|
|
Quad Sclavo Diagn, 1984 Jun, 20(2), 181 - 6 {Concept of class in relation to first-generation cephalosporins}; De Toffoli A et al.; The authors consider differences in answer of the first generation cephalosporins against several strains of Gram-negative and Gram-positive bacteria, and suggest a revision of the "class" concept as regards sensitivity response of the above mentioned cephalosporins. J Clin Microbiol, 1984 Jun, 19(6), 818 - 25 Rapid, inexpensive method for specific detection of microbial beta-lactamases by detection of fluorescent end products; Chen KC et al.; A rapid method was developed for specific detection of microbial beta-lactamases which uses ampicillin and cephalexin as substrates . The end products (open beta-lactam ring forms) generated after separately incubating either substrate with beta-lactamase-producing organisms initially were separated from the unhydrolyzed substrates by high-voltage electrophoresis at pH 2.1 . The end products of both antibiotics were highly fluorescent and could be analyzed visually and semiquantitatively under a long-wave UV lamp . Application of 5 microliters of the same incubation mixture onto filter paper without subsequent electrophoretic separation also resulted in development of fluorescence after brief heating at 120 degrees C for 5 min . This spot test differentiates penicillinase activity from cephalosporinase activity and distinguishes between beta-lactamase and acylase activities, since the end products of acylase {the common side chain, D(-)-alpha-aminophenylacetic acid, and the intact beta-lactam nuclei, 6-aminopenicillanic acid and 7-aminodeacetoxycephalosporanic acid} are not fluorescent . This method was relatively rapid, inexpensive, and more sensitive than the chromogenic cephalosporin (nitrocefin) method when 21 strains of 7 gram-positive species and 77 strains of 29 gram-negative species of bacteria were tested. J Biochem (Tokyo), 1984 Jun, 95(6), 1559 - 67 Regulation of Mycobacterium smegmatis glutamine synthetase by adenylylation; Kimura K et al.; Glutamine synthetase from a Gram-positive acid-fast bacterium, Mycobacterium smegmatis, was purified to homogeneity from cells grown with glycerol-bouillon medium . Electron micrographs of the enzyme revealed a dodecameric arrangement of its subunits in two superimposed hexagonal rings, similar to the structure of glutamine synthetase of Escherichia coli . Disc electrophoresis in the presence of sodium dodecyl sulfate indicated a subunit molecular weight of 56,000 . The sedimentation coefficient of the native enzyme was estimated to be 19.4S by ultracentrifugation in a sucrose gradient . Like the E . coli enzyme, the glutamine synthetase from M . smegmatis is regulated by adenylylation/deadenylylation . This conclusion was based on studies of the effect of snake venom phosphodiesterase treatment on the catalytic and spectral properties of the isolated enzyme . The AMP released from the enzyme by the phosphodiesterase was identified by thin-layer chromatography . Despite the structural similarity of both enzymes, striking differences were found between the catalytic properties of M . smegmatis and E . coli glutamine synthetases . The divalent cation specificity of the M . smegmatis enzyme was not altered by adenylylation of the enzyme, and deadenylylation of the enzyme caused a significant increase in the specific activities for both biosynthetic and transfer reactions with either Mg2+ or Mn2+. Arch Microbiol, 1984 May, 138(1), 15 - 7 Isolation and partial characterization of plasmid DNA from Arthrobacter oxidans; Brandsch R et al.; A method for the extraction of the high molecular weight plasmid AO 1 from the gram-positive soil bacterium Arthrobacter oxidans is presented . Following digestion of this DNA with the restriction endonucleases AccI, Bam HI, Eco RI and Hind III, an average molecular mass of 157.8 kb was estimated . This value is in good agreement with the 160 kb size determined previously by electron microscopy (Brandsch et al . 1982) . Using the same method, no plasmid DNA was found in strains of the genus Arthrobacter which do not degrade nicotine, e.g., A . albidus, A . globiformis and A . auricans. Pathol Biol (Paris), 1984 May, 32(5), 338 - 42 {Can fosfomycin reduce the nephrotoxicity of aminoglycosides?}; Morin JP et al.; Fosfomycin is an active antibiotic on Gram positive and Gram negative bacteria with a low toxicity in animals . To treat severe infections, it is recommended to associate fosfomycin with gentamicin . Wistar rats were given one of the following regimens for eight days : 100, 500 or 1 000 mg/kg fosfomycin, 50 mg/kg gentamicin or dibekacin, association of 100, 500, or 1 000 mg/kg fosfomycin and 50 mg/kg gentamicin or dibekacin . Control rats were given a saline solution . No renal histological alterations were identified with fosfomycin 100 mg/kg . Tubular dilatation and brush border rarefaction were observed with fosfomycin 500 and 1 000 mg/kg . These abnormalities did not seem related to fosfomycin itself but rather to the sodium load induced by fosfomycin treatment . A decrease in alanine aminopeptidase activity was noted for all doses of fosfomycin . Renal concentrations of gentamicin and dibekacin were not decreased by concomitant administration of fosfomycin . Fosfomycin, 100 mg/kg, did not change the nephrotoxic potential of gentamicin or dibekacin . Fosfomycin, 500 mg/kg, protected the kidney from the action of gentamicin or dibekacin . This effect seemed to be more pronounced for dibekacin than for gentamicin . Fosfomycin, 1 000 mg/kg, did not induce a more protective effect against the nephrotoxicity of these two aminoglycosides . Thus, we observed that fosfomycin combined with gentamicin or dibekacin reduced the degree of proximal tubular cell alterations, induced less modifications in alanine aminopeptidase, less lysosomal alterations, and a minor modification in sphingomyelinase activity. Clin Exp Immunol, 1984 May, 56(2), 253 - 62 Analysis of in vitro polyclonal B cell differentiation responses to bacterial peptidoglycan and pokeweed mitogen in rheumatoid arthritis; Pardo I et al.; To gain insight into possible determinants of in vivo polyclonal B cell activation seen in rheumatoid arthritis (RA), we enumerated immunoglobulin secreting cells appearing in cultures of peripheral blood mononuclear cells that were stimulated with pokeweed mitogen (PWM) or a newly described polyclonal B cell activator, bacterial peptidoglycan . Peptidoglycan, the major constituent of the cell wall of gram positive bacteria, has properties which warrant its consideration in the pathogenesis of RA; including the ability to induce rheumatoid factor production as well as a RA like syndrome in experimental animals . RA patients as a group had similar immunoglobulin secreting cell responses in PWM stimulated cultures compared to arthritis controls and showed moderately depressed responses compared to healthy volunteers . However, their in vitro responses to peptidoglycan were markedly depressed when compared to those of both control groups . Of note, severely reduced peptidoglycan-induced responses were seen in 26 of 55 rheumatoid patients who demonstrated intact PWM-induced responses . These impaired responses to peptidoglycan were not due to (1) aberrant kinetic response; (2) shift in the dose-response pattern; (3) decreased cell survival in culture or (4) the inability of peptidoglycan to activate RA cells . Cell fractionation studies indicated that peptidoglycan reactive B cells were present in the blood of some patients but their reactivity was abrogated by suppressor T cells . These studies provide evidence of aberrant in vitro polyclonal B cell activation in patients with RA and provide a basis for further investigation of peptidoglycan as an immunopathogenetic agent in this disease. J Antibiot (Tokyo), 1984 Apr, 37(4), 303 - 8 Studies on a new antibiotic FR-900336 taxonomy, isolation and characterization; Hino M et al.; A new lipophilic antibiotic, FR-900336 was isolated from a culture of Streptomyces sioyaensis subsp . tanegashimaensis . FR-900336 is light yellow and has a molecular formula C30H30NO13C1 . The characterization by IR, UV, 1H NMR and 13C NMR spectra makes a quinone structure very probable . FR-900336 is active against Gram-positive bacteria and fungi. Biochimie, 1984 Apr, 66(4), 319 - 30 Polar lipids from the radiation resistant bacterium Deinococcus radiodurans: structural investigations on glucosaminyl and N-acetyl glucosaminyl lipids; Carbonneau MA et al.; Deinococcus radiodurans, although a gram-positive bacterium, has a complex cell wall with multiple layers and associates to this structural particularity, a quite unusual lipid composition for gram-positive bacteria . The conventional phospholipids (phosphatidyl ethanolamine, phosphatidyl choline, phosphatidyl glycerol...) are absent . Among the nine polar lipids detected in the R1 Anderson strain, three are glycolipids only one is a phospholipid, the other ones are glycophospholipids . One of the latter compounds contains one free amino group . Analysis by aminoacid autoanalyser enables to identify glucosamine in one glycolipid and in two glycophospholipids . Sugar analysis by gas-liquid chromatography after acid methanolysis and trifluoroacetylation, reveals the occurrence of N-acetyl glucosaminyl residues in one glycolipid and in one phospholipid . The following identification for the two lipids of D . radiodurans is proposed: phosphatidyl glucosaminyl glycerol and phosphatidyl N-acetyl glucosaminyl glycerol. Am J Med, 1984 Mar 30, 76(3A), 91 - 100 Synergy between acylureidopenicillins and immunoglobulin G in experimental animals; Dalhoff A; The interaction of a commercially available 7S modified immunoserumglobulin and beta-lactam antibiotics was studied in animal experiments (granuloma pouch model) as well as an ex vivo system (rat polyvinyl sponge model) . Infections of the pouches were caused by gram-negative rods and gram-positive cocci, respectively . Therapy of pouches being infected with beta-lactamase-producing strains with beta-lactam antibiotics and immunoserumglobulin was as effective as beta-lactam antibiotic monotherapy of beta-lactamase-negative strains . This synergistic effect between immunoserumglobulin and beta-lactam antibiotics against beta-lactamase-producing bacteria is due to inactivation of enzymic beta-lactamase activity by specific antibodies against beta-lactamases . Immune phagocytosis was studied by adopting the in vivo and ex vivo models, respectively . Immune phagocytosis was most effectively stimulated by immunoserumglobulin whereas a pepsin-degraded product or a preparation obtained by pH4 treatment caused only minor effects . Furthermore, immunoserumglobulin stimulated phagocytosis and intracellular killing of gram-negative bacteria even in the absence of specific antibodies against these strains . Analogous effects were obtained with spermidine and albumin . These results indicate that immunoserumglobulin may stimulate phagocytosis nonspecifically, too . Thus, immunoserumglobulin may play a dual role in host defense mechanisms; in addition immunoserumglobulin acts as a beta-lactamase inhibitor, thus protecting beta-lactam antibiotics from hydrolysis. Ann Surg, 1984 Jan, 199(1), 101 - 3 Necrotizing fasciitis . A serious sequela of omphalitis in the newborn; Lally KP et al.; We reviewed all cases of omphalitis seen at Childrens Hospital of Los Angeles from 1961 to 1981 . One hundred and forty patients were seen and, of these, eight had necrotizing fasciitis . All patients with necrotizing fasciitis acquired omphalitis at home, making the incidence of necrotizing fasciitis over 10% in patients with community acquired omphalitis . Most of the infants appeared relatively well on admission with no fever but had a marked leukocytosis . The disease rapidly spread to involve most of the abdominal wall over a period of several hours to days . Seven of the eight patients died (87.5%) . Five patients were operated upon but despite extensive resection of involved tissue, four died within 24 hours of surgery . A polymicrobial flora of both gram positive and gram negative bacteria was recovered in all patients cultured . The high incidence of necrotizing fasciitis following omphalitis in the newborn with its attendant morbidity and mortality mandates close observation of these infants with early surgical intervention if there is any question of the diagnosis. Scand J Urol Nephrol Suppl, 1984, 86, 59 - 64 Light and electron microscopic studies of anaerobic curved bacteria isolated from the vagina; Skarin A et al.; Twenty strains of anaerobic curved rods isolated from vaginal secretion were studied with light and transmission electron microscopy . Ten of the strains were of a short (approx . 1.5 microns) Gram-variable type, while ten were of a long (approx . 3 microns) Gram-negative type . The former had one to four flagella and the latter between one and eight . The flagella originated from the concave aspect of the cells . Thin sections of both types of bacteria revealed an approximately 30 nm thick cell wall with no outer membrane, similar to that of most Gram-positive bacteria . An electron-dense zone in the middle of the cell wall, atypical of Gram-positive bacteria, was found, however . Amorphous and electron-translucent cytoplasmic inclusions, not membrane-enclosed, were detected . These inclusions stained metachromatically with Albert's stain. Clin Ther, 1984, 7(1), 69 - 72 Intravenous immune globulin therapy for antibody immunodeficiency; Savery F; High doses of intravenous immune globulin produced meaningful clinical responses in three patients with altered immune function . One patient had a history of repeated infection with gram-positive pneumococci, another patient had second-degree burns and previously undiagnosed chronic leukemia of unknown etiology, and the third patient had frequent infections of the intestinal tract with symptoms of malabsorption and gluten intolerance . All three of the cases are examples of antibody immunodeficiency . After receiving intravenous immune globulin, all three patients experienced complete remission of infection. J Antibiot (Tokyo), 1984 Jan, 37(1), 13 - 9 A macrocyclic antibiotic M-230B produced by Myxococcus xanthus . Isolation and characterization; Onishi N et al.; Myxococcus xanthus strain M516E produced at least three related antibiotics against Gram-positive and Gram-negative bacteria . From physico-chemical properties, a main component was identical to myxovirescin A and a second component, designated M-230B was found to be an antibiotic which is closely related to myxovirescin A . The structure of M-230B was determined from its physico-chemical properties, especially from 13C NMR spectrum as compared with that of myxovirescin A . The addition of alcohol, such as isobutyl alcohol, to the culture medium markedly stimulated production of the antibiotics. Circ Shock, 1984, 14(4), 209 - 22 Protective effects and role of endotoxin in experimental septicemia; Urbaschek B et al.; An experimental model was used in mice in which septicemia develops following invasion of the animals' own intestinal flora after cecal ligation and puncture . Pretreatment with 1 microgram of endotoxin administered 24 hours before surgery significantly reduced the rate of lethality . Bacteria were counted and differentiated in cardiac blood at various times throughout a 48-hour period after induction of septicemia in mice, with and without pretreatment . Endotoxin levels and plasma-related interference of the Limulus-amebocyte-lysate (LAL)-endotoxin reaction also were determined as were hematologic and metabolic parameters . A shift from mixed gram-positive and gram-negative to predominantly gram-negative bacteria occurred in both groups . In pretreated mice, a reduction in aerobic bacterial counts and reduced hyperglycemia were seen in the initial phase; and a decrease in anaerobic and aerobic bacteria and in endotoxin levels were observed at the end of the experiment . This appears to be related to endotoxin-induced increased resistance against the consequences of intraabdominal sepsis . These studies also indicate that the measured amount of circulating endotoxin does not necessarily correlate to the severeness of infection . Individual differences in plasma-related interference with the LAL-endotoxin reaction also emphasize the requirement for sample-internal standardization in order to reliably quantify endotoxin in plasma. Annu Rev Microbiol, 1984, 38, 339 - 57 The structure and mode of action of glycopeptide antibiotics of the vancomycin group; Barna JC et al.; It has been shown that after more than two decades of work on the structure and mode of action of the vancomycin group of antibiotics we have quite a detailed picture of aspects of their binding in vitro . Our introduction has indicated that these antibiotics are of continuing practical importance, whether in clinical use or animal husbandry . It is clear, however, that if one desires to modify these compounds to produce more effective antibiotic agents, more work is required--particularly to understand better the role of the sugar moieties . Nevertheless, with our present knowledge of the structure and mode of action of the antibiotics we can be fairly confident that they represent a group of compounds specifically evolved to aid the survival of the producing organisms by killing or inactivating competing gram-positive bacteria. Cancer, 1983 Dec 15, 52(12), 2342 - 8 Occlusion and infection in Broviac catheters during intensive cancer therapy; Lazarus HM et al.; Before administration of intensive cytotoxic therapy, 90 central venous catheters were inserted into 80 patients with malignancies . Twenty-seven episodes of bacteremia and fungemia occurred during 96 treatment courses . The majority of these infections were due to gram-positive bacteria (45%) or fungi (22%), although gram-negative organisms accounted for 33% . Catheter occlusion occurred in patients receiving intravenous phenytoin, but blood products could be infused without difficulty . An increase in gram-positive bacteremias in patients with these catheters and drug-induced catheter occlusion must now be appreciated. J Antibiot (Tokyo), 1983 Dec, 36(12), 1651 - 8 The myxopyronins, new inhibitors of bacterial RNA synthesis from Myxococcus fulvus (Myxobacterales); Irschik H et al.; From the culture supernatant of the myxobacterium, Myxococcus fulvus strain Mx f50, an antibiotic activity was isolated which blocked growth of many Gram-positive and several Gram-negative bacteria, but not of yeasts and fungi . The activity consisted of two closely related compounds, myxopyronins A and B . The myxopyronins appear to be new antibiotics, and seem to specifically inhibit bacterial RNA polymerase. J Gen Microbiol, 1983 Dec, 129 ( Pt 12), 3565 - 73 A new channel-forming antibiotic from Streptomyces coelicolor A3(2) which requires calcium for its activity; Lakey JH et al.; A recently discovered antibiotic (CDA; calcium-dependent antibiotic) of Streptomyces coelicolor A3(2) was found to be effective against a wide range of Gram-positive bacteria only in the presence of calcium ions . Producer and non-producer strains were identified and several media tested for their ability to support antibiotic production . The action of calcium was not simulated by any of the other cations tested . The antibiotic was found to induce discrete conductance fluctuations in planar lipid bilayer consistent with a channel-forming action . The electrical potential difference caused by a concentration difference of various salts across the CDA-containing bilayer, showed the channel to be cation-selective but of a size that discriminated against tetramethyl ammonium and choline ions . The data indicate that the antibiotic activity of CDA is due to its action as a calcium-dependent ionophore. Ann Trop Paediatr, 1983 Dec, 3(4), 193 - 6 Use of buffy-coat smears in the diagnosis of septicaemia in children; Nkrumah FK et al.; Gram-stained buffy-coat smears from venous and capillary blood samples in 105 children suspected of septicaemia were examined for the presence of bacteria and the results compared with blood culture isolates . Gram-positive and Gram-negative bacteria were identified in 18 venous (44%) and 19 capillary (46%) buffy-coat preparations in 41 instances where bacterial organisms were isolated from the blood cultures . It is concluded that the examination of buffy-coat smears for bacteria in children suspected of septicaemia is a useful adjunct to blood cultures and, in areas where no facilities exist for culture of blood, may be a simple and rapid method of establishing the diagnosis of bacteraemia in suspected patients. Klin Wochenschr, 1983 Nov 2, 61(21), 1075 - 9 Overwhelming infection after splenectomy in spite of some spleen remaining and splenosis . A case report; Sass W et al.; A fatal case of overwhelming postsplenectomy pneumococcal sepsis is presented occurring in a 37-year-old female 11 years after removal of the spleen because of traumatic rupture . The patient died 11 h after admission to hospital and about 32 h after sudden onset of illness . At necropsy splenic tissue, splenosis, disseminated intravascular coagulation, and thrombi within the arterioles consisting of gram-positive cocci and adrenal hemorrhage were found . The clinical, laboratory, and postmortem findings are described . Reports had been published of 41 other cases of overwhelming postsplenectomy infection (OPSI) in patients aged 20 years or more, but only three of these cases of OPSI syndrome occurred in spite of remaining splenic tissue . The longest interval between extirpation of spleen and subsequent sepsis was 42 years, indicating a small but lifelong risk of severe infection in asplenic patients . In view of the literature, the role of spleen in infection defence, the splenic function in blood clearance, and the prevention of postsplenectomy infections by antibiotic prophylaxis, pneumococcal vaccine, and reimplantation of autochthonous splenic tissue or infrared contact coagulation are discussed. Clin Pharmacol Ther, 1983 Nov, 34(5), 631 - 7 Vancomycin kinetics during continuous ambulatory peritoneal dialysis; Bunke CM et al.; To establish therapeutic guidelines for vancomycin usage in patients receiving continuous ambulatory peritoneal dialysis (CAPD), we studied single-dose kinetics of vancomycin in CAPD patients . Vancomycin was studied after a 10-mg/kg dose was given intravenously (VAN-IV) or intraperitoneally (VAN-IP) . VAN-IV provided a plasma concentration above 10 mg/l at 12 hr, with a t 1/2 of 81 hr . When VAN-IP was given, 65% was absorbed; peak plasma concentrations were only 6.3 mg/l, and t 1/2 was 66 hr . CAPD accounted for only 15% to 17% of total body clearance in both groups . The kinetic principle of superposition was used to predict plasma concentrations after repeated VAN-IP doses . A model with once-a-day dosing predicted that a loading dose of 30 mg/kg followed by 7 mg/kg would achieve steady-state plasma concentrations of 11 to 14.8 mg/l . Another model with vancomycin in each exchange predicted that a loading dose of 30 mg/kg followed by 1.5 mg/kg would provide plasma concentrations in excess of 10 mg/l at 180 hr . These data should be useful in vancomycin treatment of CAPD patients who have nonperitoneal gram-positive bacterial infections, as well as those who have peritonitis. J Clin Periodontol, 1983 Nov, 10(6), 609 - 17 Bacterial invasion of the periodontium; an important factor in the pathogenesis of periodontitis? Allenspach-Petrzilka GE, Guggenheim B. Tissue samples from 2 humans suffering from severe periodontitis were investigated by transmission electron microscopy . Confirming earlier observations in gnotobiotic rats, bacteria were found in various regions of gingival tissues . We observed bacteria invading the pocket epithelium, the underlying connective tissue, and microorganisms were also present deep in the connective tissue . The bacterial invasion of the periodontium was accompanied by different stages of tissue degradation . Various morphologically distinct types of Gram-negative and Gram-positive bacteria were evident . These microorganisms were found in the apical part of the periodontium . More coronally, a heavy infiltrate consisting predominantly of plasma cells was present . It is suggested that bacteria cannot invade regions of connective tissue protected by a massive cellular infiltrate . It seems that they rather circumvent this strong defense by penetrating more apically through the pocket epithelium while producing as camouflage leukochemophobic compounds which paralyze the chemotactically regulated mobile defense . It seems to us that bacterial invasion is a consistent feature of advanced periodontitis, leading to focal necrosis or microabscesses, and may well explain the cyclic nature of this disease. Farmaco {Sci}, 1983 Nov, 38(11), 877 - 83 Synthesis and biological activity of some di(nitrothienyl)- and di(acetylaminothienyl)sulfones; Ronsisvalle G et al.; Some new di(nitrothienyl)- and di(acetylaminothienyl)sulfones were synthesized . Compounds (I)-(VI) were active against several Gram-positive bacteria, in vitro . Di(5-acetylamino-2-thienyl)sulfone (VII) showed a mild antimalarial activity against a drug-sensitive strain of P . berghei in mice. Arch Ophthalmol, 1983 Nov, 101(11), 1749 - 52 Intrastromal noninflammatory bacterial colonization of a corneal graft; Gorovoy MS et al.; Progressive branching, needlelike stromal opacities were observed within a corneal transplant . Analysis of the corneal button by light microscopy and transmission electron microscopy disclosed a localized epithelial ingrowth into the stroma at a suture tract accompanied by intrastromal pockets of gram-positive cocci extending across the cornea . No inflammatory reaction was found in the areas of bacterial colonization . To our knowledge, noninflammatory bacterial colonization of the stroma of a corneal transplant has not been previously described. Hoppe Seylers Z Physiol Chem, 1983 Nov, 364(11), 1627 - 30 {Occurrence of pydixaminephosphate oxidase and pyridoxal kinase in Gram-negative and Gram-positive bacteria}; Pflug W et al.; Pyridoxamine-phosphate oxidase and pyridoxal kinase were detected in Gram-negative bacteria . In Gram-positive bacteria, generally only pyridoxal kinase is detectable. Transplantation, 1983 Nov, 36(5), 491 - 5 Infections after bone marrow transplantation using cyclosporine; Kay HE et al.; The incidence of infection in 86 consecutive patients having bone marrow transplantation for acute or chronic myeloid leukemia, in a protocol in which cyclosporine was the main immunosuppressant, was low . Severe bacterial infections were infrequent and mostly caused by gram-positive cocci but early bacterial infection was often associated with severe graft-versus-host disease . Fungal infections were prevented by nystatin and amphotericin thus avoiding the difficult combination of cyclosporine and ketaconazole . Viral infections were no more common than in other series but, in patients with mismatched grafts, they tended to be associated with neurological complications clinically diagnosed as encephalitis. J Bacteriol, 1983 Nov, 156(2), 837 - 45 Chemical mechanism of the Gram stain and synthesis of a new electron-opaque marker for electron microscopy which replaces the iodine mordant of the stain; Davies JA et al.; Crystal violet (hexamethyl-para-rosaniline chloride) interacts with aqueous KI-I2 during the Gram stain via a simple metathetical anion exchange to produce a chemical precipitate . There is an apparent 1:1 stoichiometry between anion (I-) and cation (hexamethyl-para-rosaniline+) during the reaction and, since the small chloride anion is replaced by the bulkier iodide, the complex formed becomes insoluble in water . It is this same precipitate which forms in the cellular substance of bacteria (both gram-positive and gram-negative types) and which initiates the Gram reaction . Potassium trichloro(eta 2-ethylene)-platinum(II), as an electronopaque marker for electron microscopy, was chemically synthesized, and it produced an anion in aqueous solution which was compatible with crystal violet for the Gram stain . It interacted with crystal violet in a similar manner as iodide to produce an insoluble complex which was chemically and physically analogous to the dye-iodide precipitate . This platinum anion therefore allows the Gram staining mechanism to be followed by electron microscopy. J Antibiot (Tokyo), 1983 Oct, 36(10), 1263 - 7 Pyrrolomycins C, D and E, new members of pyrrolomycins; Ezaki N et al.; Pyrrolomycins C, D and E, new members of pyrrolomycins produced by Actinosporangium vitaminophilum SF-2080, have been isolated by chromatography on a basic alumina column . Three antibiotics have chlorinated pyrrole nuclei linked directly or via carbonyl function to the dichlorophenol moiety . Pyrrolomycins C and E are active against Gram-positive bacteria, while the spectrum of pyrrolomycin D is broad including Gram-positive, Gram-negative bacteria and fungi. J Antibiot (Tokyo), 1983 Oct, 36(10), 1275 - 8 Isolation and characterization of a novel polyether antibiotic of the pyrrolether class, antibiotic X-14885A; Westley JW et al.; Antibiotic X-14885A is a polyether antibiotic belonging to the class of these natural acid ionophores known as pyrrolethers . The structure of the antibiotic was elucidated by X-ray crystallographic analysis of the hydrated sodium salt, which crystallized as a tetramer containing four antibiotic and water molecules and four atoms of sodium . Antibiotic X-14885A differs from the most well-known member of the class, A-23187, in two respects: the aromatic N-methylamino group present in the latter is replaced by a phenolic hydroxyl, and one of the four aliphatic methyls is replaced by a proton . Antibiotic X-14885A is active against Gram-positive bacteria and the spirochete, Treponema hyodysenteriae. Infect Immun, 1983 Oct, 42(1), 318 - 25 Characterization of surfaces involved in adherence of Legionella pneumophila to Fischerella species; Bohach GA et al.; Legionella pneumophila adheres to the slime coat of Fischerella spp . This was shown by microscopic examination and by a decline in L . pneumophila CFU in samples removed from coincubation mixtures of both organisms . Binding of partially purified Fischerella slime by L . pneumophila was most efficient by young, less hydrophobic L . pneumophila cells than by older, more hydrophobic cells . Uptake of crystal violet and partitioning into hexadecane were used to measure hydrophobicity of L . pneumophila . Purified soluble Legionella antigen also bound to Fischerella slime, as shown by indirect immunofluorescence . Adherence was not specific for L . pneumophila, since a variety of gram-negative, gram-positive, and acid-fast bacteria also bound to Fischerella slime. Zentralbl Bakteriol Mikrobiol Hyg {B}, 1983 Oct, 178(3), 263 - 79 {Qualitative and quantitative determination of bacterial populations in aquatic habitats . 