Journal of Bacteriology, January 2003, p . 674-678, Vol . 185, No . 2

Experimental Verification of a Sequence-Based Prediction: F₁F₀-Type ATPase of Vibrio cholerae Transports Protons, Not Na⁺ Ions

Judith Dzioba,¹ Claudia C . Häse,² Khoosheh Gosink,² Michael Y . Galperin,³ and Pavel Dibrov^1*

Department of Microbiology, University of Manitoba, Winnipeg, Manitoba R3T 2N2, Canada,¹ Department of Infectious Diseases, St . Jude Children's Research Hospital, Memphis, Tennessee 38105,² National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, Maryland 20894³

Received 10 June 2002/ Accepted 25 October 2002

Studies of the mechanism of H⁺ (and Na⁺) translocation through the F₀ portion of the F₁F₀ ATPase (9, 11) have demonstrated the key role of Asp⁶¹ of subunit c (AtpE) of the Escherichia coli enzyme in this process . The acidic (Asp or Glu) residue in this position is conserved among c subunits of both H⁺-dependent and Na⁺-dependent F₁F₀ ATPases from various bacteria, as well as among the equivalent K subunits of the archaeal- and vacuolar-type (A/V-type) ATPases (reviewed in reference 1) (Table 1) . In Na⁺-conducting c and K subunits, however, the Glu residue is followed by a hydroxyl-containing (Ser or Thr) residue, which apparently provides additional liganding groups, which are essential for binding alkali cations (20, 27) . The presence of conserved Pro and Gln residues on the adjacent transmembrane segment and the overall membrane topology of the c subunit have also been implicated in the determination of the cation selectivity of the enzyme (19, 20, 27) . Combining the available data, Rahlfs and Müller (27) proposed that there are two determinants of Na⁺ specificity for the F₁F₀ ATPase of A . woodii: (i) an enlargement of the C terminus of subunit c and (ii) the presence of the Na⁺-binding motif of P²⁵, Q²⁹, E⁶², and T⁶³ (Table 1) .

 
An inspection of the AtpE sequences from V . alginolyticus (23) and V . cholerae (16) showed that they share 92% identity and are very similar to the H⁺-conducting c subunits of the F₁F₀ enzymes from E . coli, Bacillus subtilis, Enterococcus hirae, and mitochondria of Saccharomyces cerevisiae and humans (Table 1) . Although vibrial AtpE subunits had longer C-terminal fragments than did the H⁺ ATPases from E . coli and B . subtilis and the Na⁺ ATPases from A . woodii and P . modestum, they clearly lacked the predicted Na⁺-binding motif (Table 1) . This apparent contradiction of the two previously established criteria of ATPase cation specificity (27) prompted us to investigate the nature of the coupling ion in V . cholerae F₁F₀ ATPase in more detail and find out whether V . cholerae uses the sodium motive or proton motive force in oxidative phosphorylation .

Growth of wild-type and atpE cells. This study used V . cholerae strain O395N1 (12) and its isogenic atpE derivative, carrying a deletion of the entire c subunit (proteolipid) of the F₁F₀ ATPase . The atpE deletion was generated by PCR-based amplification of the genomic DNA by using primer 1 (GGACTAGTCTCCGGCTCGAATAATAA) and primer 2 (GGAATTCCACTTTAGGGGGTAG) for the region downstream of the atpE gene and primer 3 (GGAATTCTCCAAAGATTCAATGGGTATTA) and primer 4 (AATGGTCGACATCTCGTTTTAT) for the region upstream of atpE . Novel EcoRI sites were introduced at the 5' ends of primers 2 and 3 to allow ligation of the two regions, resulting in a complete deletion of the atpE gene . Novel SpeI and SalI sites were introduced into primers 1 and 4, respectively, to allow direct cloning of the PCR products into the suicide vector pWM91 . The DNA was introduced into the chromosome of V . cholerae strain O395N1 following sucrose selection as described previously (12) . Genetic elimination of the c subunit allowed the inactivation of the F₁F₀ ATPase without creating undesirable ion leakage through the mutant enzyme . Growth measurements showed that while the wild-type cells were able to grow in M9 minimal medium supplemented with glucose (2%), succinate (1.2%) or glycerol (2%), the atpE mutant grew only on the fermentable substrate (glucose), thus displaying a classical unc phenotype (data not shown) . Very low (3 to 5 µM) concentrations of the protonophore uncoupler, carbonyl cyanide m-chlorophenylhydrazone (CCCP), completely arrested the growth on nonfermentable substrates at both pH 7.5 and 8.5 (data not shown), suggesting that proton acts as the coupling ion in oxidative phosphorylation in V . cholerae .

