Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us


Isr J Med Sci, 1984 Sep, 20(9), 768 - 72
A Spiroplasma tRNA gene cluster; Rogers MJ et al.; Using molecular cloning techniques, a clone containing a 7-kb insert of Spiroplasma species BC3 DNA that hybridized strongly to total labeled Spiroplasma tRNA was identified . Sequence analysis of a portion of this recombinant plasmid identified a cluster of tRNA genes . The gene order was as follows: tRNACys-tRNAArg-tRNAPro-tRNAAla-tRNAMet-tRNAIle and a portion of tRNASer All the genes encode the 3'-terminal CCA and have very high A + T and relatively long intergenic regions . An RNA polymerase promoter site was found upstream of the tRNACys gene . The tRNA gene cluster found in Spiroplasma can be compared with a similar Bacillus subtilis gene cluster, which raises interesting questions concerning gene organization and transcription.

J Gen Microbiol, 1984 Sep, 130 ( Pt 9), 2403 - 14
Characterization of the replication terminus of the Bacillus subtilis chromosome; Monteiro MJ et al.; DNA in the terminal region of the chromosome of Bacillus subtilis was labelled by a procedure in which cells in sporulation inducing conditions were pulse-labelled with {3H}thymidine and then treated with p-hydroxyphenylazouracil, an inhibitor of DNA synthesis . The labelled DNA in isolated spores yielded a small number of restriction fragments . About 14 EcoRI fragments with a total length of 80 kb were labelled in a 2.5 min pulse . A fragment of 4.0 kb had the highest specific radioactivity in terminally labelled DNA from several strains . One of these strains lacked the 120 kb prophage of SP beta that is normally integrated close to the terminus . Loss of the 120 kb prophage did not affect the point of termination which must therefore be regarded as a specific 'stop' sequence . Labelled terminus DNA has been used to identify lambda (Charon 4A) clones containing sequences derived from the terminal region . The total length of the restriction fragments present was 150 kb and adds another 90 kb to the 150 kb region mapped previously . Only one group of these sequences was present in a B . subtilis strain (CU1695) carrying a deletion spanning from SP beta to the right of the terminus and gltA . This suggests that the terminator sequence found in the wild-type can be deleted but presumably this strain has an alternative mechanism of termination.

J Bacteriol, 1984 Sep, 159(3), 811 - 9
Genes for alkaline protease and neutral protease from Bacillus amyloliquefaciens contain a large open reading frame between the regions coding for signal sequence and mature protein; Vasantha N et al.; The genes for alkaline protease (apr{BamP}) and neutral protease (npr{BamP}) from Bacillus amyloliquefaciens have been isolated and expressed in Bacillus subtilis . The DNA sequences of apr{BamP} and npr{BamP} revealed, in each case, the presence of a large open reading frame . The inferred amino acid sequence of either gene contained a signal sequence and an additional polypeptide sequence ('pro' sequence) preceding the mature protein . Based on DNA sequence, the start point of translation has been identified as amino acid residue - 107 for apr{BamP} and -221 for npr{BamP} . To demonstrate that the start point of translation of apr{BamP} in vivo is probably at codon -107, codon -103 (AAA) was changed to an ochre (TAA) by site-directed mutagenesis . Alkaline protease was produced from this ochre mutant derivative of apr{BamP} only when the host strain was Su+ . The presence of a pro sequence may be common to all of the secreted proteases from bacilli.

J Bacteriol, 1984 Sep, 159(3), 1080 - 2
Revised restriction maps of Bacillus subtilis bacteriophage phi 105 DNA; Anaguchi H et al.; Physical mapping of Bacillus subtilis temperate phage phi 105 DNA was carried out by using restriction endonucleases EcoRI, SmaI, and KpnI, and a new revised EcoRI cleavage map is presented . In addition, the EcoRI cleavage maps of six specialized transducing phages carrying sporulation genes of B . subtilis were revised.

Mycopathologia, 1984 Aug 30, 87(1-2), 43 - 9
{Antibacterial and genotoxic properties of 33 mycotoxins}; Boutibonnes P et al.; Most of the 33 fungal metabolites tested provoke: Bacterial growth inhibition of Bacillus thuringiensis similar to lethal effect of antibiotics . Positive response in the 'Rec' assay using strains of Bacillus subtilis; this fact shows that these toxins are DNA modifying agents . Enlargement of cell volume in the first bacteria species; this cell-abnormality induction resembles those obtained with mitomycin C . Correlation between elongation of cells (filamentation) and in vivo carcinogenicity of mycotoxins is discussed . The filamentation should be an expression of a perturbated DNA replication (S.O.S.-error prone repair) as the consequence of DNA damages induced by genotoxic agents (i.e . carcinogens).

Biochem Biophys Res Commun, 1984 Aug 16, 122(3), 1104 - 9
Identification of the sporulation gene spoOA product of Bacillus subtilis; Kudoh J et al.; A 2.4-kilobase fragment of the Bacillus subtilis chromosome containing the wild-type spoOA gene derived from the phi 105dspoOA+-Bc-1 transducing phage was cloned onto plasmid pBR322 in Escherichia coli . A recombinant plasmid harboring the mutant spoOA12 allele on the 2.4-kilobase insert was also constructed from the phi 105dspoOA12-1 phage DNA and pBR322 . Protein products synthesized in response to plasmid DNA in a DNA-directed cell-free system derived from E . coli were analyzed by sodium dodecyl sulfate-polyacryl-amide gel electrophoresis . A protein of approximately 27,500 daltons synthesized with the recombinant plasmid DNA harboring the wild-type spoOA gene as template was not formed with the recombinant plasmid DNA harboring the spoOA12 allele . Since the spoOA12 mutation is a nonsense mutation, we conclude that the 27.5-kilodalton protein is the product of the spoOA gene.

Nucleic Acids Res, 1984 Aug 10, 12(15), 6307 - 23
Cloning the gyrA gene of Bacillus subtilis; Lampe MF et al.; We have isolated an eight kilobase fragment of Bacillus subtilis DNA by specific integration and excision of a plasmid containing a sequence adjacent to ribosomal operon rrn O . The genetic locus of the cloned fragment was verified by linkage of the integrated vector to nearby genetic markers using both transduction and transformation . Functional gyrA activity encoded by this fragment complements E . coli gyrA mutants . Recombination between the Bacillus sequences and the E . coli chromosome did not occur . The Bacillus wild type gyrA gene, which confers sensitivity to nalidixic acid, is dominant in E . coli as is the E . coli gene . The cloned DNA precisely defines the physical location of the gyrA mutation on the B . subtilis chromosome . Since an analogous fragment from a nalidixic acid resistant strain has also been isolated, and shown to transform B . subtilis to nalidixic acid resistance, both alleles have been cloned.

J Biol Chem, 1984 Aug 10, 259(15), 9762 - 7
Utilization of a Bacillus subtilis sigma 37 promoter by Escherichia coli RNA polymerase in vivo; Wong SL et al.; The promoter region of Bacillus subtilis subtilisin E was found to be composed of two overlapping promoters with their transcription starting sites separated from each other by 15 base pairs (Wong, S.-L., Price, C . W., Goldfarb, D . S., and Doi, R . H . (1984) Proc . Natl . Acad . Sci . U.S.A . 81, 1184-1188) . At least one of the promoters is transcribed by a minor form of B . subtilis RNA polymerase with a sigma factor of 37,000 daltons . In vitro transcription analyses and in vivo studies with promoter probe plasmids pKO-1 and pCED-6 demonstrated that Escherichia coli RNA polymerase was able to initiate transcription from the subtilisin promoter cluster . S1 nuclease-mapping studies with both in vivo and in vitro transcribed RNA from E . coli and B . subtilis illustrate that E . coli can initiate transcription from both promoters with the same transcription start points as B . subtilis . The promoter strength of this promoter cluster in E . coli, as expressed in terms of galactokinase units, was 64 units and represents weak promoter activity in the E . coli system . These data indicate that either the single E . coli RNA polymerase is able to recognize the minor sigma 37 promoter or E . coli contains a hitherto unrecognized minor RNA polymerase holoenzyme which is capable of recognizing a B . subtilis sigma 37 promoter . On the other hand the B . subtilis RNA polymerase holoenzymes have been quite promoter-specific in our experiments to date.

Zentralbl Bakteriol Mikrobiol Hyg {B}, 1984 Aug, 179(4), 365 - 80
{How many biological indicators have to be tested to get reliable information on their resistance?}; Spicher G et al.; Biological indicators are used in the efficacy test of microbicidal procedures . The indicators consist of an object carrying or holding micro-organisms which exhibit resistance to microbicidal agents . The biological indicators are exposed to the procedure to be tested and afterwards examined for viable germs . If test germs are still found to grow in the cultures, the microbicidal effect of the procedure is considered as insufficient . Biological indicators are suitable for such tests only if it is known how intensive the action of the microbicide has to be to destroy the test germs . The individuals of a germ population do not die at the same time under the action of a microbicide . This phenomenon can also be observed with germs simultaneously grown as a pure culture under identical conditions . Therefore, the biological indicators do not become sterile after one and the same period of action or dose of the microbicide but within a certain period or dose range . At the beginning of this transition range, sterile biological indicators will be found very rarely . With increasing period of action or dose, the frequency of indicators carrying viable germs decreases until, eventually, hardly any biological indicators with viable germs are detectable . When samples of identical biological indicators equal in size are exposed to one and the same period of action or dose of a microbicide, the number of indicators carrying viable germs will vary from one sample to another in the transition range . The number of biological indicators that has to be exposed to the resistance test per period of action and dose, respectively, in order to obtain reliable results, can be estimated only if the regularities are known by which the findings vary from one sample to another . Twelve different batches of biological indicators were employed to determine the variation of the resistance values obtained . Spores of Bacillus subtilis served as test germs . The batches differed in the number of spores per biological indicator . The microbicide used was saturated steam of 100 degrees C with a 9 min period of action . Forty-eight samples of five indicators each were taken per batch . The number of indicators carrying viable germs (n+) varied more or less and characteristic frequency distributions were observed (Table 2, columns 3 and 4) . Afterwards, the mean relative frequency of indicators with viable germs was calculated for the different batches (Q; Table 2, column 2).(ABSTRACT TRUNCATED AT 400 WORDS)

J Appl Bacteriol, 1984 Aug, 57(1), 153 - 63
Emergence and development of resistance to antimicrobial chemicals and heat in spores of Bacillus subtilis; Gorman SP et al.; The emergence and development of chemical and thermal resistance in spores of Bacillus subtilis was examined . The chemicals studied were of the disinfectant type: glutaraldehyde, hypochlorite, hypochlorite-methanol and povidone-iodine . Growth and sporulation were followed by electron microscopy and resistance assigned to specific stages in relation to 45Ca and DPA accumulation . A sequential development of resistance was observed with thermal resistance appearing first at early Stage V corresponding to maturation of cortex and deposition of rudimentary spore coat material . Chemical resistance coincided with middle to late Stage V dependent on the chemical concerned . A progressive development of resistance was observed on prolonged incubation in sporulation medium and was affected by inclusion of lysozyme in the spore washing sequence.

J Gen Microbiol, 1984 Aug, 130 ( Pt 8), 2115 - 21
Genetic and phenotypic characterization of a cluster of mutations in the spoVA locus of Bacillus subtilis; Errington J et al.; Twenty-nine mutants blocked during stage V of sporulation have been isolated following directed mutagenesis of the lys-1 region of the Bacillus subtilis 168 chromosome . All of a sample of eight mutants tested are unaffected in sporulation marker events up to stage IV but did not produce dipicolinic acid . They produced stable 'phase white' spores that were released from the mother cell, and were partially resistant to toluene and lysozyme but sensitive to chloroform and heat . Mutation spoV A89, known to be in the lys-1 region, showed similar phenotypic characteristics . Three-factor transformation crosses and recombination indices showed that the new mutations and spoV A89 lie in a single linkage group, which maps between lys-1 and another sporulation locus, spoIIA . The size of the spoV A locus is such that it probably contains several genes, and these may be contiguous with the cluster of genes included within the spoIIA locus.

Eur J Biochem, 1984 Aug 1, 142(3), 565 - 70
Pressure dependence of thermolysin catalysis; Fukuda M et al.; A comparison of the pressure and temperature dependences of the catalytic reaction of thermolysin, a thermostable neutral protease from Bacillus thermoproteolyticus, with those of a non-thermostable neutral protease from Bacillus subtilis revealed a distinct difference in Km values of these enzymes for 3-(2-furyl)acrylyl-blocked dipeptide and tripeptide substrates, but not for Kcat . Namely, the volume changes for the binding process (delta V) for these substrates and several competitive inhibitors were -20- -30 ml/mol for thermolysin and nearly 0 ml/mol for the non-thermostable neutral protease . The enthalpy and entropy changes for the binding process were negative for thermolysin, but positive for the latter enzyme . The activation volumes (delta V not equal to) for the kcat process were 25 -35 ml/mol for both proteases, and activation enthalpy and entropy showed no significant difference between the two enzymes . The characteristic difference in the pressure and the temperature dependences seen for the binding process is discussed in relation to the thermostability of the proteases.

J Bacteriol, 1984 Aug, 159(2), 770 - 2
Order of ribosomal protein genes in the Rif cluster of Bacillus subtilis is identical to that of Escherichia coli; Dabbs ER; Mutants of Bacillus subtilis with electrophoretic variants of ribosomal protein L1, L5, L9, or L11 were used to determine the order of the genes for these proteins by transformation experiments . The proteins are homologous with Escherichia coli proteins L1, L10, L12, and L11, respectively; using the gene locus designations based on this correspondence, we determined the order of the loci to be cysA-rplK-rplA-rplJ-rplL-rpoB . The order of the last five loci was identical to that of E . coli.

J Bacteriol, 1984 Aug, 159(2), 605 - 10
Voltage clamp effects on bacterial chemotaxis; Margolin Y et al.; To examine whether or not sensory signaling in bacteria is by way of fluctuations in membrane potential, we studied the effect of clamping the potential on bacterial chemotaxis . The potential was clamped by valinomycin, a K+ -specific ionophore, in the presence of K+ . Despite the clamped potential, sensory signaling did occur: both Escherichia coli and Bacillus subtilis cells were still excitable and adaptable under these conditions . It is concluded that signaling in the excitation and adaptation steps of chemotaxis is not by way of fluctuations in the membrane potential.

Genetics, 1984 Aug, 107(4), 551 - 61
Identification of mutations associated with macrofiber formation in Bacillus subtilis; Saxe CL 3rd et al.; A search was made for the genes responsible for the production of helical macrofibers in the original collection of macrofiber-producing strains of B . subtilis . Two loci were identified: fibA, located between hisA and tag-1, and fibB, linked to cysB . fibA governs a short-lived division suppression phenomenon associated with the production of rudimentary fibers, whereas fibB appears to be responsible for a persistent division suppression and a more highly organized helical macrofiber . Both mutations are recovered from each of the original macrofiber-producing strains which also carried the div IV-B1 mutation responsible for minicell production . The latter mutation by itself is not sufficient, however, for the production of macrofibers . Other known mutations leading to division suppression that map in the same region are shown not to be allelic to fibA or fibB . Neither fib locus appears to be responsible for helix hand determination.

Appl Environ Microbiol, 1984 Aug, 48(2), 280 - 4
Characterization of Bacillus subtilis DSM704 and its production of 1-deoxynojirimycin; Stein DC et al.; A Bacillus subtilis strain, DSM704, was characterized by genetic means, and its production of a human intestinal sucrase inhibitor, 1-deoxynojirimycin, was described . Synthesis of this compound is detected concomitant with the detection of heat-resistant spores . The amount of 1-deoxynojirimycin produced is highly dependent on the carbon source, with growth on substrates metabolized via glycolysis giving the greatest amount of production (up to 1 mg/ml) . 1-Deoxynojirimycin appears to be nonmetabolizable by the producing strain in that it cannot serve as a sole carbon or nitrogen source.

Proc Natl Acad Sci U S A, 1984 Aug, 81(16), 5189 - 93
Generation of deletions in pneumococcal mal genes cloned in Bacillus subtilis; Lopez P et al.; The pneumococcal recombinant plasmid pLS70, which contains two strong promoters for transcription of the malM and malX genes, is unstable when transferred to Bacillus subtilis, and it gives rise to deleted derivatives . Analysis of proteins produced by the deleted plasmids and restriction mapping of 29 different deletions showed that stabilization in B . subtilis was accompanied by deletions affecting both promoters . Plasmids containing even a single strong promoter were at a selective disadvantage . Nucleotide sequences surrounding the deletions in 10 plasmids were determined . Six different deletions occurred between directly repeated sequences of 3-13 base pairs in length, presumably by a recombination mechanism involving short homologies . Four deletions occurred between sites not contained within repeated sequences . A weak but significant similarity of an 11-base sequence was found surrounding these deletions and the corresponding points of junction in the progenitor plasmids . It is suggested that this sequence may be the recognition site for a topoisomerase-like enzyme that can produce deletions.

J Gen Microbiol, 1984 Aug, 130 ( Pt 8), 2165 - 7
Restriction enzyme analysis of Bacillus subtilis bacteriophage phi 105 DNA; Bugaichuk UD et al.; The recognition sites on phi 105 DNA for the restriction endonucleases EcoRI, Bg/II, SmaI, KpnI, SstI, SalI, XhoI, NcoI, PstI, HindIII, ClaI, EcoRV and MluI have been mapped . The sites for EcoRI are shown to be different from those published earlier . The DNA from phi 105 contains no recognition sites for the endonucleases BamHI and XbaI.

J Gen Microbiol, 1984 Aug, 130 ( Pt 8), 2155 - 64
Construction and characterization of recombinant phage phi 105 d(Cmrmet) for cloning in Bacillus subtilis; Jenkinson HF et al.; A 1.6 kb fragment of DNA of plasmid pBD64, obtained after partial digestion with HpaII, carrying a chloramphenicol-resistance determinant and a single site for the enzyme Bg/II, was inserted into the genome of defective phage phi 105 d/ys . Two types of phage were subsequently isolated and both transduced cells of Bacillus subtilis to chloramphenicol resistance . One type contained 26 kb and the other 32 kb of DNA . Bacillus subtilis chromosomal DNA fragments generated by cleavage with Bg/II were ligated into the unique Bg/II site within the smaller phage genome . A specialized transducing phage was isolated which carried the metC gene on a 6 kb Bg/II fragment . This phage, denoted phi 105 d(Cmrmet), transduced B . subtilis strain MB79 pheA12 metC3 to Met+ and to chloramphenicol resistance, and the metC3 mutation was complemented in transductants.

J Gen Microbiol, 1984 Aug, 130 ( Pt 8), 2147 - 53
Nucleotide sequence of sporulation locus spoIIA in Bacillus subtilis; Fort P et al.; We have determined a sequence of 2073 bp from two recombinant plasmids carrying the whole spoIIA locus from Bacillus subtilis, the expression of which is required for spore formation . The sequence contains three long open reading frames (ORFs), each of them being preceded by a ribosome binding site . These three putative proteins (mol . wts 13100, 16300 and 22200) are likely to be expressed and are probably encoded on the same mRNA . The stop codon of ORF1 overlaps with the start codon of ORF2 suggesting that there might be translational coupling between the two ORFs . Although some known promoter sequences were found, the only one upstream from the first open reading frame is about 260 bp from it.

J Gen Microbiol, 1984 Aug, 130 ( Pt 8), 2137 - 45
Cloning of the Bacillus subtilis spoIIA and spoV A loci in phage phi 105DI:1t; Savva D et al.; A 6.95 kb HindIII-generated DNA fragment from Bacillus subtilis 168 was inserted into the DNA of phage phi 105DI:1t . The recombinant phage (phi 105DS1) contained DNA of 33.8 kb as compared with 35.2 kb for phi 105DI:1t and 39.2 kb for the wild-type phage . In the presence of helper phage, phi 105DS1 complemented both spoIIA and spoV A mutations in B . subtilis.

J Gen Microbiol, 1984 Aug, 130 ( Pt 8), 2123 - 36
Use of integrational plasmid vectors to demonstrate the polycistronic nature of a transcriptional unit (spoIIA) required for sporulation of Bacillus subtilis; Piggot PJ et al.; Plasmids carrying different portions of the polycistronic spoIIA locus, and unable to replicate autonomously in Bacillus subtilis, were able to transform a Spo+ B . subtilis strain, BR151, for the plasmid-determined chloramphenicol resistance by Campbell-like insertion into the region of homology on the chromosome . Two such plasmids, pPP35 and pPP36, yielded Spo- transformants, indicating that the cloned regions of these plasmids were entirely within the chromosomal spoIIA transcriptional unit . The cloned regions overlapped the end of a known spoIIA cistron, so that the transcriptional unit was larger than this cistron, and was polycistronic . This is the first demonstration of such a polycistronic sporulation transcriptional unit . The DNA sequence of the region has now been determined (given in an accompanying paper) and suggests a transcriptional unit with three open reading frames . Two other plasmids yielded Spo+ transformants of BR151, and these define the outer limits of the transcriptional unit . The adjacent sporulation locus identified by the spoV A89 mutation was not part of the same transcriptional unit.

Biochemistry, 1984 Jul 31, 23(16), 3659 - 62
Base pairing in Bacillus subtilis ribosomal 5S RNA as measured by ultraviolet absorption and Fourier-transform infrared spectrometry; Chang LH et al.; Ultraviolet (260 and 280 nm) and Fourier-transform infrared (FT-IR) spectra of Bacillus subtilis ribosomal 5S RNA have been acquired between 20 and 90 degrees C . In the presence of added Mg2+, the average UV melting midpoint, Tm, is 60 (A260) or 62 degrees C (A280), resolving into two components (Tm = 54 and 68 degrees C) . In the presence of 10 mM Mg2+, the normalized A260 increases by about 5%, and the average Tm increases to 70 degrees C (A260 or A280), resolving into components at 63 and 73 degrees C at 260 nm but not resolved at 280 nm . From the difference of the 5S RNA FT-IR spectra between 90 and 30 degrees C, the number of base pairs in B . subtilis 5S RNA was determined by the procedure outlined in the accompanying paper {Li, S.-J., Burkey, K . O., Luoma, G . A., Alben, J . O., & Marshall, A . G . (1984) Biochemistry (preceding paper in this issue)} . Addition of 10 mM Mg2+ increases the number of A-U pairs by 1 (from 11 to 12) and the number of G-C pairs by 2 (from 15 to 17) . FT-IR melting curve midpoints show that addition of Mg2+ increases the melting point for both A-U and G-C pairs in B . subtilis 5S RNA . The A-U pairs melt before G-C pairs (56 vs . 64 degrees C) in the absence of Mg2+, but both types of pairs melt at the same temperature (67 vs . 70 degrees C) in the presence of Mg2+.(ABSTRACT TRUNCATED AT 250 WORDS)

Biochem Biophys Res Commun, 1984 Jul 18, 122(1), 175 - 83
Cloning in Bacillus subtilis of an extremely thermostable alpha amylase: comparison with other cloned heatstable alpha amylases; Piggott RP et al.; A heatstable alpha amylase gene was shotgun cloned from Bacillus licheniformis RPO1 into Bacillus subtilis . Restriction endonuclease analysis of the recombinant plasmid revealed a map which was identical to a previously cloned alpha amylase from B . licheniformis FDO2 and very similar to the restriction map of a high temperature amylase from Bacillus coagulans . The thermostability and temperature optimum of the cloned alpha amylase was measureably different from those of the previously reported cloned alpha amylases.

Nucleic Acids Res, 1984 Jul 11, 12(13), 5307 - 19
Length and structural effect of signal peptides derived from Bacillus subtilis alpha-amylase on secretion of Escherichia coli beta-lactamase in B . subtilis cells; Ohmura K et al.; The precursor of Bacillus subtilis alpha-amylase contains an NH2-terminal extension of 41 amino acid residues as the signal sequence . The E . coli beta-lactamase structural gene was fused with the DNA for the promoter and signal sequence regions . Activity of beta-lactamase was expressed and more than 95% of the activity was secreted into the culture medium . DNA fragments coding for short signal sequences 28, 31, and 33 amino acids from the initiator Met were prepared and fused with the beta-lactamase structural gene . The sequences of 31 and 33 amino acid residues with Ala COOH-terminal amino acid were able to secrete active beta-lactamase from B . subtilis cells . However beta-lactamase was not secreted into the culture medium by the shorter signal sequence of 28 amino acid residues, which was not cleaved . Molecular weight analysis of the extracellular and cell-bound beta-lactamase suggested that the signal peptide of B . subtilis alpha-amylase was the first 31 amino acids from the initiator Met . The significance of these results was discussed in relation to the predicted secondary structure of the signal sequences.

J Biol Chem, 1984 Jul 10, 259(13), 8478 - 84
Glutamine nucleotide sequence of Saccharomyces cerevisiae ADE4 encoding phosphoribosylpyrophosphate amidotransferase; Mantsala P et al.; Saccharomyces cerevisiae gene ADE4 encoding glutamine phosphoribosylpyrophosphate amidotransferase (amidophosphoribosyltransferase) has been cloned by complementation of an ade4 auxotroph . The nucleotide sequence of ADE4 along with upstream and downstream flanking sequences was determined . The ADE4 structural gene consists of 1530 base pairs from which a 510-amino acid translation product, Mr = 56,691, was deduced . Yeast amidophosphoribosyltransferase is homologous to the enzymes from Escherichia coli and Bacillus subtilis . The active site cysteine residue in the bacterial amidophosphoribosyltransferases which functions in glutamine amide transfer is conserved in the yeast enzyme . Yeast amidophosphoribosyltransferase does not contain the previously deduced sequence required for binding of a {4Fe-4S} center indicating that a {4Fe-4S} center is an unlikely component of the yeast enzyme . Amidophosphoribosyltransferase was stable in growing and nongrowing cells and was not inactivated or degraded . Thus in the group, S . cerevisiae, E . coli, B . subtilis, the content of a {4Fe-4S} cluster in amidophosphoribosyltransferase correlates with a mechanism for oxygen-dependent inactivation of the enzyme . Northern blots demonstrate that ADE4 expression is transcriptionally regulated . The 5' end of the ADE4 mRNA was identified by nuclease S1 mapping.

J Biol Chem, 1984 Jul 10, 259(13), 8619 - 25
Overlapping promoters transcribed by bacillus subtilis sigma 55 and sigma 37 RNA polymerase holoenzymes during growth and stationary phases; Wang PZ et al.; A 471-base pair HindIII DNA fragment of Bacillus subtilis contains two overlapping promoters which are recognized in vitro by sigma 55- and sigma 37-containing RNA polymerase holoenzymes from B . subtilis . In vitro transcript analyses and S1 nuclease mapping experiments with in vivo RNA indicate that both enzymes initiate transcription from the same putative +1 site . Physiological studies with the promoter-containing DNA fragment inserted into the expression probe plasmid pCED6 and quantitative S1 nuclease mapping experiments with RNA isolated from various stages of growth indicate that expression from these overlapping promoters is greater during the early stationary phase than during growth . We propose that the cryptic gene controlled by these promoters is transcribed by the sigma 55 enzyme during growth and by the sigma 37 enzyme during early stationary phase.

J Mol Biol, 1984 Jul 5, 176(3), 333 - 48
A promoter whose utilization is temporally regulated during sporulation in Bacillus subtilis; Stephens MA et al.; The formation of endospores in the Gram-positive bacterium Bacillus subtilis proceeds according to a temporally ordered program of gene activation . To investigate timing mechanisms in sporulation gene expression, we have isolated and sequenced the promoter region for a B . subtilis gene known as 0.3 kb whose transcription is switched on at about stage III of development . The 5' terminus of the 0.3 kb mRNA was mapped by the S1 nuclease procedure to a position just upstream from its apparent ribosome binding site and initiation codon and just downstream from the transcription termination site for an adjacent gene . This information enabled us to construct a transcriptional fusion in which the 5' region of the 0.3 kb gene was joined to the lacZ gene of Escherichia coli . When introduced into cells of B . subtilis, the 0.3 kb-lacZ fusion caused the synthesis of a fusion-specified RNA that originated from within the 0.3 kb promoter region and extended into the adjacent E . coli DNA, and the induction of beta-galactosidase synthesis at the third to fourth hour of sporulation . Enzyme synthesis required the 0.3 kb promoter, since a deletion of the 5' region of the 0.3 kb gene in the transcription fusion eliminated the production of beta-galactosidase . Induction of the 0.3 kb-lacZ fusion was under developmental control, since the production of beta-galactosidase was blocked or substantially impaired by chromosomal mutations in the sporulation genes spoOB, spoIIA, spoIIE and spoIIIE, but not by a spoIIC mutation . We conclude that the 0.3 kb gene promoter is subject to a developmental clock, which delays its utilization until an intermediate stage of sporulation, and discuss models for how the timing of gene expression is regulated.

Gene, 1984 Jul-Aug, 29(1-2), 135 - 43
Cloning and mapping of the dihydrofolate reductase gene of Bacillus subtilis; Myoda TT et al.; The structural gene for dihydrofolate reductase (dfrA) from the Bacillus subtilis 168 chromosome has been cloned, along with the thyB gene, on a 4.5-kb insert contained on chimeric plasmid pER1 . The presence of the dfrA gene on pER1 was demonstrated by showing that: (i) transformation of Escherichia coli strains RUE10(Thy-) and RUE11(Thy+) with pER1 resulted in a 60 to 130-fold increase in dihydrofolate reductase (DFRase) activity with a turnover number characteristic of that of B . subtilis and (ii) pER1-mediated transformation of trimethoprim-resistant E . coli strain D05, which overproduced a DFRase with a decreased affinity for trimethoprim, resulted in a 41-fold increase in DFRase activity with an affinity for trimethoprim similar to that of the B . subtilis enzyme . The dfrA gene was mapped to the 200 degrees region of the B . subtilis chromosome, and the gene order was established as thyB dfrA ilvA . Furthermore, the dfrA gene was shown to be linked closely (95-99% cotransformation) to the thyB gene.

J Gen Microbiol, 1984 Jul, 130 ( Pt 7), 1613 - 21
Gene amplification in Bacillus subtilis; Young M; A strain of Bacillus subtilis that carries in its genome a staphylococcal chloramphenicol acetyltransferase gene (from pC194) responds to growth at different concentrations of chloramphenicol by an alteration in the number of copies per genome of the sequences encoding the gene . Growth at 20 micrograms chloramphenicol ml-1 results in a 15-fold amplification of the sequences, whereas growth in the absence of chloramphenicol results in their loss . The mechanism of in situ amplification probably has much in common with that involved in 'R factor transitioning' . The hybridization procedures that have been used for accurately determining the number of copies of the amplified DNA sequences are potentially useful for plasmid copy number determination . The findings reported here also provide a potentially useful alternative to more conventional cloning strategies that are based on autonomous plasmids in B . subtilis . The particular advantages that can be envisaged include enhanced stability of the cloned sequences and control of the number of copies that are present.

Genetika, 1984 Jul, 20(7), 1061 - 6
{Cloning of the Bacillus subtilis DNA fragment containing the genes for lysine and riboflavin biosynthesis}; Okunev OV et al.; The SalI fragment of chromosomal DNA of Bacillus subtilis carrying the gene for lysine biosynthesis and the regulatory operator region (ribO) from the riboflavin gene was cloned into Escherichia coli cells . This fragment was shown to contain the gene coding for lysine synthesizing enzyme . Localization of this gene in Bac . subtili was determined . New plasmids pLRS33 and pLRB4 were constructed using pBR322; they carry a fragment homologous to pLP102 plasmid containing the operon for riboflavin biosynthesis.

