|
| |
Journal of Bacteriology, January 2004, p . 570-574, Vol . 186,
No . 2
Cloning
and Characterization of Acetohydroxyacid Synthase from Bacillus
stearothermophilus
Iris Porat,1,
Michael Vinogradov,1 Maria Vyazmensky,1 Chung-Dar Lu,2
David M . Chipman,1 Ahmed T . Abdelal,3 and Ze'ev Barak1*
Department of Life Sciences, Ben-Gurion University of the Negev, Beer-Sheva,
84105 Israel,1 Biology Department, Northeastern University, Boston,
Massachusetts 02115-5000,3 Department of Biology, Georgia State
University, Atlanta, Georgia 303032
Received 20 June 2003/ Accepted 3 October 2003
Five genes from the ilv-leu operon from Bacillus stearothermophilus
have been sequenced . Acetohydroxyacid synthase (AHAS) and its
subunits were separately cloned, purified, and characterized . This
thermophilic enzyme resembles AHAS III of Escherichia coli,
and regulatory subunits of AHAS III complement the catalytic subunit
of the AHAS of B . stearothermophilus, suggesting that AHAS III
is functionally and evolutionally related to the single AHAS of
gram-positive bacteria .
The first step common to the biosynthesis of branched-chain amino
acids, catalyzed by acetohydroxyacid synthase (AHAS) (EC 4.1.3.18),
is the condensation of pyruvate with either 2-ketobutyrate (the
precursor of isoleucine) or pyruvate (the precursor of valine) (4,
26) . Bacterial AHASs are composed of large (60-kDa)
catalytic and small (9- to 18-kDa) regulatory subunits . Isolated
catalytic subunits have lower activity than the holoenzymes but
are similar to them in their cofactor dependence and specificity
towards the two different substrates (10, 27,
28) . The sensitivity of AHAS to feedback
inhibition is completely dependent on the small subunit .
Many bacteria and archaea apparently contain a single AHAS enzyme .
In most gram-positive bacteria, the genes for the first two enzymes
in the pathway are located in the same operon (ilvBNC) (5,
9, 13, 15,
30), often together with the leu genes (ilvBNC-leuACBD)
(17, 25, 30) . The
enterobacteria contain three isozymes of AHAS, encoded by distinct
and differently regulated operons (3, 4) .
To investigate the AHAS of Bacillus stearothermophilus (AHASBst),
we cloned the genes for this holoenzyme (ilvBN) and its large
(ilvB) and small (ilvN) subunits to allow sequencing and
overexpression . The screening for these genes was conducted with a
genomic cosmid library for B . stearothermophilus ATCC 7954,
created by H . Ewis (unpublished data), with a digitonin-labeled
1,100-bp probe that is highly conserved (50 to 75% amino acid
identity) among AHASs (7) and only slightly
conserved in other thiamine diphosphate (ThDP)-dependent enzymes,
such as pyruvate oxidase (30%) and catabolic acetolactate synthase
(25%) of Bacillus subtilis . This probe was amplified from the
B . stearothermophilus ATCC 12980 genome by using two
degenerate oligonucleotide primers:
5'(C/T/A)GGNACNGA(T/C)GCNTT(T/C)CA(A/G)GA and
5'T(C/G)(C/T)TGCCA(C/T)(T/G)NACCAT .
The gene order in the insert of the AHAS-positive cosmid, as
determined by coding analysis of its sequence (Fig . 1), seems
similar to that of the B . subtilis ilv-leu operon (16,
30) . The 5' end of ilvB was absent in the
cosmid-cloned fragment . This region was added to the clone, as shown
in Fig . 1, from a PCR-amplified fragment obtained
from the genome of B . stearothermophilus ATCC 7954 by using
primers that were identical to the T-box element of the ilv-leu
operon from B . subtilis (14) (GGGTGGTACCGCGG)
and to a sequenced 3' region of ilvB from B . stearothermophilus
(GGCGGATTTGCCAATGGTTCGGC) .