The transmembrane pH gradient (pH) and membrane potential () in inside-out membrane vesicles of V . cholerae were measured by fluorescence quenching and dequenching of 0.5 µM acridine orange (32) and 1.0 µM Oxonol V (34), respectively, as described previously (8) . For vesicle preparation, both wild-type and atpE strains of V . cholerae were grown aerobically to mid-logarithmic phase at 37°C in standard Luria-Bertani medium . After the cell suspension was passed through a French press, the vesicles were collected by differential centrifugation and then washed once with and resuspended in isolation buffer containing 10 mM MOPS (morpholinepropanesulfonic acid)-Tris (pH 7.5), 10% (wt/vol) glycerol, 0.2 M K₂SO₄, 25 mM MgSO₄, 0.5 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, and 0.2 µg of pepstatin A/ml .

Hydrolysis of ATP results in the formation of pH in inside-out vesicles of wild-type V . cholerae. Addition of inside-out vesicles to an experimental buffer containing 0.5 mM Tris-ATP and 0.05 µM valinomycin (added to maximize the formed pH by dissipating the concomitant ) resulted in an immediate proton uptake reflected by the rapid quenching of acridine orange fluorescence (Fig . 1A) . No such effect was observed when ATP was not added (data not shown) . Na⁺ was not required for ATP-dependent pH formation . Moreover, in the presence of 5 mM NaCl, the formation of pH was slower and lower in magnitude (Fig . 1A, upper trek) than that in Na⁺-free buffer (Fig . 1A, lower trek), apparently because of the secondary Na⁺/H⁺ antiport . Indeed, the addition of 5 mM NaCl to the mixture after the pH had been established caused a partial dissipation of pH (Fig . 1A, lower trek), which is a typical response of bacterial membranes capable of Na⁺/H⁺ antiport . Vesicles isolated from the atpE mutant of V . cholerae lost the ability to generate pH in response to the addition of ATP (Fig . 1B, upper trek) but not the respiratory substrate, succinate (Fig . 1B, lower trek) . Furthermore, secondary Na⁺/H⁺ exchange was not affected by the deletion (Fig . 1B) . The addition of CCCP after the addition of NaCl collapsed the pH completely (Fig . 1B, lower trek) . Therefore, hydrolysis of ATP by the F₁F₀ ATPase of V . cholerae appeared to be directly coupled to uphill proton movement across the membrane .

 
Effects of protonophore and Na⁺ on ATP-dependent in membrane vesicles from V . cholerae. Addition of ATP to the wild-type vesicles resulted in a rapid generation of ("plus" in vesicular interior) at pH 7.5 and 8.5 (Fig . 2A) . Similar to the ATP-dependent pH formation, this process did not require Na⁺ (Fig . 2B) . The protonophore uncoupler collapsed the generated , so the subsequent addition of valinomycin was without effect (Fig . 2A and B) . These observations strongly suggest that the ion translocated by the ATPase was proton, not sodium . The magnitudes of the ATP-dependent were the same at pH 7.5 and 8.5 (Fig . 2A) . Vesicles of the atpE mutant were unable to generate in response to the addition of ATP, while a respiratory substrate provoked rapid formation of the (Fig . 2C) . Thus, the F₁F₀ ATPase of V . cholerae displayed behavior typical of proton-translocating ATPases of this type (9) . These results indicated that hydrolysis of ATP by this enzyme is coupled to the formation of the proton motive, but not sodium motive, force .