J Bacteriol, 1984 Jul, 159(1), 243 - 50
Regulation of glycerol uptake by the phosphoenolpyruvate-sugar phosphotransferase system in Bacillus subtilis; Reizer J et al.; Enteric bacteria have been previously shown to regulate the uptake of certain carbohydrates (lactose, maltose, and glycerol) by an allosteric mechanism involving the catalytic activities of the phosphoenolpyruvate-sugar phosphotransferase system . In the present studies, a ptsI mutant of Bacillus subtilis, possessing a thermosensitive enzyme I of the phosphotransferase system, was used to gain evidence for a similar regulatory mechanism in a gram-positive bacterium . Thermoinactivation of enzyme I resulted in the loss of methyl alpha-glucoside uptake activity and enhanced sensitivity of glycerol uptake to inhibition by sugar substrates of the phosphotransferase system . The concentration of the inhibiting sugar which half maximally blocked glycerol uptake was directly related to residual enzyme I activity . Each sugar substrate of the phosphotransferase system inhibited glycerol uptake provided that the enzyme II specific for that sugar was induced to a sufficiently high level . The results support the conclusion that the phosphotransferase system regulates glycerol uptake in B . subtilis and perhaps in other gram-positive bacteria.

J Bacteriol, 1984 Jul, 159(1), 228 - 32
New mutation affecting the synthesis of some membrane proteins and sporulation in Bacillus subtilis; Matsuzaki S et al.; A new mutation, mpo, which affects the synthesis of some membrane proteins and sporulation in Bacillus subtilis was identified . The mpo mutation was tightly linked to the overproduction of membrane proteins MP32 and MP18 (molecular weights of 32,000 and 18,000, respectively) and the temperature-sensitive sporulation phenotype . Genetic analysis showed that the mpo mutation maps between the spoIIIB and lys loci.

Gene, 1984 Jul-Aug, 29(1-2), 51 - 61
Restriction and modification in Bacillus subtilis: nucleotide sequence, functional organization and product of the DNA methyltransferase gene of bacteriophage SPR; Buhk HJ et al.; Bacillus subtilis phage SPR codes for a DNA methyltransferase (Mtase) which methylates the 5' cytosine in the sequence GGCC and both cytosines in the sequence CCGG . A 2126-bp fragment of SPR DNA containing the Mtase gene has been sequenced . This fragment has only one significant open reading frame of 1347 bp, which corresponds to the Mtase gene . Within the sequence the Mtase promoter has been defined by S1 mapping . The size of the SPR Mtase predicted from the deduced amino acid composition is 49.9 kDal . This is in agreement with both the Mr of the purified enzyme and with that of the SPR Mtase gene product identified here by minicell technique . Base changes leading to mutants affected in Mtase activity were localized within the Mtase gene.

Gene, 1984 Jul-Aug, 29(1-2), 33 - 40
Cloning and expression of gene 2, required for the protein-primed initiation of the Bacillus subtilis phage phi 29 DNA replication; Blanco L et al.; A phi 29 DNA fragment containing gene 2, coding for a phi 29-specific DNA polymerase required for the formation of the terminal protein p3-dAMP initiation complex, the first step in phi 29 DNA replication, has been cloned in plasmid pPLc28 under the control of the pL promoter of bacteriophage lambda . Four polypeptides of Mr 68 000, 5800 and 3400 and less than 2000 were labelled with {35S}methionine after heat induction . The protein of Mr 68 000 had the size expected for protein p2 and it accounted for about 2% of the de novo synthesized protein . Protein p2 synthesized in Escherichia coli was shown to be stable and biologically active . Its enzymatic activity could be assayed by the in vitro formation of the protein p3-dAMP initiation complex when complemented with extracts from Bacillus subtilis infected with a phi 29sus2 mutant or with extracts from E . coli harbouring gene 3-containing recombinant plasmids . Moreover, protein p2-containing E . coli extracts could catalyze the initiation reaction in vitro when complemented with highly purified protein p3.

Gene, 1984 Jul-Aug, 29(1-2), 21 - 6
New shuttle vectors for Bacillus subtilis and Escherichia coli which allow rapid detection of inserted fragments; Sullivan MA et al.; Two new shuttle vectors have been constructed by fusing the Escherichia coli plasmid pUC9 with the Staphylococcus aureus plasmids pU110 and pC194 . The resulting hybrids replicate in both E . coli and Bacillus subtilis and contain seven restriction sites within a part of the lacZ gene . Insertion of foreign DNA into those sites can be easily detected in E . coli and hybrid plasmids can subsequently be transformed into B . subtilis.

Gene, 1984 Jul-Aug, 29(1-2), 11 - 9
Convergent transcription of the Escherichia coli hisG gene cloned in Bacillus subtilis stops in the vicinity of the attenuator; Ferretti L et al.; A 5300-bp DNA segment containing the promoter, the attenuator and the first gene (hisG) of the Escherichia coli his operon has been inserted into an interspecific E . coli-Bacillus subtilis plasmid vector, pHV14 . The resulting plasmid pPV48 restores the His+ phenotype to an E . coli hisG mutant, but fails to do so to a corresponding B . subtilis mutant . Experiments aimed at localizing the block to this heterologous expression in B . subtilis have shown that the enzymatic activity of the hisG+ gene product is neither detectable nor inhibited in crude extracts of B . subtilis cells harboring pPV48 . Furthermore, electron microscopic, Southern blot and S1 mapping analysis of the transcripts produced in vitro and in vivo by B . subtilis RNA polymerase indicate that the hisG+ region is transcribed, but that the transcripts initiate at sites different from the his promoter, converge towards, and terminate in the vicinity of the attenuator.

Biochemistry, 1984 Jun 5, 23(12), 2600 - 6
In vitro methylation and demethylation of methyl-accepting chemotaxis proteins in Bacillus subtilis; Goldman DJ et al.; Bacillus subtilis responds to attractants by demethylating a group of integral membrane proteins referred to as methyl-accepting chemotaxis proteins (MCPs) . We have studied the methylation and demethylation of these proteins in an in vitro system, consisting of membrane vesicles, and purified methyltransferase and methylesterase . The chemoattractant aspartate was found to inhibit methylation and stimulate demethylation of MCPs . Escherichia coli radiolabeled membranes in the presence of B . subtilis enzyme do not respond to aspartate by an increase demethylation rate . We also report that B . subtilis MCPs are multiply methylated, demethylation resulting in slower migrating proteins on sodium dodecyl sulfate-polyacrylamide gels.

Chemioterapia, 1984 Jun, 3(3), 152 - 5
Bacillus subtilis spores as a natural pro-host oral agent . Preliminary data in children; Novelli A et al.; The commercial preparation of Bacillus subtilis spores may be considered within the classification of biological response modifiers (BRM's) and included among exogenous natural substances . Recently we decided to study the effect of a long-term B . subtilis spores oral treatment in children suffering from recurrent infectious diseases of the respiratory tract . Fifty-three children 5-9 years old have been studied . The clinical valuative parameter was the number of days of absence from school during a 4-month period . In another group of 12 diseased children, mean age 5.5 yrs we recently initiated a laboratory immunological evaluation of peripheral lymphomonocytes in relation to an oral treatment with B . subtilis spores for at least 2 months . Our results show that B . subtilis spore therapy significantly reduced the frequency of respiratory tract infections in the group of treated children . In addition, preliminary immunological laboratory evaluation demonstrated a complete return to the normal lymphomonocyte status after at least 2 months of treatment with B . subtilis spores.

Int J Radiat Biol Relat Stud Phys Chem Med, 1984 Jun, 45(6), 615 - 26
Effects of oxygen and sulphydryl-containing compounds on irradiated transforming DNA . II . Glutathione, cysteine and cysteamine; Held KD et al.; This paper extends our earlier observations on the effects of the sulphydryl (SH)-containing compound dithiothreitol (DTT) on the radiation response of Bacillus subtilis transforming DNA to three other SH-containing compounds-cysteamine, cysteine and glutathione (GSH) . In general, all four compounds protect transforming DNA in a manner which is dependent on gassing conditions . In O2, the protection is consistent with the scavenging of OH radicals by the SH compounds, but in N2 there is additional protection which may be due to hydrogen atom donation from the SH compound to radiation-induced DNA lesions, a process which is blocked by O2 . This additional protection in N2 results in an increase in the ratio of inactivation in the absence and presence of oxygen with increasing SH concentration to a maximum followed by a decrease at high SH concentrations . The maximum value of the ratio and the SH concentration at which it occurs depend on the SH compound . In particular, GSH appears to be significantly less efficient in the hydrogen-donation repair reaction with transforming DNA than are the other three SH compounds . Furthermore, on the basis of our results, we postulate the existence of a damage fixation process which occurs in the absence of O2, in competition with damage repair by SH compounds, and that this anoxic damage fixation occurs at a rate not less than 300 s-1 . We also demonstrate here that the damage fixing reaction of O2 with transforming DNA radicals proceeds 200-fold faster than the competing repair reaction by hydrogen-donation from DTT.

Proc Natl Acad Sci U S A, 1984 Jun, 81(11), 3562 - 6
Twisted states of Bacillus subtilis macrofibers reflect structural states of the cell wall; Mendelson NH et al.; Static and dynamic studies of helical Bacillus subtilis macrofibers reveal that a spectrum of twisted states exists ranging from tight left-handed structures with twist equal to approximately equal to 40 left turns per mm to tight right-handed structures with twist equal to 57 right turns per mm . In the lytic-deficient strain FJ7 , twist varies as a function of growth temperature above or below 39 degrees C, where there is zero twist . The relationship between the temperature (below 39 degrees C) at which right-hand structures are produced to the time it takes for them to begin the inversion process in which they become left-handed following transfer to 48 degrees C reveals that structures with less twist are more rapidly converted to left-handedness than are those with higher values of twist . The initial response of live macrofibers to digestion by lysozyme consists of "relaxation" motions in which the twist of both left- and right-handed structures changes towards the right-hand end of the spectrum . The rate of relaxation is approximately equal to 5-fold higher at the left-hand end than at the right-hand end . These findings suggest that cell wall polymers can assume a range of structural states during helical growth and that these determine the quantitative aspects of macrofiber shape as well as the sensitivity of walls to attack by lysozyme.

Proc Natl Acad Sci U S A, 1984 Jun, 81(11), 3457 - 60
Selective expression of a plasmid cat gene at a late stage of Bacillus subtilis sporulation; Mongkolsuk S et al.; The cat-86 gene in plasmid pPL603 specifies chloramphenicol acetyltransferase (CAT) and is selectively expressed in Bacillus subtilis at a stage in sporulation in which internal spores are first observed (approximately T8) . The gene is unexpressed in vegetatively growing cells . cat-86 expression and spore formation are both blocked when cells are grown in excess glucose . cat-86 expression at T8 is due to selective transcription of the gene, since cat-86 mRNA is undetectable in vegetatively growing cells but is readily demonstrated in sporulating cells . The transcription start site for cat-86 mRNA from sporulating cells is within a 203-base-pair restriction fragment designated P1, which is located upstream from the cat coding region on pPL603 . Deletion of P1 from pPL603 eliminates the sporulation -associated expression of cat-86 . Host sporulation genes, whose function is absolutely required for cat-86 expression at T8, include six early sporulation, spo0 , genes and spoIIE . Therefore, pPL603 provides a novel system in which the in vivo expression of a known, plasmid-linked gene is dependent on sporulation-specific changes in B . subtilis.

J Bacteriol, 1984 Jun, 158(3), 990 - 6
N-acetylmannosaminyl(1----4)N-acetylglucosamine, a linkage unit between glycerol teichoic acid and peptidoglycan in cell walls of several Bacillus strains; Kaya S et al.; The structure of teichoic acid-glycopeptide complexes isolated from lysozyme digests of cell walls of Bacillus subtilis (four strains) and Bacillus licheniformis (one strain) was studied to obtain information on the structural relationship between glycerol teichoic acids and their linkage saccharides . Each preparation of the complexes contained equimolar amounts of muramic acid 6-phosphate and mannosamine in addition to glycopeptide components and glycerol teichoic acid components characteristic of the strain . Upon treatment with 47% hydrogen fluoride, these preparations gave, in common, a hexosamine-containing disaccharide, which was identified as N- acetylmannosaminyl (1----4) N-acetylglucosamine, along with large amounts of glycosylglycerols presumed to be the dephosphorylated repeating units of teichoic acid chains . The glycosylglycerol obtained from each bacterial strain was identified as follows: B . subtilis AHU 1392, glucosyl alpha (1----2)glycerol; B . subtilis AHU 1235, glucosyl beta(1----2) glycerol; B . subtilis AHU 1035 and AHU 1037, glucosyl alpha (1----6)galactosyl alpha (1----1 or 3)glycerol; B . licheniformis AHU 1371, galactosyl alpha (1----2)glycerol . By means of Smith degradation, the galactose residues in the teichoic acid-glycopeptide complexes from B . subtilis AHU 1035 and AHU 1037 and B . licheniformis AHU 1371 were shown to be involved in the backbone chains of the teichoic acid moieties . Thus, the glycerol teichoic acids in the cell walls of five bacterial strains seem to be joined to peptidoglycan through a common linkage disaccharide, N- acetylmannosaminyl (1----4)N-acetylglucosamine, irrespective of the structural diversity in the glycosidic branches and backbone chains.

J Bacteriol, 1984 Jun, 158(3), 884 - 9
Effect of purine and pyrimidine limitations on RNA synthesis in Bacillus subtilis; Vasantha N et al.; The effects of varying the intracellular levels of GTP or UTP on the rate of RNA synthesis in Bacillus subtilis were studied . The levels of these nucleotides were manipulated by pyrimidine limitation in a pyr auxotroph, by purine limitation in a pur auxotroph, or by the addition of decoyinine , which specifically inhibits GMP synthesis . Decreased levels of UTP and GTP were accompanied by dramatically decreased synthesis and accumulation of stable RNAs (tRNA and rRNA), but mRNA synthesis was less affected . However, sporulation was initiated only when the intracellular level of GTP decreased.

J Bacteriol, 1984 Jun, 158(3), 1182 - 7
Helical macrofiber formation in Bacillus subtilis: inhibition by penicillin G; Zaritsky A et al.; The folding process required for helical macrofiber formation after the outgrowth of Bacillus subtilis spores was found to be blocked by very low concentrations of penicillin G (1 to 3 ng/ml) . Under such conditions, growth and septation without cell separation resulted in characteristic disorganized multicellular structures . Higher concentrations (4 and 10 ng/ml) were needed to inhibit spore outgrowth and vegetative growth, respectively.

Virology, 1984 Jun, 135(2), 555 - 60
Ribonucleoside triphosphate concentration-dependent termination of bacteriophage SP01 transcription in vitro by Bacillus subtilis RNA polymerase; Brennan SM; Several sites specifying transcription termination in the bacteriophage SP01 terminal repeat have recently been located and characterized . Some of these were identified as partial terminators . Further characterization of three of the partial terminators leads to the conclusion that they are not sites of inefficient transcriptional termination by Bacillus subtilis RNA polymerase . Rather, these are sites where termination is either completely efficient or fails to occur at all, depending upon the ribonucleoside triphosphate (rNTP) concentration in the reaction mixture . The threshold rNTP concentration, above which termination will not occur, is the same for two of the terminators studied here and different for the third.

J Bacteriol, 1984 Jun, 158(3), 784 - 90
Regulatory regions that control expression of two chloramphenicol-inducible cat genes cloned in Bacillus subtilis; Duvall EJ et al.; Plasmid pPL603 is a promoter cloning vector for Bacillus subtilis and consists of a 1.1-kilobase fragment of Bacillus pumilus DNA inserted between the EcoRI and BamHI sites of pUB110 . The gene cat-86, specifying chloramphenicol-inducible chloramphenicol acetyltransferase, is located on the 1.1-kilobase cloned DNA . When pPL603 is present in B . subtilis, cat-86 is unexpressed during vegetative growth but expressed during sporulation . The regulation of cat-86 in pPL603 is due to sequences within two restriction fragments, designated P1 and R1, that precede the main coding portion of the gene . The P1 fragment promotes transcription of cat-86 only during sporulation, whereas the adjacent R1 fragment lacks promoter function but contains sequences essential to chloramphenicol inducibility . A second B . pumilus gene, cat-66, was cloned in B . subtilis and is expressed throughout the vegetative growth and sporulation cycle . The cat-66 coding region is preceded by two adjacent restriction fragments designated as P2 and R2 . P1 and P2 are identical in size and share 95% conservation of base sequence . R1 and R2 are also identical in size and share 91% conservation of base sequence . Fragment substitution experiments demonstrate that R2 can functionally replace R1 . The substitution of P2 for P1 promotes cat-86 expression throughout vegetative growth and sporulation . Analysis of a derivative of pPL603 in which P2 has replaced P1 demonstrates that P2 promotes transcription of cat-86 during vegetative growth and that P2 contains the start site for transcription of cat-86 . Thus, P1 and P2 differ strikingly in vegetative promoter function, yet they differ by single-base substitutions at only 11 positions of 203.

J Bacteriol, 1984 Jun, 158(3), 1054 - 60
Molecular cloning of a major cell wall protein gene from protein-producing Bacillus brevis 47 and its expression in Escherichia coli and Bacillus subtilis; Tsukagoshi N et al.; Bacillus brevis 47 contains two major cell wall proteins . Each protein forms a hexagonal array in the cell wall . A 4.8-kilobase HindIII fragment of B . brevis 47 DNA cloned into Escherichia coli with pBR322 as a vector directed the synthesis of polypeptides cross-reactive with antibody to the middle wall protein . A 700-base-pair BamHI-HpaI fragment was shown to be the essential region for the synthesis of immunoreactive polypeptides . Furthermore, this fragment appeared to contain the promoter activity . The 3.5-kilobase BamHI fragment covering the essential region as well as its downstream sequence was subcloned into the corresponding restriction site of pUB110 by using Bacillus subtilis as the cloning host . Both E . coli and B . subtilis carrying the cloned DNA synthesized several immunoreactive polypeptides which were mainly found in the cytoplasm . B . subtilis secreted polypeptides cross-reactive with antibody to the middle wall protein . These extracellular polypeptides were degraded upon prolonged culture.

J Gen Microbiol, 1984 Jun, 130 ( Pt 6), 1577 - 86
The isolation of lambda phage carrying DNA from the histidine and isoleucine-valine regions of the Bacillus subtilis chromosome; Walton DA et al.; From a lambda gtWES library of the chromosome of Bacillus subtilis, phages carrying DNA from the hisA and ilv-leu regions were isolated . They were identified by their ability to form complementing plaques on hisB, ilvC or leuB mutants of Escherichia coli K12 under selective conditions and in the presence of a helper phage . The his phages complemented E . coli his A, B or D mutations and could transform seven mutations in the hisA region of the B . subtilis chromosome; each carried a single EcoR1 insert of about 8.2 kb . Phages complementing E . coli ilvC or leuB mutations and carrying the equivalent B . subtilis genes ilvC and leuC transformed a range of mutations in the B . subtilis ilv-leu region . The distribution of genetic markers carried by the phages suggests that the entire ilv-leu cluster from az1A through leuD is covered in the collection of phages obtained and is carried in three EcoR1 restriction fragments of approximately 6.7, 4.7 and 2.85 kb.

Gene, 1984 Jun, 28(3), 301 - 10
Transfer and expression of recombinant plasmids carrying pneumococcal mal genes in Bacillus subtilis; Espinosa M et al.; The pneumococcal mal recombinant plasmid pLS70, which carries two strong promoters for transcription, could not be transferred and maintained intact in Bacillus subtilis . Although it could be established at low frequency, pLS70 was unstable and was rapidly replaced by deleted forms of the plasmid . A deleted derivative plasmid, pLS69, could be transferred at high frequency and maintained intact . In pLS69 the deletion reduces function of both the malM (amylomaltase) and malX (X-fragment) promoters . This mutant mal plasmid still codes for an intact amylomaltase, and the enzyme is produced in both S . pneumoniae and B . subtilis . The amylomaltase, which is inducible by maltose in S . pneumoniae, is synthesized constitutively in B . subtilis and is localized in the cytosol . Although pLS69 enables S . pneumoniae to grow with maltose, the plasmid did not enhance the ability of B . subtilis to use this sugar, presumably because the latter does not transport free maltose into the cell . Minicells of B . subtilis containing pLS69 synthesized the amylomaltase polypeptide but no X-fragment . In S . pneumoniae carrying pLS69, production of the X-fragment is also reduced more than the amylomaltase, when compared to cells carrying pLS70, which produce equal amounts of the two proteins . Inasmuch as the down promoter mutation leaves unchanged both structural genes, their ribosome-binding sites and -10 and -35 promoter sequences, the unequal effect is attributed to differential reduction in AT composition proximal to the promoters . Vector proteins were revealed in minicells as several bands, all located in the cytosol except for an Mr 35000 polypeptide located in the membrane.

J Bacteriol, 1984 Jun, 158(3), 967 - 71
Expression of the Bacillus subtilis glutamine synthetase gene in Escherichia coli; Gardner AL et al.; The structural gene for glutamine synthetase (glnA) in Bacillus subtilis ( glnAB ) cloned in the lambda vector phage Charon 4A was used to transduce a lysogenic glutamine auxotrophic Escherichia coli strain to prototrophy . The defective E . coli gene ( glnAE ) was still present in the transductant since it could be transduced . In addition, curing of the prototroph resulted in the restoration of glutamine auxotrophy . Proteins in crude extracts of the transductant were examined by a "Western blotting" procedure for the presence of B . subtilis or E . coli glutamine synthetase antigen; only the former was detected . Growth of the strain in media without glutamine was not curtailed even when the bacteriophage lambda pL and pRM promoters were hyperrepressed . The specific activities and patterns of derepression of glutamine synthetase in the transductant were similar to those of B . subtilis, with no evidence for adenylylation . The information necessary for regulation of glnAB must be closely linked to the gene and appears to function in E . coli.

Genetika, 1984 Jun, 20(6), 943 - 8
{Cloning of the purA16 locus in Rec+ cells of Bacillus subtilis}; Poluektova EU et al.; A portion of purA16 chromosomal locus of Bacillus subtilis was cloned into Rec+ cells of this microorganism with pBD12 plasmid (carrying chloramphenicol and kanamycin resistance determinants) serving as a vector . The hybrid plasmids were stably maintained in cells grown on media supplemented with antibiotics and were lost from cells in the absence of drugs . The cloned fragment could incorporate into the chromosome some with a frequency of 10(-2) per cell per generation . A clone carrying the hybrid plasmid inserted into the chromosome was detected.

J Biol Chem, 1984 May 25, 259(10), 6364 - 8
Isolation and characterization of pteroylpolyglutamate hydrolase from rat intestinal mucosa; Elsenhans B et al.; Pteroylpolyglutamate hydrolase was isolated from rat intestinal mucosa and purified with the aid of affinity chromatography . The affinity ligand was poly-gamma-glutamic acid (Mr approximately 12,000) derived from Bacillus subtilis . The specific enzymatic activity was increased 2,000-fold over the 100,000 X g supernatant of the mucosal homogenate with a yield of 20% . Sephadex G-200 gel filtration yielded an estimated molecular mass of 80,000 daltons . The isoelectric point was pH 8.2 . The pH optimum in acetate buffer containing 1 mM zinc was 4.5 . The KM values for pteroylheptaglutamate and pteroyltriglutamate were 0.21 and 0.67 microM, respectively . Polyanionic compounds, poly-gamma-glutamic acid, dextran sulfate, and heparin were noncompetitive inhibitors . Studies of the time course of hydrolysis of synthetic {3H}pteroylheptaglutamate by three separate techniques demonstrated the appearance of {3H}pteroylmonoglutamate, synchronous with substrate cleavage . Intermediate pteroyloligoglutamates were not detected . An endopeptidase-like mode of hydrolysis was further established by identification of a hexaglutamyl peptide as the other reaction product.

J Biol Chem, 1984 May 25, 259(10), 6681 - 5
Overproduction and purification of a bacteriophage SPO1-encoded RNA polymerase sigma factor; Costanzo M et al.; Gene 28 of bacteriophage SPO1 encodes an RNA polymerase sigma factor sigma gp28, which replaces the host Bacillus subtilis sigma subunit sigma 55, to alter the promoter recognition specificity of RNA polymerase . A fragment of SPO1 DNA containing gene 28 was placed under the control of the PL promoter of bacteriophage lambda in an Escherichia coli expression vector . When transcription of gene 28 was induced by derepression of PL, the sigma gp28 synthesized constituted several per cent of total cellular protein . Sigma gp28 purified from these cells was able to confer specificity for SPO1 middle gene promoters upon B . subtilis core RNA polymerase, and also enabled E . coli core RNA polymerase to recognize and initiate transcription from an SPO1 middle gene promoter.

J Mol Biol, 1984 May 25, 175(3), 285 - 97
Promoter recognition by sigma-37 RNA polymerase from Bacillus subtilis; Tatti KM et al.; Bacillus subtilis possesses at least five different forms of RNA polymerase holoenzyme which are distinguished by their sigma subunit and their promoter recognition specificity . Sigma-37 RNA polymerase, a minor form of RNA polymerase, recognizes a class of promoters, which includes promoters for genes transcribed early during endospore formation . We have used site-directed bisulfite mutagenesis to construct a series of single and multiple base substitutions in a promoter recognized by sigma-37 RNA polymerase . In vitro transcription analysis of this series of mutant promoters demonstrated that single base substitutions at positions -36, -16, -15 and -14 most dramatically reduced the efficiency of promoter utilization by sigma-37 RNA polymerase . These results support a model in which sigma-37 RNA polymerase recognizes its cognate promoters by interacting with a sequence of nucleotides near the -10 region and the -35 region of the promoter--a sequence not recognized by B . subtilis sigma-55 RNA polymerase or Escherichia coli RNA polymerase.

Biochem J, 1984 May 15, 220(1), 117 - 23
Quasi-elastic light scattering studies on dormant and germinating Bacillus subtilis spores; Harding SE et al.; Spores of Bacillus subtilis in suspension, both dormant and germinating, have been examined by light-scattering methods, both integrated intensity and correlation versions . When intensity of scatter at constant volume was plotted against angle, curves possessing a maximum at about 20 degrees were regularly obtained but without any noticeable features at higher angles . This indicated polydispersity and/or asymmetry among the population . Curves of the intensity correlation function for both dormant and germinating spores at different angles, theta, did not superimpose at the lower angles when plotted appropriately, but did so for theta greater than 35 degrees . This was considered to arise from asymmetry of the spores . By using the high-angle data the apparent diffusion coefficient was determined for both dormant spores and for germinating spores from 1 min after germinant addition . No appreciable difference was observed, from which volume changes greater than 6% during germination could be excluded . The occurrence of germination was confirmed by both absorbance and phase-contrast-microscopy observations.

Eur J Biochem, 1984 May 15, 141(1), 83 - 9
The primary structure of teichuronic acid in Bacillus subtilis AHU 1031; Yoneyama T et al.; Structural studies were carried out on the acidic polysaccharide fraction obtained from lysozyme digest of the cell walls of Bacillus subtilis AHU 1031 . The polysaccharide fraction contained N- acetylmannosaminuronic acid ( ManNAcA ), N-acetylglucosamine (GlcNAc), glucose, glycerol and phosphorus in a molar ratio of 2:2:4:1:1, together with glycopeptide components . The results of analyses involving Smith degradation, chromium trioxide oxidation, methylation and proton magnetic resonance spectroscopy led to the conclusion that the backbone chain of the polysaccharide has the repeating unit----6)Glc(alpha 1----3/4) ManNAcA (beta 1----4)GlcNAc(beta 1---- . About 50% of the N-acetylglucosamine residues in the backbone chain seem to be substituted at C-3 by the glycosidic branches, glycerol phospho-6-glucose, while the other half seem to be substituted by glucose.

Appl Environ Microbiol, 1984 May, 47(5), 1039 - 46
Characterization of the cellulolytic activity of a Bacillus isolate; Robson LM et al.; A group I Bacillus strain, DLG, was isolated and characterized as being most closely related to Bacillus subtilis . When grown on any of a variety of sugars, the culture supernatant of this isolate was found to possess cellulolytic activity, as demonstrated by degradation of trinitrophenyl-carboxymethyl cellulose . Growth in medium containing cellobiose or glucose resulted in the greatest production of cellulolytic activity . The cellulolytic activity was not produced until the stationary phase of growth, and the addition of glucose or cellobiose to a culture in this phase had no apparent effect on enzyme production . Fractionation of the culture supernatant showed that the molecular weight of the enzymatic activity was less than 100,000 . Maximum cellulolytic activity in assays was observed at pH 4.8 and at 58C, although maximum thermal stability of the activity . Kinetic experiments suggested that more than one enzyme was acting upon trinitrophenyl-carboxymethyl cellulose . Exocellular protein produced by this Bacillus isolate showed roughly one-fifth the cellulolytic activity displayed by Trichoderma reesei C30 on noncrystalline, cellulosic substrates . In contrast to T . reesei cellulase, the Bacillus enzymatic activity showed no ability to degrade crystalline forms of cellulose, nor was cellobiase activity detectable.

Gene, 1984 May, 28(2), 171 - 6
Constitutive variants of the pC194 cat gene exhibit DNA alterations in the vicinity of the ribosome binding site sequence; Ambulos NP Jr et al.; The chloramphenicol-inducible regulation of the expression of cat genes from two Gram-positive bacteria, Staphylococcus aureus and Bacillus pumilus has been suggested to result from the presence of inverted repeat sequences that span the ribosome-binding site (RBS) for cat . In support of this hypothesis, we demonstrate that two derivatives of the pC194 cat gene which are constitutively expressed in Bacillus subtilis are deleted for all or a major portion of the inverted-repeat sequences.

J Gen Microbiol, 1984 May, 130 ( Pt 5), 1263 - 9
Use of temperature-sensitive mutants to study gene expression of two closely linked sporulation loci in Bacillus subtilis; Lamont IL et al.; The spoOB and spoIVF loci are contiguous on the chromosome of Bacillus subtilis, so that genes in these loci may be parts of a single polycistronic operon . Temperature-sensitive strains having mutations in these loci were isolated, and temperature-shift experiments were carried out to investigate expression of the genes . The temperature-sensitive periods of spoOB mutants extended from the beginning of sporulation until the end of the stage II . The temperature-sensitive periods of spoIVF strains were during stage IV of sporulation . Therefore, although the spoOB and spoIVF loci are contiguous on the chromosome it is unlikely that genes in them are parts of a single polycistronic operon.

J Gen Microbiol, 1984 May, 130 ( Pt 5), 1253 - 61
Identification of a new sporulation locus, spoIIIF, in Bacillus subtilis; Lamont IL et al.; We have isolated a mutant of Bacillus subtilis, strain 590, which is blocked at stage III of sporulation . The spo mutation which is carried by this strain is linked to pheA by transformation and defines a previously unidentified locus, spoIIIF . The spoIIIF locus is contiguous with the spoVB locus, in which a mutation causes a block at stage V of sporulation . We also give a detailed genetic map of the pheA region of the chromosome.

