copy of the large subunit and four copies of the small subunits . To analyse the functionality of afRFC, we also expressed the A.fulgidus PCNA homologue and a type B polymerase (PolB1) in E.coli . In primer extension assays, afRFC stimulated the processivity of afPolB1 in afPCNA-dependent reactions . Although the afRFC complex showed significant DNA-dependent ATPase activity, which could be further stimulated by afPCNA, neither of the isolated afRFC subunits showed this activity . However, both the large and small afRFC subunits showed interaction with afPCNA . Furthermore, we demonstrate that ATP binding, but not hydrolysis, is needed to stimulate interactions of the afRFC complex with afPCNA and DNA.

Appl Microbiol Biotechnol, 2002 Oct, 60(1-2), 108 - 13 Epub 2002 Aug 29.
Detection of two distinct substrate-dependent catabolic responses in yeast cells using a mediated electrochemical method; Baronian KH et al.; Mediated electrochemical detection of catabolism in prokaryotic cells is well documented; however, the application of this technique to eukaryotic cells has received less attention . Two catabolic substrate-dependent mediated electrochemical signals were detected in the yeast Saccharomyces cerevisiae . The signal using a single hydrophilic mediator (ferricyanide) is small whereas the response using a double mediator system comprising a hydrophilic and a lipophilic mediator (ferricyanide and menadione) is up to three orders of magnitude larger . The behaviour of each response during cell ageing is different: the single mediator response increases whereas the double mediator response decreases . This difference indicates that the two signals originate at different points in the catabolic pathways . In S . cerevisiae the double mediator response is proposed to originate from the reduction of the lipophilic mediator by NADPH produced in the pentose phosphate pathway . The single mediator signal arises from reduction of the hydrophilic mediator by an extracellular redox species produced in response to the presence of glucose.

Mutat Res, 2002 Oct 31, 508(1-2), 131 - 6
Lack of dependance of transcription-induced cytosine deaminations on protein synthesis; Mokkapati SK et al.; Transcription-induced mutations (TIM) is a phenomenon in Escherichia coli in which transcription promotes C to T and other mutations in a strand-specific manner . Because the processes of transcription and translation are coupled in prokaryotes and some models regarding creating a hypermutagenic state in E . coli require new protein synthesis, we tested the possibility that TIM was dependent on efficient synthesis of proteins . We used puromycin to reversibly inhibit protein synthesis and found that it had little effect on mRNA synthesis, plasmid copy-number or TIM . Our results show that TIM is not dependent on efficient translation of mRNA and this helps eliminate certain models concerning the mechanism underlying TIM.

BMC Evol Biol . 2002 Oct 14;2(1):18 {Epub ahead of print}
Birth and death of protein domains: A simple model of evolution explains power law behavior; Karev GP et al.; Background . Power distributions appear in numerous biological, physical and other contexts, which appear to be fundamentally different . In biology, power laws have been claimed to describe the distributions of the connections of enzymes and metabolites in metabolic networks, the number of interactions partners of a given protein, the number of members in paralogous families, and other quantities . In network analysis, power laws imply evolution of the network with preferential attachment, i.e . a greater likelihood of nodes being added to pre-existing hubs . Exploration of different types of evolutionary models in an attempt to determine which of them lead to power law distributions has the potential of revealing non-trivial aspects of genome evolution . Results . A simple model of evolution of the domain composition of proteomes was developed, with the following elementary processes: i) domain birth (duplication with divergence), ii) death (inactivation and/or deletion), and iii) innovation (emergence from non-coding or non-globular sequences or acquisition via horizontal gene transfer) . This formalism can be described as a birth, death and innovation model (BDIM) . The formulas for equilibrium frequencies of domain families of different size and the total number of families at equilibrium are derived for a general BDIM . All asymptotics of equilibrium frequencies of domain families possible for the given type of models are found and their appearance depending on model parameters is investigated . It is proved that the power law asymptotics appears if, and only if, the model is balanced, i.e . domain duplication and deletion rates are asymptotically equal up to the second order . It is further proved that any power asymptotic with the degree not equal to -1 can appear only if the hypothesis of independence of the duplication/deletion rates on the size of a domain family is rejected . Specific cases of BDIMs, namely simple, linear, polynomial and rational models, are considered in details and the distributions of the equilibrium frequencies of domain families of different size are determined for each case . We apply the BDIM formalism to the analysis of the domain family size distributions in prokaryotic and eukaryotic proteomes and show an excellent fit between these empirical data and a particular form of the model, the second-order balanced linear BDIM . Calculation of the parameters of these models suggests surprisingly high innovation rates, comparable to the total domain birth (duplication) and elimination rates, particularly for prokaryotic genomes . Conclusions . We show that a straightforward model of genome evolution, which does not explicitly include selection, is sufficient to explain the observed distributions of domain family sizes, in which power laws appear as asymptotic . However, for the model to be compatible with the data, there has to be a precise balance between domain birth, death and innovation rates, and this is likely to be maintained by selection . The developed approach is oriented at a mathematical description of evolution of domain composition of proteomes, but a simple reformulation could be applied to models of other evolving networks with preferential attachment.