 
Interplay of Na⁺ and H⁺ cycles in Vibrio spp. The data reported in this work show that in V . cholerae, the central membrane-related bioenergetic process, oxidative phosphorylation, is mediated by an H⁺-dependent F₁F₀ ATPase . The similarity between the AtpE subunits of V . cholerae and another Vibrio species, V . alginolyticus (Table 1), indicates that the latter enzyme is also H⁺ dependent . The reason(s) for the previously observed Na⁺-dependent ATP synthesis in V . alginolyticus (5, 6) and V . parahaemolyticus (29, 30) is not clear at the present time . One possible explanation is that the addition of Na⁺ ions to whole cells could generate a temporary proton motive force that would not be dissipated immediately by the uncoupler . Such a generation of proton motive force could be due to the activity of any of the several Na⁺/H⁺ antiporters present in the cells of Vibrio spp . Another possible explanation is that artificially imposed Na⁺ gradient could drive reverse electron transport, leading to a substrate-level phosphorylation in the cell cytoplasm, or stimulate some other biochemical process that would result in a temporary boost of ATP levels . It should be noted that one cannot exclude the possible existence of an alternative Na⁺ ATPase in V . cholerae, which could be repressed under the growth conditions used in this study . An inducible, two-gene ABC-type system extruding Na⁺ ions, NatAB, has been reported in Bacillus subtilis (3) . This transport system supposedly expels toxic Na⁺ from the cytoplasm and stimulates K⁺ uptake when the barrier function of the cytoplasmic membrane is affected by uncouplers or alcohols (3) . A number of genes encoding putative ABC-type transporters can be found in the V . cholerae genome, but none of them shows significant similarity to the bacillar natAB genes . These putative traffic ATPases of V . cholerae await biochemical characterization .

Na⁺ and H⁺ conductance rules. The data presented here show that of the two determinants of Na⁺ specificity of the A . woodii F₁F₀ ATPase identified by Rahlfs and Müller (27), the first, i.e., the length of the C-terminal extension of AtpE, did not seem to correlate with the cation specificity of the enzyme . In contrast, the absence of the likely Na⁺-binding motif Px₃Qx_28,32ET (Table 1) led to the correct identification of the V . cholerae enzyme as an H⁺ ATPase, suggesting that this motif is a reliable predictor of Na⁺ conductance . Indeed, the presence of a similar sequence motif in the AtpE subunit from Thermotoga maritima suggests that its F₁F₀ ATPase is Na⁺ dependent, which is consistent both with the transport data (10) and with the presence in the T . maritima genome of two Na⁺ pumps, the NQR and the Na⁺-translocating oxaloacetate decarboxylase (15) .

Na⁺ ATPases in other bacterial pathogens. Verification of the Na⁺-binding motif as a reliable predictor of ATPase cation specificity allows one to classify various bacterial F₁F₀ and A/V-type ATPases into Na⁺ ATPases and H⁺ ATPases . Sequence alignment of c and K subunits of F₁F₀ and A/V ATPases, respectively, shows the presence of the Na⁺-binding motif in ATPases from such pathogens as Chlamydia trachomatis, Treponema pallidum, and Streptococcus pyogenes (Table 1), which also have primary Na⁺ pumps and have been predicted to rely on Na⁺ circulation for their energy metabolism (15) . There are some surprises, too . The causative agent of Lyme disease, Borrelia burgdorferi, for example, encodes a vacuolar-type ATPase that is very similar to the one from T . pallidum and also contains a typical Na⁺-binding motif (data not shown) . Remarkably, the genome of B . burgdorferi does not encode any (known) primary H⁺ or Na⁺ pump, except for two NQR subunits, NqrA and NqrB, fused into a single polypeptide chain (BB0072) . Therefore, it appears that this organism uses its Na⁺ ATPase for ATP hydrolysis and depends on its two NhaC-type Na⁺/H⁺ antiporters (BB0637 and BB0638) for the generation of proton motive force .