J Gen Microbiol, 1984 May, 130 ( Pt 5), 1247 - 52
Bacillus subtilis 168 mutants resistant to arginine hydroxamate in the presence of ornithine or citrulline; Baumberg S et al.; Mutations in Bacillus subtilis 168 have been isolated that confer resistance to arginine hydroxamate in the presence, but not absence, of ornithine . Seven such Ahor mutants have been studied in detail . In common with certain classes of Ahr mutant (resistant to arginine hydroxamate in the absence of arginine precursors) described previously, these Ahor mutants showed little or no inducibility of enzymes of arginine catabolism . Mutants that showed no inducibility were unable to utilize arginine or ornithine as sole nitrogen source . The only biosynthetic enzyme to show any consistent differences in activity from the parent was ornithine carbamoyltransferase, whose level was slightly elevated in cells grown in the presence of ornithine or citrulline . PBS1 transduction crosses showed that two of the ahor mutations map at the ahrA locus, while a third (unique in its resistance to arginine hydroxamate in the presence of citrulline) mapped at a hitherto undescribed locus closely linked to metC, designated ahrD.

J Bacteriol, 1984 May, 158(2), 746 - 8
Degradation of aspartate transcarbamylase in Bacillus subtilis is deficient in rel mutants but is not mediated by guanosine polyphosphates; Bond RW et al.; Degradation of aspartate transcarbamylase in growing and starved Bacillus subtilis was deficient in relA and relC mutants, but these effects were not correlated with differences in the intracellular level of guanosine polyphosphates.

J Bacteriol, 1984 May, 158(2), 411 - 8
Replacement of the Bacillus subtilis subtilisin structural gene with an In vitro-derived deletion mutation; Stahl ML et al.; The entire subtilisin structural gene from Bacillus subtilis I168 has been cloned, and its nucleotide sequence has been determined . When expressed on a high-copy-number shuttle vector, a fivefold increase in serine protease activity was observed . The DNA sequence of the gene is 80% homologous to the Bacillus amyloliquefaciens subtilisin structural gene, and the translated mature coding sequence is 85% homologous to the published protein sequence of subtilisin BPN' . The chloramphenicol resistance determinant of a plasmid integrated at the subtilisin locus was mapped by PBS1 transduction and was found to be linked to glyB (83%) and argC (60%), but not with metC or purB . The chromosomal locus containing the wild-type subtilisin allele was replaced with an in vitro-derived allele of the gene (delta apr-684) that contained a 684-base-pair deletion . The technique used for introducing the deletion is a variation of the gene replacement methods used in Saccharomyces cerevisiae and Escherichia coli . When used in B . subtilis, deletion mutants could be directly screened among the transformants . Physiological characterization of the delta apr-684 mutation revealed no discernable effect on the formation of heat-resistant endospores, but strains carrying the mutation produced only 10% of wild-type serine protease activity . A model is presented that outlines the pathway for plasmid integration and deletion formation in B . subtilis.

J Bacteriol, 1984 May, 158(2), 507 - 12
Cloning of sporulation gene spoIIG in Bacillus subtilis; Ayaki H et al.; Two specialized transducing phages carrying a sporulation gene, spoIIG , of Bacillus subtilis were constructed from B . subtilis temperate phages p11 and phi 105 by the "prophage transformation" method . Restriction enzyme analysis and transformation experiments showed that the spoIIG gene was present on a 6.2 X 10(6)-dalton (6.2-Md) EcoRI fragment in both transducing phage genomes . Further analysis showed that spoIIG + transforming activity resides on a 2.25-Md EcoRI-BamHI fragment within the 6.2-Md EcoRI fragment . The 2.25-Md fragment was subcloned into the region between the EcoRI and BamHI sites of pUB110, and deletion plasmids lacking PstI or HindIII fragments within the 2.25-Md fragment were constructed . The recombinant plasmid carrying the intact spoIIG gene restored sporulation of strain HU1002 ( spoIIG41 recE4 ) to a frequency of 10(4) spores per ml and inhibited sporulation of strain 4309 ( spo + recE4 ) to a level of 10(3) spores per ml.

Anal Biochem, 1984 May 1, 138(2), 465 - 71
Preparative-scale isolation and purification of procaryotic and eucaryotic ribosomal 5 S RNA: Bacillus subtilis, Neurospora crassa, and wheat germ; Li SJ et al.; Ribosomal 5 S RNA from three different organisms has been isolated in high yield and purity . Without prior isolation of ribosomes, a presoak in buffer followed by phenol extraction, DE-32 ion-exchange chromatography, and Sephadex G-75 gel-permeation chromatography yields at least 5-10 mg of electrophoretically homogeneous 5 S RNA from 100 g of cells . Ribonuclease activity is eliminated by various combinations of low temperature, sodium dodecyl sulfate, phenol, and bentonite . High-molecular-weight contaminants are suppressed by either 65 degrees C heat treatment or lowered sodium dodecyl sulfate concentration . For the eucaryotes, 5.8 S RNA contamination is reduced either by low temperature in the initial solubilization or by postponing 65 degrees C heat treatment until after the phenol extraction step.

J Bacteriol, 1984 May, 158(2), 543 - 50
Post-transcriptional regulation of chloramphenicol acetyl transferase; Byeon WH et al.; The +1 site for initiation of inducible chloramphenicol acetyl transferase (CAT) mRNA encoded by plasmid pC194 was determined experimentally by using {alpha-32P}ATP-labeled runoff transcripts partially digested with T1 RNase . By partial digestion of the in vitro transcripts with S1, T1, and cobra venom nucleases as probes of mRNA conformation, single- and double-stranded regions, respectively, were also identified . Thus, a prominent inverted complementary repeat sequence was demonstrated spanning the +14 to +50 positions, which contain the complementary sequences CCUCC and GGAGG (the Shine and Dalgarno sequence for synthesis of CAT) symmetrically apposed and paired as part of a perfect 12-base-pair inverted complementary repeat sequence (-19.5 kcal {ca . -81.7 kJ} per mol) . The CAT mRNA was stable to digestion by T1 RNase at the four guanosine residues in the Shine and Dalgarno sequence GGAGG , even at 60 degrees C, suggesting that nascent CAT mRNA allows ribosomes to initiate protein synthesis inefficiently and that induction involves post-transcriptional unmasking of the Shine and Dalgarno sequence . Consistent with this model of regulation, we found that cells carrying pC194 , induced with chloramphenicol, contain about the same concentration of pulse-labeled CAT-specific RNA as do uninduced cells . Induction of CAT synthesis by the non- acetylatable chloramphenicol analog fluorothiamphenicol was tested by using minicells of Bacillus subtilis carrying pC194 as well as minicells containing the cloned pC194 derivatives in which parts of the CAT structural gene were deleted in vitro with BAL 31 exonuclease . Optimal induction of both full-length (active) and deleted (inactive) CAT required similar concentrations of fluorothiamphenicol, whereas induction by chloramphenicol required a higher concentration for the wild-type full-length (active) CAT than for the (inactive) deleted CAT . Because synthesis of deleted CAT was inducible, we infer that CAT plays no direct role in regulating its own synthesis.

J Gen Microbiol, 1984 May, 130 ( Pt 5), 1285 - 91
Cloning and expression of a Bacillus subtilis Endo-1,3-1,4-beta-D-glucanase gene in Escherichia coli K12; Hinchliffe E; EcoRI fragments of DNA from Bacillus subtilis NCIB 8565, a high producer of an endo-1,3-1,4-beta-D-glucanase, were 'shot-gun' cloned in the plasmid vector pBR325 . A 3.5 kb insert, carrying single restriction sites for AvaI, BglII, ClaI, PvuI and PvuII, was shown to direct the synthesis of beta-glucanase in Escherichia coli K12 . Enzyme activity was demonstrated in extracellular fractions of E . coli harbouring the beta-glucanase gene; however, the largest proportion (greater than 50%) of total enzyme activity was periplasmic in location . beta-Glucanase activity and cellular location were independent of the orientation of the 3.5 kb fragment in pBR325.

FEBS Lett, 1984 Apr 9, 169(1), 40 - 4
The interaction of Bacillus protoplasts with sonicated phosphatidylcholine liposomes; Urbaneja MA et al.; When protoplasts from Bacillus subtilis are incubated with sonicated liposomes made from egg-yolk phosphatidylcholine, this phospholipid is incorporated into the protoplast membranes . Biochemical, fluorescence and ultrastructural data suggest that incorporation occurs through membrane fusion.

Can J Microbiol, 1984 Apr, 30(4), 423 - 9
A catabolite-resistance mutation is localized in the rpo operon of Bacillus subtilis; Sun DX et al.; By transformation analysis, a mutation (crsE1), which makes Bacillus subtilis cells able to sporulate in the presence of relatively high concentrations of glucose and other carbon sources, was mapped in the rpoBC operon . The effect of crsE1 mutation can be suppressed by another mutation in the same operon, rfm11, which confers resistance to rifamycin . Mutants carrying stv or std mutations, which are also located in the rpoBC operon, showed partial resistance to catabolites in sporulation . It appears therefore that a change in the structure or synthesis of RNA polymerase may alter the response of cells to the inhibitory effect of catabolites on sporulation.

J Bacteriol, 1984 Apr, 158(1), 55 - 62
Synthesis of oxaloacetate in Bacillus subtilis mutants lacking the 2-ketoglutarate dehydrogenase enzymatic complex; Fisher SH et al.; Bacillus subtilis mutants deficient in the 2-ketoglutarate dehydrogenase enzymatic complex required aspartate for growth at wild-type rates on carbon sources for which synthesis of the degradative enzymes is sensitive to catabolite repression (e.g., poor carbon sources), but did not require aspartate for growth on carbon sources which exert catabolite repression (e.g., good carbon sources) . Measurement of metabolite pools in a mutant lacking the 2-ketoglutarate dehydrogenase active complex showed that the aspartate requirement for growth on poor carbon sources resulted from a deficiency in intracellular oxaloacetate pools even through pyruvate carboxylase was present at levels corresponding to those in wild-type cells . The oxaloacetate deficiency most likely resulted from the inability of the mutant to regenerate oxaloacetate from citrate due to the enzymatic block in the tricarboxylic acid cycle . Mutants in the enzymes of the dicarboxylic acid half of the citric acid cycle similarly required aspartate for wild-type growth in minimal medium . These results suggested that the complete turning of the tricarboxylic acid cycle is involved in the maintainance of oxaloacetate levels in B . subtilis . The ability of the mutants lacking the 2-ketoglutarate dehydrogenase enzymatic complex to grow at wild-type rates on media containing good carbon sources in the absence of exogenous aspartate is not understood.

J Bacteriol, 1984 Apr, 158(1), 386 - 8
New chloramphenicol resistance locus in Bacillus subtilis; Anderson LM et al.; A spontaneously occurring, noninducible, chloramphenicol-resistant mutant of Bacillus subtilis 168 has a mutation (cam-2) which maps in the ribosomal protein region of the chromosome near dal . Its presence does not confer dependence on chloramphenicol . Ribosomes of the cam-2 strain remained sensitive to chloramphenicol in in vitro protein synthesis . No chloramphenicol acetyltransferase activity could be detected.

J Gen Microbiol, 1984 Apr, 130 ( Pt 4), 757 - 60
Cloning of sporulation gene spoIIC in Bacillus subtilis; Anaguchi H et al.; Specialized transducing phages rho 11spoIIC and phi 105spoIIC, carrying the Bacillus subtilis sporulation gene spoIIC, were constructed by the prophage transformation method . An EcoRI fragment (2.4 MDal) carrying the spoIIC gene was isolated from the phi 105spoIIC genome and recloned into the EcoRI site of plasmid pUB110 . The recombinant plasmids corrected the sporulation defect of a Spo- Rec- host, but slightly inhibited the sporulation of a Spo+ Rec- host.

J Appl Bacteriol, 1984 Apr, 56(2), 295 - 303
Hypochlorite effects on spores and spore forms of Bacillus subtilis and on a spore lytic enzyme; Gorman SP et al.; Spores of Bacillus subtilis NCTC 10073 were converted to ion-exchange (Ca, H) forms and coat-defective (urea-mercaptoethanol, urea-dithiothreitol-sodium lauryl sulphate) forms . The resistance of these to sodium hypochlorite (1000 parts/10(6) free chlorine) was compared and related to uptake from which the assumed monolayer capacities were calculated . Hypochlorite effects on spore protoplasts and cortical fragments were also examined in relation to DPA and hexosamine release . A spore lytic enzyme was extracted and examined in respect of hypochlorite activity . The results are discussed in terms of the mechanism and site of action of hypochlorite on the bacterial spore.

J Bacteriol, 1984 Apr, 158(1), 169 - 79
Insertion and fate of the cell wall in Bacillus subtilis; Mobley HL et al.; Cell wall assembly was studied in autolysin-deficient and -sufficient strains of Bacillus subtilis . Two independent probes, one for peptidoglycan and the other for surface-accessible teichoic acid, were employed to monitor cell surface changes during growth . Cell walls were specifically labeled with N-acetyl-D-{3H}glucosamine, and after growth, autoradiographs were prepared for both cell types . The locations of silver grains revealed that label was progressively lost from numerous sites on the cell cylinders, whereas label was retained on the cell poles, even after several generations . In the autolysin-deficient and chain-forming strain, it was found that the distance between densely labeled poles approximately doubled after each generation of growth . In the autolysin-sufficient strain, it was found that the numbers of labeled cell poles remained nearly constant for several generations, supporting the premise that completed septa and poles are largely conserved during growth . Fluorescein-conjugated concanavalin A was also used to determine the distribution of alpha-D-glucosylated teichoic acid on the surfaces of growing cells . Strains with temperature-sensitive phosphoglucomutase were used because in these mutants, glycosylation of cell wall teichoic acids can be controlled by temperature shifts . When the bacteria were grown at 45 degrees C, which stops the glucosylation of teichoic acid, the cells gradually lost their ability to bind concanavalin A on their cylindrical surfaces, but they retained concanavalin A-reactive sites on their poles . Discrete areas on the cylinder, defined by the binding of fluorescent concanavalin A, were absent when the synthesis of glucosylated teichoic acid was inhibited during growth for several generations at the nonpermissive temperature . When the mutant was shifted from a nonpermissive to a permissive temperature, all areas of the cylinder became able to bind the labeled concanavalin A after about one-half generation . Old cell poles were able to bind the lectin after nearly one generation at the permissive temperature, showing that new wall synthesis does occur in the cell poles, although it occurs slowly . These data, based on both qualitative and quantitative experiments, support a model for cell wall assembly in B . subtilis, in which cylinders elongate by inside-to-outside growth, with degradation of the stress-bearing old wall in wild-type organisms . Loss of wall material, by turnover, from many sites on the cylinder may be necessary for intercalation of new wall and normal length extension . Poles tend to retain their wall components during division and are turned over much more slowly.

Antibiotiki, 1984 Apr, 29(4), 253 - 7
{Effect of gramicidin S and its derivatives on protoplasts of Bacillus subtilis}; Petrykina ZM et al.; The lysis of Bacillus subtilis protoplasts by gramicidin S, a membrane active antibiotic, and its derivatives was studied according to free amino groups of the ornithine residue . The initial antibiotic and guanylgramicidin , a positive charge-preserving derivative, had a high lytic activity . Succinylgramicidin , a gramicidin S derivative with acid properties, and carbomoylgramicidin , a neutral derivative, actively lysed B . subtilis protoplasts suspended in 1/15 M phosphate buffer solution with sucrose . No lytic activity of succinylgramicidin was observed with respect to B . subtilis protoplasts suspended in an aqueous solution of sucrose . Comparative study on the sensitivity of the protoplasts of Micrococcus lysodeikticus, B . megaterium and B . subtilis to the lytic action of gramicidin S and its derivatives showed in the main a similar character of their interaction with the membranes of the protoplasts of the taxonomically close species (B . megaterium and B . subtilis) . It is likely that the specificity of the action of the above substances on the protoplasts of M . lysodeikticus, i . e . a complicated character of the dependence of the lytic action of gramicidin S on its concentration, manifestation of the lytic activity of the neutral and acid derivatives in the presence of phosphates or other salts and in sucrose aqueous solution was mainly defined by the properties of the micrococcal membranes.

J Bacteriol, 1984 Apr, 158(1), 379 - 82
2-Ketoglutarate and the regulation of aconitase and histidase formation in Bacillus subtilis; Fisher SH et al.; In contrast to wild-type cells, the Bacillus subtilis mutant SF109 that lacks the active 2-ketoglutarate dehydrogenase enzymatic complex is unable to increase the specific activity of two enzymes subject to glucose catabolite repression, aconitase and histidase, during limitation of growth by glucose . Examination of the intracellular metabolite pools in the mutant and wild-type cells grown in excess and limiting glucose medium showed that the complete derepression of aconitase and histidase could be correlated with the decrease in the intracellular concentration of 2-ketoglutarate . The complete repression of aconitase that occurred in wild-type and mutant cells could be correlated with a high intracellular concentration of 2-ketoglutarate.

Biochem Biophys Res Commun, 1984 Mar 30, 119(3), 1191 - 7
Retrohydroxamate ferrichrome, a biomimetic analogue of ferrichrome; Emery T et al.; A new synthetic analogue of ferrichrome, retrohydroxamate ferrichrome, has been examined for biological activity . Although spectroscopic evidence indicates that the analogue is a weaker Fe(III) chelator than ferrichrome, retrohydroxamate ferrichrome is indistinguishable from ferrichrome in its growth factor activity for Arthrobacter flavescens, and in its potency in antagonizing the antibiotic activity of albomyhcin against Bacillus subtilis . It is as active as ferrichrome as a siderophore for the fungus, Ustaligo sphaerogena . In contrast, desmethylretrohydroxamate ferrichrome shows no significant biological activity.

Biochim Biophys Acta, 1984 Mar 27, 793(1), 86 - 94
Products of phosphatidylglycerol turnover in two Bacillus strains with and without lipoteichoic acid in the cells; Koga Y et al.; In order to understand the phosphatidylglycerol turnover mechanism, especially the differential turnover of diacylated and unacylated glycerol moieties of the lipid, products of phosphatidylglycerol metabolism were surveyed in vivo in Bacillus subtilis W23 and an alkalophile, Bacillus sp . strain A007 . When cells of B . subtilis W23 labeled with radioactive glycerol were chased, lipoteichoic acid accumulated 90% of the radioactivity lost from the unacylated glycerol moiety of phosphatidylglycerol . Also, lipids other that phosphatidylglycerol, except diacylglycerol, and glycerol and glycerophosphate incorporated much less radioactivity . The {32P}phosphoryl group was also transferred from phosphatidylglycerol to lipoteichoic acid almost quantitatively in B . subtilis W23 . A unique metabolism of phosphatidylglycerol was found in Bacillus sp . strain A007 which lacked phosphoglycolipid and lipoteichoic acid, that is, the turnover of phosphatidylglycerol of this organism was less extensive compared with that of B . subtilis W23, and both glycerol moieties of the lipid were metabolized at an identical rate . These results suggested that the major reaction involved in the turnover of phosphatidylglycerol was the transfer of glycerophosphate residue to lipoteichoic acid in a bacterium which possessed lipoteichoic acid and that several minor reactions also were involved in phosphatidylglycerol turnover.

J Biol Chem, 1984 Mar 25, 259(6), 3694 - 702
Two large clusters with thirty-seven transfer RNA genes adjacent to ribosomal RNA gene sets in Bacillus subtilis . Sequence and organization of trrnD and trrnE gene clusters; Wawrousek EF et al.; Sequences of two large tRNA gene clusters (trrnD and trrnE) in Bacillus subtilis 168 revealed 16 and 21 tRNA genes, respectively, as identified by anticodon assignments . Each cluster contains upstream flanking 23 and 5 S rRNA sequences . The 23-5 S intergenic space in trrnE corresponds exactly to the analogous space in trrnB, which was previously sequenced (Wawrousek, E.F., and Hansen, J.N . (1983) J.Biol . Chem . 258, 291-298) . The 5 S rRNA genes in trrnB and trrnE are B . subtilis major species; but trrnD possesses a minor species (Raue, H.A., and Planta, R . J . (1977) Mol . Gen . Genet . 156, 185-193) gene with a putative promoter that may allow differential expression with respect to the upstream rRNA gene set . Most of the tRNA genes are probably expressed as large transcriptional units, except for a LeuTTG tRNA in the trrnD cluster that appears to constitute its own operon with putative promoter and terminator sequences . Although all the amino acids are represented among the tRNA anticodons, there are few repeats of amino acid types within clusters; trrnD with 16 tRNA genes has anticodons corresponding to 15 amino acids . About two-thirds of the tRNA genes encode a 3'-terminal-CCA, and these are intermingled with those that do not, with no apparent pattern.

Biochim Biophys Acta, 1984 Mar 22, 798(1), 88 - 95
Catabolite repression of inositol dehydrogenase and gluconate kinase syntheses in Bacillus subtilis; Nihashi J et al.; The regulation of induction of inositol dehydrogenase (EC 1.1.1.18) and gluconate kinase (EC 2.7.1.12) was studied in Bacillus subtilis . Inositol dehydrogenase is induced by myo-inositol and gluconate kinase is induced by D-gluconate . Both inductions were strongly repressed by rapidly metabolizable carbohydrates such as D-glucose, D-mannose, D-fructose and glycerol (D-glucose had the strongest repressive effect) but they were weakly repressed by slowly metabolizable carbohydrates . Although each carbohydrate exerted a stronger effect on the induction of inositol dehydrogenase than that of gluconate kinase, it showed a similar tendency with respect to the degree of repression of each induction . This catabolite repression could not be diminished by addition of cyclic AMP to medium . In addition, non-metabolizable D-glucose analogues had no or weak repressive effects . On the assumption that rapidly metabolizable carbohydrates might be metabolized to repress both inductions, it was investigated whether several mutants blocked in the Embden-Meyerhof pathway could produce metabolite(s) (repressor) to repress them . A phosphoglycerate kinase (EC 2.7.2.3) deficient mutant could produce the repressor from D-glucose, D-mannose, D-fructose and glycerol but other mutants could not produce it from carbohydrates unable to be metabolized in each mutant . Thus, catabolite repression of both enzyme inductions seemed to be under similar regulation . The identification of the possible repressor of the induction of in of inositol dehydrogenase and gluconate kinase in vivo was discussed.

Biochem Biophys Res Commun, 1984 Mar 15, 119(2), 795 - 800
Characterization of the precursor form of the exocellular levansucrase from Bacillus subtilis; Fouet A et al.; Expression of the cloned levansucrase gene (sacB) was demonstrated in E . coli minicells by assay of the enzyme in crude extracts, SDS-polyacrylamide gel electrophoresis and immunoblotting . The existence of a precursor form of the enzyme of MW 53000 was also demonstrated and confirmed by the DNA sequence corresponding to the NH2 terminal region of the protein.

Eur J Biochem, 1984 Mar 15, 139(3), 593 - 603
Changes in membrane-associated proteins during sporulation in Bacillus subtilis; Rhaese HJ et al.; Membrane proteins from vegetative and sporulating cells of Bacillus subtilis were separated by the two-dimensional gel electrophoresis system using isoelectric focusing and sodium dodecyl sulfate/polyacrylamide gel electrophoresis (O'Farrell technique) . Membrane proteins were isolated according to published procedures . The gels were stained with Coomassie blue . Three different concentrations of proteins were analyzed to detect even minor constituents . Over two hundred different membrane proteins were identified in vegetative cells by their isoelectric point (pI) and molecular weight (Mr) . Analysis of membrane proteins from cells harvested during and at the end of logarithmic growth (A600 approximately equal to 0.8; T0) and every hour thereafter until T4 showed that in the wild-type strain 55 proteins are degraded mostly at the beginning or sporulation . Many others (76 proteins) are newly synthesized during sporulation . About 16 proteins are synthesized at times during sporulation but again degraded within 1 h or less . Others (uncertain proteins, 65) are degraded and resynthesized again . This observation is in agreement with experiments previously published by Andreoli et al . {Andreoli, A . J., Kao, M., Chui, R., Cabrera, J., and Wong, S . K . S (1981) in Sporulation and Germination (Levinson, H . S., Sonenshein, A . L., and Tipper, D . J., eds) pp . 168-173, American Society for Microbiology, Washington} using Bacillus cereus . Experiments with the early blocked asporogenous mutant JH 649 (spoOF) showed that few proteins (40%) are degraded and even fewer (30%) are newly synthesized between A600 approximately equal to 0.8 and T4 . Protease inhibitors (phenylmethylsulfonyl fluoride, EDTA, o-phenanthroline) have no effect on the protein patterns . The experiments presented here show that proteins involved in differentiation in B . subtilis can be identified by the two-dimensional gel electrophoresis system and with the aid of asporogenous mutants . In order to assure that no cytoplasmic proteins are contaminating the membrane preparations, several cytoplasmic enzyme activities have been measured . Their concentration was found to be always below 0.005% of total protein, which is below the level of detection by Coomassie blue staining.

Nucleic Acids Res, 1984 Mar 12, 12(5), 2351 - 65
Overproduction and purification of the connector protein of Bacillus subtilis phage phi 29; Ibanez C et al.; A phi 29 DNA fragment containing genes 10 and 11, coding for the connector protein and the lower collar protein, respectively, has been cloned in the pBR322 derivative plasmid pKC30 under the control of the PL promoter of phage lambda . Two polypeptides with the electrophoretic mobility of proteins p10 and p11 were labelled with 35S-methionine after heat induction . The proteins were characterized as p10 and p11 by radioimmunoassay and they represented about 10% and 7%, respectively, of the total E . coli protein after 4 hours of induction . These proteins represent less than 1% of the B . subtilis protein in phi 29-infected cells . Protein p10 has been highly purified from the E . coli cells carrying the recombinant plasmid . Antibodies raised against the purified protein p10 reacted with the connector protein produced in phi 29-infected B . subtilis.

Sangyo Igaku, 1984 Mar, 26(2), 147 - 54
{Mutagenicity of organic rubber additives}; Ueno S et al.; The DNA-damaging activities of organic rubber additives such as rubber vulcanizing agents, vulcanization accelerators and rubber anti-oxidants were investigated by the rec-assay using spores of Bacillus subtilis strains H 17 and M 45 . For metabolic activation, 9,000 X g supernatant solutions of the liver homogenate of Sprague-Dawley male rats previously treated with aroclor 1,254 were used . Spore rec-assays were carried out at the dose of 1 mg/disk, and the ratio of inhibition zones for M 45 to that for H 17 was calculated . Samples showing a ratio of more than 1.2 were judged positive . In order to know the DNA-damaging capacity of positive samples, the dose-response curves were prepared by carrying out the assays at various doses, and minimal inhibition concentration (MIC) for H 17 and M 45 was obtained from these curves by extrapolation . Then indices of DNA damagenicity were calculated through division of the MIC obtained with H 17 by that with M 45 . The 0.005 micrograms/disk of mitomycin C and at 4 micrograms/disk of Trp-P1 were used as positive control, and the 50 micrograms/disk of kanamycin as negative control . The results obtained are as follows: Among 20 tested samples, p-quinone dioxime, bis-morpholine disulfide used as rubber vulcanizing agents and hexamethylenetetramine, zinc butylxanthate used as vulcanization accelerators gave positive results . It was considered that the action of hexamethylenetetramine against DNA was due to the electrophilic state of this material . Furthermore, we supposed that DNA-damaging activity of p-quinone dioxime was concerned with free hydroxyl groups of this compound.(ABSTRACT TRUNCATED AT 250 WORDS)

J Biochem (Tokyo), 1984 Mar, 95(3), 895 - 7
Accumulation of relA gene-independent ppGpp in Bacillus subtilis vegetative cells upon temperature shift-down; Ikehara K et al.; Both Bacillus subtilis BR16S (rel+) and BR16R (relA-) cells accumulated ppGpp after a temperature shift-down from 37 to 0 degree C . This indicates that a ppGpp accumulation system is present in B . subtilis vegetative cells, which is induced upon cold-shock treatment and is mediated by a relA gene-independent product.

Proc Natl Acad Sci U S A, 1984 Mar, 81(6), 1639 - 43
Purification in a functional form of the terminal protein of Bacillus subtilis phage phi 29; Prieto I et al.; Phage phi 29 terminal protein, p3, essentially pure, was isolated in a denatured form from viral particles, and anti-p3 antiserum was obtained . A radioimmunoassay to detect and quantitate protein p3 was developed . By using this assay, native protein p3 was highly purified from Escherichia coli cells harboring a gene 3-containing recombinant plasmid . After three purification steps, the protein was more than 96% pure; its amino acid composition was very similar to that deduced from the nucleotide sequence of gene 3 . The purified protein was active in the formation of the covalent p3-dAMP initiation complex when supplemented with extracts of B . subtilis infected with a sus mutant of phi 29 in gene 3 . No DNA polymerase or ATPase activities were present in the final preparation of protein p3.

J Bacteriol, 1984 Mar, 157(3), 942 - 4
Isolation of Bacillus subtilis mutants pleiotropically insensitive to glucose catabolite repression; Fisher SH et al.; A pleiotropic mutant of Bacillus subtilis was isolated which overproduced in the presence of glucose several enzymes whose synthesis is subject to glucose catabolite repression . Examination of intracellular metabolites suggested that the mutation may have resulted in a defect in glycolysis, increasing phosphoenolpyruvate and decreasing pyruvate, 2-ketoglutarate, and oxaloacetate.

J Bacteriol, 1984 Mar, 157(3), 931 - 3
Expression of Bacillus megaterium and Bacillus subtilis small acid-soluble spore protein genes during stationary-phase growth of asporogenous B . subtilis mutants; Mason JM et al.; The small acid-soluble spore proteins alpha and beta were not detected during stationary-phase growth of asporogenous Bacillus subtilis mutants blocked in stages 0, II, or III, but mutants blocked in stages IV or V accumulated nearly wild-type levels of these small acid-soluble spore proteins . Similar results were obtained when production of Bacillus megaterium C protein (also a small acid-soluble spore protein), as well as alpha and beta, were monitored in these mutants containing a recombinant plasmid carrying the B . megaterium C protein gene . The only exception was a spo0H mutant which synthesized a small amount of C protein, but no alpha or beta.

J Bacteriol, 1984 Mar, 157(3), 733 - 8
Transformation in Bacillus subtilis: a 75,000-dalton protein complex is involved in binding and entry of donor DNA; Smith H et al.; A 75,000-dalton protein complex involved in DNA binding during transformation was purified from membranes of competent Bacillus subtilis cells . Previous results (Smith et al., J . Bacteriol . 156:101-108, 1983) showed that the complex contained two polypeptides, polypeptide a (molecular weight, 18,000; isoelectric point, 5.0) and polypeptide b (molecular weight, 17,000; isoelectric point, 4.7) in approximately equal amounts . In the present experiments the two polypeptides were extracted from two-dimensional gels and studied separately and in combination with respect to DNA binding and nuclease activities . For DNA binding the interaction of both polypeptides was required . DNA binding occurred efficiently in the presence of EDTA . Nuclease activity was restricted to polypeptide b . The nucleolytic properties of b were identical to those of the native 75,000-dalton complex . Polypeptide a affected b by reducing its nuclease activity . Analysis of the nuclease subunit b on DNA-containing polyacrylamide gels revealed nuclease activities at four different molecular weight positions . These activities were identical to the major competence-specific nuclease activities which were previously implicated in the entry of donor DNA during transformation (Mulder and Venema, J . Bacteriol . 152:166-174, 1982) . These results indicate that the 75,000-dalton protein complex is composed of two different competence-specific polypeptides involved in both binding and entry of donor DNA . The possible roles of the two polypeptides in the transformation of B . subtilis are discussed.

