|
|
|
Journal of Bacteriology, April 2002, p . 1932-1939, Vol . 184, No . 7 Identification and Characterization of CAMP Cohemolysin as a Potential Virulence Factor of Riemerella anatipestiferKaren C . Crasta,1 Kim-Lee Chua,1,2 Sumathi Subramaniam,1 Joachim Frey,3 Hilda Loh,4 and Hai-Meng Tan1,5* Institute of Molecular Agrobiology, National University of Singapore, Singapore 117604, Departments of,1 Biochemistry ,2 Microbiology, National University of Singapore, Singapore 117597,5 Veterinary Laboratory Branch, Central Veterinary Laboratory, Singapore 548596, Singapore,4 Institute for Veterinary Bacteriology, University of Berne, CH-3012 Berne, Switzerland3 Received 3 October 2001/ Accepted 11 December 2001
Most work on R . anatipestifer has been centered on its serology . Currently, 21 serotypes have been identified by slide and tube agglutination tests with antisera (14, 19) . Recently, repetitive-sequence-PCR-based fingerprints were used for subtyping R . anatipestifer isolates for epidemiological investigations (11) . An OmpA protein was characterized for its possible use in serodetection of R . anatipestifer infection (28) . Inactivated bacterins and live vaccines have successfully conferred protection against homologous strains or serotypes of R . anatipestifer but were unable to protect against heterologous serotype exposure (20, 22) . In contrast, there has been little work on the molecular basis of the pathogenesis of this organism, and so far no virulence factors have been established except for the identification of VapD, which shows homology to virulence-associated proteins of other bacteria (31) . One of the goals of our laboratory is to identify and characterize virulence factors of R . anatipestifer . This study describes the CAMP cohemolysin . The CAMP effect describes the synergistic lysis of erythrocytes in the presence of diffusible substances, one of which is the CAMP cohemolysin, produced by microorganisms growing adjacent to each other on the surface of blood agar (6) . Since the cohemolysin causes lysis of red blood cells, it is considered a potential virulence factor . In this study, R . anatipestifer strains of serotype 19 exhibited the CAMP phenomenon on blood agar . To facilitate study of the role of CAMP in pathogenesis, which may eventually lead to the development of diagnostics and subunit vaccines, the CAMP cohemolysin gene, cam, of reference strain 30/90 of serotype 19 was cloned and expressed . The deduced amino acid sequence of Cam showed high homology to those of O-sialoglycoprotein endopeptidases . An assay was done to show that Cam is a sialoglycoprotease, leading to this first report of a cohemolysin being a protease .
Preparation and manipulation of plasmid DNA. The general procedures for recombinant DNA technology (transformation, plasmid preparation, ligation, restriction enzyme digestion, and analytical gel electrophoresis) used for cloning, subcloning, and analysis of recombinant plasmids are described by Sambrook et al . (21) . Generation of the His tag fusion construct. Primers used for amplification of the cam determinant are CAMPB (with BamHI linker; GGCGGATCCATGAAACAATCTATTATC) and CAMPH (with HindIII linker; CGCAAGCTTTTACTTTACATTTAACTC . PCR was performed in a Hybaid Limited Touchdown thermal cycler by using a 50-µl reaction mixture (20 mM Tris-HCl [pH 8.8], 10 mM KCl, 2 mM MgSO4, 10 mM [NH4]2SO4, 200 µM [each] deoxynucleoside triphosphate, 100 pmol of each primer, 1 µg of plasmid DNA, and 1.25 U of Pfu polymerase mixture [Promega]) . The PCR cycling parameters consisted of an initial denaturation at 95oC for 2 min; 30 cycles of 95oC for 1 min, 44oC for 1 min, and 72°C for 1 min; and a final extension step at 72oC for 5 min . The pQE30 His tag vector and the cam amplicon were digested with BamHI and