Biochemistry, 2002 Oct 22, 41(42), 12876 - 82
Topology and secondary structure of the N-terminal domain of diacylglycerol kinase; Oxenoid K et al.; Prokaryotic diacylglycerol kinase (DAGK) functions as a homotrimer of 13 kDa subunits, each of which has three transmembrane segments . This enzyme is conditionally essential to some bacteria and serves as a model system for studies of membrane protein biocatalysis, stability, folding, and misfolding . In this work, the detailed topology and secondary structure of DAGK's N-terminus up through the loop following the first transmembrane domain were probed by NMR spectroscopy . Secondary structure was mapped by measuring 13C NMR chemical shifts . Residue-to-residue topology was probed by measuring 19F NMR relaxation rates for site-specifically labeled samples in the presence and absence of polar and hydrophobic paramagnetic probes . Most of DAGK's N-terminal cytoplasmic and first transmembrane segments are alpha-helical . The first and second transmembrane helices are separated by a short loop from residues 48 to 52 . The first transmembrane segment extends from residues 32 to 48 . Most of the N-terminal cytoplasmic domain lies near the interface but does not extend deeply into the membrane . Finally, catalytic activities measured for the single cysteine mutants before and after chemical labeling suggest that the N-terminal cytoplasmic domain likely contains a number of critical active site residues . The results, therefore, suggest that DAGK's active site lies very near to the water/bilayer interface.

Biochemistry, 2002 Oct 22, 41(42), 12745 - 54
Crystal structures of transhydrogenase domain I with and without bound NADH; Prasad GS et al.; Transhydrogenase (TH) is a dimeric integral membrane enzyme in mitochondria and prokaryotes that couples proton translocation across a membrane with hydride transfer between NAD(H) and NADP(H) in soluble domains . Crystal structures of the NAD(H) binding alpha1 subunit (domain I) of Rhodospirillum rubrum TH have been determined at 1.8 A resolution in the absence of dinucleotide and at 1.9 A resolution with NADH bound . Each structure contains two domain I dimers in the asymmetric unit (AB and CD); the dimers are intimately associated and related by noncrystallographic 2-fold axes . NADH binds to subunits A and D, consistent with the half-of-the-sites reactivity of the enzyme . The conformation of NADH in subunits A and D is very similar; the nicotinamide is in the anti conformation, the A-face is exposed to solvent, and both N7 and O7 participate in hydrogen bonds . Comparison of subunits A and D to six independent copies of the subunit without bound NADH reveals multiple conformations for residues and loops surrounding the NADH site, indicating flexibility for binding and release of the substrate (product) . The NADH-bound structure is also compared to the structures of R . rubrum domain I with NAD bound (PDB code 1F8G) and with NAD bound in complex with domain III of TH (PDB code 1HZZ) . The NADH- vs NAD-bound domain I structures reveal conformational differences in conserved residues in the NAD(H) binding site and in dinucleotide conformation that are correlated with the net charge, i.e., oxidation state, of the nicotinamides . The comparisons illustrate how nicotinamide oxidation state can affect the domain I conformation, which is relevant to the hydride transfer step of the overall reaction.

J Leukoc Biol, 2002 Oct, 72(4), 810 - 8
The chemoattractant Trp-Lys-Tyr-Met-Val-D-Met activates eosinophils through the formyl peptide receptor and one of its homologues, formyl peptide receptor-like 1; Svensson L et al.; Whereas prokaryotes use L- and D-isomers of amino acids in their protein synthesis, eukaryotic proteins as a rule incorporate only L-isomers . Hence, D-isomers may constitute danger signals to the innate immune system . A D-methionine-containing peptide, Trp-Lys-Tyr-Met-Val-D-Met-NH(2) (WKYMVm), has been shown to be a stronger activator of neutrophils than f-Met-Leu-Phe . The aim of this study was to compare the responsiveness of eosinophils to WKYMVm with that of neutrophils . The peptide was found to induce chemotaxis and respiratory burst in eosinophils . However, it did not mobilize granule constituents, as evidenced by a lack of eosinophil cationic protein, eosinophil peroxidase, and interleukin-5 in the supernatants of stimulated eosinophils . In contrast, WKYMVm caused the release of complement receptor 3 from secretory vesicles in neutrophils . Different members of the formyl peptide receptor family were preferentially engaged by the peptide in the two classes of granulocytes: the formyl peptide receptor itself in eosinophils and formyl peptide receptor-like 1 in neutrophils.

Plant Physiol, 2002 Oct, 130(2), 740 - 56
Molecular characterization of a heteromeric ATP-citrate lyase that generates cytosolic acetyl-coenzyme A in Arabidopsis; Fatland BL et al.; Acetyl-coenzyme A (CoA) is used in the cytosol of plant cells for the synthesis of a diverse set of phytochemicals including waxes, isoprenoids, stilbenes, and flavonoids . The source of cytosolic acetyl-CoA is unclear . We identified two Arabidopsis cDNAs that encode proteins similar to the amino and carboxy portions of human ATP-citrate lyase (ACL) . Coexpression of these cDNAs in yeast (Saccharomyces cerevisiae) confers ACL activity, indicating that both the Arabidopsis genes are required for ACL activity . Arabidopsis ACL is a heteromeric enzyme composed of two distinct subunits, ACLA (45 kD) and ACLB (65 kD) . The holoprotein has a molecular mass of 500 kD, which corresponds to a heterooctomer with an A(4)B(4) configuration . ACL activity and the ACLA and ACLB polypeptides are located in the cytosol, consistent with the lack of targeting peptides in the ACLA and ACLB sequences . In the Arabidopsis genome, three genes encode for the ACLA subunit (ACLA-1, At1g10670; ACLA-2, At1g60810; and ACLA-3, At1g09430), and two genes encode the ACLB subunit (ACLB-1, At3g06650 and ACLB-2, At5g49460) . The ACLA and ACLB mRNAs accumulate in coordinated spatial and temporal patterns during plant development . This complex accumulation pattern is consistent with the predicted physiological needs for cytosolic acetyl-CoA, and is closely coordinated with the accumulation pattern of cytosolic acetyl-CoA carboxylase, an enzyme using cytosolic acetyl-CoA as a substrate . Taken together, these results indicate that ACL, encoded by the ACLA and ACLB genes of Arabidopsis, generates cytosolic acetyl-CoA . The heteromeric organization of this enzyme is common to green plants (including Chlorophyceae, Marchantimorpha, Bryopsida, Pinaceae, monocotyledons, and eudicots), species of fungi, Glaucophytes, Chlamydomonas, and prokaryotes . In contrast, all known animal ACL enzymes have a homomeric structure, indicating that a evolutionary fusion of the ACLA and ACLB genes probably occurred early in the evolutionary history of this kingdom.