Prikl Biokhim Mikrobiol, 1984 Mar-Apr, 20(2), 200 - 7
{Purification and properties of intracellular nuclease of a competent strain of Bacillus subtilis}; Belov IS et al.; A new nuclease was isolated from a membrane-nucleoproteid complex (MNC) of the cell lysate of the competent strain Bacillus subtilis SB25 his2trp2 and purified 674-fold . It differs from the known exonucleases of Bacillus subtilis by the place of "attacking" the phosphodiester bond, by the absence of the specificity towards the end groups of denatured DNA and by a high pH optimum . Isolation and purification were performed as follows: cell destroying by lysozyme and osmotic shock, isolating the MNC by centrifugation, treating the MNC with pancreatic RNase and dialysis with Ca+2 ions against Tris-acetate buffer, chromatography on CM-and phosphocellulose . The nuclease of the partially purified preparation was activated by Ca+2 ions with the optimal concentration 0.5-1.0 mM . It hydrolysed denatured DNA and RNA with the pH optimum at 10.0-10.5 . The main products of the denatured DNA hydrolysis were mono- and dinucleotides with 5'-end phosphate . The enzyme is insensitive to the end hydroxyl and phosphate groups of denatured DNA and was completely inhibited by 1.0 mM EDTA.

J Virol, 1984 Mar, 49(3), 806 - 12
Characterization of proteins induced by mitomycin C treatment of Bacillus subtilis; Mauel C et al.; A total of 26 polypeptides have been resolved by gel electrophoresis of purified phage PBSX, 3 of which belong to the head and the remainder to the tail . After mitomycin C treatment, synthesis of 11 additional proteins which are not found in the assembled phage particle was demonstrated, all but 4 being under the control of the phage repressor . Existence of a prehead and of a precursor of the main capsid protein (molecular weight, 35,000) suggested phage head maturation which is accompanied by cleavage of the precursor (molecular weight, 36,500) . The role of induced proteins related and unrelated to PBSX is discussed . Finally, the estimated phage genome mass of 4 X 10(7) daltons exceeded by more than four times its head capacity, which could explain the defectiveness of the phage.

J Bacteriol, 1984 Mar, 157(3), 965 - 7
Promoter-probe plasmid for Bacillus subtilis; Donnelly CE et al.; We have constructed a promoter-probe expression vector for Bacillus subtilis . This plasmid, pCED6, can be used to fuse various DNA sequences to the structural gene of Escherichia coli beta-galactosidase, permitting analysis of the promoter activity of such sequences . pCED6 replicates and confers drug resistances in both E . coli and B . subtilis.

J Bacteriol, 1984 Mar, 157(3), 718 - 26
Use of chromosomal integration in the establishment and expression of blaZ, a Staphylococcus aureus beta-lactamase gene, in Bacillus subtilis; Saunders CW et al.; With several different vectors, attempts were made to establish blaZ, a Staphylococcus aureus beta-lactamase gene, in Bacillus subtilis . Stable establishment of blaZ in B . subtilis was achieved by use of a vector that allowed the integration of a single copy of the gene into the chromosome of that host . blaZ was expressed in the heterologous host since B . subtilis strains carrying integrated blaZ produced beta-lactamase and were more resistant to ampicillin than was wild-type B . subtilis . blaZ was stably inherited in such strains, as no loss of the ability to produce beta-lactamase was observed after growth in nonselective liquid medium or on solid medium . In contrast, a blaZ-containing restriction fragment could not be established in B . subtilis with either pUB110- or pC194-based vectors . Similarly, a pC194-based shuttle vector (pGX318) containing the 5' end of blaZ (including the promoter and the coding region for the signal sequence and the first few amino acids of the mature protein) was unable to transform B . subtilis . Two derivatives of pGX318 that could be stably established in B . subtilis were isolated . The structures of these derivatives suggested that inactivation of the blaZ promoter was associated with the acquisition of the ability to be established.

Nucleic Acids Res, 1984 Feb 24, 12(4), 1943 - 60
In vitro transcription of the Bacillus subtilis phage phi 29 DNA by Bacillus subtilis and Escherichia coli RNA polymerases; Sogo JM et al.; The Escherichia coli RNA polymerase bound to phage phi 29 DNA has been visualized by electron microscopy . Thirteen specific binding sites have been observed at 1.7,2.6,5.5,10.4,13.7,25.2,25.7,26.3,33.5,59.5,69.2,91.7 and 99.6 DNA length units and they have been named A1,A1I,A1II,A1III,A1IV,A2,A2I, A3, A4,B1,B1I,C1 and C2, respectively . The binding sites A1,A2,A3,B1,C1 and C2 coincide with those found with Bacillus subtilis RNA polymerase . The transcription of phage phi 29 DNA with B . subtilis or E . coli RNA polymerases has been studied . With the B . subtilis RNA polymerase eight transcripts were found, starting at positions corresponding to the binding sites A1, A1III, A2,A3,B1I,B2,C1 and C2, respectively . With the E . coli RNA polymerase the same transcripts were found and a new one starting at position corresponding to the A4 binding site . The RNAs starting at binding sites A1,A1III,A2,B1I, B2,C1 and C2 are transcribed from right to left, as expected for early RNA . The RNAs which initiate at positions A3 and A4 are transcribed from left to right and probably correspond to late RNAs.

Biochemistry, 1984 Feb 14, 23(4), 675 - 80
Purification and characterization of chemotactic methylesterase from Bacillus subtilis; Goldman DJ et al.; By utilization of methanol evolution as an assay, a protein methylesterase from Bacillus subtilis has been purified . A 1200-fold purification has been achieved by CM-Bio-Gel A, hydroxylapatite, and Bio-Gel P-60 column chromatography . Gel filtration and sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicate the enzyme is a monomer of 41 000 in molecular weight . The enzyme is stabilized and activated by aqueous glycerol solutions . Methyl-accepting chemotaxis proteins (MCPs) serve as substrates for the enzyme . The enzyme requires divalent cation for activity, with maximum activity obtained at 1.1 mM Mg2+ . The enzyme is most active at pH 7.5 and at 28 degrees C . Methylesterase has an apparent Km for methylated MCPs of about 10 nM.

J Biol Chem, 1984 Feb 10, 259(3), 1483 - 90
Synthesis of peptidoglycan by high molecular weight penicillin-binding proteins of Bacillus subtilis and Bacillus stearothermophilus; Jackson GE et al.; The high molecular weight penicillin-binding proteins (PBP(s) ) Bacillus subtilis PBPs 1, 2, and 4 and Bacillus stearothermophilus PBPs 1-4 were shown to catalyze peptidoglycan synthesis from the undecaprenol-containing lipid intermediate substrate in two assay systems . In a filter paper assay system, high levels of substrate polymerization occurred when reaction mixtures were incubated on Whatman 3MM filter paper . The pH optimum for peptidoglycan synthesis was 7.5 for B . subtilis PBPs 1, 2, and 4 and 8.5 for B . stearothermophilus PBPs 1-4 . Polymerization was Mg2+-independent and was unaffected by sulfhydryl reagents . Reconstitution with membrane lipids or addition of detergent (optimal concentration, 0.1%) was necessary for synthesis to occur . Bacitracin, penicillin, and cephalothin did not affect polymerization while vancomycin, ristocetin, moenomycin, and macarbomycin were strong inhibitors . In a test tube assay system, optimal synthesis occurred either in the presence of 10% ethylene glycol, 10% glycerol, and 8% methanol or in the presence of 10% N-acetylglucosamine . The products of lysozyme digestion of the synthesized peptidoglycan were analyzed by gel filtration and paper chromatography . B . stearothermophilus PBPs 1-4 synthesized a peptidoglycan product that was 5-7% cross-linked . No evidence for cross-linking was apparent in the peptidoglycan product of B . subtilis PBPs 1, 2, and 4.

Chemioterapia, 1984 Feb, 3(1), 45 - 52
Determination of the spectrum of antibiotic resistance of the "Bacillus subtilis" strains of Enterogermina; Ciffo F; Resistance to the antibiotics most widely used in chemotherapy of the "Bacillus subtilis" strains constituting the specialty Enterogermina was measured by the method of diffusion on agar plates . The results obtained demonstrate that the mutations to resistance present in such strains confer a broad spectrum of resistance to the most important classes of antibiotics . We were also able to demonstrate a considerable number of antibiotic resistances which had not been previously recognized . For the most representative antibiotics, resistance levels were determined in comparison to the sensitive strains . The multiple resistance phenotype of the strains studied is discussed in relation to the molecular basis of antibiotic resistance.

J Gen Microbiol, 1984 Feb, 130 ( Pt 2), 411 - 21
Cloning of an unstable spoIIA-tyrA fragment from Bacillus subtilis; Mahler I et al.; A recombinant cosmid clone was isolated from a library created from cosmid pQB79-1 and Bacillus subtilis DNA, and a 15 kb BamHI fragment derived from the cloned insert was transferred to the vector pHV33 . The recombinant clone, pRC12, was capable of complementing eight auxotrophic markers in the spoIIA-tyrA region of the B . subtilis chromosome (map positions 205-210) . It also complemented eight of nine markers in the spoIIA locus . The exception, spoIIA176, is the most distal marker from lysine . Although pRC12 failed to complement sporulation defects in spoVA or spoIVA (spoIIA+) strains, subclones of pRC12, lacking a functional spoIIA gene, did complement these mutations . pRC12 inhibited sporulation in a spo+ recE strain, possibly due to the presence of multiple functional spoIIA genes . Both the original cosmid and pRC12 were unstable in Escherichia coli and B . subtilis . Antibiotic selection of the vector resulted in extensive deletion of the insert, while selection for insert function in B . subtilis invariably led to loss of the chloramphenicol resistance vector function.

J Gen Microbiol, 1984 Feb, 130 ( Pt 2), 343 - 55
Curie-point pyrolysis mass spectrometry applied to characterization and identification of selected Bacillus species; Shute LA et al.; The use of pyrolysis mass spectrometry in the characterization and identification of Bacillus species was studied . Fifty-three strains of four closely related groups, Bacillus subtilis, B . pumilus, B . licheniformis and 'B . amyloliquefaciens', were used in a study of both sporulated and nonsporulated cultures . Pyrolysis was carried out using a Pyromass 8-80, a novel pyrolysis mass spectrometer specifically designed for fingerprinting complex samples . The pyrolysis data obtained were analysed using multivariate statistical techniques . All four groups could be differentiated using data from non-sporulated cultures but the data from sporulated cultures did not separate B . subtilis from 'B . amyloliquefaciens' or B . pumilus . In contrast, B . licheniformis was more clearly differentiated from the other three species using these data . Culture maturity affected the mass spectra obtained from non-sporulated cultures.

Anal Biochem, 1984 Feb, 136(2), 446 - 50
Assaying proteinases with azocoll; Chavira R Jr et al.; Azocoll, an insoluble, ground collagen to which a bright-red azodye is attached has been widely used for the assay of proteolytic enzymes . Earlier studies showed that hydrolysis of azocoll progressed linearly as a function of proteinase concentration but in an exponentially increasing manner as a function of time . No explanation for the latter behavior has been offered . We have found that assays of both crude extracts of Bacillus subtilis and commercial preparations of subtilisin BPN' gave linear rates of hydrolysis of azocoll as a function of protease concentration; however, both gave increasing rates of hydrolysis of azocoll as a function of time . In attempting to improve and standardize proteolytic assays using azocoll we have found: (a) the absorption maximum of solubilized azocoll at pH 7.8 is 516 nm and is not significantly altered at acid pH; (b) assays which are perfectly linear as a function of time can be obtained by using azocoll that has been vigorously prewashed with buffer; (c) the soluble filtrate removed by prewashing can regenerate the nonlinear time courses previously observed; and (d) the rate of hydrolysis of azocoll can be varied by a factor of 3 by varying the rates of agitation of the assay tubes . In summary, to obtain reproducible, linear assays it was essential to prewash commercial azocoll and agitate reaction tubes vigorously.

Can J Microbiol, 1984 Feb, 30(2), 204 - 11
Metal binding by the peptidoglycan sacculus of Escherichia coli K-12; Hoyle BD et al.; The peptidoglycan of Escherichia coli K-12 strain AB264 was isolated by treating whole cells with sodium dodecyl sulfate and was purified by deoxyribonuclease, ribonuclease, and trypsin treatment . Like the peptidoglycan of Bacillus subtilis, this peptidoglycan proved able to bind substantial amounts of metallic ions from aqueous solution . In particular, most metals of the transition I series were bound from solution in amounts greater than or equal to 1 mumol/mg dry weight peptidoglycan.

J Appl Bacteriol, 1984 Feb, 56(1), 95 - 102
Interaction of the Bacillus subtilis spore protoplast, cortex, ion-exchange and coatless forms with glutaraldehyde; Gorman SP et al.; Bacillus subtilis spores with altered ionic content were tested for their susceptibility to lysis with lysozyme or sodium nitrite following treatment with glutaraldehyde . The Ca-form was more sensitive to glutaraldehyde (pH 4.0 and pH 7.9) than the untreated or H-form . Removal of spore coat dramatically increased sensitivity of the spore to glutaraldehyde . Pretreatment of spores, the coats of which had been extensively removed, with glutaraldehyde (pH 7.9) reduced the rate of lysis by lysozyme and by sodium nitrite, whereas glutaraldehyde at pH 4.0 had little effect . Glutaraldehyde pretreatment (pH 4.0 and pH 7.9) reduced the amount of hexosamine released by lysozyme but not by nitrite from isolated cortical fragments . Spore protoplasts were more susceptible to 0.01% (w/v) glutaraldehyde at pH 4.0 and isolated spore coats adsorbed alkaline glutaraldehyde more rapidly . These results are discussed in terms of a possible mode of action of glutaraldehyde on the bacterial spore.

J Antibiot (Tokyo), 1984 Feb, 37(2), 172 - 7
Action of antifungal peptidolipids from Bacillus subtilis on the cell membrane of Saccharomyces cerevisiae; Besson F et al.; Iturin A and bacillomycin L, antibiotics of the iturin group inhibit the growth of Saccharomyces cerevisiae and the lethal doses were respectively 10 and 60 micrograms/ml . Both antibiotics had an effect on the incorporation of radioactive precursors into macromolecules which decreased with increasing concentrations of antibiotics . However, no specificity was observed on the various macromolecules, proteins, ribonucleic acids and polysaccharides . The site of action on yeast cells was demonstrated to be the cytoplasmic membrane: both antibiotics of iturin group lysed spheroplasts of S . cerevisiae . Moreover, a rapid leakage of potassium ions occurred in the presence of the antibiotics; this leakage was directly associated to the killing effect . These results are consistent with a disruption of the structural integrity of the cytoplasmic membrane correlated to the loss of viability of the yeast cells.

Food Chem Toxicol, 1984 Feb, 22(2), 109 - 12
Mutagenicity of extracts from Ceylon cinnamon in the rec assay; Ungsurungsie M et al.; The extraction of about 1.9 kg of Ceylon cinnamon (Cinnamomum zeylanicum Nees) with 10 litres each of petroleum ether, chloroform and ethanol in a Soxhlet apparatus produced extracts weighing 76, 28 and 270 g respectively for the three solvents . In the preliminary test the ethanol extract showed no mutagenic activity . However, both the petroleum ether and the chloroform extracts showed mutagenicity when tested in the rec assay using Bacillus subtilis strains H17 (rec+) and M45 (rec-) . When these extracts were studied quantitatively by the liquid and spore rec-assay methods, the minimum inhibitory concentrations of the extracts against strain H17 were higher than those against strain M45 . However, in the presence of the liver S-9 mix, the minimum inhibitory concentrations of the petroleum ether and chloroform extracts against both strains of B . subtilis were equal, indicating that the mutagenicity of the extracts had been inactivated.

J Med Chem, 1984 Feb, 27(2), 181 - 5
Quantitative structure-activity relationships of 6-anilinouracils as inhibitors of Bacillus subtilis DNA polymerase III; Wright GE et al.; Quantitative structure-activity relationships (QSAR) of a series of 6-anilinouracil derivatives were developed for their inhibitory activity against the wild-type DNA polymerase III (pol III) and a mutant enzyme, pol III/azp-12, derived from Bacillus subtilis . Interaction between inhibitors and both enzymes appears to result solely from hydrophobic binding . Comparison of the substituent contributions indicates increased hydrophobic character and a minor change of shape of the inhibitor binding site of the mutant enzyme . Because the two enzymes have identical Km values for substrates, the inhibitor binding site is thought to be distinct from the enzyme active site.

J Bacteriol, 1984 Feb, 157(2), 454 - 9
Genetics of leucine biosynthesis in Bacillus megaterium QM B1551; Garbe JC et al.; Genes involved in the biosynthesis of leucine have been mapped in Bacillus megaterium QM B1551, using transducing phage MP13 . Mutations were designated leuA, leuB, or leuC on the basis of enzyme assays . Two mutant strains were deficient in the enzyme activities of leuA (alpha-isopropylmalate synthase) and leuC (beta-isopropylmalate dehydrogenase) and so may contain polar mutations . Fine-structure transduction mapping established the gene order leuC-leuB-leuA-ilv-hem-phe . The orientation of the leu genes to the ilv gene is the same as in Bacillus subtilis, but the relationship in respect to two other linked markers, hem and phe, differs.

J Bacteriol, 1984 Feb, 157(2), 405 - 12
Bacillus subtilis spo0H gene; Weir J et al.; A 2.8-kilobase fragment of the Bacillus subtilis chromosome containing a functional spo0H gene was cloned by using a modification of the helper system described by T . Gryczan and co-workers (T . Gryczan, S . Contente, and D . Dubnau, Mol . Gen . Genet . 177:459-467, 1980) . The chromosomal segment specifically complements spo0H mutations in recE4 strains and when integrated into the chromosome of Rec+ strains maps in the spo0H region of the B . subtilis genome . A deletion within the transcribed region of the cloned spo0H gene was constructed which abolishes its spo0H+-complementing activity . DNA sequences containing this deletion were introduced into a B . subtilis Rec+ strain containing the spo0H75 mutation . The absence of recombination between the deletion and the spo0H mutation indicates that both reside in the same gene . There is homology between the B . subtilis spo0H gene and a 1.2-kilobase chromosomal fragment from Bacillus licheniformis which also complements B . subtilis spo0H mutations . In vivo transcription mapping experiments have shown that the B . subtilis spo0H gene is transcribed during vegetative growth as well as during sporulation.

Cancer Res, 1984 Feb, 44(2), 602 - 4
Perturbations of enzymic uracil excision due to guanine modifications in DNA; Duker NJ et al.; Phage PBS2 DNA, which contains uracil in place of thymine, was used as substrate for purified Bacillus subtilis uracil:DNA glycosylase . Incubation of this DNA with the ultimate carcinogen N-acetoxy-N-2-acetylaminofluorene resulted in the production of N-(deoxyguanosin-8-yl)acetylaminofluorene . A decreased Vmax resulted from the reaction of the glycosylase with this arylamidated substrate . Addition of a 2-fold excess of control PBS2 DNA following initiation of the reaction with the modified substrate showed delayed dissociation of the enzyme from the arylamidated DNA . This shows that the presence of a carcinogen-modified DNA base can reduce the capacity for uracil excision . Therefore, interference with enzymic release of uracil from DNA may be an indirect mechanism of mutagenesis by carcinogen:DNA adducts.

Proc Natl Acad Sci U S A, 1984 Feb, 81(4), 1184 - 8
The subtilisin E gene of Bacillus subtilis is transcribed from a sigma 37 promoter in vivo; Wong SL et al.; A cloned Bacillus subtilis gene (sprE) expressed only during the stationary growth phase is shown to encode the subtilisin E protease, an enzyme associated with sporulation . We have determined the DNA sequence of the sprE promoter region and the promoter-proximal half of the structural gene . The sprE gene codes for a putative 29-residue signal peptide and a 77-residue leader peptide preceding the mature subtilisin sequence . By plasmid integration and phage PBS1 transduction, we have mapped the sprE locus between glyB and metD on the B . subtilis chromosome, a region also containing the hyperprotease-producing hpr gene . In vitro the sprE gene is transcribed by the minor form of RNA polymerase containing a 37,000-dalton sigma factor (sigma 37) . We show by S1 nuclease mapping that sprE transcription initiates at dual start sites both in vitro and in vivo and that the promoter for the downstream site has a characteristic sigma 37 recognition sequence . We propose that the physiological role of the sigma 37 RNA polymerase is to transcribe a class of genes that are catabolite repressed, that encode extracellular enzymes, or that are expressed only during the stationary phase of growth.

J Bacteriol, 1984 Feb, 157(2), 428 - 34
Genome organization of Sp beta c2 bacteriophage carrying the thyP3 gene; Spancake GA et al.; Thymine auxotrophs of Bacillus subtilis strains lysogenic for temperate bacteriophage SP beta c2 were transformed to prototrophy by DNA from related phage phi 3T . During transformation, the phi 3T-encoded thymidylate synthetase gene, thyP3, became integrated into the extreme right end of the SP beta c2 prophage near the bacterial citK gene . Upon heat induction, the transformed B . subtilis cells released SP beta c2T phages that could lysogenize thymine auxotrophs and convert them to prototrophy . Comparison of restriction endonuclease fragments of DNAs from SP beta c2 and SP beta c2T phages revealed that the latter contained a large region of deletion and substitution near the center of the chromosome . This region included the phage attachment site on the SP beta c2 genome.

J Bacteriol, 1984 Feb, 157(2), 612 - 21
Bacillus subtilis glutamine synthetase mutants pleiotropically altered in glucose catabolite repression; Fisher SH et al.; Strain SF22, a glutamine-requiring (Gln-) mutant of Bacillus subtilis SMY, is likely to have a mutation in the structural gene for glutamine synthetase, since this strain synthesized 22 to 55% as much glutamine synthetase antigen as did wild-type cells in a 10-min period but had less than 3% of wild-type glutamine synthetase enzymatic activity . The expression of several genes subject to glucose catabolite repression was altered in the Gln- mutant . The induced levels of alpha-glucosidase, histidase, and aconitase were 3.5- to 4-fold higher in SF22 cells than in wild-type cells grown in glucose-glutamine medium, and citrate synthase levels were 8-fold higher in the Gln- mutant than in wild-type cells . The relief of glucose catabolite repression in the Gln- mutant may result from poor utilization of glucose . Examination of the intracellular metabolite pools of cells grown in glucose-glutamine medium showed that the glucose-6-phosphate pool was 2.5-fold lower, the pyruvate pool was 4-fold lower, and the 2-ketoglutarate pool was 2.5-fold lower in the Gln- cells than they were in wild-type cells . Intracellular levels of glutamine were sixfold higher in the Gln- mutant than in wild-type cells . Measurements of enzymes involved in glutamine transport and utilization showed that the elevated pools of glutamine in the Gln- mutant resulted from a threefold increase in glutamine permease and a fivefold decrease in glutamate synthase . The pleiotropic effect of the gln-22 mutation on the expression of several genes suggests that either the glutamine synthetase protein or its enzymatic product, glutamine, is involved in the regulation of several metabolic pathways in B . subtilis.

Biochemistry, 1984 Jan 31, 23(3), 438 - 45
Two-dimensional gel electrophoresis technique for determination of the cross-linked nucleotides in cleavable covalent RNA-RNA complexes . Application to Escherichia coli and Bacillus subtilis acetylvalyl-tRNA covalently linked to E . coli 16S and yeast 18S ribosomal RNA; Ehresmann C et al.; We have developed a new method which yields in a single step the site of cross-linking between two oligonucleotides covalently linked by a cleavable bond . The isolated duplex, labeled at both 5'-ends, is split randomly and then analyzed by diagonal gel electrophoresis with cleavage of the cross-link between the two gel dimensions . Digestion products which do not contain the cross-link migrate along the diagonal, while products resulting from cleavage of the cross-link migrate as off-diagonal products . The site of cross-linking is determined by analysis of both diagonal and off-diagonal products . This method was successfully applied to three different oligonucleotide duplexes isolated by T1 RNase digestion from Escherichia coli tRNA covalently linked at the ribosomal P site to either Escherichia coli 16S RNA or yeast 18S RNA and from Bacillus subtilis tRNA cross-linked to Escherichia coli 16S RNA . The site of cross-linking was unambiguously localized to C1400 in Escherichia coli 16S RNA and to the equivalent position, C1626, in yeast 18S RNA . Direct evidence was also provided for the participation of the wobble base (c)mo5U34 of the tRNA in the cross-link . Furthermore, our results exclude the possibility of minor cross-linking sites at other positions . This new method is reliable, rapid, and easy to handle and should be applicable to any cleavable covalent RNA-RNA duplex . Furthermore, it is sensitive to certain aspects of the steric conformation of such covalent duplexes.

Biochemistry, 1984 Jan 31, 23(3), 429 - 37
Cross-linking of the anticodon of Escherichia coli and Bacillus subtilis acetylvalyl-tRNA to the ribosomal P site . Characterization of a unique site in both E . coli 16S and yeast 18S ribosomal RNA; Ehresmann C et al.; The nucleotide residues involved in the cross-link between P site bound acetylvalyl-tRNA (AcVal-tRNA) and 16-18S rRNA have been identified . This cross-link was formed by irradiation of Escherichia coli or Bacillus subtilis AcVal-tRNA bound to the P site of E . coli ribosomes or by irradiation of E . coli AcVal-tRNA bound to the P site of yeast ribosomes . The three cross-linked RNA heterodimers were obtained in 10-35% purity by disruption of the irradiated ribosome-tRNA complex with sodium dodecyl sulfate followed by sucrose gradient centrifugation . After total digestion with RNase T1, and labeling at either the 5'- or the 3'-end, the cross-linked oligomers could be identified and isolated before and after photolytic splitting of the cross-link . One of the oligomers was shown to be UACACACCG, a unique rRNA nonamer present in an evolutionarily conserved region . This oligomer was found in all three heterodimers . The other oligomer of the dimer had the sequence expected for the RNase T1 product encompassing the anticodon of the tRNA used . The precise site of cross-linking was determined by two novel methods . Bisulfite modification of the oligonucleotide dimer converted all C residues to U, except for any cross-linked C which would be resistant by being part of a cyclobutane dimer . Sequencing gel analysis of the UACACACCG oligomer showed that the C residue protected was the 3'-penultimate C residue, C1400 in E . coli rRNA or C1626 in yeast rRNA.(ABSTRACT TRUNCATED AT 250 WORDS)

Nucleic Acids Res, 1984 Jan 25, 12(2), 901 - 14
DNA binding and antigenic specifications of DNA gyrase; Lother H et al.; Complexes of DNA gyrase and minichromosomal DNA containing the origin of replication of Escherichia coli (oriC) can be formed without metabolic energy and visualised by electron microscopy . The A subunit, part of the A2B2-DNA gyrase complex is the binding protein . Various binding sites are scattered around the minichromosomal DNA including oriC . The minimal origin contains the only prominent and reproducible binding site . Binding to this site is suppressed by oxolinic acid and the ATP analogue beta-y-imido ATP . If gyrase isolated from the gram-positive bacterium Bacillus subtilis is used no binding to oriC is seen . This observation is consistent with antigenic differences between the A subunits of the two microorganisms . The binding to oriC might reflect a requirement for DNA gyrase during the initiation of DNA replication.

J Virol, 1984 Jan, 49(1), 300 - 1
Dissection of HA20, a double mutant of bacteriophage SPO1; Stewart CR; HA20, a mutant of Bacillus subtilis phage SPO1, is deficient in both DNA replication and late transcription . HA20 contains mutations in two different genes, which suggested that the two effects might be caused independently . However, single-mutation derivatives, affected only in gene 27, were deficient for both activities . Thus, a single mutation apparently affects both DNA replication and late transcription.

Mol Gen Genet, 1984, 197(3), 522 - 4
Plasmid transformation in Bacillus subtilis: factors affecting the synapsis of donor and recipient DNA; Ceglowski P et al.; Hybrid plasmids were constructed in which the transcription of regions of inserted DNA was defined . Cells containing these plasmids were transformed with monomeric forms of a different hybrid plasmid, which contained, however, the same inserted DNA as the resident plasmid . The transformation frequencies observed indicated that transcription of homologous DNA in resident plasmids and also tertiary DNA structure interfered with transformation.

Mol Gen Genet, 1984, 197(3), 478 - 85
Heterospecific transformation in Bacillus subtilis: protein composition of a membrane-DNA complex containing unstable heterologous donor-recipient complex; te Riele HP et al.; Previously it was demonstrated that, in contrast to the homologous donor-recipient complex, the unstable heterologous donor-recipient complex remains bound to the cellular membrane . To examine whether proteins known to be involved in the processing of transforming DNA in Bacillus subtilis are associated with membrane fragments which carry chromosomal DNA, a crude membrane-DNA complex was subjected to electrophoresis through a sucrose gradient . This resulted in the separation of membrane fragments associated with DNA and free membrane fragments . By means of two-dimensional gel electrophoresis several proteins, either uniquely present or considerably enriched in the purified membrane-DNA complex, were detected . Among these proteins we identified the 45 kD recE gene product, required for recombination, the 18 kD binding protein involved in the binding of transforming DNA and a 17 kD nuclease involved in the entry of transforming DNA . These results suggest that the membrane sites at which donor DNA integrates into the recipient chromosome are in the vicinity of the sites of entry of donor DNA through the membrane.

Nucleic Acids Symp Ser, 1984, (15), 121 - 4
Enzymatic synthesis of anticodon-deleted and replaced Bacillus subtilis tRNAThr and their amino acid acceptor activity; Hasegawa T et al.; By some enzymatic and chemical procedures, one or two nucleotides in the anticodon region of Bacillus subtilis tRNAThr were deleted and a part of the anticodon sequence was replaced . The anticodon-deleted molecules retained amino acid acceptor activity although the activity was low . However, the anticodon-replaced molecule which has a lysine specific sequence (U-U-U) exhibited neither threonine acceptor activity nor lysine acceptor activity.

Microbiol Immunol, 1984, 28(11), 1203 - 10
Effect of glucose on the interaction of hydrophobic compounds with the alanine receptor field of Bacillus subtilis spores during initiation of germination; Yasuda Y et al.; Glucose interfered with the inhibitory action of hydrophobic compounds, such as n-octanol, diphenylamine and 2-tert-butylphenol, during L-alanine-initiated germination of Bacillus subtilis spores . The action of glucose on the action of the hydrophobic compounds was not competitive, and the binding affinity of glucose was not essentially affected by the hydrophobic compounds, indicating the presence of separate binding sites for glucose and the hydrophobic compounds . The binding affinity of D-alanine, a competitive inhibitor of L-alanine, was not affected by the hydrophobic compounds, indicating separate binding sites for D-alanine and the hydrophobic compounds . A possible arrangement of the binding sites for glucose and for the hydrophobic compounds in relation to those for L- and D-alanine on the spores is discussed.