The absence of experimental data on the role of the Pro residue in the Na⁺-binding motif described by Rahlfs and Müller prevents us from predicting the nature of the coupling ion for mycoplasmal F₁F₀ ATPases (Table 1) . The conservation of other residues in the Na⁺-binding site suggests that these organisms should be able to utilize Na⁺ as a coupling ion . Remarkably, another species of the Mycoplasmataceae, Ureaplasma urealyticum, appears to have lost the critical Ser residue of the motif and probably has a strictly H⁺-dependent ATPase .

In conclusion, the results of this work show that in spite of the importance of Na⁺ circulation for the membrane energetics of Vibrio cholerae and related microorganisms, these organisms still rely on the proton motive force for oxidative phosphorylation . The situation might be different for less versatile bacterial pathogens with smaller genomes that do not possess such a variety of membrane ionic pumps (15) .

1. Blair, A., L . Ngo, J . Park, I . T . Paulsen, and M . H . Saier, Jr. 1996 . Phylogenetic analyses of the homologous transmembrane channel-forming proteins of the F₀F₁-ATPases of bacteria, chloroplasts and mitochondria . Microbiology 142:17-32.
2. Chen, J., Y . Morita, M . N . Huda, T . Kuroda, T . Mizushima, and T . Tsuchiya. 2002 . VmrA, a member of a novel class of Na⁺-coupled multidrug efflux pumps from Vibrio parahaemolyticus . J . Bacteriol . 184:572-576.
3. Cheng, J., A . A . Guffanti, and T . A . Krulwich. 1997 . A two-gene ABC-type transport system that extrudes Na⁺ in Bacillus subtilis is induced by ethanol or protonophore . Mol . Microbiol . 23:1107-1120.
4. Denda, K., J . Konishi, T . Oshima, T . Date, and M . Yoshida. 1989 . A gene encoding the proteolipid subunit of Sulfolobus acidocaldarius ATPase complex . J . Biol . Chem . 264:7119-7121.
5. Dibrov, P . A., R . L . Lazarova, V . P . Skulachev, and M . L . Verkhovskaya. 1986 . The sodium cycle . II . Na⁺-coupled oxidative phosphorylation in Vibrio alginolyticus cells . Biochim . Biophys . Acta 850:458-465.
6. Dibrov, P . A., R . L . Lazarova, V . P . Skulachev, and M . L . Verkhovskaya. 1989 . A study on Na⁺-coupled oxidative phosphorylation: ATP formation supported by artificially imposed delta pNa and delta pK in Vibrio alginolyticus cells . J . Bioenerg . Biomembr . 21:347-357.
7. Dyer, M . R., and J . E . Walker. 1993 . Sequences of members of the human gene family for the c subunit of mitochondrial ATP synthase . Biochem . J . 293:51-64.
8. Dzioba, J., E . Ostroumov, A . Winogrodzki, and P . Dibrov. 2002 . Cloning, functional expression in Escherichia coli and primary characterization of a new Na⁺/H⁺ antiporter, NhaD, of Vibrio cholerae . Mol . Cell . Biochem . 229:119-124.
9. Fillingame, R . H. 1990 . Molecular mechanism of ATP synthesis of the F₁F₀ type H⁺-transporting ATP synthases, p . 345-391 . In T . A . Krulwich (ed.), The bacteria, vol . 12 . Academic Press, New York, N.Y.
10. Galperin, M . Y., K . M . Noll, and A . H . Romano. 1996 . The glucose transport system of the hyperthermophilic anaerobic bacterium Thermotoga neapolitana . Appl . Environ . Microbiol . 62:2915-2918.