Di Yi Jun Yi Da Xue Xue Bao, 2002 Jul, 22(7), 592 - 5
Construction of pGFP-FL plasmid and its application in preparing FL-secreting tumor vaccine; Lu Y et al.; OBJECTIVE: To construct a plasmid containing a green fluorescent protein (GFP) reporter gene as the effective vector for preparing fms-like tyrosine kinase receptor-3 ligand (FL)-secreting tumor vaccines . METHODS: A pGFP-FL plasmid, harboring a FL gene and a GFP gene, was designed and constructed by routine molecular cloning techniques . In this plasmid, FL gene was under the control of cytomegalovirus promoter, while EF-1a promoter acted to drive GFP gene . A prokaryotic/eukaryotic selective gene Kan(R)/neo was also introduced into the plasmid . After structure identification by restriction analysis, pGFP-FL plasmid was further transferred into Hepa1-6 cells, and the expression of GFP and FL genes was examined by way of fluorescent microscopy and reverse transcriptase-PCR respectively . RESULTS: Restriction analysis showed that the structure of pGFP-FL plasmid was exactly the same as anticipated . Further results indicated that both GFP and FL genes were simultaneously expressed in Hepa1-6 cells . CONCLUSION: A new plasmid has been established as the vector for studying the FL-secreting tumor vaccines, in which GFP gene can serve as a reporter gene reflecting the expression of FL gene.

FEBS Lett, 2002 Oct 9, 529(2-3), 341 - 5
N-terminal acetylation of ectopic recombinant proteins in Escherichia coli; Charbaut E et al.; N-terminal acetylation is a protein modification common in eukaryotes, but rare in prokaryotes . Here, we characterized five mammalian stathmin-like subdomains expressed in Escherichia coli by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and nanoESI Q-TOF tandem mass spectrometry . We revealed that RB3(SLD) and RB3'(SLD) are N(alpha)-acetylated, whereas SCG10(SLD) and SCLIP(SLD), although identical up to residue 6, are not, as well as stathmin . To assess the influence of the N-terminal sequences on N(alpha)-acetylation, we exchanged residues 7 and 8 between acetylated RB3(SLD) and unacetylated SCG10(SLD), and showed that it reversed the acetylation pattern . Our results demonstrate that ectopic recombinant proteins can be extensively N(alpha)-acetylated in E . coli, and that the rules governing N(alpha)-acetylation are complex and involve the N-terminal region, as in eukaryotes.

BMC Biochem . 2002 Sep 20;3(1):28 {Epub ahead of print}
MPN+, a putative catalytic motif found in a subset of MPN domain proteins from eukaryotes and prokaryotes, is critical for Rpn11 function; Maytal-Kivity V et al.; BACKGROUND: Three macromolecular assemblages, the lid complex of the proteasome, the COP9-Signalosome (CSN) and the eIF3 complex, all consist of multiple proteins harboring MPN and PCI domains . Up to now, no specific function for any of these proteins has been defined, nor has the importance of these motifs been elucidated . In particular Rpn11, a lid subunit, serves as the paradigm for MPN-containing proteins as it is highly conserved and important for proteasome function . RESULTS: We have identified a sequence motif, termed the MPN+ motif, which is highly conserved in a subset of MPN domain proteins such as Rpn11 and Csn5/Jab1, but is not present outside of this subfamily . The MPN+ motif consists of five polar residues that resemble the active site residues of hydrolytic enzyme classes, particularly that of metalloproteases . By using site-directed mutagenesis, we show that the MPN+ residues are important for the function of Rpn11, while a highly conserved Cys residue outside of the MPN+ motif is not essential . Single amino acid substitutions in MPN+ residues all show similar phenotypes, including slow growth, sensitivity to temperature and amino acid analogs, and general proteasome-dependent proteolysis defects . CONCLUSIONS: The MPN+ motif is abundant in certain MPN-domain proteins, including newly identified proteins of eukaryotes, bacteria and archaea thought to act outside of the traditional large PCI/MPN complexes . The putative catalytic nature of the MPN+ motif makes it a good candidate for a pivotal enzymatic function, possibly a proteasome-associated deubiquitinating activity and a CSN-associated Nedd8/Rub1-removing activity.