Mol Gen Genet, 1984, 197(1), 46 - 54
Recombination between repeated DNA sequences occurs more often in plasmids than in the chromosome of Bacillus subtilis; Niaudet B et al.; Directly repeated pBR322 sequences 3.7-3.8 kb long recombine with a frequency of about 10% per generation when carried on plasmids related to pC194 and 0.01% per generation when carried on the Bacillus subtilis chromosome . Recombination is therefore 1,000 times more efficient in plasmids than in the chromosome of this organism.

Z Allg Mikrobiol, 1984, 24(8), 575 - 9
Formation of extracellular alpha-amylase by Bacillus subtilis in relation to guanosine polyphosphates; Wambutt R et al.; The kinetics of growth, extracellular alpha-amylase formation and pool sizes of guanosine polyphosphates (p)ppGpp and adenosine phosphates (ATP and AMP) were determined during discontinuous cultivation of Bacillus subtilis 44 . The results indicate a positive involvement of (p)ppGpp in the regulation of the expression of the alpha-amylase gene.

Mol Gen Genet, 1984, 196(3), 488 - 93
Complementation and genetic inactivation: two alternative mechanisms leading to prototrophy in diploid bacterial clones; Levi-Meyrueis C et al.; Evidence for diploidy at loci located all around the Bacillus subtilis chromosome previously led us to refer to the prototrophic bacterial clones produced by fusion of polyauxotrophic protoplasts as complementing diploid clones (Levi-Meyrueis et al . 1980; Sanchez-Rivas 1982) . In this paper, evidence is presented that gene inactivation may occur in such clones, as judged from the unequal expression of three unselected markers and their low transforming activity in cell lysates, an established property of inactivated genes (Bohin et al . 1982) . The insensitivity to protease treatment of the lysates and also the low transforming activity observed with purified DNA may indicate that chromosome inactivation does not necessarily result from the mere attachment of proteins to DNA . Cotransfer by transformation of similarly expressed genes, initially located on separate chromosomes, suggests that genetic recombination has taken place, resulting in the reassortment of active and inactive genes on separate chromosomes . Several genetic structures compatible with the observations are presented which illustrate that prototrophy may result from such reassortment as well as from functional complementation.

Mol Gen Genet, 1984, 196(3), 381 - 6
Bacteriophage phi 29 DNA replication in vitro: participation of the terminal protein and the gene 2 product in elongation; Matsumoto K et al.; From phi 29-infected Bacillus subtilis cells, we have isolated a protein fraction which promotes in vitro replication of phi 29 DNA . This fraction catalyses both initiation and elongation, indicating that it contains the product of gene 3 (tp: terminal protein) and the product of gene 2 (gp2: probably a DNA polymerase), since initiation requires the two products (Blanco et al . 1983; Matsumoto et al . 1983) . The fractions isolated from cells infected with temperature-sensitive (ts) mutants of gene 2 and gene 3 were thermolabile in both the initiation and elongation assays . When the pre-initiated material from the ts fractions of each mutant was heat-inactivated and mixed no complementation, restoring the elongation activity, was found . These results indicate: (i) tp and gp2 participate not only in the initiation but also in the elongation of phi 29 DNA replication, (ii) they probably function in tight physical association with each other.

Folia Microbiol (Praha), 1984, 29(5), 359 - 64
Kinetics of alpha-amylase production in a batch and a fed-batch culture of Bacillus subtilis; Baig MA et al.; Analysis of the kinetics of alpha-amylase production in a batch and a fed-batch culture of Bacillus subtilis made it possible to derive a kinetic model of the process describing mutual interactions between growth and production . The specific growth rate is limited by the concentration of both corn-steep liquor and starch . Higher concentrations of reducing sugars in the medium also inhibit growth . The overall production of alpha-amylase is a result of an equilibrium between the rate of enzyme production and its degradation due to the effect of environment . The actual specific production rate is directly proportional to the specific growth rate (characterizing the physiological state of the culture) and is inhibited by higher concentrations of corn-steep liquor in the medium.

Mol Gen Genet, 1984, 195(1-2), 370 - 3
Restriction of hemimethylated DNA by the Bacillus subtilis R system; Bron S et al.; The effects of restriction by the BsuR system on hemimethylated SPP1 DNA were investigated . In vitro, single-stranded nicks were introduced in the nonmodified strand of the hemimethylated DNA at the same sites as recognized in nonmodified homoduplex DNA . Transfection with BsuR-treated hemimethylated DNA was severely reduced . In vivo, transfection with hemimethylated DNA was also severely reduced in competent B . subtilis R cells . In contrast, transfection of protoplasts of the R strain with this DNA was not affected . The apparent restriction by competent cells was attributed to the special mode of processing of transfecting DNA.

Mol Gen Genet, 1984, 195(1-2), 200 - 8
Molecular fate of heterologous bacterial DNA in competent Bacillus subtilis: further characterization of unstable association between donor and recipient DNA and the involvement of the cellular membrane; te Riele HP et al.; Although heterospecific transformation is extremely inefficient and very little heterologous donor DNA integrates into the recipient chromosome in a stable way, we have previously shown that B . pumilus DNA entering competent B . subtilis efficiently associates with the recipient chromosome in an unstable way . This association can be stabilized by photocrosslinking in the presence of 4,5',8-trimethylpsoralen; it depends on the recombination proficiency of the recipient strain and on strand-separation of the recipient chromosome (te Riele and Venema 1982b) . The present study provides further evidence that the heterologous donor DNA and the recipient DNA are associated by regions of base-pairing . Based on the high sensitivity of the donor moiety in the complex to nuclease S1 (90%) and the high sensitivity of the complex to moderate denaturing conditions (Tm = 48 degrees C), we presume that donor and recipient DNA are associated either by several short sequences of 15-25 fairly well matched base pairs or by a region of base-pairing of about 200 bases, which contains 25% of mismatches . During incubation, the unstable complex disappears, probably due to nucleolytic degradation . The unstable heterologous donor-recipient complex (DRC) was found to be membrane-bound . However, in contrast to homologous DRC, the unstable heterologous DRC remains membrane bound during incubation . Apparently, the predominantly single-stranded character of the heterologous DRC prevents release of the complex from the membrane.

Mol Gen Genet, 1984, 195(1-2), 175 - 9
Repair of UV damage in plasmid DNA by human fibroblasts; Mooibroek H et al.; Plasmid DNA from Bacillus subtilis was introduced into monolayers of human fibroblasts by means of a modification of the calcium phosphate coprecipitation technique, comprising centrifugation of the coprecipitate onto the cells and treatment with polyethyleneglycol . The amount of DNA resistant to removal from the monolayers ranged from 10% to 15% of the input DNA . By determination of the biological activity of the plasmid DNA, re-extracted after various periods following entry into the fibroblasts and subsequently used as donor for B . subtilis protoplasts, it was shown that the activity of the plasmid DNA was gradually lost . When ultraviolet light-inactivated plasmid DNA was used as donor, reactivation of the plasmid was observed, which was completed within 2 h . The dose-dependent incorporation of {14C}-thymidine suggests that DNA repair processes were involved in reactivation of the plasmid DNA.

Folia Microbiol (Praha), 1984, 29(4), 295 - 300
Standardization of parameters for the mycobacillin synthetase activity; Mukhopadhyay NK et al.; An effective method of preparation involving sonication was developed for cell-free mycobacillin synthetase from Bacillus subtilis . The enzyme showed optimum activity at a buffer concentration of 50 mM (Tris-HCl) and pH 7.5 . ATP and Mg2+ which were essential for synthesis showed an optimum requirement at a ratio of 1:1 . The synthetase was markedly inhibited by ADP whereas AMP was without any effect . ATP or ATP-generating system could not be replaced by GTP, UTP or CTP . Co2+ and Mn2+ could to some extent substitute Mg2+ . Mercapto reagents inhibited the antibiotic synthesis . Exogenous addition of pantothenic acid had no effect.

Z Allg Mikrobiol, 1984, 24(6), 397 - 401
{Protein biosynthesis following heat shock in Bacillus subtilis}; Wachlin G et al.; Heat-activated spores of Bacillus subtilis synthesize during the early outgrowth special proteins which are absent from vegetative cells (Hecker 1983) . Some of these outgrowth-specific proteins may be synthesized in response to heat activation of spores . In vegetative cells of B . subtilis synthesis of several proteins is markedly induced when temperature is shifted up from 30 to 44 degrees C . None of these putative heat shock proteins is synthesized during early outgrowth of heat-activated spores at 30 degrees C.

Orig Life, 1984, 14(1-4), 825 - 32
Photobiology in space: an experiment on Spacelab I; Horneck G et al.; The joint European/US Spacelab Mission I, scheduled for October 1983 for a 9 day lasting Earth-orbiting flight, provides a laboratory system for various disciplines of science, including exobiology . On the pallet, in the experiment ES 029 "Microorganisms and Biomolecules in Space Hard Environment" 316 dry samples of Bacillus subtilis spores will be exposed to space vacuum and/or selected wavelenghs of solar UV radiation . After recovery action spectra of inactivation, mutation induction, reparability and photochemical damage in DNA and protein will be determined . The results will contribute to the understanding of the mechanism of the increased UV sensitivity of bacterial spores in vacuo and to a better assessment of the chance of survival of resistant life forms in space and of interplanetary transfer of life.

Mol Gen Genet, 1984, 194(3), 451 - 6
Prophage induction in thermosensitive DNA mutants of Bacillus subtilis; Mauel C et al.; Incubation of thermosensitive dna mutants of Bacillus subtilis at the non-permissive temperature leads in some instances to induction of defective prophage PBSX and cell lysis . A clear distinction can be made between mutants affected in DNA replication at the growing point (extension mutants) and those unable to initiate new rounds of replication (initiation mutants) . The former promote PBSX induction to a variable and mutation-specific extent, whereas the latter do not exhibit any signs of induction . Analysis of mutants carrying two dna mutations suggests that products of some dna genes involved in initiation and in extension are not essential for induction but can substantially amplify its extent . However, mitomycin C treatment of dna mutants which have completed their residual DNA synthesis leads to a PBSX induction essentially identical to that obtained by mitomycin C treatment of the wild-type strain, which precludes an essential role for any of the mutated proteins in this induction process . On the basis of our observations we propose that the induction signal is related to the number of blocked replication forks: the larger that number, the higher the proportion of induced cells within the population.

Microbiol Immunol, 1984, 28(2), 197 - 207
Relation between D-glucose and L- and D-alanine in the initiation of germination of Bacillus subtilis spore; Yasuda Y et al.; The rate of L-alanine-initiated germination of Bacillus subtilis spore was measured by both loss of heat resistance and loss of turbidity, and the effect of glucose on the germination response to a wide range of concentrations of the germinant was analyzed in the presence and absence of D-alanine, an inhibitor . Glucose stimulated L-alanine germination by means of a cooperative effect: glucose increased the affinity of L-alanine by about 3-fold and the rate of germination by about 1.3-fold . However, glucose had little effect on the binding affinity of D-alanine . The apparent binding constant of L-alanine to the spore, which was determined by the next measurable event in the trigger reaction, was 1.2 X 10(-5), that of D-alanine was 6 X 10(-6), and that of glucose was 5 X 10(-5) . The relation between the binding site for glucose and those for L- and D-alanine on the spore is discussed . Effect of glucose analogs was also examined.

Gene, 1984 Jan, 27(1), 55 - 65
Nucleotide sequence of the Bacillus subtilis trpE and trpD genes; Band L et al.; Several overlapping portions of the tryptophan (trp) operon of Bacillus subtilis have been cloned into plasmid pBR322 . The nucleotide sequence of the region comprising the trpE and trpD genes and a portion of the trpC gene has been determined . When the deduced amino acid sequences of these genes are compared with their counterparts in Escherichia coli, several regions of striking homology are seen . The probable initiation codons for the trpE, D and C genes are each preceded by a recognizable Shine-Dalgarno sequence . The coding sequences for the trpE and trpD genes and for the trpD and trpC genes overlap slightly, leaving no intercistronic regions between the genes.

Mol Gen Genet, 1984, 193(3), 500 - 6
Involvement of single-strand breaks in complex formation between single-stranded DNA and nucleoids of Bacillus subtilis; van Randen J et al.; RNase-unfolded chromosomes of competent Bacillus subtilis are able to take up single-stranded homologous donor DNA fragments in vitro to form donor-recipient DNA complexes (Van Randen and Venema 1981) . The unfolded chromosomes behave as supercoiled DNA molecules . X-irradiation increased the formation of unstable and stable complexes between donor and recipient DNA during incubation at 37 degrees C . The complex-forming ability of the unfolded chromosomes increased linearly with increasing X-ray dose, even after complete relaxation of the unfolded chromosomes had occurred . Limited DNase I action increased the complex-forming ability of the chromosomes as effectively as X-irradiation . Unstable donor-recipient DNA complexes can be distinguished from stable ones by their dissociation upon density gradient centrifugation in CsCl at pH 11.2 . They are stable at pH 10 (Van Randen et al . 1982a) . At an intermediate pH value during isopycnic centrifugation, a fraction of the unstable complexes were stable, suggesting that a range of stabilities existed among the unstable complexes . The donor moiety of the stable donor-recipient DNA complexes was far more resistant to nuclease S1 treatment than that of the unstable ones.

Tsitol Genet, 1984 Jan-Feb, 18(1), 58 - 60
{Expression of the genes for lysine biosynthesis of Bacillus subtilis in Escherichia coli cells}; Shevchenko TN et al.; Hybrid plasmids pLRS33 and pLRB4 containing Bac . subtilis genes coding lysin biosynthesis were subjected to genetical analysis . It is shown that after pLRS33- and pLRB4- transformation of E . coli strains, auxotrophic relative to lysin and diaminopimelic acid, there occurs complementation of dapA, dapB, dapC, dapD, dapE, lysA mutations by plasmid pLRS33 and of dapC, dapB, lysA mutations by plasmid pLRB4 . The plasmids are studied for their influence on the level of lysin and its precurror synthesis in E . coli strains.

Proc Natl Acad Sci U S A, 1984 Jan, 81(2), 439 - 43
Use of the Escherichia coli lac repressor and operator to control gene expression in Bacillus subtilis; Yansura DG et al.; The Escherichia coli lac operator has been placed on the 3' side of the promoter for the penicillinase gene of Bacillus licheniformis, creating a hybrid promoter controllable by the E . coli lac repressor . The E . coli lac repressor gene has been placed under the control of a promoter and ribosome-binding site that allows expression in Bacillus subtilis . When the penicillinase gene that contains the lac operator is expressed in B . subtilis on a plasmid that also produces the lac repressor, the expression of the penicillinase gene can be modulated by isopropyl beta-D-thiogalactoside (IPTG), an inducer of the lac operon in E . coli . A similar system was constructed from a promoter of the B . subtilis phage SPO-1 and the leukocyte interferon A gene, which allowed the controlled expression of interferon in B . subtilis . These two examples show that a functional control system can be introduced into B . subtilis from E . coli.

Mol Gen Genet, 1984, 193(2), 364 - 9
Genetic mapping of a mutation causing an alteration in Bacillus subtilis ribosomal protein S4; Henkin TM et al.; A mutation causing an alteration in Bacillus subtilis ribosomal protein S4 was mapped by transformation and PBS-1 transduction to a site between aroG and argA, a region of the B . subtilis chromosome not previously demonstrated to contain ribosomal protein genes . The S4 mutation conferred a spore-plus phenotype in a streptomycin-resistant, spore-minus genetic background . The altered protein was detectable by polyacrylamide gel electrophoresis of ribosomal proteins of recombinants scored for the spore-plus phenotype in genetic crosses.

Mol Gen Genet, 1984, 193(1), 85 - 91
Intracellular effects of phage phi W-14 DNA on transformation of Bacillus subtilis; Lopez P et al.; Uptake of transforming DNA by competent Bacillus subtilis cells in the presence of phage phi W-14 DNA (in which half the thymine residues are replaced by alpha-putrescinyl-thymine) is accompanied by a decrease in the amount of trichloracetic acid-precipitable label of the former retained by recipient cells during subsequent incubation . Fractionation of lysates of cells incubated for 0.5 min at 37 degrees C after DNA uptake at 30 degrees C in the presence of low concentrations of phi W-14 DNA (0.1 microgram/ml) demonstrated the presence of single-stranded transforming DNA molecules, typical for DNA taken up by B . subtilis . The intracellular effect of phi W-14 DNA was enhanced by an increase in its concentration (to 0.5-1 microgram/ml), or by increasing the temperature of uptake (to 37 degrees C) . With either of these treatments transforming DNA taken up was found in the form of a broad asymmetric band, indicative of degradation, and partially located at the density characteristic for single-stranded molecules . Fractionation of lysates of cells treated (0.1 microgram/ml) or untreated with phi W-14 DNA, and incubated for 20 min at 37 degrees C after DNA uptake, showed disappearance of the single-stranded band . Donor DNA label was then found exclusively in the recipient DNA band, its amount being lower in samples treated with phi W-14 DNA . The influence of a high concentration of phi W-14 DNA on retention of transforming DNA label was correlated with its effect on transformation.(ABSTRACT TRUNCATED AT 250 WORDS)

J Bacteriol, 1984 Jan, 157(1), 318 - 20
Absence of correlation between rates of cell wall turnover and autolysis shown by Bacillus subtilis mutants; Vitkovic L et al.; Bacillus subtilis mutants with reduced rates of cell wall autolysis reached a constant rate of wall turnover after a longer lag than the standard strain but eventually showed the same turnover rate . In reverse, a turnover-deficient mutant autolysed at a slightly higher rate than the standard strain . Consequently, there is no correlation between the rates of cell wall turnover and autolysis.

J Bacteriol, 1984 Jan, 157(1), 202 - 10
Genetic analysis of a streptomycin-resistant oligosporogenous Bacillus subtilis mutant; Henkin TM et al.; Strain SRB15T+, a streptomycin-resistant, oligosporogenous mutant of Bacillus subtilis, contains two mutations, fun and strR . These mutations were mapped by PBS-1 mediated transduction and by transformation to two different sites in the cysA-linked region of the B . subtilis chromosome . The fun mutation mapped very close to rpsLl, a classic strA mutation, whereas strR mapped to a site distal to rpsE . The effects of these mutations on growth, sporulation, and streptomycin resistance in vivo and in vitro were determined . The fun mutation gave a different phenotype than did the rpsLl mutation and caused altered migration of a ribosomal protein which was identified as S12, the protein encoded by rpsL . It therefore appears that fun is an allele of the rpsL gene.

J Bacteriol, 1984 Jan, 157(1), 109 - 14
Morphological and genetic characterization of a bacteriophage-resistant Bacillus subtilis macrofiber-producing strain; Saxe CL 3rd et al.; Bacillus subtilis C6 phi R4 is an SPO1-resistant derivative of strain C6D, a left-hand macrofiber-producing strain described previously (N . H . Mendelson, Proc . Natl . Acad . Sci . U.S.A . 75:2478-2482, 1978) . In addition to the phage resistance property, strain C6 phi R4 differs from its parent in macrofiber organization and formation of aggregates in liquid shake cultures . The phage resistance mutation was located in the gtaC gene . The macrofiber organization and aggregation phenotypes also appear to be controlled by the gtaC locus . Strains constructed by introduction of the gtaC mutation into C6D appear to be identical to the original C6 phi R4 strain in all phenotypic properties . In contrast, other constructs carrying either gtaA or gtaB that are resistant to SPO1 do not display the characteristic C6 phi R4 morphological phenotypes.

Folia Biol (Praha), 1984, 30 Spec No, 52 - 64
Comparison of Bacillus subtilis phages PZA, phi 29 and phi 15; Paces V et al.; Morphologically identical phages PZA, PZE , phi 29, and phi 15 can be distinguished by the neutralization test with rabbit antisera and by host range specificity . Each member of this phage group contains 18 kb double-stranded linear DNA carrying proteins covalently attached to its 5' ends . Physical maps of their DNA constructed with the use of restriction endonucleases EcoRI, HpaI, HindIII, BspRI, and XbaI and DNA-DNA hybridization experiments show a closer relationship between phi 29 and PZE than between phi 29 and phi 15 or phi 29 and PZA . phi 15 is closer to PZA than to phi 29 . This conclusion is supported by analysis of differential denaturation profiles of the phage DNAs . Sequencing of selected parts of phi 29 and PZA DNAs reveals 93% homology with a preference for synonymous base replacements (silent mutations) randomly distributed in the coding regions . Using promoter-probe plasmid pPV33 -H the region functioning as a promoter in E . coli was localized on the smallest EcoRI fragment of PZA and phi 29 DNAs . Comparison of the nucleotide sequence of this region with known promoters of B . subtilis shows extensive homologies with at least two types of promoters of different specificities, namely those recognized by factors sigma 28 of B . subtilis and sigma gp28 of phage SPO1 . These promoter-like regions overlap and the whole sequence is conserved in both phages.

J Biochem (Tokyo), 1984 Jan, 95(1), 87 - 93
A Bacillus subtilis secretion vector system derived from the B . subtilis alpha-amylase promoter and signal sequence region, and secretion of Escherichia coli beta-lactamase by the vector system; Ohmura K et al.; A secretion vector system in Bacillus subtilis was constructed from the alpha-amylase promoter and signal sequence coding region of an alpha-amylase hyperproducing strain, B . subtilis NA64, and the major part of the plasmid pTUB4 which was derived from pUB110 . When an Escherichia coli beta-lactamase gene, lacking its own promoter and signal sequence coding region, was introduced into the secretion vector system, beta-lactamase was expressed in B . subtilis . In addition, more than 95% of the enzyme synthesized was secreted into the culture medium via the secretion vector system . Secreted beta-lactamase crossreacted with rabbit antiserum raised against the E . coli enzyme.

Mol Gen Genet, 1984, 193(2), 306 - 11
Molecular cloning with bifunctional plasmid vectors in Bacillus subtilis . II . Transfer of sequences propagated in Escherichia coli to B . subtilis; Ostroff GR et al.; Recombinant plasmid DNA cloned in E . coli via the bifunctional vector pDH5060 suffered deletions when returned to B . subtilis . However, DNA preparations of identical chimeras containing homologous or heterologous sequences stably transformed B . subtilis at high efficiency when isolated from B . subtilis . The vector pDH5060, however, was not affected and could be stably shuttled between E . coli and B . subtilis at high frequency . These problems affected the transfer of clone pools and individual chimeras, irrespective of the restriction or recombination phenotype of B . subtilis recipients . Deleted chimeras lost at least one end of cloned inserts, and in most cases, flanking plasmid sequences . Single plasmid forms (intact or deleted) were isolated from several hundred individual Cmr-transformants this suggests that events leading to deletion of chimeric plasmid DNA occur during transformation by restriction of unmodified insert sequences propagated in the intermediate host, E . coli . This conclusion is discussed with regard to the mechanism of plasmid transformation in B . subtilis.

Mol Gen Genet, 1984, 193(2), 299 - 305
Molecular cloning with bifunctional plasmid vectors in Bacillus subtilis . I . Construction and analysis of B . subtilis clone banks in Escherichia coli; Ostroff GR et al.; Cloning in Escherichia coli and Bacillus subtilis was carried out using the bifunctional plasmid pDH5060 . B . subtilis chromosomal DNA and pDH5060 DNA were digested with either BamHI or SalI, then annealed, ligated, and transformed into E . coli SK2267 . Transformants containing sequences ligated into the BamHI or SalI sites in the Tcr gene of pDH5060 were selected directly using a modification of the fusaric acid technique . The BamHI and SalI clone banks contain about 250 and 140 B . subtilis fragments, respectively, with an average insert size of 8-9 Kbp in the BamHI and 4-5 Kbp in the SalI bank . The inserts ranged in size from 0.3 Kbp to greater than 20 Kbp . The vector used here therefore accepts inserts which are significantly larger than previously reported for other B . subtilis cloning systems . All individual cloned B . subtilis sequences examined were stably propagated in E . coli SK2267 . Eight of eighteen B . subtilis auxotrophic markers tested (aroG, gltA, glyB, ilvA, metC, purA, pyrD, and thrA) were transformed to prototrophy with BamHI or SalI clone bank DNA . All or part of the hybrid plasmid DNA recombined at the sites of homology in the chromosome of these Rec+ recipients . Loss of sequences from hybrid plasmids was not prevented in a r- m- recE4 recipient strain of B . subtilis . Although the recE4 background prevented recombination between homologous chromosomal DNA, a variety of cloned fragments were shown to be unstable and undergo deletions of both insert and plasmid sequences . In addition, B . subtilis sequences propagated in E . coli transformed B . subtilis recE4 recipients with a 500-1,000-fold reduced efficiency.

J Bacteriol, 1984 Jan, 157(1), 152 - 7
Isolation and characterization of Bacillus subtilis mutants altered in competence; Fani R et al.; We isolated and characterized four Bacillus subtilis competence-deficient mutants . The mutants were obtained by nitrosoguanidine mutagenesis and by screening for mutants unable to be transformed both on solid and in liquid medium . Most of the mutants obtained in this way were tested for their sensitivity to the DNA-damaging agents methyl methanesulfonate, mitomycin C, and UV light . Among the mutants which did not show an increased sensitivity to these agents, four were chosen for further characterization . Data were obtained which indicate that the mutants are reduced in chromosomal and plasmid transformation and in transfection, whereas they are not altered in transduction and in protoplast transformation . Transformation experiments carried out by mixing a culture of a mutant with a culture of a wild-type strain gave some complementation for competence with one of the strains . The mutants were also characterized for their capacity to bind, take up, and break down transforming DNA; furthermore, the four competence mutations were mapped, and the results indicate that they belong to four different genes.

Arch Oral Biol, 1984, 29(8), 587 - 9
Transport to the bloodstream of amylase following retrograde infusion of amylase into the parotid glands in the rat; Ikeno T et al.; Amylase secretion into parotid saliva was increased more by isoprenaline whereas the secretion rate of parotid saliva was increased more by pilocarpine . Retrograde infusion of parotid-amylase solution into excretory ducts of the parotid gland elevated the activity of the enzyme in the serum . Direct evidence that retrogradely-infused amylase reaches the blood from the parotid gland was obtained using amylase prepared from Bacillus subtilis . Pretreatment with pilocarpine accelerated the release of amylase into the blood . The elevation of intraductal pressure may be the primary mechanism for the release of amylase into the blood from the parotid glands.

Folia Biol (Praha), 1984, 30 Spec No, 29 - 35
Possible hyperattenuation of transcription in the Escherichia coli hisG gene cloned in Bacillus subtilis; Ferretti L et al.; The expression of the E . coli hisG gene in B . subtilis cells does not occur in spite of the faithful replication of the relevant DNA fragment cloned in this host by means of a plasmid vector, pHV14 , capable of replication in both B . subtilis and E . coli . Analysis of the RNA transcribed in vitro and in vivo by the B . subtilis RNA polymerase on the cloned hisG sequence indicates that in B . subtilis cells the physiological his operon promoter is not recognized . Transcription is initiated at many sites, some of which are located upstream of and some are located downstream of the his operon promoter . These "adventitious" promoters give rise to convergent transcription products which stop at, or in the vicinity of, the his operon attenuator sequence.

DNA, 1984, 3(1), 17 - 21
Bacillus subtilis requires a "stringent" Shine-Dalgarno region for gene expression; Band L et al.; A series of plasmids was constructed differing only in the sequence of the Shine-Dalgarno region preceding the leukocyte interferon-A gene . This series of plasmids was used to test the efficiency of interferon expression in both Bacillus subtilis and Escherichia coli . In B . subtilis, interferon expression was much more sensitive to changes in the sequence of the Shine-Dalgarno region than in E . coli and it appeared to require more homology to the 3' end of 16S ribosomal RNA.

J Gen Microbiol, 1984 Jan, 130 ( Pt 1), 113 - 7
DNA-dependent ATPases in Bacillus subtilis mutants and in competent cells; Mazza G et al.; Three DNA-dependent ATPases (gamma phosphohydrolases) can be isolated from Bacillus subtilis cells . We studied these enzymes in a number of mutants deficient in recombination or repair functions (rec, uvr) and in competent cells . The recA mutant studied had lower ATPase II activity, while competent cells had higher ATPase I activity, in comparison with the parental strain not brought to competence.

Acta Microbiol Hung, 1984, 31(3), 207 - 11
Effect of pH on the activity of ceftizoxime; Uri JV; The in vitro antibacterial activity of ceftizoxime (Cefizox) is influenced by the ambient pH of the medium . This pH-dependent activity was observed when either the assay discs or the assay medium were buffered . For the conventional disc agar-diffusion assay, using Bacillus subtilis ATCC 6633, the medium buffered to pH 6 had definite advantage for measuring potency and activity . In serial dilution assay, the acidic (pH 6) medium gives better MIC values with Staphylococcus aureus strains . In the case of Escherichia coli strains, the pH of the medium (6, 7.3 and 8) appears to be of less significance.

Mol Gen Genet, 1984, 197(1), 82 - 9
Cloning of a Bacillus subtilis restriction fragment complementing auxotrophic mutants of eight Escherichia coli genes of arginine biosynthesis; Mountain A et al.; Following shotgun cloning of EcoRI fragments of Bacillus subtilis 168 chromosomal DNA in pBR322 a hybrid plasmid, pUL720, was isolated which complements Escherichia coli K12 mutants defective for argA, B, C, D, E, F/I, carA and carB . Restriction analysis revealed that the insert of pUL720 comprises four EcoRI fragments, of sizes 12.0, 6.0, 5.0 and 0.8 kbp . Evidence was obtained from subcloning, Southern blot hybridisation, enzyme stability studies and transformation of B . subtilis arginine auxotrophs that the 12 kbp EcoRI fragment carries all the arg genes . It proved impossible to subclone the intact fragment in isolation in the multicopy vectors pBR322, pBR325 or pACYC184, and although it could be subcloned in the low copy vector pGV1106, propagation of the hybrid rapidly resulted in the selection of stable derivatives carrying, near one end, an insertion of 1 kbp of DNa originating from the E . coli chromosome . These and other stable derivatives resulting from subcloning the 12 kbp EcoRI fragment have lost only the ability to complement for E . coli argC, and it is suggested that sequences located close to the equivalent of argC are involved in destabilising plasmids bearing the 12 kbp fragment in E . coli in a copy number dependent manner.

Mol Gen Genet, 1984, 197(1), 75 - 81
Transcription analysis of a Bacillus subtilis arg gene following cloning in Escherichia coli in an initially unstable hybrid plasmid; Mann NH et al.; Following shotgun cloning of EcoRI fragments of Bacillus subtilis DNA in pBR322, a hybrid plasmid pUL710 was isolated which complements argC but no other auxotrophs of E . coli K12 . Restriction mapping, Southern blotting and other evidence suggest that pUL710 carries an insert of 1.6 kbp, and derives, by deletion of both vector and insert sequences, from a larger but unstable initial hybrid which carried a 12 kbp EcoRI fragment from the B . subtilis chromosome . RecE-dependent integration of pUL710 into the B . subtilis chromosome demonstrated homology between the insert DNA and the argO locus of B . subtilis . pUL710 was found to confer appreciable tetracycline resistance even though the deletion presumed to stabilise the hybrid had inactivated the tet promoter . The results of analysis by Tn5 mutagenesis, transcriptional fusions and run-off in vitro transcription suggest that both the cloned argC gene and the tetracycline gene in pUL710 are expressed from a B . subtilis promoter located very close to the EcoRI cloning site.

