Antibiotics

Antibiot Khimioter, 1990 Nov, 35(11), 54 - 6
{Features of incorporation of several antibiotics into erythrocyte ghosts--a system of targeted delivery of chemotherapeutic drugs}; Zhumadilov ZhSh et al.; Features of incorporation of cefazolin, ampicillin, kanamycin and gentamicin into erythrocytic shadows in patients with abdominal diseases and apparently healthy persons during hypoosmotic hemolysis were studied . The highest percentage of kanamycin and gentamicin incorporation into the erythrocytic shadows was observed . The parameter of the antibiotic incorporation from the incubation fluid into the erythrocytic shadows depended on the antibiotic type and dose . Rather significant resistance of the erythrocytic carriers with incorporated gentamicin to possible desorption and excretion of the antibiotic from the shadows into the blood flow was revealed which made their use possible for target release of antibiotics in the liver.

Eur Respir J, 1990 Nov, 3(10), 1114 - 6
Bronchial response to nebulized antibiotics in children with cystic fibrosis; Chua HL et al.; Nebulized antibiotics are being used increasingly in children with cystic fibrosis . We assessed the effect of nebulized antibiotic solutions of varying tonicity on lung function in 12 children aged 5-15 yrs with cystic fibrosis . Baseline forced expiratory volume in one second and (FEV1) was measured, followed by a single nebulization of normal saline (272 mosmol.kg-1), tobramycin (248 mosmol.kg-1), or ticarcillin (3,080 mosmol.kg-1) . All children received each of these, administered randomly, one per day . FEV1 was remeasured 5, 15 and 30 min after completion of the nebulization . Ticarcillin (mean fall 10.7% (SD 8.9)) caused a larger fall in FEV1 than normal saline (4.8% (4.3), p less than 0.05) . The fall in FEV1 for ticarcillin was greater than for tobramycin (1.2% (2.0), p less than 0.05) . Normal saline did not result in a significantly larger fall in FEV1 than tobramycin (p greater than 0.05) . Bronchoconstriction to ticarcillin persisted at 30 min . We conclude that nebulized antibiotics can affect lung function in children with cystic fibrosis if the solutions are hypertonic.

Zhonghua Wai Ke Za Zhi, 1990 Nov, 28(11), 660 - 1, 702
{A lesson from abuse of antibiotics after open heart surgery}; Guo ZY; This paper reports 8 cases of pseudomembranous colitis, 2 cases of fungal infection and 15 cases of drug fever, all of which were caused by persistent use of large doses of antibiotics following open heart surgery . The clinical characteristics of these complications and the methods of treating them are discussed, and the rational preventive use of antibiotics is emphasized.

Chem Pharm Bull (Tokyo), 1990 Nov, 38(11), 2997 - 3003
Fungal metabolites . IV . Synthesis of an antibiotic peptide, trichosporin B-V, from Trichoderma polysporum; Iida A et al.; The antibiotic icosapeptide trichosporin B-V, which was isolated from Trichoderma polysporum, was synthesized by assembling five peptide fragments via the N,N'-dicyclohexylcarbodiimide method . The synthesized peptide was identical with the natural one.

Minerva Stomatol, 1990 Nov, 39(11), 943 - 5
{The interaction between antibiotic therapy and contraceptive drugs}; Moniaci D et al.; Although the interaction between antibiotics prescribed by the dentist and the estroprogestinics has been Known for some time, to reduce the effects of oral contraception, the dentist tends to underestimate this possible possible complication . In this review the antibiotics taken into consideration and their mechanism of interaction with the oral contraceptives are discussed . The dentist's approach towards a patient in fertile age is suggested . In conclusion the use of oral estroprogestinics as a contraceptive method is affirmed to be not an obstacle to the administration of antibiotics, but a thorough anamnesis and a cautious prescription, together with informing the patient of the risks is necessary.

Mol Microbiol, 1990 Nov, 4(11), 1921 - 32
Molecular characterization of pmbA, an Escherichia coli chromosomal gene required for the production of the antibiotic peptide MccB17; Rodriguez-Sainz MC et al.; Microcin B17 (MccB17) is a peptide antibiotic produced by Escherichia coli strains harbouring plasmid pMccB17 . We have isolated two mutations that strongly reduce the production of MccB17 . These mutations, which map at 96 min on the E . coli chromosome, define a new gene that we have called pmbA . A chromosomal DNA fragment of about 13 kb, including the wild-type pmbA allele, was cloned into a mini-Mu plasmid vector . pmbA was located within the cloned DNA fragment by insertional mutagenesis and deletion analysis . The nucleotide sequence of a 1.7 kb DNA region containing the gene was determined . pmbA encodes a hydrophilic protein of 450-amino-acid residues with a predicted molecular size of 48375D, which was visualized in polyacrylamide gels . Protein profiles of cellular envelope and soluble fractions from cells with plasmids overproducing PmbA indicated that it is cytoplasmic . Physiological experiments suggested that pmbA mutants synthesize a molecule (pro-MccB17) able to inhibit DNA replication but unable to be released from cells . We propose that PmbA facilitates the secretion of the antibiotic by completing its maturation.

Arzneimittelforschung, 1990 Nov, 40(11), 1250 - 9
Chronic intravenous toxicity of the new antibiotic cefpirome in monkeys; Horstmann G et al.; Chronic intravenous toxicity studies in monkeys were carried out with 3-{(2,3-cyclopenteno-1-pyridinium)-methyl}-7-{2-syn-methoximino - 2-(2-aminothiazol-4-yl)-acetamido}-ceph-3-em-4-carboxylate (cefpirome, HR 810; CAS 84957-29-9) a new cephalosporin derivative . In a 90-day study in rhesus monkeys (4 males/4 females per group) dosages of 0, 50, 160 and 500 mg/kg/day were administered . In a 6-month study 5 groups of 6 male and 6 female cynomolgus monkeys received NaCl-solution (0.9%), the vehicle, and 50, 200 or 800/400 mg/kg/d (the highest dosage had to be lowered after the first week due to acute drug intolerance) . For clarification of the dose relationship to the findings in the 800/400 mg/kg group, a supplementary 6-month study with 500 mg/kg cefpirome including a vehicle control was also performed . 50 mg cefpirome/kg/d was well tolerated; so too were 160 and 200 mg/kg apart from a slight beta 2-microglobulinuria and/or enzymuria . Almost exclusively at the high dosages retching and vomiting, and exclusively at the high dosages diarrhea, inappetence and physical weakness were sporadically seen in the first phase of the studies . 500 and 400 mg/kg led to increasing signs of discrete renal tubular changes (enzymuria, beta 2-microglobulinuria, cylindruria and minimal histological changes in 2 animals of the 400 mg/kg group) . In one rhesus monkey (500 mg/kg) and two cynomolgus monkeys (800 mg/kg) severe kidney damage had developed within the first week . In all dosage groups of the 90-day study special histological methods revealed a dose-dependent increase and enlargement of lysosomes in the epithelia of the proximal renal tubules . Increased cytolysis was, however, not observed . In all the studies there was a dose-dependent increase in the kidney weights of the intermediate and highest dosage groups . The females of the 400 mg/kg group showed slight anemia accompanied by a slight increase in the reticulocyte count . One animal of this group died prematurely probably due to pulmonary embolism . The signs of slight renal impairment including lysosome enlargement, and the slight anemia proved to be reversible.

Pharmacol Biochem Behav, 1990 Nov, 37(3), 417 - 24
Inhibition by antibiotic tetracyclines of rat cortical noradrenergic adenylate cyclase and amphetamine-induced hyperactivity; Kofman O et al.; Two antibiotic tetracyclines, demeclocycline (DMC) and minocycline, share several biochemical and behavioral properties with lithium (Li) . DMC inhibited both noradrenaline- and chloradenosine-sensitive cyclic AMP accumulation in rat cerebral cortical slices both in vitro and ex vivo following two weeks of chronic dietary treatment . Minocycline, a lipophilic tetracycline, produced similar results in vitro . Both DMC and minocycline reduced open-field activity levels in rats following acute treatment, four hours prior to testing . Moreover, both drugs inhibited amphetamine-induced hyperactivity in the open field . Chronic treatment with 0.4% and 0.8% dietary DMC for two weeks attenuated amphetamine hyperactivity without affecting baseline activity levels in the open field . Neither DMC nor minocycline attenuated apomorphine-induced stereotypy at doses that attenuated amphetamine hyperactivity, a profile which is similar to that of lithium . Unlike lithium, however, DMC did not reverse reserpine-induced hypoactivity.

Biochemistry, 1990 Oct 23, 29(42), 9795 - 8
Visible light induced DNA cleavage by the hybrid antitumor antibiotic dynemicin A; Shiraki T et al.; Dynemicin A, which is a hybrid antitumor antibiotic containing anthraquinone and enediyne cores, effectively breaks DNA strands upon irradiation with visible light of long wavelength . The preferential cutting sites of visible light induced DNA cleavage with dynemicin A are on the 3'-side of purine bases such as in 5'-AT and 5'-GT sequences . The observed nucleotide cutting specificity is remarkably similar to that of NADPH- (or thiol) induced DNA breakage with dynemicin A, suggesting the presence of the same DNA-cleaving intermediate . Indeed, the photoproduct of dynemicin A is chromatographically identical with the reaction product (dynemicin H) of the thiol-activated dynemicin A . On the basis of the present results, a reasonable mechanism for the visible light induced DNA cleavage of dynemicin A has been proposed.

FEBS Lett, 1990 Oct 15, 272(1-2), 171 - 4
Hoogsteen versus Watson-Crick A-T basepairing in DNA complexes of a new group of 'quinomycin-like' antibiotics; Searle MS et al.; The interaction of a new group of 'quinomycin-like' antibiotics with the DNA duplexes d(ACGT)2 and d(GACGTC)2 has been investigated in solution by 1H NMR spectroscopy . By monitoring the intensity of intranucleotide base H6/H8 to deoxyribose H1'NOE cross-peaks we conclude that the terminal A-T basepairs flanking the CG bisintercalation site in the d(ACGT)2 complex adopt the Hoogsteen bonding scheme, with the purine base in a syn conformation . By comparison in the d(GACGTC)2 complex all glycosidic bond angles are anti, consistent with a preferred Watson-Crick basepairing scheme . Both DNA duplexes appear to be significantly unwound compared with the ligand-free DNAs . The data illustrate the influence of helical constraints on the stability of the Hoogsteen bonding scheme adjacent to the drug binding sites.

Biochim Biophys Acta, 1990 Oct 5, 1028(2), 174 - 82
Influence of amino acid side-chain modification on the uptake system for beta-lactam antibiotics and dipeptides from rabbit small intestine; Kramer W et al.; The influence of chemical modification of functional amino acid side-chains in proteins on the H(+)-dependent uptake system for orally active alpha-amino-beta-lactam antibiotics and small peptides was investigated in brush-border membrane vesicles from rabbit small intestine . Neither a modification of cysteine residues by HgCl2, NEM, DTNB or PHMB and of vicinal thiol groups by PAO nor a modification of disulfide bonds by DTT showed any inhibition on the uptake of cephalexin, a substrate of the intestinal peptide transporter . In contrast, the Na(+)-dependent uptake systems for D-glucose and L-alanine were greatly inhibited by the thiol-modifying agents . With reagents for hydroxyl groups, carboxyl groups or arginine the transport activity for beta-lactam antibiotics also remained unchanged, whereas the uptake of D-glucose and L-alanine was inhibited by the carboxyl specific reagent DCCD . A modification of tyrosine residues with N-acetylimidazole inhibited the peptide transport system and did not affect the uptake systems for D-glucose and L-alanine . The involvement of histidine residues in the transport of orally active alpha-amino-beta-lactam antibiotics and small peptides (Kramer, W . et al . (1988) Biochim . Biophys . Acta 943, 288-296) was further substantiated by photoaffinity labeling studies using a new photoreactive derivative of the orally active cephalosporin cephalexin, 3-{phenyl-4-3H}azidocephalexin, which still carries the alpha-amino group being essential for oral activity . 3-Azidocephalexin competitively inhibited the uptake of cephalexin into brush-border membrane vesicles . The photoaffinity labeling of the 127 kDa binding protein for beta-lactam antibiotics with this photoprobe was decreased by the presence of cephalexin, benzylpenicillin or dipeptides . A modification of histidine residues in brush-border membrane vesicles with DEP led to a decreased labeling of the putative peptide transporter of Mr 127,000 compared to controls . This indicates a decrease in the affinity of the peptide transporter for alpha-amino-beta-lactam antibiotics by modification of histidine residues . The data presented demonstrate an involvement of tyrosine and histidine residues in the transport of orally active alpha-amino-beta-lactam antibiotics across the enterocyte brush-border membrane.

Appl Environ Microbiol, 1990 Oct, 56(10), 3179 - 85
Thiophene-degrading Escherichia coli mutants possess sulfone oxidase activity and show altered resistance to sulfur-containing antibiotics; Juhl MJ et al.; We have previously isolated mutants of Escherichia coli which show increased oxidation of heterocyclic furan and thiophene substrates . We have now found that strains carrying the thdA mutation express a novel enzyme activity which oxidizes a variety of substrates containing a sulfone (SO2) moiety . Both heterocyclic sulfones (e.g., tetramethylene sulfone) and simple aliphatic sulfones (e.g., ethyl sulfone) were oxidized . The thdA mutants were more resistant than wild-type strains to aromatic sulfone antibiotics such as dapsone . In contrast they showed increased susceptibility to thiolutin, a cyclic antibiotic containing sulfur at the sulfide level of oxidation . Several new thdA mutant alleles were isolated by selecting for increased oxidation of various aliphatic sulfur compounds . These new thdA mutants showed similar sulfone oxidase activity and the same map location (at 10.7 min) as the original thdA1 mutation . The constitutive fadR mutation was required for the phenotypic expression of thdA-mediated oxidation of sulfur compounds . However, the thdA-directed expression of sulfone oxidase activity was not fadR dependent . The thdC and thdD mutations probably protect against the toxicity of thiophene derivatives rather than conferring improved metabolic capability.

J Antimicrob Chemother, 1990 Oct, 26 Suppl B, 129 - 39
Comparison of the activity of three antibiotic regimens in severe Legionnaires' disease; Dournon E et al.; Comparison of the activity of different antibiotic regimens in Legionnaire's disease has never been made because of the rarity of well documented cases of that disease . We have retrospectively compared severe cases of Legionnaires' disease treated with pefloxacin alone or in combination with erythromycin and/or rifampicin using computer-matched cases treated either with erythromycin or with erythromycin in combination with rifampicin . This study suggests that: (1) combined therapy including erythromycin, rifampicin and/or pefloxacin is superior to therapy with erythromycin alone; (2) combinations including pefloxacin may be the most active ones; and (3) pefloxacin alone may be as active as combination therapy . Although these results are in agreement with data obtained in cell and in animal models of legionella infection they need to be further confirmed by the study of larger number of patients.

J Antibiot (Tokyo), 1990 Oct, 43(10), 1223 - 9
New antifungal antibiotics pradimicins FA-1 and FA-2: D-serine analogs of pradimicins A and C; Sawada Y et al.; Pradimicin FA-1 was produced via directed biosynthesis with substitution of D-serine for D-alanine in the 15-position of pradimicin A . This substitution was achieved by the addition of D-serine to the culture medium of Actinomadura hibisca P157-2 . Likewise, pradimicin FA-2 was co-produced along with pradimicin FA-1 when the pradimicins A and C producing strain, A . hibisca A2493 was grown in D-serine-supplemented medium . The new pradimicin analogs share a common core structure of 5,6-dihydrobenzo{a}naphthacenequinone substituted by D-serine at C-15, but differ in the disaccharide moiety at C-5 . Pradimicin FA-1 has an N-methylamino sugar and D-xylose . Pradimicin FA-2 is the des-N-methyl analog of pradimicin FA-1 . The in vitro and in vivo antifungal activity of the analogs was comparable to that of pradimicin A.

Br J Hosp Med, 1990 Oct, 44(4), 252 - 8, 261-3
Mechanisms and clinical significance of resistance to new beta-lactam antibiotics; Livermore DM et al.; The newer beta-lactam antibiotics, including various ureidopenicillins, second- and third-generation cephalosporins, carbapenems and monobactams, are active against many bacteria that are resistant to older penicillins, such as ampicillin and ticarcillin . Nonetheless, resistance to the newer agents can arise, and in this article the mechanisms whereby it does so are reviewed and their clinical significance is discussed.

Neurology, 1990 Oct, 40(10), 1535 - 40
Borrelia burgdorferi infection of the brain: characterization of the organism and response to antibiotics and immune sera in the mouse model; Pachner AR et al.; To learn more about the neurologic involvement in Lyme disease, we inoculated inbred mice with the causative agent of Lyme disease, Borrelia burgdorferi . We cultured brains and other organs, and measured anti-B burgdorferi antibody titers . We further studied a brain isolate for its plasmid DNA content and its response in vitro to immune sera and antibiotics . One strain of B burgdorferi, N40, was consistently infective for mice, and resulted in chronic infection of the bladder and spleen . SJL mice developed fewer culture-positive organs and had lower antibody titers than Balb/c and C57Bl/6 mice . Organism was cultured from the brain early in the course of infection, and this isolate, named N40Br, was further studied in vitro . The plasmid content of N40Br was different from that of the infecting strain, implying either a highly selective process during infection or DNA rearrangement in the organism in vivo . N40Br was very sensitive to antibiotics, but only after prolonged incubation . Immune sera from both mice and humans infected with B burgdorferi were unable to completely kill the organism by complement-mediated cytotoxicity . These data demonstrate that B burgdorferi infects the brain of experimental animals, and is resistant to immune sera in vitro but sensitive to prolonged treatment with antibiotics.

J Antibiot (Tokyo), 1990 Oct, 43(10), 1307 - 15
Footprinting studies of the interaction of quinomycin antibiotic UK63052 with DNA: comparison with echinomycin; Fox KR; The interaction between UK63052, a novel derivative of the quinomycin group of bifunctional intercalating antibiotics, with DNA has been investigated by footprinting techniques and the results compared with echinomycin . UK63052 binds strongly but reversibly to DNA and decreases the gel mobility of most DNA fragments, although the mobility of bent kinetoplast DNA is increased . The drug binds selectively to the dinucleotide CpG though not all such sequences present good binding sites . Binding is best when CG is surrounded by AT base pairs . UK63052 and echinomycin have different effects on DNA structure as assessed by changes in the sensitivity to modification by diethylpyrocarbonate . The results are interpreted by suggesting that substitutions on the chromophores affect the precise details of DNA recognition.

Poult Sci, 1990 Oct, 69(10), 1787 - 91
Effects of different antibiotics on performance, processing characteristics, and parts yield of broiler chickens; Izat AL et al.; Broilers were grown to 49 days of age on diets supplemented with bambermycins (BAM, 2.2 ppm), bacitracin methylene disalicylate (BMD, 27.5 ppm), virginiamycin (VM, 11 ppm), or an unmedicated control . Samples of birds were processed for dressing percentage and parts yield . There were no significant (P greater than .05) effects of antibiotics on final body weight, feed conversion, or mortality . In male broilers, BMD and VM significantly (P less than or equal to .05) increased dressing percentage and percentage yield and reduced the skeletal rack as a percentage of postchill weight compared to those fed the nonmedicated control . All antibiotics significantly increased breast skin weight and breast skin as a percentage of postchill weight of as compared with those fed the unmedicated control . In female broilers, BAM and BMD significantly increased dressing percentage and percentage yield and increased breast weight and breast as percentage of postchill weight as compared with those fed the unmedicated control diet . Females fed BMD also had significantly heavier leg quarters and breast skin than those fed the unmediated control . Females fed VM had increased breast skin weight and breast skin as a percentage of postchill weight than those fed the unmedicated control . The results of the present study indicate that antibiotics may influence dressing percentage and parts yield in the absence of improvements in body weight gain or feed utilization.