6 . Germ regrowth and drinking water}; Dott W; Regrowth of bacteria in the sphere of drinking water is dependent on time (stagnation of the water in the distribution system) and on the absence or inefficiency of disinfectants e.g . chlorine and chlorinedioxid . Traceable amounts of assimilable organic carbon are not a presupposition for the multiplication of the bacteria . Even in bidistilled water growth of bacteria could be observed . Under laboratory conditions it was shown that the number of bacteria increased to 10(4) per ml after a 4-days-incubation at 20 degrees C . In particular the multiplication is concerned with the autochton bacterial flora of the water e.g . pseudomonas species . As a result of the identification of the bacteria it was observed that the increase number of bacteria was accompanied by a decrease of individual species . After 6-days'-incubation of the water samples pseudomonas-species like P . fluorescens and P . cepacia were the predominating bacterial forms . The number of Gram-positive bacteria decreased significantly during incubation. Hand, 1983 Oct, 15(3), 335 - 40 Butcher's knife wounds, are they really so contaminated? de Boer A, van Saene HK, Smit MP. The aerobic flora found in wounds caused by butcher's knives was compared with the flora in similar wounds caused by other sharp objects . Gram-positive bacteria predominated in the wounds caused by butcher's knives while the other cuts were colonised predominantly by Gram-negative flora . Identically low concentrations of colonising bacteria were found in both groups . The qualitative analysis provided no bacteriological argument for treating a wound from a butcher's knife as being more infected and therefore produced no contraindication for the primary reconstruction of damaged structures (i.e., tendons and nerves) together with skin closure in this type of injury. Antimicrob Agents Chemother, 1983 Oct, 24(4), 529 - 32 Pharmacokinetics of ceftriaxone in patients with renal failure and in those undergoing hemodialysis; Cohen D et al.; The pharmacokinetic parameters of ceftriaxone in eight patients with end-stage renal disease were determined during dialysis and during the interdialysis period . The mean half-life, clearance, and apparent volume of distribution during dialysis were 16 h, 722 ml/h, and 16.7 liters, respectively . During the interdialysis period, the half-life was 14 h, clearance was 739 ml/h, and volume of distributions was 14 liters . Individual variability in plasma concentrations occurred even in patients with apparently normal hepatic function . Based on these parameters, a dose of 1 g every 24 h would yield concentrations in excess of the concentrations needed to inhibit most gram-positive and gram-negative aerobic species. Antibiotiki, 1983 Oct, 28(10), 723 - 8 {New species of actinomycete Streptomyces variegatus sp . nov . synthesizing an antibiotic of the alpha-hydroxyketopentaene group}; Sveshnikova MA et al.; Stroptomyces strains INA T-511 and INA 3946 were isolated from 2 different soil samples . Both the strains produced an antibiotic of the group of alpha-hydroxyketopentaenes . The antibiotic was active against gram-positive bacteria, yeasts and fungi belonging to Penicillium . In addition, the strains produced a pigment antibiotic of the prodigiosin type and a pigment identified as ferroverdin . The study of the cultural and morphological features and the natural variation of the strains has shown that they belong to a new species, designated as Streptomyces variegatus sp . nov . Sveshnikova et Timuk. Antibiotiki, 1983 Sep, 28(9), 643 - 7 {Formation of an antibiotic of the siomycin group by a Streptomyces corchorusii 1401 culture}; Gauze GF et al.; Streptomycete 1401 inhibiting the growth of gram-positive organisms was isolated from a soil sample in the screening of new antibiotics . By its cultural and morphological properties the culture was classified as Str . corchorusii . An antibiotic complex was isolated from the mycelium of the culture . The main component of the complex was shown to belong to the antibiotics of the siomycin group. Can Med Assoc J, 1983 Sep 1, 129(5), 449 - 53 {Development of the risk of infection in the child with leukemia}; Lutz P et al.; Infection is the leading cause of illness and death in children with leukemia . The risk of infection may change over time as regimens of therapy are modified . A review of the hospital charts of 166 infants in whom leukemia had been diagnosed between 1976 and 1980 revealed an increased number of deep fungal infections (20 v . 3) during this period in comparison with the number between 1969 and 1976 in 164 patients treated at the same hospital whose leukemia was diagnosed between 1969 and 1975 . The 20 severe fungal infections between 1976 and 1980 were characterized by difficulty of diagnosis (a definite diagnosis having been made three times out of four only at autopsy), an important role of Candida but also of Aspergillus (the latter having been isolated almost as often as the former) and a grave prognosis (the mortality being very high {75%} and much above that for gram-positive septicemia {6%} and that for gram-negative septicemia {31%}) . This increase in frequency of fungal infections was concurrent with the introduction of phase-1 chemotherapy, which was often responsible for prolonged neutropenia . To reduce the risk of infection in children with leukemia it appears to be essential to improve diagnostic methods and approaches to therapy. J Antibiot (Tokyo), 1983 Sep, 36(9), 1150 - 6 The myxalamids, new antibiotics from Myxococcus xanthus (Myxobacterales) . I . Production, physico-chemical and biological properties, and mechanism of action; Gerth K et al.; From the cell mass and culture supernatant of Myxococcus xanthus strain Mx X12 an antibiotic activity against yeasts, molds and some Gram-positive bacteria could be extracted . It consisted of 4 biologically active compounds which were named myxalamid A, B, C and D . The main component, myxalamid B, was shown to block in beef heart submitochondrial particles the respiratory chain at the site of complex I, i.e . NADH: ubiquinone oxidoreductase . The myxalamids are new antibiotics. Yale J Biol Med, 1983 Sep-Dec, 56(5-6), 385 - 90 Lipid tracers of mycoplasma phylogeny; Langworthy TA; Comparison of the lipid composition between members of the Mycoplasmatales reveals a striking diversity of lipid structures, not only between the six genera but among species within the same genus . This is in contrast to nearly all other bacterial groups in which members of the same genus possess essentially the same lipids . There are in fact more similarities between lipids of a given species of mycoplasma and a genus of bacterium than there are between lipids of a given species of mycoplasma and a genus of bacterium than there are between mycoplasma species . Mycoplasmal lipids suggest that these organisms do not represent a phylogenetically related group at all, but are probably degenerative forms of bacteria, particularly gram-positive bacteria, which have lost the ability to synthesize a cell wall. J Antibiot (Tokyo), 1983 Sep, 36(9), 1129 - 35 Karabemycin, a new antimetabolite of glutamine produced by a strain of streptomycete; Omura S et al.; Karabemycin, a new peptide antibiotic, was isolated from the culture filtrate of Streptomyces sp . AM-6424, a soil isolate . The molecular formula of the antibiotic was determined as C15H24N4O6 on the basis of elemental analysis, FD-mass spectrum and 1H and 13C NMR . Acid hydrolysate of karabemycin contains one mol each of valine, alanine and an unknown amino acid . The antibiotic is active against Gram-positive and -negative bacteria on a synthetic medium . The inhibitory activity is reversed by L-glutamine and L-glutamic acid. Am J Med, 1983 Aug, 75(2), 345 - 8 Efficacy of intravenous vancomycin in the treatment of gram-positive peritonitis in long-term peritoneal dialysis; Krothapalli RK et al.; Peritonitis is the major complication of long-term peritoneal dialysis . Gram-positive bacteria are responsible for two thirds of the total number of peritonitis episodes . Conventional therapy consists of daily administration of antibiotics, either parenterally or intraperitoneally . Vancomycin, an antibiotic with a prolonged half-life in renal failure, has a wide spectrum of activity against gram-positive bacteria and diffuses readily across the peritoneal membrane . In the present study, 82 percent of gram-positive peritonitis episodes were cured following the intravenous administration of vancomycin at weekly intervals . This cure rate compares favorably with that obtained following conventional therapy of peritonitis . It is concluded that intravenous vancomycin is an effective treatment for gram-positive peritonitis in patients undergoing long-term peritoneal dialysis . This form of therapy is convenient, reduces hospitalization, minimizes cost, and avoids possible contamination of the peritoneal dialysate used during the intraperitoneal administration of antibiotics. Jpn J Antibiot, 1983 Aug, 36(8), 2017 - 28 {Clinical use of cefroxadine in dentistry and oral surgery}; Kikuta T et al.; Cefroxadine (CXD) is an orally administered synthesized cephalosporin antibiotic developed by Ciba-Geigy Limited (Switzerland) in 1972 . We have studied the clinical effectiveness of this drug in a total of 45 cases of various types of infections in the dentistry and the oral surgery . The studies resulted in showing 18 markedly effective cases, 19 effective cases, 5 slightly effective cases, 1 ineffective case, and 2 unknown cases showing an effective rate of 82.2% . Side effects manifested in 2 cases, of which 1 case was considered to be attributable to CXD, and the occurrence frequency of side effects was as low as 2.2% . In bacteriological test, there were many cases of mixed infections by Gram-positive and Gram-negative bacteria, and these infections were those which are observed in high frequency in dentistry and oral surgery infections . As a result of an overall evaluation of CXD clinical effects, the drug considered to be an antibiotic which is highly useful in dentistry and oral surgery. Aust N Z J Med, 1983 Aug, 13(4), 343 - 7 Tuberculous peritonitis in chronic renal failure managed by continuous ambulatory peritoneal dialysis; McKerrow KJ et al.; Continuous ambulatory peritoneal dialysis (CAPD) is being increasingly used to treat chronic renal failure in New Zealand . Peritonitis due in particular to gram positive organisms remains the major complication . Three of 92 CAPD patients trained in the Wellington Renal Unit had tuberculous peritonitis, a previously rarely reported complication . Gram positive or Gram negative bacterial infections preceded or followed isolation of Mycobacterium tuberculosis . Differential peritoneal fluid leucocyte counts were not predictive of tuberculous infection and total leucocyte counts remained elevated in tuberculous patients treated for other concurrent bacterial peritonitides . Systemic toxicity was not encountered in these patients, symptoms being confined almost entirely to the peritoneum . CAPD was continued during treatment with anti-tuberculous therapy, in all three patients . However, peritoneal pain on dialysis fluid in-flow necessitated temporary hemodialysis management in two . Anti-tuberculous chemoprophylaxis may be prudent in the at-risk Polynesian patient with chronic renal failure who is being considered for CAPD management. Chem Biol Interact, 1983 Jul 15, 45(2), 223 - 34 Inhibition of glycosylation by corynetoxin, the causative agent of annual ryegrass toxicity: a comparison with tunicamycin; Jago MV et al.; The biological activities of corynetoxins, the causative agents of annual ryegrass toxicity, were compared with those of the closely related tunicamycins and found to be essentially identical . Both showed similar antibiotic activity against Newcastle disease virus and a range of gram-positive bacteria . In preparations of rat liver rough microsomes they also strongly inhibited the uridine diphospho-N-acetylglucosamine (UDP-GlcNAc):dolichol-P N-acetylglucosamine-1-phosphate (GlcNAc-1-P) transferase, an enzyme essential for N-glycosylation of glycoproteins . Pretreatment of rats with corynetoxins resulted in dose- and time-related reduction in the level of activity of this transferase in liver microsomal preparations . The implications of this reduction are discussed with reference to annual ryegrass toxicity, the only field disease known to be caused by tunicamycin-related compounds . Both corynetoxin and tunicamycin produced similar neurological effects and increased vascular permeability in nursling rats and they showed similar LD50-values of 137 and 132 micrograms/kg, respectively, in the nursling rats. Clin Nephrol, 1983 Jul, 20(1), 40 - 3 Serum and dialyzate concentrations of intraperitoneal cephalothin in patients undergoing continuous ambulatory peritoneal dialysis; Munch R et al.; The pharmacokinetics of cephalothin sodium were studied in seven patients with chronic renal failure undergoing continuous ambulatory peritoneal dialysis . 100 mg of cephalothin per liter dialyzate were administered intraperitoneally during nine dialysis cycles with 2 liters of dialysis fluid per cycle . Serum levels of the antibiotic, measured microbiologically during the first, fifth and ninth dwell time, revealed peak values of 3.5 +/- 1.7 mg/l, 5.6 +/- 2.2 mg/l and 5.3 +/- 2.5 mg/l, respectively . The mean concentration in the dialysis outflow was 23.6 +/- 15.6 mg/l (range: 2.0-78.7 mg/l) . Intraperitoneally administered cephalothin is well tolerated . Serum levels exceeded the minimal inhibitory concentrations of most gram positive bacteria causing peritonitis in these patients. Rev Infect Dis, 1983 Jul-Aug, 5 Suppl 3, S402 - 6 History of the development of rifampin; Sensi P; Rifampin was developed in the Dow-Lepetit Research Laboratories (Milan, Italy) as part of an extensive program of chemical modification of the rifamycins, the natural metabolites of Nocardia mediterranei . One peculiar fact was that all of the studies leading to highly active derivatives were performed on a molecule (rifamycin B) that was itself practically inactive . The first chemical modifications led to the discovery of rifamycin SV, which was introduced in some countries for the parenteral and topical treatment of infections due to gram-positive bacteria and infections of the biliary tract . Systematic structural modifications of most of the functional groups of the rifamycin molecule were performed with the objective of finding a derivative that was active when administered orally . The understanding of structure-activity relations in the rifamycins led to the synthesis of several hydrazones of 3-formylrifamycin SV . Among them, the hydrazone with N-amino-N'-methylpiperazine (rifampin) was the most active in the oral treatment of infections in animals and, after successful clinical trials, was introduced into therapeutic use in 1968 . In the intervening years, a large number of clinical and biologic studies have confirmed the important role of rifampin in therapy for tuberculosis and other selected infectious diseases. Infection, 1983 Jul-Aug, 11(4), 210 - 1 Studies on lamoxactam penetration into the aqueous humor of the human eye; Manthey KF et al.; Eighteen patients scheduled for surgical lens removal were assigned to six groups of three patients each . These patients received 25 mg/kg lamoxactam i . v . 30 to 180 min prior to surgery . In the course of the operation, aqueous humor was obtained and a serum sample taken to determine the antibiotic concentration . The mean peak serum level was 154.5 mg/l after 30 min; it was still 46.4 mg/l after 3 h . The lamoxactam concentrations in the aqueous humor increased slowly . Peak levels after 2 h were 4.2 mg/l . The ratio of aqueous humor level: serum level after 1 h was 4.7%, after 1.5 h 5.3% and after 2 h 6.9% . The ratio then remained constant up to the third hour . Aside from some gram-positive bacterial species and Pseudomonas species, all relevant microorganisms which cause eye infections are included in lamoxactam's spectrum of susceptibility. J Periodontol, 1983 Jul, 54(7), 408 - 19 Effect of factors other than pathologic status on responsiveness of peripheral blood mononuclear cells from patients with chronic periodontitis; Suzuki JB et al.; Studies were designed to assess factors other than pathologic status of the cell donor which affect the blastogenic responsiveness in vitro of peripheral blood mononuclear cells (PBMs) from normal donors and patients with periodontitis . Cultures were established and activated using phytohemagglutinin-P (PHA) or homogenates of Actinomyces viscosus (AVIS), a gram-positive plaque microorganism, and Fusobacterium nucleatum (FUSO), a gram-negative plaque microorganism . Activation was assessed by measuring the incorporation of labeled precursor into DNA . The effects of incubation time, vessel shape, cell concentration, prostaglandin E2 and indomethacin on blastogenic responsiveness were studied . Blastogenic responsiveness became maximal after 5 to 8 days' activation with the bacterial substances, and after 3 days' activation with PHA . Radioactivity incorporated by cultures in microtest wells with flat, round and conical bottoms was 5.9, 7.8 and 10.6 X 10(3) cpm, respectively . Cultures of cells from all of the patients and normal subjects were activated by PHA, AVIS and FUSO, and cell concentration was a major determinant of the magnitude of the blastogenic response . Responsiveness of cultures from all patients and control subjects activated with AVIS and FUSO was inhibited significantly by prostaglandin E-2 (PGE2) at a concentration of 10 microM . Inhibition was generally 50% or greater . Indomethacin, an inhibitor of prostaglandin production, at a concentration of 0.5 micrograms/ml significantly enhanced responsiveness of AVIS- and FUSO-activated cultures from control donors and patients, indicating that prostaglandins are produced endogenously, and that they affect cell responsiveness . The effect of PGE2 and indomethacin on PHA-activated cultures was more variable and, where present, of a lesser magnitude than that observed for cultures activated with bacterial homogenates . In most cultures the effects were not statistically significant . Our data show that in studies of lymphocyte activation, the incubation time, culture-vessel shape, cell concentration and presence of endogenous inhibitors need to be taken into account. J Antimicrob Chemother, 1983 Jul, 12 Suppl A, 101 - 10 A randomized study of ceftazidime compared to ceftazidime and tobramycin for the treatment of infections in cancer patients; Fainstein V et al.; Three hundred and twenty-one febrile episodes in cancer patients were treated with ceftazidime alone or in combination with tobramycin . Patients were grouped according to their neutrophil count into neutropenic and non-neutropenic (less than 1000 and greater than 1000/mm3) respectively . Two hundred and seventy-five episodes were evaluated . The overall response rate in 83 episodes of infection treated with ceftazidime alone was 60 and 73% in those who received the combination . In those bacteriologically proven the response rate was 72% in both groups of the study . The overall response rate in septicaemia was 75% with ceftazidime alone and 85% with the combination . High response rates were obtained in Gram-negative bacillary septicaemias in both groups even in neutropenic patients treated with ceftazidime alone . Pneumonias in neutropenic patients responded equally well . However, patients with adequate neutrophil counts responded better to the combination than to single-agent therapy . The response rate for Gram-positive infections was 41% for ceftazidime alone and 57% for the combination, which was inferior to the results obtained for Gram-negative infections (P = 0.001) . The rates of superinfection and toxicity were very low . Ceftazidime is a useful antibiotic against Gram-negative infections in cancer patients . It should be combined with an agent active against Gram-positive pathogens in neutropenic patients. Transplantation, 1983 Jul, 36(1), 54 - 9 Transplantation for polycystic kidney disease; Sanfilippo FP et al.; During the 4-year period from June 1977 to May 1981, a total of 108 patients with polycystic kidney disease and 2440 nonpolycystic patients received cadaver renal allografts in the Southeastern Organ Procurement Foundation (SEOPF) Prospective Study . There were no significant differences between the groups with and without polycystic disease in terms of recipient blood group, history of splenectomy, or preformed antibody status . As a group, transplanted polycystic patients underwent native nephrectomy more often, had a better HLA match, received less antilymphocyte serum (ALS), and were slightly older than nonpolycystic patients . Although proportionately fewer polycystic patients received pretransplant transfusions than nonpolycystic patients (P = .002), transfusion was associated with a significant increase in graft survival in the polycystic group (P less than .05), as well as in the nonpolycystic group (P less than .0001) . Gene frequency analysis showed no HLA-A, or -B antigen linkage with polycystic disease . No significant differences existed between the polycystic and nonpolycystic groups in terms of overall graft and patient survival . However, transplanted polycystic patients died more frequently from bacterial sepsis (P less than .05), especially from gram-positive organisms (P = .01) . Pretransplant bilateral nephrectomy did not affect the incidence of sepsis . However, following graft failure, patients with bilateral native nephrectomy had a greater incidence of severe anemia (50% versus 39%) and death (58% versus 25%; P less than .05) than those with unilateral nephrectomy or no nephrectomy . Treatment with ALS did not significantly improve graft survival in those with polycystic disease . A strong positive correlation was found between patient death and treatment with ALS only in the polycystic group (P less than .01) . These findings indicate that the use of pretransplant bilateral native nephrectomy and posttransplant ALS should be judicious in the polycystic patient because they may be associated with increased morbidity and mortality. J Antibiot (Tokyo), 1983 Jul, 36(7), 761 - 9 Retrostatin, a new specific enzyme inhibitor against avian myeloblastosis virus reverse transcriptase; Nishio M et al.; A novel enzyme inhibitor against RNA-directed DNA polymerase of avian myeloblastosis virus was produced by an isolate of a new streptomycete for which the name Streptomyces retrostaticus is proposed . This enzyme inhibitor, which was named retrostatin, did not inhibit DNA-directed DNA polymerase of Escherichia coli and DNA-directed RNA polymerase of Ehrlich ascites tumor cells . Retrostatin was produced by the microorganism together with streptonigrin . These two substances were extracted from the culture broth with ethyl acetate at acidic pH . Retrostatin is an acidic pH indicator and the free acid was recovered as a red powder . Retrostatin had weak antibiotic activities against Gram-positive bacteria and yeasts. Eur J Biochem, 1983 Jul 1, 133(3), 523 - 30 Improved preparation of lipoteichoic acids; Fischer W et al.; A procedure is described for measuring the extraction of lipoteichoic acids from gram-positive bacteria in absolute terms . Virtually complete extraction was achieved from various bacteria by hot phenol/water if the cells were disrupted . Extraction of whole and delipidated cells and of the membrane fraction gave considerably lower yields . Most of the nucleic acids co-extracted from disrupted cells was removed by treatment with nucleases . Nuclease-resistant nucleic acid, protein, polysaccharide, and teichoic acid were separated from lipoteichoic acid by anionexchange chromatography on DEAE-Sephacel or hydrophobic interaction chromatography on octyl-Sepharose . Purified preparations were essentially free of polymeric contaminants, retained their alanine ester substitution, and were in the sodium salt form . Hydrophobic interaction chromatography also made it possible to recognize contamination of lipoteichoic acid with its deacylated and lyso-form, and to discriminate molecular species containing two and three, or two and four acyl groups. Biochem Biophys Res Commun, 1983 Jun 15, 113(2), 562 - 8 Activation of pro-phenoloxidase by bacterial cell walls or beta-1,3-glucans in plasma of the silkworm, Bombyx mori; Ashida M et al.; Silkworm hemolymph plasma contains pro-phenoloxidase and the activating system for the pro-enzyme . The latter was triggered by elicitors such as Gram-negative or Gram-positive bacterial cell wall, glucans with beta-1,3-glycosidic linkages and denatured lipophorin, which is one of silkworm plasma proteins, but not by lipopolysaccharide, dextram sulfate, kaolin or inulin . Calcium was required for the elicitors to activate the system . However, putative pro-PO activating enzyme, which activity is induced in plasma by the action of the elicitors, could activate pro-PO in the absence of the ion, suggesting that at least two reaction steps are involved in the activation reaction of pro-PO in plasma . The activating enzyme was completely inhibited in the presence of p-NPGB, an inhibitor for serine protease. J Pediatr, 1983 Jun, 102(6), 941 - 6 Pharmacokinetics of intravenously administered piperacillin in preadolescent children; Thirumoorthi MC et al.; We studied the pharmacokinetics of piperacillin in 37 preadolescent children (mean age 52 months, range 1 month to 11 years) after 50 mg/kg IV doses . Pharmacokinetic parameters were determined after the initial dose in 18 instances and after subsequent doses in 32 instances . There were no significant differences between the initial doses and the subsequent doses in the plasma piperacillin concentrations at comparable times, the elimination rate constants, the elimination-phase plasma half-lives, the total body clearances, the apparent volumes of distribution, or the areas under the concentration curves . At the end of a 30-minute infusion of the drug, the plasma concentration was 166.2 +/- 42.2 mg/L (mean +/- SD) and ranged from 91.6 to 268.3 mg/L . The mean half-life was 31.0 +/- 9.4 minutes . The half-life of piperacillin in children 1 to 6 months of age (47.2 minutes) was significantly longer than in older children (28.8 minutes) (P less than 0.05) . Likewise, the total body clearance of the drug in the younger age group (71.7 ml/min/m2) was significantly lower than in the older children (130.8 ml/min/m2) (P less than 0.05) . The mean renal clearance of the drug was only 63% (range 39% to 85%) of the total body clearance, suggesting a variable but substantial nonrenal route of elimination . The intravenous administration of 50 mg/kg piperacillin every four hours results in adequate plasma concentrations for the treatment of most infections caused by gram-negative and gram-positive organisms. Mikrobiologiia, 1983 May-Jun, 52(3), 434 - 7 {Isolation of lipoteichoic acid from Streptomyces levoris}; Potekhina NV et al.; Lipoteichoic acid was isolated from Streptomyces levoris K-3056 by cold phenol extraction . Its hydrophilic moiety is represented by 1,3-poly(glycerophosphate) whereas the hydrophobic part contains fatty acids among which pentadecanoic, 14-methylpentadecanoic (isopalmitic), palmitic and heptadecanoic acids prevail . Lipoteichoic acid has been found in the Streptomyces genus for the first time . Its overall content in the cells of Streptomyces levoris K-3056 is comparable with that found in other Gram-positive bacteria. J Am Acad Dermatol, 1983 May, 8(5), 714 - 7 Disseminate intradermal bacterial colonization presenting as palpable purpura in lymphoblastic leukemia; Shelley WB et al.; A patient with acute lymphoblastic leukemia suddenly developed a disseminated monomorphic eruption of purpuric papules . The papules were initially thought to be lesions of vasculitis, leukemia cutis, or septic emboli . Histologic study, however, revealed large focal colonies of gram-positive cocci within the dermis . It is postulated that a bacteremia of antibiotic-resistant cocci led to dissemination of these organisms into a virtually defenseless skin . The patient's pancytopenia and consequent immune paralysis are viewed as accounting for this focal bacterial colonization and for the remarkable absence of clinical and histologic inflammatory response . Such hematogenous noninflammatory bacterial colonization of the skin must be added to the differential diagnosis of palpable purpura. Cancer, 1983 May 1, 51(9), 1587 - 92 Reduction in mortality from gram-negative sepsis in neutropenic patients receiving trimethoprim/sulfamethoxazole therapy; Riben PD et al.; The causes of death were reviewed in 53 patients from two prospective randomized trials on the efficacy of trimethoprim/sulfamethoxazole as prophylaxis of gram-negative bacillary infection in granulocytopenic patients . Twenty-nine deaths occurred in patients treated with TMP/SMX prophylaxis while 24 occurred in patients who served as controls in the first trial . The two groups were similar, with the exception that more patients in the TMP/SMX group had acute leukemia (82 versus 50%; P less than 0.02) . Microbiologically documented gram-negative rod infection preceeded death in 8/24 control patients as compared to 2/29 TMP/SMX recipients (P less than 0.02) . This decrease in gram-negative related deaths was most pronounced in the patients with acute leukemia . Fatal gram-negative rod infection occurred in 7/12 control leukemic patients as compared to 2/24 TMP/SMX treated patients . Despite the reduction in numbers of gram-negative rod-related deaths, infectious deaths accounted for 16/24 and 15/29 patients in control and TMP/SMX treated patients, respectively . Similar numbers of fungal, viral, and gram-positive bacterial infections occurred in each group . Fever with pulmonary infiltrates but without proven etilogic agents were included in the category of "clinically documented infections;" 6/7 patients with fever and undiagnosed pulmonary infiltrates were in the TMP/SMX group . Prophylactic administration or oral trimethoprim/sulfamethoxazole reduces the frequency of fatal gram-negative rod infections in neutropenic patients. J Rheumatol, 1983 Apr, 10(2), 197 - 203 Modulation of phagocytosis and bactericidal activity of human polymorphonuclear and mononuclear phagocytes by antiarthritic agents; Pruzanski W et al.; The influence of 9 antiarthritic drugs on phagocytosis and intracellular bactericidal activity of human polymorphonuclear (PMN) and mononuclear phagocytes was investigated using gram-positive and -negative microorganisms and latex particles . With the exception of prednisone all the other agents suppressed phagocytosis and/or phagocytic index of PMN . Whereas naproxyn suppressed phagocytosis of all 3 particles used, other drugs had more pronounced inhibitory activity on phagocytosis of E . coli than of S . aureus or latex particles . Monocytes were less influenced by antiarthritic agents . Intracellular bactericidal activity was markedly suppressed by phenylbutazone, oxyphenbutazone, naproxyn and gold sodium thiomalate . In suboptimal conditions when serum was omitted from the assay, dual action of some drugs was observed . It may be concluded that antiarthritic agents may modulate phagocytosis and intracellular bactericidal activity . The modulation was most pronounced in conditions similar to those in vivo i.e., with added serum and when the cells were exposed to antiarthritic agents for longer time . It should be taken into consideration while assessing defense mechanisms and susceptibility to infection in rheumatic diseases. Antibiotiki, 1983 Apr, 28(4), 243 - 5 {Search for new antibiotics of the cyclosporin group}; Gauze GF et al.; A total of 160 fungal cultures belonging to Trichoderma were isolated from soil samples collected in various regions of the USSR . The cultures were tested for production of antibiotics of the cyclosporin group, having a narrow antifungal spectrum . It was found that 7 cultures produced substances having a selective inhibitory effect on Asp . niger and no activity against gram-positive and gram-negative organisms . An antibiotic substance close by its physicochemical properties to cyclosporins was isolated from T . viride 122. J Antibiot (Tokyo), 1983 Apr, 36(4), 355 - 61 Ravidomycin (AY-25,545), a new antitumor antibiotic; Sehgal SN et al.; A streptomycete was isolated from a Guatemala soil sample and found to inhibit Grampositive bacteria including mycobacteria . The antibiotic-producing microorganism was characterized, identified as a new species and named Streptomyces ravidus . The antibiotic principle was extracted with organic solvent from the mycelium, isolated in crystalline form and named ravidomycin . Ravidomycin is mainly active against Gram-positive bacteria including mycobacteria . It shows only weak activity against Gram-negative organisms and no activity against fungi . Ravidomycin exhibits potent antitumor activity against P388 lymphocytic leukemia, Colon 38 tumor and CD8F1 mammary tumor . Acute toxicity in mice is low. J Bacteriol, 1983 Apr, 154(1), 471 - 8 Primary structure of the peptidoglycan from the unicellular cyanobacterium Synechocystis sp . strain PCC 6714; Jurgens UJ et al.; A peptidoglycan fraction free of non-peptidoglycan components was isolated from the unicellular cyanobacterium Synechocystis sp . strain PCC 6714 . Hydrofluoric acid treatment (48%, 0 degrees C, 48 h) cleaved off from the peptidoglycan non-peptidoglycan glucosamine, mannosamine, and mannose . The purified peptidoglycan consists of N-acetyl muramic acid, N-acetyl glucosamine, L-alanine, D-alanine, D-glutamic acid, and meso-diaminopimelic acid in approximately equimolar amounts . At least partial amidation of carboxy groups in the peptide subunits is indicated . Peptide analyses and 2,4-dinitrophenyl studies of partial acid hydrolysates revealed the structure of the Synechocystis sp . strain PCC 6714 peptidoglycan to belong to the A1 gamma type (direct cross-linkage) of peptidoglycan classification . The degree of cross-linkage is about 56% and thus is in the range of that found in gram-positive bacteria . Some of the peptide units are present as tripeptides lacking the carboxy-terminal D-alanine. J Nat Prod, 1983 Mar-Apr, 46(2), 226 - 31 Revised structure of phaeantharine; Van Beek TA et al.; Revised structure 8 is proposed for the quaternary bisbenzylisoquinoline alkaloid phaeantharine, based on spectrometric data . Phaeantharine, which occurs in Phaeanthus ebracteolatus (fam . Anonaceae), has current interest as a potential insecticide . Phaeantharine also exhibits moderate activity against gram-positive bacteria. Am J Med Technol, 1983 Mar, 49(3), 177 - 8 Differentiation of gram-positive and gram-negative bacteria and yeasts using a modification of the "string" test; Agbonlahor DE et al.; Solutions of potassium hydroxide and sodium hydroxide with concentrations between 0.5% and 4% were found to produce mucoid and sticky suspensions when added in drops, using a bacteriological loop, to smears of 609 strains of gram-negative bacteria on glass slides . A total of 461 strains of gram-positive bacteria and yeasts did not produce any mucoid or "string" formation when treated with the same solutions . It was concluded that this modified test could aid in differentiating gram-positive from gram-negative organisms. Antimicrob Agents Chemother, 1983 Mar, 23(3), 497 - 9 Comparative in vitro study of teichomycin A2; Fainstein V et al.; Teichomycin A2 was evaluated in vitro against clinical isolates, and its activity was compared with that of other antibiotics . This compound was very active against all organisms tested; its activity was comparable to that of vancomycin, and it was superior to several other antibiotics when tested against gram-positive cocci . Because of its in vitro activity, it deserves clinical evaluation. Prikl Biokhim Mikrobiol, 1983 Mar-Apr, 19(2), 182 - 92 {Modification of the lipid component of bacterial membranes by the introduction of lipotropic compounds into lyophilized cells}; Reshetniak VI et al.; In order to elucidate potentialities of modifying the lipid component of bacterial membranes, lyophilized cells of M . lysodeikticus, E . coli and other bacteria were treated by hydrophobic compounds dissolved in the organic solvent, with the latter subsequently removed by evaporation or freezedrying prior to cell rehydration . The data obtained by means of spin-probes, fluorescent spectroscopy, electron microscopy, photoreactive label and other methods suggest that following bacteria rehydration at least part of the substance occurs in the membrane structures . The amount of the substance involved in bacterial cells depends on the type of compound and on whether bacterial cells belong to gram-positive or gram-negative microorganisms: the substance content of the latter is greater than of the former. Lancet, 1983 Feb 5, 1(8319), 284 - 7 Efficacy of chloramphenicol in the treatment of neonatal and infantile meningitis: a study of 70 cases; Mulhall A et al.; The efficacy of chloramphenicol in the treatment of 21 neonates and 9 infants with proven meningitis and 37 neonates and 3 infants with suspected meningitis was evaluated from mortality and morbidity data, and by assay of the drug in serum and cerebrospinal fluid . Minimum inhibitory concentrations (MICs) were established for ten isolates . 