|
FIG . 1 . Restriction map and schematic representation of the insert of
the AHAS-positive cosmid (upper-left diagram) and construction of
plasmids . Plasmid pT7-6-ilvB-beg was constructed by ligating the DNA
fragment of the beginning of ilvB (see text) (which was initially
introduced into the pGEM-T Easy plasmid, creating pGEM-T
Easy-beg-ilvB-777) into the SalI site of the pT7-6 expression
vector . Plasmid pT7-6-ilvBNC-leuAdel was constructed by inserting the
4.0-kb EcoRI fragment, obtained from the cosmid containing the
putative 3' end of the ilvB gene, into the EcoRI site of
pT7-6-ilvB-beg . The pT7-6-ilvBN plasmid was constructed by deleting a
1,771-bp Ecl136II-Bst1107I DNA fragment from the
pT7-6-ilvBNC-leuAdel plasmid and by a self-ligation of the rest of the
plasmid . The pT7-6-ilvB plasmid was constructed by deleting a 2,561-bp
Ecl136 II-SmaI fragment from pT7-6-ilvBNC-leuAdel and by a
self-ligation of the remaining plasmid . The pT7-6-ilvN plasmid was
constructed by deleting a 1,190-bp HindIII fragment from
pT7-6-ilvBN and by a self-ligation of the rest of the plasmid . Genes and
their directions of transcription are marked by black arrows .
Overlapping genes are shown below the line for clarity . The order of the
last two EcoRI fragments in the cosmid insert was not determined.
|
|
The DNA sequences of the ilv-leu operon of B . stearothermophilus
(NCBI accession no.
AY083837) and the deduced amino acid sequences of its encoded
proteins show 67% and 68 to 74% identity, respectively, with those of
B . subtilis for this region .
The purification of AHAS for biochemical characterization required
the subcloning of its genes into the expression vector pT7-6 (Table
1), as illustrated in Fig . 1 . In the
purification of the holoenzyme [from E . coli
HMS174(DE3)/pT7-6-ilvBN] and its separately expressed subunits [from
HMS174(DE3)/pT7-6-ilvB or HMS174(DE3)/pT7-6-ilvN], we took advantage
of the thermophilic properties of the enzyme and precipitated most of
the mesophilic proteins of the host by heat denaturation in the first
step of this process (Fig . 2; Table 2) .
After two further steps, we achieved more than 90% purity for the
polypeptides (Fig . 2) . The inferred molecular
masses of the polypeptides encoded by the ilvB gene (63.3 kDa)
and by ilvN (18.7 kDa) were confirmed . The N-terminal amino
acid sequence of the putative large subunit (AKMNVEEQTKTKMSGSMM) also
agrees with that deduced from the ilvB gene, when initiated
from the fourth in-frame AUG triplet, after cleavage of the initial
N-formylmethionine . The ilvN product showed no AHAS
activity, as expected for the regulatory subunit, but was capable of
activating the large subunit .
| TABLE 1 . Bacterial strains and plasmids used in this work
|
|
|
FIG . 2 . SDS-PAGE of AHASBst and its subunits . (A)
Results for the steps of purification of the holoenzyme (lanes 1 to 4)
as summarized in Table 2 . Forty micrograms of protein
was loaded in each lane . (B) Purified large subunit (lane 2) and small
subunit (lane 3), 10 µg each . Protein size markers are in lane 1.
|
|
| TABLE 2 . Purification of holoenzyme and large subunit of AHAS
|
|
AHASBst is the first thermophilic AHAS to be isolated and
characterized . Its optimal temperature for activity is about 55°C . At
65°C, the enzyme loses its activity with a half time of 5 min, and
at 70°C, it does so in less than a minute . Although none of the
Escherichia coli AHAS isozymes is as thermostable as AHASBst,
the latter is less thermophilic (Table 3) than one
might expect for an enzyme from an organism whose optimal growth
temperature is 55°C . Interestingly, the optimal temperature for AHAS
activity is nearly 65°C in crude extracts of B . stearothermophilus
ATCC 12980 (21), suggesting that interactions with
other factors in the cytosol might contribute to the thermostability
of this enzyme .
| TABLE 3 . Comparison of catalytic activity of AHASBst
(holoenzyme, isolated large subunit, and reconstituted enzyme) to that
of AHAS III from E . colia
|
|
The specific activity and substrate affinity of AHASBst under
optimal conditions are quite similar to those of E . coli AHAS
III (Table 3), except that the former shows substrate
inhibition at high pyruvate concentrations (Fig . 3) .
The enzyme has a moderately high preference for ketobutyrate over
pyruvate as the second substrate (R = 22) . AHASBst
is more sensitive to the inhibitor sulfometuron methyl than is E .
coli AHAS III (Table 3) but is less sensitive
than the AHAS II of E . coli or plant enzymes (22,
24) .
|
FIG . 3 . Pyruvate dependence of AHAS holoenzyme . The reaction was carried
out at 60°C in 0.1 M Tricine, pH 8.0, with 5 mg of purified enzyme ml-1
in the presence of 0.1 mM ThDP, 10 mM Mg2+, and 0.025 mM FAD .