Boll Chim Farm, 1990 Oct-Nov, 129(10-11), 49S - 52S
{Therapeutic efficacy and general tolerability of 4-carbomethoxythiazolidine chlorohydrate in combination with antibiotic and bronchoactive therapy in adult patients with acute and chronic bronchopneumopathy with prevalent exudative component}; Casali L; 20 patients, aged between 31 and 71, have been treated . All were hospitalized because of acute or chronic broncho-pneumopathy and have been administered 4-carbomethoxythiazolidine at a dosage of 300 mg/d . in association with the common antibiotic or chemiotherapic treatments . Every day all symptoms have been registered (asthenia, cephalea, sibiluses, rhoncuses, rales, inspiratory and expiratory dyspnea) . Before and after the treatment some respiratory functioning tests have been performed, including the VEMS and VEMS/CV determination . A further study on the distribution of the inhaled air has been carried out, as well as on the ventilation/perfusion ratio by means of He and CO2 curves . At the beginning and at the end of the TMC treatment some hematiobiologic tests have been carried out, including: haemochromo with leukocytic formula, blood platelets counting, VES, glycemia, azotemia, transaminase, alkaline phosphatase, total bilirubinaemia, prothrombinic activity and determination of urine's specific weight . The pulmonary symptomatology (cough, sibiluses, rhoncuses, rates, inspiratory and expiratory dyspnea), was markedly reduced . Even if, as for the preliminary character of the experiment, we can state that 4-carbomethoxythiazolidine is a drug with an outstanding level of tolerance.

Postgrad Med J, 1990 Oct, 66(780), 858 - 9
Anaphylactic reactions to topical antibiotic combinations; Eedy DJ et al.; We describe two patients who developed anaphylaxis type reactions following the application of the topical antibiotic Polyfax (polymixin B and bacitracin) . We draw attention to this potentially serious complication of topical antibiotic preparations and emphasize the need for careful history taking before prescribing such preparations.

Mol Microbiol, 1990 Oct, 4(10), 1679 - 91
Spore colour in Streptomyces coelicolor A3(2) involves the developmentally regulated synthesis of a compound biosynthetically related to polyketide antibiotics; Davis NK et al.; Streptomyces coelicolor produces spores whose development of a grey colour requires the activity of the whiE locus . The cloned whiE locus was identified after mobilization into a whiE mutant of a library of S . coelicolor DNA inserted into a transmissible plasmid vector . The whiE region of the cloned DNA was localized both by subcloning and by mutagenesis of the cloned DNA with the Streptomyces transposon Tn4560 . Nucleotide sequencing of this region revealed seven open reading frames, of which six show homology at the level of deduced gene products with genes involved in the synthesis of polyketide antibiotics . A previously described S . coelicolor DNA segment encoding biosynthesis of a brown pigment (Horinouchi and Beppu, 1985) corresponds to the cloned whiE DNA . It is proposed that whiE is normally expressed only in the aerial hyphae, where the biosynthetic product is responsible for spore colour.

Planta Med, 1990 Oct, 56(5), 446 - 50
Strobilurin D and strobilurin F: two new cytostatic and antifungal (E)-beta-methoxyacrylate antibiotics from Cyphellopsis anomala (1); Weber W et al.; Strobilurin D and strobilurin F, two new cytostatic and antifungal antibiotics of the (E)-beta-methoxyacrylate class, have been isolated from mycelial cultures of the basidiomycete Cyphellopsis anomala (Pers . ex Fr.) Sing . The structures were elucidated by spectroscopic methods . The antibiotics inhibit the growth of human and animal cells and a wide variety of fungi . Like strobilurins A and B, the new metabolites are potent inhibitors of respiration.

FEBS Lett, 1990 Sep 17, 270(1-2), 139 - 42
Revised structure of the peptide lactone antibiotic, TL-119 and/or A-3302-B; Kitajima Y et al.; The peptide lactone antibiotic TL-119 and/or A-3302-B was chemically synthesized in order to confirm the proposed structure . The synthetic compound was different from both natural TL-119 and A-3302-B in their physicochemical properties and in biological activity . Re-examination of the configuration of the constituent amino acid residues in natural TL-119 and/or A-3302-B indicated that natural TL-119 and A-3302-B contains D-aThr instead of the original L-Thr . We tentatively propose a revised structure for TL-119 and/or A-3302-B.

Cancer Res, 1990 Sep 15, 50(18), 5841 - 4
Induction of mammalian DNA topoisomerase II dependent DNA cleavage by antitumor antibiotic streptonigrin; Yamashita Y et al.; Streptonigrin, a nonintercalative antitumor antibiotic, induced mammalian topoisomerase II dependent DNA cleavage in vitro . The cleavage activity of streptonigrin was comparable to that of demethylepipodophyllotoxin ethylidene-beta-D-glucoside at a low concentration (less than or equal to 10 microM) but one-third lower at a higher concentration (greater than 250 microM) . Exposure of a reaction mixture containing streptonigrin, DNA, and topoisomerase II to an elevated temperature (65 degrees C) resulted in substantial reduction in DNA cleavage, suggesting that the mechanism of the topoisomerase II dependent DNA cleavage induced by streptonigrin was through the formation of a cleavage complex previously reported for topoisomerase II poisons such as 4'-(9-acridinylamino) methanesulfon-m-anisidide and epipodophyllotoxins.

Cancer Res, 1990 Sep 1, 50(17), 5475 - 80
Prevention of central nervous system toxicity of the antitumor antibiotic acivicin by concomitant infusion of an amino acid mixture; Williams MG et al.; Acivicin is an investigational amino acid antitumor antibiotic currently being evaluated in Phase II clinical trials . In humans acivicin causes reversible, dose-limiting central nervous system (CNS) effects including somnolence, ataxia, personality changes, and hallucinations . We have observed and reported previously that acivicin-treated cats exhibit symptoms (ataxia, sedation, somnolence) resembling CNS toxicity reported in humans . We hypothesized that if acivicin uptake into brain were mediated by a saturable transport system common to endogenous amino acids, drug uptake and CNS toxicity might be blocked by elevation of normal amino acid concentrations in circulating plasma . To test this hypothesis, cats received constant-rate i.v . infusions of either saline or Aminosyn, 10% (a commercially available mixture of 16 amino acids not containing glutamine, glutamate, aspartate, or cysteine) for 4 h prior to and 18 h subsequent to administration of acivicin at a dose producing marked behavioral changes in control cats . Presence or absence of ataxia and sedation were noted at intervals after acivicin treatment . Results showed that Aminosyn infusion prevented CNS symptoms in six of eight cats . Subsequent experiments showed that acivicin levels in brain tissue of Aminosyn-treated cats were 13% of the drug levels in saline-infused cats . Acivicin levels in most peripheral tissues were also decreased significantly by Aminosyn infusion but not to the extent observed in brain . Decreased brain uptake was shown to be due to a combination of amino acid blockade of drug transport into that organ and of increased total body clearance of drug . Concomitant Aminosyn treatment did not alter the efficacy of acivicin in mice bearing L1210 leukemia or MX-1 human mammary carcinoma . Further studies demonstrated that a solution containing only four large neutral amino acids (leucine, isoleucine, phenylalanine, and valine) could also protect cats from acivicin-induced CNS toxicity, apparently without increasing acivicin total body clearance . However, a mixture of several other amino acids contained in Aminosyn (alanine, arginine, tyrosine, histidine, proline, serine, and glycine) failed to prevent CNS toxicity . We conclude that cotreatment with Aminosyn or a mixture of large neutral amino acids could protect cancer patients from acivicin-induced CNS toxicity without ablating antitumor efficacy.

Contraception, 1990 Sep, 42(3), 297 - 308
The need for prophylactic antibiotics after female sterilization: tetracycline in Bangladesh; Akhter HH et al.; All female sterilization patients in Bangladesh receive five-day courses of tetracycline capsules every six hours as a postoperative prophylactic . A double-blind randomized study was conducted by the Bangladesh Fertility Research Programme (BFRP) to determine whether prophylactic antibiotics reduced infection after minilaparotomy, and to compare the prophylactic effectiveness of tetracycline and ampicillin . Women recruited from throughout Bangladesh (N = 1350) received five-day courses of 250 mg tetracycline, 250 mg ampicillin, or placebo . The infection rate was significantly lower with tetracycline than with placebo (6% vs 10% with placebo), but did not differ significantly between the ampicillin and placebo groups or between the tetracycline and ampicillin groups.

Chem Pharm Bull (Tokyo), 1990 Sep, 38(9), 2518 - 22
Estimation of the molecular volumes of the reaction products between beta-lactam antibiotics and aminoglycoside antibiotics, and those of the degradation products of beta-lactam antibiotics by isotachophoresis; Fujishita O et al.; The correlative equations between the molecular volume and the qualitative indication (hR) for beta-lactam antibiotics, the reaction products between beta-lactam antibiotics and kanamycin, and the degradation products of beta-lactam antibiotics were hR = 0.32 + 0.080 VA2/3//Z/(N = 15, r = 0.972 for penicillins) and hR = 0.04 + 0.072 VA2/3//Z/(N = 12, r = 0.987 for cephems) . Where VA is van der Waals volume (A3/molecule), hR is the relative step height in the isotachopherogram, and Z is the electric change, respectively . According to these equations, the molecular volumes of the reaction products between beta-lactam antibiotics and the other aminoglycoside antibiotics, and those of the degradation products of beta-lactam antibiotics can be estimated from the value of hR . Also according to the step height in the isotachopherogram, the reaction products or the degradation products may be estimated directly when the electric charge is known . It was confirmed that a molecule of aminoglycoside antibiotics reacted with a molecule of beta-lactam antibiotics . Therefore, the inactivation of aminoglycoside antibiotics is much greater than for beta-lactam antibiotics when the clinical doses of these antibiotic combinations are used.

J Assoc Off Anal Chem, 1990 Sep-Oct, 73(5), 813 - 7
Validation of a method for determination of tetracycline antibiotics in salmon muscle tissue; Reimer GJ et al.; A method was validated for analysis of oxytetracycline (OTC), tetracycline (TC), and chlortetracycline (CTC) in fortified salmon muscle tissue . Recoveries of OTC were 100 +/- 6, 86 +/- 6, and 82 +/- 5% (n = 6) at fortification levels of 1.0, 0.5, and 0.2 ppm, respectively . Recoveries of TC were 68 +/- 4, 65 +/- 6, and 66 +/- 7%; recoveries of CTC were 45 +/- 9, 48 +/- 8, and 0%, respectively . Detection limits for OTC and TC were 0.08 and 0.09 ppm, respectively.

J Hand Surg {Am}, 1990 Sep, 15(5), 761 - 4
Role of antibiotics in open fractures of the finger; Suprock MD et al.; The role of antibiotics was investigated prospectively in 91 open fractures of the finger . Antibiotics were administered to alternate patients with open phalangeal fractures . Only finger fractures distal to the metacarpophalangeal joint were included . Both groups were treated with aggressive surgical irrigation and debridement . In four patients in each group clinical signs of infection eventually developed; osteomyelitis did not develop in any patients, and no secondary surgical procedures were required in either group . This data indicates that vigorous irrigation and debridement is adequate primary treatment for open phalangeal fractures in fingers with intact digital arteries.

Gene, 1990 Sep 1, 93(1), 91 - 9
Cloning and expression in a heterologous host of the complete set of genes for biosynthesis of the Streptomyces coelicolor antibiotic undecylprodigiosin; Malpartida F et al.; A fragment of DNA carrying the hitherto unisolated members of the cluster of genes (red) for biosynthesis of the red-pigmented antibiotic undecylprodigiosin of Streptomyces coelicolor A3(2) was isolated . This was done by cloning random fragments of S . coelicolor DNA into the closely related Streptomyces lividans 66 and recovering a clone that caused overproduction of undecylprodigiosin . The effect was probably due to the presence of the cloned redD gene, which functions as a positive regulator of the expression of the red cluster, activating the normally poorly expressed red genes of S . lividans . Two fragments from either end of the red cluster were cloned adjacent to each other on a low-copy-number Streptomyces vector . Double crossing-over occurring between these plasmid-borne sequences and the chromosomal copy of the same DNA in S . coelicolor led to isolation of the entire red cluster as a single cloned fragment . Isolation of antibiotic biosynthetic genes by the effects of an activator in a self-cloning experiment, and in vivo reconstitution of a large cluster of genes by homologous recombination, may turn out to be usefully generalizable procedures.

J Perinatol, 1990 Sep, 10(3), 252 - 6
Prolongation of the latency period in preterm premature rupture of the membranes using prophylactic antibiotics and tocolysis; Fortunato SJ et al.; Mixed results have been obtained in several studies using tocolysis or antibiotics individually in the treatment of premature rupture of membranes (PROM) . We compared the outcomes of a management protocol consisting of tocolysis, prophylactic antibiotic administration, and documentation of pulmonary maturity with a control group treated with passive expectant management for premature rupture of membranes . There were 55 women in the treatment group and 57 women in the control group . The mean latent phase (+/- SEM) in the treatment group was 7.34 (+/- 1.25) days compared with 1.86 (+/- .431) days in the control group (P less than .001) . Eighteen of 55 patients (33%) in the treatment group were electively delivered after documentation of lung maturity, contributing to a falsely lowered mean latent phase in the treatment group . Twenty-four patients in the treatment group and 6 in the control group had a latent phase of 5 days or greater (P = .00018) . There were 9 postpartum infections in the control group and 10 infections in the treatment group (P = NS) . There was no difference in the length of latent phase of patients treated with ceftizoxime compared with the other antibiotics used (cefoxitin, cefazolin, ampicillin), although postpartum ceftizoxime was more effective in preventing postpartum infections (1 of 28 vs 9 of 27) (P = .005) . There were fewer infected neonates in the study group, but this was not significant . It appears that treatment with this protocol significantly prolongs the latent phase in patients with preterm PROM without increasing infectious morbidity.

Am J Obstet Gynecol, 1990 Sep, 163(3), 743 - 7
Antibiotic therapy in preterm premature rupture of membranes: a randomized, prospective, double-blind trial; Johnston MM et al.; The use of antibiotics in the management of preterm, premature rupture of membranes remains controversial . By use of a prospective randomized double-blind design we investigated the maternal-fetal benefits associated with antibiotic therapy in 85 women with premature rupture of membranes at 34 weeks' estimated gestational age . In the treatment group 40 patients received intravenous mezlocillin for 48 hours followed by oral ampicillin until delivery . In the control group 45 patients received intravenous and oral placebo . Patients who received antibiotics had chorioamnionitis and endometritis less frequently than the control group (p less than 0.01 and p less than 0.05) . Pathologic examination of the placentas showed a lower incidence of chorioamnionitis in the treatment group (p less than 0.05) . The period from premature rupture of membranes to delivery (latency) was prolonged with antibiotics (p less than 0.05) and resulted in significant weight gain in the infants in the antibiotic group (p less than 0.0001) . These infants also had higher 1- and 5-minute Apgar scores . Clinically suspected sepsis, respiratory distress syndrome, intraventricular hemorrhage, perinatal death rate, and prolonged hospitalization (greater than 30 days) were also increased in the control group.

Proc Natl Acad Sci U S A, 1990 Sep, 87(17), 6609 - 13
Inter- and intraspecies spread of Escherichia coli in a farm environment in the absence of antibiotic usage; Marshall B et al.; The spread of wild-type Escherichia coli bearing a transferable plasmid was studied in a farm environment . E . coli of bovine and porcine origin were marked by resistance to nalidixic acid (Nar) or rifampicin (Rfr), and a transferable, multiple resistance plasmid (pSL222-1 derivative of plasmid R222) was introduced by conjugation . In separate experiments, the two mutant derivatives were fed back to the respective host animals, which were housed adjacent to, but separate from, one or more "recipient" animals . No antibiotic was given . Although the Rfr derivatives declined rapidly to undetectable levels within 1 week, the Nar mutants of bovine and porcine origin persisted in the original hosts and in their bedding throughout most of each 4-month test period . Test bacteria were isolated from mice residing in the same pen as the donor animals and from multiple secondary hosts having direct or indirect contact with the inoculated donors, but not from neighboring animals maintained in isolation . The bovine mutant was excreted by two caretakers for greater than 4 weeks and was recovered for 4-6 weeks from pigs, fowl, and flies . Although the porcine mutant appeared to colonize less effectively, it spread rapidly to flies and mice and was recovered transiently from humans and fowl . Despite high transfer rates of plasmid pSL222-1 from E . coli K-12 in vitro, transfer of the plasmid from the animal E . coli host was very low and transfer in vivo was not detected among indigenous gut or environmental bacteria . E . coli of animal origin can spread rapidly and can colonize the intestinal tract of humans and of other animals in the absence of antibiotic selection.

J Urol, 1990 Sep, 144(3), 780 - 4
Bacterial epididymitis in the rat: a model for assessing the impact of acute inflammation on epididymal antibiotic penetration; See WA et al.; A rat model of bacterial epididymitis was developed and characterized for use in assessing the impact of acute epididymal inflammation on antibiotic penetration into the epididymis . A 0.2 ml . intratesticular injection of a 0.5 McFarland standard suspension of E . coli resulted in histologically confirmed acute epididymitis in all animals studied . Inflammatory changes were detectable as early as 24 hours following inoculation and were progressive to the last assessment point at 11 days . Early testicular infarction was observed in association with epididymal inflammation . Serial transcrotal ultrasounds of infected animals showed progressive increase in epididymal size and a late decrease in testicular size . Serum and epididymal drug concentrations were assayed following a single dose of the antibiotic amdinocillin . Fifteen minutes following the peak serum level, the drug concentration in infected epididymis was 2.3-fold higher than the contralateral, non-infected epididymis . These data suggest that acute inflammation enhances antibiotic penetration into the infected epididymis . The model described provides a rapid, reproducible method to study epididymal drug delivery in normal and diseased states.

Zh Mikrobiol Epidemiol Immunobiol, 1990 Sep, (9), 10 - 5
{Activation of the alarm response of Escherichia by antibiotics}; Tets VV et al.; The data on the effect of antibiotics suppressing the synthesis of protein on the activation of the SOS-system are presented . The action of tetracycline, chloramphenicol rifampicin and nalidixic acid, a well-known activator of SOS-response, has been studied . The short-term action of inhibitory concentrations and the prolonged action of subinhibitory concentrations of these preparations on the activity of genes rec A and sul A and the induction of the synthesis of phage lambda have been considered . Chloramphenicol and tetracycline, as well as nalidixic acid, have been shown to be capable of activating genes rec A, sul A and synthesis of the phage . The induction of SOS-response has been found to be more pronounced in the short-term action of inhibitory concentrations of antibiotics on bacteria than in the prolonged subinhibitory concentrations.