Mol Gen Genet, 1984, 195(1-2), 57 - 61
Direct plasmid transfer from replica-plated E . coli colonies to competent B . subtilis cells . Identification of an E . coli clone carrying the hisH and tyrA genes of B . subtilis; van Randen J et al.; We have cloned the hisH tyrA wild-type genes of Bacillus subtilis with the aid of the chimeric plasmid pBJ194, which replicates both in B . subtilis and Escherichia coli . Primary cloning was done in E . coli . The original E . coli clone, carrying the recombinant plasmid (pGR1) which complements hisH tyrA mutants of B . subtilis, was selected directly from a mixture of plated E . coli clones by replicaplating these clones onto minimal agar plates without tyrosine, spread just before with competent B . subtilis cells . After overnight incubation clusters of small colonies had developed exclusively in the E . coli {pGR1} colony prints . The Tyr+ minicolonies were shown to be B . subtilis carrying pGR1 because (i) their appearance depended linearly on the number of B . subtilis cells plated, (ii) they produced extracellular protease and amylase and (iii) plasmids could be reisolated from the minicolonies and used to transform B . subtilis recE4 tyrA1 both to Cmr and Tyr+ . Plasmid pGR1 transfer through replica plating was compared with plasmid transfer in liquid . Both systems depended on transformable B . subtilis strains and were sensitive to DNAseI . However, whereas integration of the tyrA+ gene into the chromosome and concomitant loss of plasmids occurred frequently during regular plasmid transformation of Rec+ B . subtilis, this was a rare event during plasmid transfer through replica plating.

Mol Gen Genet, 1984, 195(1-2), 246 - 51
Expression in Bacillus subtilis of the gene for human urogastrone using synthetic ribosome binding sites; Flock JI et al.; A chemically synthesised gene coding for human urogastrone which was earlier cloned in E . coli (Smith et al . 1982) has now been cloned into expression vectors for Bacillus subtilis . Two types of constructs have been made, one giving production of methionyl-urogastrone and the other giving rise to a methionyl-urogastrone-beta galactosidase fusion polypeptide facilitating quantification of expression levels . The ribosome binding sites used in the expression plasmids are synthetically made oligonucleotides residing on short restriction fragments to allow easy replacement by other ribosome binding sites . Using "shuttle" vectors and constitutive promoters from Bacillus phages phi 105 and SPP1, we were able to detect levels of expression amounting to a few thousand molecules per cell during logarithmic growth in both E . coli and B . subtilis.

Mol Gen Genet, 1984, 195(3), 424 - 33
A novel method for the rapid cloning in Escherichia coli of Bacillus subtilis chromosomal DNA adjacent to Tn917 insertions; Youngman P et al.; A rapid and general procedure has been devised for the pBR322-mediated cloning in Escherichia coli of Bacillus subtilis chromosomal DNA extending in a specified direction from any Tn917 insertion . Derivatives of Tn917 have been constructed that contain a pBR322-derived replicon, together with a chloramphenicol-resistance (Cmr) gene of Gram-positive origin (selectable in B . subtilis), inserted by ligation in two orientations into a SalI restriction site located near the center of the transposon . When linearized plasmid DNA carrying such derivatives was used to transform to Cmr B . subtilis bacteria already containing a chromosomal insertion of Tn917, the pBR322 sequences efficiently became integrated into the chromosomal copy of the transposon by homologous recombination . It was then possible to clone chromosomal sequences adjacent to either transposon insertion junction into E . coli, using a selection for ampicillin-resistance, by transforming CaCl2-treated cells with small amounts of insert-containing DNA that had been digested with various restriction enzymes and then ligated at a dilute concentration . Because pBR322 sequences may be inserted by recombination in either orientation with respect to the transposon arms, a single restriction enzyme (such as EcoRI or SphI) that has a unique recognition site in pBR322 DNA may be used to separately clone chromosomal DNA extending in either direction from the site of any transposon insertion . A family of clones generated from the region of an insertional spo mutation (spoIIH::Tn917) was used in Southern hybridization experiments to verify that cloned material isolated with this procedure accurately reflected the arrangement of sequences present in the chromosome . Strategies are discussed for taking advantage of certain properties inherent in the structure of clones generated in this way to facilitate the identification and study of promoters of insertionally mutated genes.

Biochim Biophys Acta, 1983 Dec 28, 749(3), 302 - 11
Actions of porcine pancreatic and Bacillus subtilis alpha-amylases and Aspergillus niger glucoamylase on phosphorylated (1--4)-alpha-D-glucan; Takeda Y et al.; Porcine pancreatic alpha-amylase (1,4-alpha-D-glucan glucanohydrolase, EC 3.2.1.1) produced O-6-phosphoryl-alpha-D-glucopyranosyl-(1--4)-O-alpha-D-glucopyranosyl -(1--4)-D-glucopyranose (6(3)-phosphoryl maltotriose) and O-alpha-D-glucopyranosyl-(1--4)-O-alpha-D-glucopyranosyl- O-3-phosphoryl-alpha-D-glucopyranosyl-(1--4)-D-glucopyranose (3(2)-phosphoryl maltotetraose) from potato starch upon exhaustive hydrolysis, while Bacillus subtilis alpha-amylase (liquefying type) yielded O-alpha-D-glucopyranosyl-(1--4)-O-6-phosphoryl-alpha-D- -glucopyranosyl-(1--4)-D-glucopyranose (6(2)-phosphoryl maltotriose) and 3(2)-phosphoryl maltotetraose . Thus, the two alpha-amylases cleave different sites in the vicinity of the phosphate group at C-6 of the glucosyl residue but the same site in the vicinity of that at C-3 . Aspergillus niger glucoamylase (1,4-alpha-D-glucan glucohydrolase, EC 3.2.1.3) hydrolyzed the (1--4)-alpha-linkage of the 6-phosphoryl residue at the non-reducing site (Abe, J., Takeda, Y . and Hizukuri, S . (1982) Biochim . Biophys . Acta 703, 26-33) but not that of the 3-phosphoryl residue, leaving a glucosyl residue attached to the 3-phosphoryl residue . These results indicate that the phosphate group at C-3 is more obstructive than that at C-6 for the actions of these three amylases.

Nucleic Acids Res, 1983 Dec 10, 11(23), 8333 - 42
A novel DNA polymerase induced by Bacillus subtilis phage phi 29; Watabe K et al.; A novel DNA polymerase induced by Bacillus subtilis bacteriophage phi 29 has been identified . This polymerase can be separated from host DNA polymerase, by fractionation of extracts prepared from phage infected cells, using phosphocellulose chromatography . The isolated polymerase prefers poly(dA)oligo(dT) as template . The DNA polymerase isolated from the cells infected with a gene 2 temperature sensitive mutant (ts2) showed greater heat-lability than that induced by wild type phi 29 . The ts2 DNA polymerase was also thermolabile for its activity in the formation of a covalent complex between phi 29 terminal protein and dAMP, the initiation step of phi 29 DNA replication . These findings indicate that gene 2 is the structural gene for a phi 29 DNA polymerase required for the complex formation step of DNA initiation.

J Biol Chem, 1983 Dec 10, 258(23), 14284 - 93
Oxidation-reduction properties of the iron-sulfur cluster in Bacillus subtilis glutamine phosphoribosylpyrophosphate amidotransferase; Vollmer SJ et al.; Native Bacillus subtilis glutamine phosphoribosylpyrophosphate amidotransferase contains a {4Fe-4S} cluster in the diamagnetic (+2) state . The cluster is essential for catalytic function, even though amidotransferase does not catalyze a redox reaction . The ability of the Fe-S cluster to undergo oxidation and reduction reactions and the consequences of changes in the redox state of the cluster for enzyme activity were studied . Treatment of the enzyme with oxidants resulted in either no reaction or complete dissolution of the Fe-S cluster and loss of activity . A stable +3 oxidation state was not detected . A small amount of paramagnetic species, probably an oxidized 3Fe cluster, was formed transiently during oxidation . The native cluster was poorly reduced by dithionite, but it could be readily reduced to the +1 state by photoreduction with 5-deazaflavin and oxalate . The reduced enzyme did not display an EPR spectrum typical of {4Fe-4S} ferredoxins in the +1 state, unless it was prepared under denaturing conditions . Mossbauer spectroscopy of reduced 57Fe-enriched amidotransferase confirmed that the cluster was in the +1 state, but the magnetic properties of the reduced cluster observed at 4.2 K indicated that it is characterized by a ground state spin S greater than or equal to 3/2 . The midpoint potential of the +1/+2 couple was too low to measure accurately by conventional techniques, but it was below -600 mV, which is 100 mV more negative than reported for {4Fe-4S} clusters in bacterial ferredoxins . Fully reduced amidotransferase had about 40% of the activity of the native enzyme in glutamine-dependent phosphoribosylamine formation . The fact that both the +1 and +2 forms of the enzyme are active indicates that the cluster does not function as a site of reversible electron transfer during catalysis.

J Mol Biol, 1983 Dec 5, 171(2), 119 - 37
Restriction map of DNA spanning the replication terminus of the Bacillus subtilis chromosome; Weiss AS et al.; The Bacillus subtilis 168 dna-1 chromosome was labelled during sporulation with {3H}thymine for five minutes immediately before termination of replication . The isolated radioactive DNA was cleaved with BamHI (or SalI) and the resulting restriction fragments separated by agarose gel electrophoresis . The individual fragments, fractionated into a series of slices cut from the gel, were then cleaved with SalI (or BamHI) and the double-digest fragments identified by electrophoresis and fluorography . All major fragments and most minor ones present in a whole double-digest were assigned to BamHI and SalI parents . Such information enabled the construction of an unambiguous restriction map of 150 X 10(3) bases of the approximately 250 X 10(3) bases of DNA labelled in the five minutes . In conjunction with published data on the order of replication of restriction fragments as termination is approached, it was clear that most (105 X 10(3) bases) of the mapped DNA was replicated by a major fork moving in one direction towards a BamHI 24.8 X 10(3) base fragment . The 45 X 10(3) bases extending to the other side of this region were labelled only slightly, and presumably was replicated by a fork that approached the other in an opposite direction until its progress was blocked or severely impeded within this region at a site, referred to as terC, sometime (less than 5 min) earlier . The regions of the map replicated in the final 2.5 and 1.0 minute by the major fork were also identified.

Infect Immun, 1983 Dec, 42(3), 973 - 9
Mutagenesis of extrachromosomal genetic determinants for exfoliative toxin B and bacteriocin R1 synthesis in Staphylococcus aureus after plasmid transfer by protoplast fusion; Masterson R et al.; In previous studies, we have shown that a 27-megadalton plasmid (pRW002) in Staphylococcus aureus contains genetic determinants for exfoliative toxin B (ET B) and bacteriocin (Bac R1) synthesis and Bac R1 resistance . Attempts to transform or transduce this plasmid to S . aureus or Bacillus subtilis recipients were not successful . However, genetic transfer of the plasmid was possible after polyethylene glycol-induced fusion of S . aureus protoplasts containing pRW002 and S . aureus protoplasts lacking this plasmid . Some of the resulting fusants lost the ability to make ET B, Bac R1, or both products . Fusants that were Bac R1-, Bac R1s, ET B- all lacked the 27-megadalton pRW002 plasmid . The largest class of fusants was Bac R1+, Bac R1r, ET B- . Immunodiffusion analyses of ET B extracts from 28 fusants showed that four ET B+ strains were cross-reacting mutants that produced ET B protein that was serologically related to, but not identical to, the wild-type toxin . Results indicated that genetic transfer of pRW002 after protoplast fusion induced molecular rearrangements that resulted in mutation of the genetic determinants for ET B and Bac R1 synthesis . Recombination of chromosomal genes was enhanced after CaCl2 was added to the protoplast-fusion mixture.

Gene, 1983 Dec, 26(1), 59 - 65
Molecular cloning of a Bacillus subtilis xylanase gene in Escherichia coli; Bernier R Jr et al.; A gene coding for xylanase synthesis in Bacillus subtilis was isolated by direct shotgun cloning using Escherichia coli as a host . Following partial digestion of B . subtilis chromosomal DNA with PstI or EcoRI restriction enzymes, fragments ranging from 3 to 7 kb were introduced into the PstI or EcoRI sites of pBR325 . Transformed colonies having lost either the ampicillin or chloramphenicol resistance markers were screened directly on 1% xylan plates . Out of 8000 transformants, ten xylanase-positive clones were identified by the clearing zone around lysozyme-treated colonies . Further characterization of one of the clones showed that the xylanase gene was present in a 3.9-kb insert within the PstI site of the plasmid pBR325 . Retransformation of E . coli strain with the xylanase-positive hybrid plasmid pRH271 showed 100% transformation to xylanase production . The intracellular xylanase produced by the transformed E . coli was purified by ion exchange and gel permeation chromatography . The electrophoretic mobility of the purified xylanase indicated an Mr of 22 000.

J Appl Bacteriol, 1983 Dec, 55(3), 495 - 8
A note on inhibition test and electrophoretic detection limits of antibiotics used in British animal husbandry; Bates ML et al.; A four plate microbiological inhibition test (the FPT) and a bioelectrophoretic method were evaluated for their ability to detect a range of antibiotic agents, which may be present as residues in animal tissues following their therapeutic use in animal husbandry . Both methods exhibited a wide range of sensitivities and several of the tested antibiotics could not be detected by either method . The pattern of responses across the bacterial plates in the FPT could not be used to identify agents and the bioelectrophoretic inhibition zone diameters were generally too large to allow the use of Rs values for identification . The Bacillus subtilis pH 7.2 plate with trimethoprim added was as effective as the four bacterial plates used in the FPT in antibiotic detection.

Genetika, 1983 Dec, 19(12), 1958 - 64
{Transformation of competent Bacillus subtilis cells by chromosomal and plasmid DNA incorporated in liposomes}; Glumova EF et al.; Transformation with chromosomal and plasmid DNAs comprised in liposomes of different compositions was studied on competent cells of Bacillus subtilis . Transformation with chromosomal DNA comprised in liposomes appeared to constitute 1.1 to 1.5% of the control, and transformation with plasmid DNA in liposomes reaches 8 to 11%, as compared to the control . It has been revealed that absorbtion of chromosomal or plasmid DNA comprised in liposomes by competent cells is 1-2 orders higher than that of chromosomal or plasmid DNAs which are not contained in liposomes . Besides, chromosomal DNA in liposomes was found to be transferred to competent cells in the double-stranded form, while during common transformation without liposomes, the DNA transferred is single-stranded.

J Bacteriol, 1983 Dec, 156(3), 1107 - 17
Specificity and control of uptake of purines and other compounds in Bacillus subtilis; Beaman TC et al.; Certain nucleotides control adaptation to changing nutrition or differentiation (sporulation) resulting from a general nutritional deficiency . To maintain the adaptation or differentiation process, once it has started, it may have been important for cells to evolve several independent and metabolically controllable systems enabling the uptake and metabolism of various nucleic acid bases or nucleosides . We have analyzed the cellular reactions with these compounds by measuring both their effect on growth and their uptake in appropriately chosen auxotrophic and uptake mutants . We have found one uptake system for guanine and hypoxanthine, another one for guanosine and inosine, and three other systems for adenine, adenosine, and uracil . The uptake systems of guanine-hypoxanthine and guanosine-inosine are inhibited by the stringent response to amino acid deprivation (increase of guanosine 5'-diphosphate-3'-diphosphate), but they do not depend on the concentration of GTP, which decreases during sporulation . In contrast, the uptake of Ura depends on the presence of GTP, regardless of whether a GTP decrease was produced by the stringent response or otherwise . This was the only uptake system whose decrease was always correlated with the onset of sporulation . The uptake of other compounds, e.g., alpha-methylglucoside and alpha-aminoisobutyric acid, decreased under some, but not all, sporulation conditions.

Gene, 1983 Dec, 26(2-3), 313 - 5
Construction of a vector for cloning promoters in Bacillus subtilis; Band L et al.; A versatile vector for cloning DNA fragments containing promoter activity in Bacillus subtilis was derived from plasmids pBR322, pUB110 and pC194 . Selection is based on chloramphenicol resistance which is dependent upon the introduction of DNA fragments allowing expression of a chloramphenicol acetyl transferase gene . The plasmid contains a second selectable marker, neomycin resistance, and contains functional origins of replication for both B . subtilis and Escherichia coli.

J Antibiot (Tokyo), 1983 Dec, 36(12), 1638 - 43
New streptothricin-group antibiotics, AN-201 I and II . Screening, fermentation, isolation, structure and biological activity; Miyashiro S et al.; Two streptothricin-group antibiotics, AN-201 I and II, were newly discovered and isolated from the culture broth of Streptomyces nojiriensis C-13 . These antibiotics were purified by IRC-50 (H+) and CM-Sephadex C-50 chromatography, and paper electrophoresis . Structural analysis of AN-201 I and II showed that they were N beta-acetylated derivatives of streptothricin E and D, respectively . They had antibacterial activities against several strains of Escherichia coli, Bacillus subtilis, Micrococcus luteus and Staphylococcus aureus, and showed a strong selective cytotoxic effect on 3T3 cells transformed with SV-40 as compared with their normal cells in a test system in vitro as well as in vivo.

J Bacteriol, 1983 Dec, 156(3), 1099 - 106
Rates of peptidoglycan turnover and cell growth of Bacillus subtilis are correlated; Cheung HY et al.; Peptidoglycan turnover was measured by the decrease of trichloroacetic acid-precipitable label in cells labeled with N-acetyl-D-{14C}glucosamine . The rate of turnover was reduced strongly by the inhibition of RNA or protein synthesis and weakly by the inhibition of lipid, peptidoglycan, or DNA synthesis . It increased with the growth rate (which was controlled by the concentration of oxomethylvalerate limiting the intracellular isoleucine supply) to the same degree in stringent (rel+) and isogenic relaxed (relA) strains . In these and all other strains tested, the turnover rate (k) increased with the growth rate (g) according to the equation, k = 0.70 X g1.38, even when the growth rate was systematically altered by changes in the temperature or in the composition of the medium.

Nucleic Acids Res, 1983 Nov 25, 11(22), 7911 - 25
Cloning, sequencing, and secretion of Bacillus amyloliquefaciens subtilisin in Bacillus subtilis; Wells JA et al.; The subtilisin gene from B . amyloliquefaciens has been cloned and expressed under its own promoter on a high copy plasmid, pBS42, in Bacillus subtilis I-168 (Marburg strain) . Greater than 95 percent of the expressed protease activity is secreted, and the activity is sensitive to inhibition by phenylmethylsulfonyl fluoride as expected for subtilisin . Bacillus subtilis transformants carrying the Bacillus amyloliquefaciens subtilisin gene in pBS42 (called pS4) secreted large amounts of a protein not seen in control pBS42 transformants . This protein migrated in SDS gels near the position of authentic subtilisin . The complete nucleotide sequence of the cloned gene has been determined using dideoxy sequencing methods . Ba131 exonuclease digestion studies at the 5' end of the gene have defined a 31 base pair stretch necessary for efficient expression of subtilisin . In addition to this putative promoter region, sequences have been assigned for ribosome binding, translation initiation, a signal peptide, the mature enzyme, and translation and transcription termination . A most interesting feature of the gene is a sequence of unknown function coding for roughly 75 amino acids between the signal sequence and the mature enzyme . It is proposed that this region serve as a pro-peptide as is commonly found in eukaryotic secreted proteases.

J Assoc Off Anal Chem, 1983 Nov, 66(6), 1506 - 9
Identification and semiquantitation of monensin sodium in animal feeds by thin layer bioautography; Martinez EE et al.; A bioautographic technique for the determination of monensin sodium contamination in animal feeds is described . The feeds are extracted in aqueous methanol and the initial monensin extracts are isolated by filtration through an alumina column . These eluates are partitioned between 5% NaCl and methylene chloride, and are further purified through a Sephadex LH-20 column . A 10 mL eluate containing the monensin is collected from the Sephadex column and evaporated, and the residue is dissolved in methylene chloride . Aliquots are spotted on a thin layer plate and monensin is detected by a thin layer bioautographic technique, using Bacillus subtilis as the test organism . The reliable limit of sensitivity is 100 ppb, but 10 ppb can be detected . This technique can be used to semiquantitate monensin by comparing the zones of inhibition of unknown test samples against monensin standards.

J Gen Microbiol, 1983 Nov, 129 ( Pt 11), 3499 - 504
Bacillus subtilis mutation blocking irreversible binding of bacteriophage SPP1; Santos MA et al.; Mutants of Bacillus subtilis 168 were isolated which allow adsorption but not infection by bacteriophage SPP1 . The adsorbed phages can be subsequently recovered in active form . From ten other bacteriophages tested, only the SPP1-related phages 41c, 22a, p15 and SF6 failed to plate on the mutant cells . The mutation responsible for this behaviour (pha-2) was mapped by PBS1 transduction, showing 95% cotransduction with ald-1.

Hoppe Seylers Z Physiol Chem, 1983 Nov, 364(11), 1537 - 40
{Primary structure of subtilisin DY}; Nedkov P et al.; The complete amino-acid sequence of subtilisin DY, an extracellular alkaline proteinase produced by Bacillus subtilis, strain DY, is presented . The enzyme's primary structure was elucidated using peptides obtained by tryptic hydrolysis and peptides released from BrCN, tryptophan and Asn-Gly cleavage (using hydroxylamine) . The peptides were isolated by gelfiltration and by reversed phase high performance liquid chromatography and were degradated automatically in the sequenator . The complete sequence has been verified by peptide overlapping . The subtilisin DY polypeptide chain, like that of subtilisin Carlsberg, consists of 274 amino-acid residues . 32 Amino-acid replacements were found between these two molecules (37 nucleotide mutations, 5 of them two-point mutations) . Between the subtilisins DY and Novo 82 amino-acid residue replacements (106 nucleotide mutations, 24 two-point mutations) and one deletion were found . The polypeptide chains of the three subtilisins mentioned were compared and some differences discussed.

Gene, 1983 Nov, 25(2-3), 301 - 8
Cloning and expression of the Escherichia coli recA gene in Bacillus subtilis; de Vos WM et al.; By means of homopolymer dG-dC tailing, using PstI linearized pBR327 as vector, we constructed small plasmids containing the entire Escherichia coli recA gene . The 1.8-kb inserts were recloned in the Bacillus subtilis expression vector pPL608 in a B . subtilis recE4 strain . Analysis of plasmid-coded proteins showed expression of the E . coli recA gene both in minicells and whole cells of B . subtilis . Expression was under control of the bacteriophage SP02 promoter, which is part of pPL608 . A recA-expressing plasmid completely abolished the transformation deficiency of the recE4 mutant as well as its sensitivity to mitomycin C (MC) . The expressed recA gene also restored recombination in other B . subtilis strains lacking the recE gene product . These results indicate a high similarity between the functions of the E . coli RecA and B . subtilis RecE proteins.

J Antibiot (Tokyo), 1983 Nov, 36(11), 1451 - 7
Iturin AL--a new long chain iturin a possessing an unusual high content of C16-beta-amino acids; Winkelmann G et al.; From a strain of Bacillus subtilis a new antifungal peptidolipid complex of the iturin group was isolated . This antibiotic complex contained six lipophilic beta-amino acids with 3-amino-14-methylpentanoic acid as the predominant component . Iturin AL contains: 2 D-Asp, 1 L-Asp, 1 L-Glu, 1 L-Pro, 1 L-Ser, 1 D-Tyr and a mixture of 2.9% iso-C14-beta-amino acid, 30.7% n-C14-beta-amino acid, 15% iso-C15-beta-amino acid, 9% anteiso-C15-beta-amino acid, 35.3% iso-C-16-beta-amino acid and 4.5% n-C16-beta-amino acid . The structures of the beta-amino acids were determined by combined GLC/MS . FAB mass spectroscopy revealed three M+H+ peaks (1,043, 1,057, 1,071) . Iturin AL could be resolved into six components by HPLC whose structures confirm the high amount of long chain beta-amino acids.

Genetika, 1983 Nov, 19(11), 1753 - 9
{Cloning in Bacillus subtilis cells of the Bacillus mesentericus genes that determine the enzyme synthesis of tryptophan metabolism}; Malkov SV et al.; In this work, we tried to clone some Bacillus mesentericus genes coding for tryptophan synthesis in Bacillus subtilis cells . We succeeded in obtaining two identical plasmids carrying some genes of Bac . mesentericus and complementing the trpC2 and trpF mutations of Bac . subtilis . The cloned genes of Bac . mesentericus completely replaced the functions of trpC2 and trpF genes.

J Bacteriol, 1983 Nov, 156(2), 966 - 9
A pair of Bacillus subtilis ribosomal protein genes mapping outside the principal ribosomal protein cluster; Dabbs ER; Before now, the only ribosomal protein gene loci to be identified in Bacillus subtilis map within the principal ribosomal protein gene cluster at about 10 degrees on the linkage map . Using mutants with alterations in large subunit ribosomal proteins L20 or L24, I mapped the corresponding genes near leuA at approximately 240 degrees . The data were fully consistent with the fact that the genes for the two proteins were close together but not near any other ribosomal protein genes, as is also the case with the genes for the corresponding proteins of Escherichia coli.

J Bacteriol, 1983 Nov, 156(2), 931 - 3
Transfection of Bacillus subtilis protoplasts by bacteriophage phi do7 DNA; Perkins JB et al.; DNA from the Bacillus subtilis temperate bacteriophage phi do7 was found to efficiently transfect B . subtilis protoplasts; protoplast transfection was more efficient than competent cell transfection by a magnitude of 10(3) . Unlike competent cell transfection, protoplast transfection did not require primary recombination, suggesting that phi do7 DNA enters the protoplast as double-stranded molecules.

J Bacteriol, 1983 Nov, 156(2), 773 - 7
Biosynthesis of Bacillus licheniformis penicillinase in Escherichia coli and in Bacillus subtilis; Hayashi S et al.; Modified prepenicillinase was accumulated in both Escherichia coli and Bacillus subtilis treated with globomycin . Although the inhibitions of processings of prepenicillinase and prolipoprotein by globomycin in E . coli are qualitatively similar, they differ in the degree of inhibition at given concentrations of globomycin . The processing of prepenicillinase proceeds much more rapidly in E . coli than in B . subtilis.

J Bacteriol, 1983 Nov, 156(2), 545 - 51
Stability and synthesis of the penicillin-binding proteins during sporulation; Buchanan CE et al.; The penicillin-binding proteins (PBPs) of Bacillus subtilis were examined after incubation of vegetative and sporulating cultures with chloramphenicol, an inhibitor of protein synthesis . The results indicate that the sporulation-specific increases in vegetative PBPs 2B and 3 and the appearance of two new PBPs, 4* and 5*, depend on concurrent protein synthesis, which is most likely to be de novo synthesis of the PBPs rather than synthesis of an activator or processing enzyme . It was also learned that in vivo the PBPs differ in their individual stabilities, which helps to explain some of the quantitative changes that occur in the PBP profile during sporulation . All the membrane-bound PBPs, except possibly PBP 1, were found to be stable in the presence of crude extracts of sporulating cells that contained proteolytic activity.

Cell, 1983 Nov, 35(1), 275 - 83
Use of a lacZ fusion to study the role of the spoO genes of Bacillus subtilis in developmental regulation; Zuber P et al.; A mutation in any one of eight spoO genes of Bacillus subtilis blocks the process of spore formation at its earliest stage . To investigate how the products of the spoO genes may be involved in developmental gene expression, we fused the lacZ gene of E . coli to spoVG, a sporulation gene whose induction at the onset of sporulation is under spoO control . In cells of Spo+ bacteria containing a single copy of the gene fusion, conditions leading to the onset of sporulation resulted in the induction of beta-galactosidase synthesis . This induction was moderately to severely impaired by mutations in any of seven spoO genes . Deletion and hybridization analysis demonstrated that this sporulation-induced enzyme synthesis was exclusively expressed from the two overlapping promoters, which comprise the spoVG transcription-initiation region, and that a small DNA segment (157 bp) containing the spoVG promoters was sufficient to cause spoO-dependent induction of the fused lacZ gene.

Gene, 1983 Nov, 25(1), 67 - 70
Deletion mutants of megacinogenic plasmid pBM309 from Bacillus megaterium; Riabchenko NF et al.; A 46.8-kb plasmid, pBM309, of Bacillus megaterium determines the production of a bacteriocin, megacin A, and confers immunity against this antibiotic on the host cells . The megacin A (megA) and megacin A-immunity (megAim) genes were mapped on the physical map of pBM309 by using its deletion derivatives . Both genes were isolated as a 10.6-kb PstI fragment and cloned in Bacillus subtilis vector plasmid pBD9 for expression in B . megaterium.

Plasmid, 1983 Nov, 10(3), 224 - 34
Isolation of a tetracycline-resistance plasmid excised from a chromosomal DNA sequence in Bacillus subtilis; Shishido K et al.; When Bacillus subtilis GSY908 (recE4-) (H . C . Spatz and T . A . Trautner, 1971, Mol . Gen . Genet . 113, 174-190) protoplasts were infected with Staphylococcus aureus plasmid pNS1 specifying tetracycline resistance (Tcr) (N . Noguchi et al., 1983, Gene 21, 105-112), which was modified such that it either could not replicate or did not carry a functional Tcr gene, a plasmid with a molecular weight of 3.1 X 10(6) (4.9 kb) was generated in Tcr phenotypes . This plasmid, named Tcr pNS1981, exhibited completely different restriction endonuclease cleavage patterns to pNS1 and showed only negligible sequence homology in hybridization experiments . Southern hybridization experiments revealed that pNS1981 arises by excision of a B . subtilis chromosomal DNA sequence . No sequence corresponding to pNS1 was detectable on the chromosome of pNS1981-maintaining B . subtilis . The production of pNS1981 was also observed in B . subtilis RM125 (r-Mm-Mrec+) (T . Uozumi et al., 1977, Mol . Gen . Genet . 152, 65-69.) with almost the same frequency as B . subtilis GSY908 . Since the recipient B . subtilis Marburg 168 derivatives stated above are sensitive to Tc, the results indicate that information essential for Tcr is under negative regulatory control in the integrated state on the chromosome . Restriction endonuclease analysis suggested that pNS1981 is essentially the same as pBC16, formerly found in B . cereus (K . Bernhard, H . Schrempf, and W . Goebel, 1978, J . Bacteriol . 133, 897-903).

J Bacteriol, 1983 Nov, 156(2), 934 - 6
Molecular cloning with bifunctional plasmid vectors in Bacillus subtilis: isolation of a spontaneous mutant of Bacillus subtilis with enhanced transformability for Escherichia coli-propagated chimeric plasmid DNA; Ostroff GR et al.; Hybrid plasmid DNA cloned in Escherichia coli undergoes deletions when returned to competent Bacillus subtilis, even in defined restriction and modification mutants of strain 168 . We have isolated a mutant of B . subtilis MI112 which is stably transformed at high frequency by chimeric plasmid DNA propagated in E . coli.