11. Girvin, M . E., V . K . Rastogi, F . Abildgaard, J . L . Markley, and R . H . Fillingame. 1998 . Solution structure of the transmembrane H⁺-transporting subunit c of the F₁F₀ ATP synthase . Biochemistry 37:8817-8824.
12. Häse, C . C., and J . J . Mekalanos. 1998 . TcpP protein is a positive regulator of virulence gene expression in Vibrio cholerae . Proc . Natl . Acad . Sci . USA 95:730-734.
13. Häse, C . C., and J . J . Mekalanos. 1999 . Effects of changes in membrane sodium flux on virulence gene expression in Vibrio cholerae . Proc . Natl . Acad . Sci . USA 96:3183-3187.
14. Häse, C . C., and B . Barquera. 2001 . Role of sodium bioenergetics in Vibrio cholerae . Biochim . Biophys . Acta 1505:169-178.
15. Häse, C . C., N . D . Fedorova, M . Y . Galperin, and P . A . Dibrov. 2001 . Sodium ion cycle in bacterial pathogens: evidence from cross-genome comparisons . Microbiol . Mol . Biol . Rev . 65:353-370.
16. Heidelberg, J . F., J . A . Eisen, W . C . Nelson, R . A . Clayton, M . L . Gwinn, R . J . Dodson, D . H . Haft, E . K . Hickey, J . D . Peterson, L . Umayam, S . R . Gill, K . E . Nelson, T . D . Read, H . Tettelin, D . Richardson, M . D . Ermolaeva, J . Vamathevan, S . Bass, H . Qin, I . Dragoi, P . Sellers, L . McDonald, T . Utterback, R . D . Fleishmann, W . C . Nierman, O . White, S . L . Salzberg, H . O . Smith, R . R . Colwell, J . J . Mekalanos, J . C . Venter, and C . M . Fraser. 2000 . DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae . Nature 406:477-483.
17. Heise, R., V . Müller, and G . Gottschalk. 1992 . Presence of a sodium-translocating ATPase in membrane vesicles of the homoacetogenic bacterium Acetobacterium woodii . Eur . J . Biochem . 206:553-557.
18. Ihara, K., S . Watanabe, K . Sugimura, I . Katagiri, and Y . Mukohata. 1997 . Identification of proteolipid from an extremely halophilic archaeon Halobacterium salinarum as an N,N'-dicyclohexyl-carbodiimide binding subunit of ATP synthase . Arch . Biochem . Biophys . 341:267-272.
19. Kaim, G., and P . Dimroth. 1995 . A double mutation in subunit c of the Na⁺-specific F₁F₀-ATPase of Propionigenium modestum results in a switch from Na⁺ to H⁺-coupled ATP synthesis in the Escherichia coli host cells . J . Mol . Biol . 253:726-738.
20. Kaim, G., F . Wehrle, U . Gerike, and P . Dimroth. 1997 . Molecular basis for the coupling ion selectivity of F₁F₀ ATP synthases: probing the liganding groups for Na⁺ and Li⁺ in the c subunit of the ATP synthase from Propionigenium modestum . Biochemistry 36:9185-9194.
21. Kakinuma, Y., S . Kakinuma, K . Takase, K . Konishi, K . Igarashi, and I . Yamato. 1993 . A gene encoding the 16-kDa proteolipid subunit of Enterococcus hirae Na⁺-ATPase complex . Biochem . Biophys . Res . Commun . 195:1063-1069.
22. Kojima, S., K . Yamamoto, I . Kawagishi, and M . Homma. 1999 . The polar flagellar motor of Vibrio cholerae is driven by an Na⁺ motive force . J . Bacteriol . 181:1927-1930.
23. Krumholz, L . R., U . Esser, and R . D . Simoni. 1992 . Characterization of the genes coding for the F₁F₀ subunits of the sodium dependent ATPase of Propionigenium modestum . FEMS Microbiol . Lett . 70:37-41.
24. Laubinger, W., and P . Dimroth. 1987 . Characterization of the Na⁺-stimulated ATPase of Propionigenium modestum as an enzyme of the F₁F₀ type . Eur . J . Biochem . 168:475-480.