25% of neonates and 50% of infants had subtherapeutic concentrations of chloramphenicol in serum or cerebrospinal fluid . Dosage was less than that currently recommended in over half of these subjects . Mild toxicity (reversible thrombocytopenia) was observed in only 1 of 20 babies being treated at the recommended dose . Toxic reactions, including the grey-baby syndrome, occurred in 10 babies receiving higher doses . In 4 cases, doses up to ten times that prescribed had been given, and death of 1 baby was attributable in part to chloramphenicol toxicity . 5 of 21 neonates and 1 of 9 infants with bacteriologically proven meningitis died, an overall mortality of 20% . Those infected with gram-negative bacteria had a higher mortality than those infected with gram-positive bacteria (p less than 0 . 05) . 21% of the survivors had neurological sequelae . Therapeutic concentrations of chloramphenicol will be achieved in serum and cerebrospinal fluid with daily doses of 25 mg/kg in preterm and term infants during the first week of life and 37 . 5-50 mg/kg for older term babies . The drug should be assayed at 48-hour intervals, to maintain concentrations in the therapeutic, non-toxic range . Dosage should be increased when the peak serum concentration falls below 20 mg/l and decreased when the trough serum concentration exceeds 15 mg/l or the peak concentration exceeds 30 mg/l. Arch Biochem Biophys, 1983 Feb 1, 220(2), 354 - 60 Citrate synthase of Tetrahymena pyriformis: evolutionary and regulatory aspects; Fabregat I et al.; Citrate synthase (EC 4.1.3.7) from Tetrahymena pyriformis has been purified 185-fold . The molecular weight of the native enzyme was determined to be 120,000 . The enzyme is labile at low ionic strength, but can be stabilized by KCl and glycerol . It is activated by KCl at low (below 60 mM) or high concentrations, and inhibited by divalent cations (Mn2+, Mg2+, Ca2+) . The Michaelis constants are 0.1 mM for oxalacetate and 0.01 mM for acetyl-CoA . The kinetics with oxalacetate exhibit negative cooperativity, with a nH = 0.66 . Among the metabolites tested, only ATP and GTP can inhibit the enzyme but Mg2+ relieves the ATP inhibition . Incubation with sulfhydryl reagents (DTNB) in the absence of its substrates results in a rapid inactivation of the enzyme . It is concluded that Tetrahymena citrate synthase is closer to the enzyme from Gram-positive bacteria than to those of eucaryotes. J Clin Microbiol, 1983 Feb, 17(2), 272 - 5 Comparison of tryptic soy broth with tryptic soy broth supplemented with sucrose in the septi-chek blood culture system; Pfaller MA et al.; The performance of tryptic soy broth (TSB) was compared with TSB supplemented with 10% sucrose (TSB-S) in the Septi-Chek blood culture system (Roche Diagnostics, Div . Hoffmann-La Roche Inc.) . A total of 2,292 sets of blood cultures were evaluated . Although slightly more isolates were recovered in the TSB bottle in comparison with the TSB-S bottle, there was no significant difference between the two medium formulations in the recovery of either gram-positive or gram-negative bacteria . Significantly more isolates of fungi were recovered in the TSB bottles . At least 94% of all isolates were detected by day 3 of incubation in both the TSB and TSB-S bottles . Thus, the addition of sucrose to TSB did not result in greater total recovery or faster recovery of the isolates detected in this study. Adv Shock Res, 1983, 10, 143 - 8 Thromboxane synthetase inhibitors in septic shock; Short BL et al.; Thromboxane (TX) has been reported to cause mortality in endotoxin or septic shock . Cyclooxygenase inhibition improves survival in gram-negative or gram-positive shock . The exact level in the prostaglandin system of which the protection occurs is unknown . This study was designed to compare the effects of a cyclooxygenase inhibitor (indomethacin, IND) to a thromboxane synthetase inhibitor (IMI) on survival and on the production of Tx and prostacyclin (PGI2) in a clinically relevant rat gram-negative sepsis model . Three groups were studied: 1) control (N = 35) animals received E coli only; 2) IND (N = 35) treated animals received 3 mg/kg IP; 3) IMI (N = 35) treated animals received 30 mg/kg IP . All drugs were given 1 h after an IP injection of E coli (LD70) organisms . In this model only IND significantly improved survival . IND and IMI significantly blocked the production of Tx seen in septic shock . IND blocked PGI2 production whereas IMI increased the production . These results show that Tx may not be important in the irreversible stages of shock . Shunting prostaglandin production to PGI2 with thromboxane synthetase inhibitors needs to be considered when using this group of compounds . The mechanism of protection by IND remains unknown. Clin Invest Med, 1983, 6(4), 319 - 25 Plasma lysosomal enzymes in experimental and clinical endotoxemia; Godin DV et al.; Endotoxins, which are lipopolysaccharide complexes derived from the cell walls of gram-negative bacteria, have been implicated in the pathogenesis of gram-negative septic shock . One possible mechanism of endotoxin-induced damage may involve an action at cell surface membranes resulting in cell injury and lysosomal enzyme release . In our experiments, the administration of purified E . coli endotoxin (2 mg/kg intravenously) to guinea pigs produced elevations in the plasma activity of the lysosomal hydrolases glucosaminidase, acid phosphatase and Cathepsin D of approx . 2-, 3- and 4-fold, respectively, at 5 h following endotoxin injection . Animals haemorrhaged to produce sustained hypotension that was greater than the reduction in blood pressure seen with endotoxin treatment, exhibited an elevation only in plasma Cathepsin D activity that was, however, significantly lower than the increase associated with endotoxemia . The three lysosomal hydrolases were also measured in man, including a control group, patients with gram-negative septic shock, other shock, gram-positive and gram-negative septicaemia without shock . Plasma Cathepsin D activity was significantly elevated (26-fold above control) in the group with gram-negative septic shock as compared to all other groups . Patients in the gram-negative septic shock group and the other shock group both had significantly greater glucosaminidase activity than controls . Our results suggest that plasma Cathepsin D measurements may be of diagnostic and prognostic value in the clinical management of gram-negative septic shock. Adv Exp Med Biol, 1983, 166, 199 - 214 Immunomodulation by small molecular weight bacterial products; Friedman H; Microbial products are known immunomodulators . Endotoxins derived from gram negative bacteria both enhance and suppress a wide variety of immune responses in vivo and in vitro, depending upon dose, concentration, form, and time of exposure . Studies in this laboratory have shown that a small molecular weight polysaccharide derivative from endotoxin has strong immunomodulatory effects, both in vivo and in vitro, similar to intact LPS . Injection of PS into mice or addition to normal mouse spleen cell cultures results in enhanced responses similar to that observed with LPS as well as with lipoteichoic acid derived from gram positive bacteria . The immunomodulatory activity, both in vivo and in vitro, was related to development of soluble serum factors, most likely interleukins . Similar soluble mediators were observed in vivo since post endotoxin or post LTA serum, when added in small quantities to normal mouse spleen cell cultures, mediated enhanced antibody responses . Normal spleen cell cultures exposed to these materials also released soluble mediators into the supernatants which enhanced the antibody response of normal spleen cell cultures . These observations support the view that similar to larger molecular weight cell wall components, small molecular weight substances such as polysaccharide derivatives, despite lack of toxicity share related mechanisms of enhancing immune responses. Adv Myocardiol, 1983, 4, 227 - 32 Immunologic studies in infective endocarditis; Wahi PL et al.; Some immunologic changes in patients with infective endocarditis were measured during therapy with antibiotics . T cells and C3 levels were low in 29 and 59% of the subjects, respectively . The circulating immune complexes were high and showed a negative correlation with serum C3 levels . Teichoic acid antibodies with titer of above 5 were generally seen only in cases of bacteremia in which endothelial damage had taken place . The antibody was specific for gram-positive organisms because it was negative in gram-negative bacteremia . The antibody showed a fall during treatment and hence could be used to monitor efficacy of antibiotic therapy. Scand J Infect Dis Suppl, 1983, 39, 14 - 8 Clinical aspects on bacterial infections in the upper respiratory tract; Norrby R; Acute respiratory tract infections represent the major cause of morbidity in younger age groups . Most of these infections involve the upper respiratory tract . The frequency of respiratory tract infections vary not only with age, but also with season of the year and the epidemiological situation . Surveys of the incidence and aetiology of these infections must therefore cover large populations during relatively long periods of time . In the developed countries, the mortality in respiratory tract infections in patients below the age of 60 years is low, while it increases markedly in elderly patients, mainly due to involvement of the lower respiratory tract . Aetiologically, viral infections dominate but bacterial pathogens often cause pharyngitis/tonsillitis, otitis media and sinusitis . In longstanding cough in children, Branhamella catarrhalis has been found to be a pathogen of probably high significance . Other factors increasing the clinical importance of colonisation of the upper respiratory tract with potentially pathogenic bacterial species, are various immune defects, especially reduced IgA production, and granulocytopenia . In the latter case, Gram-negative bacteria seem to be more pathogenic than Gram-positive ones . The clinical differentiation between viral and bacterial upper respiratory tract infections is difficult and sometimes not possible . However, based on the knowledge that acute tracheitis, laryngitis and common cold are normally caused by viral agents, it seems reasonable not to use antibiotics for those patients. Oral Surg Oral Med Oral Pathol, 1983 Jan, 55(1), 73 - 7 Effective surface sterilization of gutta-percha points; Linke HA et al.; A bacteriologic investigation was conducted to determine the sterilizing effectiveness of various germicidal endodontic irrigants on gutta-percha points . It was found that most effective in surface sterilization was a 5-minute treatment using sodium hypochlorite, Zephiran, and hydrogen peroxide in concentrations of 4.50 percent, 0.53 percent, and 3.00 percent, respectively . These agents were potent against gram-positive and gram-negative bacteria as well as endospore-forming microorganisms . Fungal spores were killed only by the first two but not by the latter germicidal agents . On the other hand, ethanol, chloroform, eugenol, betadine, and Gram's iodine solution were found not to be effective for surface sterilization. Microbios, 1983, 38(151), 27 - 32 Pigments with antibiotic activity from Myxococcus coralloides; Arias JM et al.; A strain of Myxococcus coralloides produces pigments with antibiotic activity . The pigments are non-diffusible and become detectable at the beginning of the autolytic phase . Red pigments produced by vegetatively growing cells were extracted by acetone treatment . The crude extract when chromatographed yielded several fractions, two of which were active against certain Gram-positive bacteria . Both fractions were partial purified in thin layer chromatography and can be differentiated according to colour, polarity and absorption spectrum . Production of active pigments is increased by nicotine and inhibited by diphenylamine . The pigments are also compared with the antibiotic produced by this bacterium. Radiat Environ Biophys, 1983, 22(2), 149 - 62 Electric field effects on bacteria and yeast cells; Hulsheger H et al.; Comparative studies were carried out describing the lethal effects of electric pulses on GRAM-negative bacteria, GRAM-positive bacteria, and yeast cells . Microorganisms are killed by the pulse treatment without visible morphological destruction . The observed survival rates are figured as functions of the field strength E and the treatment time t (pulse number X time constant) revealing three explicit parameters as sufficient to explain the kinetics of the results . These parameters are determined by the species of microorganism used and moreover depend on the physiological properties of the microbial population . GRAM-positive bacteria and yeasts were found to be less sensitive to electric pulse treatment than GRAM-negative bacteria, when low pulse numbers are applied . Treatment with high pulse numbers reveals survival rates below 1% for all microorganisms examined . Cells from the logarithmic growth phase are killed in markedly higher percentage than cells harvested from the stationary growth phase . The obtained results as well as further studies confirm the hypothesis of an electric induced selective damage of inner cell membranes. Adv Shock Res, 1983, 9, 125 - 32 Effect of age and splenectomy in murine endotoxemia; Karanfilian RG et al.; The protective role of the spleen in gram-positive infections, particularly in infancy and childhood, is well established . Since it is not known whether the spleen is protective in gram-negative sepsis, particularly in elderly individuals as compared to young subjects, the following study was undertaken . Splenectomized and nonsplenectomized Swiss Webster mice, 3 months old (young), or 12 months old (elderly) were utilized . Splenectomy was performed 4 weeks prior to administration of E coli endotoxin . Mortality in elderly nonsplenectomized mice was significantly greater than that of young nonsplenectomized mice . Prior splenectomy significantly increased the mortality in young mice at 48 h, whereas the mortality of E coli endotoxemia (ECE) in elderly mice was not altered by prior splenectomy . The spleen, therefore, appears to have a protective role for young mice but does not protect elderly mice with ECE . It is postulated that this loss of splenic protection reflects deteriorating splenic function with age. Arzneimittelforschung, 1983, 33(2), 269 - 72 Pharmacokinetics of Cefmenoxime in normal and impaired renal function; Hoffler D et al.; 7 beta-{2-(2-Aminothiazol-4-yl)-(Z)-2-methoxy-iminoacetamido}-3-{(1- methyl-1H-tetrazol-5-yl)thiomethyl}-ceph-3-em-4-carboxylic acid hemihydrochloride (Cefmenoxime), a new cephalosporin with a broad spectrum of activity against gram-positive and gram-negative bacteria, was investigated pharmacokinetically . 10 healthy volunteers and 20 patients with renal disease each received 2 g of the substance i.v . The plasma levels were monitored for 6 h in healthy volunteers and for 24 h in the patients with renal disease . The analysis of the data showed that the majority of the curves could be properly evaluated only with the aid of a two-compartment model . Therefore a simple half-life cannot be given . Cefmenoxime is eliminated more rapidly than cefoperazone, but more slowly than cefotaxime . The area under the serum level curves (AUC) increases when renal function is impaired . There is a mathematical correlation between the AUC and the renal function parameters, plasma creatinine and glomerular filtration rate . This gives the dose reduction factors, allowing the calculation of the doses with the same AUC on restricted renal function as that observed in healthy persons after normal doses . Dosage recommendations are given in the form of tables regarding the questions 1 . to what extent the dose may be reduced in impaired renal function without lowering the AUC and 2 . what is the highest safe dose. Drug Intell Clin Pharm, 1983 Jan, 17(1), 7 - 11 Cefoperazone (Cefobid, Pfizer); Lyon JA; Cefoperazone is a new beta-lactam antibiotic that possesses a broad spectrum of activity against gram-positive and gram-negative organisms . Cefoperazone differs from all previous cephalosporins in that it has exceptional activity against P . aeruginosa . The other distinguishing feature of cefoperazone is its high rate of biliary excretion, which will allow for treatment of biliary tract infections . Renal elimination accounts for only 20 percent of the agent's elimination; dosage modification is not necessary in decreased renal function . The clinical response rate of infections to cefoperazone is similar to that of moxalactam, cefotaxime, or the cephalosporins in general . The overall incidence of side effects was 14 percent in U.S . trials, with skin rash, fever, or urticaria occurring in 1 percent; phlebitis and injection-site pain in 2 percent; and diarrhea in 5 percent . As with the other third-generation cephalosporins, cefoperazone requires close scrutiny because of its expected high cost and the lack of comparative trials with standard antibiotic regimens. J Gen Microbiol, 1982 Dec, 128 (pt 12), 3061 - 5 Antibiotic activity of Xenorhabdus spp., bacteria symbiotically associated with insect pathogenic nematodes of the families Heterorhabditidae and Steinernematidae; Akhurst RJ; A wide range of micro-organisms, including yeasts, was found to be inhibited by the primary form of Xenorhabdus spp., but not by the secondary form . Only one Xenorhabdus strain, the symbiont of Neoaplectana glaseri, did not inhibit any of the micro-organisms tested; it is suggested that this strain may not have been isolated in the primary form . Gram-positive bacteria were sensitive to all active isolates of Xenorhabdus; each of the yeasts and almost all of the Gram-negative bacteria were sensitive to some but not all Xenorhabdus isolates . Each Xenorhabdus isolate was sensitive to some other Xenorhabdus isolates . The antibiotic activity of X . nematophilus was unaffected by autoclaving but was lost after dialysis . Anaerobically incubated Xenorhabdus spp . did not exhibit antibiotic activity. J Gen Microbiol, 1982 Dec, 128 (pt 12), 2893 - 8 Incorporation of diaminopimelic acid into the old poles of Escherichia coli; Koch AL et al.; The surface stress theory of the ontogeny of the bacterial rod depends critically on whether the old poles continue to incorporate new material into the stress-bearing murein . If insertion of peptidoglycan continues, then seemingly the shape must become gradually rounder due to the surface stress resulting from the internal hydrostatic pressure . We have reanalysed our earlier experimental data by classifying grains with respect to distance from the nearest pole, and not from the cell centre as was done previously, and conclude that old poles do incorporate new diaminopimelic acid residues . This eliminates the model we have proposed for Gram-positive rods, which assumed diffuse growth on the cylindrical sides and that poles once formed would be rigid . The new results are consistent with another model (presented elsewhere) in which insertion of new murein occurs all over the surface, although not equally . This new model leads to elongation and division if the energetics of wall expansion is altered by the cell in a control region at a particular point of the cycle by the cell. Immunobiology, 1982 Dec, 163(5), 427 - 35 Mitogenic and suppressive activity of mycelia from gram-positive bacteria on murine and human lymphocytes; Maier BF et al.; Mycelia from several strains of Streptomyces were potent B-lymphocyte mitogens for spleen cells from 3 inbred mouse strains (BALB/c, C3H/HeJ, C3H/nu/nu), inducing lymphocyte proliferation and differentiation into immunoglobulin-secreting cells . Streptomyces mycelia were also mitogenic towards human peripheral blood lymphocytes, where maximal stimulation was found on days 5 to 7 . On the other hand, human lymphocytes incubated with the mycelia for 3 days, but not the supernatants of these cultures, strongly inhibited mixed leukocyte reactions . Irradiation experiments suggest the induction of both radioresistant and radiolabile suppressor-cell populations by the components. Antimicrob Agents Chemother, 1982 Nov, 22(5), 805 - 9 Effect of 2-alkynoic acids on in vitro growth of bacterial and mammalian cells; Konthikamee W et al.; 3-Decynoyl-N-acetylcystamine is known to inhibit the in vitro growth of Escherichia coli but not of yeasts or mammalian cells . Neither the free acid nor the 2 positional isomer is active (L . R . Kass, J . Biol . Chem . 243:3223-3228, 1968) . Other studies have shown that 2-hexadecynoic acid is fungitoxic whereas most of the shorter chain isomers are inactive (H . Gershon and L . Shanks, Can J . Microbiol . 24:591-597, 1978) . Since these studies suggested that positional or chain length isomers of the acetylenic acids may selectively inhibit the growth of microorganisms, the effect of the alkynoic acids on the in vitro growth of gram-positive and gram-negative bacteria was evaluated . 2-Hexadecynoic acid was found to be the most active species . This acid was bacteriostatic for all gram-positive bacteria tested . The acid was readily taken up by the treated cells and incorporated into the phospholipid fraction . When added to the culture medium, 2-hexadecynoic acid inhibited the growth of HeLa cells, but when mixed with an equivalent amount of palmitic acid, growth inhibition was not observed. J Clin Microbiol, 1982 Nov, 16(5), 909 - 19 Rapid method for simultaneous detection of the arginine dihydrolase system and amino acid decarboxylases in microorganisms; Chen KC et al.; A specific procedure has been developed for the detection of the first two enzymes involved in the arginine dihydrolase system and the detection of the decarboxylases of arginine, glutamic acid, histidine, lysine, ornithine, phenylalanine, tryptophan, and tyrosine . A loopful of growth of each organism from dihydrolase-decarboxylase induction agar medium (or broth) was washed and incubated separately with 0.2-ml samples of three test media supplemented with different amino acids . Each spent test medium was dansylated, and the dansyl derivatives were separated by two-dimensional thin-layer chromatography on polyamide sheets . The end products (citrulline, ornithine, gamma-amino-n-butyric acid, and amines) produced during incubation were estimated by comparing the fluorescent intensities of end products from the spent test media and of the corresponding parent amino acids from test medium controls after thin-layer chromatography . The method is reproducible, requiring incubation of an organism in three test media for 1 h for simultaneous detection of the first two enzymes involved in the arginine dihydrolase system and of eight amino acid decarboxylases . This method has been successfully applied to gram-positive and gram-negative microorganisms and also to Mycoplasmatales . It could simplify and improve the accuracy of the corresponding biochemical tests performed in clinical laboratories for the identification and differentiation of microorganisms, and it may prove particularly useful for the differentiation of species of Pseudomonas and Mycoplasma. J Clin Microbiol, 1982 Nov, 16(5), 844 - 6 Achromopeptidase for lysis of anaerobic gram-positive cocci; Ezaki T et al.; Achromopeptidase, which has potent bacteriolytic activity for most of the gram-positive aerobic bacteria, was for the first time used for the lysis of anaerobic cocci . Most of the lysozyme-resistant gram-positive anaerobic cocci were lysed with this new enzyme . Peptococcus magnus was the only organism tested resistant to achromopeptidase . P . saccharolyticus was quite unusual because it was very sensitive to both achromopeptidase and lysozyme. J Antibiot (Tokyo), 1982 Nov, 35(11), 1448 - 53 An inhibitor of (Na+, K+)-ATPase produced by Streptomyces pseudovenezuelae MF722-02; purification and properties; Hori M et al.; A culture product of Streptomyces pseudovenezuelae MF722-02, with a molecular formula of C29H32N2O7, was isolated as yellow needles from culture broths and mycelia of the organism by means of a series of solvent extraction, column chromatography and crystallization . The antibiotic is active against some Gram-positive bacteria, inhibits growth in vitro of cells of mouse leukemia L-1210, prolongs the life span of mice inoculated with the leukemia cells, enhances deoxycholate-induced hemolysis in vitro and inhibits (Na+, K+)-ATPase in vitro. Rev Infect Dis, 1982 Nov-Dec, 4 Suppl, S683 - 7 Comparison of moxalactam with the combination of clindamycin and an aminoglycoside in the treatment of common surgical infections; Rambo WM et al.; The efficacy and safety of moxalactam were compared with those of a combination of clindamycin and an aminoglycoside in a randomized study of therapy for 60 patients with the following surgical infections: intraabdominal or pelvic infections (12 patients), abscesses (13 patients), and severe infections of extremities (35 patients) . These infections were equally distributed between the two treatment groups, except that, according to the randomization process, a majority of patients with intraabdominal infections received moxalactam therapy . Surgery was used as adjunctive therapy when necessary . One adverse reaction--fever and leukocytosis with eosinophilia--was due to continued administration of moxalactam . No significant adverse reaction was observed in the patients treated with the clindamycin-aminoglycoside combination . Although the number of isolated organisms resistant to the antibiotics was similar within each treatment regimen, an alarmingly high percentage of gram-positive cocci were intermediately sensitive to moxalactam in vitro . Even in the presence of resistant organisms, moxalactam therapy was as effective as the clindamycin-aminoglycoside therapy when surgical debridement or drainage was properly timed and executed. J Dairy Sci, 1982 Nov, 65(11), 2095 - 101 Effect of diet on amino and nucleic acids of rumen bacteria and protozoa; Arambel MJ et al.; Amino acid composition and nucleic acid content of pure cultures of rumen bacteria (17 species) were analyzed . Amino acid composition between gram-positive and -negative organisms was not different . The total nitrogen content of gram-negative bacteria (10.8%) was significantly higher than gram-positive organisms (9.9%) . Deoxyribonucleic acid-nitrogen: total nitrogen (mg/g) differed between gram-positive (8.8) and gram-negative (18.9) bacteria, but there was no significant difference in ratio of ribonucleic acid-nitrogen to total nitrogen . In a second experiment six rumen-fistulated cattle were fed either a high roughage (85% alfalfa hay plus 15% concentrate) or high concentrate diet (15% alfalfa hay and 85% concentrate) . Cattle were adapted 14 days and rumen contents sampled on 3 consecutive days . Nitrogen content was higher in protozoa from cattle fed low concentrate (8.4%) than in protozoa from cattle fed high concentrate (7.9%) but was similar in bacteria for both diets . Deoxyribonucleic acid nitrogen: total nitrogen (mg/g in bacteria decreased from 27.2 in cattle fed the low concentrate diet to 20.9 in those fed the high concentrate diet . Differences between sampling days were significant for both bacteria and protozoa for ratio of deoxyribonucleic acid-nitrogen to total nitrogen but were significant only in protozoa for ratio of ribonucleic acid nitrogen to total nitrogen . Ribonucleic acid may serve as a marker for estimating microbial production in the rumen if sources of variation are recognized and corrected adequately. J Antibiot (Tokyo), 1982 Oct, 35(10), 1271 - 9 New anthracycline antibiotics, auramycins and sulfurmycins . II . Isolation and characterization of 10 minor components (C approximately G); Hoshino T et al.; Following the discovery of new anthracycline antibiotics, auramycins A and B and sulfurmycins A and B, we found 10 minor analogues of auramycins and sulfurmycins, C, D, E, F and G, from the culture broth of a mutant strain of Streptomyces galilaeus OBB-111 and prepared 2 analogues as the chemical derivatives from auramycin G and sulfurmycin G . All analogues have a sugar moiety at C-7 position of the aglycones . These analogues exhibit activities against Gram-positive bacteria and P388 leukemia. J Antibiot (Tokyo), 1982 Oct, 35(10), 1345 - 50 Structural features of cytochalasins responsible for gram-positive bacterial inhibitions; Flashner M et al.; A study of the relative effectiveness of some eighteen natural and synthetically modified cytochalasins on the uptake of glucose by the Gram-positive bacterium Arthrobacter sialophilus showed that cytochalasins B, C or D and aspochalasins A, C or D were inactive natural congeners . The presence of an alpha,beta-unsaturated carbonyl group in the macrolide moiety of these compounds with appropriate bioisosteric placement, as exemplified by cytochalasin A and aspochalasin B, are requisite molecular features . The transmembrane inhibitory index of active compounds was enhanced by increasing their lipophilicity . Thiol adducts of CA were around 20% as active in solute uptake inhibition as was the free drug . Radioactive 7-O-acetyl