Curr Protein Pept Sci, 2002 Feb, 3(1), 93 - 106
Structure and function of the acidic ribosomal stalk proteins; Wahl MC et al.; The acidic L7/L12 (prokaryotes) and P1/P2 (eukaryotes) proteins are the only ribosomal components that occur in more than one, specifically four, copies in the translational machinery . These ribosomal proteins are the only ones that do not directly interact with ribosomal RNA but bind to the particles via a protein, L10 and P0, respectively . They constitute a morphologically distinct feature on the large subunit, the stalk protuberance . Since a long time proteins L7/L12 have been implicated in translation factor binding and in the stimulation of the factor-dependent GTP-hydrolysis . Recent studies reproduced such activities with the isolated components and L7/L12 can therefore in retrospect be regarded as the first GTPase activating proteins identified . GTP-hydrolysis induces a drastic conformational change in elongation factor (EF) Tu, which enables it to dissociate from the ribosome after having successfully delivered aminoacylated tRNA into the A-site . It is also used as a driving force for translocation, mediated by EF-G . The in vitro stimulation of translation-uncoupled EF-G-dependent GTP-hydrolysis seems to be an intrinsic property of the ribosome that is dependent on L7/L12, reaches a maximum with four copies of the proteins per particle, and reflects the in vivo hydrolysis rate during translation . It is much larger than the analogous activity observed for EF-Tu, which is correlated with the in vitro polypeptide synthesis rate . Therefore, at least certain stimulatory activities of L7/L12 are controlled by the ribosomal environment, which in the case of EF-Tu senses the successful codon-anticodon pairing . Present knowledge is consistent with a picture in which proteins L7/L12 constitute a "landing platform" for the factors and after rearrangements induce GTP-hydrolysis . The molecular mechanism of the GTPase activation is unknown . While sequence comparisons show a large diversity in the stalk proteins across the kingdoms, a conserved functional domain organization and conserved designs of their genetic units are discernible . Consistently, stalk transplantation experiments suggest that coevolution took place to maintain functional L7/L12 EF-G and P-protein EF-2 couples . The acidic proteins are organized into three distinct functional parts: An N-terminal domain is responsible for oligomerization and ribosome association, a C-terminal domain is implicated in translation factor interactions, and a hinge region allows a flexible relative orientation of the latter two portions . The bacterial L7/L12 proteins have long been portrayed as highly elongated dimers displaying globular C-terminal domains, helical N-termini, and unstructured hinges . Conversely, recent crystal structures depict a compact hetero-tetrameric assembly with the hinge region adopting either an alpha-helical or an open conformation . Two different dimerization modes can be discerned in these structures . Models suggest that dimerization via one association mode can lead to elongated dimeric complexes with one helical and one unstructured hinge . The physiological role of the other dimerization mode is unclear and is in apparent contradiction to distances measured by fluorescence resonance energy transfer . The discrepancies between the crystal structures and results from other physico-chemical methods may partly be a consequence of the dynamic functions of the proteins, necessitating a high flexibility.

Curr Protein Pept Sci, 2001 Sep, 2(3), 205 - 25
Chaperone-like activity of alpha-crystallin and other small heat shock proteins; Ganea E; Small heat shock proteins (sHsps) are a large family of proteins with monomeric molecular weight of 12-43 kDa, present within the prokaryotic and eukariotic cell as large oligomeric complexes, ranging in size from 200-800 kDa . Unlike the high molecular weight Hsps, which are involved in protein folding in vivo, under normal conditions, sHsps play an important role in protecting organism from stress . SHsps share an evolutionarily conserved sequence of 80-100 amino acids, located in the C-terminal region, and called "alpha-crystallin domain"; its role in subunits interactions has been recently underlined by site-directed spin labeling studies and by fluorescence resonance energy transfer data . The N-terminal region, preceding the alpha-crystallin domain, is variable in length and amino acid sequence, contributing to structural diversity between different sHsps and having a role in multimerization . The alpha-Crystallin domain is followed by C-terminal extension, a polar structure, involved in protein solubility, which share no sequence homology . Expression of sHsps is induced in response to various kinds of stress including heat shock, oxidative stress, osmostress, or ischemia, but some sHsps are expressed constitutively under physiological conditions . In vitro, sHsps selectively bind and stabilize proteins and prevent their aggregation at elevated temperatures in an ATP-independent way and protect enzymes against heat-induced inactivation . Our own studies focused on the chaperone-like activity of alpha-crystallin, the major protein component of vertebrate lens, using another system than heat-induced aggregation . Our data demonstrated that alpha-crystallin specifically protects enzymes against inactivation by different posttranslational modifications such as glycation, carbamylation and aldehyde binding, and also reactivates GuHCl-denatured enzymes . Complex formation between alpha-crystallin and the denatured enzymes, was suggested as a mechanism of protection.

Curr Protein Pept Sci, 2000 Sep, 1(2), 139 - 54
DNA replication in the third domain (of life); Kelman Z; DNA replication is the process underlying evolution and the propagation of living organisms . Since the discovery of DNA-dependent DNA polymerases more than 40 years ago, the mechanisms governing DNA replication have been extensively studied in bacteria and eukarya . During the last several years, these studies have been extended to the third domain of life, the archaea . Although archaea are prokaryotes, their replication machinery and the proteins participating in the initiation of DNA replication are more similar to those found in eukarya than bacteria . It appears, however, that replication in archaea is a simpler version of the eukaryotic one as fewer polypeptides participate in each phase of the replication process . The archaeal replication apparatus also has several unique features not found in eukaryotic organisms . Furthermore, like bacteria, members of this domain thrive under a broad range of environmental conditions including extreme temperature, high salt, pH, etc . Thus, the replication machinery had to adapt to these extreme conditions . This article summarizes our current understanding of the mechanisms governing DNA replication in archaea and highlights similarities and differences between archaeal replication and that of bacteria and eukarya.

J Mol Biol, 2002 Oct 11, 323(1), 131 - 42
A structure-based interpretation of E.coli GrpE thermodynamic properties; Gelinas AD et al.; GrpE is the nucleotide exchange factor for the Escherichia coli molecular chaperone DnaK, the prokaryotic homologue of Hsp70 . Thermodynamic properties of GrpE structural domains were characterized by examining a number of structural and point mutants using circular dichroism, differential scanning calorimetry and analytical ultracentrifugation . These structural domains are the long paired N-terminal helices, the central four-helix bundle, and the C-terminal compact beta-domains . We show that the central four-helix bundle (t(m) approximately 75 degrees C) provides a stable platform for the association of the long paired N-terminal helices (t(m) approximately 50 degrees C), which can then function as a temperature sensor . The stability of the N-terminal helices is linked to the presence of the C-terminal compact beta-domains of GrpE, providing a potential mechanism for coupling of DnaK-binding activity of GrpE with temperature . On the basis of our thermodynamic analysis of E.coli GrpE, we present a structure-based model for the melting properties of the nucleotide exchange factor, wherein the long paired helices function as a molecular thermocouple.