25. Macino, G., and A . Tzagoloff. 1979 . Assembly of the mitochondrial membrane system . The DNA sequence of a mitochondrial ATPase gene in Saccharomyces cerevisiae . J . Biol . Chem . 254:4617-4623.
26. Nielsen, J., F . G . Hansen, J . Hoppe, P . Friedl, and K . von Meyenburg. 1981 . The nucleotide sequence of the atp genes coding for the F₀ subunits a, b, c and the F₁ subunit delta of the membrane bound ATP synthase of Escherichia coli . Mol . Gen . Genet . 184:33-39.
27. Rahlfs, S., and V . Müller. 1997 . Sequence of subunit c of the Na⁺-translocating F₁F₀ ATPase of Acetobacterium woodii: proposal for determinants of Na⁺ specificity as revealed by sequence comparisons . FEBS Lett . 404:269-271.
28. Rahlfs, S., S . Aufurth, and V . Müller. 1999 . The Na⁺-F₁F₀-ATPase operon from Acetobacterium woodii . Operon structure and presence of multiple copies of atpE which encode proteolipids of 8- and 18-kDa . J . Biol . Chem . 274:33999-34004.
29. Sakai, Y., C . Moritani, M . Tsuda, and T . Tsuchiya. 1989 . A respiratory-driven and an artificially driven ATP synthesis in mutants of Vibrio parahaemolyticus lacking H⁺-translocating ATPase . Biochim . Biophys . Acta 973:450-456.
30. Sakai-Tomita, Y., M . Tsuda, and T . Tsuchiya. 1991 . Na⁺-coupled ATP synthesis in a mutant of Vibrio parahaemolyticus lacking H⁺-translocating ATPase activity . Biochem . Biophys . Res . Commun . 179:224-228.
31. Santana, M., M . S . Ionescu, A . Vertes, R . Longin, F . Kunst, A . Danchin, and P . Glaser. 1994 . Bacillus subtilis F₀F₁ ATPase: DNA sequence of the atp operon and characterization of atp mutants . J . Bacteriol . 176:6802-6811.
32. Schuldiner, S., H . Rottenberg, and M . Avron. 1972 . Determination of pH in chloroplasts . 2 . Fluorescent amines as a probe for the determination of pH in chloroplasts . Eur . J . Biochem . 25:64-70.
33. Shibata, C., T . Ehara, K . Tomura, K . Igarashi, and H . Kobayashi. 1992 . Gene structure of Enterococcus hirae (Streptococcus faecalis) F₁F₀-ATPase, which functions as a regulator of cytoplasmic pH . J . Bacteriol . 174:6117-6124.
34. Smith, J . C. 1990 . Potential-sensitive molecular probes in membranes of bioenergetic relevance . Biochim . Biophys . Acta 1016:1-28.
35. Umemoto, N., Y . Ohya, and Y . Anraku. 1991 . VMA11, a novel gene that encodes a putative proteolipid, is indispensable for expression of yeast vacuolar membrane H⁺-ATPase activity . J . Biol . Chem . 266:24526-24532.
36. Vimont, S., and P . Berche. 2000 . NhaA, an Na⁺/H⁺ antiporter involved in environmental survival of Vibrio cholerae . J . Bacteriol . 182:2937-2944.

Free Online Full-text Article

What Is Rhizobia?, What Is Salmonella?, What Is Biofilm?, What Is Bioremediation?, What Is Pcr?, i, Microorganism, r, Bacteriology, c, Microbes, c, Bacteria, e, Microorganisms, s, Escherichia coli, c, Minimum inhibiting concentration, c, Neisseria, o, Halomonas, i, Streptococcal, i, Staphylococcus aureus, o, Antimicrobials, s, Fermentations, n, Antibiotics, o, Lactococci, a, Sepsis, c, Antibiotics, c, Microbial, i, Salmonella typhimurium, i, Botulism, n, Xanthomonas, c, Neisseria, a, Yeasts, a, Antibiotic prophylaxis, a, Escherichia coli, r, Cell cultures




 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005