CA and its thiol adduct were each rapidly taken up by A . sialophilus and remained firmly bound to cellular components even after denaturant manipulations . These findings provide strong evidence for a stable association between CA and presumptive macromolecular receptors in transport and related processes. Gann, 1982 Oct, 73(5), 825 - 32 Prolongation of the survival time of tumor-bearing mice treated with penicillins alone or in combination with living bacteria; Matsumoto T et al.; Relatively high doses (100 approximately 250 mg/kg) of penicillins such as sulbenicillin and ampicillin prolonged the survival time of C57BL/6 mice bearing EL-4 tumor when they were given 2 days after subcutaneous implantation of the tumor . This activity of penicillins was small but consistent under these conditions . These penicillins had little influence on lymphocytic functions or antibody production of normal and tumor-bearing mice . Therefore, the activity of penicillins to prolong the survival time of mice with a small tumor burden was assumed to be due to an enhanced host resistance elicited by certain indigenous bacterial flora susceptible to penicillins . This view was supported by the findings that artificial infection with gram-positive cocci in combination with treatment with penicillins considerably prolonged the survival time of mice with an early EL-4, while similar treatment did not improve the survival time of mice with growing tumors . Most gram-negative bacteria, which proliferated systemically and did not remain in the local region, were ineffective. Cutis, 1982 Oct, 30(4), 536 - 7, 541, 547 Effectiveness of cefoperazone in treating cutaneous infections; Marley WM et al.; Twenty-eight patients with severe cutaneous infections received cefoperazone, 2 grams intramuscularly twice a day for seven days . A wide range of gram-positive and gram-negative pathogens were isolated from admission cultures . All patients showed rapid clinical improvement . Two patients did not complete the full course of therapy because of intervening medical problems unrelated to the antibiotic . No significant side effects were noted . Relapses or reinfections occurred in two patients . In conclusions, cefoperazone is a safe and effective antibiotic for use in skin infections requiring parenteral therapy. Appl Environ Microbiol, 1982 Oct, 44(4), 992 - 3 Nonstaining (KOH) method for determination of gram reactions of marine bacteria; Buck JD; A rapid nonstaining (KOH) method for the determination of the Gram reactions of bacteria is described, and its application to marine isolates is discussed . All gram-positive and gram-negative results obtained by Gram staining were confirmed by the KOH method . Gram-variable bacteria produced equivocal results. Yale J Biol Med, 1982 Sep-Dec, 55(5-6), 453 - 61 Pelvic actinomycosis and usage of intrauterine contraceptive devices; Kelly J et al.; PIP: A case history is reported of a 29-year old patient who presented with a chronic illness characterized by lethargy, back pain, fever, and anemia . Evaluation disclosed the presence of a large pelvic mass which was confirmed as a tubo-ovarian abscess at surgery . Histological evaluation demonstrated involvement by Actinomyces species . The patient's illness is discussed as a complication of chronic IUD usage with reference to specific management for this emerging problem . Data from the National Fertility Study conducted in 1973 revealed that nearly 2 million married women in the US, ages 15-44, were using IUDs . Scott noted the serious potentially fatal complications associated with IUD use, including pelvic inflammatory disease (PID), uterine perforation, ectopic pregnancy, and spontaneous or septic abortion . The relative risk of PID among IUD users has been reported to be increased 2-12 fold over controls . The risk of infection appears to increase as the period of IUD use lengthens, but the risk associated with the use of copper IUDs may be slightly less than with plastic IUDs . Actinomycosis has traditionally been described in 3 anatomical regions, the cervicofacial, thoracic, and abdominal areas, but pelvic and genital disease has been recognized with increasing frequency over the past decade . The common denominator associated with the latter syndrome appears to be the concurrent presence of an IUD . The Actinomyces are gram positive, nonacid fast, anaerobic, obligate parasites which are classified somewhere between the true bacteria and the complete fungi . Actinomyces species are not generally considered part of the normal vaginal flora but rather are associated with the presence of a foreign body, most often an IUD . It is thought that the IUD causes the initial tissue injury which permits subsequent colonization by these organisms . It is not known whether orogenital contact is a means of transmission of Actinomyces to the lower genital tract of sexual partners . One might estimate that the overall rate of cytological detection of A . israelii in cervical smears of IUD users at about 10% . This incidence increases sharply in patients being evaluated for symptomatic pelvic infection . Conversely, in women with IUDs in place and Actinomyces demonstrable in cervical smears, PID is up to 4 times as common as in those who have negative smears . Antibiotic treatment should probably be dictated by the clinical setting . As a general guide, the threshold for treatment should be low, since the therapy is relatively benign and the extent to which colonization and tissue invasion may have occurred is unknown . J Bacteriol, 1982 Sep, 151(3), 1397 - 402 Occurrence of alpha-tocopherolquinone and alpha-tocopherolquinol in microorganisms; Hughes PE et al.; Both alpha-tocopherolquinol and alpha-tocopherolquinone were found in 56 of 93 strains of microorganisms examined . Organisms that contained these compounds included the single example of a eucaryotic alga, a Euglena, and a cyanobacterium (blue-green alga), 22 of 32 genera of bacteria, and 9 genera of yeasts . In the bacteria and yeasts the levels of quinone and hydroquinone were nearly equal and averaged about 3 nmol of each compound g-1 of packed cells . Included among the bacteria that contained these compounds were three examples from the newly proposed kingdom of Archaebacteriae . Those microorganisms that did not contain alpha-tocopherolquinol or alpha-tocopherolquinone tended to fall into two groups . One group consisted of gram-positive, anaerobic or facultative bacteria with a low content of guanine and cytosine, and the second group encompassed all of the filamentous microorganisms studied . No metabolic function is known for alpha-tocopherolquinol or its quinone other than as a cofactor in the biohydrogenation of unsaturated fatty acids that can be carried out by only a few organisms. Ophthalmology, 1982 Sep, 89(9), 1055 - 66 Endophthalmitis: current approaches; Rowsey JJ et al.; Seventy patients referred with a diagnosis of endophthalmitis underwent anterior chamber and vitreous taps with intracameral antibiotic injections . Fifty-four eyes were culture positive, 34 (63%) after previous intraocular surgery, 12 (22%) had sustained penetrating trauma, and 8 (15%) resulted from a metastatic infection . Of 61 total isolates, 48 (79%) were gram positive, 9 (15%) were gram negative, and 5 (8%) were fungi . Visual recovery after surgery was related to the relative virulence of the organisms isolated . Twenty-four (44%) eyes achieved 20/400 or better vision, but only seven (13%) obtained 20/40 or better vision . Patients with a markedly abnormal ERG operatively demonstrated poor visual acuity recovery, while patients with near normal ERG recovered better vision . The authors currently recommend vitrectomy in patients with endophthalmitis whenever the retina cannot be visualized. J Periodontol, 1982 Sep, 53(9), 578 - 86 Gingival crevice neutrophil function in periodontosis; Newman HN et al.; This study examined gingival crevicular polymorphonuclear leucocyte function in periodontosis patients . Cells were examined for viability, function and ultrastructure . Eighty percent or more of the cells in each sample were viable as assessed by the fluorescein diacetate technique, but the test organism, Candida guillermondiae, was not phagocytosed . Gingival crevicular fluid contained many lysing neutrophils and nonphagocytosed organisms . Recognizable polymorphs contained Gram-negative and Gram-positive organisms . On the basis of this and previous studies it is concluded that gingival crevice neutrophils from periodontosis sites show reduced phagocytic function compared with cells from normal or periodontitis-affected gingival crevices . It is possible that the behavior of neutrophils from gingival crevices may be irrelevant . Original changes by that stage may have obscured their capabilities. J Clin Microbiol, 1982 Sep, 16(3), 525 - 30 Clinical laboratory comparison of a slide blood culture system with a conventional broth system; Pfaller MA et al.; The recovery of bacteria and fungi from blood cultures was compared in conventional tryptic soy broth (TSB) bottles and in TSB bottles with an agarcoated slide attachment . A total of 2,662 sets of blood cultures, including 413 that were positive (15.5%), were evaluated . Significantly more gram-positive and gram-negative bacteria were recovered in the slide culture bottles than in conventional bottles (299 versus 253 isolates) . Growth of gram-positive organisms and fungi was detected in the slide culture bottles 24 to 48 h earlier than in the TSB bottles . In addition, 76% of the isolates in the slide culture system were detected on the agar slide . In comparison, only 40% of the isolates in the TSB bottles were detected initially by blind subculturing . The incidences of contamination were 2.7% (71 cultures) for the slide culture system and 1.5% (39 cultures) for the TSB bottles. Infect Immun, 1982 Sep, 37(3), 1191 - 9 Zinc and bacterial adherence; Sugarman B et al.; Zinc significantly enhances the ability of piliated Gram-negative and Gram-positive bacteria to attach to HeLa cells . This effect is related to the concentration of zinc and degree of bacterial piliation, and is not present with unpiliated organisms . Bacterial viability is not necessary for this effect, and sulfhydryl blockers decrease the response . These data suggest that zinc can bind to bacterial pili and augment bacterial adherence; in this manner, zinc may act as a virulence factor. J Antibiot (Tokyo), 1982 Aug, 35(8), 972 - 8 Prothracarcin, a novel antitumor antibiotic; Shimizu K et al.; A novel antibiotic, prothracarcin was isolated from the culture broth of Streptomyces umbrosus subsp . raffinophilus DO-62 . The antibiotic has the molecular formula of C14H14N2O and belongs to the pyrrolo {1,4}benzodiazepine antibiotics . Its structure has been elucidated by mass and NMR spectra . It is active against Gram-positive and Gram-negative bacteria and experimental murine tumor sarcoma 180 and leukemia P388. Arthritis Rheum, 1982 Aug, 25(8), 947 - 53 Gas-liquid chromatographic analysis of synovial fluid . Succinic acid and lactic acid as markers for septic arthritis; Borenstein DG et al.; Nonvolatile short-chain fatty acids from 80 synovial fluids were quantified by gas-liquid chromatography . Succinic acid was detectable in all 23 septic synovial fluids infected with either gram-positive or gram-negative organisms and in only 5 of 57 nonseptic synovial fluids . Lactic acid was present in all of the effusions but was correlated with septic arthritis only when present in concentrations greater than 250 mg% . Neither short-chain fatty acid was more sensitive than high white blood cell counts (greater than 50,000 mm3) or depressed glucose concentration (less than 40 mg/dl) in diagnosing septic arthritis before antibiotic therapy; however, the detection of succinic acid was helpful in identifying patients with septic arthritis who had been given antibiotic treatment before arthrocentesis . Thus, gas-liquid chromatography, a rapid and sensitive method for the detection of short-chain fatty acids, may complement the currently available methods used to diagnose septic arthritis. Arch Intern Med, 1982 Aug, 142(8), 1456 - 9 Bacteremias and fungemias in oncologic patients with central venous catheters: changing spectrum of infection; Lowder JN et al.; Ninety central venous catheters were inserted into 80 patients undergoing therapy for malignant neoplasms . Bacteremia and fungemia occurred in 18 of 41 treatment courses in patients with acute leukemia and in nine of 55 treatment courses in patients with solid tumors and lymphomas . Although gram-negative organisms accounted for nine (33%) cases of infection, the majority of disseminated infections were caused by gram-positive organisms (12 {45%} cases) or fungi (six {22%} cases) . Central venous catheters may be helpful in the treatment of patients undergoing intensive therapy with cytotoxic agents, but the shift in-spectrum of infection to gram-positive bacteremias in patients with these catheters compared with patients treated using peripheral vein access must be appreciated. Am J Pathol, 1982 Aug, 108(2), 196 - 205 Acute and chronic graft-versus-host disease in dogs given hemopoietic grafts from DLA-nonidentical littermates . Two distinct syndromes; Atkinson K et al.; We recognized two distinct clinical and histologic syndromes of acute and chronic graft-versus-host disease (GVHD) in irradiation chimeric dogs given hemopoietic grafts from DLA-nonidentical littermate donors . Clinically acute GVHD developed, with a median onset of 13 days after the transplant, and was characterized by skin erythema, jaundice, diarrhea, and gram-negative infections; the median survival of these dogs was 29.5 days . Chronic GVHD developed a median of 124 days after the transplant and was characterized by generalized skin ulcerations, massive ascites, and gram-positive infections; the median survival of these dogs was 150 days . Chronic GVHD could be distinguished histologically from acute GVHD by epidermal atrophy and dermal fibrosis and by bile duct proliferation, bridging, piecemeal necrosis, and portal fibrosis in the liver . Questions related to GVHD in man can be investigated in this model of acute and chronic GVHD in a large outbred species. Monatsschr Kinderheilkd, 1982 Jul, 130(7), 567 - 9 {Spontaneous bacterial peritonitis in cirrhosis of the liver caused by alpha-1-antitrypsin deficiency (author's transl)}; Bosch C et al.; A three year old child with cirrhosis of the liver and ascites caused by alpha-1-antitrypsin deficiency, developed severe abdominal pain with diarrhea and fever . Spontaneous bacterial peritonitis was diagnosed by demonstrating a purulent ascitic fluid with gram-positive cocci in the smear which were identified as pneumococci in the bacterial culture . The peritonitis subsided under antibiotic treatment without complications . Spontaneous bacterial peritonitis in children with cirrhosis of the liver is mentioned in the literature, but up to now, however, only three cases were reported in detail . In order to establish the diagnosis, abdominal tap should be tried rather than explorative laparotomy, the demonstration of gram-positive cocci is diagnostic of spontaneous bacterial peritonitis . With early antibiotic therapy, prognosis of the disease is favourable . Newborns and children with nephrotic syndrome, however, are particularly at risk. J Antibiot (Tokyo), 1982 May, 35(5), 622 - 8 A selective isolation procedure for Pseudomonas bacteria; Wakisaka Y et al.; A selective isolation medium was devised for Pseudomonas bacteria . An antibiotic mixture which contained 10 micrograms per ml of cerexin A, 10 micrograms per ml of nalidixic acid and 30 micrograms per ml of cycloheximide was used . With the antibiotic medium, 58 strains of bacteria presumed to be Pseudomonas which were subdivided into 18 taxonomically different groups were isolated from 3 soil samples with 9% of contaminants . With this method, it was possible to isolate a Pseudomonas bacterium from a sample containing about 400 times as many other Gram-positive and -negative bacteria. Crit Care Med, 1982 May, 10(5), 308 - 10 Complement activation in septic shock due to gram-negative and gram-positive bacteria; Leon C et al.; Whole serum complement (CH50) and C3, C4, and C3PA plasma values were studied in 48 patients: 9 with nonseptic shock; 20 with sepsis; 14 with septic shock caused by gram-negative bacteria; 5 with septic shock caused by gram-positive bacteria . All were compared with a control group of 25 healthy individuals . Determinations were made upon admission and again 48 and 96 h later . No significant differences in complement values were found between the patients with nonseptic shock and the control group . In the patients with sepsis, decreased CH50 (p less than 0.001) and increased C3PA (p less than 0.02) values were observed, while C3 and C4 remained unaltered . In the patients with septic shock, markedly decreased levels of CH50, C3, and C4 were seen (p less than 0.001, and p less than 0.001, and p less than 0.001, respectively) without changes in C3PA levels . There were no differences between septic shock due to gram-negative and gram-positive bacteria, or between patients who died and those who survived . After 96 h, the altered values returned to the normal range . This underlines the transitory activation of the complement system through the classic pathway and suggests its possible role in the pathogenesis of septic shock in man. J Antibiot (Tokyo), 1982 Mar, 35(3), 285 - 94 Paulomycins A and B . Isolation and characterization; Argoudelis AD et al.; Paulomycin A, C34H46N2O17S and paulomycin B, C33H44N2O17S are two antibiotics produced by Streptomyces paulus strain 273 (UC 5142) . Both antibiotics, which are mainly active against a variety of Gram-positive bacteria, contain an isothiocyanate group and in this respect they are related to senfolomycins A and B and proceomycin. Can J Surg, 1982 Mar, 25(2), 138 - 40 Infective endocarditis: surgical treatment of 41 patients; Haraphongse M et al.; Forty-one patients with infective endocarditis were treated surgically at the University of Alberta Hospital, Edmonton, between 1961 and 1980 . Their ages ranged from 10 to 67 years and the male to female ratio was 4:1 . A wide variety of organisms were cultured but gram-positive organisms predominated . Bicuspid aortic valves, normal valves and valves affected by rheumatic heart disease, were the most common sites of infection . The aortic valve was most frequently involved . The onset of left ventricular failure was the major indication for surgery . The overall mortality at 30 days was 19.5% . The mortality after 30 days was 9.8% . Eleven of 12 patients who died had left ventricular failure preoperatively . The mortality in patients who had valve replacement during the first 4 weeks of infection did not differ from those who had valve replacement after 4 weeks of infection . Hemodynamic studies following operation in six patients showed that pulmonary arterial and wedge pressures had returned to normal levels . Nineteen of 26 patients who were followed up were asymptomatic . One had a malfunctioning prosthesis, one chronic heart failure and one had reoperation for paravalvular leak . Four patients diet during the follow-up period . The authors conclude that all patients with infective endocarditis who suffer left ventricular failure should have prompt valve replacement regardless of the duration of antibiotic therapy. J Vet Pharmacol Ther, 1982 Mar, 5(1), 59 - 69 Distribution of penicillin G, dihydrostreptomycin, oxytetracycline, and chloramphenicol in serum and subcutaneous chamber fluid; Ziv G et al.; Penetration of penicillin G, dihydrostreptomycin, oxytetracycline, and chloramphenicol into interstitial fluid of calves was estimated using subcutaneously implanted, multiple perforated spherical polypropylene capsules as a model . Antibiotic concentrations were determined in simultaneously withdrawn serum and capsular fluid (CF) samples at intervals after single and multiple intramuscular injections of antibiotics at recommended dose schedules . Peak concentrations of penicillin G in CF were 57% of those in serum, and the drug was eliminated from CF at a slower rate than from serum . Dihydrostreptomycin diffused into CF to a limited degree and was eliminated from CF much more slowly than from serum leading to gradual drug accumulation in CF upon repeated dosing . Multiple injections of oxytetracycline resulted in CF drug levels comparable with those in serum . Concentrations of chloramphenicol in CF were generally similar to free (non-protein bound) serum drug levels . CF concentrations of penicillin G were within the range of the minimal inhibitory concentrations of the drug for pathogenic gram positive micro-organisms and CF levels of dihydrostreptomycin, oxytetracycline, and chloramphenicol were apparently sufficient to inhibit the majority of gram negative pathogens involved in bovine injections . Advantages and limitations of the tissue cage model are briefly discussed. Nouv Presse Med, 1982 Feb 20, 11(8), 579 - 82 {Incidence, prognosis and prevention of septicaemias in patients under treatment for acute leukaemia (author's transl)}; Gastaut JA et al.; Septicaemias are frequent and severe in patients with acute leukaemia under aplastic treatment . The present study concerns 69 such patients: 29 with acute lymphoblastic leukaemia (ALL), and 40 with acute non-lymphoblastic leukaemia (ANLL) . All were treated in single rooms in the same hospital and in similar conditions . The overall incidence of septicaemia was 62%; it was 60% in patients with recently diagnosed ALL and 68% during relapses . More than 34% of ALL patients and 82.5% of ANLL patients had one or several episodes of septicaemia . Among the 74 pathogens isolated 50% were Gram-positive organisms, 45% Gram-negative organisms and 5% Candida spp. . The first episodes of septicaemias were predominantly caused by Gram-positive spp . (61%) and the subsequent ones by Gram-negative spp . (60%) . The primary infection could only be diagnosed in 19% of the cases and was most frequently located in the digestive tract or perineal region . The most common focal complications were lung infections (18 cases), skin infections (12 cases) and septic shock (15 cases) . Seventy-four p . cent of the patients survived with prompt and potent antibiotic therapy . Death occurred in 26% and was clearly related to the following factors: chemotherapy of relapsed leukaemia and/or blastic aplasia and/or successive episodes of septicaemia . The incidence and severity of septicaemias in leukaemic patients will only be reduced by improved prophylactic measures against infection and by less pronounced and shorter chemotherapy-induced granulocytopenia. Mycopathologia, 1982 Feb 19, 77(2), 123 - 8 Antifungal activity of some Discomycetes . I . Biological spectrum of Ciboria rufo-fusca (Weberb.) Sacc; Gueho E et al.; The antifungal activity was investigated in culture filtrates of 131 strains (41 genera and 104 species) of Ascomycetes--Discomycetes by testing against 6 fungal species which caused diseases in man . The anti-fungal spectrum was established for a Ciboria rufo-fusca strain, the only one found to inhibit all test organisms . This strain was also active against several gram-positive and gram-negative bacteria. J Antibiot (Tokyo), 1982 Feb, 35(2), 142 - 50 Tetronomycin, a novel polyether of unusual structure; Keller-Juslen C et al.; Tetronomycin, C34H50O8, isolated from a strain of Streptomyces sp . nov . represents a novel polycyclic ionophore polyether . The crystal structure and absolute configuration were established by X-ray analysis of the mono-O-acetyltetronomycin silver salt . Tetronomycin is the first metabolic polyether which contains a tetronic acid moiety instead of the essential carboxylic acid function . A trisubstituted cyclohexane ring and an interesting molecular conformation of the silver salt represent additional unique structural features . Extensive NMR-studies enabled the assignment of chemical shifts and the correlation of the proton and carbon signals . Tetronomycin exhibits activity against Gram-positive bacteria. Arch Surg, 1982 Feb, 117(2), 221 - 4 Transplantation of microbially contaminated cadaver kidneys; Majeski JA et al.; Bacterial cultures of graft perfusion fluid were taken on 514 renal perfusions during a ten-year period . A total of 22 positive cultures were found . Two sets of kidneys were discarded because of the bacteriology report . Only two possible wound infections were found that could be attributable to the preoperative contamination even though 19 of 24 patients with "contaminated" kidneys received no antibiotics . No loss of kidneys or life was found . Of the 22 contaminated perfusates, 18 (80%) originated from other institutions although only 144 (28%) of the total kidneys that were perfused came from other institutions . The majority of cultures indicated that the organisms were skin contaminants or organisms of low virulence . Microbial contamination of perfused cadaver kidneys is uncommon (1.2% in local kidneys and 9.3% in shared kidneys) . Contaminated kidneys are not a major source of infection in renal transplant recipients . Kidneys that are contaminated with frequently virulent Gram-negative bacteria, such as Escherichia coli, should be discarded . Contamination of kidneys with Gram-positive organisms should not be a contraindication for transplantation, but the patients should probably be given prophylactic antibiotics. J Bacteriol, 1982 Feb, 149(2), 718 - 25 Regulatory properties of citrate synthase from Rickettsia prowazekii; Phibbs PV Jr et al.; Citrate synthase {citrate (si)-synthase} (EC 4.1.3.7) was partially purified from extracts of highly purified typhus rickettsiae (Rickettsia prowazekii) . Molecular exclusion and affinity column chromatography were used to prepare 200-fold-purified citrate synthase that contained no detectable malate dehydrogenase (EC 1.1.1.37) activity . Rickettsial malate dehydrogenase also was partially purified (200-fold) via this purification procedure . Catalytically active citrate synthase exhibited a relative molecular weight of approximately 62,000 after elution from a calibrated Sephacryl S-200 column . Acetyl coenzyme A saturation of partially purified enzyme was sensitive to strong competitive inhibition with adenylates (ATP greater than ADP much greater than AMP) . {beta,gamma-methylene}ATP, dATP, and dADP also caused strong inhibition, but guanosine and cytosine nucleotides were significantly less inhibitory . Adenylates had no effect on oxalacetate saturation kinetics when acetyl coenzyme A was present in high concentration (greater than or equal to 50 microM) . Neither NADH nor alpha-ketoglutarate affected the saturation kinetics of rickettsial citrate synthase . Thus, citrate synthase from R . prowazekii exhibits greater similarity to the eucaryotic and gram-positive procaryotic enzymes than to citrate synthase from free-living gram-negative bacteria . These results represent the first characterization of a highly purified key regulatory enzyme from these obligate intracellular parasitic bacteria. Jpn J Antibiot, 1982 Feb, 35(2), 399 - 408 {Experimental and clinical studies on ceftizoxime in the field of oral surgery (author's transl)}; Tsushima T et al.; Experimental and clinical studies on ceftizoxime (CZX), a new cephalosporin derivative, were carried out and the following results were obtained . 1 . The minimal inhibitory concentrations of CZX, cefazolin (CEZ), cephalothin (CET), cefotiam (CTM) and cefmetazole (CMZ) against Gram-positive cocci (31 strains) and Gram-negative rods (169 strains) isolated from the patients with oral infections were determined . CZX, though somewhat less active against Gram-positive cocci than the other cephalosporins, was the most active of the antibiotics tested against Gram-negative rods . 2 . The mean serum levels in 19 patients who received 1 g of CZX by intravenous drip infusion for 1 hour were as follows . 19.6 micrograms/ml 30 minutes after the start of intravenous drip infusion, 52.2 micrograms/ml after 1 hour, 25.0 micrograms/ml after 1.5 hours, 20.3 micrograms/ml after 2 hours, 7.9 micrograms/ml after 4 hours, 3.5 micrograms/ml after 6 hours . The mean peak tissue levels of CZX after 1 g dose by intravenous drip infusion for 1 hour were 14.3 micrograms/g (n = 5) in gingiva and 8.5 micrograms/g (n = 2) in bone marrow at the end of intravenous drip infusion . 