Cell, 1983 Nov, 35(1), 285 - 93
Developmental and genetic regulation of Bacillus subtilis genes transcribed by sigma 28-RNA polymerase; Gilman MZ et al.; Sigma-28 RNA polymerase is a minor form of Bacillus subtilis RNA polymerase that is highly specific for transcription from a small number of promoter sites in the B . subtilis genome . We have followed transcription from two of these loci (P28-1 and P28-2) in vivo using a quantitative S1 nuclease mapping procedure . Both promoters are used at a modest rate in vegetatively growing cells (about 10 RNA copies per cell) and transcripts are initiated at the same start sites as found in vitro with the purified sigma 28-RNA polymerase . Transcription from the sigma 28 promoters varies somewhat with growth conditions and is shut off rapidly and almost completely after the first hour of sporulation . Neither sigma 28 transcripts is detected in vegetative cells of certain B . subtilis mutants (spoO classes A, B, E, and F) that are defective in sporulation . Transcription from these promoters is restored in second site revertants that are able to sporulate . Hence the action of sigma 28-RNA polymerase appears to be regulated by the spoO genes and the functions controlled by sigma 28-promoters may be closely tied to the system involved in the initiation of sporulation.

J Bacteriol, 1983 Nov, 156(2), 846 - 58
Cellular responses of Bacillus subtilis and Escherichia coli to the Gram stain; Beveridge TJ et al.; Exponentially growing cells of Bacillus subtilis and Escherichia coli were Gram stained with potassium trichloro(eta 2-ethylene)platinum(II) (TPt) in place of the usual KI-I2 mordant . This electron-dense probe allowed the staining mechanism to be followed and compared with cellular perturbations throughout the staining process . A crystal violet (CV)-TPt chemical complex was formed within the cell substance and at the cell surface of B . subtilis when the dye and Pt mordant were added . The ethanol decolorization step dissolved the precipitate from the cell surface, but the internal complex was retained by the cell wall and remained within the cell . This was not the case for E . coli; the ethanol decolorization step removed both surface-bound and cellular CV-TPt . During its removal, the outer membrane was sloughed off the cells until only the murein sacculus and plasma membrane remained . We suspect that the plasma membrane was also perturbed, but that it was retained within the cell by the murein sacculus . Occasionally, small holes within the murein and plasma membrane could be distinguished through which leaked CV-TPt and some cellular debris . Biochemical identification of distinct envelope markers confirmed the accuracy of these images.

J Bacteriol, 1983 Nov, 156(2), 800 - 8
Restriction and modification in Bacillus subtilis: sequence specificities of restriction/modification systems BsuM, BsuE, and BsuF; Jentsch S; The sequence specificities of three Bacillus subtilis restriction/modification systems were established: (i) BsuM (CTCGAG), an isoschizomer to XhoI; (ii) BsuE (CGCG), an isoschizomer to FnuDII; and (iii) BsuF (CCGG), an isoschizomer to MspI, HpaII . The BsuM modification enzyme methylates the 3' cytosine of the recognition sequence . The BsuF modification enzyme methylates the 5' cytosine of the sequence, rendering such sites resistant to MspI degradation and leaving the majority of sites sensitive to HpaII degradation.

Biochem Biophys Res Commun, 1983 Oct 31, 116(2), 751 - 8
Peptide antibiotic subtilin is synthesized via precursor proteins; Nishio C et al.; Biogenesis of subtilin, an antimicrobial peptide produced by Bacillus subtilis ATCC 6633, was studied in growing cells . Pulse-chase labeling experiments with {35S}cysteine revealed the presence of precursor proteins of subtilin . The synthesis of both precursor proteins and subtilin was inhibited by inhibitors of protein and RNA synthesis . When the precursor proteins were incubated with crude extracts of the organism in vitro, they were converted to subtilin . Pepstatin and phenylmethylsulfonyl fluoride in combination inhibited this conversion.

J Biol Chem, 1983 Oct 25, 258(20), 12558 - 65
Glycerol protection and purification of Bacillus subtilis glucose dehydrogenase; Ramaley RF et al.; Bacillus subtilis glucose dehydrogenase (EC 1.1.1.47) has been purified from sporulating cell extract to apparent homogeneity (as determined by polyacrylamide gel electrophoresis, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and isoelectric focusing) . The enzyme purified as a single molecular species with no evidence for a multiple form of the enzyme . The B . subtilis glucose dehydrogenase has an apparent isoelectric point of 4.7-4.8 and an apparent Mr = 126,000 and is comprised of four subunits of Mr = 31,500 each . The glucose 2-deoxyglucose and glucosamine substrate specificity of the enzyme is similar to the substrate specificity for B . subtilis spore germination, suggesting that the spore glucose dehydrogenase may play some role in spore germination . The B . subtilis glucose dehydrogenase is extremely dependent on the presence of glycerol or other hydrophobic bond-stabilizing agents (or NAD) for retention of enzymatic activity, and the presence of glycerol (20% w/v) in the extraction and purification buffers was absolutely necessary for the successful purification of this enzyme.

J Biol Chem, 1983 Oct 25, 258(20), 12487 - 93
Purification and properties of a new bacillus subtilis RNA processing enzyme . Cleavage of phage SP82 mRNA and Bacillus subtilis precursor rRNA; Panganiban AT et al.; An RNA processing activity capable of cleaving Bacillus subtilis phage SP82 early mRNA has been purified to apparent homogeneity from crude extracts of uninfected B . subtilis . The enzyme, a functional monomer of Mr approximately 27,000, cleaves only at the 5' side of adenosine residues at processing sites and is competitively inhibited by double-stranded synthetic RNA polymers . Processed SP82 mRNAs were translated in an Escherichia coli cell-free system and no qualitative or quantitative effects of processing on the synthesis of polypeptides was observed . The processing enzyme does not cleave T7 mRNA, E . coli precursor rRNA, or double-stranded poly(AU) . A recombinant plasmid containing portions of two B . subtilis rRNA gene sets was transcribed in vitro and the resulting RNA was cleaved in the spacer region between the 16 S and 23 S rRNA genes . The ability of the B . subtilis processing enzyme to cleave SP82 mRNA and B . subtilis precursor rRNA and the fact that the enzyme has high affinity for double-stranded RNA suggest that it is the functional analog of E . coli RNase III.

Nucleic Acids Res, 1983 Oct 11, 11(19), 6709 - 21
Ribosomal RNA precursors of Bacillus subtilis; Loughney K et al.; The DNA sequence of the region corresponding to the 5'-end of a 16S rRNA gene of B . subtilis 168 was determined . Comparison of this sequence with the sequences flanking other 16S and 23S rRNA coding regions (1-4) indicated that large RNA stem structures, surrounding the mature 16S and 23S rRNAs, could form in a precursor rRNA . The 5'-ends of the precursors of 16S and 23S rRNAs (p16S and p23S) were mapped to the middles of these potential RNA stem structures . We propose that the initial cleavages of the primary rRNA transcript occur near the "opposed G's" which interrupt the basepairing of each of these stem structures . This model is supported by the finding that the 5'-end of the 5S rRNA precursor, p5A (5), maps to the region of the "opposed G's" in the 23S rRNA stem structure.

Biochim Biophys Acta, 1983 Oct 11, 753(3), 372 - 80
Specific inhibition of phosphatidate cytidylyltransferase from Bacillus subtilis membranes by cytidine monophosphate; Gaillard JL et al.; In Bacillus subtilis, the phosphatidate cytidylyltransferase was localized exclusively in the membrane fraction prepared by sucrose density gradient fractionation . A single enzyme could synthesize the two liponucleotides: CDPdiacylglycerol and dCDPdiacylglycerol . Kinetic experiments and isotopic exchange reactions suggested a ping-pong mechanism . Among the nucleosides monophosphate, CMP specifically reduced the synthesis of both liponucleotides . This inhibition was non-competitive and might be involved in regulation of phospholipid synthesis.

J Biol Chem, 1983 Oct 10, 258(19), 11981 - 3
Crystallization and preliminary X-ray diffraction study of heavy riboflavin synthase from Bacillus subtilis; Ladenstein R et al.; Crystals of heavy riboflavin synthase from Bacillus subtilis have been obtained from 1.3 M sodium/potassium phosphate, pH 8.7, containing 0.35 mM 5-nitroso-6-(1'-D-ribitylamino)-2,4(1H,3H)-pyrimidinedione . X-ray photographs indicate a hexagonal unit cell with dimensions of a = b = 156.4 A; c = 298.5 A; alpha = beta = 90 degrees; gamma = 120 degrees . The space group was established as P6(3)22 with 12 general positions.

J Gen Microbiol, 1983 Oct, 129 (Pt 10), 3211 - 4
The pattern of protein synthesis in spoIVC mutants of Bacillus subtilis resuspended in sporulation medium; Boschwitz H et al.; Two spoIVC mutants of Bacillus subtilis were labelled with {35S}methionine either at the time of resuspension in sporulation medium or 1, 2 or 3 h later, and radioactive proteins were detected after cell extracts had been subjected to two-dimensional gel electrophoresis . The mutants completed almost all of the changes in protein synthesis that occur in the wild-type in these conditions . A heavily labelled protein was found in the mutants that has also been observed in a spoO mutant but does not occur in the wild-type.

J Hyg (Lond), 1983 Oct, 91(2), 287 - 92
The sterilizing capacity of propylene oxide and chlorhexidine diacetate solutions upon pre-injection swabs saturated with propan-2-ol; Wright RC; The sporicidal activity of two solutions which have been used in the production of 'sterile' pre-injection swabs has been investigated . Propylene oxide (3.4% w/w) and chlorhexidine diacetate (0.6% w/w), both made up in approximately 65% w/w propan-2-ol, were artificially contaminated with spores of Bacillus subtilis var . niger and swabs were impregnated with these; surviving spores were enumerated at various temperatures and times of storage . Chlorhexidine diacetate had no sporicidal activity, whereas the activity of propylene oxide was dependent on temperature . The former should not be considered a sterilant and the latter can only be considered such if a controlled incubation period at an elevated temperature is employed.

Gene, 1983 Oct, 24(2-3), 171 - 7
Chloramphenicol-inducible gene expression in Bacillus subtilis; Duvall EJ et al.; A cloned Bacillus pumilus cat gene expresses chloramphenicol-inducible chloramphenicol acetyltransferase activity in Bacillus subtilis . The chloramphenicol inducibility trait was shown to be determined by a 234-bp region of the cloned DNA . Nucleotide sequence analysis of this 234-bp segment indicated that the cat ribosome-binding site occurs within a 40-bp region containing 14-bp terminal inverted repeat sequences . Transcription of this region into RNA should sequester the cat ribosome-binding site in a stable stem-loop conformation . Chloramphenicol-mediated destabilization of the stem-loop is suggested as the basis for the chloramphenicol inducibility phenotype.

Biochem J, 1983 Oct 1, 215(1), 133 - 40
Dual role of a single multienzyme complex in the oxidative decarboxylation of pyruvate and branched-chain 2-oxo acids in Bacillus subtilis; Lowe PN et al.; The pyruvate dehydrogenase and branched-chain 2-oxo acid dehydrogenase activities of Bacillus subtilis were found to co-purify as a single multienzyme complex . Mutants of B . subtilis with defects in the pyruvate decarboxylase (E1) and dihydrolipoamide dehydrogenase (E3) components of the pyruvate dehydrogenase complex were correspondingly affected in branched-chain 2-oxo acid dehydrogenase complex activity . Selective inhibition of the E1 or lipoate acetyltransferase (E2) components in vitro led to parallel losses in pyruvate dehydrogenase and branched-chain 2-oxo acid dehydrogenase complex activity . The pyruvate dehydrogenase and branched-chain 2-oxo acid dehydrogenase complexes of B . subtilis at the very least share many structural components, and are probably one and the same . The E3 component appeared to be identical for the pyruvate dehydrogenase, 2-oxoglutarate dehydrogenase and branched-chain 2-oxo acid dehydrogenase complexes in this organism and to be the product of a single structural gene . Long-chain branched fatty acids are thought to be essential for maintaining membrane fluidity in B . subtilis, and it was observed that the ace (pyruvate dehydrogenase complex) mutant 61142 was unable rapidly to take up acetoacetate, unlike the wild-type, indicative of a defect in membrane permeability . A single pyruvate dehydrogenase and branched-chain 2-oxo acid dehydrogenase complex can be seen as an economical means of supplying two different sets of essential metabolites.

Proc Natl Acad Sci U S A, 1983 Oct, 80(20), 6303 - 6
Membership mutation of the genetic code: loss of fitness by tryptophan; Wong JT; Bacillus subtilis strain QB928, a tryptophan-auxotroph, was serially mutated to yield strain HR15 . For QB928, tryptophan functioned as a competent amino acid and 4-fluorotryptophan as merely an inferior analogue . For HR15, these roles were reversed . The tryptophan/4-fluorotryptophan growth ratio decreased by a factor of 2 X 10(4) in the transition from QB928 to HR15.

J Bacteriol, 1983 Oct, 156(1), 466 - 70
Density gradient analysis of DNA replicated during Bacillus subtilis sporulation; Binnie C et al.; Density gradient centrifugation was used to monitor DNA replication during sporulation of a 5-bromo-2'-deoxyuridine-tolerant, thymidine-requiring strain of Bacillus subtilis . DNA of heavy, intermediate, and light density was found in cells induced to sporulate in the presence of bromodeoxyuridine, but only intermediate DNA was detected in mature spores . Cells grown with bromodeoxyuridine until DNA was in the heavy form formed spores containing intermediate and light DNA when sporulated with thymidine alone.

J Bacteriol, 1983 Oct, 156(1), 409 - 13
Triple fixation of Bacillus subtilis dormant spores; Kozuka S et al.; A triple-fixation method with a sequential application of 5% glutaraldehyde, 1% osmium tetroxide, and 2% potassium permanganate gave superior preservation of the ultrastructure of Bacillus subtilis dormant spores with a thick spore coat.

J Bacteriol, 1983 Oct, 156(1), 327 - 37
Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences; Yamazaki H et al.; amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B . subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4 . The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4 . Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined . Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids) . Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA . The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110 . The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases . The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem . Biophys . Res . Commun . 112:687-683, 1983) . The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified . The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character . The nucleotide sequence around the region was quite different from the promoter region of the B . subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.

J Bacteriol, 1983 Oct, 156(1), 257 - 63
Genes controlling xylan utilization by Bacillus subtilis; Roncero MI; Eight mutants of Bacillus subtilis deficient in xylan utilization were isolated and characterized genetically and biochemically . Each mutant was obtained independently after nitrosoguanidine mutagenesis . All of the analyzed mutations were shown to be linked . Reciprocal transformation crosses revealed the existence of two genes controlling xylan utilization which have been designated xynA and xynB . Available data have indicated that these two genes code for two xylan-degrading enzymes existing in the wild-type strains, an extracellular beta-xylanase (xynA) and a cell-associated beta-xylosidase (xynB).

J Bacteriol, 1983 Oct, 156(1), 101 - 8
Transformation in Bacillus subtilis: purification and partial characterization of a membrane-bound DNA-binding protein; Smith H et al.; In DNA binding-deficient mutants of Bacillus subtilis a competence-specific protein with a subunit molecular weight of 18,000 was absent . The native protein containing this subunit was purified from B . subtilis membranes by chromatography on hydroxyapatite, DEAE-cellulose, and Sephacryl S-200 . This protein appeared to be complexed with a second protein of slightly lower molecular weight (17,000) and a different isoelectric point . The native protein complex (apparent molecular weight, 75,000) contained approximately equal amounts of the two polypeptides and showed a strong DNA-binding activity . Incubation of the complex with plasmid and bacteriophage DNA revealed nuclease activity, specifically directed toward double-stranded DNA . Predominantly single-stranded nicks and a limited number of double-stranded breaks were introduced in the presence of Mg2+ ions . In the presence of Mn2+ ions the complex produced low-molecular-weight breakdown products from the DNA.

J Gen Microbiol, 1983 Oct, 129 (Pt 10), 3203 - 10
Use of the Escherichia coli transposon Tn1000 (gamma delta) to generate mutations in Bacillus subtilis DNA; de Lencastre H et al.; Plasmid pHM2 contains a Bacillus subtilis spoIIA gene and is able to replicate in both Escherichia coli and B . subtilis . The plasmid was mobilized at low frequency by the E . coli F plasmid . Nearly 30% of the mobilized plasmids contained an insert of Tn1000 (gamma delta) . Fourteen of the inserts were in the B . subtilis DNA portion of pHM2 . Of these, two adjacent inserts abolished expression of the plasmid spoIIA gene in B . subtilis . From the map positions of flanking inserts that do not abolish spoIIA gene expression, it is estimated that the gene is probably not more than 700 bp long.

Gene, 1983 Oct, 24(2-3), 255 - 63
Construction of a Bacillus subtilis cloning vehicle with heterologous DNA sequence; Yoshimura K et al.; A cloning vehicle, pFTB91, for the Bacillus subtilis host was constructed with DNA fragments heterologous to the host chromosome . It consists of three DNA fragments: (i) chromosomal DNA of Bacillus amyloliquefaciens which complements the leuA and ilvC mutations in B . subtilis; (ii) a B . amyloliquefaciens plasmid DNA that supplies an autonomously replicating function; and (iii) a HindIII fragment of Staphylococcus aureus plasmid pTP5 that carries gene tetr, conferring the TetR phenotype . It has sufficiently low DNA homology to prevent its integration into the host chromosome in recombination-competent cells of B . subtilis . It is 9.3 kb, and approx . 10 copies are present per chromosome . The SalI and KpnI sites in the ilvC+ and tetr genes, respectively, could be used for selection of recombinant plasmids by insertional inactivation . The plasmid has unique sites for EcoRI, PstI, and XbaI.

Gene, 1983 Oct, 24(2-3), 163 - 9
Nucleotide sequence of a Bacillus pumilus gene specifying chloramphenicol acetyltransferase; Harwood CR et al.; Gene cat-86 of Bacillus pumilus, specifying chloramphenicol-inducible chloramphenicol acetyltransferase, was previously cloned in Bacillus subtilis on plasmid pUB110 . The nucleotide sequence of cat-86 indicates that the gene encodes a protein of 220 amino acids and contains TTG as the translations-initiation codon . The proteins specified by cat-86 and the cat genes present on pC194, pC221 and Tn9 appear to share regions of amino acid sequence similarity . cat-86 is a structural gene on the B . subtilis expression plasmid pPL608 . Restriction sites exist within the gene that should permit the product of inserted heterologous coding sequences to be synthesized in B . subtilis as fusion proteins.

J Bacteriol, 1983 Oct, 156(1), 1 - 5
Association of penicillin-binding proteins and other enzymes with the ribosome-free membrane fraction of Bacillus subtilis; Caulfield MP et al.; We had previously separated the ribosome-complexed and -free membrane fractions of Bacillus subtilis by sedimentation in a biphasic sucrose gradient . We now have found that the complexed fraction is contaminated with ribosome-free vesicles and that these can be removed by equilibrium density centrifugation . With this improved preparation, it could be shown that the penicillin-binding proteins are present almost exclusively in the ribosome-free membrane fraction . It thus appears that the fragmentation of the membrane in the lysing protoplast yields separate vesicles for the domains involved in protein translocation and for those involved in the synthesis and reshaping of the peptidoglycan . An enzyme of lipid synthesis (phosphatidylserine synthase) and also H+-ATPase were similarly found to be concentrated, but less exclusively, in the ribosome-free membrane fraction.

Proc Natl Acad Sci U S A, 1983 Oct, 80(20), 6214 - 8
Initiation of DNA replication in vitro by a DNA-membrane complex extracted from Bacillus subtilis; Benjamin P et al.; Initiation of DNA replication has been observed in vitro with a DNA-membrane complex extracted from Bacillus subtilis . Antibiotics known to interfere with various aspects of initiation inhibited DNA synthesis significantly in vitro, whereas a mutant resistant to one inhibitor failed to respond to its presence . The inhibitory effects occurred primarily when the immediate RNA precursors (ribonucleoside triphosphates) were present in the assay solution but not significantly when the precursors were omitted . Complexes extracted from a temperature-sensitive initiation mutant were almost incapable of synthesizing DNA at the restrictive temperature but displayed extensive synthesis at the permissive temperature . A strong indication of semiconservative DNA synthesis was obtained in vitro after density-shift experiments involving incubation of the complex with a heavy-density DNA precursor, followed by neutral and alkaline CsCl density gradient centrifugation . A significant amount of chain elongation or repair (or both) was also observed.

Nucleic Acids Res, 1983 Sep 24, 11(18), 6301 - 18
Structure and organization of rRNA operons in the region of the replication origin of the Bacillus subtilis chromosome; Ogasawara N et al.; Structure and organization of two complete ribosomal RNA (rRNA) gene sets, rrnO and rrnA, were determined for the first time in Bacillus subtilis . They are located at the region of the replication origin of the chromosome . Each set constitutes a single operon of: two tandem promoters - leader sequence - 16S rRNA gene - Ile-tRNA gene - Ala-tRNA gene - 23S rRNA gene - 5S rRNA gene - termination signal . The first promoter (P1) of rrnO differs from that of rrnA in sequence and function . P1 of rrnO was used very little for transcription either in vivo or in vitro while P1 was predominantly used in rrnA . A putative transcript of the entire operon was determined and constructed into a secondary structure . Analysis of in vivo transcripts by S1 mapping revealed primary processing sites at the loop and stem structure of 16S rRNA in rrnO and rrnA . A unique sequence in the leader region of rrnO can be formed into a highly complexed secondary structure and affects processing of mature 16S rRNA . The sequences of the two spacer tRNA genes are highly conserved between B . subtilis and Escherichia coli.

FEBS Lett, 1983 Sep 19, 161(2), 257 - 60
Essential protein factors for polyprenyl pyrophosphate synthetases . Separation of heptaprenyl pyrophosphate synthetase into two components; Fujii H et al.; Heptaprenyl pyrophosphate synthetase from Bacillus subtilis was dissociated into two essential components, none of which had catalytic activity alone . The enzyme activity was restored when the two components were combined with each other . Both fractions, designated components I and II in the order of their elution from DEAE-Sephadex, appeared to be proteins of Mr 30000 . Component I was much more stable than component II which was easily destroyed by relatively mild heat treatment . Neither was interchangeable with any of the essential components of hexaprenyl pyrophosphate synthetase of Micrococcus luteus B-P 26.

J Biol Chem, 1983 Sep 10, 258(17), 10586 - 93
Cloning of the Bacillus subtilis glutamine phosphoribosylpyrophosphate amidotransferase gene in Escherichia coli . Nucleotide sequence determination and properties of the plasmid-encoded enzyme; Makaroff CA et al.; The Bacillus subtilis gene encoding glutamine phosphoribosylpyrophosphate amidotransferase (amidophosphoribosyltransferase) was cloned in pBR322 . This gene is designated purF by analogy with the corresponding gene in Escherichia coli . B . subtilis purF was expressed in E . coli from a plasmid promoter . The plasmid-encoded enzyme was functional in vivo and complemented an E . coli purF mutant strain . The nucleotide sequence of a 1651-base pair B . subtilis DNA fragment was determined, thus localizing the 1428-base pair structural gene . A primary translation product of 476 amino acid residues was deduced from the DNA sequence . Comparison with the previously determined NH2-terminal amino acid sequence indicates that 11 residues are proteolytically removed from the NH2 terminus, leaving a protein chain of 465 residues having an NH2-terminal active site cysteine residue . Plasmid-encoded B . subtilis amidophosphoribosyltransferase was purified from E . coli cells and compared to the enzymes from B . subtilis and E . coli . The plasmid-encoded enzyme was similar in properties to amidophosphoribosyltransferase obtained from B . subtilis . Enzyme specific activity, immunological reactivity, in vitro lability to O2, Fe-S content, and NH2-terminal processing were virtually identical with amidophosphoribosyltransferase purified from B . subtilis . Thus E . coli correctly processed the NH2 terminus and assembled {4Fe-4S} centers in B . subtilis amidophosphoribosyltransferase although it does not perform these maturation steps on its own enzyme . Amino acid sequence comparison indicates that the B . subtilis and E . coli enzymes are homologous . Catalytic and regulatory domains were tentatively identified based on comparison with E . coli amidophosphoribosyltransferase and other phosphoribosyltransferase (Argos, P., Hanei, M., Wilson, J., and Kelley, W . (1983) J . Biol . Chem . 258, 6450-6457).

J Biol Chem, 1983 Sep 10, 258(17), 10582 - 5
The glutamine-utilizing site of Bacillus subtilis glutamine phosphoribosylpyrophosphate amidotransferase; Vollmer SJ et al.; Reaction of Bacillus subtilis glutamine phosphoribosylpyrophosphate amidotransferase with 6-diazo-5-oxo-L-norleucine resulted in complete loss of its ability to catalyze glutamine-dependent phosphoribosylamine formation and its glutaminase activity, whereas its ability to catalyze ammonia-dependent phosphoribosylamine formation and to hydrolyze phosphoribosylpyrophosphate was increased . The site of reaction with 6-diazo-5-oxo-L-norleucine was the NH2-terminal cysteine residue . The NH2-terminal sequence of the B . subtilis enzyme was homologous with that of the corresponding amidotransferase from Escherichia coli, for which the NH2-terminal cysteine is also essential for glutamine utilization (Tso, J . Y., Hermodson, M . A., and Zalkin, H . (1982) J . Biol . Chem . 257, 3532-3536) . The fact that the metal-free E . coli amidotransferase contains a glutamine-utilizing structure that is very similar to that found in B . subtilis amidotransferase, which contains an essential {4Fe-4S} center, indicates that the iron-sulfur center probably plays no role in glutamine utilization.

Biochim Biophys Acta, 1983 Sep 9, 740(4), 449 - 59
In vitro transcription from Bacillus subtilis nucleoids by homologous RNA polymerase; Guillen NM et al.; The effect of DNA structural features on RNA synthesis was investigated . Purified Bacillus subtilis nucleoids templated from vegetative cells were transcribed by the homologous RNA polymerase using Hg-UTP as one of the nucleotide substrates . Low RNA polymerase/DNA ratios were used during transcription in order to avoid nonspecific initiations . The rate of synthesis of total RNA was 40% greater on nucleoid templates than on naked DNA . The proportion of asymmetric transcript synthesized on nucleoid templates (HvsL strand transcripts) was close to that observed in vivo, whereas with naked DNA this value was at least 3-times lower . The percentage of rRNA relative to the total RNA, synthesized in the in vitro system with the nucleoid template, approaches the rate of the in vivo transcription . The size of the RNA synthesized on nucleoids was large and heterogeneous while with naked DNA it was homogeneous and of about 6 S . Our results suggest that the supercoiled, folded nucleoids may retain some of the structural features responsible for the regulation of RNA synthesis in vivo.

Genetika, 1983 Sep, 19(9), 1397 - 403
{Mutagenic action of O-methlhydroxylamide on transforming DNA}; Bresler SE et al.; The mutagenic effect of O-methylhydroxylamine (OMHA) on transforming DNA of Bacillus subtilis was studied . In accordance with the earlier reported chemical and functional data, the mutagenic effect was observed at 4.5 and 6.0 pH . An increase in pH caused a decrease in the rate of mutagenesis, though the maximal level of mutagenesis was equal at both values of pH . The results obtained with recipients defective in the system of UV-repair revealed that both products of reaction of OMHA with the cytosine-base of DNA, N4-metoxycytidine and N4-metoxy-6-metoxyamino-5,6-dihydrocytidine, are effectively eliminated through the system of UV repair.

Anal Biochem, 1983 Sep, 133(2), 322 - 9
Two-dimensional zymogram analysis of nucleases in Bacillus subtilis; Coughlin SA et al.; A two-dimensional zymogram procedure for the analysis of nucleases is described . Isoelectric focusing (IEF) and nonequilibrium pH gradient electrophoresis (NEPHGE) were compared as first dimensions in combination with sodium dodecyl sulfate (SDS) electrophoresis as the second dimension in analyzing nucleases in lysates of Bacillus subtilis . All renaturable nucleases detected following SDS electrophoresis alone were resolved in NEPHGE-SDS electrophoresis gels whereas, in IEF gels, most either were at the basic end or were not present in the second-dimension gels . This method of analysis has revealed a complexity in nuclease species in B . subtilis not previously recognized . Eighty-three discreet nuclease activities have been detected in B . subtilis lysates . Using purified deoxyribonuclease I (bovine pancreas), as little as 10 pg of nuclease can be detected.

J Bacteriol, 1983 Sep, 155(3), 1459 - 62
Expression of a Bacillus megaterium sporulation-specific gene during sporulation of Bacillus subtilis; Goldrick S et al.; The gene for the Bacillus megaterium spore C protein, a sporulation-specific gene, has been transferred into Bacillus subtilis . The B . megaterium gene was expressed little, if at all, during log-phase and early-stationary-phase growth, but was expressed during sporulation with the same kinetics as and at a level similar to that of the analogous B . subtilis genes . This finding is most consistent with the regulation of this class of genes by a mechanism of positive control.

Infect Immun, 1983 Sep, 41(3), 1112 - 7
Expression of a cloned Staphylococcus aureus alpha-hemolysin determinant in Bacillus subtilis and Staphylococcus aureus; Fairweather N et al.; A DNA sequence encoding Staphylococcus aureus alpha-hemolysin, which had been previously cloned and mapped in Escherichia coli K-12, was introduced into Bacillus subtilis BD170 and several strains of S . aureus by using plasmid vectors, some of which could replicate in all three organisms . The determinant was cloned on a 3.3-kilobase pair DNA fragment into B . subtilis by using the vector plasmid pXZ105 to form the hybrid plasmid pXZ111 . B . subtilis cells harboring pXZ111 produced large zones of alpha-hemolysis after 18 h of growth at 37 degrees C on rabbit blood agar plates, and alpha-hemolysin activity was detected in supernatants prepared from growing cultures of this strain . The alpha-hemolysin was apparently secreted across the B . subtilis cell envelope . Polypeptides of molecular weights 34,000 and 33,000 were precipitated with anti-alpha-hemolysin serum from lysates prepared from BD170 cells harboring pXZ111 . A hybrid replicon which could replicate in both E . coli and S . aureus was constructed in E . coli by ligating a HindIII fragment encoding the replication functions and chloramphenicol resistance genes of S . aureus plasmid pCW59 to the pBR322 alpha-hemolysin hybrid plasmid pDU1150 . The DNA of this plasmid, pDU1212, was prepared in E . coli and used to transform protoplasts prepared from a non-alpha-hemolytic, nonrestricting strain of S . aureus RN4220 . Some of the transformants contained plasmids which had suffered extensive deletions . Some plasmids, however, were transformed intact into RN4220 . Such plasmids were subsequently maintained in a stable manner . pDU1212 DNA was prepared from RN4220 and transformed into alpha-hemolytic S . aureus 8325-4 and two mutant derivatives defective in alpha-hemolysin synthesis . All three strains expressed alpha-hemolysin when harboring pDU1212.

Gene, 1983 Sep, 24(1), 83 - 91
Cloning DNA from the replication terminus region of the Bacillus subtilis chromosome; Weiss AS et al.; DNA from the Bacillus subtilis 168 prototroph, SB19, was partially cleaved with MboI and cloned into the BamHI site of the Escherichia coli cosmid vector, pHC79 . {3H}thymine-labelled DNA from the replication terminus region of the B . subtilis dna-1 chromosome was used to identify, by hybridization, clones harboring recombinant cosmids carrying inserts from the terminus region . Restriction maps have been constructed for two such cosmids carrying overlapping DNA inserts that cover or extend into four of the previously identified five SalI fragments which are replicated last . The composite map of the cloned region, together with the available data on the replication order of fragments within it, is consistent with its replication being achieved by the unidirectional movement of a fork through it and towards the late replicating 16.2-kb SalI fragment . Most, if not all, of the terminus sequences in at least one of the recombinant cosmids are missing from a viable strain of B . subtilis that carries a deletion in the SP beta-gltA region of the chromosome.