J Pept Res, 2002 Oct, 60(4), 187 - 97
Enhanced antitumor activity and selectivity of lactoferrin-derived peptides; Yang N et al.; A number of peptide analogs derived from the N-terminal alpha-helical region of bovine lactoferrin (LFB 14-31), were designed in order to investigate how deviating numbers and positions of positively charged residues and numbers of aromatic residues affected their activity against prokaryotic, normal and transformed eukaryotic cells . Most of the LFB derivatives were highly active against both Escherichia coli and Staphylococcus aureus . The peptides were more active against the tumor cell lines MethA, HT-29 and MT-1 than normal eukaryotic cells . The peptides that were most active against the tumor cell lines had all cationic residues concentrated in one sector of the helical structure . These peptides were less selective against the tumor cell lines than against normal fibroblasts . Quantitative structure-activity relationship studies showed that certain structural parameters affected toxicity against the tumor cell lines more than against fibroblasts . Peptides encompassing these parameters were slightly less active against tumor cells, but gained significant selectivity.

Nucleic Acids Res, 2002 Oct 1, 30(19), 4264 - 71
Congruent evolution of different classes of non-coding DNA in prokaryotic genomes; Rogozin IB et al.; Prokaryotic genomes are considered to be 'wall-to-wall' genomes, which consist largely of genes for proteins and structural RNAs, with only a small fraction of the genomic DNA allotted to intergenic regions, which are thought to typically contain regulatory signals . The majority of bacterial and archaeal genomes contain 6-14% non-coding DNA . Significant positive correlations were detected between the fraction of non-coding DNA and inter- and intra-operonic distances, suggesting that different classes of non-coding DNA evolve congruently . In contrast, no correlation was found between any of these characteristics of non-coding sequences and the number of genes or genome size . Thus, the non-coding regions and the gene sets in prokaryotes seem to evolve in different regimes . The evolution of non-coding regions appears to be determined primarily by the selective pressure to minimize the amount of non-functional DNA, while maintaining essential regulatory signals, because of which the content of non-coding DNA in different genomes is relatively uniform and intra- and inter-operonic non-coding regions evolve congruently . In contrast, the gene set is optimized for the particular environmental niche of the given microbe, which results in the lack of correlation between the gene number and the characteristics of non-coding regions.

Int J Syst Evol Microbiol, 2002 Sep, 52(Pt 5), 1893 - 900
Lateral gene transfers and the evolution of eukaryotes: theories and data; Katz LA; Vertical transmission of heritable material, a cornerstone of the Darwinian theory of evolution, is inadequate to describe the evolution of eukaryotes, particularly microbial eukaryotes . This is because eukaryotic cells and eukaryotic genomes are chimeric, having evolved through a combination of vertical (parent to offspring) and lateral (trans-species) transmission . Observations on widespread chimerism in eukaryotes have led to new and revised hypothesis for the origin and diversification of eukaryotes that provide specific predictions on the tempo (early vs continuous transfers) and mode (nature of donor and recipient lineages) of lateral gene transfers (LGTs) . Analyses of available data indicate that LGTs in eukaryotes largely fall into two categories: (1) LGTs from organelles to the nucleus, only a few of which appear to have occurred at the time of the origin of eukaryotes, and (2) anomalous LGTs involving diverse donor and recipient lineages . Further testing of hypotheses on the origin and diversification of eukaryotes will require complete genome sequences from a number of diverse eukaryotes and prokaryotes combined with sequences of targeted genes from a broad phylogenetic sample.

Pharmacogenetics, 2002 Oct, 12(7), 543 - 53
Allelic variants of the human glutathione S-transferase P1 gene confer differential cytoprotection against anticancer agents in Escherichia coli; Ishimoto TM et al.; The polymorphic human GSTP1 gene locus encodes proteins that differentially metabolize electrophilic substrates, including, many chemotherapeutic agents used in clinical cancer therapy . In this study, we used XL1-Blue MRF strain, transformed with phagemid expression vectors carrying cDNAs of three GSTP1 alleles, to investigate the cytoprotective abilities of the different GSTP1 alleles against four clinically active anticancer agents, namely, carboplatin, cisplatin, thiotepa, and 4-hydroperoxyifosfamide . Following induction of protein expression with isopropyl-beta-d-thiogalactoside, the cells were treated with each drug for 3 h (1 h for 4-hydroperoxyifosfamide) . Surviving fractions were determined and used to compute a cytoprotective factor for each allele against each drug . The results showed all the GSTP1 alleles to be cytoprotective, albeit, to different degrees . For cisplatin and carboplatin, the allele was most protective, with CPs of 5.58 and 3.76, respectively, compared with 1.21 and 1.61 for and 2.50 and 2.79 for . In contrast, protection against thiotepa was highest for the allele, with a cytoprotective factor of 1.56, compared to 1.32 for and 1.1 for . For 4-hydroperoxyifosfamide, the CP for and was the same, 1.45, compared with 1.18 for . These data demonstrate significant differences in the ability of the different GSTP1 alleles to protect against the cytotoxicity of electrophilic anticancer agents . The level of protection differs significantly between different GSTP1 alleles, and between different anticancer agents . The optimized prokaryotic system described provides a useful and rapid tool for pharmacogenetic analysis of the effects of genes on drug sensitivity.