3 . CZX was administered to 17 patients with various infections in the oral surgical field at daily dose of 1 approximately 2 g for 3 approximately 6 days . The therapeutic effect was as follows: 'excellent' in 6 cases, 'good' in 9, 'fair' in 1 and 'poor' in 1 . The final rate of effectiveness was 88.2% . No adverse reaction was observed except for 2 cases of slight elevation of S-GPT. Biochim Biophys Acta, 1982 Jan 4, 700(1), 24 - 32 Purification and properties of the exocellular beta-lactamase of Actinomadura strain R39; Duez C et al.; The exocellular beta-lactamase (penicillin amido-beta-lactamhydrolase, EC 3.5.2.6) of Actinomadura R39 consists of one single polypeptide chain of molecular weight about 15 200 . It exhibits a highly asymmetrical shape, has a low isoelectric point (at pH 5.0) and contains about 9.3% (w/w) of a polydeoxyribonucleotide with which it forms a rather stable complex . Removal of a substantial amount of this deoxyribonucleotide by treatment with DNAase I has no effect on the enzyme activity . The beta-lactamase has a wide spectrum of activity . Penicillins and delta 3-cephalosporins can be either good or poor substrates . Oxacillin, which is a poor substrate of most beta-lactamases from Gram-positive bacteria, is a good substrate of the beta-lactamase of Actinomadura R39 . Its best substrate, however, is nitrocefin (kcat/Km: 2300 000 M-1.s-1; catalytic centre activity: 210 s-1) . The kcat/Km values observed with some penicillins and delta 3-cephalosporins are similar to the values of the bimolecular rate constants that govern the formation of the acyl-enzyme intermediates between these antibiotics and the serine D-alanyl-D-alanine peptidase that is also secreted by the same strain Actinomadura R39 . Such a relationship, however, is not observed with all the beta-lactam compounds tested. Am J Trop Med Hyg, 1982 Jan, 31(1), 131 - 5 An outbreak of pyomyositis in a large refugee camp in Thailand; Fanney D et al.; During a 2-month period, 17 cases of pyomyositis were seen in the hospital population of a large refugee camp for Cambodians in Thailand . The temporal clustering of the cases suggests an epidemic pattern . Patients in this series were generally young and otherwise healthy . All had gram-positive cocci demonstrated in abscess pus, and all responded to surgical drainage . Fourteen (82%) of the cases were initially misdiagnosed by volunteer physicians who were unfamiliar with the disease . The authors suggest that a mosquito-borne virus predisposes to the development of the pyomyositis abscess. Infect Control, 1982 Jan-Feb, 3(1), 44 - 51 Wound infection: a review of diagnosis and treatment; Simmons RL; Surgical wounds can become infected by a variety of organisms, leading to a variety of clinical courses . In this article, several types of infections, therapies, prognoses and prophylaxes are discussed . Skin and subcutaneous tissues infect with a range of gram-positive and gram-negative aerobic and anerobic bacteria . Gangrenous infections, whether necrotizing fasciitis or bacterial synergistic gangrene, can be devastating or fatal . Gangrenous infection in the muscle is also discussed, and various treatments outlined . The intention is to familiarize readers with the predisposing conditions, clinical manifestations and therapeutic alternatives for these surgical infections. Surgery, 1982 Jan, 91(1), 61 - 3 Suture resistance to infection; Sharp WV et al.; The emergence of both absorbable and nonabsorbable synthetic materials has been primary among the many new developments in suture materials . This is a study of 16 types of natural and synthetic suture materials and their resistance to both gram-positive and gram-negative infections . Four hundred and twenty suture inplants were made in the Edlich mouse model . The 16 different sutures were compared to appropriate controls and graded by the degree of infectibility . Synthetic sutures were superior in all areas . The monofilament sutures performed better than the multifilament sutures . Lubricating coatings had no effect on infectibility . Natural sutures performed poorly and should not be used in wounds that are potentially susceptible to infection. Metab Pediatr Syst Ophthalmol, 1982, 6(3-4), 221 - 5 A retrospective study of endophthalmitis; Molinari H et al.; The results of a survey of 50 cases of endophthalmitis following surgery, trauma, corneal ulcers, or of endogenous origin are described . Most of the post-surgical cases followed intracapsular cataract surgery and in 48.1% of the eyes, the predominant organisms were gram positive bacteria . In cases where the infected eyes were treated with topical, intravenous and subconjunctival injections of antibiotics, 57.2% of the eyes were lost; however, in 6 cases, where vitrectomy and intravitreal injection of antibiotics was performed, only 1 of the 6 eyes was lost (16.6%) . In this eye, however, the vitreous removal and antibiotic injection was done in advanced stage of the disease . In one case where the vitrectomy and antibiotic therapy was performed early, the patient attained good vision. Arch Oral Biol, 1982, 27(12), 993 - 8 Cell-mediated and humoral immune responses of guinea-pigs to the oral bacterium Actinomyces viscosus; Doroszczak N et al.; Actinomyces viscosus is a Gram-positive facultative rod indigenous to most human mouths . The guinea-pig was evaluated as a model for assessing cellular immune responses to a human strain of A . viscosus . Guinea-pigs, immunized with heat-killed A . viscosus cells or a water-soluble extract from A . viscosus (AVS), were tested for delayed-type hypersensitivity responses to A . viscosus 4 weeks after immunization . A week later, the guinea-pigs were terminated . Lymphocytes from peripheral blood, lymph node and spleen were tested for in-vitro blastogenic responses to heat-killed A . viscosus or the water-soluble extract . Plasma from these guinea-pigs were tested for the presence of precipitating antibodies . Positive in-vivo delayed-type hypersensitivity reactions and antibody responses to AVS occurred only in immunized guinea-pigs . A strong in-vitro blastogenic response to AVS or heat-killed A . viscosus occurred in lymphocytes from immunized guinea-pigs, but a weak response was detected in un-immunized animals . These data suggest that the guinea-pig can be used to evaluate different parameters of the immune response to oral bacteria such as A . viscosus. Am J Pediatr Hematol Oncol, 1982 Fall, 4(3), 263 - 71 Fever and bacteremia in children and adolescents with acute lymphoblastic leukemia; Green DM; The medical records of 318 children and adolescents with acute lymphoblastic leukemia (ALL) were reviewed to determine the relationship between the occurrence of fever, a positive blood culture, and the absolute neutrophil count (ANC) during induction, remission maintenance, and bone marrow relapse . On the day of diagnosis of ALL, almost one-third of the patients had a temperature higher than 38.5 degrees C, but only three (4.1%) had positive blood cultures . Following the initiation of induction chemotherapy, many patients had febrile episodes . Forty-six percent of the blood cultures obtained during this period were positive . Only patients with an absolute neutrophil count of 1000/mm3 or less were at risk of a positive blood culture during induction . Thirty-four percent of the admissions during remission maintenance for fever were associated with pneumonia . One-half of the episodes of pneumonia occurred during the first 150 days following the diagnosis of ALL . No patient with pneumonia during remission maintenance had a positive blood culture . Eighteen percent of the blood cultures obtained from patients admitted during periods of bone marrow relapse were positive . Gram-positive organisms predominated during induction, whereas gram-negative organisms predominated during periods of bone marrow relapse. J Clin Microbiol, 1982 Jan, 15(1), 74 - 7 Lysis-filtration blood culture versus conventional blood culture in a bacteremic rabbit model; Zierdt CH et al.; Thirteen representative pathogenic bacterial species were used to create septicemia in rabbits, by injecting 10(6) colony-forming units into the marginal ear vein . At a selected time, usually 30 to 60 min after injection, heart blood was drawn into heparin and dispensed in 5.0-,0.5-, and 0.1-ml volumes into duplicate bottles of commercial brain heart infusion broth with sodium polyanetholesulfonate, and into duplicate bottles of a newly developed blood-lysing solution . Lysed blood was filtered, and the filter membranes were cultured in brain heart infusion broth . At the 5.0-ml blood inoculum level, of 126 total culture bottles (63 rabbits) for each system, 83 conventional cultures versus 109 lysis-filtration cultures were positive . At the 0.5-ml blood inoculum, 20 of 126 conventional culture bottles were positive, versus 66 of 126 lysis-filtration cultures . At the 0.1-ml blood inoculum, 2 of 126 conventional culture bottles were positive, versus 30 of 126 lysis-filtration cultures . Overall, 105 of 378 conventional cultures and 205 of 378 lysis-filtration cultures were positive . The advantage of the lysis-filtration system was striking for both gram-positive and gram-negative organisms at all inoculum concentrations, but was greater for gram-positive organisms . Most significant was the rate of recovery by this new system, when the number of bacteria in the blood was reduced to the point where recovery by conventional culture was unlikely . It is postulated that the superiority of lysis-filtration culture may be due to release of bacteria by lysis of phagocytes, preventing continued loss of pathogens by intracellular destruction during the first hours of blood culture. Scott Med J, 1982, 27 Spec No., S39 - 47 Penicillins in perspective; McAllister TA; Fifty-three years after their discovery the penicillins still present a challenge to laboratory workers and clinicians . They are members of the broader beta-lactam group and are susceptible to inactivation by beta-lactamases from Gram-positive and Gram-negative bacteria . Countering these enzymes is achieved by producing more stable penicillin molecules or by using enzyme-blocking agents like clavulanic acid to protect the antibiotics . The field is confusing and to assist in defining the present-day role of the group, the concept of a microbiological profile is considered . The modes and sites of action of the penicillins and the beta-lactamases are presented and both are classified . The place of penicillins in the treatment of life-threatening and lesser infections, and in prophylaxis, is discussed. Toxicon, 1982, 20(1), 247 - 52 Genetics and pathogenic role of Escherichia coli haemolysin; Hughes C et al.; While clear evidence exists for the direct involvement of cytolysins in the pathogenesis of Gram-positive bacteria, the significance of Gram-negative haemolysins remains unclear . This paper presents briefly data indicating a role for haemolysin production in infections caused by Escherichia coli and also experiments which have allowed an analysis of the molecular basis of the haemolysis among pathogenic and non-pathogenic strains of this species. Infection, 1982, 10 Suppl 3, S141 - 3 The treatment of surgical infections by deep intramuscular administration of mezlocillin; Freylejer A et al.; Thirty adult inpatients were enrolled in an open multicenter study to determine the efficacy and tolerability of mezlocillin injected i.m . in surgical bacterial infections . Clinical, bacteriological and laboratory controls were performed . The infections were caused by gram-negative and/or gram-positive bacteria . Twenty-seven patients were cured bacteriologically and clinically . One patient had a relapse and there was a failure in two . The local and systemic tolerance was very good . One patient experienced nausea, headache and intestinal pain on the second day of treatment . These symptoms subsided spontaneously shortly after mezlocillin treatment was discontinued. Drug Intell Clin Pharm, 1981 Dec, 15(12), 951 - 7 Use of cefamandole in the treatment of soft tissue and skeletal infections; LeFrock JL et al.; In review of our data, 12 of 38 patients (31.5 percent) had adverse drug reactions, a somewhat bothersome factor . Disturbing side effects of leukopenia and pancytopenia were seen in two patients, respectively, who were receiving cefamandole 12 g/d . Other cephalosporins, including cephalothin and cefazolin, have been reported to cause leukopenia . Eosinophilia and elevations of alkaline phosphatase and SGOT levels were noted with other cephalosporins . We observed no adverse clinical reactions associated with these findings . Although our study was able to demonstrate the therapeutic effectiveness of cefamandole in the treatment of soft tissue and skeletal infections, it should be reemphasized that cefamandole should be used only as an alternative treatment for the penicillin-allergic patient . In reality, a first-generation cephalosporin should be used for gram-positive organisms if one is required in soft tissue infections. J Bacteriol, 1981 Dec, 148(3), 1006 - 11 Duplication of the tuf gene, which encodes peptide chain elongation factor Tu, is widespread in Gram-negative bacteria; Filer D et al.; The tuf gene which encodes peptide chain elongation factor Tu was found to be duplicated in nine enteric and four nonenteric gram-negative bacteria, but present only in one copy in two gram-positive genera . In two of the nonenteric gram-negative genera, Pseudomonas and Caulobacter, the duplicate tuf genes were found to be very close together on the chromosome, which contrasts with the situation in Escherichia coli, where they are more than 660 kilobases apart. J Antibiot (Tokyo), 1981 Nov, 34(11), 1456 - 68 Cephalosporins . III . Synthesis and structure-activity relationships of 7-vinylenethioacetamid:o cephalosporins with a tetrazolo-pyridazine at the 3-position; Nannini G et al.; The synthesis and in vitro activity of 7-vinylenethioacetamido cephalosporins with a tetrazolo-pyridazine at the 3-position are described . These cephalosporins showed good activity against Gram-positive and Gram-negative bacteria . 7-{(Z)-beta-carboxyvinylenethio-acetamido}-3-{(tetrazolo{1,5-b}pyridazin-8- amino-6-yl)-thiomethyl}-3-cephem-4-carboxylic acid (K 13176, 21) was significantly more active in vitro and in vivo than cefazolin against Gram-negative bacteria. Antibiotiki, 1981 Nov, 26(11), 803 - 7 {New species of Actinomadura isolated from soils in Turkmenia and their antagonistic properties}; Galatenko OA et al.; New species, i.e . Actinomadura polychroma and Actinomadura umbrina are described . The cell wall of the cultures contains meso-diaminopimelic acid galactose, glucose and madurose . The former species is characterized by short spore chains in the form of spirals or pseudosporangia, smooth spore surface, white aerial mycelium and colourless, yellowish-brown or blue-green substrate mycelium . The cultures of this species have no antagonistic activity with respect to various test-microbes . The type culture of A . polychroma is designated as INA 2755 . A . umbrina is characterized by formation of short spore chains, which are straight, hooked or spiral, often branching, smooth spore surface, white scanty aerial mycelium and brownish or black-brown substrate mycelium and soluble pigment of the same colour . The strains of this species inhibit the growth of some gram-positive bacteria and have no activity against gram-negative organisms . The type culture of A . umbrina is designed as INA 2309. Nucleic Acids Res, 1981 Oct 24, 9(20), 5407 - 10 The nucleotide sequence of 5S rRNA from Mycoplasma capricolum; Hori H et al.; The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH . The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known . The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria. J Antibiot (Tokyo), 1981 Oct, 34(10), 1253 - 6 Setamycin, a new antibiotic; Omura S et al.; A new antibiotic, setamycin, was extracted from the mycelia of a rare actinomycete strain KM-6054 . The antibiotic, the molecular formula of which was found to be C42H61NO12 (tentative), is a yellow powder showing activity against some fungi, trichomonads and weakly against Gram-positive bacteria. Antibiotiki, 1981 Oct, 26(10), 723 - 7 {Actinomadura of the sierozem soils of Turkmenia and their antagonistic properties}; Galatenko OA et al.; Occurrence of actinomycetes of the genus Actinomadura in the grey earth soils of Turkmenistan was studied . The Gause organic medium No . 2 with rubomycin proved to be most favourable for isolation of Actinomadura from the soil samples . The number of Actinomadura in 1 g of the soil varied from 3 to 686 000 depending on the sample which constituted 0.2-11 per cent of the total number of the actinomycetes . It was shown that Actinomadura are rather widely distributed in the grey earth soils of Turkmenistan . They were detected practically in all the soil samples tested . The number of Actinomadura significantly depended on the level of the soil cultivation . The number of Actinomadura in the samples of cultivated soils was higher than that in the virgin land samples . The isolates were classified as belonging to 16 species of actinomadura, 5 of which proved to be new Actinomadura species . It was shown with the streak plate method that Actinomadura had moderate antagonistic properties . The majority of the isolates were active against gram-positive organisms. Mikrobiologiia, 1981 Sep-Oct, 50(5), 928 - 31 {Sensitivity to sodium dodecyl benzene sulfonate: a supplementary test for bacterial identification}; Serov GD; The susceptibility to sodium dodecylbenzene sulfonate, an anion-active detergent, was studied with 10 Gram-positive and 18 Gram-negative bacterial cultures . According to this susceptibility, the cultures were subdivided into two groups identical in their tinctorial properties . The bacteria growing at a 0.05% concentration of sodium dodecylbenzene sulfonate or at its higher concentrations were Gram-negative . The threshold concentration of this compound in the medium at which Gram-positive cultures could grow was 0.008%; some of the bacteria ceased growing even at a 0.002% concentration . The bacteria varied in their susceptibility to the detergent also within one and the same group, and even within one and the same species . The subdivision of bacteria on the basis of their susceptibility to sodium dodecylbenzene sulfonate may be considered as a taxonomic feature. Farmaco {Sci}, 1981 Sep, 36(9), 785 - 93 Synthesis, spectral behaviour and microbiological properties of some di(nitrothienyl)sulfides; Ronsisvalle G et al.; Six novel di)nitrothienyl)sulfides (I)-(VI) have been prepared either by condensation of suitable bromonitrothiophene derivatives with sodium sulfide or by hydrolysis of di-(3-nitro-2-thienyl)disulfide (XI), with ethanolic potassium hydroxide, followed by condensation of the resulting nitrothiophene thiolate with the appropriate bromonitrothiophenes . All compounds proved active, in vitro, against a number of gram-positive bacteria, at very low concentrations . Substitution of a thiophene nucleus by the benzene nucleus resulted in a decrease of activity . I.R . and U.V . spectral data are discussed. J Antibiot (Tokyo), 1981 Aug, 34(8), 938 - 50 Rubeomycin, a new anthracycline antibiotic complex . I . Taxonomy of producing organism, isolation, characterization and biological activities of rubeomycin A, A1, B and B1; Ogawa Y et al.; A new antibiotic complex has been obtained from the cultures of an actinomycete, strain FA-1180, isolated from a soil sample collected at lake side of Biwa in Japan . On the basis of taxonomic studies the producing microorganism is designated as Actinomadura roseoviolacea var . biwakoensis nov . var . The antibiotic complex belongs to the class of anthracycline glycoside antibiotics . All components form deep red fine needles on crystallization; components are named rubeomycin A, A1, B and B1 . These components exhibit activity against Gram-positive bacteria as well as Yoshida sarcoma cell in vitro . These components are also effective on P388 leukemia. Appl Environ Microbiol, 1981 Aug, 42(2), 303 - 7 Culture medium for selective isolation and enumeration of Gram-negative bacteria from ground meats; Cyzeska FJ et al.; We developed a new medium, designated peptone bile amphotericin cycloheximide (PBAC) agar, which contains (per liter) 10 g of peptone, 300 mg of bile salts, 1 mg of amphotericin B, 1 g of cycloheximide, and 15 g of agar . When 21 samples of fresh ground beef were studied and plate count agar counts were used as references, we obtained a mean recovery of 28% of total counts with violet red bile agar overlay, whereas we obtained 48% recovery with PBAC agar . With 12 samples of frozen ground beef, recovery on violet red bile agar overlay was 29% of the recovery on plate count agar, whereas the corresponding value on PBAC agar was 45% . PBAC agar allowed the enumeration of 1.4 times as many gram-negative bacteria as violet red bile agar overlay . None of eight strains of gram-positive bacteria and none of eight strains of yeasts grew on PBAC agar . Of 158 colonies randomly selected from pour plates of eight fresh ground meat samples, 95% stained gram negative . In comparison, only 70% of 151 colonies selected from corresponding plate count agar plates were gram negative . The lack of background color, turbidity, and ease of use make PBAC agar easier to handle than other media used for gram-negative bacteria, such as violet red bile agar, violet red bile agar overlay, and crystal violet tetrazolium agar . In the preparation PBAC agar, all ingredients are autoclaved together except amphotericin B, which is filter sterilized and added before the plates are poured. Can J Microbiol, 1981 Jul, 27(7), 729 - 34 Isolation and characterization of the plasma membrane and the outer membrane of Deinococcus radiodurans strain Sark; Thompson BG et al.; Deinococcus radiodurans strain Sark, although gram-positive, has a complex cell wall profile that includes an outer membrane-like structure . The outer cell envelope layers formed blebs throughout the growth cycle, which were shed as large vesicles (0.5-3.5 micron m in diameter) from approximately 5% of the cell population . Instability was accentuated by treatment with 10% NaCl, which released the outer membrane from all cells without disrupting the peptidoglycan layer, and provided an outer membrane fraction uncontaminated by plasma membrane . Cells so treated formed protoplasts after sequential treatment with 6 M urea, trypsin, and the supernatant from batch cultures of Lysobacter enzymogenes 495 . The plasma membrane was isolated from lysed protoplasts . The absence of presence of catalase activity, and differences in lipid composition, were used to differentiate between plasma membrane and outer membrane. Jpn J Antibiot, 1981 Jun, 34(6), 939 - 41 1H NMR analysis of R-75-1 substance; Xiao-Chang F et al.; Compound R-75-1 is a very potent rifamycin derivative prepared from rifamycin SV at the Sichuan Institute of Antibiotics Industry, China in 1975 . This compound showed a strong (see graphs in book) activity against Myobacterium tuberculosis and Gram-positive organisms . Here we describe the assignment of the 1H NMR spectrum of this novel compound. Clin Pediatr (Phila), 1981 Jun, 20(6), 397 - 401 Rapid glucose disappearance in infants with infection; Leake RD et al.; Altered carbohydrate metabolism has been reported during episodes of neonatal infection . To document that there is more rapid glucose disappearance during infection, intravenous glucose tolerance tests (IVGTT) and serial plasma growth hormone and insulin levels were determined in eight full-term neonates during the first three days of an acute episode of infection and during convalescence, 5 to 15 days later . Eight healthy infants were each studied once using the same study protocol . Glucose disappearance rates, measured as K1 of glucose, were increased (p less than 0.01) during both the acute septic period (3.7 +/- 0.3% disappearance/min; mean +/- S.E.M.) and convalescent period (2.5 +/- 0.2% min) when compared with values in control infants (1.3 +/- 0.3%/min) . Gram-negative, gram-positive, and viral infections were all associated with rapid glucose disposal . The abnormality in carbohydrate homeostasis persisted for at least 5 to 15 days after treatment was begun . Baseline and stimulated (20-minutes post bolus glucose infusion) plasma insulin and growth hormone levels did not differ among the groups . Thus, there is no evidence that hyperinsulinism produced the rapid glucose disappeared rate and enhanced glucose utilization . The reason for the disturbed carbohydrate metabolism in neonatal infections remains unknown. J Oral Pathol, 1981 Jun, 10(3), 173 - 85 Bacterial bone resorption in noma (gangrenous stomatitis); Merrell BR et al.; Bone resorption (gangrenous stomatitis) was found to be associated with extensive bacterial colonization of mandibular bone in three separate cases of noma . Light and electron microscopy revealed a heterogeneous bacterial population with a long, filamentous, Gram-positive organism predominantly in direct contact with the resorbing bone front . The bone was completely denuded and no osteoclastic activity was observed . The highly regular arrangement of the filamentous organism along the resorbing bone and the absence of osteoclastic activity suggested that bone resorption in noma is mediated by bacterial action. Antimicrob Agents Chemother, 1981 May, 19(5), 826 - 30 Chemoprophylaxis with cefoxitin and cephalothin in orthopedic surgery: a comparison; Rosenfeld MB et al.; Forty-eight patients who underwent elective hip or knee surgery were randomly divided into two groups . A total of 22 patients received a single 1-g preoperative bolus of cefoxitin, and 26 patients received a single 1-g preoperative dose of cephalothin . At various time intervals, serum and bone samples were taken during the operative procedure . Our data indicated that whereas serum levels of cefoxitin and cephalothin were maintained for at least 2h at levels capable of inhibiting most gram-positive cocci and many gram-negative rods, bone levels of cefoxitin rather rapid decay over a 2-h period . Moreover, in only 58% of the entire cephalothin-treated group were bone levels detectable and then only at a concentration that would inhibited gram-positive cocci . No significant morbidity was observed in either treatment group. Jpn J Antibiot, 1981 May, 34(5), 678 - 81 {A clinical study of cefotiam in pediatric field (author's transl)}; Aoyama R et al.; Cefotiam is a new semisynthetic cephalosporin antibiotic . The treatment with this drug was carried out in 12 cases of pediatric infection . The clinical response was observed in 92% of the cases . Cefotiam was found to be active against a variety of Gram-positive and Gram-negative bacteria . Neither marked side effects nor laboratory abnormalities were found with this treatment. J Antibiot (Tokyo), 1981 Apr, 34(4), 412 - 26 Cephalosporins . II . Synthesis and structure-activity relationships of new 7-vinylenethioacetamido and thioacrylamido cephalosporins; Nannini G et al.; The synthesis and in vitro structure-activity relationships of 7-vinylenethioacetamido and thioacrylamido cephalosporins with various substituents at the 3-position are described . 7(Z)-beta-Vinylenethioacetamido cephalosporins proved the most active against Gram-positive and Gram-negative bacteria . 7-{(Z)-beta-Cyanovinylenethioacetamido}-3-{(1-methyl-1H-tetrazol-5-yl)-thiomethyl}-3-cephem-4-carboxylic acid (K 13101, 40) was several times more active in vitro than cefazolin. Scand J Dent Res, 1981 Apr, 89(2), 157 - 64 Ultrastructural estimation of the effect of sucrose and glucose rises on early dental plaque formed on plastic films; Brecx M et al.; The influence of water, glucose and sucrose rises on early plaque formation has been studied . The amount and structure of dental deposits formed on plastic films were determined on four occasions: no rinsing, water, glucose or sucrose rinses . Five subjects with healthy gingiva developed plaque in 4 h on plastic films applied to the buccal surfaces of premolars and canines, after which period the plastic films with adhering deposits were processed for electron microscopy . Sections were prepared for examination in the light and electron microscope . Some were stained for the demonstration of carbohydrates according to the periodic acid thiocarbohydrazide osmium tetroxide technique . Furthermore, the number of cellular elements collected on the films during the four experiments was calculated and statistically compared . The results in the four groups were identical . The plastic films were covered by a surface coating of acellular material in or on which bacteria, epithelial cells and leukocytes were observed . The microorganisms were almost exclusively Gram-positive cocci . Many bacteria exhibited intracellular polysaccharides . The results indicate that the rinsing procedure does not influence early plaque formation, and that frequent mouthrinses with glucose or sucrose have no detectable effect on plaque growth at this initial stage of bacterial adherence. Antimicrob Agents Chemother, 1981 Apr, 19(4), 556 - 61 Inhibition of Escherichia coli by thioglycerol; Jensen KK et al.; Thioglycerol inhibits the growth of various Escherichia coli strains and other microorganisms, both gram positive and gram negative . The susceptibility of organisms varies . The bactericidal action of this substance is not continuous and stops after an initial burst . At subbactericidal concentrations synthesis of ribonucleic acid is the most strongly affected . This is not due to interference with nucleoside biosynthesis or to direct inhibition of ribonucleic acid polymerase by thioglycerol. J Antibiot (Tokyo), 1981 Mar, 34(3), 259 - 65 A new antitumor antibiotic, stubomycin; Umezawa I et al.; A new antibiotic, stubomycin, was isolated from the culture broth and mycelia of Streptomyces strain No . KG-2245 . Stubomycin was prepared as colorless plates and has the empirical formula C29H35NO5 . The antibiotic possesses growth inhibitory activity against Gram-positive bacteria and transplantable murine tumors, such as Ehrlich carcinoma, and leukemia P388 . The antibiotic also shows direct cytotoxic activity against HeLa cells in vitro. J Clin Microbiol, 1981 Mar, 13(3), 472 - 7 Antibiotic-resistant group JK bacteria in hospitals; Gill VJ et al.; The organisms designated as Center for Disease Control group JK are gram-positive rods that have previously been described as causing serious infection in compromised hosts . Four years of hospital experience with this group of organisms in Clinical Center patients was reviewed . Studies were also undertaken on specific wards to determine frequency of occurrence and distribution patterns . Inguinal cultures taken on two wards showed that 30 to 35% of patients were colonized with group JK and that newly admitted patients may already be colonized at the time of admission . Colonization was shown to persist for weeks and sometimes months . Isolates obtained throughout the hospital were predominantly from cancer patients, particularly in wounds, abscesses, and drainage sites . Most blood isolates were from granulocytopenic patients with hematological malignancies. Appl Environ Microbiol, 1981 Mar, 41(3), 837 - 9 Simple filter paper procedure for estimation of glucose uptake via group translocation by whole-cell suspensions of bacteria; Germaine GR et al.; A simple and rapid filter paper technique is described for processing samples from glucose uptake studies with whole cells of gram-positive or gram-negative bacteria that transport glucose via group translocation . The procedure yields results equivalent to those obtained with a conventional membrane filtration method and requires no special filtration equipment or source of vacuum. Am Fam Physician, 1981 Feb, 23(2), 110 - 2 Human bites of the hand; Mann RJ; Infected human bite wounds of the hand may result in loss of function . Prompt treatment is essential to prevent such complications as septic arthritis and osteomyelitis . Principles of treatment include thorough debridement and irrigation, culture and sensitivity studies, leaving the wound open, bulky hand dressing and intravenous antibiotics to cover both gram-positive and gram-negative organisms. Cancer, 1981 Feb 1, 47(3), 583 - 7 Fever in children with acute lymphoblastic leukemia; Peng LH et al.; In this study among children with acute lymphoblastic leukemia, more febrile episodes occurred during induction of remission and relapse than during remission . Infection was mainly responsible for fever during remission, regardless of the neutrophil count . However, during induction and relapse, evidence suggests that the underlying malignancy is the more likely cause of fever if the neutrophil count exceeds 200 per mm3 . For all cases, the risk of serious infection was high with severe neutropenia (neutrophil count less than 200 per mm3) . Of the organisms identified, gram-positive and gram-negative bacteria were equally represented . Infection remains a serious problem in the management of children with leukemia. Br J Hosp Med, 1981 Jan, 25(1), 24 - 7 Antibiotics for gram-positive organisms; Pagan FS; Most infections due to Gram-positive organisms can be treated with quite a small number of antibiotics . Penicillin, cloxacillin, and erythromycin should be enough to cover 90 per cent of Gram-positive infections . The relatively narrow spectrum of these drugs should be the incentive to prescribers to use them selectively, together with adequate bacteriological investigation, in order to achieve effective treatment with a minimum of disturbance to the patient's normal bacterial flora and without any other harmful side effects. J Antibiot (Tokyo), 1981 Jan, 34(1), 34 - 9 Chemical modifications in the tetracycline series; Valcavi U et al.; New tetracycline analogs modified at position 5, 6 and 2 were synthetized . The 5-deoxy-5-oxo-derivatives, 2a and 3a, were obtained by DMSO/acetic anhydride oxidation of doxycycline (2) and methacycline (3), respectively; the 6-demethyl-6-hydroxymethyl-6-alpha-hydroxyoxytetracycline (3b) by methacycline oxidation with the KCIO3/OsO4 system and the 6-hydroxyanhydrooxytetracycline (4) treating 3b with periodic acid . The 2-ethoxycarbonyl-2-decarboxamidodoxycycline (2b), was synthesized by treating doxycycline nitrile (2c) with EtOH and anhydrous HCl, 2-thiocarboxamide-2-decarboxamidodoxycycline (2d) by reaction of doxycycline with P2S5 in dioxane and 2-aminomethyl-2-decarboxamidodoxycycline (2e) by RANEY-Nickel reduction of 2d . All the synthetized compounds proved to be almost inactive on agar plates both on Gram-positive and Gram-negative bacteria. Immun Infekt, 1981, 9(3), 78 - 87 {Permeability barrier of bacterial cell envelopes as cause of resistance to antibiotics (author's transl)}; Fischer E et al.; The uptake of antibiotics into bacterial cells depends on the structures and mechanisms involved in general transport of substrates . Because of their different molecular architecture, the distinct layers of the cell envelope differ in permeability . The cell-wall of gram-positive bacteria, which is simply structured, is therefore more permeable to a series of antibiotics than is the gram-negative cell-wall which is built like other biological membranes . The energy dependent uptake of many antimetabolic antibiotics in managed by the selective transport systems of the cytoplasmic membrane . In the case of antibiotics, which are not analogous in structure with metabolites, the dependence of the drug on active transport is less obvious . The uptake of antibiotics may even be influenced by the target-site of the drug in the cytoplasm . An example is the accumulation of aminoglycoside antibiotics which is initiated by binding of the drugs to the ribosome . The autoinduction of aminoglycoside uptake is associated with an increased transport of polyamines . The broad variety of modes of resistance, based on permeability, results from the large number of components involved in the uptake of antibiotics . Resistance of bacteria can depend on alterations of every layer of the cell envelope . The existence of a capsule can cause resistance, as well as the specific loss of protein components of the outer membrane, which are involved in the uptake of special substrates . The exclusion of antimetabolites by the loss of the cognate transport system yields well defined resistance . By contrast, resistance towards a wide variety of unrelated antibiotics results from the uncoupling of energization and transport phenomena . Resistance based on reduced uptake becomes even more complex when the modification of the target site alters the accumulation of antibiotics . Far beyond common mechanisms is the ability of cells to actively excrete antibiotics . Far beyond common mechanisms is the ability of cells to actively excrete antibiotics that have already penetrated . The induction of selective export systems for tetracyclines is not dependent on activities of cell-borne transport systems but is a consequence of the acquisition of resistance plasmids. Biochem J, 1981 Jan 1, 193(1), 75 - 82 The exocellular beta-lactamase of Streptomyces albus G . Purification, properties and comparison with the exocellular DD-carboxypeptidase; Duez C et al.; The exocellular beta-lactamase of Streptomyces albus G has been purified to near protein homogeneity . It consists of one single polypeptide chain of mol.wt . 