Data were fitted to the empirical equation V = (vmax[Pyr])/(Km
+ [Pyr] + [Pyr]2/K2), where v is the
measured reaction velocity, Vmax is the maximum
velocity at substrate saturation, and Pyr is pyruvate.
|
|
The isolated large subunit has about one-third the activity of the
holoenzyme, but it can be reconstituted to nearly complete activity
by the addition of purified small subunits (Table 3;
Fig . 4) . It also shows a low apparent affinity for the
enzyme's cofactors (ThDP, Mg2+, and flavin adenine
dinucleotide [FAD]) .
|
FIG . 4 . Reconstitution titration of the purified AHAS large subunit with
purified small subunits . Large subunits (4.2 µg/ml) were preincubated
for 15 min at 55°C with varied amounts of purified small subunits of
AHASBst (•) (upper abscissa; micrograms of N) in the
standard reaction buffer . Note that the large and small subunits are
calculated to be equimolar at 1.25 µg of small subunit . The reaction was
initiated by the addition of pyruvate (20 mM), stopped after 20 min, and
analyzed . In a parallel reaction, the large subunits were incubated at
40°C with purified small subunits of E . coli AHAS III ( )
(lower abscissa, micrograms of H).
|
|
The feedback regulation of AHASBst by valine is dependent on
the presence of the small subunits (Table 3) . The
inhibition at saturation with valine is incomplete (Table
3), as has been shown for other AHASs (19,
31), and depends on the substrate concentration;
at 1.0 mM pyruvate, for instance, the inhibition was 24% with a
valine concentration for half of this inhibition (K0.5)
of 4 µM, while at 10 mM pyruvate, there was no inhibition . We suggest
that at physiological levels of pyruvate (0.1 to 0.5 mM), feedback
inhibition by valine may play a significant role in modulating
branched-chain amino acid biosynthesis . Leucine and isoleucine have
only very small effects on the enzyme (data not shown) .
It is interesting that the purified small subunits of E . coli
AHAS III can also activate the B . stearothermophilus large
subunits, if the reaction is carried out at a temperature at which
the AHAS III small subunits are stable (40°C) . The concentration
that is required for half activation (Fig . 4) is about
four to five times higher than that required for the activation of
the homologous subunit . The activity of this heterologous large-
and small-subunit combination is sensitive to valine inhibition .
In this case, at a pyruvate concentration of 0.3 mM, valine
leads to 48% inhibition of activity at saturation, with an apparent
K0.5 of about 150 µM (data not shown) . In contrast, there
is no heterologous activation or conferral of valine sensitivity
when regulatory and catalytic subunits from different E . coli
isozymes (23, 27, 28)
or from E . coli AHAS III and Saccharomyces cerevisiae (20;
R . Duggleby, personal communication; M . Vyazmensky, unpublished
results) are combined .
In conclusion, AHASBst is quite similar to isozyme III from
E . coli (2, 11,
19, 23) (Table 3) and to AHASs from
other gram-positive bacteria with a single AHAS (8,
15, 31) . The evolutionary and
functional connections between the single AHASs of gram-positive
bacteria and isozyme III of E . coli can be seen in the sequences
of the regulatory subunits, the tendencies of the regulatory
subunits to dissociate, and the heterologous complementation
described above . Another hint of such a relationship is the
regulation of the expression of E . coli ilvIH by leucine and
the encoding of a typical gram-positive AHAS by an ilvBNC-leu
operon .
|
|
Nucleotide sequence accession number .
|
The sequence data reported here have been deposited in the NCBI
database under accession no.
AY083837 .
This research was supported in part by grant 93-00233 from the
U.S.-Israel Binational Science Foundation and by seed grants from the
Vice President for Research and Development of Ben-Gurion University .
I.P . thanks the students and technical staff who assisted her
during the period she spent at Georgia State University, particularly
Debby Walthall and Hosam Ewis .
* Corresponding author . Mailing address: Department of Life
Sciences, Ben-Gurion University of the Negev, P.O . Box 653, Beer-Sheva, 84105
Israel . Phone: (972) 864 61713 . Fax: (972) 864 79178 . E-mail: barakz@bgumail.bgu.ac.il.
Present address: Department of Microbiology, University of Georgia,
Athens, GA 30602-2605 .
- Ausubel, F . M., R . Brent, R . E . Kingston, D . D . Moore, J . G .