Gene, 1983 Sep, 24(1), 15 - 27
Chemical synthesis and molecular cloning of a STOP oligonucleotide encoding an UGA translation terminator in all three reading frames; Pettersson RF et al.; We have chemically synthesized an oligonucleotide 5'd(TGATTGATTGA)3' 3'd(ACTAACTAACT)5' that encodes the translation termination codon TGA in all three reading frames . After ligation of appropriate restriction endonuclease linkers to the ends, the double-stranded oligonucleotide (STOP-oligonucleotide) was joined to the plasmid pBR322 between the EcoRI and BamHI, or HindIII and BamHI sites, and the hybrid plasmids were transformed into Escherichia coli HB101 . Four different constructions were obtained: (i) EcoRI-STOP-BamHI (STOP-oligonucleotide flanked by EcoRI and BamHI linkers; pKTH606), (ii) HindIII-STOP-BamHI (pKTH601), (iii) BamHI-STOP-HindIII (pKTH604), and (iv) HindIII-STOP-POTS-BamHI (two STOP-oligonucleotides in opposite orientation; pKTH605) . The inserts in pKTH606 and pKTH601 were excised and transferred to a modified plasmid constructed previously for the expression and secretion of foreign gene products from Bacillus subtilis . The resulting secretion plasmids now contain the promoter/signal sequence region of the alpha-amylase gene from Bacillus amyloliquefaciens joined to the STOP-oligonucleotide by EcoRI or HindIII linkers . Foreign genes can be cloned into these sites . The plasmids can be used to express foreign genes truncated at their C-terminal end and therefore lacking their own translation termination codon . One such plasmid has been successfully used to express the Semliki Forest virus (SFV) membrane protein E1 truncated at its C-terminus.

Gene, 1983 Sep, 23(3), 267 - 76
Molecular cloning in Bacillus subtilis of a Bacillus licheniformis gene encoding a thermostable alpha amylase; Ortlepp SA et al.; A resident-plasmid cloning system developed for Bacillus subtilis has been used to isolate recombinant plasmids carrying DNA from Bacillus licheniformis which confer alpha-amylase activity on alpha-amylase-negative mutants of B . subtilis . These plasmids contain a 3550-bp insert at the EcoRI site of the plasmid pBD64 . Subcloning various lengths of the B . licheniformis DNA has localised the gene to a 2550-bp BclI fragment . We present evidence that the cloned fragment codes for a B . licheniformis heat-stable alpha-amylase with a temperature optimum of 93 degrees C . The foreign gene is expressed efficiently in B . subtilis and is stably maintained.

J Bacteriol, 1983 Sep, 155(3), 1399 - 406
Restriction fragments that exert promoter activity during postexponential growth of Bacillus subtilis; Mongkolsuk S et al.; Two restriction fragments of Bacillus subtilis DNA were identified which caused the cat-86 gene present on the promoter cloning plasmid pPL703 to be activated predominantly during postexponential growth of host cells . The postexponential increase was observed in both sporulation-positive strains and in a spoOA mutant of B . subtilis . However, the postexponential increase in the cat-86 gene product, chloramphenicol acetyltransferase, was diminished or not observed when the plasmid-containing cells were grown in the presence of excess glucose . The promoter-containing fragment, designated as 33, was mapped to a site on the B . subtilis chromosome adjacent to hisA . The other fragment, 14, mapped to a site adjacent to ctrA . When present on a high-copy vector, both fragments caused a reduction in the sporulation frequency of host cells . Fragment 33 in high copy number conferred on B . subtilis cells three additional phenotypic changes: brown colony color, intracellular inclusions, and, in a protease-deficient mutant, the production of extracellular protease activity . These activities were observed only in postexponential-phase cultures.

Biochem J, 1983 Sep 1, 213(3), 759 - 63
Methyl esterification of glutamic acid residues of methyl-accepting chemotaxis proteins in Bacillus subtilis; Ahlgren JA et al.; The amino acid residue modified in the reversible methylation of Bacillus subtilis methyl-accepting chemotaxis proteins was identified as glutamic acid; methylation results in the formation of glutamate 5-methyl ester . Identification was made by comparing the behaviour of a 3H-labelled compound isolated from proteolytically hydrolysed methyl-accepting chemotaxis proteins labelled in vivo with that of authentic methylated amino acids by chromatographic and electrophoretic techniques . Also, the isolated compound on mild alkaline hydrolysis shows behaviour identical with that of authentic glutamate 5-methyl ester . {3H}Methanol released by mild alkaline hydrolysis was made to react with 3,5-dinitrobenzyl chloride to form {3H}methyl 3,5-dinitrobenzoate, which was identified by reverse-phase high-pressure liquid chromatography.

Nucleic Acids Res, 1983 Aug 25, 11(16), 5763 - 74
Sequence analysis of a cluster of twenty-one tRNA genes in Bacillus subtilis; Green CJ et al.; The DNA sequence of a cluster of twenty-one tRNA genes distal to a rRNA gene set in B . subtilis was determined . None of the tRNA genes are repeated in the sequence . The only classes of tRNAs that are not represented are those for cysteine, glutamine, tryptophan, and tyrosine . Three of the tRNA genes in this cluster do not have the 3'-CCA sequence encoded in the gene . There is no RNA polymerase terminator sequence in the region between the 5S gene and the first tRNA gene or within the tRNA gene cluster . A terminator sequence was found directly after the last tRNA gene . This rRNA and tRNA gene cluster probably represents one transcriptional unit . However, there may be an RNA polymerase promoter site within this sequence, which raises some interesting questions concerning the regulation of transcription for these tRNA genes.

J Mol Biol, 1983 Aug 5, 168(2), 351 - 65
Deletion analysis of a complex promoter for a developmentally regulated gene from Bacillus subtilis; Banner CD et al.; SpoVG is a developmentally regulated gene from the spore-forming bacterium Bacillus subtilis . The transcription initiation region for spoVG consists of two overlapping promoters whose startpoints of RNA synthesis are ten base pairs apart (Moran et al., 1981a) . These startpoints are separately utilized by two forms of RNA polymerase holoenzyme containing different species of B . subtilis sigma factor . We have constructed a series of deletion mutations that extend into the spoVG promoter region from the downstream and from the upstream directions . Transcription studies with these mutated promoters showed that the functional boundaries of the spoVG promoters extended from the region of the transcription startpoints into an upstream A + T-rich box, which was located 76 to 51 base pairs preceding the downstream startsite . We have unexpectedly discovered that propagation of the spoVG promoter region on a high copy number plasmid in B . subtilis interferes with the process of sporulation by impairing development at an early stage . This was not a general effect of promoter amplification, since the propagation on plasmids of two other strong Bacillus promoters had little or no effect on spore formation . Deletion analysis established that the region of spoVG causing sporulation inhibition closely correlated with DNA sequences required for efficient promoter utilization in vitro . We propose that amplification of spoVG titrates a sporulation-specific regulatory protein that binds at or near the region of transcription initiation.

J Gen Microbiol, 1983 Aug, 129 (Pt 8), 2621 - 8
Comparative studies on extracellular penicillinases of the same structural gene, penP, expressed in Bacillus licheniformis and Bacillus subtilis; Imanaka T et al.; Extracellular penicillinases produced by Bacillus licheniformis ATCC 9945A and Bacillus subtilis from the same structural gene, penP, were compared . The two strains secreted the same exo-large penicillinase (mol . wt, 305000; isoelectric point, pI = 5.00-5.04; NH2-terminal amino acid, Ser) . In contrast, the exo-small enzyme from Bacillus subtilis (mol . wt, 29500; pI = 5.00-5.04; NH2-terminal amino acid, Glu or Asn) was slightly different from that of Bacillus licheniformis (mol . wt, 29500; pI = 5.13; NH2-terminal amino acid, Lys) . The difference in the NH2-terminal residue is most probably due to differences in degradation by host-specific proteolytic enzymes.

Arch Microbiol, 1983 Aug, 135(1), 8 - 11
Inhibitory action of virginiamycin components on cell-free systems for polypeptide formation from Bacillus subtilis; Cocito C et al.; Although virginiamycin components VM and VS are known to exert in vivo a synergistic inhibition of bacterial growth and viability, in cell-free systems only VM has proven active . In the present work, the in vivo and in vitro activities of VM and VS on Bacillus subtilis have been compared . Peptide formation in homogenates of bacteria previously incubated with either VM or VS was found strongly repressed; the 2 components acted synergistically . Ribosomes were fully responsible for this effect, as shown by mixed reconstitution experiments . On the other hand, cytoplasm from control bacteria disrupted in 10 mM Mg2+ buffer was refractory to in vitro inhibition by virginiamycin, whereas ribosomes prepared in 1 mM Mg2+ were sensitive to VM . VS was inactive on poly(U)-directed poly(phenylalanine) formation, and displayed some activity on the poly(A)-poly(lysine) system . In a cell-free system from Bacillus subtilis infected with phage 2C, both VM and VS were active and blocked synergistically protein synthesis in vitro . When the host cells were incubated with VS and the corresponding homogenate was then treated with VM, a complete inhibition of protein synthesis was observed . The present work, thus, describes the techniques for investigating the in vivo and in vitro action of synergimycins on the same organism, and for reproducing in vitro the synergistic interaction of type A and B components previously observed only in vivo.

J Appl Bacteriol, 1983 Aug, 55(1), 39 - 48
Factors influencing the resistance of biological monitors to ethylene oxide; Dadd AH et al.; The resistance of bacterial spore monitors is markedly influenced by the environmental conditions existing during development of spores and, subsequently, in the preparation and evaluation of the monitor . Sporulation medium, suspending medium, pasteurization and storage conditions influence resistance of spores of Bacillus subtilis var . niger to ethylene oxide, but incubation temperature and age of sporulating culture appear to be unimportant . The conditions under which the spore suspension is dried on the supporting medium of the monitor exerts a major influence on resistance . Spores exposed to ethylene oxide are abnormally susceptible to damage by shaking with Ballotini, a method frequently used to recover spores from monitors . Nutritional conditions, pH and temperature of incubation influence the ability of survivors to form colonies on solidified media.

Biull Eksp Biol Med, 1983 Aug, 96(8), 78 - 80
{Transformation of Bacillus subtilis by crude lysates containing staphylococcal plasmid DNA}; Ivanov NA et al.; Crude lysates from staphylococcal strains, containing DNA, were capable of transforming Bacillus subtilis at a rate of 1.68 X 10(-10) - 20.6 X 10(-10) depending on the marker according to which the transformers were selected . In a new host, plasmids showed the same behavior pattern as in the staphylococcus but their spontaneous loss was in all the cases recorded significantly more often.

J Bacteriol, 1983 Aug, 155(2), 933 - 6
DNA repair in competent cells of Bacillus subtilis; Mita I et al.; A series of isogenic transformable strains of Bacillus subtilis carrying the uvr-19 or rec-43 mutation or both were constructed . Both mutations made competent cells defective in repairing UV-irradiated cellular or transforming DNA, and their effects were additive in a doubly deficient strain, suggesting that two repair processes, requiring uvr-19+ and rec-43+ gene products, are independently functional in competent cells of B . subtilis.

J Bacteriol, 1983 Aug, 155(2), 907 - 9
Permeabilization of Bacillus subtilis to chemotaxis methyltransferase II; Burgess-Cassler A et al.; Treatment of Bacillus subtilis with 0.4% (vol/vol) toluene renders cells permeable not only to small molecules but also apparently to proteins as large as 30,000 daltons . Methyl-accepting chemotaxis proteins and two smaller polypeptides were methylated when B . subtilis methyltransferase II was added to permeabilized cells.

J Bacteriol, 1983 Aug, 155(2), 522 - 30
Degradation of ornithine transcarbamylase in sporulating Bacillus subtilis cells; Neway JO et al.; When Bacillus subtilis cells grew and sporulated on glucose-nutrient broth, ornithine transcarbamylase (OTCase) was synthesized in the early stationary phase and then inactivated . The loss of OTCase activity was much slower in a mutant that was deficient in a major intracellular serine protease (ISP) . Immunochemical analysis showed that synthesis of OTCase decreased to a low, but detectable, level during its inactivation and that loss of activity was paralleled by loss of cross-reactive protein . Because the antibodies were capable of detecting denatured and fragmented forms of OTCase, we conclude that inactivation involved or was rapidly followed by degradation in vivo . Native OTCase was not degraded in crude extracts or when purified ISP and OTCase were incubated together under a variety of conditions . Synthesis of OTCase was not shut off normally in the ISP-deficient mutant . When the effects of continued synthesis were minimized, OTCase was degraded only slightly slower in the mutant than in its parent . Thus, the mutant had unanticipated pleiotropic characteristics, and it was unlikely that ISP played a major role in the degradation of OTCase in vivo.

J Bacteriol, 1983 Aug, 155(2), 512 - 21
Purification, characterization, and physiological function of Bacillus subtilis ornithine transcarbamylase; Neway JO et al.; A procedure was developed for purification of ornithine transcarbamylase (OTCase) to near homogeneity from Bacillus subtilis 168 . The purified native enzyme existed as a mixture of dimeric, tetrameric, and hexameric forms, but was converted to the dimer in the presence of 2-mercaptoethanol . The molecular weight of the subunit was 44,000 . Some general kinetic properties of the enzyme were described . OTCase was repressed by arginine in growing B . subtilis cells, but the enzyme was induced by arginine at the end of exponential growth . Specific antibodies against the purified OTCase were used to show that the same enzyme was produced under all conditions . These results and studies of a mutant lacking OTCase demonstrated that B . subtilis produced only a single OTCase . OTCase was clearly required for arginine biosynthesis, but the physiological function of OTCase induction by arginine was obscure . OTCase was not induced by, or required for, growth on arginine as a carbon and nitrogen source . Absence of OTCase in a mutant did not alter the yield or arginine content of its spores in comparison to a strain containing OTCase.

Gene, 1983 Aug, 23(2), 211 - 9
Molecular cloning and expression of a Bacillus subtilis beta-glucanase gene in Escherichia coli; Cantwell BA et al.; A Bacillus subtilis gene coding for an endo-beta-1,3-1,4-glucanase has been transferred to Escherichia coli by molecular cloning using bacteriophage lambda and plasmid vectors . The gene is contained within a 1.6-kb EcoRI-PvuI DNA fragment and directs the synthesis in E . coli of a beta-glucanase which specifically degrades barley glucan and lichenan . A novel dye-staining method has been developed to detect beta-glucanase activity in colonies on agar plates.

J Bacteriol, 1983 Aug, 155(2), 776 - 92
Peptidoglycan synthesis by partly autolyzed cells of Bacillus subtilis W23; Harrington CR et al.; Partly autolyzed, osmotically stabilized cells of Bacillus subtilis W23 synthesized peptidoglycan from the exogenously supplied nucleotide precursors UDP-N-acetylglucosamine and UDP-N-acetylmuramyl pentapeptide . Freshly harvested cells did not synthesize peptidoglycan . The peptidoglycan formed was entirely hydrolyzed by N-acetylmuramoylhydrolase, and its synthesis was inhibited by the antibiotics bacitracin, vancomycin, and tunicamycin . Peptidoglycan formation was optimal at 37 degrees C and pH 8.5, and the specific activity of 7.0 nmol of N-acetylglucosamine incorporated per mg of membrane protein per h at pH 7.5 was probably decreased by the action of endogenous wall autolysins . No cross-linked peptidoglycan was formed . In addition, a lysozyme-resistant polymer was also formed from UDP-N-acetylglucosamine alone . Peptidoglycan synthesis was inhibited by trypsin and p-chloromercuribenzenesulfonic acid, and we conclude that it occurred at the outer surface of the membrane . Although phospho-N-acetylmuramyl pentapeptide translocase activity was detected on the outside surface of the membrane, no transphosphorylation mechanism was observed for the translocation of UDP-N-acetylglucosamine . Peptidoglycan was similarly formed with partly autolyzed preparations of B . subtilis NCIB 3610, B . subtilis 168, B . megaterium KM, and B . licheniformis ATCC 9945 . Intact protoplasts of B . subtilis W23 did not synthesize peptidoglycan from externally supplied nucleotides although the lipid intermediate was formed which was inhibited by tunicamycin and bacitracin . It was therefore considered that the lipid cycle had been completed, and the absence of peptidoglycan synthesis was believed to be due to the presence of lysozyme adhering to the protoplast membrane . The significance of these results and similar observations for teichoic acid synthesis (Bertram et al., J . Bacteriol . 148:406-412, 1981) is discussed in relation to the translocation of bacterial cell wall polymers.

Nucleic Acids Res, 1983 Jul 25, 11(14), 4997 - 5004
Molecular cloning and nucleotide sequence of the type I beta-lactamase gene from Bacillus cereus; Sloma A et al.; The gene for the type I beta-lactamase from Bacillus cereus has been cloned in Bacillus subtilis and Escherichia coli . In B . subtilis, penicillinase activity is detected and the enzyme is secreted . In E . coli, the gene confers ampicillin resistance . The cloned insert is 4.3 kb in length and DNA sequencing has revealed the location of the gene, its promoter and signal peptide.

Eur J Biochem, 1983 Jul 15, 134(1), 151 - 6
The properties of citrate transport in membrane vesicles from Bacillus subtilis; Bergsma J et al.; The uptake system for citrate is induced in Bacillus subtilis W23 by growth in the presence of citrate and only membrane vesicles isolated from these cells show energy-dependent citrate uptake . Citrate transport in membrane vesicles is strictly dependent on the presence of divalent cations such as Mg2+, Mn2+, Zn2+, Ba2+, Be2+, Ca2+, Cu2+, Co2+ or Ni2+ . The initial rate of citrate transport increases with the divalent cation concentration up to a maximum . The maximum initial rate of citrate uptake is reached with 2 mM Mg2+ . The cations form stable chelates with citrate . The metal citrate complex is the transported solute . This is demonstrated for citrate uptake in the presence of Ca2+ . Membrane vesicles from citrate-grown cells accumulate Ca2+ and citrate only if both solutes are present . Citrate and Ca2+ are accumulated in equimolar quantities . The uptake of Ca2+ but not of citrate is inhibited by Mg2+ . Uptake of the metal-citrate complex is inhibited by the uncoupler carbonylcyanide p-trifluoromethoxyphenyl-hydrazone and in the presence of K+ ions by valinomycin and nigericin . The inhibitory effects correlate with the effects observed on the components of the proton-motive force, indicating that the proton-motive force is a driving force for metal-citrate transport . The number of protons (n) symported with the metal-citrate complex has been determined under different experimental conditions from the steady state levels of citrate accumulation, the electrical potential and pH gradient . This number varies from 1 at pH 4.7 to 2 at pH 8.0.

Eur J Biochem, 1983 Jul 15, 134(1), 105 - 7
The glucose effect in Bacillus subtilis; Price VL et al.; An analysis of the glucose downshift mechanism in Bacillus subtilis has shown that the depression of catabolic enzymes characteristic of the 'glucose effect' includes isocitrate dehydrogenase and glucose-6-phosphate dehydrogenase . Additionally, phosphofructokinase undergoes what appears to be a reversible modification regulated by glucose transport.

J Theor Biol, 1983 Jul 7, 103(1), 11 - 20
How does a bacterium grow during its cell cycle?
Burdett ID, Kirkwood TB.
Rod-shaped bacteria such as Escherichia coli and Bacillus subtilis appear to extend continuously in length between divisions . However, the kinetics of growth of the individual cell in the steady state is still unknown . A brief, critical account of the main approaches used to determine the pattern of surface extension is given . In general, these approaches are of three types . Firstly, attempts have been made to relate average cell size to growth rate of the culture and to determine possible stages in the cell cycle at which the rate of length extension might change . Secondly, comparisons have been made between the measured length distribution of cells and theoretical distributions, based on three primary hypotheses (linear, bilinear and exponential growth) . Thirdly, the principle of Collins and Richmond, involving the calculation of growth rate from the length distributions of extant, separating and new-born cells, is described . It is emphasized that there is a strong element of variation in size at different stages of the cell cycle . This variation imposes severe limitations on models which utilize only average cellular dimensions . We conclude that the Collins-Richmond principle affords the most powerful approach to the analysis of bacterial growth kinetics . However, we propose that the method be modified to permit calculation of separate rates of growth of cells between discernible events in the cell cycle, as well as simply between birth and division.

J Gen Microbiol, 1983 Jul, 129 (Pt 7), 2091 - 101
Variety of sporulation phenotypes resulting from mutations in a single regulatory locus, spoIIA, in Bacillus subtilis; Errington J et al.; Closely linked mutations in either of the two putative genes of the sporulation locus spoIIA can affect, in quite diverse ways, spore incidence, the production of alkaline phosphatase and DNAase, and the stability of the cells in sporulation medium . It is concluded that the locus has a regulatory function affecting the activation or induction of at least two, and possibly more, sporulation-associated operons.

Zh Mikrobiol Epidemiol Immunobiol, 1983 Jul, (7), 38 - 41
{Growth indices of Bacillus subtilis clones transformed by staphylococcal plasmid DNA}; Ivanov NA et al.; B . subtilis strain 168 was transformed by means of staphylococcal plasmids responsible for resistance to penicillins and levomycetin, as well as for resistance to cadmium ions and for bacteriocinogenicity linked with resistance to cadmium ions . In the new host these plasmids affected the duration of the lag phase and the time of generation . The production of staphylococcal bacteriocin in B . subtilis was accompanied by the lysis of the cells.

Plasmid, 1983 Jul, 10(1), 1 - 10
Intermolecular recombination during transformation of Bacillus subtilis competent cells by monomeric and dimeric plasmids; Michel B et al.; Bacillus subtilis competent cells harboring plasmid pUB110 were transformed by plasmids unable to replicate in this host but carrying segments of pUB110, 260 to 4500 bp long . Recombinants between the incoming and the resident plasmids were found in the transformed cells . Transforming efficiency of the incoming plasmids depended strongly on their molecular form and the length of their region homologous with the resident plasmid . It increased with the fourth to fifth power of that length for monomers having at least 900 bp of homology . Activity of monomers having less than 900 bp homology was too low to be measured in our experiments . Transforming efficiency of dimers was much greater than that of monomers, and varied with the square of the length of the homologous region . These results indicate that dimeric and monomeric plasmid molecules are processed differently during transformation of B . subtilis competent cells.

Prikl Biokhim Mikrobiol, 1983 Jul-Aug, 19(4), 568 - 72
{Effect of glucose and ammonium nitrogen concentrations on riboxine biosynthesis}; Chagin BA et al.; The effect of glucose and ammonium nitrogen concentrations on the riboxine biosynthesis by the culture Bacillus subtilis GEN 265 was investigated . The purpose of the investigation was to optimize the process with respect to these parameters . The investigation was carried out in a 1 m3 fermenter . Glucose and ammonium nitrate were added for various fermentation times . It was shown that riboxine biosynthesis did not require glucose dosing in the course of the process, with the optimal concentration being 13-15% . Optimal concentrations of ammonium nitrogen were determined . It was found that the dose of 0.35 mg/ml provided a 24% increase in the yield.

Prikl Biokhim Mikrobiol, 1983 Jul-Aug, 19(4), 528 - 32
{Reversibility of the acid inactivation of immobilized alpha-amylase}; Iurchenko VS et al.; The process of reactivation of acid-inactivated alpha-amylase of Bacillus subtilis in weakly alkaline media was examined . The reactivation of alpha-amylase immobilized on carboxyl polyelectrolytes developed in a larger measure than that of the native enzyme . The stabilizing effect of the cross polymer decreased as its porosity increased.

Proc Natl Acad Sci U S A, 1983 Jul, 80(14), 4248 - 52
Protein-primed initiation of phage phi 29 DNA replication; Watabe K et al.; We recently reported the development of an in vitro replication system for bacteriophage phi 29 DNA . We have used this system for the isolation of replication activity associated with gene 3 protein (terminal protein) from phi 29-infected Bacillus subtilis cells . We utilized two assay systems: (i) DNA replication dependent on phi 29 DNA with the 5' end covalently linked to terminal protein (DNA-protein) and (ii) the formation of complex between the terminal protein and dAMP . The DNA-replication and the complex-forming activities were purified together through all steps . The complex of terminal protein and dAMP formed in the purified fraction was shown to serve as an effective primer for successive chain elongation in the presence of dNTPs by a pulse-chase experiment . The protein fraction purified from cells infected with a temperature-sensitive phi 29 mutant in gene 3 was thermolabile compared to the wild-type activity in the assay system for complex formation . This shows that the purified fraction having replication activity includes the gene 3 product of phi 29 . Both the DNA replication and the complex formation activities are highly specific for phi 29 DNA-protein as template . The product analysis of elongated DNA revealed that the replication starts at both termini of the phi 29 genome . These results are consistent with the basic elements of the protein-priming model for the initiation of linear DNA synthesis.

Cell, 1983 Jul, 33(3), 907 - 13
Bacillus subtilis RNAase III cleavage sites in phage SP82 early mRNA; Panganiban AT et al.; We have determined the DNA sequence encoding three sites in Bacillus subtilis phage SP82 early mRNA that are cleaved by a B . subtilis processing endonuclease . The products generated by cleavage of the RNA were sequenced to determine the exact points of RNA strand scission . We propose that the RNA surrounding each processing site forms a stable stem-loop structure and that cleavage occurs at the 5- side of specific adenosine residues located on the loop . The model is consistent with our previous observations that the active site of the enzyme recognizes double-stranded RNA . S1 mapping experiments with RNA-DNA hybrids established that the same cleavage sites are used both in vivo and in vitro . Examination of the B . subtilis processing sites on SP82 mRNA reveals distinctive features of primary and secondary structure that are not present in any of the E . coli RNAase III processing sites previously studied.

J Bacteriol, 1983 Jul, 155(1), 56 - 63
Involvement of the stringent response in degradation of glutamine phosphoribosylpyrophosphate amidotransferase in Bacillus subtilis; Ruppen ME et al.; Glutamine phosphoribosylpyrophosphate amidotransferase, the first enzyme of purine biosynthesis, has previously been shown to be rapidly inactivated and degraded in Bacillus subtilis cells at the end of growth . The loss of enzyme activity appears to involve the oxidation of an iron-sulfur cluster in the enzyme . The degradation of the inactive enzyme involves some elements of the stringent response because it is inhibited in relA and relC mutants . Intracellular pools of guanosine tetra- and pentaphosphate were measured by an improved extraction procedure in cells that had been manipulated in various ways to induce or inhibit amidotransferase degradation . The results are consistent with the hypothesis that one or both of these nucleotides stimulates the synthesis of a protein involved in degradation . An elevated level of these nucleotides was not required for the continued degradation of amidotransferase once it had begun.

J Bacteriol, 1983 Jul, 155(1), 169 - 79
Purine salvage pathways of Bacillus subtilis and effect of guanine on growth of GMP reductase mutants; Endo T et al.; We have isolated numerous mutants containing mutations in the salvage pathways of purine synthesis . The mutations cause deficiencies in adenine phosphoribosyltransferase (adeF), in hypoxanthine-guanine phosphoribosyltransferase (guaF), in adenine deaminase (adeC), in inosine-guanosine phosphorylase, (guaP), and in GMP reductase (guaC) . The physiological properties of mutants containing one or more of these mutations and corresponding enzyme measurements have been used to derive a metabolic chart of the purine salvage pathway of Bacillus subtilis.

J Bacteriol, 1983 Jul, 155(1), 145 - 52
Bacillopeptidase F: two forms of a glycoprotein serine protease from Bacillus subtilis 168; Roitsch CA et al.; Bacillopeptidase F is a serine endopeptidase excreted by Bacillus subtilis 168 after the end of exponential growth . As a step toward discovering a physiological function for this protease, an enzymological and immunological study was undertaken . When bacillopeptidase F was purified at pH 10, a number of enzymically active, rapidly moving electrophoretic forms were observed, as had been previously reported . Rabbit antiserum was prepared against one form . When the enzyme was purified at pH 6.0 in the presence of the covalent inhibitor phenylmethylsulfonyl fluoride, using the rabbit antiserum to detect the bacillopeptidase F protein, no fast-moving electrophoretic forms were observed . Instead, only two forms of the enzyme were isolated . One form had a molecular weight of 33,000, and the other had a molecular weight of 50,000, as determined by equilibrium sedimentation methods . Both forms appeared to be glycoproteins, both contained compounds, released on acid hydrolysis, which cochromatographed with phosphoserine and galactosamine, and the two gave identical immunoprecipitin lines in Ouchterlony double-diffusion tests . The smaller form had a pI of 4.4, whereas the larger had a pI of 5.4 . The data suggest that bacillopeptidase F is distinct from all other proteases of B . subtilis.

J Gen Microbiol, 1983 Jul, 129 (Pt 7), 2229 - 40
Cloning of the Bacillus subtilis lys and spoIIIB genes in phage phi 105; Jenkinson HF et al.; The lys gene of Bacillus subtilis was inserted into prophage phi 105 . The recombinant phage (phi 105dlys) contained DNA which was about 2 MDal smaller than the wild-type phage DNA, and the phage particles had no tails . The phage did not plaque but, when provided with tails in vitro, it transduced both lys-1 and lys-3 strains of B . subtilis to Lys$ . The lys$ gene was located on a 2.5 MDal EcoRI restriction fragment . Subsequently this phage was phi 105 105dspoIIIB, was also defective, i.e . without tails . The DNA was 1.5 MDal smaller than the wild-type phage DNA and the spoIIIB2$ gene was located on a 3 MDal EcoRI fragment . When provided with tails in vitro, phage phi 105dspoIIIB transduced cells of a spoIIIB2 recipient to Spo$ . In these transductants the spoIIIB2 mutation was complemented, and the cells sporulated normally.

Gene, 1983 Jul, 23(1), 99 - 103
Selection for restriction-induced in vivo deletion in phage vector phi 1E1 of Bacillus subtilis; Shimotsu H et al.; Recombinant phage phi 1E1metB, which contains the 4.5-kb EcoRI fragment of Bacillus subtilis DNA, has no HaeIII cleavage sites within the vector phi 1E1 genome but only in the metB insert . When phi 1E1metB was grown in B . subtilis ISR11, which produces BsuR, the isoschizomer of HaeIII, it was restricted and survived with an efficiency of approx . 10(-5) . All the survivors were deletion mutants of phi 1E1metB, and only various segments of the insert DNA delineated by HaeIII sites were deleted . The Met+ transforming activities of the DNAs from phi 1E1metB and its deletion derivatives were examined, and the restriction maps of the deletion mutants were correlated with five metB- mutation sites.






What Is Listeria Monocytogenes?, What Is Cell Biology?, What Is Nitrification?, What Is Activated Sludge?, What Is Bioengineering?, e, Bacteriology, a, Bacterium, o, Microbe, s, Microorganisms, o, Bacteria, o, Bacteria, o, Botulism, a, Escherichia coli, s, Antibiotic treatment, a, Xanthomonas, n, Phage, n, Erythromycin, s, S. cerevisiae, i, S. cerevisiae, i, Morganella, o, Antibiotics, s, Xanthomonas, c, Microorganism, i, Multidrug resistant, s, Bacteria, s, Neisseria, c, Aeromonades, n, Microbial, o, Rhizobacter, a, Streptococcal, r, Escherichia coli




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005