30 000-31 000, has a rather low isoelectric point (at pH 6.0) and contains less lysine (2.1%) and more half-cystine residues than most beta-lactamases from other Gram-positive bacteria . Penicillins are much better substrates than delta 3-cephalosporins; the catalytic-centre activity of good penicillin substrates is 333-500 s-1 . The exocellular, mol.wt . 17 000 DD-carboxypeptidase of S . albus G {previously purified to protein homogeneity; Duez, Frere, Geurts, Ghuysen, Dierickx & Delcambe (1978) Biochem . J . 175, 793-800} behaves as an exceedingly poor beta-lactamase, hydrolysing benzylpenicillin into benzylpenicilloate 5 x 10(-6)-fold less rapidly than does the exocellular beta-lactamase . To all appearances, the beta-lactamase has no bivalent cation requirement whereas, as shown elsewhere {Dideberg, Charlier, Dupont, Vermeire, Frere & Ghuysen (1980) FEBS Lett . 117, 212-214, and Dideberg, Joris, Frere, Ghuysen, Weber, Robaye, Delbrouck & Roelands (1980) FEBS Lett . 117, 215-218}, the DD-carboxypeptidase possesses one essential Zn2+ ion per molecule . Peptide 'mapping' and immunological studies suggest that the two Streptomyces enzymes probably have very different structural and mechanistic properties. Antibiotiki, 1981 Jan, 26(1), 8 - 10 {Streptomyces coerulatus, a producer of the nonaromatic heptaene, LIA-0735}; Barashkova NP et al.; An actinomycete designated as Streptomyces coerulatus LIA-0735 was isolated from a soil sample collected in the Alma-Ata region . The strain produces a nonaromatic heptaenic antibiotic with a very low inhibitory effect on the growth of gram positive bacteria, yeasts and actinomycetes . By a number of features antibiotic LIA-0735 differs from the known heptaens of the nonaromatic group. Crit Rev Microbiol, 1981, 8(4), 303 - 38 The role of bacterial surface structures in pathogenesis; Costerton JW et al.; Modern research has revealed that the true surfaces of animal cells consist of polysaccharide chains that are linked to proteins hydrophobically anchored in the membrane and protrude to form a dense glycocalyx . It has become increasingly clear that most pathogenic bacteria must position themselves at the surface of their "target" cell in order to exert their toxic or otherwise deleterious effects . The true surface of most pathogenic bacteria has also been recently shown to consist of a protruding mass of polysaccharide chains--the bacterial glycocalyx--that is composed of teichoic acids in many gram-positive species and of acid polysaccharides in many gram-negative organisms . Through this bacterial glycocalyx certain cell surface proteins and organized protein structures (e.g., pili) are known to project, so that the bacterial surface is a mosaic of polysaccharides and proteins; both of these types of molecules have been implicated in instances of specific pathogenic adhesion . Besides their role in specific adhesion to target cells, these surface components interpose a highly charged, and often very extensive, barrier that can prevent the penetration of antibodies and antibiotics to their target sites in the bacterial cell . They may also frustrate mucociliary clearance, phagocytosis, and other clearance mechanisms of the host . We will discuss the chemical and physical nature of these bacterial surface components that mediate pathogenic adhesion and counteract host defense mechanisms sufficiently to allow infections to become established. Proc Natl Acad Sci U S A, 1981 Jan, 78(1), 229 - 33 Regulation of glutamine synthetase activity by adenylylation in the Gram-positive bacterium Streptomyces cattleya; Streicher SL et al.; The enzymatic activity of glutamine synthetase {GS; L-glutamate:ammonia ligase (ADP-forming), EC 6.3.1.2} from the Gram-positive bacterium Streptomyces cattleya is regulated by covalent modification . In whole cells containing high levels of GS the addition of ammonium chloride leads to a rapid decline in GS activity . Crude extracts prepared from such ammonia-shocked cells had very low levels of GS activity as measured by biosynthetic and gamma-glutamyltransferase assays . Incubation of the crude extracts with snake venom phosphodiesterase restored GS activity . In cell extracts, GS was also inactivated by an ATP- and glutamine-dependent reaction . Radioactive labeling studies demonstrated the incorporation of an AmP moiety into GS protein upon modification . Our results suggest a covalent modification of GS in a Gram-positive bacterium . This modification appears to be adenylylation of the GS subunit similar to that found in the Gram-negative bacteria. J Antibiot (Tokyo), 1980 Dec, 33(12), 1437 - 42 Antibiotic no . 6016, a polyether antibiotic; Kusakabe Y et al.; A new polyether antibiotic, No . 6016, was isolated from the culture of Streptomyces albus strain No . 6016 . The antibiotic was obtained as colorless prisms having a molecular formula of C46H77O16Na, m.p . 192 approximately 195 degrees C (dec.), and has only end absorption in ultraviolet region . The infrared and NMR spectra of the antibiotic suggest the presence of carbonyl and methoxyl groups . The antibiotic No . 6016 exhibits activity against Gram-positive bacteria including mycobacteria and is effective in the treatment of coccidiosis of fowl. Infect Immun, 1980 Dec, 30(3), 887 - 9 Microbicidal and cytotoxic properties of soluble components from quaternary aminoethyl-sephadex; Selsted ME et al.; Soluble material released during hydration and equilibration of a quaternary aminoethyl-Sephadex anion exchanger was found to be toxic for a variety of cell types . Among these were gram-positive and gram-negative bacteria, fungi, and a murine cell line . The material was also found to interfere with the spectrophotometric enzymatic determination of lysozyme. J Antibiot (Tokyo), 1980 Dec, 33(12), 1515 - 20 Studies on new aminoglycoside antibiotics, istamycins, from an actinomycete isolated from a marine environment . III . Nutritional effects on istamycin production and additional chemical and biological properties of istamycins; Hotta K et al.; Streptomyces tenjimariensis SS-939 produced istamycins in a medium containing starch as the carbon source and soy bean meal as the nitrogen source . Istamycin production decreased substantially when starch was substituted with mono- or di- saccharides such as glucose, glycerol and maltose . A marked decrease of istamycin production was also observed when a rapidly used nitrogen source such as yeast extract, peptone or casamino acid was employed instead of soy bean meal . Addition of palmitate at a concentration of 0.2% doubled istamycin production . Istamycins A and B were found to be as active as fortimicin A and sporaricin A against Gram-positive and Gram-negative bacteria including aminoglycoside-resistant strains. J Biol Buccale, 1980 Dec, 8(4), 287 - 97 Electron microscopic study of denture plaque; Theilade J et al.; This study was designed to gain information on the composition and ultrastructure of bacterial plaque on the fitting surface of maxillary dentures in edentulous patients (with or without denture stomatitis of the palatal mucosa) . Denture plaque was examined from 12 patients with complete dentures of unknown age . Clinical inspection of the palatal mucosa revealed that 5 suffered from denture stomatitis, while 7 exhibited a clinically normal palatal mucosa . Smears taken from the palatal mucosa and the fitting surface of the denture revealed the presence of bacteria in 11 of the 12 patients, while yeast cells were present in only 5, all of whom suffered from denture stomatitis . After the dentures were stained with a plaque disclosing solution, a 3 x 3 mm piece of the denture plate exhibiting plaque was cut out and processed for electron microscopy . Examination of sections in the light and electron microscope revealed no systematic differences between those from patients with denture stomatitis as compared with those with a clinically healthy palatal mucosa . In 2 specimens the denture was covered only by a very thin layer of condensed material which resembled the pellicle forming on teeth . In 10 the denture was covered with a deposit of microorganisms in an intermicrobial matrix . In 9 of these cocci or short rods predominated, and most of them were Gram-positive . In one specimen the plaque consisted of yeast cells only . The surface of the dentures was relatively smooth although minor irregularities were encountered . The denture material was in no instance invaded by microorganisms. Mikrobiologiia, 1980 Nov-Dec, 49(6), 1005 - 7 {Blattabacterium in the fat body of the Maritime Territory relic roach, Cryptocercus relictus}; Gromov BV et al.; Rod-like symbiotic bacteria in the fat body of the cockroach Cryptocercus relictus have a thin cell wall of the Gram-positive type; the nucleoplasm in "diffuse" . The septum connected with a massive mesosome is formed during cell division . The bacteria in the host cells are surrounded will several host membranes . For tens of millions of years . Cryptocercus relictus has been developing in the conditions of entire geographical isolation, but the morphology of its Blattabacterium is similar to that of the symbionts of other cockroaches examined . This gives evidence to the conservative nature of the cockroach--bacterial symbiosis. J Antibiot (Tokyo), 1980 Nov, 33(11), 1274 - 80 A new aminoglycoside antibiotic, sannamycin C and its 4-N-glycyl derivative; Deushi T et al.; Streptomyces sannanensis KC-7038 used for the production of sannamycins A and B has also produced another antibiotic sannamycin C, in the culture broth . Physico-chemical characterization revealed that sannamycin C is a new aminoglycoside antibiotic having 6-N-methylpurpurosamine C and 2-deoxy-3-epi-fortamine . Its 4-N-glycyl derivative indicated inhibitory activity against Gram-positive and Gram-negative bacteria containing aminoglycoside resistant strains. J Clin Periodontol, 1980 Oct, 7(5), 361 - 73 Influence of optimal and excluded oral hygiene on early formation of dental plaque on plastic films . A quantitative and descriptive light and electron microscopic study; Brecx M et al.; The influence of oral hygiene on early plaque formation has been studied . The amount and structure of dental deposits formed on plastic films were determined at two occasions with or without a preceding period of effective oral hygiene . Six human subjects developed plaque during 4 hours on plastic films applied to the buccal surfaces of premolars and cuspids . The plastic films with adhering deposits were processed for electron microscopy . In presence of healthy gingiva, the plastic films were covered by a surface coating of acellular material in or on which bacteria, epithelial cells and leukocytes were observed . The microorganisms were almost exclusively Gram-positive cocci . When plaque formation was preceded by a week of excluded oral hygiene, the deposits collected on the same teeth exhibited a threefold increase in the number of bacteria . The relative composition of the flora was altered, as evidenced by a higher number of Gram-negative cells as well as the occurrence of rods and filamentous organisms . The results indicate that neglect of oral hygiene favors an earlier establishment of a complex bacterial flora at the dento-gingival region of the buccal surfaces of premolars and cuspids. Mikrobiologiia, 1980 Sep-Oct, 49(5), 769 - 75 {Relationship between the number of nucleoidosomes and the stage of development of Mycobacterium rubrum cultures}; Biriuzova VI et al.; This work has confirmed that the nucleoidosome (mesosome) of Gram-positive bacteria is a specialized invagination of the cytoplasmic membrane and serves for accommodating the replicative centres of nucleoid homologous chromosomes . The structure is not constant, it arises under specified conditions of cultivation and at certain growth stages which are characterized by decelerated division of nucleoids and cells while the rate of DNA replication does not change. J Immunol, 1980 Sep, 125(3), 1380 - 6 Production of a suppressor factor by human adherent cells treated with mycobacteria; Wadee AA et al.; Human peripheral blood mononuclear cell (MN) proliferation and lymphokine production induced by mitogen could be inhibited by heat killed whole mycobacteria . The inhibition was induced by a wide variety of mycobacteri but not by other Gram-positive or Gram-negative organisms or by latex particles . Proliferation and lymphokine production by adherent cell-depleted lymphocytes was not inhibited by these organisms . Adherent cells treated with mycobacteria had the ability to inhibit lymphocyte blastogenesis when co-cultured with the lymphocytes . the inhibitory effect of these adherent cells was due to the release of a heat stable, nondialyzable suppressor cells . These latter cells, which were T gamma cells, could inhibit the blastogenic ability of normal lymphocytes activated by mitogens . The results suggest that in situations of high mycobacterial load, adherent cells are activted to release a suppressor factor that will activate lymphocytes to become suppressor cells . This mechanism may explain the anergy associated with lepromatous leprosy or advanced tuberculosis. Jpn J Antibiot, 1980 Sep, 33(9), 931 - 4 {Clinical results of cefoperazone in pediatric infections (author's transl)}; Miyao M et al.; In order to evaluate effectiveness of cefoperazone (CPZ) in the treatment of bacterial infections of children, the clinical studies were carried out . CPZ was administered by one-shot injection to 28 patients at daily dose of 50 approximately 160 (average 89.7) mg/kg in 3 approximately 4 divided dose for 2 approximately 10 (average 5.6) days . The overall efficacy rate in 28 cases was 92.9%, i.e., excellent in 16 (57.1%), good in 10 (35.7%), fair in 1 (3.6%) and poor in 1 case (3.6%) . Temporary rise of GOT and GPT or only GOT was observed in each 1 case out of 28 cases (7.1%), but any other abnormality was not observed throughout this series . Based on the above results, CPZ was thus considered to be a useful antibiotic in treatment of pediatric infections caused by Gram-positive cocci and Gram-negative rods. J Bacteriol, 1980 Sep, 143(3), 1108 - 15 Structure of the Escherichia coli K2 capsular antigen, a teichoic acid-like polymer; Jann K et al.; The primary structure of the K2 antigen of Escherichia coli was elucidated by composition, alkaline fragmentation, dephosphorylation with hydrofluoric acid, periodate oxidation, and methylation analysis . The polymer contains galactose in the pyranosidic and furanosidic ring form . It consists of phosphogaolactopyranosyl glycerol and phosphagalactofuranosyl glycerol units in a molar ratio of 2:1 . The sequence of these units is not known . The structure of the K2 antigen is reminiscent of that of certain teichoic acids of gram-positive bacteria . Using microprecipitation, it was shown that in the polymer galactoside is immunodominant. J Gen Microbiol, 1980 Aug, 119(Pt 2), 333 - 40 A pigmented mycelial antibiotic in Streptomyces coelicolor: control by a chromosomal gene cluster; Rudd BA et al.; Streptomyces coelicolor was found to produce a third secondary metabolite, in addition to the antibiotics methylenomycin A and actinorhodin previously described . This is a red pigmented, highly non-polar compound with antibiotic activity against certain Gram-positive bacteria . Mutants lacking the red compound fell into five cosynthetic classes . Representatives of each of the five classes were mapped to the chromosome of the producing organism, in a closely linked cluster . Genetic studies provided evidence that this new metabolite is distinct from actinorhodin and indicated that the two pigments do not share parts of the same biosynthetic pathway. Nature, 1980 Jul 31, 286(5772), 527 - 9 DNA cloning in Streptomyces: a bifunctional replicon comprising pBR322 inserted into a Streptomyces phage; Suarez JE et al.; The Gram-positive, mycelial, differentiating streptomycetes are responsible for the production of many important antibiotics . The availability of gene cloning systems in this microbial group would have many industrial applications besides allowing more penetrating study of the genetics of Streptomyces coelicolor A3(2) (which, as the best understood streptomycete genetically, serves as a model for much other Streptomyces genetics) . Recent successes (see previous paper) in introducing Streptomyces DNA into S . coelicolor and Streptomyces lividans on plasmid vectors would be nicely complemented by the availability of Streptomyces bacteriophage vectors (discussed in ref . 5): for example, many phages have wide and easily defined host ranges; heat-inducible prophages might be used to give high copy number of cloned DNA; efficient phage promoters might be used to increase gene expression; there may be differential stabilities for particular DNA sequences cloned in plasmids vis-a-vis phages; selective insertion of DNA, utilizing packaging constraints, may be possible with phages; and in situ hybridization of radioactive probes to DNA in plaques is likely to be simple . We describe here the use of the moderately wide host range temperate phage, phi C31, for this purpose. J Clin Microbiol, 1980 Jul, 12(1), 124 - 6 Acid-fast actinomyces in a child with pulmonary actinomycosis; Lowe RN et al.; Open-lung biopsy in a child with chronic pneumonia revealed branched gram-positive acid-fast organisms, later identified as Actinomyces israelii . Like Nocardia asteroides, A israelii can be acid fast by the commonly used Putt stain . The pneumonia was cured with 12 weeks of penicillin treatment. J Antibiot (Tokyo), 1980 Jul, 33(7), 690 - 4 3-Trehalosamine, a new disaccharide antibiotic; Dolak LA et al.; 3-Amino-3-deoxy-alpha-D-glucopyranosyl-alpha-D-glucopyranoside (alpha, alpha--3-trehalosamine) was isolated from a culture of Nocardiopsis trehalosei sp . nov . (NRRL 12026) . The structure was determined using a combination of spectroscopic techniques on derivatives of the component sugars, especially gas chromatography-mass spectrometry . The compound exhibited antibiotic activity against Gram-positive organisms at levels similar to what was found for the 2- and 4-trehalosamines. Blood, 1980 Jul, 56(1), 88 - 92 Thrombocytopenia in septicemia: the role of disseminated intravascular coagulation; Neame PB et al.; The mechanism of isolated thrombocytopenia in septicemia is unknown, but compensated disseminated intravascular coagulation (DIC) has been suggested as a possible cause . To investigate this possibility, platelet counts and sensitive assays for in vivo thrombin and plasmin generation, including fibrinogen gel chromatography and fibrinopeptide A (FPA) assays, were obtained on 31 septicemic patients . Fifteen of 17 patients with gram-negative septicemia and 8 of 14 patients with gram-positive septicemia had thrombocytopenia . Platelet survival studied demonstrated a decreased platelet survival . In 11 of 12 patients with severe thrombocytopenia (platelet count less than 50,000mul), there was laboratory evidence of intravascular coagulation . In contrast, there was little evidence of intravascular coagulation in 8 of 11 patients with moderate thrombocytopenia (platelet counts 50,000 to less than 150,000/mul) or in 7 of 8 patients with normal platelet counts . This report indicates that while DIC accompanies thrombocytopenia in many patients with severe thrombocytopenia, there is frequently little evidence for intravascular coagulation in patients with moderate thrombocytopenia . It is apparent that factors other than intravascular thrombin must play a role in producing the thrombocytopenia of septicemia. J Antibiot (Tokyo), 1980 Jun, 33(6), 533 - 42 K-582, a new peptide antibiotic . I; Kondo S et al.; A new basic peptide antibiotic designated as K-582 was isolated, purified and characterized . When K-582 was applied to a column of Al2O3 or Biol-Gel P-2 or CM Sephadex, two major peaks which were named Fraction I (K-582 A) and Fraction II (K-582 B) were obtained . The nitrogen content, the behavior in color reaction, the absorption bands of amide linkages in the infrared absorption spectrum, 1H NMR spectrum and C-13 NMR spectrum indicated the peptide nature of K-582 A and K-582 B . K-582 was effective against yeasts, but inactive against other Gram-positive bacteria, Gram-negative bacteria and Mycobacterium . The toxicity was low in mice. Soz Praventivmed, 1980 Jun, 25(3), 149 - 51 {Epidemiologic study of a multidisciplinary hospital of medium size}; Gaschen M; A study, done in a hospital of 200 beds, during 12 months, has demonstrated that the risk of surinfection is coming as well from gram-positive as from gram-negative strains . These strains are strongly antibioresistant . The individual measures of hygiene are one of the most important factors of prevention against the propagation of these strains . The choice of disinfectants and their non-continual use (rotation process) contribute to maintain the density of microbial populations at a non-dangerous level. Am J Med, 1980 Jun, 68(6), 893 - 7 Prophylactic granulocyte transfusions during human bone marrow transplantation; Winston DJ et al.; Thirty-eight uninfected patients undergoing bone marrow transplantation were assigned at random to receive prophylactic granulocyte transfusions and oral nonabsorbable antibiotics (group 1) or oral nonabsorbable antibiotics alone (group 2) when their neutrophil count fell below 0.5 x 10(9)/liter . The two groups were comparable in terms of age, sex, underlying disease, immunosuppressive therapy and days of neutropenia . There were three cases of septicemia (all due to gram-positive organisms) in group 2 and none in group 1 (p = 0.23) . There was no difference in the incidence of other documented infections, and survival between the two groups was comparable . Recipients of prophylactic granulocyte transfusions had a significantly higher incidence of cytomegalovirus (CMV) infections (13 of 18 versus six of 17, p = 0.043) . These data suggest that prophylactic granulocyte transfusions may prevent septicemia, have no effect on other infections or survival in patients undergoing bone marrow transplantation, and are associated with a higher incidence of CMV infection . Oral nonabsorbable antibiotics alone are equally effective in preventing serious infections in bone marrow transplant recipients. Med Clin (Barc), 1980 May 25, 74(10), 387 - 94 {Cooperative study of bacterial incidence and susceptibility to cefamandole and other antibiotics (author's transl)}; de Vega JC et al.; A total of 44 medical centers participated in a cooperative study on nosocomial infections . Percentages of Gram-negative, Gram-positive and anaerobic germs isolated during 30 alternate-days for 3 months were 80.35 percent, 17.25 percent and 0.52 percent, respectively . Activity of cefamandole and cefalotin against Gram-positive bacteria was very similar, and both antibiotics showed a low number of resistances . On the contrary, against Gram-negative strains the activity of cefamandole was definitely superior to that of cefalothin, but it was similar when compared to that of gentamicin . In many instances, cefamandole may be a valid alternative in treating hospital-acquired infections (except for Pseudomonas). Mikrobiologiia, 1980 May-Jun, 49(3), 502 - 6 {Morphogenesis and the fine structure of Stibiobacter senarmontii}; Pivovarova TA et al.; The morphogenesis and fine structure of Stibiobacter senarmontii were studied during its cultivation in the autotrophic conditions of growth in a mineral medium as well as in a medium containing yeast extract . The morphology of the organism was shown to be variable . A young culture was represented mainly by rods with three flagella . Coccoid, club-shaped and branching forms were observed during aging of the culture . The cells multiplied by irregular division and by breaking along the partition of the parent cell . The latter process yielded cell aggregates looking like rings and hieroglyphs . Electronograms revealed a complex membrane apparatus, polyribosomes, large electron-transparent inclusions, and unknown electron-dense inclusions in the nuclear zone . The cell wall looked on cross-sections as a three-layer structure . The assignment of St . senarmontii to Gram-positive bacteria is discussed . The morphogenesis of this organism suggests that it is related to the coryneform group of bacteria. Arch Microbiol, 1980 May, 126(1), 71 - 5 The occurrence of teichoic acids in streptomycetes; Naumova IB et al.; The presence of teichoic acids in a number of streptomycetes led to the conclusion that these biopolymers were widely spread in genus Streptomyces . The nature of the teichoic acid present in the mycelium was determined by extracting it with 10% trichloroacetic acid, precipitating it with ethanol and identifying the precipitated polymer by partial acid and alkali hydrolysis to alditol, alditol phosphates and glycosylalditol phosphates . Most strains examined in this survey contained glycerol or ribitol teichoic acids; in some cases neither type was detected . Structurally teichoic acids closely resemble those of other genera of gram-positive bacteria and in many cases represent poly(glycerol phosphate) and poly(ribitol phosphate) chains . The proportion of alditol residues bearing sugar substituents varied widely . Three species of genus Streptoverticillium contained glycerol teichoic acids . It is believed that some of the data presented in this paper might be used with some success in taxonomic studies of streptomycetes. Experientia, 1980 Apr 15, 36(4), 414 - 6 Nosiheptide, a sulfur-containing peptide antibiotic isolated from Streptomyces actuosus 40037; Benazet F et al.; Nosiheptide (9671 R.P.) isolated from Streptomyces actuosus 40037 (NRRL 2954) is a sulfur-containing polypeptidic antibiotic, quite different from all the other members of this family . Very active in vitro against gram-positive bacteria, it is inactive in vivo in experimentally infected mice . Not toxic, even at high dose, it may be used as a feed additive for chickens and pigs and it shows a favourable effect on the growth and conversion index. J Antibiot (Tokyo), 1980 Apr, 33(4), 383 - 92 The aminoglycoside antibiotics.IV . Synthesis of aminodeoxy analogs of neamine; Sitrin RD et al.; An efficient synthesis of the key 3',4'-galacto epoxide intermediate 4 obtained from the known 5,6-O,O'-cyclohexylidene-N,N'-bis-(methoxycarbonyl)-4-O-{2,6-bis(methoxycarbony lamino)-alpha-D-glucopyranosyl}-2-deoxystreptamine (5) is described . Treatment of this epoxide with sodium azide, followed by reduction and acetylation, yielded the protected4'-amino-4'-deoxyneamine 18 (3',4'-diequatorial), whereas treatment with ammonia followed by acetylation yielded the protected 3'-amino-3'-deoxyneamine analog 19 with a diaxial configuration of its 3' and 4' positions . Reaction of the previously described protected 3',4'-allo epoxide 3 with sodium azide yielded separable mixtures of the protected 3'-amino-3'-deoxyneamine 14 and the protected diaxial 4'-amino-4'-deoxyneamine isomer 13, the ratios of products depending on the solvent temperature . Structural assignments for 13, 14, 18 and 19 were based on their PMR spectra . An additional 4'-amino-4'-deoxyneamine analog (24) with an axial configuration as its 4' position was also prepared by azide displacement of an approximately protected 4'-methanesulfonyl neamine intermediate 10 . The five protected isomers were deblocked to yield a series of aminodeoxyneamine analogs (15, 16, 20, 21 and 25), all of which were less active in vitro than neamine against a group of Gram-positive and Gram-negative bacteria. Schweiz Med Wochenschr, 1980 Mar 22, 110(12), 430 - 7 {Status febrilis: humoral and cellular factors}; Block LH; Clinical fever seems clearly associated with those diseases in which inflammation, in one form or other, plays a dominant role . The actual contribution of the various listed factors to the febrile response associated with any specific disease may, of course, be complex . For instance in a gram-positive infection, inflammatory cells may be activated to produce endogenous pyrogen at the site of bacterial multiplication by any or all of the following mechanisms, most of which have been demonstrated experimentally: phagocytosis of bacteria, chemotactic factors produced by bacteria or released from injured tissue of complement activation, immune reactions (either cellular or antibody-mediated) in a previously sensitized host, and toxins, e.g . endotoxins which may activate phagocytic cells directly. Otolaryngol Head Neck Surg, 1980 Mar-Apr, 88(2), 124 - 32 Aerobic isolates in hemovac lines; Yoder MG et al.; Positive aerobic isolates from hemovac lines were found in 41 of 68 patients (60%) who had major head and neck procedures requiring the hemovac drainage system during the postoperative period . When studied up to six days of placement, the number and the type of organisms in a hemovac system generally remained the same . A clue to impending infection was the isolation of two or more different genera from the hemovac system . Isolates from hemovac lines can frequently indicate the cause of the complication . Possible pathogens in postoperative head and neck infections include gram-positive bacteria, gram-negative bacteria, and fungi. J Periodontol, 1980 Mar, 51(3), 136 - 54 Comparative ultrastructure of certain Actinomyces species, Arachnia, Bacterionema and Rothia; Lai CH et al.; A comparative ultrastructural study was carried out on several species of Acinomyces and related Gram-positive rods including Arachnia, Bacterionema, Rothia and Leptotrichia . A total of 52 well characterized strains were examined by transmission electron microscopy . Particular attention was paid to the ultrastructure of the cell periphery, that is the plasma membrane, periplasmic space, the cell wall per se and extramural structures, including surface "fuzz" . In addition, the ultrastructure of various features of the cytoplasm were also examined . A good correlation appeared to exist between certain ultrastructural characteristics of the microorganisms and their taxonomic position as determined by other criteria . It should be noted, however, that the ultrastructure of certain strains differed markedly from that of the remaining strains of the species . This observation raises some doubt on the appropriateness of the current classification for these particular strains . The ultrastructural features of the cell periphery were found to be particularly stable for all strains grown under standard conditions . For this reason, ultrastructural features of the cell wall and associated structures are probably a more reliable source of morphological criteria for identification purposes than the ultrastructural characteristics of the cytoplasmic components which tend to be more variable . The results suggest that certain ultrastructural features are useful criteria for the identification and classification of these Gram-positive rods. Experientia, 1980 Feb 15, 36(2), 192 - 3 Bactericidal effects of human sera versus pathogens; Flournoy DJ; Human sera, free of antibiotics, was found to possess varying degrees of bactericidal activity . A significantly greater amount of activity was seen against gram negative than gram positive bacteria. J Antibiot (Tokyo), 1980 Feb, 33(2), 137 - 43 Studies on the ionophorous antibiotics . XXIV . Leuseramycin, a new polyether antibiotic produced by Streptomyces hygroscopicus; Mizutani T et al.; A new antibiotic leuseramycin has been isolated from the cultured mycelium of the strain of Streptomyces hygroscopicus TM-531 . Physicochemical data, in particular those of 1H- and 13C-NMR spectra, revealed that leuseramycin is closely related to dianemycin in its structure, the former having a methyl group in place of the hydroxymethyl group at C-30 . It is active against Gram-positive bacteria, some phytopathogenic fungi and some protozoa. Jpn J Antibiot, 1980 Feb, 33(2), 227 - 33 Tendomycin, a new antitumor antibiotic isolated from Streptomyces No . 