Seidman, J . A . Smith, and K . Struhl. 1993 . Current protocols in molecular
biology, vol . 1 to 3 . John Wiley and Sons, New York, N.Y.
- Barak, Z., J . M . Calvo, and J . V . Schloss. 1988 .
Acetolactate synthase isozyme III from Escherichia coli. Methods
Enzymol . 166:455-458.
- Barak, Z., D . M . Chipman, and N . Gollop. 1987 .
Physiological implications of the specificity of acetohydroxy acid synthase
isozymes of enteric bacteria . J . Bacteriol . 169:3750-3756.
- Barak, Z., N . Kogan, N . Gollop, and D . M . Chipman. 1990 .
Importance of AHAS isozymes in branched chain amino acid biosynthesis, p .
91-107 . In Z . Barak, D . M . Chipman, and J . V . Schloss (ed.),
Biosynthesis of branched chain amino acids . VCH, Weinheim, Germany.
- Bolotin, A., P . Wincker, S . Mauger, O . Jaillon, K . Malarme,
J . Weissenbach, S . D . Ehrlich, and A . Sorokin. 2001 . The complete genome
sequence of the lactic acid bacterium Lactococcus lactis ssp . lactis
IL1403 . Genome Res . 11:731-753 .
- Bradford, M. 1976 . A rapid and sensitive method of
quantitation of microgram quantities of protein utilizing the principle of
protein-dye binding . Anal . Biochem . 72:248-254.
- Chipman, D., Z . Barak, and J . V . Schloss. 1998 .
Biosynthesis of 2-aceto-2-hydroxy acids: acetolactate synthases and
acetohydroxyacid synthases . Biochim . Biophys . Acta 1385:401-419.
- Cordes, C., B . Mockel, L . Eggeling, and H . Sahm. 1992 .
Cloning, organization and functional analysis of ilvA, ilvB and
ilvC genes from Corynebacterium glutamicum . Gene 112:113-116.
- De Rossi, E., R . Leva, L . Gusberti, P . Manachini, and G .
Riccardi. 1995 . Cloning, sequencing and expression of the ilvBNC
gene cluster from Streptomyces avermitilis. Gene 166:127-132.
- Eoyang, L., and P . M . Silverman. 1986 . Role of small
subunit (IlvN polypeptide) of acetohydroxyacid synthase I from Escherichia
coli K-12 in sensitivity of the enzyme to valine inhibition . J . Bacteriol.
166:901-904.
- Gollop, N., B . Damri, Z . Barak, and D . M . Chipman. 1989 .
Kinetics and mechanism of acetohydroxy acid synthase isozyme III from
Escherichia coli. Biochemistry 28:6310-6317.
- Grimminger, H., and H . E . Umbarger. 1979 . Acetohydroxy
acid synthase I of Escherichia coli: purification and properties . J .
Bacteriol . 137:846-853.
- Gusberti, L., R . Cantoni, E . De Rossi, M . Branzoni, and G .
Riccardi. 1996 . Cloning and sequencing of the ilvBNC gene cluster
from Mycobacterium avium . Gene 177:83-85.
- Henkin, T . M., B . L . Glass, and F . J . Grundy. 1992 .
Analysis of the Bacillus subtilis tyrS gene: conservation of a
regulatory sequence in multiple tRNA synthetase genes . J . Bacteriol . 174:1299-1306.
- Keilhauer, C., L . Eggeling, and H . Sahm. 1993 .
Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis
of the ilvB-ilvN-ilvC operon . J . Bacteriol . 175:5595-5603.
- Kunst, F., N . Ogasawara, I . Moszer, A . M . Albertini, G .
Alloni, V . Azevedo, M . G . Bertero, P . Bessieres, A . Bolotin, S . Borchert, R .
Borriss, L . Boursier, A . Brans, M . Braun, S . C . Brignell, S . Bron, S .
Brouillet, C . V . Bruschi, B . Caldwell, V . Capuano, N . M . Carter, S . K . Choi,
J . J . Codani, I . F . Connerton, A . Danchin, et al. 1997 . The complete
genome sequence of the gram-positive bacterium Bacillus subtilis.
Nature 390:249-256.
- Kuroda, M., T . Ohta, I . Uchiyama, T . Baba, H . Yuzawa, I .
Kobayashi, L . Cui, A . Oguchi, K . Aoki, Y . Nagai, J . Lian, T . Ito, M . Kanamori,
H . Matsumaru, A . Maruyama, H . Murakami, A . Hosoyama, Y . Mizutani-Ui, N . K .