J Biol Chem, 2002 Nov 29, 277(48), 46433 - 41 Epub 2002 Sep 30.
Conformational flexibility in sigma70 region 2 during transcription initiation; Anthony LC et al.; Prokaryotic RNA polymerase holoenzyme is composed of core subunits (alpha(2)betabeta'omega) plus a varsigma factor that confers promoter specificity allowing for regulation of gene expression . Holoenzyme is known to undergo several conformational changes during the multiple steps of transcription initiation . However, the effects of these changes on the functions of specific regions have not been well characterized . In this work, we addressed the role of possible conformational change in region 2 of Escherichia coli varsigma(70) by engineering disulfide bonds that "lock" region 2.1 with region 2.2 and region 2.2 with region 2.3 . When these mutant holoenzymes were characterized for gross defects in multiple-round transcription, we found that insertion of either disulfide bond did not result in a fundamental block, indicating that the disulfide-containing holoenzymes are active . However, both disulfide-containing holoenzymes exhibited defects in formation and stability of the open complex . Our results suggest that conformational flexibility within varsigma(70) region 2 facilitates open complex formation and transcription initiation.

RNA, 2002 Sep, 8(9), 1129 - 36
Stability of mRNA in the hyperthermophilic archaeon Sulfolobus solfataricus; Bini E et al.; Archaea-like bacteria are prokaryotes but, in contrast, use eukaryotic-like systems for key aspects of DNA, RNA, and protein metabolism . mRNA is typically unstable in bacteria and stable in eukaryotes, but little information is available about mRNA half-lives in archaea . Because archaea are generally insensitive to antibiotics, examination of mRNA stability in the hyperthermophile, Sulfolobus solfataricus, required the identification of transcription inhibitors for half-life determinations . An improved lacS promoter-dependent in vitro transcription system was used to assess inhibitor action . Efficient inhibitors were distinguished as blocking both lacSp transcription in vitro and the incorporation of 3H-uracil into bulk RNA in vivo . Actinomycin D was the most stable and potent compound identified . A survey of transcript chemical half-lives normalized to levels of the signal recognition particle 7S RNA ranged from at least 2 h for tfb1, a transcription factor TFIIB paralog, to a minimum of 6.3 min for gln1, one of three glutamine synthetase paralogs . Transcript half-lives for other mRNAs were: 2 h, superoxide dismutase (sod); 37.5 min, glucose dehydrogenase (dhg1); 25 min, alpha-glucosidase (malA); and 13.5 min, transcription factor TFIIB-2 (tfb2) resulting in a minimum average half-life of 54 min . These are the first mRNA half-lives reported for a hyperthermophile or member of the crenarchaea . The unexpected stability of several transcripts has important implications for gene expression and mRNA degradation in this organism.

Protein Expr Purif, 2002 Oct, 26(1), 42 - 9
Functional homologs of cyanovirin-N amenable to mass production in prokaryotic and eukaryotic hosts; Mori T et al.; Cyanovirin-N (CV-N) is under development as a topical (vaginal or rectal) microbicide to prevent sexual transmission of human immunodeficiency virus (HIV), and an economically feasible means for very large-scale production of the protein is an urgent priority . We observed that N-glycosylation of CV-N in yeast eliminated the anti-HIV activity, and that dimeric forms and aggregates of CV-N occurred under certain conditions, potentially complicating the efficient, large-scale manufacture of pure monomeric CV-N . We therefore expressed and tested CV-N homologs in which the glycosylation-susceptible Asn residue at position 30 was replaced with Ala, Gln, or Val, and/or the Pro at position 51 was replaced by Gly to eliminate potential conformational heterogeneity . All homologs exhibited anti-HIV activity comparable to wild-type CV-N, and the Pro51Gly homologs were significantly more stable proteins . These glycosylation-resistant, functional cyanovirins should be amenable to large-scale production either in bacteria or in eukaryotic hosts.

FEBS Lett, 2002 Oct 2, 529(1), 86 - 92
Biochemistry of arsenic detoxification; Rosen BP; All living organisms have systems for arsenic detoxification . The common themes are (a) uptake of As(V) in the form of arsenate by phosphate transporters, (b) uptake of As(III) in the form of arsenite by aquaglyceroporins, (c) reduction of As(V) to As(III) by arsenate reductases, and (d) extrusion or sequestration of As(III) . While the overall schemes for arsenic resistance are similar in prokaryotes and eukaryotes, some of the specific proteins are the products of separate evolutionary pathways.

Mol Microbiol, 2002 Sep, 45(6), 1701 - 13
The cellular level of the recognition factor RssB is rate-limiting for sigmaS proteolysis: implications for RssB regulation and signal transduction in sigmaS turnover in Escherichia coli; Pruteanu M et al.; Degradation of the general stress sigma factor sigmaS of Escherichia coli is a prime example of regulated proteolysis in prokaryotes . Whereas exponentially growing cells rapidly degrade sigmaS, various stress conditions result in stabilization and, therefore, rapid accumulation of sigmaS . Proteolysis of sigmaS requires the response regulator RssB, a direct recognition factor with phosphorylation-dependent affinity for sigmaS, which targets sigmaS to the ClpXP protease . Here, we demonstrate that a sudden increase in sigmaS synthesis results in sigmaS stabilization, indicating titration of an essential proteolytic component . Evidence is provided that RssB is the overall rate-limiting factor for sigmaS proteolysis . As a consequence, the cell has to continuously adjust the expression of RssB to sigmaS in order to maintain sigmaS proteolysis in growing cells, despite variations in the rate of sigmaS synthesis . Such homeostatic feedback-coupling is provided by rssB transcription being dependent on the sigmaS-controlled rssAB operon promoter . However, strong and rapid increases in sigmaS synthesis, in re-sponse to acute stress, exceed the compensatory potential of this feedback loop with the result that sigmaS is stabilized because of RssB titration . We propose that RssB control of sigmaS proteolysis functions as a genetic switch, in which (i) the 'off' state (low sigmaS levels caused by proteolysis) is stabilized by a homeostatic negative feedback, and (ii) the threshold for switching to the 'on' state (high levels of stable sigmaS) is dependent on the cellular level of active, i.e . phosphorylated RssB.