Ann Ostet Ginecol Med Perinat, 1990 Sep-Oct, 111(5), 296 - 320
{Infections in obstetric-gynecologic surgery: chemo-antibiotic prophylaxis and therapy . A bibliographic review}; Franchi M et al.; The Authors review, on the basis of their experience, the literature data concerning chemo-antibiotic prophylaxis in gynaecological surgery . Prophylaxis is widely employed although some important aspects are still under evaluation: bacterial selection and resistance, benefit in case of abdominal hysterectomy or elective Cesarean section, risk of pseudomembranous colitis . The most effective drugs are Piperacillin/Mezlocillin given in a single dose preoperatively . The same drugs are useful in the treatment of postsurgical infections.

Arzneimittelforschung, 1990 Sep, 40(9), 1034 - 8
Subchronic and chronic toxicity of the new antibiotic cefpirome in rats; Donaubauer HH et al.; Subchronic and chronic toxicity studies in rats were performed with 3-{(2,3-Cyclopenteno-1-pyridinium)-methyl}- 7-{2-syn-methoximino-2-(2-aminothiazol-4-yl)-acetamido} -ceph-3-em-4- carboxylate (cefpirome, HR 810), a new cephalosporin derivative . In subchronic (14 day) studies cefpirome was intravenously administered in dose levels up to 1500 mg/kg/d with good kidney tolerance . Signs of renal functional impairment were observed (800 and 1500 mg/kg) but histologically no morphological changes could be detected . The chronic intraperitoneal administration (90 day) of cefpirome at dose levels of 400 or 1600 mg/kg/d resulted in some reversible changes in hematology (slight anemia), serum-chemistry parameters (liver), urinalysis (proteinuria), and histopathology (increased numbers and enlargement of lysosomes in proximal tubular epithelia of the kidneys and pigment deposits in follicle epithelia of the thyroids), predominantly in high-dose animals . The "no effect level" is considered to be 100 mg/kg/d in this study.

Antiviral Res, 1990 Sep, 14(3), 173 - 8
Inhibitory effect of a new antibiotic, guanine 7-N-oxide, on the replication of several RNA viruses; Yamamoto K et al.; Guanine 7-N-oxide (G-7-Ox) was examined for its antiviral activity against 9 viruses based on plaque reduction, neuraminidase activity reduction, a fluorescent antibody technique or ELISA . The following viruses were included in the tests: influenza, Sendai, simian virus 5 (SV5), respiratory syncytial, western equine encephalitis, Japanese encephalitis, vesicular stomatitis, rabies and polio . G-7-Ox showed broad anti-RNA viral activity against all viruses tested, except for poliovirus . Inhibition of persistent SV5 infection by G-7-Ox indicates that its antiviral activity is independent of cytotoxicity.

Vopr Med Khim, 1990 Sep-Oct, 36(5), 39 - 41
{The effect of the polyether antibiotic omomycin on the activity of cyclic nucleotides in the primary culture of newborn rat heart cells}; Gerasimova TsI et al.; Content of cyclic nucleotides was studied in primary culture of newborn rat heart cells after administration of the polyether-containing antibiotic omomycin (985-I, 16-diethyl indanomycin) . Level of cGMP was increased within 10 min of the cells exposition with 4 micrograms/ml of the antibiotic, while the nucleotide content elevation was more significant in presence of 1-methyl-3-isobutyl xanthine (10(-4) M) . When the exposition time was prolonged up to 20 min, content of cGMP returned to control values in absence of isobutyl xanthine and remained at the elevated level in presence of the drug . Content of cAMP was unaltered under these conditions . Omomycin may be used in experiments, where distinct increase of the cellular cGMP content is required.

Eur J Biochem, 1990 Aug 28, 192(1), 1 - 15
Nonribosomal biosynthesis of peptide antibiotics; Kleinkauf H et al.; Peptide antibiotics are known to contain non-protein amino acids, D-amino acids, hydroxy acids, and other unusual constituents . In addition they may be modified by N-methylation and cyclization reactions . Their biosynthetic origin has been connected in many cases to an enzymatic system referred to as the 'thiotemplate multienzymic mechanism' . This mechanism includes the activation of the constituent residues as adenylates on the enzymic template, the acylation of specific template thiol groups, epimerization or N-methylation at this thioester stage, and polymerization in the sequence directed by the multienzymic structure with the aid of 4'-phosphopantetheine as a cofactor, including possible cyclization or terminal modification reactions . The reaction sequences leading to gramicidin S, tyrocidine, cyclosporine, bacitracin, polymyxin, actinomycin, enniatin, beauvericin, delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine and linear gramicidin are discussed . The structures of the multienzymes, their genetic organization, the biological functions of these peptides and results on related systems are discussed.

Biochim Biophys Acta, 1990 Aug 17, 1035(2), 218 - 22
Basement membrane collagen-degrading activity from a malignant tumor is inhibited by anthracycline antibiotics; Karakiulakis G et al.; Type IV collagenase activity was previously identified and purified to 7500-fold in homogenates from murine Walker 256 carcinoma, using acetylated {3H}-type IV collagen as a substrate . Anthracycline antibiotics daunorubicin, doxorubicin and epirubicin exhibited a non-competitive, reversible inhibition with Ki 92, 49 and 40 microM, respectively . This inhibitory effect, at therapeutically attainable concentrations of the forementioned antineoplastic drugs, may contribute, at least in part, to their antimetastatic properties . The anthracycline derivatives: 4-demethoxydaunorubicin, 4'-iododoxorubicin and 4-demethoxy-3'-deamino-3'-hydroxyepirubicin were without inhibitory effects at comparable concentrations . Other antineoplastic agents, such as belomycin, carmustine, cisplatine, etoposide, methotrexate, mitotane and teniposide did not exhibit any inhibitory effect at concentrations up to 1.0 mM.

Biochim Biophys Acta, 1990 Aug 10, 1027(1), 25 - 30
Interaction of renin inhibitors with the intestinal uptake system for oligopeptides and beta-lactam antibiotics; Kramer W et al.; The interaction of two renin inhibitors, S 86,2033 and S 86,3390, with the uptake system for beta-lactam antibiotics and small peptides in the brush border membrane of enterocytes from rabbit small intestine was investigated using brush border membrane vesicles . Both renin inhibitors inhibited the uptake of the orally active cephalosporin cephalexin into brush border membrane vesicles from rabbit small intestine in a concentration-dependent manner . 1.1 mM of S 86,3390 and 2.5 mM of S 86,2033 led to a half-maximal inhibition of the H(+)-dependent uptake of cephalexin . Both renin inhibitors were stable against peptidases of the brush border membrane . The uptake of cephalexin into brush border membrane vesicles (1 min of incubation) was competitively inhibited by S 86,2033 and S 86,3390 suggesting a direct interaction of these compounds with the intestinal peptide uptake system . The renin inhibitors are transported across the brush border membrane into the intravesicular space as was shown by equilibrium uptake studies dependent upon the medium osmolarity . The uptake of S 86,3390 was stimulated by an inwardly directed H(+)-gradient and occurred with a transient accumulation against a concentration gradient (overshoot phenomenon) . The renin inhibitors S 86,2033 and 86,3390 also caused a concentration-dependent inhibition in the extent of photoaffinity labeling of the putative peptide transport protein of apparent Mr 127,000 in the brush border membrane of small intestinal enterocytes . In conclusion, these studies show that renin inhibitors specifically interact with the intestinal uptake system shared by small peptides and beta-lactam antibiotics.

Anticancer Drug Des, 1990 Aug, 5(3), 265 - 71
Anti-cancer activity of anthracycline antibiotics and DNA condensation; Cera C et al.; Light scattering techniques were used to investigate the ability of a number of anthracyclines to cause compaction in double-stranded DNA and nucleosomes at physiological ionic strength . The structurally organized polynucleotide was efficiently condensed by all of the drugs examined, while no appreciable aggregation of free double-stranded DNA is observed under the same experimental conditions . A model for the process is proposed . Our results suggest the lack of a direct relationship between the critical concentration of free drug at which condensation of DNA occurs and the cytotoxic and anti-cancer properties exhibited by the various anthracycline derivatives.

Biochem Pharmacol, 1990 Aug 1, 40(3), 499 - 506
Effect of acidic phospholipids on the activity of lysosomal phospholipases and on their inhibition induced by aminoglycoside antibiotics--II . Conformational analysis; Mingeot-Leclercq MP et al.; In a companion paper (Mingeot-Leclercq et al . Biochem Pharmacol 40: 489-497, 1990), we showed that the inhibitory potency of gentamicin on the activity of lysosomal phospholipases, measured towards phosphatidylcholine included in negatively-charged liposomes, is markedly influenced by the nature of the acidic phospholipid used (phosphatidylinositol, phosphatidylserine, phosphatidic acid), whereas the binding of the drug to the three types of liposomes is similar . This result challenged previous conclusions pointing to a key role exerted by drug binding to phospholipid membranes and presumably charge neutralization, for phospholipases inhibition (Carlier et al . Antimicrob Agents Chemother, 23: 440-449, 1983; Mingeot-Leclercq et al., Biochem Pharmacol 37:591-599, 1988) . Conformational analysis of mixed monolayers of gentamicin and each of the three acid phospholipids shows that gentamicin systematically adopts an orientation largely parallel to the hydrophobic-hydrophilic interface, but that (i) the energies of interaction are largely different (phosphatidylinositol greater than phosphatidylserine greater than phosphatidic acid), and (ii) the apparent accessibility of the bound drug to water varies in an inverse relation with the energies of interaction . Amikacin, a semisynthetic derivative of kanamycin A with a lower inhibitory potential towards phospholipases than gentamicin in the three types of liposomes used, also showed similar differences in energies of interaction and accessibility to water, but constantly exhibited an orientation perpendicular to the hydrophobic-hydrophilic interface . We conclude that impairment of lysosomal phospholipase activities towards phosphatidylcholine included in negatively-charged membranes by aminoglycoside antibiotics is indeed dependent upon drug binding to the bilayer, but is also modulated by (i) the nature of the acidic phospholipid, which influences the energy of interaction and the accessibility of the drug with respect to the hydrophilic phase, and (ii) the orientation of the drug, which it itself related to its chemical structure . Inasmuch as phospholipases inhibition is related to aminoglycoside nephrotoxicity, these findings may help in better defining the molecular determinants and mechanisms responsible for this adverse effect.

Biochem Pharmacol, 1990 Aug 1, 40(3), 489 - 97
Effect of acidic phospholipids on the activity of lysosomal phospholipases and on their inhibition by aminoglycoside antibiotics--I . Biochemical analysis; Mingeot-Leclercq MP et al.; Aminoglycoside antibiotics accumulate in lysosomes of kidney and cultured cells and cause an impairment of phospholipid catabolism which is considered to be an early and significant step in the development of their toxicity . Using liposomes, wer previously demonstrated that the activity of lysosomal phospholipases A1 and A2 towards phosphatidylcholine was markedly enhanced by the inclusion of phosphatidylinositol in the bilayer, and that gentamicin impaired this activity by binding to phosphatidylinositol . Since gentamicin-induced inhibition was inversely related to the amount of phosphatidylinositol included in the liposomes, we proposed that gentamicin impairs activity of phospholipases by decreasing the quantity of available negative charges carried by the bilayer surface (Mingeot-Leclercq et al., Biochem Pharmacol 37: 591-599, 1988) . We now extend these observations to phosphatidylserine and phosphatidic acid, and compare the inhibition caused by gentamicin, amikacin and streptomycin towards lysosomal phospholipases on the hydrolysis of phosphatidylcholine in the presence of each of these acidic phospholipids . Inclusion of phosphatidic acid in liposomes, and, to a lesser extent, phosphatidylserine, caused a larger increase in phospholipases activity than phosphatidylinositol . In parallel, the three aminoglycosides tested were found less inhibitory towards phospholipases activity measured on phosphatidic acid-or phosphatidylserine-containing liposomes than was previously observed with phosphatidylinositol, even though equilibrium dialysis experiments failed to demonstrate significant difference in binding parameters of the drug towards each of these liposomes populations . Yet, as for phosphatidylinositol-containing liposomes, the inhibition was inversely related to the amount of phosphatidic acid or phosphatidylserine included in the bilayer and the inhibitory potency of the three drugs was consistently gentamicin greater than amikacin greater than streptomycin with the three types of negatively-charged liposomes used . We conclude that impairment of lysosomal phospholipases activity towards phosphatidylcholine included in negatively-charged membranes by aminoglycoside antibiotics is dependent upon drug binding to the bilayer, but that it is modulated by the nature of the acidic phospholipid that binds the drug as well as by that of the drug itself . A companion paper (Mingeot-Leclercq et al., Biochem Pharmacol 40: 499-506, 1990) will examine by computer-aided conformational analysis the parameters (drug-phospholipid energy of interaction, position of the drug in a monolayer and its accessibility to the aqueous phase) which may be important for these effects.

Mol Microbiol, 1990 Aug, 4(8), 1227 - 32
What are antibiotics? Archaic functions for modern activities; Davies J; Secondary metabolites are proposed to have played important roles in the evolution of the reactions of living forms on earth, in effecting and modulating reactions during biochemical evolution by chemical and structural interaction with 'receptor' sites in primitive macromolecular templates . For example, in the evolution of the translation system, as the polymerizing reactions became more complex and proteins became involved, the low molecular-weight effectors were functionally replaced by polypeptides, but retained their ability to interact with receptor sites in nucleic acids and proteins . Many of these low molecular-weight effectors now play a different role, that of antagonists, by interacting with the original receptor sites in macromolecular structures; this explains their contemporary activity as antibiotics.

Yakugaku Zasshi, 1990 Aug, 110(8), 523 - 46
{Stereoselective synthesis of macrolide and polyether antibiotics}; Yonemitsu O; In order to establish a common methodology for the highly stereoselective and efficient synthesis of macrolide and polyether antibiotics, two macrolide aglycons, 12-membered ring methynolide and 16-membered ring tylonolide, were first synthesized mainly from D-glucose, with the aid of 4-methoxybenzyl (MPM) type protecting groups and construction of three consecutive chiral centers, via the syntheses of respective fragments followed by their coupling (Yamaguchi's esterification) and cyclization (Wittig-Horner reaction) . This method was extended to the synthesis of 14-membered ring pikronolide and, together with conformational analysis and control of macrolide rings, some typical 16-membered ring aglycons such as carbonolides, leuconolides, maridonolides, etc . Erythronolide A was also synthesized via an extremely efficient macrolactonization by virtue of conformational control and super activation of a seco-acid . For the synthesis of polyether antibiotics a new synthetic method of substituted tetrahydrofuran and -pyran rings was first established via a cyclization of styryl derivatives by acid catalyzed and/or chelation controlled reactions under kinetic and/or thermodynamic conditions . Highly complex polyether salinomycin was synthesized via coupling of three fragments prepared from D-glucose, D-mannitol, and ethyl L-lactate essentially by the same method developed in the synthesis of macrolides . In this synthesis the MPM type protecting groups acted a crucial role . The synthesis of isolasalocid A was completed via isolasalocid ketone, in which two tetrahydrofuran rings were constructed by the above acid catalyzed and chelation controlled cyclizations . Similarly lasalocid A was synthesized from D-glucose via lasalocid ketone.

J Gen Microbiol, 1990 Aug, 136 ( Pt 8), 1447 - 54
Biosynthesis of oleandomycin by Streptomyces antibioticus: influence of nutritional conditions and development of resistance; Vilches C et al.; The influence of different nutritional compounds on oleandomycin biosynthesis by Streptomyces antibioticus was studied, resulting in the design of a chemically defined medium for production of the antibiotic . Of the variety of carbon and nitrogen compounds tested, fructose and aspartic acid (carbon and nitrogen sources, respectively) supported the highest oleandomycin titres . Addition of propionate but not acetate, both precursors of the skeleton of the macrolide lactone ring, stimulated the biosynthesis of the antibiotic . Oleandomycin biosynthesis was repressed by glucose but not by phosphate . S . antibioticus develops oleandomycin resistance shortly before the antibiotic begins to be synthesized, showing a triphasic pattern of resistance: spores and producing mycelium are resistant, while non-producing mycelium is sensitive.

Arerugi, 1990 Aug, 39(8), 696 - 700
{Studies on antibiotic skin testing}; Matsumura Y et al.; Commercially available antibiotics for injection are supplied with test ampules . Users are instructed to dissolve them to make 300 micrograms/ml solution for intradermal pretests to avoid allergic reactions . Sometimes this concentration is too low to prevent anaphylactic reactions . In the present study, we tried to find the maximum concentration for the intradermal tests which would have high sensitivity without giving nonspecific, false positive reactions . We investigated intradermal tests with cephalothin (CET) in a patient who suffered from anaphylaxis after drip infusion with CET, although she was judged to be negative to CET by the usual intradermal test prior to the infusion . Her CET skin test was negative at a concentration of 150 micrograms/ml and positive at 300 micrograms/ml 6 weeks after anaphylaxis, but negative at 300 micrograms/ml and positive at 1000 micrograms/ml 4 and 7 years after anaphylaxis . Prick tests were always negative, even with the maximum soluble concentration of CET, 200 mg/ml . Nonspecific reactions to intradermal tests at concentrations as high as 1000 micrograms/ml were examined with 20 kinds of penicillins and cephems in 51 healthy subjects without histories of drug allergies . Very few false positive reactions were observed, except in 5 out of 24 cases with cefotiam . Intradermal tests at 3000 micrograms/ml, however, frequently resulted in nonspecific reactions . We conclude that 1000 micrograms/ml, not 300 micrograms/ml solutions should be used for intradermal tests to prevent allergic reactions to the injection of antibiotics.

Acta Paediatr Scand, 1990 Aug-Sep, 79(8-9), 838 - 46
Use of medical care and antibiotics among preschool children in different day care settings; Rasmussen F et al.; The use of medical care among 880 1-5 year olds in different day care settings was studied using register information on physician visits, purchases of antibiotics and municipal day care in 1984 . The unit of analysis was months in the different day care settings and not children . The rates of physician visits were 1.4 to 1.8 times higher for acute upper respiratory tract infections and all acute infections and 2 to 3 times higher for secretory otitis media during day care centre months and family day care months as compared to home care months . The rate of visits for bronchial asthma was 5 times higher during day care centre months than during home care months . No differences were found between day care centre months and family day care months with respect to the rates of physician visits for acute upper respiratory tract infections, acute otitis media and all acute infections . Among children in family day care, the daily number of hours in day care, and size, average age and age homogeneity of the groups were not significantly associated with rates of visits for all acute infections or purchases of antibiotics.

Jpn J Pharmacol, 1990 Aug, 53(4), 463 - 72
Specific metabolic activation of FK973, a new antitumor antibiotic, in L1210 leukemia cells; Masuda K et al.; FK973 (11-acetyl-8-carbamoyloxymethyl-4-formyl-14-oxa-1,11- diazatetracyclo{7.4.1.O2,7O10,12}tetradeca-2,4,6-trien -6,9-diyl diacetate), a new substituted dihydrobenzoxazine, has potent cytotoxic and antitumor effects on murine and human tumors in vivo and in vitro, and forms interstrand DNA-DNA and DNA-protein cross-links after being activated in the cytoplasm . In this study, the mechanism(s) by which FK973 is activated in the cytoplasm of in vitro cultured murine L1210 leukemia cells were studied using compounds that affect monoamine oxidase . When the cells were incubated with an antitumor drug and the compounds, tranylcypromine, benzylamine, phenylethylamine and tyramine of the many compounds tested reduced the cytotoxicity of FK973, but not that of mitomycin C or cisplatin . These compounds also suppressed the formation of interstrand DNA-DNA cross-links with FK973 in the cells, but did not suppress cross-links with mitomycin C or cisplatin . The incorporation of 14C-FK973 into the cells was not affected by these compounds . The results suggest that FK973 is activated by some drug-metabolic system(s) in the cytoplasm to form interstrand DNA-DNA cross-links, and induces cytotoxicity against the cells . This activation of FK973 in the cytoplasm is discussed in connection with the drug-metabolic system(s) in relation to the structures of the compounds.