Takahashi, T . Sawano, R . Inoue, C . Kaito, K . Sekimizu, H . Hirakawa, S . Kuhara,
S . Goto, J . Yabuzaki, M . Kanehisa, A . Yamashita, K . Oshima, K . Furuya, C .
Yoshino, T . Shiba, M . Hattori, N . Ogasawara, H . Hayashi, and K . Hiramatsu.
2001 . Whole genome sequencing of meticillin-resistant Staphylococcus
aureus. Lancet 357:1225-1240.
- Lago, C . T., G . Sannia, G . Marino, C . H . Squires, J . M .
Calvo, and M . DeFelice. 1985 . The ilvIH operon of Escherichia
coli K-12 . Identification of the gene products and recognition of the
translational start by polypeptide microsequencing . Biochim . Biophys . Acta
824:74-79.
- Mendel, S., T . Elkayam, C . Sella, M . Vyazmensky, D . M .
Chipman, and Z . Barak. 2001 . Acetohydroxyacid synthase: a proposed
structure for regulatory subunits supported by evidence from mutagenesis . J .
Mol . Biol . 307:465-477.
- Pang, S . S., and R . G . Duggleby. 1999 . Expression,
purification, characterization, and reconstitution of the large and small
subunits of yeast acetohydroxyacid synthase . Biochemistry 38:5222-5231.
- Porat, I. 2000 . Cloning and characterization of
acetohydroxy acid synthase from two thermophilic bacteria . Ph.D . thesis .
Ben-Gurion University, Beer-Sheva, Israel.
- Schloss, J . V., L . M . Ciskanik, and D . E . Van Dyk. 1988 .
Origin of the herbicide binding site of acetolactate synthase . Nature 331:360-362.
- Sella, C., O . Weinstock, Z . Barak, and D . M . Chipman.
1993 . Subunit association in acetohydroxy acid synthase isozyme III . J .
Bacteriol . 175:5339-5343.
- Singh, B . K., K . E . Nerwhouse, M . A . Stidham, and D . L .
Shaner. 1990 . Imidazolinones and acetohydroxyacid synthase from plants, p .
357-371 . In Z . Barak, D . M . Chipman, and J . V . Schloss (ed.),
Biosynthesis of branched chain amino acids . VCH, Weinheim, Germany.
- Takami, H., K . Nakasone, Y . Takaki, G . Maeno, R . Sasaki, N .
Masui, F . Fuji, C . Hirama, Y . Nakamura, N . Ogasawara, S . Kuhara, and K .
Horikoshi. 2000 . Complete genome sequence of the alkaliphilic bacterium
Bacillus halodurans and genomic sequence comparison with Bacillus
subtilis . Nucleic Acids Res . 28:4317-4331 .
- Umbarger, H . E. 1987 . Biosynthesis of the branched-chain
amino acids, p . 352-367 . In F . C . Neidhardt, J . L . Ingraham, K . B . Low,
B . Magasanik, M . Schaechter, and H . E . Umbarger (ed.), Escherichia coli
and Salmonella typhimurium: cellular and molecular biology, vol . 1 .
American Society for Microbiology, Washington, D.C.
- Vyazmensky, M., C . Sella, Z . Barak, and D . M . Chipman.
1996 . Isolation and characterization of subunits of acetohydroxy acid synthase
isozyme III and reconstitution of the holoenzyme . Biochemistry 35:10339-10346.
- Weinstock, O., C . Sella, D . M . Chipman, and Z . Barak.
1992 . Properties of subcloned subunits of bacterial acetohydroxy acid
synthases . J . Bacteriol . 174:5560-5566.
- Yadav, N., R . E . McDevitt, S . Benard, and S . C . Falco.
1986 . Single amino acid substitutions in the enzyme acetolactate synthase
confer resistance to the herbicide sulfometuron methyl . Proc . Natl . Acad . Sci .
USA 83:4418-4422.
- Zahler, S . A., N . Najimudin, D . S . Kessler, and M . A .
Vaneyar. 1990.
 -Acetolactate
synthesis by Bacillus subtilis, p . 25-32 . In Z . Barak, D . M .
Chipman, and J . V . Schloss (ed.), Biosynthesis of branched chain amino acids .
VCH, Weinheim, Germany.
- Zohar, Y., M . Einav, D . M . Chipman, and Z . Barak. 2003 .
Acetohydroxyacid synthase from Mycobacterium avium and its inhibition
by sulfonylureas and imidazolinones . Biochim . Biophys . Acta 1649:97-105.
Free Online Full-text Article
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
|