9034; Miyamura S et al.; A new antibiotic designated tendomycin was isolated from the culture of Streptomyces No . 9034 . The antibiotic is active against Gram-positive bacteria, fungi and cultured cancer cells, and shows an inhibitory effect of EHRLICH carcinoma in mice. Ann Biol Clin (Paris), 1980, 38(5), 297 - 304 {Firefly assay of bacterial ATP: comparative study of extraction methods (author's transl)}; Jakubczak E et al.; The firefly bioluminescence ATP assay presents multiple applications in microbiological analysis . Nine ATP extraction methods were tested on thirteen Gram positive and Gram negative bacterial species . The DMSO method appears as the procedure for choice . It provides the highest yields and the best reproducibility, even at high bacterial concentrations . It is simple, rapid and can be recommended for routine analysis . Assays carried out after extraction by this procedure show that in 24 hours cultures, the ATP content ranges from 0.28 fg to 15.65 fg per cell depending on species. Natl Inst Anim Health Q (Tokyo), 1980 Summer, 20(2), 53 - 9 A histological and ultrastructural comparison of the sulfur granule of the actinomycosis and actinobacillosis; Kubo M et al.; The sulfur granules of actinomycosis and actinobacillosis were studied histologically and ultrastructurally . The sulfur granule of actinomycosis was large, and oval or horsehoe-shaped . In it, there were a number of gram-positive, filamentous or short rod-like hyphae beneath clubs . Ultrastructurally, the center of the sulfur granule was composed of a cluster of hyphae, and the periphery was surrounded by clubs arranged radially . The clubs were made of electron-dense fine granules and had a degenerated hypha at the center . These granules varied in amount from small to large . As for the host reaction, neutrophil infiltration appeared first around the sulfur granule . Then epithelioid cells proliferated and phagocytized hyphae . Finally, proliferating fibroblasts enclosed them and formed tiny granulomas . The sulfur granule of actinobacillosis was small and lobulated . In it, a number of gram-negative, short rod-like bacteria were present beneath clubs . Ultrastructurally, the center of the sulfur granule contained intact or degenerated bacteria, and the periphery was composed of radially projecting clubs . These clubs were made of electron-dense amorphous material, in which several layers of tubular structures surrounded the bacterium conentrically . The host reaction was almost the same as that of actinomycosis . The proliferation of fibroblasts was prominent . There was a strong tendency for these cells to form many tiny granulomas. Scan Electron Microsc, 1980, (3), 523 - 6, 542 Postmortem alterations of bacterial localization; Davis CP; Localization of bacteria in mammalian gastrointestinal tracts by electron microscopy has yielded much information on our understanding of intimate host-microbial interactions, but because of difficulties in obtaining human tissue, the human host-microbial interactions have not been well studied . In this report, an attempt was made to ascertain the feasibility of using gastrointestinal tissues obtained at autopsy . A rat model was used to produce samples that would simulate conditions that autopsy samples might undergo . Rats, left at room temperature for 1 hr and then refrigerated at 2C for time intervals up to 24 hours after death were autopsied and samples from the stomach, ileum and cecum were removed and processed for light and scanning microscopy . Tissues were fixed in buffered glutaraldehyde, postfixed in buffered osmium tetroxide, dehydrated in an ethanol series, critical point dried, coated with gold-palladium and examined . Keratinized murine stomachs showed little or no changes in the localization of the gram-positive layer of bacteria over 24 hours . However, major changes were noted in the ileum and colon with the ileum showing the most dislocation of the flora . Colonic tissues were altered by invading bacteria although some regions had a relatively normal appearing host-flora relationship . Slow cooling rates of the gastrointestinal tracts were implicated as a major cause for alterations in bacterial localization . The data predict that studies of normal microbial location with human autopsy samples will be best pursued on keratinized tissue. Chemotherapy, 1980, 26(4), 248 - 53 Bacterial sensitivity test kit; Baker HA et al.; A method and an apparatus have been developed for the determination of the susceptibility of pathogenic bacteria to antibiotics . The method has the same applicability as the accepted Bauer-Kirby method . The method is rapid, the procedure for the performance of the test is simple, the supplies and equipment for the performance of the test are inexpensive and finally the test gives easily measurable end-points . The correlation of the method to the accepted Bauer-Kirby method against clinical isolates of gram-positive bacteria was 90-100% for the antibiotics tested with the exception of neomycin which was 80% . With gram-negative bacteria, the correlation was 92-100% for the antibiotics tested. J Antibiot (Tokyo), 1980 Jan, 33(1), 76 - 82 Semisynthetic cephalosporins . III . Synthesis and structure activity relationships of novel orally active 7-{4-hydroxy-3-(substituted methyl)phenyl}-acetamido-3-cephem-4-carboxylic acids; Nudelman A et al.; A family of novel optically active alpha-amino-3-substituted-methyl-4-hydroxy benzene acetic acids (3) have been prepared . A number of these amino acids were converted to a group of cephalosporins (12) . Compound 12A showed the most interesting activity in vitro and in vivo, primarily against Gram-positive organisms and was shown to be well absorbed orally. Cancer, 1980 Jan 1, 45(1), 206 - 7 Treatment of gram-positive septicemia in cancer patients; Pizzo PA et al.; Seventy-eight pediatric cancer patients were treated for gram-positive bacterial septicemia during a 10-year period (1968-1977) . Sixty-one (78%) of the patients were granulocytopenic (PMNs less than 500/mm3) at the onset of the septic episode . All the patients whose granulocytopenia resolved (PMNs greater than 500/mm3) within one week of therapy recovered without sequelae . However, 7 of 15 patients (47%) who remained granulocytopenic for more than 7 days and who were treated with a single antibiotic developed a second sepsis with a gram-negative organism . In contrast, second infections were not observed in 24 patients with PMNs less than 500/mm3 for more than 7 days who were treated with broad spectrum antibiotics (p less than 0.002), suggesting that a broad-spectrum antibiotic regimen may be preferable when a cancer patient has prolonged granulocytopenia. Akush Ginekol (Sofiia), 1980, 19(5-6), 486 - 92 {Experience in the use of IUDs and the risk of inflammatory genital diseases in inserting them in the early period after birth}; Vikhliaeva EM et al.; PIP: To evaluate a possible risk of development of inflammatory diseases of the genital organs in IUD users, 410 women in whom IUD was inserted on day 5 after normal delivery were followed up for 3 years . The follow-up included gynecologic, colposcopic, and bacteriologic examinations . IUD insertion shortly after childbirth did not affect the course of the puerperal period . Within the 1st 3-6 months, 13% of the women showed expulsion of the IUD and had to undergo the reinsertion of the device . The IUD did not increase the incidence of vaginal discharge (6%, compared with 6.3% reported in the literature) . Bacteriologic examination of the vaginal and cervical content showed prevalence of cocci and gram-positive bacteria identical to those in women who did not use the IUD . Histological examination of the endometrium in 65 women indicated chronic endometritis in 4 and foci of the perivascular and periglandular round cell and leukocytic infiltration indicative of a local nonspecific immune response to the foreign body in 26 . Among these 65 women, 15 showed proliferative phase of the endometrium, 24 showed early secretory phase and 26 showed secretory phase . The state of the endometrium corresponded to the phase of the menstrual cycle in 41 of 65 women . It was concluded that the incidence of complications in women subjected to IUD insertion after childbirth did not exceed that of the general population . Arzneimittelforschung, 1980, 30(1), 109 - 13 {Epicillin concentrations in bile and serum after parenteral application (author's transl)}; Baier R et al.; 11 patients with cholelithiasis and choledocholithiasis, respectively, were cholecystectomized with subsequent inspection of the common bile duct . The drainage of the bile alpha-amino-3,6-dihydrobenzylpenicillin (epicillin, Spectacillin) were administered i.v . and the antibiotic concentrations in the bile and the serum determined . Samples were taken at intervals of 20 min over a period of 3 h . The maximum concentration in the bile was observed 60 min following administration of the antibiotic . The values in the bile were found to exceed the corresponding serum concentrations 6--14 fold . By the end of the observation period the concentrations of epicillin in the bile as well as in the serum were still higher than the minimum inhibitory concentrations for most of the gram-positive and gram-negative organisms. Arkh Patol, 1980, 42(5), 71 - 4 {Bacterial (endotoxic) shock}; Kan'shina NF; The data on one of sepsis variations, bacterial or endotoxin shock (BS) are presented . BS is caused by gram-negative flora among which the first place belongs to E . coli, but may also be caused by gram-positive bacteria . BS is characterized by an acute onset with chills, hyperthermia, leukocytosis and early development of circulatory collapse which may cause early death of the patient . The direct of mediated effect of endotoxin on the vascular wall causing paralytic distention of the microcirculatory bed with deposition of the blood in it is recognized in the pathogenesis of BS . Subsequently, under conditions of hypoxia and acidosis disorders of hemocoagulation develop in the form of disseminated intravascular coagulation which may result in cortical necrosis of the kidneys, necrosis and apoplexy of the adrenals, hypophysis, acute ulcers in the gastrointestinal tract, necroses and hemorrhages in some other organs. Ann Intern Med, 1980 Jan, 92(1), 7 - 13 Peritonitis during continuous ambulatory peritoneal dialysis; Rubin J et al.; We initiated a therapeutic program of continuous ambulatory peritoneal dialysis for patients with chronic renal failure . Our program resulted in many episodes of peritonitis arising from contamination due to the technical aspects of the procedure . Microbiologic evaluation showed that 73% of 97 episodes were culture positive, with gram-positive organisms causing most of the cases, especially early in dialysis . Gram-negative rods tended to occur later . Gram stains of dialysate effluent resulted in a disappointingly low yield of only 9% positivity . Cell counts were a dependable indicator of the presence of peritoneal inflammation and also of therapeutic success . Most patients responded well to intraperitoneal cephalothin, 125 mg/L for 10 to 14 d . The occurrence of peritonitis resulted in 0.93 years of hospitalization during the total of 15.45 patient-years on dialysis, which essentially negated the financial advantages of this method of treatment of chronic renal failure . For this to be a successful mode of therapy, advances in the prevention of peritonitis must be made. J Int Med Res, 1980, 8(2), 112 - 7 An open evaluation of a 3-day course of pivmecillinam (ten 200 mg tablets) in women with acute uncomplicated cystitis; Donald JF et al.; One hundred and eighty-four women, with acute uncomplicated cystitis, received a 3-day course of pivmecillinam comprising an initial 400 mg (two tablets) dose, followed by 200 mg every 8 hours; a total of ten tablets . A satisfactory clinical response was achieved in 91% of patients . Bacteriological success was observed in 94% of sixty-eight patients with a proven infection . Side-effects were reported in sixteen patients (8.4%) . Two patients ceased therapy prematurely . Pivmecillinam did not select out resistant Gram-negative organisms . A trend towards reinfection with Gram-positive cocci was observed . The possible significance of reinfection with different organisms is discussed. Nature, 1979 Dec 20-27, 282(5741), 851 - 3 Ionomycin stimulates mast cell histamine secretion by forming a lipid-soluble calcium complex; Bennett JP et al.; The activation of cellular function following the direct introduction of Ca2+ into the cytosol by the use of a Ca2+-transporting ionophore has served to confirm the widely held idea that Ca2+ has the status of a second messenger in many cell types . However, this evidence has been obtained largely from the use of a single ionophore, the antibiotic A23187; experiments with X537A, which is another ionophorous antibiotic capable of transporting Ca2+ (ref . 3), have failed to show the expected characteristics . For example, histamine release from rat mast cells mediated by X537A is neither dependent on extracellular Ca2+ nor prevented by metabolic inhibitors . Ionomycin is a recently described polyether antibiotic produced by Streptomyces conglobatus ATCC 31005, and is active against Gram-positive bacteria . The antibiotic action is presumably due to its ionophorous properties, as it extracts Ca2+ from an aqueous phase into an organic phase with a stoichiometry of 1:1 (ref . 6) . The ionophore is also capable of transporting 45Ca2+ across biological membranes (our unpublished results) . Here we report the application of ionomycin to rat mast cells . We show that ionomycin stimulates mast cell secretion solely through its ability to form a lipid-soluble calcium complex, and thus to convey Ca2+ across the hydrocarbon region of the cell membrane. Nouv Presse Med, 1979 Dec 17, 8(49), 4019 - 22 {The bacteriological diagnosis of pneumonia by transtracheal puncture . Value in medical intensive care (author's transl)}; Ricome JL et al.; Seventy five patients referred with a diagnosis of pneumonia underwent transtracheal puncture . In 76% of cases this examination led to discovery of an organism in infected patients . In 50% of cases, the bacteriological diagnosis was sufficiently accurately oriented by direct examination to permit rapid and effective treatment . There was virtually perfect agreement with the results of blood cultures when the latter were positive . The organisms most often responsible were Gram positive and above all the pneumococcus . These results led to narrow spectrum antibiotic treatment appropriate for the organism . This early treatment, based upon the results of tracheal puncture, was associated with a favourable course in 85% of cases, in particular in severely ill patients requiring intubation . No notable complications occurred. Appl Environ Microbiol, 1979 Dec, 38(6), 1166 - 72 Adherence of bacteria, yeast, blood cells, and latex spheres to large-porosity membrane filters; Zierdt CH; Strong adherence of bacteria, yeast, erythrocytes, leukocytes, platelets, spores, and polystyrene spheres to membrane filter materials was noted during filtration through membranes with pore size diameters much larger than the particles themselves . Quantitative recovery on the membrane filters of these particles from low-concentration suspensions was achieved during gravity- or vacuum-assisted filtration through membranes with pore diameters as much as 30 times that of the filtered particles . Mechanical sieving was not responsible . The phenomenon was judged to be electrostatic . It could be partially blocked by pretreating the filter with a nonionic surfactant (Tween 20), and elution of adherent particles was achieved with 0.05% Tween 20 . Gram-positive cocci were removed from suspension more efficiently than gram-negative rods . The commonly used cellulose membranes adsorbed more bacteria, blood cells, and other particles than did polycarbonate filters . Of lesser adsorptive capacity were vinyl acetate, nylon, acrylic, and Teflon membranes . Backwashing with saline, serum, 6% NaCl, dextran solutions, or phosphate buffers of varying molality and pH removed only a fraction of adherent particles . Tween 20 (0.05%) eluted up to 45% of adherent particles in a single back-filtration . Selected filters quantitatively removed the particles tested, which then could be washed and subjected to reagents for a variety of purposes . It is important to anticipate the removal of particles during membrane filtration, since it is not a simple mechanical event. Infect Immun, 1979 Nov, 26(2), 427 - 34 Mannose-contaminating agglutinin for Actinomyces viscosus and Actinomyces naeslundii; Ellen RP et al.; Rapid agglutination of Actinomyces viscosus and Actinomyces naeslundii cells by D-mannose solutions was observed during studies of their attachment to mammalian cells in vitro . The specificity of the agglutination reaction was studied by slide agglutination tests and by measuring the rate of decrease in optical density of bacterial phosphate buffer suspensions caused by the setting of bacterial aggregates . Actinomyces cells were agglutinated by protein-containing mannose solutions of several chemical suppliers . Solutions of sugars other than D-mannose and solutions of mannitol and mannan all failed to agglutinate A . viscsus and A . naeslundii . "Mannose-enhanced" agglutination was impaired by boiling or autoclaving the mannose but was not affected by heating the bacteria, the presence of chloramphenicol, running the assay in the cold, or incorporating any of several commercially purchased sugars in the reaction mixture . During these hapten inhibition experiments, only 6-deoxy-L-talcose-containing extracts of an A . viscosus strain retarded the rate of mannose-enhanced agglutination . Protein-containing fractions of D-mannose mother liquors also agglutinated cells of A . viscosus and A . naeslundii . Other species of oral gram-positive rods were not agglutinated by mannose solutions . Together the data indicate that plant seed-derived D-mannose contains a protein-associated agglutinin for A . viscosus and A . naeslundii which may function via a "lectin-like" selective affinity for the unique cell wall sugar 6-deoxy-L-talose. Antimicrob Agents Chemother, 1979 Nov, 16(5), 592 - 7 Pharmacokinetics of cefotaxime; Fu KP et al.; The pharmacokinetics of cefotaxime after intramuscular injection and intravenous infusion were determined . The mean peak serum level after the 500-mg intramuscular dose was 11.7 micrograms/ml, and it was 20.5 micrograms/ml after a 1,000-mg dose . The serum half-life was 1.2 and 1.3 h, respectively for the two doses . The apparent fractional volumes of distribution of 32 and 37 liters were not significantly different for the two doses, and the fractional serum clearance was approximately 315 ml/min per 1.73 m2 for both doses . The mean peak serum level after 1,000 mg administered by intravenous infusion over 30 min was 41.1 micrograms/ml . The half-life was 1.13 h, apparent volume of distribution was 33 liters, serum clearance 341 ml/min per 1.73 m2, and renal clearance was 130 ml/min per 1.73 m2 . The pharmacology of cefotaxime is similar to the pharmacology of other cephalosporin antibiotics, but the low inhibitory levels which it has against gram-positive and gram-negative bacteria suggest that lower dosage regimens should be possible. Am J Obstet Gynecol, 1979 Nov 1, 135(5), 680 - 4 Pelvic colonization with Actinomyces in women using intrauterine contraceptive devices; Hager WD et al.; PIP: Recent reports indicate that colonization or infection of the genital tract with Actinomyces israelli (an anaerobic, gram-positive, non-acid fast, obligate parasite classified between the true bacteria and complete fungi) may be related to IUD use . To determine the incidence of Actinomyces infection in IUD users and a comparable samples of nonusers, a prospective controlled study was undertaken using 50 study and 50 control patients from the Grady Memorial Hospital's gynecology and family planning clinics . The age and parity of the 2 groups ranged from 17 to 52 years, and 1.9 to 2.8, respectively . Selected risk factors predisposing to colonization or infection with Actinomyces were considered and included frequency of intercourse per week; contraceptives used; and histories of appendicitis and pelvic inflammatory disease (PID) . Both groups were divided into women less than 35 years of age and those more than 35 years of age . There were 29 control and 9 study patients in the older group . Of the 9 study patients, 4 (44.4%) had Actinomyces compared to none of the 29 control patients (p .01) . The Lippes loop, which was used by 50% of the IUD users, was the most commonly removed IUD . The characteristics of the 4 patients were described in Table 5 . Cervical cytology was used in detecting the Actinomyces infection or colonization of the 4 study patients, who were managed by IUD removal and follow-up biopsies or Pap smears . Symptomatic patients should have their IUDs removed and should be treated with antibiotics to provide both aerobic and anaerobic coverage . J Bacteriol, 1979 Nov, 140(2), 687 - 98 Novel microbial and chemical components of a specific black-band region in the cockroach hindgut; Cruden DL et al.; An area of the hindgut of the cockroach, Eublaberus posticus, is characterized by its black color . This area is the site of accumulation of metal sulfides in the lumen next to the gut wall . In addition to the normal hindgut flora, two unusual procaryotic organisms are seen by both scanning and transmission electron microscopy only in this area of the hindgut . They are (i) a large rod (1.2 by 6 micrometers) with a tuft of polar flagella, many inclusion bodies, and a distinctive complex wall and (ii) an apparently flexible rod with a helically ridged wall . In addition, phagelike particles are described which are apparently infecting gram-positive bacteria attached to the gut wall in the black band area. J Med Chem, 1979 Nov, 22(11), 1416 - 8 Cephalosporin derivatives with 2- and 4-pyridone groups at carbon-3; Edwards ML et al.; Two compounds, analogues of cephalexin with 2- and 4-pyridone groups at C-3, were prepared . Biological evaluation found the compounds to exhibit activity against Gram-positive and Gram-negative organisms in vitro and in vivo . The compounds were only active in vivo on subcutaneous administration. J Antibiot (Tokyo), 1979 Nov, 32(11), 1130 - 6 Controlled biosynthesis of neoviridogriseins, new homologues of viridogrisein . IV . In vitro synergism between neoviridogrisein II and the antibiotics of the mikamycin A group; Okumura Y et al.; Neoviridogrisein II is a homologue of viridogrisein in which the hydroxyproline residue is replaced by proline . Neoviridogrisein II proved to be more active than the parent antibiotic against Gram-positive bacteria and Mycoplasma species . When neoviridogrisein II or viridogrisein was combined with griseoviridin, a non-peptidyl macrocyclic lactone, synergism was observed: maximum synergistic effect was observed for a combination ratio that depended on the test bacterium used . Neoviridogrisein II also exerted synergism when combined with mikamycin A and A-2315A. Stain Technol, 1979 Nov, 54(6), 331 - 5 Electron microscopy of malachite green--glutaraldehyde fixed bacteria; Kushnaryov VM et al.; Malachite green combined with glutaraldehyde has been used recently as a fixative for preserving and revaling lipid complexes in thin sections of eukaryotic cells examined by electron microscopy . When bacteria were prefixed with the above mixture granular electron dense inclusions were revealed in all cultures tested . These inclusions were replaced by electron transparent areas in cells fixed with glutaraldehyde alone . The structures were frequently located near to or within the nucleoid and adjacent to the cell membrane in Gram-negative bacteria and were associated with the nucleoid and mesosomes in Gram-positive species . Polyhydroxybutyrate granules, generally poorly preserved in thin sections of Aquaspirillum serpens, were well preserved by the malachite green-glutaraldehyde fixative . Malachite green complexes were observed outside of the cells in all preparations . Capsules were neither preserved nor stained. Nouv Presse Med, 1979 Oct 29, 8(41), 3313 - 7 {Modification of septicaemias in an intensive care unit following the suppression of prophylactic antibiotics (author's transl)}; Blettery B et al.; The authors after to have suppressed the preventive antibiotic therapy in their intensive care concluded after four years of this new attitude . They ascertain that this new attitude has not changed by no means the number of septicenia in their intensive care . In the other hand, the gram negative septicemia stronghly decrease, succeeding by gram positive septicemia . This results were statistically significant in the sector of intensive care where the supress of antibiotic was quick and the most completely . Thanks to this attitude, the cost of operation of the service was divided by three. N Engl J Med, 1979 Oct 25, 301(17), 897 - 900 Human infection from an unidentified erythrocyte-associated bacterium; Archer GL et al.; A 49-year-old splenectomized man had an infection from an unidentified, gram-positive, rod-shaped bacterium that adhered to the majority of his peripheral-blood erythrocytes . On transmission electron microscopy, the bacterium was seen to be extra-erythrocytic and was 0.2 micrometer wide by 1.0 to 1.7 micrometer long . It possessed a thick, granular cell wall, a trilamellar membrane external to the cell wall and prominent mesosomes . Attempts to cultivate the organism in vitro or to duplicate the patient's disease in splenectomized animals were unsuccessful . The patient's response suggested that the bacterium was susceptible to cell-wall-active antibiotics and to chloramphenicol but not to tetracycline . This bacterium may be the cause of other chronic, fever-producing, multisystem diseases of unknown origin. Laryngoscope, 1979 Oct, 89(10 Pt 1), 1553 - 62 Avoidance of early complications following radical neck dissection; Camnitz PS et al.; Multiple factors are associated with the increased risk of postoperative complications following radical neck dissection . Most significant of these are preoperative radiation and entry into the pharynx . The most common of these complications are discussed, and following is a description of preoperative, intraoperative, and postoperative methods to reduce them . Changes in operative methods and antibiotic coverage were associated with a decrease in wound infection and fistula formation . It is suggested that patients in high risk categories be covered with preoperative, prophylactic gram positive antibiotic coverage, along with Tobramycin. Biochim Biophys Acta, 1979 Sep 21, 556(2), 322 - 30 An X-ray study of the cytoplasmic membranes of two gram-positive bacteria; Baianu IC et al.; X-ray diffraction diagrams of partially disordered one-dimensional lattices of isolated bacterial cytoplasmic membranes are described and they provide a basis for suggesting possible molecular structures of bacterial membranes . Biochemical and electron microscope evidence points towards a lipid bilayer with a high degree of fluidity . The protein molecules are in a disordered configuration in the membrane. J Am Geriatr Soc, 1979 Sep, 27(9), 395 - 7 The vaginal flora after natural or surgical menopause; Blum M et al.; A study was made of the cervical and upper vaginal flora in menopausal women, in an attempt to determine whether such women are predisposed to infections when undergoing gynecologic operations . The series comprised 72 women (age range, 44-80 years) classified as follows: a) 35 with a natural menopause, b) 18 with a surgical menopause induced by abdominal panhysterectomy, and c) 19 postmenopausal women after vaginal hysterectomy performed for genital prolapse . The vaginal flora of these menopausal women consisted predominantly of Gram-positive bacteria which, together with the Gram-negative bacteria, conformed to the normal pattern of microorganisms in the vagina . Such bacteria also are found in women of child-bearing age, but occasionally they can be pathogenic . Despite the inherent biohormonal changes of the memopause, expressed especially by the low estrogen level, 26.4 percent of the cultures in our study were sterile, even after major vaginal operations . Thus, the pattern of the vaginal flora, even though occasionally pathogen, should not be a contraindication to gynecologic surgical procedures in postmenopausal women . Even when vaginal cultures show the presence of these bacteria, it does not seem necessary to use prophylactic antibiotic and hormonal therapy routinely . Rather, it should be given selectively, depending upon the local state of the tissues and upon the postoperative course. Prostaglandins, 1979 Sep, 18(3), 397 - 400 Prostaglandin formation in bacteria; Gulbis E et al.; We report here that intact Gram positive and Gram negative bacteria, in the presence of exogenous arachidonic acid, produce and release PGE2 and PGF2 alpha into the medium as measured by radioimmunoassay . The seven bacterial strains so far studied release 6.5-50.9 ng PGE2 and less than 0.02-0.51 ng PGF2 alpha per mg bacterial protein during a 1 hour incubation, quantities of the same order of magnitude as those observed in mammalian systems . PGE2 and PGF2 alpha formation in bacteria are inhibited by indomethacin. J Antimicrob Chemother, 1979 Sep, 5(5), 569 - 79 Correlation of in vitro susceptibility with in vivo efficacy in mice for cefoxitin in comparison with cephalosporins; Miller AK et al.; Agar minimal inhibitory concentrations and mouse protection test effective doses were determined for each of four beta-lactam antibiotics against each of 12 Gram-negative and 3 Gram-positive bacterial cultures . The beta-lactamase activity of these cultures also was studied . The data were examined to determine whether relative in vivo efficacies could be predicted from relative in vitro activities . Although such predictions were quite accurate for cefoxitin and cefazolin, this was not true for cefamandole or for cephalothin . Such poor predictability was not necessarily associated with the susceptibility of these cephalosporins to hydrolysis by bacterial beta-lactamases . Although the clinical significance of these observations is not known, these data emphasize that relative in vitro activities should be used only with caution to estimate in vivo efficacies, since not all compounds show the excellent predictability observed here for cefazolin and cefoxitin. Histochemistry, 1979 Sep, 63(1), 1 - 6 Histochemical observations on Pneumocystis carinii: selective demonstration of honeycomb forms; Waldrop FS et al.; Histochemical investigations of pulmonary lesions indicated selective coloration of membranes of honeycomb stages of Pneumocystis carinii by the periodic acid--sodium bisulfite--resorcin-fuchsin reaction for basement membranes; mucus, fibrin and other deposits in respiratory pathways did not react . These membranes were colored selectively also by the picro-Sirius Red F3BA method for collagens; fungi in tissues from patients with candidiasis remained unstained . For simultaneous demonstration of honeycomb and cyst forms of Pneumocystis carinii, sections were prestained with Grocott's modification of Gomori's methenamine-silver nitrate technic and then treated with the periodic acid-Schiff (PAS) or picro-Sirius Red F3BA reaction . In contrast to other Gram-positive microorganisms, cysts of Pneumocystis carinii were immediately decolorized by acetone-ether mixtures; this indicates differences in the mode of dye binding . Frequently, only one stage of Pneumocystis carinii was found in a given area . Hence a combination of reactions showing different stages is recommended for studies of small tissue samples. Nouv Presse Med, 1979 Aug 25-Sep 3, 8(33), 2655 - 8 {Septicaemia and spontaneous peritonitis in the cirrhotic (author's transl)}; Clumeck N et al.; During a five year period 36 episodes of septicaemia in 32 patients with hepatic cirrhosis were documented . This represents 20% of the patients hospitalized with a decompensated cirrhosis and 1.1% of the patients with non decompensated cirrhosis . In patients with decompensated cirrhosis, enteric Gram-negative organisms