Nat Struct Biol, 2002 Oct, 9(10), 771 - 8
Dimerization allows DNA target site recognition by the NarL response regulator; Maris AE et al.; Two-component signal transduction systems are modular phosphorelay regulatory pathways common in prokaryotes . In the co-crystal structure of the Escherichia coli NarL signal output domain bound to DNA, we observe how the NarL family of two-component response regulators can bind DNA . DNA recognition is accompanied by the formation of a new dimerization interface, which could occur only in the full-length protein via a large intramolecular domain rearrangement . The DNA is recognized by the concerted effects of solvation, van der Waals forces and inherent DNA deformability, rather than determined primarily by major groove hydrogen bonding . These subtle forces permit a small DNA-binding domain to perturb the DNA helix, leading to major DNA curvature and a transition from B- to A-form DNA at the binding site, where valine on the recognition helix interacts unexpectedly with the polar major groove floor.

Acta Crystallogr D Biol Crystallogr, 2002 Oct, 58(Pt 10 Pt 1), 1734 - 9 Epub 2002 Sep 26.
Sugar-mediated lattice contacts in crystals of a plant glycoprotein; Hogg T et al.; Pokeweed antiviral protein, PAP-S(aci), isolated from seeds of the Chinese pokeweed plant, Phytolacca acinosa, belongs to the family of type-1 ribosome-inactivating proteins (RIPs) . Type-1 RIPs are approximately 30-kDa N-glycosidases that inactivate eukaryotic and prokaryotic ribosomes via a site-specific depurination of ribosomal RNA (rRNA) . Here we describe the preliminary X-ray structure determination at 1.7 A resolution of one PAP isoenzyme from seeds, PAP-S1(aci), after crystallisation from a heterogeneous mixture of two isoenzymes . PAP-S1(aci) possesses a rare type of glycosylation, specifically, N-linked N-acetyl-D-glucosamine monosaccharide (GlcNAc) substitutions at canonical Asn-Xaa-Ser/Thr sequons . One GlcNAc residue was found to play a critical role in crystal lattice formation, forming a packing interface across a crystallographic two-fold with the identical sequon of an adjacent monomer . This observation suggests that deglycosylation protocols for the crystallisation of glycoproteins should be designed to allow for exploitation of the crystal packing potential of the innermost core sugar residue (N-linked GlcNAc or O-linked GalNAc).

Chembiochem, 2002 Jul 2, 3(7), 629 - 35
Combinatorial biosynthesis of carotenoids in a heterologous host: a powerful approach for the biosynthesis of novel structures; Sandmann G; Carotenoids are commercially important pigments with high antioxidative potential . A variety of structures can be biosynthesized in the heterologous host Escherichia coli after transformation with combinations of genes from prokaryotes, lower and higher plants . Among the produced carotenoids are novel structures with superior antioxidative activity . In this article, the concept of the combinatorial biosynthesis approach, E . coli as a carotenoid production system, and metabolic engineering of precursor supply are covered.

Biophys J, 2002 Oct, 83(4), 1797 - 808
Kinetics of electron transfer through the respiratory chain; Jin Q et al.; We show that the rate at which electrons pass through the respiratory chain in mitochondria and respiring prokaryotic cells is described by the product of three terms, one describing electron donation, one acceptance, and a third, the thermodynamic drive . We apply the theory of nonequilibrium thermodynamics in the context of the chemiosmotic model of proton translocation and energy conservation . This approach leads to a closed-form expression that predicts steady-state electron flux as a function of chemical conditions and the proton motive force across the mitochondrial inner membrane or prokaryotic cytoplasmic membrane . The rate expression, derived considering reverse and forward electron flow, is the first to account for both thermodynamic and kinetic controls on the respiration rate . The expression can be simplified under specific conditions to give rate laws of various forms familiar in cellular physiology and microbial ecology . The expression explains the nonlinear dependence of flux on electrical potential gradient, its hyperbolic dependence on substrate concentration, and the inhibiting effects of reaction products . It provides a theoretical basis for investigating life under unusual conditions, such as microbial respiration in alkaline waters.

Appl Environ Microbiol, 2002 Oct, 68(10), 5064 - 81
Oligonucleotide microarray for 16S rRNA gene-based detection of all recognized lineages of sulfate-reducing prokaryotes in the environment; Loy A et al.; For cultivation-independent detection of sulfate-reducing prokaryotes (SRPs) an oligonucleotide microarray consisting of 132 16S rRNA gene-targeted oligonucleotide probes (18-mers) having hierarchical and parallel (identical) specificity for the detection of all known lineages of sulfate-reducing prokaryotes (SRP-PhyloChip) was designed and subsequently evaluated with 41 suitable pure cultures of SRPs . The applicability of SRP-PhyloChip for diversity screening of SRPs in environmental and clinical samples was tested by using samples from periodontal tooth pockets and from the chemocline of a hypersaline cyanobacterial mat from Solar Lake (Sinai, Egypt) . Consistent with previous studies, SRP-PhyloChip indicated the occurrence of Desulfomicrobium spp . in the tooth pockets and the presence of Desulfonema- and Desulfomonile-like SRPs (together with other SRPs) in the chemocline of the mat . The SRP-PhyloChip results were confirmed by several DNA microarray-independent techniques, including specific PCR amplification, cloning, and sequencing of SRP 16S rRNA genes and the genes encoding the dissimilatory (bi)sulfite reductase (dsrAB).