HindIII, subjected to ligation, and transformed into E . coli M15 cells for overexpression . Both strands of the inserted fragment and vector cloning sites were sequenced to confirm the identity of the construct . Purification of recombinant protein. The His tag fusion protein was induced with 0.1 mM IPTG at 37oC . Following induction, the cells were harvested and resuspended in a volume of ice-cold 10 mM Tris-Cl buffer, pH 7.5, that gave a concentration of 1 g wet weight of cells per ml of buffer . The resuspended cells were then subjected to sonication at 14 µm for 4 min (each cycle consisted of a 10-s burst followed by a 10-s interval) . The fusion proteins were then purified from these cell extracts by using 50% Ni-nitrilotriacetic acid (NTA) slurry (Qiagen) according to manufacturer's instructions . N-terminal sequencing. The purified Cam protein was separated by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis (SDS-12% PAGE) and electroblotted onto a polyvinylidene difluoride (PVDF) membrane at 50 V for 1 h . The PVDF membrane was stained with Coomassie brilliant blue and destained, and the appropriate region carrying Cam was excised . This was then subjected to N-terminal amino acid analysis by the automated Edman procedure (Bioprocessing Technology Centre, National University of Singapore) . Production of antisera and immunological methods. Monospecific polyclonal antisera directed against the polyhistidine-tailed fusion protein were obtained by immunization of three New Zealand White rabbits with Freund's adjuvant (Sigma) emulsified with purified recombinant proteins . Each received initial intramuscular injections of 0.5 ml of Freund's complete adjuvant containing 0.5 mg of the recombinant protein in both their right and left hind thigh muscles . The rabbits received subsequent booster injections on days 14, 28, and 42 after primary immunization . Booster injections were prepared using Freund's incomplete adjuvant (Sigma) as the emulsifying agent and contained the same amount of recombinant protein as the primary immunization . Serum samples were collected before each injection and stored at -20oC for immunodetection of proteins from various R . anatipestifer strains . Purified recombinant proteins and whole-cell extracts were mixed with SDS sample buffer and boiled for 5 min, and subsequently immunoblot analysis was performed on 12% acrylamide gels . Membranes were probed with rabbit sera raised against the CAMP cohemolysin at 1:200 dilution and detected by using horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (Pierce) at 1:20,000 dilution and the SuperSignal West Pico chemiluminescent substrate (Pierce) . Glycoprotease assay. Glycoprotease activity was monitored by the hydrolysis of human glycophorin A (GPA) . An aliquot of the enzyme (0.2 mg) was incubated with 3.5 µg of 125I-GPA, prepared as described elsewhere (15, 16), in 50 mM HEPES (pH 7.4) in a total volume of 25 µl at 37°C for 3 h . Hydrolysis was terminated by the addition of sample buffer and boiling for 2 min . The substrate and the products were separated by SDS-PAGE on 12% gels, which were dried and autoradiographed to locate the radiolabeled bands . The enzyme activity of the glycoprotease at different pH values and in the presence of inhibitors was also tested . For the latter, Cam was preincubated with the inhibitor for 30 min at 37°C, pH 7.4, followed by the addition of soluble 125I-GPA . The mixture was further incubated for 1 h . Activity was calculated from the percent disappearance of GPA dimer bands on an autoradiogram, measured by using a densitometer . Nucleotide sequence accession number. The GenBank accession number of the nucleotide sequence of the gene encoding the CAMP cohemolysin of R . anatipestifer serotype 19 strain 30/90, cam, is AF202727 .