were most frequently isolated (91% of the cases) and ascitis was infected in one third of the cases . No primary foci of infection were documented . On the contrary patients with a non decompensated cirrhosis had infection mostly with Gram-positive organisms (82%) and foci of infection (skin, throat) were documented in 38% of the cases . Infection by enteric organisms was associated with higher mortality than infection by non enteric organisms (68% vs 28%) . Five patients with inappropriate antibiotic treatment died from septic shock . Spontaneous septicaemia and peritonitis are frequent complications if cirrhosis . There are potentially treatable causes of deterioration in the cirrhotic patient, necessitating prompt recognition and treatment. J Gen Microbiol, 1979 Aug, 113(2), 243 - 53 Glaucescin, a bacteriocin-like substance from Streptomyces glaucescens; Schurter W et al.; Streptomyces glaucescens ETH 22794 produced a variety of antibiotic substances . Besides low molecular weight antibiotics like hydroxystreptomycin and the tetracenomycins, this strain excreted glaucescin, a high molecular weight product with bacteriocin-like properties . In plate tests the antagonism of glaucescin against Streptomyces canadiensis was masked by the large inhibition zone caused by the tetracenomycins . Glaucescin activity was revealed when a tetracenomycin-resistant mutant of S . canadiensis NRRL 3155 was used as an indicator . Glaucesin was produced on complex and minimal solid and liquid media . It was not inducible by mitomycin C . The killing activity of glaucescin was thermolabile and resistant to DNAase, RNAase, various proteinases, and lipase . Its apparent molecular weight was estimated as 196000 by gel filtration and glycerol gradient centrifugation . Glaucescin preferentially killed outgrowing spores of S . canadiensis . Resting spores and mycelium were considerably less sensitive to the inhibitor, and adsorption of glaucescin by S . canadiensis paralleled sensitivity . The activity spectrum of the bacteriocin was restricted to spore-forming Actinomycetales . Non spore-forming nocardiae and a variety of Gram-positive and Gram-negative bacteria were resistant to glaucescin. J Antibiot (Tokyo), 1979 Jul, 32(7), 673 - 8 Pamamycin: a new antibiotic and stimulator of aerial mycelia formation; McCann PA et al.; Pamamycin is a new antibiotic isolated from Streptomyces alboniger ATCC 12461 . The antibiotic is active in vitro against Gram-positive bacteria, Neurospora, and Mycobacteria . The compound also acts as a streptomycete differentiation effector . It stimulates aerial mycelia formation in the producing organism . The new antibiotic of elemental composition C36H63NO7 is completely different from puromycin, also produced by this strain . The present communication deals with the isolation, properties, and preliminary characterization of pamamycin. Arch Esp Urol, 1979 Jul-Aug, 32(4), 387 - 96 {Sisomicin sulfate: its efficacy in the treatment of urologic infections}; Rodriquez Torres A; The authors explain the good results (80%) obtained with a new antibiotic belonging to the aminoglucoside group, the Sisomycin sulphate . Due to its active kidney excretion, its beneficial bactericide effect on Gram-positive and negative germs and its excellent tolerance, the author advises its use in infectious urological pathologies. Can J Microbiol, 1979 Jul, 25(7), 826 - 32 The ultrastructure of the major species of an enriched methanogenic culture utilizing acetic acid; Colvin JR et al.; The ultrastructure of the cells of the major component of an enriched culture of a presumed methanogen which utilized acetic acid was studied by transmission and scanning electron microscopy . The filaments were composed of Gram-positive, rod-shaped cells, 1--2 micrometer in length and about 0.5 micrometer in breadth, attached end to end . Septa between cells were complex, with a central, electron-dense sheet which had a spherical enlargement in the center separating the cell walls . The cells walls themselves were of variable thickness with a light, fluffy, thin portion on the outside and a denser, thicker portion within . They contain a series of rings stacked side by side which are composed of material that stains strongly and positively with phosphotungstate ion . The cytoplasmic membrane of these cells had an outer leaflet which stains more densely with uranium and lead ions than the inner leaflet . There were no recognizable organelles in the cytoplasm other than ribosomes . It is shown in these observations that the presumed methanogen may likely be a new species. Surg Gynecol Obstet, 1979 Jul, 149(1), 69 - 71 Gram-positive peritonitis in patients with infected ventriculoperitoneal shunts; Hubschmann OR et al.; Patients with infected ventriculoperitoneal shunts may, in some situations, present with prominent abdominal signs and symptoms and no neurologic complaints . As a consequence, the correct diagnosis may be confused initially, and the appropriate therapy may be dangerously delayed . Definitive diagnosis is established by percutaneous tap of the shunt reservoir and analysis of the ventricular fluid . If the offending organism is gram-positive, externalization of the shunt combined with systemic and intraventricularly administered antibiotics, without laparotomy, is the treatment of choice . If gram-negative organisms are identified, exploratory laparotomy is indicated to rule out a ruptured viscus . In establishing the correct diagnosis and determining the appropriate therapeutic priorities, the co-operative efforts of the general, as well as the neurologic, surgeon are required. Minerva Stomatol, 1979 Jul-Sep, 28(3), 167 - 86 {Controlled clinical trial of a new antibiotic "CM 9164" (Midecacin) in dental and stomatological practice}; Pappalardo G et al.; The action of a new antibiotic identified as CM 9164 ("Midecamycin") and provisionally called "Midecacin", has been experimented on patients admitted for dental conditions . The research was carried out on an open basis and erythromycin was used as a comparison . After a short review of the chemicophysical properties and toxicological and pharmacological features of Midecamycin, the purpose, materials and methods of the research, which was done on two groups of patients, are presented . The results demonstrated the therapeutics usefulness of the new antibiotic as its activity is certainly on a par if not greater than that of erythromycin whether considered "historically" or from the viewpoint of the comparison group . The tolerance of the antibiotic was clinically better than that of the other substances . The doses used were much lower than those required with erythromycin . On the basis of these results, the use of Midecamycin is therefore recommended in the treatment of Gram-positive infections in the dental field. Am J Dis Child, 1979 Jun, 133(6), 619 - 22 Infective endocarditis during the first decade of life . An autopsy review of 33 cases; Mendelsohn G et al.; Twenty-six cases of infective endocarditis seen at autopsy during the first decade of life, between 1911 and 1944, are compared with seven fatal cases between 1944 and 1977 . The incidence of infective endocarditis at autopsy in this age-group has decreased since 1944 (0.60% to 0.23%) . Before 1944, Gram-positive cocci were most frequently responsible . Rheumatic heart disease (31%) more often predisposed to infective endocarditis than did congenital heart disease and left-sided valves were most frequently involved . Peripheral septic foci and penumonia were the most frequent sources of infection . The introduction of penicillin and advances in cardiology and cardiovascular surgery have had considerable impact of the spectrum and evolution of the diseases . Fungi and uncommon opportunistic bacteria are now frequently encountered . Rheumatic heart disease rarely predisposes to infective endocarditis in this age-group, congenital heart disease being the major underlying disease. Ann Ophthalmol, 1979 Jun, 11(6), 935 - 43 Endophthalmitis in a pediatric population; Weinstein GS et al.; A study of 22 consecutive cases of suspected endophthalmitis in children disclosed that 68% (15/22) were male with a mean age of 7.4 years . In contrast to adult populations, 86% (19/22) followed trauma in this series . Cultures were performed in 18 cases yielding positive results in 8 cases . Anterior chamber paracentesis was positive in 6/10 attempts, vitreous cultures in 1/4, and wound cultures in 2/7 . Gram-positive organisms were recovered in 75% (6/8) of the cultures, stressing the importance of coverage for these organisms before culture results are known . Although cultures should be obtained as soon as possible, the initiation of antibiotics beforehand should not deter one from obtaining cultures as 75% (6/8) of patients with positive cultures had preculture antibiotics . Fourteen patients were diagnosed within 48 hours of the precipitating event, and all of these cases followed trauma . Three of 7 patients with positive cultures and 1 of 10 patients with negative cultures had final visual acuities of 20/200 or better . The lack of correlation between a positive culture and a poor visual outcome suggests that the final visual acuity depends not only on the endophthalmitis, but also on the extent of trauma. J Urol, 1979 Jun, 121(6), 755 - 60 Patterns of inflammation in prostatic hyperplasia: a histologic and bacteriologic study; Kohnen PW et al.; In a series of 162 cases of surgically resected hyperplastic prostates the incidence of inflammation is 98.1% . Six morphologic patterns of inflammation are described: 1) segregated glandular inflammation, 2) periglandular inflammation, 3) diffuse stromal inflammation, 4) isolated stromal lymphoid nodules, 5) acute necrotizing inflammation and 6) focal granulomatous inflammation . The most common pattern, segregated glandular inflammation, is characterized by intraluminal neutrophils and foamy macrophages and by chronic inflammatory cells in the surrounding stroma . No significant morphological differences are found among groups of cases with positive and negative evidence by culture of bacterial prostatic infection . Quantitative but not qualitative morphologic differences are found between cases of gram-negative infections and infection by gram-positive organisms that often are considered non-pathogens. Arch Microbiol, 1979 May, 121(2), 111 - 6 {Metabolic products of microorganisms . 175 . Tetracenomycin C (author's transl)}; Weber W et al.; Streptomyces glaucescens, strain Tu 49 = ETH 22794, produces hydroxystreptomycin as well as the tetracenomycins, a mixture of several lipophilic antibiotics . The main component and the most active one is tetracenomycin C . Tetracenomycin C has a molecular formula C23H20O11 and is chemically related to tetracyclines and anthracyclinones . The pale yellow antibiotic is active against some gram-positive bacteria, especially against streptomycetes . Gram-negative bacteria and fungi are not inhibited . In considering the differences of biological activity and the functional groups of the molecule, tetracenomycin C is not a member of the tetracycline or anthracyclinone group of antibiotics. Tijdschr Diergeneeskd, 1979 May 1, 104(9), 359 - 68 {Decontamination of hot beef carcases with organic acids (author's transl)}; Snijders JM et al.; The decontamination effect of spraying hot beef carcases with solutions of lactic acid and solutions of the commercial preparation of pH liquid was studied . Spraying a 0.5 per cent lactic acid solution only resulted in a significant reduction of aerobic, gram-negative and gram-positive bacterial counts on severely contaminated areas . Treatment with a 0.75 per cent solution of lactic acid caused a significant decrease of almost all bacterial counts, whereas a 1 per cent lactic solution produced a significant reduction of all bacterial counts at the sites sampled . The maximum reduction was 2 log units per sq.cm . and varied with the level of contamination . A 5 per cent pH Liquid solution was ineffective and a 20 per cent pH Liquid solution had an effect similar to that of a 0.5 per cent lactic acid solution . The reduced bacterial counts persisted during three days of storage in the chilling room . When the above concentrations are applied, this will not cause any permanent changes of colour of the treated carcases . These changes do occur when a 10 per cent solution of lactic acid is used . This treatment can only be used to spray severely contaminated superficial layers which are to be removed . Recommendations are made for the possible use of organic acids in the slaughter line . The legal aspects are discussed. N Engl J Med, 1979 Apr 5, 300(14), 760 - 4 Elevated platelet-associated IgG in the thrombocytopenia of septicemia; Kelton JG et al.; The mechanism of thrombocytopenia, a frequent complication of septicemia, is obscure, but indirect evidence suggests that the immune system may be involved . To investigate this possibility, we quantitated platelet-associated IgG on platelets obtained from 44 patients during 46 episodes of septicemia . Thrombocytopenia occurred in 21 of 46 episodes (46 per cent) . Platelet-associated IgG was elevated in eight of 11 episodes of gram-negative septicemia and thrombocytopenia (47.3 +/- 11.7 fg of IgG per platelet {mean +/- S.E.}) and in one of 20 patients with gram-negative septicemia and normal platelet counts (5.9 +/- 1.1) (P less than 0.001) . Elevated levels occurred in eight of 10 patients with gram-positive septicemia and thrombocytopenia (55.3 +/- 14.7 fg of IgG per platelet) and in none of 11 patients with gram-positive septicemia and normal platelet counts (5.6 +/- 1.7) (P less than 0.001) . Serial testing during the thrombocytopenia and recovery showed an inverse relation between the platelet count and platelet-associated IgG . Thrombocytopenia in some patients with septicemia may be related to the binding of IgG to platelets. Pathology, 1979 Apr, 11(2), 289 - 92 Chronic asymptomatic genital tract infection and semen quality; Harrison KL et al.; Chronic asymptomatic genital tract infection has been postulated to cause infertility in man . This study demonstrates the correlation of positive seminal fluid bacteriological cultures with abnormal parameters of seminal fluid analysis in the male partners of 100 uninvestigated couples presenting with infertility . Gram negative bacteria were cultured only in patients with semen abnormalities while Gram positive bacteria were cultured from both normal and abnormal semen specimens. Ann Intern Med, 1979 Apr, 90(4), 686 - 9 False positive reactions in the indirect fluorescent antibody test for Legionnaires' disease eliminated by use of formolised yolk-sac antigen; Taylor AG et al.; The indirect fluorescent antibody (FA) technique for the diagnosis of Legionnaires' disease was used to investigate an outbreak of respiratory disease in a military population . The outbreak was later shown to be caused by an adenovirus . High titres were obtained using the ether-killed antigen supplied by the Center for Disease Control (CDC), Atlanta, but not with a formolised yolk-sac antigen prepared in out laboratory . The reactivity of these sera with the CDC antigen was removed by absorption with a partly identified gram-positive bacterium, whereas sera from persons with true Legionnaires' disease were unaffected by such treatment, suggesting that such reactivity is not specific for Legionnaires' disease . The lack of reactivity with negative control sera and strong reactivity from a small group of patients in whom seroconversion was demonstrated has led us to conclude that formolised yolk-sac antigen is a reliable antigen for the diagnosis of Legionnaires' disease by the FA method . Measurement of the sensitivity and specificity of the formolised yolk-sac antigen is still in progress. Southeast Asian J Trop Med Public Health, 1979 Mar, 10(1), 13 - 7 Tachypleus lysate test for endotoxin in patients with Gram negative bacterial infections; Usawattanakul W et al.; Amoebocyte lysate from the horseshoe crabs (Tachypleus gigas) which abounds in the Gulf of Thailand was used to detect endotoxin in patients with Gram-negative bacteremia, in patients with Gram-positive bacterial infections as well as in the control . The Tachypleus lysate test (TLT) was positive in 94.4% of 36 patients with Gram-negative bacteremia before initiation of antibiotic therapy . Only 4% of 50 healthy individuals were positive and all 7 patients with Gram-positive bacterial infections were negative . The threshold sensitivity of TLT was 0.625 micrograms endotoxin per ml of the plasma . In comparison with the commercial Limulus lysate test (LLT), the TLT was slightly more sensitive in exhibiting higher grade of reaction, eventhough the threshold sensitivity was the same. J Clin Microbiol, 1979 Mar, 9(3), 358 - 61 Tyrosine degradation in presumptive identification of Peptostreptococcus anaerobius; Babcock JB; A new tyrosine medium was developed and evaluated for the differentiation of Peptostreptococcus anaerobius from other anaerobic, gram-positive cocci . The strains included 159 originating from clinical specimens and 13 reference strains received from other workers in the field . Only one strain of each species was included in the study from multiple cultures from the same patient . This medium is simple to prepare and can be used in a small clinical laboratory . One hundred seventy-two strains of anaerobic gram-positive cocci were grown and evaluated with the new tyrosine medium; 36 strains (100%) of P . anaerobius degradated the tyrosine crystals when incubated at 37 degrees C under anaerobic conditions in a GasPak jar (Baltimore Biological Laboratory) for approximately 72 h . On the other hand, 135 of 136 other anaerobic gram-positive cocci were negative for tyrosine degradation, but grew on the tyrosine agar plate when incubated anaerobically . The single strain that degraded tyrosine was 1 of the 13 isolates of Peptostreptococcus micros studied. Zentralbl Bakteriol {Orig A}, 1979 Mar, 243(1), 125 - 35 Investigation into the effects of cell wall antigens of gram-positive bacteria on lymphocyte stimulation and on cell-mediated cytotoxicity; Buschmann H et al.; The effect of Staph, epidermidis and Bac . subtilis cell walls as well as of cell wall teichoic acid, N-acetyl-muramic acid, N-acetyl-D-glucosamine, D-alanine, and DL-alpha, epsilon-diaminopimelic acid on lymphocyte stimulation and on cell-mediated cytotoxicity has been studied . Bac . subtilis cell wall preparations, N-acetyl-D-glucosamine and teichoic acid showed a slight but significant effect on the mitogenic response of pig lymphocyte cultures . When studied in combination with the mitogens PHA, ConA, and PWM significant synergistic effects were observed with N-acetyl-muramic acid . The most significant stimulation of the in vitro 51Cr-release from labelled P815 tumor cells in the presence of non-sensitized as well as specifically sensitized lymphocytes was exerted by D-alanine. J Clin Pathol, 1979 Feb, 32(2), 187 - 90 A new technique for Gram staining paraffin-embedded tissue; Engbaek K et al.; Five techniques for Gram staining bacteria in paraffin sections were compared on serial sections of pulmonary tissues from eight bacteriological necropsies . Brown and Hopp's method was the most satisfactory for distinguishing Gram-positive and Gram-negative bacteria . However, this method cannot be recommended as the preparations were frequently overstained, and the Gram-negative bacteria were stained indistinctly . A modification of Brown and Hopps' method was developed which stains larger numbers of Gram-negative bacteria and differentiates well between different cell types and connective tissue, and there is no risk of overstaining. Curr Med Res Opin, 1979, 6(4), 244 - 8 Evaluation of tissue levels of cefamandole in severely ischaemic lower limbs using two regimens of dosage; Bullen BR et al.; Cefamandole levels were measured in peripheral blood, and in skeletal muscle and subcutaneous fat samples taken from 20 patients during amputation of the leg for severe ischemia . Tissue samples were taken from both proximal and distal levels in the amputated limb . Cefamandole was administered as either a 2 g intravenous bolus given with induction of anaesthesia, or a combination of 1 g intramuscularly with the premedication plus 1 g intravenously with anaesthetic induction . Levels of cefamandole in serum and proximal muscle and fat samples were well above the minimum inhibitory concentrations required for most Gram-positive and Gram-negative organisms . Cefamandole levels in more distal samples were somewhat lower but still achieved therapeutic levels in most cases . Higher tissue levels of cefamandole were achieved when 2 g were given intravenously as a bolus. Anesth Analg (Paris), 1979 Jan-Feb, 36(1-2), 7 - 12 {Humoral and cellular immunity and sepsis in intensive care (author's transl)}; Durocher A et al.; Different parameters of humoral and cell mediated immunity were studied in 17 patients with sepsis . There is an important decrease of CH 50 (82 p . cent of patients) and variations of serum complement according with activation of alternative pathway in gram negative and gram positive septicemia . The cellular immunity is never normal: the stimulation index of lymphocyte proliferation under the influence of P . H . A . is lower than 3 . There is less than 50 p . cent of T lymphocytes forming rosettes . With cure of sepsis a discrimination is observed between patients with transient decreased immunity and those with persistent lower responses. Childs Brain, 1979, 5(3), 304 - 9 Management of ventricular shunt infections; O'Brien M et al.; The authors report the incidence (2.7%) of shunt infection in a series of 778 consecutive shunt procedures . The management of these infections and an additional group of infected patients operated elsewhere is discussed . A protocol is given for the treatment of external infections, gram-positive internal infections and gram-negative internal infections. Zentralbl Gynakol, 1979, 101(6), 382 - 93 {Intrauterine infections in pregnancy . The significance of premature rupture of the membranes and early lung complications}; Beller FK et al.; The course of intrauterine infections are illustrated and 5 maternal deaths reported . Early lung complications were predominant, described as shock lung or septic pneumonia . Renal complications or disseminated intravascular coagulation were absent or developed late . In contrast to gram negative sepsis there was a frequent association with premature rupture of the membranes, which indicates the danger of this event . On microbiology gram positive rods were found more frequently than a mixed flora . The morphology of intrauterine infection is similar to those of puerperal sepsis although the clinical course is quite different . This indicates a change in infectious pattern during the last centuries. Curr Med Res Opin, 1979, 6(1), 44 - 9 The penetrability of cephazolin into the subcutaneous fat and skeletal muscle of ischaemic lower limbs with atherosclerotic disease; Kester RC et al.; Seventeen patients with atherosclerotic disease, who were undergoing arterial reconstruction or amputation of the lower limb, had 2 g cephazolin injected per-operatively in two equal doses by intramuscular and intravenous routes . Samples of subcutaneous fat and skeletal muscle from the ischaemic leg, and serum were collected during the operation for assay of cephazolin content . The mean cephazolin levels in the serum, skeletal muscle and subcutaneous fat were found to be well above the minimum inhibitory concentrations required for most important Gram-positive and Gram-negative pathogens. Zentralbl Bakteriol {B}, 1979, 169(5-6), 560 - 6 {About the temperature dependence of the bactericidal effect of some chemical disinfectants (author's transl)}; Schliesser T et al.; In quantitative suspension tests the influence of different temperatures (4 degrees C, 12 degrees C, 22 degrees C, 37 degrees C, +/- 2 degrees) on the bactericidal effect of formalin, phenol, sodium hydroxide peracetic acid with respect to gram-positive and gram-negative test germs (10(8) KBE/ml original culture) was examined . The results showed for formalin, phenol and sodium hydroxide a distinct temperature factor within the range of the germ-dependent, bactericidal limit concentrations . Compared with the temperature of about 22 degrees C which is normally applied in disinfectants tests revealed that at 12 degrees C the action time had at least to be doubled and at 4 degrees C the action time had to be four times as long for the complete killing of the germs . By contrast, with peracetic acid in its minimum effective concentrations (0.015 to 0.06%) a total germ reduction was attained after identical action times (5 minutes) at temperatures ranging between 4 degrees and 37 degrees C . Recommendations for the use of disinfectants must make allowance for the temperature factor. Vet Med Nauki, 1979, 16(9), 58 - 64 {Pharmacokinetic and microbiological studies of Pharmachem erythromycin asparate}; Doneva M et al.; Anti-microbial activity and pharmokinetics of erythromycin aspartate "Pharmachim" (EA) in chickens was studied . The investigations included erythromycin thiocyanat (ET) of the company Abbott-USA (the preparation Gallimycin poultry formula) . The studies revealed that EA has an effect on Gram-positive microorganisms mainly . It is quickly resorbed by the digestive tract and following the administration of 50 and 100 mg/kg body weight (applied by tube) in doses of 0.14 to 0.8 meg/cm3 it can be detected in the blood serum of chickens after 10 min only have elapsed . Maximal concentrations (from 0.35 to 0.95 meg/cm3) are discovered at about the 30-60th min and after that EA levels are gradually reduced to traces or 0.125 mcg/cm3 by 24th h . Application via drinking water in a dose of 115 mg/l results in EA quantities of 0.11 to 0.2 meg/cm3 detected in the blood during the entire course of treatment with therapeutic water . The use of equal ET doses results in 20 to 39% lower antibiotic levels . The same is true for EA and ET content in organs and tissues . Both preparations are eliminated by the bile secretion untill the 96th h post treatment's end . Resorption of EA is quick and high grade following muscular injection and at a dose of 20 mg/kg body weight the antibiotic persists in bacteriostatic concentrations in the blood up to the 15th, while at a dose of 40 mg/kg body weight-up to the 24th h post its single application. Mikrobiologiia, 1979 Jan-Feb, 48(1), 99 - 101 {Results of measuring the modulus of elasticity of microorganism cell walls}; Chemeris NA et al.; The elasticity modulus of Escherichia coli cell walls was found to change in the course of growth of the culture . It decreased in the middle of the exponential phase, apparently as a result of intensification of biosynthetic and related to them transport processes at this period . If the cells were treated with EDTA, their elasticity modulus was lower, by an order of magnitude, than that of the control cell walls . If the cells were treated with lysozyme, the elasticity modulus of their walls decreased by three orders of magnitude . The elasticity modulus of cell walls was less in gram-positive rods than in E . coli . The elasticity modulus of spherical cells cannot be determined using this technique. J Bacteriol, 1979 Jan, 137(1), 686 - 8 Localization of membrane-derived oligosaccharides in the outer envelope of Escherichia coli and their occurrence in other Gram-negative bacteria; Schulman H et al.; The glucose-containing, membrane-derived oligosaccharides of Escherichia coli are localized in the external envelope of that organism, most probably in the periplasmic space . The membrane-derived oligosaccharides appear to be generally occurring cell constituents of gram-negative (but not gram-positive) bacteria. J Antibiot (Tokyo), 1978 Dec, 31(12), 1252 - 61 New cephalosporins with 7-acyl groups derived from beta-ketoacids . II . Further modifications of 7-(3-oxobutyrylamino)-cephalosporins; Numata M et al.; New cephalosporins modified in the acyl part of 7-(3'-oxobutyrylamino)cephalosporins (1), which have been described in the preceding paper, were synthesized by thiolation at the 2'- or the 4'-position, or by transforming the 3'-oxo group into a 3'-imino group . The most active compound in vitro was 3-{{(1-methyl-1H-tetrazol-5-yl)thio}methyl}-7-(4-methylthio-3-oxobutyrylamino)ceph-3-em-4-carboxylic acid (7c), which showed superior in vitro activity against Gram-positive and Gram-negative bacteria compared to the parent cephalosporin (1b) with the same 3-substituent . The ED50 value for 7c, however, was essentially equal to that of 1b in mice infected with Escherichia coli O-111. Am J Med Sci, 1978 Nov-Dec, 276(3), 279 - 85 Recent experiences with nocardial infections; Rosett W et al.; A review of Nocardia isolates at two Kansas City hospitals from 1968 to 1976 revealed isolates from 42 different patients . Data were available for analysis from 36 patients . According to strict criteria, only 17(47%) were infected . Infection increased from zero to one yearly from 1968 through 1973 to five and seven in 1974 and 1975, respectively . Commensal isolates varied from zero to five yearly with no recent increase . Analysis of underlying disease and predisposing factors suggests that bronchopulmonary abnormalities predispose to colonization but infection is unusual without immunosuppression . Primary nocardial infection without known underlying disease accounted for only 4 of the 17(24%) infections . Fever and leukocytosis were not helpful in distinguishing nocardial infection from colonization . A history of prior steroid use and a smear showing gram-positive filamentous organisms correlated highly with infection . Mortality correlated with pulmonary and brain involvement, prior use of steroids, and inappropriate therapy . Nosocomial infection was noted in five patients with a mortality of 60% . Overall mortality was only 29%. Appl Environ Microbiol, 1978 Nov, 36(5), 683 - 7 Use of platinum electrodes for the electrochemical detection of bacteria; Wilkins JR; Platinum electrodes with surface area ratios of four to one were used to detect and enumerate a variety of gram-positive and gram-negative organisms . Linear relationships were established between inoculum size and detection time . End points for platinum electrodes were similar to those obtained with a platinum-reference electrode combination . Shape of the overall response curves and length of detection times for gram-positive organisms were markedly different than those for the majority of gram-negative species . Platinum electrodes are better than the platinum-reference electrode combination because of cost, ease of handling, and clearer definition of the end point. J Antibiot (Tokyo), 1978 Nov, 31(11), 1091 - 8 A new antibiotic, setomimycin, produced by a strain of Streptomyces; Omura S et al.; A new antibiotic, setomimycin, was isolated from the culture broth of strain AM-2947, which was identified as Streptomyces pseudovenezuelae . The compound is a weakly acidic substance, and has UV-absorption at 228, 268 and 422 nm and a molecular formula of C34H28O9 (MW 580) . It is active against Gram-positive bacteria including Mycobacteria, and has antitumor activity against Sarcoma-180 solid tumor in mice. J Exp Med, 1978 Nov 1, 148(5), 1228 - 40 Nonspecific resistance to bacterial infections . Enhancement by ubiquinone-8; Block LH et al.; A lipid fraction from Escherichia coli was extracted with apolar solvents and was found to protect mice from a number of experimental bacterial infections . The benzoquinone, ubiquinone-8, was isolated from this extract by high pressure liquid chromatography and identified as such by nuclear magnetic resonance and mass spectrometry . At a dose of 25 mg/kg this substance was found to provide complete protection against otherwise lethal infections with gram-negative and gram-positive bacteria in mice . Treatment was most effective when given intravenously 24 h before infection . In comparative studies, ubiquinone-8 had a clearly higher activity than ubiquinones-4, Q6, and Q10 . A highly significant increase in the clearance rate of bacteria from the blood by the spleen and the liver of treated animals, correlated well with the protective effect of ubiquinone-8 . The compound stimulated the ability of mouse macrophages to incorporate sheep erythrocytes and significantly increased the number of antibody-producing cells in spleens of mice.
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||