J Antibiot (Tokyo), 1990 Aug, 43(8), 967 - 76
Chemical and biological properties of rubiginone, a complex of new antibiotics with vincristine-cytotoxicity potentiating activity; Oka M et al.; A novel complex of isotetracenone (angucyclinone) group antibiotics was discovered from the cultured broth of Streptomyces griseorubiginosus No . Q144-2 . The antibiotic consisted of six related factors, designated rubiginones A1, A2, B1, B2, C1 and C2 . They significantly potentiated cytotoxicity of vincristine (VCR) against VCR-resistant P388 leukemia and Moser cells.

J Antibiot (Tokyo), 1990 Aug, 43(8), 961 - 6
Himastatin, a new antitumor antibiotic from Streptomyces hygroscopicus . II . Isolation and characterization; Leet JE et al.; The novel antitumor antibiotic himastatin was isolated from cultured broth of Streptomyces hygroscopicus (ATCC 53653) and purified by vacuum liquid chromatography, column chromatography, and crystallization . Degradation and spectroscopic studies have shown that himastatin contains valine, leucine, threonine, alpha-hydroxyisovaleric acid, 5-hydroxypiperazic acid and a dimeric hexahydropyrroloindole system.

J Antibiot (Tokyo), 1990 Aug, 43(8), 948 - 55
YS-822A, a new polyene macrolide antibiotic . I . Production, isolation, characterization and biological properties; Itoh A et al.; A new polyene macrolide antibiotic, YS-822A was isolated from the culture filtrate of a mutant strain H-8 of Streptoverticillium eurocidicum var . asterocidicus S-822 . Whereas the original S-822 strain produced not only YS-822 substances but also teleocidin as by-product which is well-known as a strong carcinogenic promoter, the mutagenized H-8 strain produced the antibiotic with only a trace amount of teleocidin . Chemical and biological characterizations of the antibiotic revealed that YS-822A (molecular formula: C37H59NO14) is a new polyene macrolide with a wide antifungal spectrum and a low acute toxicity.

Exp Mol Pathol, 1990 Aug, 53(1), 11 - 33
Interaction of anthracyclinic antibiotics with cytoskeletal components of cultured carcinoma cells (CG5); Molinari A et al.; The effects of doxorubicin (adriamycin, ADR) and daunorubicin (daunomycin, DAU), two anthracyclinic antibiotics, on a human breast carcinoma cell line (CG5) were studied by cytochemical and morphological methods . Both ADR and DAU were capable of inducing the multinucleation and spreading phenomena, associated with a decrease of the cell growth rate . DAU appeared to be more effective than ADR at the tested concentrations (10(-5), 5 x 10(-5) mM), in affecting the cell growth as well as in inducing multinucleation . As revealed by scanning electron microscopy, spreading and multinucleation were accompanied by a remarkable redistribution of surface structures . Moreover, a dose- and time-dependent rearrangement of the underlying cytoskeletal components was clearly detected . In addition, both ADR and DAU at 5 x 10(-5) mM seemed to favor the rebuilding of microtubules after treatment with colcemid, while a higher dose (10(-4) mM) exerted the opposite effect . Furthermore, both anthracyclines prevented the action of the antimicrotubular agent . When recovered after treatment with cytochalasin B, in presence of ADR (or DAU) (5 x 10(-5), 10(-4) mM), cells showed a microfilament pattern rearranged differently as compared to that of cells recovered in anthracycline-free medium . The results reported here strongly suggest the involvement of actin and tubulin in CG5 cell response to ADR and DAU treatments . Thus, the cytoskeletal apparatus is confirmed as another target involved in the mechanism of action of anthracyclines.

FEBS Lett, 1990 Aug 1, 268(2), 405 - 7
Antibiotics--cloning of biosynthetic pathways; Kleinkauf H et al.; Biosynthetic pathways leading to antibiotics have often been found to be clustered, and new organizational forms of multifunctional enzymes have been discovered . Such polyenzymes accomplish the synthesis of complex metabolites such as peptides or polyketides by a sequence of enzymatic reactions . So, reactions leading to the tripeptide precursor of beta-lactam antibiotics, ACV, or to the cycloundecapeptide cyclosporine have been fused into single polypeptide chain synthetases, respectively . In certain isofunctional sites restricted similarities have been detected.

Antibiot Khimioter, 1990 Aug, 35(8), 9 - 11
{High-molecular polyphosphates and pyrophosphate in cyclosporin- producing Tolypocladium sp . and their role in the processes of growth and antibiotic synthesis}; Sotnikova IV et al.; The contents of high-energy phosphorous compounds, i.e . three fractions of polyphosphates, pyrophosphate, and ATP were determined in isogenic strains of Tolypocladium sp . differing in cyclosporine production levels . The content of polyphosphates was 1 to 2 orders of magnitude greater than that of pyrophosphate or ATP and did not depend on the strain productivity . During the period of the mycelial intensive growth and at the beginning of antibiotic synthesis, the level of polyphosphates lowered 2-3-fold and the content of pyrophosphate markedly decreased as well . The activities of polyphosphatase and pyrophosphatase during the culture growth and cyclosporine biosynthesis was higher in the highly productive strain.

Hindustan Antibiot Bull, 1990 Aug-Nov, 32(3-4), 81 - 3
In vitro activity of certain antibiotics against dermatophytes; Dixit AK et al.; The in vitro effect of antibiotics i.e . Hamycin, Griseofulvin and Mycostatin against Microsporum gypseum and M . fulvum showed that hamycin was comparatively less inhibitory to M . fulvum . Complete inhibition in mycelial growth and sporulation of these two dermatophytes was observed by Mycostatin at its 1000 micrograms/ml conc . after 8 days . M . fulvum did not sporulate at higher concentration of griseofulvin . However, griseofulvin completely inhibited the sporulation in M . gypseum at all the concentration of this drug, but mycelial growth of M . fulvum and M . gypseum were significantly inhibited . Mycostatin was found more inhibitory to these dermatophytes in comparison to hamycin and griseofulvin.

Cesk Otolaryngol, 1990 Aug, 39(4), 191 - 4
{Rational antibiotic therapy in ORL oncologic surgery}; Sibl O et al.; The decisive point is the suitable time of antibiotic administration, their combination and possibility to extend the surgical repertoire by prevention in particular of general complications . Wound healing is more rapid, and intended adjuvant treatment can, due to the reduce period of wound healing, be applied much sooner . It is more effective and the attainment of target structures by the administered drugs is not blocked by prolonged processes which are sometimes associated with fibrosis, scars and regressive tissue changes.

Klin Med (Mosk), 1990 Aug, 68(8), 83 - 5
{Antibiotics as proteolysis inhibitors in the stomach}; Gorshkov VA et al.; The study was made of antibiotics action on hydrolysis of coagulated protein in gastric juice . It was established that antibiotics can produce inhibition of protein proteolysis in gastric juice . The highest antiprotease activity was reported for cephalosporins , rifampicin and penicillins, the lowest for tetracycline++ . Antiprotease activity of antibiotics should be taken into consideration when defining their therapeutic effect in peptic ulcer.

Endod Dent Traumatol, 1990 Aug, 6(4), 157 - 69
Pulp revascularization in reimplanted immature monkey incisors--predictability and the effect of antibiotic systemic prophylaxis; Cvek M et al.; In 32 monkeys 105 immature maxillary incisors were extracted and reimplanted either immediately or after 30 or 60 min wet or dry storage . Of the monkeys, 17 (group I) did not receive and 15 (group II) received prophylactic treatment with 4 mg/kg doxycycline before extraction and 2 mg/kg for 5 d after reimplantation . The observation time varied from 6 to 8 weeks . After being histologically processed, the material was evaluated with respect to the amount of vital tissue and presence of micro-organisms in the pulpal lumen . A comparison revealed no difference in the results between the groups . The results were therefore pooled and statistically analysed with respect to the significance of apical foramen width, extra-alveolar time, wet or dry storage and presence of micro-organisms in the pulpal lumen for the occurrence of complete pulp revascularization (CPR) . The overall frequency of CPR was 18% . Log-linear analyses (SAS, 1985) of the material as a whole or of separate parameters consistently revealed a relationship between presence of micro-organisms and absence of CPR (P = 0.0001) . A higher frequency of CPR and a lower frequency of micro-organisms (P = 0.05) was found only for the group of immediately reimplanted teeth . The presence of micro-organisms could be explained for 61 teeth . In 27 of these, blood clots containing bacteria in the apical portion of pulpal lumen indicated contamination during the extra-alveolar time, while in 34, the micro-organisms originated from plaque covered mechanical damage in the cervical part of the root surface.

Enzyme Microb Technol, 1990 Aug, 12(8), 564 - 70
Effect of intercalating dyes on the production of antibiotics by Micromonospora rosaria and Micromonospora purpurea; Kim KS et al.; The effect of treatment with various intercalating dyes on the ability to produce antibiotics in Micromonospora rosaria and Micromonospora purpurea was studied . Treatment with acriflavine resulted in a high frequency loss of antibiotic productivity in both species . In M . rosaria, the loss of antibiotic-producing ability appeared to be strain-dependent . In M . purpurea, up to 90% of colonies were found to have lost gentamicin-producing ability when protoplasts were used in the test . These antibiotic-nonproducing strains were further studied . The following observations were made: (1) Unlike the producing ability, the resistance to the antibiotics is a very stable character in both species . (2) Protoplast fusion analysis indicates that rosamicin-nonproducing characteristics of MR 217-AF2 and MR 217-AF3 strains induced by the acriflavine treatment is due to chromosomal mutation or rearrangement but not to loss of a plasmid . (3) Gentamicin-nonproducing strains of M . purpurea responded differently to the supplementation of streptamine or DOS in the culture medium . When supplemented with streptamine or DOS, some of these strains regained the ability to produce antibiotic, showing that the biosynthesis of intermediate was affected in these strains.

Cancer Res, 1990 Jul 15, 50(14), 4260 - 6
Anthracycline antibiotics with high liposome entrapment: structural features and biological activity; Perez-Soler R et al.; We evaluated the entrapment of 21 different water-insoluble aglycones or anthracycline antibiotics in multilamellar liposomes composed of dimyristoyl phosphatidyl choline and dimyristoyl phosphatidyl glycerol at a 7:3 molar ratio . The drug:lipid weight ratio was 1:15 to 1:50 . The different analogues tested were modified at position 4 in the aglycone portion (4-demethoxy) and/or positions 2' (halo), 3' (hydroxy, acetoxy), or 4' (epi, acetoxy) in the sugar portion . The entrapment efficiency was assessed by measuring the amount of free drug remaining in the supernatant after centrifugation of the liposomes and by direct examination of the pellets by fluorescent microscopy . Optimal entrapment (greater than 98%) was observed with only four compounds: 4-demethoxyadriamycinone; 2'-iododaunorubicin; 4-demethoxydaunorubicin; and 2'-iodo-3'-hydroxy-4'-epi-4-demethoxydoxorubicin (Compound 22) . All other compounds showed significant drug precipitation outside the multilamellar vesicles when observed by fluorescent microscopy . Compound 22, entrapped in liposomes, was evaluated in vivo against i.p . L-1210 leukemia by the i.p . route, and liver metastases of M5076 reticulosarcoma by the i.v . route . In both models, liposome-entrapped Compound 22 was more active than doxorubicin at the optimal dose {median survival (given in percentage) of treated to control animals was for L-1210, greater than 600 versus 212; for M5076, 200 versus 133} . 4-Demethoxy and 2'-iodo are structural modifications that markedly enhance the affinity of anthracycline antibiotics for lipid bilayers without compromising biological activity . These findings will serve as a guideline to obtain liposome-anthracycline preparations, with optimal formulation characteristics, enhanced tumor-targeting properties, and non-cross-resistance with doxorubicin.

Alcohol, 1990 Jul-Aug, 7(4), 295 - 8
Ferrous sulfate combined with ascorbic acid does not significantly reduce acetaldehyde accumulation in the blood of alcoholized rats treated with disulfiram or betalactam antibiotics; Freundt KJ et al.; Adult female SPF Sprague-Dawley rats treated orally by gavage with disulfiram (1 g/kg b.wt.) or betalactam antibiotics (3.38 mmol/kg b.wt.) with a 1-methyltetrazole-5-thiol side chain (cefmenoxime, latamoxef, cefotetan, cefoperazone, cefamandole) produced a marked, statistically significant rise of acetaldehyde in the blood 1 and 3 hr following IP administration of ethanol {2 g/kg b.wt., 20% (g/v) solution} . This accumulation of blood acetaldehyde remained unchanged or was reduced only very slightly by a mixture of iron sulfate {Fe(II)SO4.7H2O, 2.64 mg/kg b.wt.} and ascorbic acid (6.67 mg/kg b.wt.) injected intravenously . This slight decrease is considered to be due to a formation of a complex between ferrous sulfate and agents (disulfiram and the betalactam antibiotics as well as their metabolites) producing acetaldehyde by inhibition of acetaldehyde metabolizing enzymes . A possible coaction of ascorbic acid cannot be explained satisfactorily; ascorbic acid may support cellular redox potentials . The combination of ferrous sulfate and ascorbic acid was used for examination since both chemicals are recommended to reduce adverse symptoms of an ethanol incompatibility reaction in the course of a therapy with the mentioned antibiotics or disulfiram . Since acetaldehyde augmentation in the blood is regarded as a cause of complaints and because the acetaldehyde rise was not depressed significantly by ferrous sulfate and ascorbic acid it can be concluded that these two agents are not potent enough for a rational therapy of ethanol incompatibility symptoms initiated by the investigated drugs.

J Antibiot (Tokyo), 1990 Jul, 43(7), 890 - 6
The structure of tautomycetin, a dialkylmaleic anhydride antibiotic; Cheng XC et al.; The chemical structure of tautomycetin (C33H50O10) was determined by chemical degradation and spectroscopic evidence . Tautomycetin exists in methanol-buffer solution (1% diethylamine-formic acid, pH 7.3) as an equilibrium mixture of a 2,3-dialkylmaleic anhydride and its dicarboxylic acid . The structure of tautomycetin is similar to tautomycin in many respects.

J Antibiot (Tokyo), 1990 Jul, 43(7), 809 - 19
The structure of tautomycin, a dialkylmaleic anhydride antibiotic; Cheng XC et al.; The chemical structure of tautomycin (C41H66O13) was determined by chemical degradation, spectroscopic analysis and 2D INADEQUATE of tautomycin labeled with {1,2-13C}acetate . Tautomycin exists in methanol-buffer solution (1% diethylamine-formic acid, pH 7.3) as an equilibrium mixture of a 2,3-dialkylmaleic anhydride and its dicarboxylic acid in a ratio of approximately 5:4.

J Antibiot (Tokyo), 1990 Jul, 43(7), 755 - 62
Pradimicins A, B and C: new antifungal antibiotics . I . Taxonomy, production, isolation and physico-chemical properties; Tomita K et al.; New antifungal antibiotics, pradimicins A, B and C were isolated from the culture broth of actinomycete strains proposed as Actinomadura hibisca . They are orange to red pigments containing a benzo{a}naphthacenequinone chromophore substituted with a D-alanine, an aminosugar and a D-xylose (pradimicins A and C).

J Antibiot (Tokyo), 1990 Jul, 43(7), 748 - 54
A novel antifungal antibiotic, FR-900848 . I . Production, isolation, physico-chemical and biological properties; Yoshida M et al.; Streptoverticillium fervens produced a new antibiotic, FR-900848, which has a high specific activity against filamentous fungi . Purified by solvent extraction and column chromatography, the compound appears as colorless crystals . Its structure is C32H43N3O6, which consists of 5'-amino-5'-deoxy-5,6-dihydrouridine with an unsaturated fatty acid having unprecedented four serial and one isolated cyclopropane rings.

Urol Nefrol (Mosk), 1990 Jul-Aug, (4), 17 - 20
{Postoperative endolymphatic antibiotic therapy in urology patients with suppurative-inflammatory diseases}; Ukhal' MI et al.; In 54 patients with pyoinflammatory processes in the urogenital system, the efficacy of endolymphatic antibiotic therapy was investigated after surgical interventions into these organs along with administration of antibiotics just into the inguinal lymph node . To administer antibiotics, separation and drainage of the inguinal lymph node were conducted concurrently with surgical interventions in 26 patients for pyoinflammatory processes in the epididymis, prostate, and kidneys . In the other group (n-28), the inguinal lymph node was drained on days 4 to 5 of postoperative interventions due to the progression of an acute infectious inflammation in the affected organs and wounds . The efficacy of endolymphatic antibiotic therapy was evaluated by using clinical, laboratory, cytochemical, and immunological criteria . The drainage of inguinal lymph nodes in combination with aminoglycoside and cephalosporin antibiotics given in the postoperative period proved to be a safe and effective mode of treatment of pyoinflammatory processes in urogenital organs and wounds.

Andrologia, 1990 Jul-Aug, 22(4), 355 - 60
{Mollicutes in male infertility: is antibiotic therapy indicated?}; Sanchez R et al.; Mollicutes are frequently isolated from sperma of infertile men . The potential effect on the fertility of mollicute infection is controversial as is antibiotic therapy . In our andrological patients, the prevalence of mollicutes is approximately 10% . To evaluate the benefit of antibiotic therapy, we investigated two groups of patients: group 1-patients with positive or negative mollicute cultures and normal spermiogram; morphological changes on spermatozoa were particularly evaluated (n = 40); group 2 - patients with positive mollicute cultures treated with doxycycline or erythromycin . Sperm parameters were analysed before and after treatment (n = 20) . When infected and non-infected sperma from group 1 were compared, the only difference found was an alteration of the sperm tail (p less than 0.005) . Light microscopy and electron microscopy (EM) often revealed coiled tails which were probably due to adhesion of mollicutes (EM) . The most frequently observed pathology in group 2 was found in patients with teratoasthenozoospermia . Compared with the post-therapy spermiogram, a significant difference was only observed in spermatozoal morphology (p less than 0.005) . Therefore, we conclude that mollicutes produce important alterations in the human spermatozoal morphology, especially in the tail which appears in a spiral form . Since teratozoospermia is considered to be an important factor of infertility in man, antibiotic therapy is recommended in cases of mollicute involvement.

Acta Neurol Scand, 1990 Jul, 82(1), 59 - 67
Follow-up of antibiotically treated and untreated neuroborreliosis; Kruger H et al.; Follow-up of 57 patients who suffered from antibiotically untreated acute, monophasic neuroborreliosis 5 to 27 years ago shows no significant difference in comparison with the follow-up of 66 patients who suffered from antibiotically treated acute, monophasic neuroborreliosis during the last 5 years . In both groups, the involution of clinical symptoms and the normalization of pathological CSF findings were nearly identical . We found no significant difference of sequelae between the groups . Following acute neuroborreliosis, neither the antibiotically untreated nor the antibiotically treated patients developed chronic neuroborreliosis . Only in rare cases of primary chronic neuroborreliosis with CNS involvement did we observe convincing effects of antibiotics, which were given mostly in combination with glucocorticosteroids.