Cloning and sequence analysis of cam. Chromosomal DNA extracted from R . anatipestifer serotype 19 reference strain 30/90 was partially digested with Sau3A . These fragments were ligated into BamHI-digested pBluescript II SK(-) vector and subsequently transformed into E . coli XL1-Blue and selected on plates containing ampicillin, IPTG (isopropyl-ß-D-thiogalactopyranoside), and X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) . Transformants identified by blue/white selection were subjected to the CAMP test . Those that showed zones of clearing were CAMP positive and were subjected to sequencing . One clone containing hybrid plasmid pJFRA8, the vector of which contained a 6,906-bp insert, was chosen for further analysis . By using the National Center for Biotechnology Information (NCBI) ORF Finder (http://www.ncbi.nlm.nih.gov.), three putative protein-coding regions were found, and these were subjected to the NCBI BLASTX program (3) for determination of sequence homology . To determine the location of the gene encoding the CAMP factor protein, the 6.9-kb R . anatipestifer insert in pJFRA8 was digested with BamHI and DraII to yield 2,308-bp fragment 1 and 4,600-bp fragment 3 (Fig . 1) . Fragment 1 specified a 684-bp open reading frame (ORF) whose product has homology to a gamma glutamyl-transpeptidase precursor, while fragment 3 specified a 4,349-bp ORF whose product has homology to the reovirus attachment protein . These fragments were ligated to a DraII- and BamHI-digested pBluescript II SK(-) vector and transformed into XL1-Blue, yielding pHMT1 and pHMT3, respectively . Fragment 2 (3,566 bp) contained a 1,026-bp ORF whose product has homology to sialoglycoprotein endopeptidases . This was obtained by digestion with BamHI and BstXI, ligation to the pBluescript II SK(-) vector, and transformation into E . coli . Clones containing pHMT1, pHMT2, and pHMT3 carrying fragments 1, 2, and 3, respectively (Table 1), were subjected to the CAMP test . The gene responsible for cohemolysis was found to be located on fragment 2 . PCR cloning of the 1,026-bp ORF was carried out using primers CAMB and CAMH to generate subclone HMT2A . The recombinant plasmid was sequenced to confirm the identity of the construct . CAMP activity was tested, and HMT2A showed a positive CAMP effect (Fig . 2) . The gene was referred to as cam .
The sequence also showed a conserved region containing two conserved histidines, at amino acids 112 and 116, which, as for all the other metalloproteases, indicate the presence of potential zinc-binding sites (Fig 3) . Analysis of the hydropathicity of the sequence by the TMpred program (http://www.ch.embnet.org) showed it to be predominantly hydrophilic, suggesting that Cam is a cytoplasmic or peripheral protein . An examination of the amino terminus showed no signal sequence, indicating that the mechanism of transport across the double membrane of bacteria for secretion was unconventional, similar to that of sialoglycoproteases found in other organisms (1, 30) .
The cam gene was found to be common to all R . anatipestifer strains . However, only serotype 19 strains were observed to phenotypically exhibit cohemolytic activity with S . aureus on blood agar although Western blotting results revealed that strains from serotypes 1, 2, 3, 5, 6, and 19 expressed the Cam protein . The CAMP effect involves at least two individual membrane-active components interacting sequentially with the erythrocyte membrane, which contains at least 45 mol% sphingomyelin (26) . The first step involves a nonlytic hydrolysis of membrane sphingomyelin and phospholipids by sphingomyelinase or phospholipase (7) . The "second-step agents," the CAMP cohemolysins, can then gain access to the membrane and induce further membrane destruction or cell lysis nonenzymatically (4, 7) . Although the cohemolytic reactions are an in vitro phenomenon, they might be of relevance in vivo and might emerge from mixed infections producing two or more membrane-acting proteins or simply from the coexistence of different bacterial species in an appropriate location such as the upper respiratory tract . Field studies have shown that the bacterium rarely acts as a primary agent but rather that in most cases predisposing bacterial and viral infections are involved in causing disease (23) . The natural environment of R . anatipestifer is the heart, brain, air sacs, bone marrow, lungs, and liver of ducklings, and the bacterium is thought to enter through the respiratory tract or skin punctures (23) . The Cam protein shows high homology to O-sialoglycoprotein endopeptidases . As its name suggests, it is a neutral metalloprotease which has high specificity for O-sialoglycoproteins attached to serine or threonine residues, most of which are membrane proteins . Substrates include human GPA, CD34, CD43, CD44, and CD45; ligands for P- and L-selectins; tumor antigen epitectin; vascular adhesion protein VAP-1; platelet glycoprotein Ib; and cranin, a brain O-sialoglycoprotein (18) . The best-characterized substrate is the transmembrane cell surface glycoprotein of human erythrocytes, GPA (18) . Although it cannot be the physiological substrate for R . anatipestifer sialoglycoprotease, it was used to determine hydrolysis by Cam, as few glycoproteins from avian target cells are available for testing as potential in vivo substrates . Cam was able to hydrolyze GPA, demonstrating that it was a sialoglycoprotease . Similar membrane O-sialoglycoprotein substrates present in host cells, such as those present on the mucosal epithelia of the respiratory tracts of ducklings or on immune cell surfaces, may be the natural targets of this enzyme, thus contributing to its pathogenicity, as these are potential sites for an intrinsic cohemolytic reaction of R . anatipestifer with other organisms . The action of two or more factors on individual target structures could initiate events leading to structural and functional disorders and may contribute to the fibrinous exudates on the surfaces of infected organs and inflammatory exudates on lesions that are observed postmortem (23) . Variations of virulence as assessed by mortality and morbidity rates have been reported for the different serotypes and within a given serotype . Our results show that strains from serotypes 1, 2, 3, 5, 6, and 19 expressed the cohemolysin . Serotypes 1, 2, 3, 5, and 15 are most prevalent in severe outbreaks of septicaemia anserum exsudativa (19, 29) . The presence of the cohemolysin could contribute to virulence, as it is produced by most of the prevalent serotypes, which may be better adapted at producing the cohemolysin during a natural infection under certain intracellular conditions and therefore able to damage the host and aid in the infection process, thus providing a function essential to pathogenesis . One possible consequence of hemolytic activity in vivo is the release of iron for use by the organism, as pathogenic bacteria require iron in the infection process (10) . The Cam protein of R . anatipestifer was found to possess properties similar to those of the sialoglycoprotease from P . haemolytica, which was considered a virulence factor (13) . A Presponse vaccine has been designed based on the P . haemolytica recombinant sialoglycoprotease fusion protein (P . E . Shewen, A . Perets, C . W . Lee, and R . Y . C . Lo, Abstr . 3rd Int . Conf . Haemophilus, Actinobacillus, Pasteurella Organisms, abstr . P44, 1994) . In addition, the CAMP factor of Streptococcus uberis (11a) has also been used in vaccine compositions . Thus, subunit vaccines of the CAMP cohemolysin of R . anatipestifer could be used for preventive or therapeutic measures against septicaemia anserum exsudativa of ducklings . Work to further characterize the cohemolysin is under way . This should aid in the understanding of the potential role of Cam as a virulence determinant and the mechanisms of R . anatipestifer pathogenicity, which should help prevent disease .
What Is Genome?,
What Is Staphylococcus Aureus?,
What Is Biofilm?,
What Is Rhizobia?,
What Is Salmonella?,
o,
Bacterium,
s,
Microorganisms,
n,
Microbiology,
i,
Microorganism,
o,
Bacteria,
s,
Escherichia coli,
o,
Ps. fluorescens,
c,
Streptococcal,
n,
Yeasts,
n,
Multidrug resistant,
i,
Bacillus subtilis,
r,
Staphylococcus aureus,
r,
Lactobacillus,
c,
Escherichia coli,
a,
Thermophile,
e,
Escherichia coli,
a,
Microorganisms,
i,
Microbiological,
n,
Cell suspensions,
a,
Cell suspensions,
c,
Candida tropicalis,
a,
Escherichia coli,
o,
Microorganism,
s,
S. cerevisiae,
s,
Staphylococcus,
a,
Lactobacillus
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||