Appl Environ Microbiol, 2002 Oct, 68(10), 4740 - 50
Relationship between bacterial community composition and bottom-up versus top-down variables in four eutrophic shallow lakes; Muylaert K et al.; Bacterial community composition was monitored in four shallow eutrophic lakes during one year using denaturing gradient gel electrophoresis (DGGE) of PCR-amplified prokaryotic rDNA genes . Of the four lakes investigated, two were of the clearwater type and had dense stands of submerged macrophytes while two others were of the turbid type characterized by the occurrence of phytoplankton blooms . One turbid and one clearwater lake had high nutrient levels (total phosphorus, >100 micro g liter(-1)) while the other lakes had relatively low nutrient levels (total phosphorus, <100 micro g liter(-1)) . For each lake, seasonal changes in the bacterial community were related to bottom-up (resources) and top-down (grazers) variables by using canonical correspondence analysis (CCA) . Using an artificial model dataset to which potential sources of error associated with the use of relative band intensities in DGGE analysis were added, we found that preferential amplification of certain rDNA genes over others does not obscure the relationship between bacterial community composition and explanatory variables . Besides, using this artificial dataset as well as our own data, we found a better correlation between bacterial community composition and explanatory variables by using relative band intensities compared to using presence/absence data . While bacterial community composition was related to phytoplankton biomass in the high-nutrient lakes no such relation was found in the low-nutrient lakes, where the bacterial community is probably dependent on other organic matter sources . We used variation partitioning to evaluate top-down regulation of bacterial community composition after bottom-up regulation has been accounted for . Using this approach, we found no evidence for top-down regulation of bacterial community composition in the turbid lakes, while grazing by ciliates and daphnids (Daphnia and Ceriodaphnia) was significantly related to changes in the bacterial community in the clearwater lakes . Our results suggest that in eutrophic shallow lakes, seasonality of bacterial community structure is dependent on the dominant substrate source as well as on the food web structure.

Biofizika, 2002 Jul-Aug, 47(4), 581 - 6
{Evolution of the genetic code and earliest proteins . Reconstruction from the current sequences}; Trifonov EN; One would expect that present-day protein sequences have changed many times during their evolution, at every point, so that there is no chance to recognize in the sequences any traces of their ancient organization . It turns out to be not true . Massive analysis of complete genomes of bacteria allows one to derive, according to very specific predictions, distinct features of very early sequences and to outline the history of evolution protein . Modern proteins appear to have evolved from short peptides of mixed sequences of two alphabet types . They were then closed to sequences of optimal size from which modern folds/domains and multidomain proteins were formed . The reconstruction of amino acid and codon chronology is described . A specific idea on the nature and evolutionary significance of gene splicing is suggested . The gene splicing, while obeying the rules of basic structural organization of proteins, offers accessibility to regions of sequence space that could not be reached by mutational changes typical for prokaryotes.

Biol Reprod, 2002 Oct, 67(4), 1225 - 31
Expression and structure-function analysis of de, a sperm cysteine-rich secretory protein that mediates gamete fusion; Ellerman DA et al.; Rat sperm epididymal glycoprotein DE belongs to the cysteine-rich secretory protein (CRISP) family and participates in sperm-egg fusion through its binding to complementary sites on the egg surface . To investigate the molecular mechanisms underlying the role of DE in gamete fusion, in the present work we expressed DE in a prokaryotic system, and examined the relevance of carbohydrates and disulfide bonds for the biological activity of the protein . Immunofluorescence and sperm-egg fusion assays carried out in the presence of recombinant DE (recDE) revealed that this protein exhibits the ability to bind to the DE-egg binding sites and to inhibit gamete fusion, as does native DE (nDE) . Comparison of the proteins indicated, however, that the inhibitory ability of recDE was significantly lower than that of nDE . This difference would not be due to the lack of carbohydrates in the bacterially expressed protein because enzymatically deglycosylated nDE was as able as the untreated protein to inhibit gamete fusion . To examine whether disulfide bridges are involved in DE activity, the presence of sulfhydryls in nDE and recDE was evaluated by the biotin-maleimide technique . Results indicated that, unlike nDE, in which all cysteines are involved in disulfide bonds, recDE contains free thiol groups . Subsequent experiments showed that reduction of nDE with dithiothreitol significantly decreased the ability of the protein to inhibit gamete fusion . Together, these results indicate that whereas carbohydrates do not have a role in DE-mediated gamete fusion, disulfide bridges are required for full biological activity of the protein . To our knowledge, this is the first study reporting the relevance of structural components for the function of a CRISP member.






What Is Bioremediation?, What Is Antibiotic?, What is Food Microbiology?, What Is Environmental Microbiology?, What Is Rhizobia?, o, Microorganism, i, Bacteriology, r, Microbiology, s, Microbe, a, Bacteria, a, Antibiotic resistance, s, Staphylococcus aureus, s, Escherichia coli, s, S. cerevisiae, e, Neisseria, n, Microorganisms, a, Pseudomonas aeruginosa, n, S. cerevisiae, i, S. cerevisiae, c, Shigella, s, Listeriosis, e, Brevibacteria, c, Culture medium, c, Antimicrobial, r, Yeasts, i, Bacteriological, o, Escherichia coli, e, Rhizobacter, c, S. cerevisiae, i, Multidrug resistant, c, Antibiotics




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005