Eur J Clin Microbiol Infect Dis, 1990 Jul, 9(7), 523 - 9
The design of clinical trials with antibiotics; Norrby SR; Clinical trials to test antibiotics are normally of a less than satisfactory quality . Examples of common errors in the design and execution of trials with antibiotics are inclusion of too few patients to allow conclusions to be drawn, open uncontrolled design leading to a risk of considerable investigator bias, and inclusion of heterogeneous patient samples . This article suggests minimum requirements for antibiotic studies . Guidelines for such trials are needed and should have the widest possible international application in order to permit studies involving centres in various countries and to reduce the costs for development of new drugs.

Eur J Clin Microbiol Infect Dis, 1990 Jul, 9(7), 472 - 8
Animal models as predictors of the safety and efficacy of antibiotics; Zak O et al.; As opposed to the testing of safety, the testing of the efficacy of antibiotics in animals is not specified in any directives or guidelines and not explicitly required by regulatory authorities . There exists, however, no doubt that in the evaluation of new compounds testing of both safety and efficacy forms an essential link between in vitro tests and clinical trials . It is inconceivable that clinicians would be prepared to conduct a trial in patients without evidence of the efficacy of the antibiotic in question in an appropriate animal model of infection . Both the models for testing safety and those for testing efficacy suffer from a number of shortcomings . If investigators are aware of these deficiencies and take them into account when interpreting the results, the predictive value of the models can be significantly enhanced.

Clin Podiatr Med Surg, 1990 Jul, 7(3), 523 - 44
Use of antibiotic-loaded bone cement in the management of common infections of the foot and ankle; Jacobs AM et al.; Antibiotic-loaded bone cement is a useful adjunct in the management of chronic osteomyelitis and in the prevention of recurrent osteomyelitis after an initial attack . Additionally, antibiotic-loaded bone cement stimulated the formation of granulation tissue in excess of that which would normally be expected . Our experience has been consistent with others' experience, which suggests that the use of antibiotic-loaded bone cement is an effective means of reducing the length of hospitalization and the cost usually associated with traditional methods in the management of bone and soft-tissue infections.

Ther Umsch, 1990 Jul, 47(7), 561 - 8
{Preventive use of antibiotics in surgery: a review}; Picard G et al.; As a rule, prophylactic antibiotics should only be given pre- or perioperatively as a single shot . Cephalosporins of the first and second generation are still quite effective and appear to be the most widely used drugs for this purpose . In some cases a second drug, like i.e . metronidazole, can be added . For each surgical specialty, the most appropriate prophylactic regimen is discussed.

J Ophthalmic Nurs Technol, 1990 Jul-Aug, 9(4), 145 - 51
Confusion and the patient on an intensive topical ocular antibiotic regimen: a case analysis; Orticio LP; Round-the-clock instillation of antibiotics disrupts the sleep-wake cycle and may concomitantly result in an acute confusional state . Behavioral manifestations can be attributed to alterations in the sleep-wake cycle; sensory/environmental deficit related to hospitalization; alterations in nutrition and electrolyte balance; age; and medication . Patients at high risk for confusion must be identified and given priority attention . Acute confusion, if not detected and addressed early, may have serious consequences as threatening as the loss of sight.

J Am Podiatr Med Assoc, 1990 Jul, 80(7), 354 - 9
Development and application of antibiotic-loaded bone cement beads; Stabile DE et al.; The authors presented an overview of the development of antibiotic-loaded bone cement beads and their indications for usage, method of application, advantages, disadvantages, and causes of failure . This method of treatment for bone and soft tissue infections of the foot is not a panacea and should be used only in selected cases . The vascular status and the physiologic ability of the patient to heal a peripheral wound or infection are the basis for the success of this method of therapy . European literature makes little mention of adjunctive systemic antibiotic therapy with local antibiotic-loaded bone cement bead use . It is the authors' opinion that clinical judgment should be used to determine the necessity for such therapy.

Eur J Obstet Gynecol Reprod Biol, 1990 Jul-Aug, 36(1-2), 69 - 74
Suspected postpartum endometritis: a controlled clinical trial of single-agent antibiotic therapy with Amox-CA (Augmentin) vs . ampicillin-metronidazole +/- aminoglycoside; Fernandez H et al.; Endometritis is the commonest postpartum complication and is one of the leading causes of maternal morbidity, if not mortality . The object of the present clinical trial was to assess the efficiency of single-agent therapy with Amox-CA (Augmentin) (formulation which includes a beta-lactamase inhibitor), against standard treatment which necessarily combines two or three antibiotics depending on the clinical severity of the case . 101 patients were evaluated in this comparative prospective randomized study . The mild forms were defined by a temperature between 37.9 and 38.4 degrees C and the severe forms by a temperature of more than 38.5 degrees C (which alone required treatment with three antibiotics) . The time until the return of apyrexia and the clinical cure rate, as well as duration of treatment, were identical in both groups . Tolerance was good: no side effect requiring discontinuation of treatment occurred . In the population value, the use of a single-agent therapy with amoxycillin/clavulanic acid is not significantly different from a double or triple-agent regimen, and the convenience is increase.

Antibiot Khimioter, 1990 Jul, 35(7), 41 - 3
{The main principles of biophysical and chemical purification of highly concentrated liquid waste from antibiotic manufacture}; Faingol'd ZL; An approach to investigation of multicomponent systems such as plants designed for biophysicochemical purification of liquid sewage including diverse interconnected technological apparatus operating under routine conditions is described . A system analysis applied to a simplified technological scheme for collecting treated liquid sewage was used.

Antibiot Khimioter, 1990 Jul, 35(7), 35 - 8
{Increasing the effectiveness of antibiotic therapy by correcting immunologic disorders with vitamin A in patients with brucellosis}; Kurmanova KB et al.; Experimental studies and clinical trials were performed on possible increase of antibiotic therapy efficacy in brucellosis patients by correction of the immunity disorders with vitamin A . It was experimentally shown that vitamin A increased cellular immunity and accelerated sanation of guinea pigs sensitized with Brucella abortus 19 BA . The clinical trials demonstrated that the use of vitamin A in a dose of 33,000 IU thrice a day for 10 to 12 days during the complex treatment of patients with acute (36 persons) and subacute (57 persons) brucellosis lowered the average period of manifestation of the disease clinical signs and formation of the antibodies, increased the skin allergic sensitivity, the lymphocyte blast cell transformation, the total number and subpopulations of the active T-cells, theophylline-resistant lymphocytes, phagocytic and metabolic activity of neutrophils, showed 1.5- and 2-fold increased in the frequency of the infection transformation into a chronic process in patients with acute or subacute brucellosis, respectively.

Br J Nutr, 1990 Jul, 64(1), 59 - 70
The influence of inclusion of either an antibiotic or a probiotic in the diet on the development of digestive enzyme activity in the pig; Collington GK et al.; The aim of the present experiment was to determine the influence of either probiotic or antibiotic inclusion in the diets of pigs from birth on the development of enzyme activity in the small intestine . Pigs were fed on creep feed and grower diets containing either a probiotic, an antibiotic or no added growth promoter . At 7, 17, 42 and 80 d of age pigs from each treatment group were sampled to investigate the development of carbohydrase and peptidase activity in the mucosa at five sites along the small intestine . Inclusion of either the probiotic or antibiotic had a significant effect on the development of sucrase (sucrose alpha-D-glucohydrolase; EC 3.2.1.48), lactase (beta-D-galactoside galactohydrolase; EC 3.2.1.23) and tripeptidase (EC 3.4.11.4) activities before weaning but had no effect on depeptidase (EC 3.14.13.11) activity . The study of the distribution of enzyme activity along the small intestine showed significant differences between the proximal and distal sections associated with weaning.

J Bacteriol, 1990 Jul, 172(7), 3772 - 9
The ermC leader peptide: amino acid alterations leading to differential efficiency of induction by macrolide-lincosamide-streptogramin B antibiotics; Mayford M et al.; The inducibility of ermC by erythromycin, megalomicin, and celesticetin was tested with both wild-type ermC and several regulatory mutants altered in the 19-amino-acid-residue leader peptide, MGIFSIFVISTVHYQP NKK . In the model test system that was used, the ErmC methylase was translationally fused to beta-galactosidase . Mutational alterations that mapped in the interval encoding Phe-4 through Ile-9 of the leader peptide not only affected induction by individual antibiotics, but did so differentially . The subset of mutations that affected inducibility by the two macrolides erythromycin and megalomicin overlapped and were distinct from the subset of mutations that affected induction by celesticetin . These studies provide a model system for experimentally varying the relative efficiencies with which different antibiotics induce the expression of ermC . The possibility that antibiotics with inducing activity interact directly with the nascent leader peptide was tested by using a chemically synthesized decapeptide, MGIFSIFVIS--, attached at its C-terminus to a solid-phase support . This peptide, however, failed to bind erythromycin in vitro.

Aust N Z J Surg, 1990 Jul, 60(7), 539 - 43
Systemic antibiotic regimens for acute cholecystitis treated by early cholecystectomy; Lau WY et al.; A total of 203 patients were randomized into a prospective trial to compare short (SC) versus long courses (LC) of systemic antibiotic for acute cholecystitis treated by early cholecystectomy . The initial pre-operative management was the same and all patients received 2 g of cefamandole intravenously just before operation . Two further doses of cefamandole 500 mg were given 6 and 12 h later for patients on SC while the antibiotic was continued at 500 mg at 6 h intervals for 7 days for patients on LC . Seven patients developed wound infection on SC compared with five patients with wound infection and an additional patient with a subphrenic abscess on LC (P greater than 0.05) . Thrombophlebitis related to intravenous antibiotic injections was more common in patients on LC (P less than 0.05) . Also, patients on LC had to stay statistically longer in hospital in order to complete the course of antibiotic (P less than 0.05) . We therefore recommend a SC to be used, as it is more cost-effective and causes fewer complications.

Biotechnol Prog, 1990 Jul-Aug, 6(4), 266 - 72
Representation of phase equilibrium behavior of antibiotics; Zhu YZ et al.; The phase equilibrium behavior of biomolecules is important both in understanding the partition mechanisms and in the design and optimization of downstream recovery processes . Chen et al . (1989) proposed a molecular thermodynamic framework that successfully represents the liquid-solid equilibrium behavior of amino acids and small peptides as functions of temperature, ionic strength, solvent compositions, and pH . Based on this theoretical framework, this paper presents recent results in representing the liquid-solid equilibrium behavior (solubilities) and the liquid-liquid equilibrium behavior (phase partitioning) of beta-lactam antibiotics, which are amino acid derivatives and important chemotherapeutic agents.

Trends Biotechnol, 1990 Jul, 8(7), 184 - 9
Phosphate control sequences involved in transcriptional regulation of antibiotic biosynthesis; Liras P et al.; The expression of genes encoding enzymes involved in antibiotic and other secondary metabolite biosynthesis is down-regulated by easily assimilable phosphate, carbon and nitrogen sources . Phosphate control of antibiotic production appears to act at the transcriptional level by a mechanism similar to that involved in control of phosphatases and other phosphate-regulated enzymes . A phosphate control (PC) sequence, strikingly similar to the phosphate control (pho) boxes of many bacterial genes, has been isolated from the phosphate regulated promoter that controls biosynthesis of the antibiotic candicidin, and characterized . From computer analysis of sequence data, PC sequences appear to be associated with promoter regions of several phosphate-controlled antibiotic biosynthetic genes.

Biochem Biophys Res Commun, 1990 Jun 15, 169(2), 610 - 6
Inhibition of 3-hydroxy-3-methylglutaryl coenzyme A synthase by antibiotic 1233A and other beta-lactones; Mayer RJ et al.; 3-Hydroxy-3-methylglutaryl CoA synthase was shown to be inhibited in a time-dependent, irreversible manner by compounds containing the substituted beta-lactone functionality found in the natural product 1233A . The rate of inactivation (kinact) was found to approach the rate of catalysis (kcat) . The inactivation was irreversible over several hours . A related compound lacking the hydroxymethyl substituent on the beta-lactone ring is a reversible inhibitor and is competitive with respect to acetylCoA . The results are consistent with beta-lactone ring opening by the active site Cys to form an enzyme bound thioester.

Br Dent J, 1990 Jun 9, 168(11), 446 - 7
Prophylactic antibiotics; Pogrel MA; The prescribing of antibiotics in the absence of infection has always been controversial and when the lawyers get involved as well, it becomes almost unmanageable . With this is mind, it might be useful to look at some of the problems we have with antibiotics in California.

Antibiot Khimioter, 1990 Jun, 35(6), 43 - 5
{A case of successful antibiotic therapy of legionnaires' disease with lesions of the lungs and heart}; Zamotaev IP et al.; Pulmonary affections in patients with legionellosis are the main ones . The affections of the heart, gastrointestinal tract and other organs and systems are less frequent . Some characteristic features of the legionellosis clinical process in the case described are indicated . The torpid process of chronic bronchitis, the two-phase pattern of the disease, dyspnea at 3-4 month intervals, intermissions, edema and failure of complex therapy with antibiotics and cardiac glycosides provided a tentative diagnosis of Legionella pneumonia with affection of the myocardium . The importance of early serological diagnosis (enzyme immunoassay) was shown . A new approach to the treatment of legionellosis with cefuroxime was of interest.

Vrach Delo, 1990 Jun, (6), 38 - 40
{The side effects of antibiotics in chronic bronchitis}; Pilipchuk VN; The author investigated the frequency and character of side-effects to penicillin, levomycetin, tetracycline in the treatment of 92 patients with different forms of chronic bronchitis . Clinically all side-effects were subdivided in dysbacteriosis, allergic, toxic and mixed . It was established that the high incidence of side-effects furthers allergization of the body and potentiation of bronchial spasm . That is why the employment of antibiotics in these cases is not indicated . The low incidence of side-effect of antibiotics in purulent bronchitis requires their use under thorough medical surveillance.

Pathol Biol (Paris), 1990 Jun, 38(5 ( Pt 2)), 543 - 7
{Treatment of bone infection by plaster of Paris pellets impregnated with antibiotics}; Evrard J et al.; In two prospective clinical trials, the authors treated 83 chronic osteomyelitis from various origins by sequestrectomy completed with insertion of Plaster of Paris pellets impregnated with antibiotics . After a review of the experimental and clinical reports on the subjects, the authors give their results: 61.5% of healings and 38.5% of failures . Because of the small number of cases, it was not possible to find out an explanation for this fair results . However wide extension of the lesions, which is frequent in chronic haematogenous osteomyelitis, seems to be a contraindication to the technics . The authors conclude to the necessity of carrying up new experiments with new antibiotics and large series of patients in order to point out the righted indications of the method.

S Afr J Surg, 1990 Jun, 28(2), 58 - 61
Do pre-operative antibiotics reach the operative field in amputation surgery for peripheral vascular disease? A pilot study; Mars M et al.; Amputation surgery in patients with peripheral vascular disease is associated with high revision and mortality rates . A prospective pilot study examined the intra-operative delivery of cefoxitin sodium to the amputation site, and used pre-operative transcutaneous oxygen pressure measurement to try to predict the tissue antibiotic levels at the amputation site . Antibiotic concentrations were measured in plasma and muscle from the amputation site at the time of amputation, and a significant difference in antibiotic distribution was found between healed and failed amputations . Transcutaneous oxygen pressures correlated with the antibiotic distribution.

J Bacteriol, 1990 Jun, 172(6), 3108 - 16
Streptomyces genes involved in biosynthesis of the peptide antibiotic valinomycin; Perkins JB et al.; We have identified genes from Streptomyces levoris A-9 involved in the biosynthesis of the peptide antibiotic valinomycin . Two segments of chromosomal DNA were recovered from genomic libraries, constructed by using the low-copy-number plasmid pIJ922, by complementation of valinomycin-deficient (vlm) mutants of S . levoris A-9 . One set of plasmids restored valinomycin production to only one mutant, that carrying vlm-1, whereas a second set of plasmids restored productivity to seven vlm mutants, those carrying vlm-2 through vlm-8 . Additional complementation studies using subcloned restriction enzyme fragments showed that the vlm-1+ gene was contained within a 2.5-kilobase (kb) DNA region, whereas alleles vlm-2+ through vlm-8+ were contained in a 12-kb region, representing at least three genes . Physical mapping experiments based on the isolation of cosmid clones showed that the two vlm loci were 50 to 70 kb apart . Southern hybridization experiments demonstrated that the vlm-2+ gene cluster was highly conserved among other valinomycin-producing Streptomyces strains, whereas the vlm-1+ gene was ubiquitous among Streptomyces species tested . Increasing the copy number of the vlm-2+ gene cluster in S . levoris A-9 by the introduction of low-copy-number recombinant plasmids resulted in a concomitant increase in the level of valinomycin production.

J Bacteriol, 1990 Jun, 172(6), 2962 - 9
Mutations in a new Streptomyces coelicolor locus which globally block antibiotic biosynthesis but not sporulation; Adamidis T et al.; Streptomyces coelicolor produces four known antibiotics . To define genetic elements that regulate antibiotic synthesis, we screened for mutations that visibly blocked synthesis of the two pigmented antibiotics and found that the mutant strains which we recovered were of two classes--double mutants and mutants in which all four antibiotics were blocked . The mutations in these multiply blocked strains define a new locus of S . coelicolor which we have named absA . The genetic location of absA, at 10 o'clock, is distinct from the locations of the antibiotic gene clusters and from other known mutations that affect antibiotic synthesis . The phenotype of the absA mutants suggests that all S . coelicolor antibiotic synthesis genes are subject to a common global regulation that is at least in part distinct from sporulation and that absA is a genetic component of the regulatory mechanism.

Can J Microbiol, 1990 Jun, 36(6), 384 - 9
Interaction of iturin A, a lipopeptide antibiotic, with Saccharomyces cerevisiae cells: influence of the sterol membrane composition; Latoud C et al.; The binding of the membrane-active lipopeptide antibiotic iturin A to yeast cells was studied using radioactive iturin A . Saccharomyces cerevisiae had a maximum binding capacity of 5.6 x 10(9) molecules per single cell . The Scatchard plot of binding showed a biphasic profile, with a lower dissociation constant for small concentrations of iturin A . The break of slope at 30 microM iturin A corresponds to the micellization of antibiotic in solution . The binding is also dependent on the nature of the sterol present in the membrane . A mutant yeast strain with a membrane containing cholesterol instead of ergosterol showed the highest affinity for iturin A and the highest sensitivity to this antibiotic, as measured by K+ ion release . In contrast the presence of stigmasterol increased the resistance of the cells to iturin A.

Mol Microbiol, 1990 Jun, 4(6), 1009 - 18
Construction of isogenic gonococci with variable porin structure: effects on susceptibility to human serum and antibiotics; Carbonetti N et al.; Protein I (PI) is the most abundant protein on the gonococcal cell surface and besides its porin function it may have important properties contributing to pathogenicity . By allelic exchange using cloned PI genes from FA19 (PIA) and MS11 (PIB) and a selectable marker introduced closely downstream of these genes, we constructed sets of isogenic gonococcal strains that differ only in their PI gene . Analysis revealed that PI has a major effect on stable resistance to normal human serum, and a slight effect on low-level resistance to antibiotics . All PIA/B hybrids were hypersusceptible to serum, suggesting a possible explanation for why such hybrids do not occur in nature.

Antibiot Khimioter, 1990 Jun, 35(6), 7 - 12
{Study of the structure of amplifying sequence of Streptomyces antibioticus}; Ukhabotina LS et al.; A low productive laboratory strain of S . antibioticus and a strain with an increased productivity of oleandomycin derived from it were studied comparatively with using restriction analysis and blotting hybridization . Amplification, site specific integration and segregation of the DNA sequence 32.0 kb in size were detected in the strains . The chromosomes of the laboratory strain contained one copy of the amplifying sequence AUD . After uniting of the end sequences AUD appeared to be capable of segregating from the chromosomes and its one copy per five genomes was present in the form of an extrachromosomal genetic element eSA1 . The genome of the strain with increased productivity of oleandomycin contained in its chromosomes sequence ADS-Sa1 amplified to 150 copies and the eSA1 extrachromosomal genetic element in the form of mono-, di- and trimeric structures in the quantity of approximately one copy per genome . The BamHIB fragment of the eSA1 DNA 4 kb in size was identified . The fragment was able to participate in segregation or integration of eSA1 from or into the chromosomes since its subfragments were flanking AUD and ADS-SA1 in the chromosomes . The BamHIB fragment was hybridizing with a number of fragments of the chromosomal DNA of S . antibioticus, S . erythraeus . S . lividans and other strains of streptomycetes . It probably contained an IS-like element or a dispersed genetic element of another class . The DNA sequence of the eSA1 genetic element contained regions homologous to the sequence of the Erm E gene in S . erythraeus NRRL 2338.

Antibiot Khimioter, 1990 Jun, 35(6), 12 - 8
{Elaboration of a semiautomated enzymatic analyzer of glucose for the control of biosynthesis of antibiotics}; Kraniauskas VI et al.; The results of developing a semiautomatic apparatus with oxygen detection for enzymatic control of glucose concentration are presented . The design of a glucose sensitive electrode is based on an oxygen probe and a membrane with immobilized glucose oxidase . Materials for the probe were chosen and the operating conditions for measuring temperature, pH, linear agitation velocity and other parameters were optimized . The semiautomatic analyzer was constructed and its main characteristics were studied . The results of the apparatus testing during biosynthesis of various antibiotics are presented . It was shown that the required glucose concentration in the cultivation medium was provided for any specific circumstances in relation to the carbohydrate source.

Semin Dermatol, 1990 Jun, 9(2), 109 - 16
Gonorrhea: diagnostic and therapeutic strategies in the era of resistance to antibiotics; Danielsson D; Culture procedures are the methods of choice for the diagnosis of gonorrhea, and they also allow for antibiotic susceptibility testing of isolated gonococcal strains . This is important because of the growing frequency in many countries of infections with antibiotic-resistant strains . The present report discusses the diagnosis, epidemiology, and various modes for treatment of infections with plasmid-mediated high-level penicillin- and high-level tetracyclin-resistant gonococcal strains, as well as infections with gonococcal strains with chromosomally mediated resistance to penicillin, spectinomycin, and other antibiotics, such as the quinolones . The importance of subjecting treated patients to tests of cure is stressed, as well as the need for continous surveillance studies and strategies for control.

Mol Pharmacol, 1990 Jun, 37(6), 966 - 70
Mitomycin antibiotic reductive potential and related pharmacological activities; Pan SS et al.; Relationships of reductive potential, kinetics of enzymatic reduction, augmented oxygen consumption, and cytotoxicity were determined for seven clinically relevant mitomycin antibiotics . Potentials for one-electron reduction were obtained by cyclic voltammetry analysis in dimethyl sulfoxide with 0.1 M tetraethyl-ammonium perchlorate . These potentials were -0.55 V for N7-acetylmitomycin C, -0.61 V for mitomycin A, -0.75 V for N7-(p-hydroxyphenyl)mitomycin C, -0.79 V for N7-(dimethylamino-methylene)mitomycin C, -0.81 V for N7-(2-(4-nitrophenyldithio)-ethyl)-mitomycin C, -0.81 V for mitomycin C, and -0.89 V for porfiromycin . All seven antibiotics were reduced by xanthine oxidase and NADPH-cytochrome P450 reductase, but the rate of reduction varied for each antibiotic and each enzyme . The less negative the reductive potential of an antibiotic, the more easily that antibiotic was reduced enzymatically . These seven mitomycin antibiotics also augmented oxygen consumption by rat liver microsomes . As with their reduction by xanthine oxidase and NADPH-cytochrome P450 reductase, the less negative the reductive potential of an antibiotic, the more it augmented oxygen consumption . Cytotoxicity of each antibiotic was assessed by defining the IC50 against HCT 116 human colon carcinoma cells . A relationship between the reductive potential of these antibiotics and their cytotoxicity against HCT 116 cells was also observed.

Compendium, 1990 Jun, 11(6), 392 - 6
Reduced oral contraceptive effectiveness with concurrent antibiotic use: a protocol for prescribing antibiotics to women of childbearing age; Donley TG et al.; PIP: A brief literature review and update on the effect of concurrent antibiotic administration with oral contraceptive use is presented for dentists, with advice on how to manage antibiotic prescription to minimize legal repercussions in case of contraceptive failure . In the U.S . approximately 30% of women of childbearing age are using oral contraceptives, so it is quite likely that a dentist prescribing antibiotics may encounter patients on these agents . Since 1971 reports of breakthrough bleeding or contraceptive failure have concerned rifampicin, penicillins, tetracyclines, erythromycin, metronidazlole, sulfonamides, griseofulvin and cephalosporins . There have been 63 reported contraceptive failures to the British Committee on Safety of Medicine, and 29 reports to the U.S . Dept . of Health and Human Services . A case of contraceptive failure in a woman prescribed antibiotics by her dentist has been ruled in favor of the woman, making the dentist responsible for child support . The probable mechanisms for these failures are diminished enterohepatic re-circulation due to elimination of bacteria that regenerate active estrogens from conjugated estrogens in the gut, and induction of liver cytochrome P450 enzymes resulting in faster catabolism of the drugs . There are conflicting reports in the literature on how or whether these mechanisms are active in clinical situations . For the working dental practitioner it is recommended that a history of contraceptive use be taken and signed by the patient; that the dentist inform the patient of possible lower contraceptive efficacy; that the woman taking antibiotics be advised to use additional means of contraception throughout the cycle; and that women on long-term antibiotics be urged to consult their physician about increasing the does of oral contraceptives . All this advice and the antibiotic prescription should be documented in the patient's chart .

Minerva Chir, 1990 May 31, 45(10), 747 - 50
{Pseudomembranous colitis caused by antibiotic therapy during aorto-iliac surgery}; Barile C et al.; Pseudomembranous colitis is not a rare complication of antibiotic therapy . 2000 surgical procedures with implantation of grafts in the aorto-iliac region were performed from 1974 through 1988; during this period 11 cases of CMP were observed . The Authors report their experience in regard to the various antibiotics administered.

J Chromatogr, 1990 May 16, 507, 277 - 92
Liquid chromatographic investigation of quinoxaline antibiotics and their analogues by means of ultraviolet diode-array detection; Alfredson TV et al.; Numerical formats for evaluation of spectral purity and for spectral comparison of ultraviolet diode-array detector data, together with library search routines, were applied to the liquid chromatographic analysis of echinomycin, triostin A and their synthetic and biosynthetic analogues . Samples of monoquinoline and bisquinoline analogues of echinomycin were found to contain echinomycin and the other respective analogue . Triostin A and its undermethylated synthetic analogues, des-N-tetramethyltriostin A (TANDEM) and {MeCys3,MeCys7}-TANDEM, were each composed of two or more components . Triostin A primarily consisted of a major chromatographic component and a minor component with very similar ultraviolet spectral features . TANDEM exhibited three chromatographic components with nearly identical ultraviolet spectral characteristics . Apparent conformational interconversion of at least two forms of the {MeCys3,MeCys7}-TANDEM analogue was observed by reversed-phase liquid chromatography . An activation energy of 15 kcal/mol was estimated for the interconversion based upon an Arrhenius plot of the data.

Tidsskr Nor Laegeforen, 1990 May 10, 110(12), 1539 - 40
{Antibiotic prevention in acute appendicitis}; Dahlstrom BL et al.; Preoperative prophylaxis with metronidazole suppositorium to patients undergoing appendectomy was introduced in our department in 1981 . One hundred consecutive patients who had an appendectomy in the period May to October 1988 were reviewed to assess the efficiency of the prophylaxis . Postoperative infections were found in seven cases, but none were serious or caused sequelae . The clinical results of this simple, low-cost practice are satisfying, and we therefore intend to continue using metronidazole suppositorium as prophylaxis before appendectomy.

Biochim Biophys Acta, 1990 May 9, 1024(1), 193 - 7
The transport of Na+ and K+ ions through phospholipid bilayers mediated by the antibiotics salinomycin and narasin studied by 23Na- and 39K-NMR spectroscopy; Riddell FG et al.; Addition of the ionophoric antibiotics salinomycin or narasin to preparations of large unilamellar vesicles made from egg yolk phosphatidylcholine in sodium or potassium chloride solutions gives rise to dynamic effects in the 23Na- and 39K-NMR spectra . The dynamic spectra arise from the ionophore-mediated transport of the metal ions through the membrane . The kinetics of the transport are followed as a function of the concentrations of ionophore and the metal ion and are compatible in all cases with a model in which one ionophore molecule transports one metal ion . For both ionophores the transport of potassium ions is appreciably faster than that of sodium and in both cases the rate-limiting step for sodium transport is dissociation of the ionophore-metal complex . Assuming dissociation to be rate limiting in all four cases it is shown that the transport rate differences between the pairs of complexes of each metal arise solely from differences in the rates of formation . The stability constants for ionophore-metal complex formation in the membrane/water interface are evaluated.

Minerva Pediatr, 1990 May, 42(5), 189 - 91
{Antibiotic therapy in congenital obstruction of the nasolacrimal duct}; Nucci P; Forty-eight children aged from 4 to 11 months, affected by Congenital Nasolacrimal Duct Obstruction (CNDO), treated successfully by local hydrostatic massage, were retrospectively included in two groups: Group A treated by massage and antibiotic eye drops, Group B treated by massage only . The comparison shows a quicker resolution of the CNDO when antibiotic eye drops are administered . The Author stresses the utility of topical antibiotic therapy regardless of the presence of mucopurulent discharge.

Biull Eksp Biol Med, 1990 May, 109(5), 449 - 51
{Experimental bases of directed transport of antibiotics in suppurative-inflammatory diseases of the liver and biliary tract}; Zhumadilov ZhSh et al.; The possibility of use and effectiveness of directed transport of antibiotics in erythrocyte carriers in the treatment of suppurative-inflammatory diseases of biliary ducts has been studied on dogs . It has been found that erythrocyte carriers were resistant to desorption of antibiotics in the blood circulation . Pharmacokinetic investigation has shown the more prolonged collection of antibiotics in hepatic tissue in comparison with traditional intravenous route . The results of clinical, pharmacokinetic and morphological investigation have shown more effectiveness of directed transport of antibiotics to the liver in autologous erythrocyte carriers in treatment of suppurative diseases of biliary ducts in comparison with traditional methods of infusion of antibiotics . For reasons given it is recommended to use this method in clinical practice.

J Assoc Off Anal Chem, 1990 May-Jun, 73(3), 373 - 9
Capillary gas chromatographic method for determination of benzylpenicillin and other beta-lactam antibiotics in milk; Meetschen U et al.; A capillary gas chromatographic method is described for determining residues of beta-lactam antibiotic residues in milk, with specificity for benzylpenicillin (penicillin G), phenoxymethylpenicillin, methicillin, oxacillin, cloxacillin, dicloxacillin, and nafcillin . Residues are extracted from milk with acetonitrile . Samples are cleaned up by partitioning between aqueous and organic phases at different pH values . The penicillin residues are methylated with diazomethane to render them amenable to determination by gas chromatography on a methyl silicone fused silica column . Samples are introduced by split/splitless injection using a programmed temperature vaporization injector and are detected by nitrogen-selective thermionic detection . Internal standardization is used for quantitation . The limits of detection for all penicillins are well below 1 microgram/kg . Recoveries of spiked samples at 3 and 10 micrograms/kg are in the range of 42-85% (coefficients of variation 2-5%) and 41-92% (coefficients of variation 3-7%), respectively.

J Antibiot (Tokyo), 1990 May, 43(5), 492 - 503
Landomycins, new angucycline antibiotics from Streptomyces sp . I . Structural studies on landomycins A-D; Henkel T et al.; The chemical structure of the new angucycline antibiotic landomycin A has been elucidated via chemical and spectroscopic methods, in particular by 2D NMR correlation spectroscopy, e.g., 1H, 1H-COSY, 13C, 1H-COSY, correlation spectroscopy via long-range-couplings and heteronuclear multiple bond connectivity spectroscopy sequences . The spectroscopic investigations were carried out principally with the octaacetyl derivative of landomycin A, which is more soluble in organic solvents than landomycin A itself . The structure consists of a new, unusual angucyclinone, landomycinone A, and of six deoxy sugars, four D-olivoses and two L-rhodinoses, which are all assembled in one chain thus forming the sequence (olivose-4----1-olivose-3----1-rhodinose)2 . This long sugar chain is bonded as a phenolic glycoside to the aglycone moiety, a unique structural feature among quinone glycoside antibiotics . By comparison with the main component landomycin A, the structures of three minor congeners, namely landomycins B, C and D, could be proposed.

J Antibiot (Tokyo), 1990 May, 43(5), 485 - 91
Structures of the novel anthraquinone antitumor antibiotics, DC92-B and DC92-D; Yasuzawa T et al.; The structures of the new anthraquinone antitumor antibiotic DC92-B and its photodegradation product DC92-D were determined by their spectral studies . DC92-B and D are pluramycin antibiotics, related to hedamycin which possess a characteristic ring F and a side chain containing a cis-epoxide and terminal dimethyl.

J Antibiot (Tokyo), 1990 May, 43(5), 477 - 84
Structural studies on new depsipeptide antibiotics, variapeptin and citropeptin; Nakagawa M et al.; Variapeptin and citropeptin were found as novel hexadepsipeptide antibiotics produced by Streptomyces variabilis and Streptomyces flavidovirens, respectively . Their structures were elucidated by NMR spectral analysis including a variety of 2D techniques . Variapeptin and citropeptin are structurally realted to azinothricin and A83586C, respectively.

J Intraven Nurs, 1990 May-Jun, 13(3), 172 - 6
Home antibiotic therapy for brain abscesses; Hinkle JL; Patients with brain abscesses now have the option of receiving intravenous antibiotic therapy at home . However, before discharge from the hospital, these patients require significant education in aseptic technique, general catheter care, medication administration, and troubleshooting . Also provided is a review of the pathology, signs, symptoms, diagnosis, and treatment of adult brain abscesses.

Proc Natl Acad Sci U S A, 1990 May, 87(10), 3831 - 5
DNA intercalation and cleavage of an antitumor antibiotic dynemicin that contains anthracycline and enediyne cores; Sugiura Y et al.; Dynemicin is a hybrid containing anthraquinone and enediyne cores, which contribute to binding and cleavage of DNA, respectively . DNA strand scission by the antitumor antibiotic is significantly enhanced by the addition of NADPH or thiol compounds . The preferential cutting site of dynemicin is on the 3' side of purine bases (i.e., 5'-GC, -GT, and -AG) and is clearly different from the cutting sites of esperamicin and calicheamicin . The double-stranded and the stem regions of single-stranded DNAs are preferentially cleaved by dynemicin . Therefore, dynemicin may be a useful reagent for probing secondary structures of DNA . Pretreatment of DNA with Adriamycin and actinomycin D alters the cutting mode of dynemicin . Dynemicin-mediated DNA breakage is strongly inhibited by pretreatment of the DNA with distamycin A and anthramycin, suggesting that dynemicin interacts with the minor groove of the DNA helix . Intercalation of the anthraquinone core into the DNA followed by the attack of the phenyl diradical formed from the enediyne core is considered as a possible mechanism of action of dynemicin.

J Pharmacol Exp Ther, 1990 May, 253(2), 537 - 44
Membrane potential-dependent and carrier-mediated transport of cefpiramide, a cephalosporin antibiotic, in canalicular rat liver plasma membrane vesicles; Tamai I et al.; The biliary excretion mechanism of cefpiramide, a typical biliary excretion type cephalosporin antibiotic, was investigated by measuring the uptake by purified rat liver bile canalicular membrane vesicles . The initial uptake of cefpiramide showed significant temperature and concentration dependencies; the kinetic parameters were estimated to be 1.73 mM, 2.64 nmol/40 sec/mg protein and 0.17 nmol/40 sec/mg protein/mM for Michaelis constant, maximum uptake rate and nonsaturable uptake rate constant, respectively . An intravesicular positive membrane potential induced by valinomycin significantly enhanced the initial uptake of cefpiramide . Furthermore, by inducing an inside negative membrane potential, the initial efflux was significantly enhanced . Organic anions such as bile acids, bromosulfophthalein, bilirubin, probenecid, furosemide and 4,4'-diisothiocyanostilben-2,2'-disulfonic acid significantly reduced the uptake of cefpiramide, whereas amino acids, dipeptides, organic neutral compounds and cationic compounds had no effect . The inhibitory effects of taurocholic acid and bromosulfopthalein were especially competitive . Most of the beta-lactam antibiotics tested significantly reduced the uptake of cefpiramide in a competitive manner . Furthermore, benzylpenicillin showed a countertransport effect on the cefpiramide uptake . From these results it is suggested that neither organic cation nor dipeptide carrier systems participate in the uptake of beta-lactam antibiotics, and most of the derivatives are transported by recognition as organic anions in the bile canalicular membrane.

Crit Care Med, 1990 May, 18(5), 529 - 36
Effect of hemorrhagic shock on bacterial translocation, intestinal morphology, and intestinal permeability in conventional and antibiotic-decontaminated rats; Deitch EA et al.; Bacterial translocation and ileal and cecal injury have been shown to occur 24 h after limited periods of hemorrhagic shock . The present studies were performed to determine the temporal sequence of mucosal injury, permeability, and bacterial translocation after hemorrhagic shock . The results indicated that bacterial translocation and mucosal injury have occurred by 2 h after a 30-min episode of shock (mean arterial pressure 30 mm Hg) . Although the histologic extent of the intestinal mucosal injury was less at 2 h postshock than at 24 h postshock, at both times intestinal barrier function was lost as measured by permeability to horseradish peroxidase . Since the role of translocating bacteria in potentiating the loss of intestinal barrier function after shock is unclear, the second goal was to determine whether the extent of shock-induced mucosal injury and permeability could be reduced or abrogated by antibiotic decontamination of the gut . The extent of shock-induced mucosal injury and intestinal permeability was similar between rats with a normal gut flora (greater than 10(6) bacteria/g cecum) and antibiotic-decontaminated rats (less than 10(3) bacteria/g cecum) 2 h postshock, although the incidences of bacterial translocation were 67% and 0, respectively . Thus, shock-induced mucosal permeability and injury appear not to be directly related to the presence of translocating bacteria.

J Neurosurg, 1990 May, 72(5), 703 - 5
Influence of intraoperative antibiotic choice on the incidence of early postcraniotomy seizures; Michenfelder JD et al.; Because of a suspicion that intraoperative penicillin antibiotics might be causing early postoperative seizures in craniotomy patients, a deliberate effort was initiated in 1987 to avoid these agents in favor of nonpenicillin antibiotics . This permitted a retrospective comparison of the incidence of early postoperative seizures in craniotomy patients who did and who did not receive intraoperative penicillins . Records of patients treated between July 1, 1984, and July 1, 1985, and between July 1, 1987, and July 1, 1988, were reviewed, for a total of 1316 procedures . There were no seizures in the 323 patients who underwent suboccipital craniectomy . However, among the 993 patients receiving supratentorial procedures there were 30 with seizures within the first 6 hours postoperatively, 19 of which were generalized seizures . The incidence of early seizures was 4.7% (20 cases) of the 427 patients given penicillins and only 1.8% (10 cases) of the 566 not given penicillins (p less than 0.01) . Since patients undergoing surgery for intractable seizures have a high incidence of early postoperative seizures (11 of 92 in this series, or 12%), creation of a subgroup eliminated these from consideration but did not alter the relationship of penicillins to early seizures (p less than 0.02) . The authors conclude that intraoperative (and early postoperative) penicillin antibiotic administration should be avoided, if possible, in patients undergoing craniotomy for supratentorial pathology.

Pathol Biol (Paris), 1990 May, 38(5), 426 - 30
{In vitro sensitivity of Chlamydiae to antibiotics}; Dailloux M et al.; The in vitro activity of 11 antibiotics against 16 Chlamydia trachomatis strains isolated from genital tract and 2 Chlamydia psittaci strains isolated from pulmonary tract . The CMI determination (the lowest dilution of the drug which inhibited the inclusion development when untreated control give 10(3) IFC) was assessed by growth in cycloheximide treated McCoy cells-antibiotics were added after incubation for 2 hours at 37 degrees C . The CMI values for Chlamydia trachomatis and Chlamydia psittaci are similar . The activity of antibiotics by comparison between CMI90 and serial levels . The CMI90 (mg/l) were: doxycycline = 0.2, minocycline = 0.2, roxythromycine = 0.12, erythromycine = 0.5, spiramycine = 4, rifampicine = 0.016, ofloxacine = 4, ciprofloxacine = 4, pefloxacine = 8, lomefloxacine = 8, fleroxacine = 8 . For Chlamydia trachomatis species all the strains have the same sensibility, no resistance was detected.

Antimicrob Agents Chemother, 1990 May, 34(5), 858 - 62
Activities of beta-lactam antibiotics against Escherichia coli strains producing extended-spectrum beta-lactamases; Jacoby GA et al.; Seven extended-spectrum beta-lactamases related to TEM and four enzymes derived from SHV-1 were transferred to a common Escherichia coli host so that the activity of a variety of beta-lactams could be tested in a uniform genetic environment . For most derivatives, penicillinase activity was 10% or less than that of strains making TEM-1, TEM-2, or SHV-1 beta-lactamase, suggesting that reduced catalytic efficiency accompanied the broader substrate spectrum . Despite this deficit, resistance to aztreonam, carumonam, cefdinir, cefepime, cefixime, cefmenoxime, cefotaxime, cefotiam, cefpirome, cefpodoxime, ceftazidime, ceftibuten, ceftizoxime, ceftriaxone, cefuroxime, and E1040 was enhanced . For strains producing TEM-type enzymes, however, MICs of carumonam, cefepime, cefmenoxime, cefotiam, cefpirome, and ceftibuten were 8 micrograms/ml or less . Susceptibilities of cefmetazole, cefotetan, cefoxitin, flomoxef, imipenem, meropenem, moxalactam, temocillin, FCE 22101, and Sch 34343 were unaffected . FCE 22101, imipenem, meropenem, and Sch 34343 were inhibitory for all strains at 1 microgram/ml or less . In E . coli an OmpF- porin mutation in combination with an extended-spectrum beta-lactamase enhanced resistance to many of these agents, but generally by only fourfold . Hyperproduction of chromosomal AmpC beta-lactamase increased resistance to 7-alpha-methoxy beta-lactams but not that to temocillin . When tested at 8 micrograms/ml, clavulanate was more potent than sulbactam or tazobactam in overcoming resistance to ampicillin, while cefoperazone-sulbactam was more active than ticarcillin-clavulanate or piperacillin-tazobactam, especially against TEM-type extended-spectrum beta-lactamases.

J Antibiot (Tokyo), 1990 May, 43(5), 513 - 8
Synthesis and structure determination of FR109615, a new antifungal antibiotic; Kawabata K et al.; The structure of FR109615, a new antifungal antibiotic, was determined to be (1R,2S)-2-aminocyclopentane-1-carboxylic acid ((-)-cis-2-ACPC: 8a) by X-ray analysis . (-)-cis-2-ACPC (8a) was also synthesized via optical resolution of 3a and 3b derived from (+/-)-cis-2-ACPC hydrochloride (1) . 8a showed potent antifungal activity, while its antipode (+)-cis-2-ACPC (8b) had no activity.

Biochem J, 1990 May 1, 267(3), 709 - 13
Characterization of Saccharomyces cerevisiae strains displaying high-level or low-level resistance to trichothecene antibiotics; Fernandez-Lobato M et al.; Biochemical and genetic analyses have been carried out on Saccharomyces cerevisiae strains characterized in vivo as sensitive, low-level-resistant or high-level-resistant to trichothecene antibiotics . Levels of drug resistance in vitro were determined for each strain and for suitable diploids derived from them . Ribosome biogenesis was also studied in selected haploids . It is suggested that resistance in all cases results from a mutation in the gene encoding ribosomal protein L3 . If this is indeed the situation, then different mutations in this same gene not only can cause low-level or high-level resistance to trichothecene antibiotics but also can affect the maturation of either 40 S or 60 S ribosomal subunits.

Zh Vopr Neirokhir Im N N Burdenko, 1990 May-Jun, (3), 11 - 4
{The ultraviolet irradiation of autologous blood and endolymphatic antibiotic therapy in treating pneumonia in patients with craniocerebral trauma}; Kibirev AB et al.; On the basis of analysis of 50 cases of craniocerebral injury complicated by pneumonia, the authors prove the efficacy of including ultraviolet irradiation of autologous blood and endolymphatic antibiotic therapy in the complex of therapeutic measures . The mortality and the period of in-hospital treatment of this group of patients reduced.

Proc Natl Acad Sci U S A, 1990 May, 87(9), 3435 - 9
A mutant neomycin phosphotransferase II gene reduces the resistance of transformants to antibiotic selection pressure; Yenofsky RL et al.; The neo (neomycin-resistance) gene of transposon Tn5 encodes the enzyme neomycin phosphotransferase II (EC 2.7.1.95), which confers resistance to various aminoglycoside antibiotics, including kanamycin and G418 . The gene is widely used as a selectable marker in the transformation of organisms as diverse as bacteria, yeast, plants, and animals . We found a mutation that involves a glutamic to aspartic acid conversion at residue 182 in the protein encoded by the chimeric neomycin phosphotransferase II genes of several commonly used transformation vectors . The mutation substantially reduces phosphotransferase activity but does not appear to affect the stability of the neomycin phosphotransferase II mRNA or protein . Plants and bacteria transformed with the mutant gene are less resistant to antibiotics than those transformed with the normal gene . A simple restriction endonuclease digestion distinguishes between the mutant and the normal gene.

Compendium, 1990 May, 11(5), 328 - 32
Update on antibiotics for the endodontic practice; Olson AK et al.; The increasing reports of antibiotic-resistant bacteria and the introduction of new antibiotics have resulted in a change in prescribing antibiotics in many dental offices . The purpose of this article is to provide a rationale for selecting the appropriate antibiotic for odontogenic infections and to review the basic concepts of antibiotic therapy.

Chem Res Toxicol, 1990 May-Jun, 3(3), 262 - 7
Mode of action of saframycin antitumor antibiotics: sequence selectivities in the covalent binding of saframycins A and S to deoxyribonucleic acid; Rao KE et al.; The sequence-preferential reversible covalent binding of certain saframycin antitumor antibiotics from Streptomyces lavendulae has been examined by complementary-strand methidium propyl-EDTA (MPE) footprinting on an EcoRI/HindIII restriction fragment of pBR322 DNA under several experimental conditions . A buffer at pH 7.4 and in the presence of 9.5 mM dithiothreitol at 37 degrees C was found to be optimum for the interaction of these antibiotics with DNA . At r' = 0.6 both saframycins A and S exhibited footprints in the regions 4244-4257 (CAAATAGGGTTCC) and 4265-4286 (TTCCCCAAAAGTGCCACCTG) and a weak footprint in the region 4297-4302 (AACCAT) . The binding locations identified that are common to saframycins A and S are (all 5'----3') GGGG (4250-4253), CCCC (4268-4271), and GCC (4279-4281), and weak interaction locations are ACC (4282-4284 and 4298-4300) (underlined bases are shared by two adjacent binding sites) . Both the antibiotic saframycins A and S show preference for 5'-GGG or 5'-GGC sequences . It appears that saframycin A has no affinity for 5'-CGG while saframycin S shows a strong footprint at this sequence . Neither of the saframycins recognizes alternating CG sequences . Saframycin S also binds to 5'-CTA, which suggests that molecular recognition processes involving the parent antibiotics are also important, and not only recognition by, and covalent binding of, the common iminium species to the DNA . The protection sites at 5'-GCC and 5'-ACC suggest that saframycins A and S recognize 5'-GGPy sequences . However, between the two pyrimidine bases, C is preferred to T . Enhancement of cleavage by both saframycins is observed in the AT-rich region of 4301-4318.(ABSTRACT TRUNCATED AT 250 WORDS)

Dtsch Z Mund Kiefer Gesichtschir, 1990 May-Jun, 14(3), 232 - 4
{Lyophilized cartilage--an antibiotic carrier}; Puelacher W et al.; Human lyophilized bruised costal cartilage was tested in vitro for its ability to act as a carrier medium for antibiotics . A remarkable capacity of accumulating streptomycin, gentamicin, tobramycin, vancomycin and ciprofloxacin was observed; whereas beta-lactum antibiotics and fosfomycin were released at a high rate . This release pattern was not influenced by the sterilization procedure, but rather by the size of the cartilage granula . Lyophilized cartilage--rehydrated in antibiotic-solutions--be helpful adjunct in the surgical management of osseous infections.

J Pharm Pharmacol, 1990 May, 42(5), 314 - 8
Contribution of passive transport mechanisms to the intestinal absorption of beta-lactam antibiotics; Sugawara M et al.; The transport characteristics of aminopenicillins (ampicillin and amoxicillin), aminocephalosporins (cephalexin, cephradine and cefadroxil) and cefazolin have been compared with those of an actively transported substance (D-glucose) and a passively transported substance (L-glucose) . Although the initial uptake of the aminocephalosporins was stimulated in the presence of an inward H+ gradient, there was no overshoot in the uptake of any of the drugs tested, even in the presence of an H+ gradient . Also, the time course and the degree of uptake of these drugs were similar to those of L-glucose, especially in the absence of an H+ gradient . These results suggest that the beta-lactam antibiotics tested, like L-glucose, pass through the rat intestinal brush border membrane mainly by passive diffusion . However, the differences in absorption between these drugs, like the differences in their disappearance from a proximal loop of rat intestine, cannot be explained by a simple permeation process alone.

Clin Ter, 1990 Apr 30, 133(2), 87 - 90
{Combination of oral bacterial vaccines and antibiotics in acute recurrent respiratory infections}; Lauriello G et al.; The authors treated 34 patients with acute bronchopulmonary disease or flare-ups of chronic ones with equal doses of ambroxol and ceftriaxone considering the homogeneity of the morbid processes . Patients were divided into two groups of 17 subjects each: group A was given a polyvalent oral bacterial vaccine, group B a placebo . Relevant differences were found between the experimental and control groups concerning cough (score: A = 108, B = 119), duration of expectoration (A = 5.3 days, B = 6.4 days), duration of antibiotic therapy (A = 8.0 days, B = 8.8 days), and length of hospitalization (A = 10.9 days, B = 12.0 days) . Differences were slight as far as duration of fever, characteristics of cough and objective findings on the chest were concerned.

Pathol Biol (Paris), 1990 Apr, 38(4), 273 - 5
{Penetration of antibiotics in alveolar macrophages compared by in vitro and in vivo data in man}; Harf R et al.; Optimal therapy of infections caused by intracellular organisms requires an active antibiotic prone to intracellular penetration . This phenomenon has been studied on alveolar macrophages as well in vitro as in vivo for most groups of antibiotics . The comparison of data shows that the values obtained by incubation are not predictive of what happens in situ . These results must be taken in account for the choice of an antibiotic in pulmonary infections as well as its spectrum, pharmacokinetic, and possible side effects.

Methods Find Exp Clin Pharmacol, 1990 Apr, 12(3), 197 - 204
Gastric emptying and the pharmacokinetics of the cephalosporin antibiotic, cefpodoxime proxetil; Hughes GS Jr et al.; The effects of gastric motility on the pharmacokinetics of cefpodoxime proxetil, an oral, broad spectrum, third-generation cephalosporin antibiotic were evaluated in 12 healthy subjects . In this open-label, crossover trial, each subject took a 200 mg dose (two 100 mg film-coated tablets) in each study period . There was an initial fasting period followed by a control period and then either a propantheline or metoclopramide period . Gastric motility was measured using {99mTc}-labeled sulfur colloid in oatmeal in the control, propantheline and metoclopramide periods . Treatment with propantheline or metoclopramide was given 30 min before dosing with the antibiotic and the radioisotope . Serial images with a gamma counter were made every 15 min for 2 h . Gastric emptying time was faster than control with metoclopramide, but generally slower with propantheline than control . The mean peak plasma concentration, mean area under plasma concentration time curve and mean half-life of cefpodoxime proxetil were similar in all groups as compared to control . The mean time to peak plasma concentration was delayed in the propantheline period and peak plasma concentrations were greater at all sampling times at six hours after dosing . This study utilized the gastric nuclear scan with modification of gastric motility by metoclopramide and propantheline and with simultaneous determination of the disposition of cefpodoxime proxetil to understand the absorption of the drug.

J Antibiot (Tokyo), 1990 Apr, 43(4), 372 - 82
Synthesis and cytostatic activity of the antitumor antibiotic chartreusin derivatives; Kon K et al.; In order to overcome the rapid biliary excretion of chartreusin, which diminished its activity when administered iv, a series of 3',4'-O-substituted derivatives of chartreusin were synthesized . Exo-type of 3',4'-O-benzylidene-chartreusin was found active both by ip and iv administration . Therefore, this compound was selected for further modification on its 6-phenol to obtain broader spectra and better pharmacokinetic parameters than the original compound . Several 6-O-acyl-3',4'-O-exo-benzylidene-chartreusins had high antitumor activity against some murine tumors both by iv and po administration.

In Vitro Cell Dev Biol, 1990 Apr, 26(4), 393 - 8
In vitro correlation of ultrastructural morphology and creatine phosphokinase release in L6 skeletal muscle cells after exposure to parenteral antibiotics; Laska DA et al.; Morphologic changes in a rat skeletal muscle cell line (L6) exposed for 1 h to the parenteral antibiotics amphotericin B (AMP), tetracycline-HCl (TET), erythromycin lactobionate (ERY), and cephaloridine (CEP) were characterized by transmission and scanning electron microscopy and compared to cellular release of creatine phosphokinase (CPK) . AMP (0.05, 0.1, 0.5 mg/ml) caused a concentration-related swelling of nuclei, endoplasmic reticulum, and mitochondria . Loss of membrane integrity associated with AMP exposure was evident at the middle concentration and extensive at the high concentration, which correlated well with the 43 and 90% depletion of CPK from the muscle cells, respectively . TET (0.25, 1.0, 2.5 mg/ml) caused dilation of endoplasmic reticulum and cytoplasmic blebbing at the low concentration but had no effect on the cytoplasmic membrane or CPK . Cells exposed to the high concentration of TET had extensive damage to the cytoplasmic membrane, and CPK was completely depleted . ERY (2.5, 5.0, 25 mg/ml) caused a pattern of morphologic changes and CPK depletion similar to TET . CEP (4.0, 20, 50 mg/ml) had no effect on membrane integrity or CPK; however, membranous whorls were prominent in the cytoplasm . A good correlation between CPK release and cytoplasmic membrane integrity was evident and the ability of these agents to release CPK from muscle cells in culture correlated with the known irritancy potential of these parenteral antibiotics . Furthermore, CPK depletion seems to be a reliable indicator of muscle cell damage after cytoplasmic membrane perturbation and is therefore an appropriate index of toxicity in this in vitro muscle irritation model.

Fundam Appl Toxicol, 1990 Apr, 14(3), 589 - 97
Comparison of in vitro and in vivo models to assess venous irritation of parenteral antibiotics; Hoover DM et al.; The venous irritation potential of four parenteral antibiotics, tetracycline hydrochloride (TET), erythromycin lactobionate (ERY), amphotericin B (AMP), and cephaloridine (CEP), was evaluated in an in vivo model using the rabbit ear vein . Lateral ear veins of New Zealand White rabbits were infused for 1 hr with test solutions containing TET (0.25,2.5, or 10 mg/ml), ERY (2.5, 5, or 25 mg/ml), AMP (0.05, 0.1, or 0.5 mg/ml), or CEP (4 or 20 mg/ml) . Control rabbits received comparable volumes of 0.9% NaCl or 5% dextrose . Approximately 24 hr postinfusion, the rabbits were evaluated for visually evident changes in the treated ears . Pathologic evaluation of the veins was performed using histologic sections and scanning electron microscopy . TET, ERY, and AMP caused concentration-dependent changes in veins characterized primarily by loss of endothelium with associated inflammation and thrombus formation, consistent with the known clinical irritancy of these antibiotics . CEP, on the other hand, was well tolerated in the rabbit ear vein, paralleling its low irritancy potential in man . Test solutions identical to those used in vivo in rabbits were also evaluated in established in vitro assays for hemolytic potential when mixed with whole blood from monkeys and for damage to L6 muscle cells as determined by loss of creatine phosphokinase . Results of the in vitro test systems paralleled those of the rabbit ear model, with TET, ERY, and AMP exhibiting dose-dependent hemolysis and muscle cell toxicity, while CEP was comparatively nontoxic . Of the three models, the rabbit ear vein had the greatest sensitivity when histopathologic evaluation was employed.(ABSTRACT TRUNCATED AT 250 WORDS)

J Pharmacol Exp Ther, 1990 Apr, 253(1), 315 - 20
In vivo evidence for carrier-mediated uptake of beta-lactam antibiotics through organic anion transport systems in rat kidney and liver; Tsuji A et al.; The transport mechanisms of beta-lactam antibiotics in the rat kidney and liver were studied with an in vivo tissue-sampling single-injection technique using {3H}benzylpenicillin {( 3H}PCG) as a substrate . Concentration-dependent uptake of {3H}PCG was observed in the kidney, and the in vivo kinetic parameters were estimated as follows: the maximum uptake rate (Jmax) was 6.88 mumol/min/g of kidney, MIchaelis constant (Kt) was 1.39 mM and nonsaturable first-order rate constant (kd) was 0.414 ml/min/g of kidney . The uptake of {3H}PCG was inhibited by organic anions but not by organic cations . Several beta-lactam antibiotics also reduced the uptake of {3H}PCG . Furthermore, the organic anion, probenecid, and beta-lactam antibiotic, cefpiramide, showed a dose-dependent inhibitory effect . These results suggest participation of an organic anion transport system in uptake of beta-lactam antibiotics across the renal plasma membrane . Saturable uptake of {3H}PCG was also observed in the liver and Jmax, Kt and Kd were estimated to be 3.62 mumol/min/g of liver, 3.59 mM and 0.223 ml/min/g of liver, respectively . The in vivo influx rate calculated from Jmax/Kt in the liver was 1.01 ml/min/g of liver and was close to the in vitro value, 1.54 ml/min/g of liver, estimated previously from isolated hepatocytes . Although dipeptides and organic cations showed no effect on the hepatic uptake of {3H}PCG, probenecid significantly reduced its uptake . Several beta-lactam antibiotics also reduced the uptake of {3H}PCG by the liver . These features of the hepatic uptake of beta-lactam antibiotics through an organic anion transport system are in agreement with the previous results obtained in isolated hepatocytes.(ABSTRACT TRUNCATED AT 250 WORDS)

Arch Otolaryngol Head Neck Surg, 1990 Apr, 116(4), 406 - 10
The incidence of aminoglycoside antibiotic-induced hearing loss; Brummett RE et al.; The definition of ototoxicity in most clinical studies of aminoglycoside antibiotics is an increase in pure-tone threshold from a baseline audiogram greater than or equal to 15 dB at two or more frequencies, or greater than or equal to 20 dB at one or more frequencies . In this study, test-retest auditory threshold differences of this magnitude were found in a group of 20 normal volunteers who were not taking any known ototoxic drugs . Depending on which of the two criteria for ototoxicity are used, these data represent a 20% or 33% incidence of ototoxicity . We believe that many of the audiometric changes reported to represent aminoglycoside antibiotic ototoxicity may actually represent the normal test-retest variability of pure-tone audiometry . If this is true, the reported incidence of hearing loss due to aminoglycoside antibiotics may be exaggerated.

Pathol Biol (Paris), 1990 Apr, 38(4), 255 - 60
{Antibiotics and anti-inflammatory agents: drug interactions}; Carbon C; Antibiotics (AB) are sometimes used in patients taking anti-inflammatory drugs (AID) (steroidal and non steroidal anti-inflammatory drugs) . At the present time, the usefulness of AID in bacterial infections has been established in a limited number of clinical situations . AID are able to modify the kinetics of AB through different mechanisms which are illustrated by results obtained with cephalosporins and phenylbutazone or diclofenac . In some conditions, these modifications might have consequences on in vivo effect of AB . Conversely, some AB are able to alter metabolism and/or kinetics of some steroids . Interactions of AI on AB toxicity have also been investigated on kidney and central nervous system . AB/AI kinetic interactions have to be investigated for a better understanding of the mechanisms through which AI improve the evolution of an infectious process.

J Can Dent Assoc, 1990 Apr, 56(4), 337 - 9
Commonly prescribed medical drugs and their significance in dental therapy . Part I--The antibiotics; Hardie J; An analysis of Tables I and II reveals that the 20 drugs most frequently prescribed by family practitioners may be classified into 10 therapeutic categories . The antibiotics constitute the numerically largest group . The medical use, adverse reactions, and dental significance of these antibiotics have been described . The remaining drugs will be discussed using a similar format in subsequent papers.

Am Surg, 1990 Apr, 56(4), 251 - 4
Antibiotics in elective colon surgery . A randomized trial of oral, systemic, and oral/systemic antibiotics for prophylaxis; Stellato TA et al.; A prospective, randomized double-blind study was undertaken to compare the efficacy of three prophylactic regimens (oral neomycin and erythromycin, intravenous cefoxitin, and a combination of both oral and intravenous antibiotics) in patients undergoing elective colorectal surgery . One hundred sixty-nine patients were randomized and 146 patients were evaluable . Septic complications occurred in 11.4 per cent of patients receiving oral antibiotics only, in 11.7 per cent of patients receiving intravenous cefoxitin alone, and in 7.8 per cent of patients receiving both oral and intravenous antibiotics . These differences were not statistically different . The greatest number of septic complications occurred in those patients with anastomotic disruptions . Two patients died (1.3%), both of whom had major anastomotic failures . There was no advantage between any of the groups in the incidence of wound infection (3.9-6.8%) . Thus, no advantage could be identified in this study in the combination of oral and intravenous antibiotics in elective colorectal surgery.

Clin Microbiol Rev, 1990 Apr, 3(2), 171 - 96
Pneumococcal resistance to antibiotics; Klugman KP; The geographic distribution of pneumococci resistant to one or more of the antibiotics penicillin, erythromycin, trimethoprim-sulfamethoxazole, and tetracycline appears to be expanding, and there exist foci of resistance to chloramphenicol and rifampin . Multiply resistant pneumococci are being encountered more commonly and are more often community acquired . Factors associated with infection caused by resistant pneumococci include young age, duration of hospitalization, infection with a pneumococcus of serogroup 6, 19, or 23 or serotype 14, and exposure to antibiotics to which the strain is resistant . At present, the most useful drugs for the management of resistant pneumococcal infections are cefotaxime, ceftriaxone, vancomycin, and rifampin . If the strains are susceptible, chloramphenicol may be useful as an alternative, less expensive agent . Appropriate interventions for the control of resistant pneumococcal outbreaks include investigation of the prevalence of resistant strains, isolation of patients, possible treatment of carriers, and reduction of usage of antibiotics to which the strain is resistant . The molecular mechanisms of penicillin resistance are related to the structure and function of penicillin-binding proteins, and the mechanisms of resistance to other agents involved in multiple resistance are being elucidated . Recognition is increasing of the standard screening procedure for penicillin resistance, using a 1-microgram oxacillin disk.

J Antibiot (Tokyo), 1990 Apr, 43(4), 417 - 21
Mechanism of action of a new macromolecular antitumor antibiotic, C-1027; Sugimoto Y et al.; C-1027 is a new antitumor protein antibiotic containing a non-protein chromophore . The active moiety and the mechanism of action of this antibiotic were studied . C-1027 and its chromophore inhibited the growth of KB carcinoma and L1210 leukemia cells, even at extremely low concentrations . C-1027 inhibited DNA synthesis of L1210 cells and cleaved cellular DNA in a drug concentration-dependent manner . C-1027 and chromophore caused directly DNA single strand breaks in the purified DNA without any supplement of reducing agents . These results suggest that C-1027 chromophore may inhibit cell growth by causing DNA breakage with subsequent inhibition of DNA synthesis.

N Z Dent J, 1990 Apr, 86(384), 44 - 7
Antibiotics revisited; Barclay JK; The choice of an antibiotic for the management of an acute dental infection should be made from a relatively small range of agents . There is little evidence for prescribing the newer, more expensive, wide-spectrum, antibiotics . Failure to respond to therapy is usually due to inadequacy of dose, or failure to eliminate aggravating factors . The temptation to use antibiotics for the management of trivial infections should be resisted, and such problems managed by careful attention to first principles . The prophylactic use of antibiotics is less clear cut . Guidelines have been produced by expert committees that cover some situations, but such guidelines cannot be all-embracing . By weighing individual factors, the dentist should be able to reach a decision as to when antibiotic cover is indicated . This can only be done by maintaining contact with the literature in order to note changing recommendations, and drawing conclusions from conflicting opinions.

Genetika, 1990 Apr, 26(4), 636 - 47
{Determinants of resistance to chlortetracycline and other antibiotics in chlortetracycline-producing strain of Streptomyces aureofaciens}; Chinenova TA et al.; Data are presented on resistance of Streptomyces aureofaciens strain TB-633 FU--the producer of chlortetracycline (CTC) to autogenous antibiotics and a number of other antibiotics . It is demonstrated that resistance to CTC is specified by ctr genes of constitutive expression as well as by inducible genes . CTC and ethidium bromide may serve as efficient inductors of inducible ctr genes . The induction process is accompanied by increase in antibiotic biosynthesis level . Genes responsible for strain resistance to a number of macrolide antibiotics and thiostrepton are inducible and only function in the presence of appropriate antibiotics in the medium . The action of inducible mtr gene(s) is described in detail . The gene(s) simultaneously ensure increase in resistance to CTC and a number of macrolide antibiotics in the presence of exogenous inductors in media, such as both CTC and macrolide antibiotics . Mutants have been isolated which provide constitutive level of resistance to these antibiotics . A series of ctr and mtr mutants have increased CTC biosynthesis as compared to the initial level . Data on comparative analysis of the results obtained from hybridization of fragments of S . aureofaciens and S . rimosus DNAs to actI and actIII genes, responsible for polyketide synthases' synthesis, demonstrate that genes for CTC and OTC biosynthesis are situated on DNA fragments of similar size . This determines the strategy for cloning ctr and mtr genes as well as genes for CTC biosynthesis from S . aureofaciens.

Clin Orthop, 1990 Apr, (253), 173 - 8
Prophylaxis with systemic antibiotics versus gentamicin bone cement in total hip arthroplasty . A five-year survey of 1688 hips; Josefsson G et al.; In Sweden in 1976, nine orthopedic departments organized a prospective, randomized, and controlled study in which the prophylactic effect of systemic antibiotics (SA) was compared to gentamicin bone cement (GBC) in 1688 consecutive total hip arthroplasties (THAs) . After a follow-up period of one to two years, there was a statistically significant difference in the infection rate between the two groups in favor of the gentamicin cement . After five years or more, the difference was unaltered . Altogether, 16 deep infections had occurred in the SA group (1.9%) and seven (0.8%) in the GBC group . Roentgenographically, aseptic loosening had occurred in 29% and 24% of the hips in the SA and GBC groups, respectively, which suggests that admixture of the antibiotic did not weaken the cement . The results of this five-year review clearly showed the prophylactic value of gentamicin cement against deep infection after THA but did not support the hypothesis that this effect was prolonged over one year.

J Hosp Infect, 1990 Apr, 15 Suppl A, 41 - 8
Current issues in the antibiotic primary management of the febrile neutropenic cancer patient: a perspective from the National Cancer Institute; Pizzo PA; In summary, the overall approach to the treatment of neutropenic cancer patients is to bridge the neutropenic gap . Empirical therapy serves as an important pillar of support, and a rational programme for modifications of the initial therapy, according to the evolving clinical course of the patient, forms another pillar in bridging this gap (Pizzo & Meyers, 1989) . The incorporation of biologicals that might shorten the duration of neutropenia could potentially lead to greater improvements in outcome and greater success for therapy for the febrile neutropenic cancer patient.

Agric Biol Chem, 1990 Apr, 54(4), 1007 - 11
A new depsipeptide antibiotic, citropeptin; Hayakawa Y et al.; An actinomycete identified as Streptomyces flavidovirens was found to produce a new cyclic hexadepsipeptide antibiotic, designated citropeptin . Citropeptin showed antitumor activity against P388 murine leukemia.

Appl Microbiol Biotechnol, 1990 Apr, 33(1), 78 - 80
Effect of phosphate on antibiotic and extracellular protein production by Myxococcus coralloides D; Gonzalez F et al.; The effect of inorganic phosphate concentrations on antibiotic and extracellular protein production by Myxococcus coralloides D have been examined . Antibiotic production by growing cells of this myxobacterium was maximal at phosphate concentrations of 10-20 mM, but was inhibited by concentrations higher than 20 mM . The total extracellular protein and the extracellular protein per cell ratio were independent of phosphate levels in the culture broth.

Schweiz Rundsch Med Prax, 1990 Mar 27, 79(13), 387 - 8
{ERCP under ceftriaxone antibiotic cover in patients with obstructive jaundice}; Werth B et al.; The risk of cholangitis after ERCP has been reported to occur in up to 50% of patients with obstructive jaundice . Prophylactic antibiotics have therefore been advocated to reduce the risk . Here we report on the results of 46 patients with obstructive jaundice who were given 1 g of Ceftriaxone i.v . 30 to 60 min . prior to the procedure . Only one patient developed cholangitis with septicemia, which was treated conservatively . No side effects were observed in this group of patients . It is suggested that Ceftriaxone is an adequate prophylactic method to prevent cholangitis and septicemia in patients with obstructive jaundice.

Cas Lek Cesk, 1990 Mar 23, 129(12), 366 - 8
{Transfer of resistance to the newer beta-lactam antibiotics in Czechoslovakia}; Antal M et al.; Transmitted resistance to recent cephalosporin antibiotics of the third generation was first proved in 1983 by the authors . Approximately five years later the authors revealed during systematic monitoring of bacterial strains resistant to cephtazidime, cephtriaxone and cephotaxim also transmitted resistance to these and other more recent beta-lactam antibiotics in Czechoslovakia . The authors advocate rational use of new cephalosporins and other beta-lactams (e . g . aztreonam) as reserve antibiotics.

Biochim Biophys Acta, 1990 Mar 9, 1051(3), 285 - 92
Early membrane potential and cytoplasmic calcium changes during mitogenic stimulation of WEHI 231 cell line by polyene antibiotics, lipopolysaccharide and anti-immunoglobulin; Henry-Toulme N et al.; Changes in free cytosolic calcium concentration and in membrane voltage are thought to be important initiating events in lymphocyte activation . The antifungal agent amphotericin B (AmB) holds interesting immunomodulating properties and its N-thiopropionyl derivative (AmBSH) is a potent polyclonal B-cell activator . These molecules may then exert their stimulating activity through the production of early ionic signals similar to those delivered by the classical activators lipopolysaccharide (LPS) and anti-immunoglobulin (anti-Ig) . We addressed this question in a B-cell line (WEHI 231) which has previously been shown to exhibit characteristic response to LPS and anti-Ig . AmBSH protected these cells against anti-Ig-induced cell growth inhibition, providing a LPS-like response . In contrast, the parental compound AmB did not . The two polyene antibiotics did not modify the resting Ca2+i level of the cells, neither did LPS, whereas anti-Ig induced a rapid increase in the cytosolic calcium concentration . On the other hand, polyene antibiotics and LPS promoted membrane depolarization, whereas membrane voltage remained unchanged after anti-Ig treatment . Polyene antibiotics-induced depolarization originated from the increase of membrane permeability to Na+ ions and occurred independently of Ca2+i changes . The relationship between membrane potential and Ca2+i changes in lymphocyte activation are discussed on the basis of these results . Our conclusion was that constitutive Ca2+(-)dependent K+ channels are absent in the WEHI 231 cell line.

J Bacteriol, 1990 Mar, 172(3), 1361 - 7
Cir and Fiu proteins in the outer membrane of Escherichia coli catalyze transport of monomeric catechols: study with beta-lactam antibiotics containing catechol and analogous groups; Nikaido H et al.; Recently, beta-lactam agents containing iron-chelating moieties, such as E0702, which contains catechol, and pirazmonam and U-78,608, which contain 3-hydroxypyridone, have been developed . By determining the susceptibility to these agents of Escherichia coli mutants lacking various iron-repressible outer membrane proteins, we showed that two of these proteins with hitherto unknown functions, Fiu and Cir, were apparently involved in the transport of monomeric catechol and its analogs . These results confirm the conclusion of Curtis and co-workers, which was obtained by using a different set of catechol-containing antibiotics (N . A . C . Curtis, R . L . Eisenstadt, S . J . East, R . J . Cornford, L . A . Walker, and A . J . White, Antimicrob . Agents Chemother . 32:1879-1886, 1988) . E0702 was shown to enhance the uptake of radioactive ferric iron into wild-type cells but not into cir fiu double mutants . By combining the influx of E0702 with its hydrolysis by a periplasmic beta-lactamase, we showed that the wild-type cells transported unliganded E0702 at a rate comparable to or even higher than the rate of transport of the E0702-Fe3+ complex . We postulate that the main function of Cir and Fiu may be to recapture the hydrolytic products of enterobactin, such as 2,3-dihydroxybenzoic acid and 2,3-dihydroxybenzoylserine.

Gac Med Mex, 1990 Mar-Apr, 126(2), 102 - 7
{Antibiotic therapy in post-cesarean endomyometritis . Comparison of ampicillin-gentamicin and ampicillin-metronidazole regimens}; Walss-Rodriguez R et al.; Two therapeutic combinations for the treatment of post-cesarean endomyometritis are compared: A, ampicillin plus gentamycin; B, penicillin plus metronidazole, in 40 patients . There were no failures with any of the combinations . However, hospital stay and the time elapsed for resuturing a dehiscent surgical wound, as well as the average cost of treatment, were significantly less for combination B.

J Med Assoc Thai, 1990 Mar, 73(3), 168 - 74
Antibiotic use at a university hospital . Antibiotic Working Group of Srinagarind Hospital; Udomthavornsuk B et al.; A prospective survey of antibiotic use in 5 departments (MED, SURG, OB-GYN, PED, ORTHO) in Srinagarind Hospital was done during May 1988 . The majority of prescribers were interns and residents, except in the department of OB-GYN . Out of 400 prescriptions, 52.3 per cent were inappropriate and 5 per cent were inappropriate for economic reasons . For empirical use, the inappropriateness was 42.3 per cent mostly due to no indication of use . For surgical prophylaxis, 82.4 per cent were inappropriate mostly due to delayed prophylaxis and excessive length of treatment of more than 72 hours . For the treatment of documented infection, 39.6 per cent were inappropriate, mostly due to wrong choice and too many drugs used . There were no statistical differences in mortality, total hospital stay, hospital stay after treatment between the appropriate and inappropriate use.

Curr Eye Res, 1990 Mar, 9(3), 277 - 85
Corneal epithelial wound healing: a tissue culture assay on the effect of antibiotics; Nelson JD et al.; The effects of gentamicin, tobramycin and the fluorquinolone, ofloxacin on corneal epithelial wound healing were determined using an in vitro model of wound healing . Wounds were created in rabbit corneal epithelial cultures which were then exposed to various concentrations of the antibiotics . Effects on wound healing were measured by comparing migration rates between 6 and 18 hours and wound areas at various antibiotic concentrations over 36 hours . Gentamicin at concentrations of 0.5, 1.0, 1.5 and 2.0 mg/ml was found to statistically significantly effect wound healing compared to controls . Tobramycin on the other hand was found to have minimal effect on wound healing up to 2.0 mg/ml . Ofloxacin at concentrations greater than or equal to 0.05 mg/ml had statistically significant effects on wound-healing.

J Laryngol Otol, 1990 Mar, 104(3), 225 - 8
Prophylactic antibiotics and post laryngectomy pharyngocutaneous fistulae; Violaris N et al.; Pharyngo-cutaneous fistula following laryngectomy is a serious complication . The incidence worldwide varies from 7.6 to 50 per cent . The value of prophylactic antibiotics in preventing fistulae is well recognized but the type of antibiotics and the length of administration of the antibiotics is variable depending on the individual surgeon . Below we present the Plymouth Head and Neck Unit experience where, in the last five years, 33 patients underwent laryngectomy (30 total, three vertical hemi-laryngectomies) . The prophylactic antibiotics used in all patients was parenteral cefotaxime 1G or cefuroxime 750 mg, given at eight hours pre-operatively, with the premedication and at eight, 16 and 24 hours post-operatively . Only two patients developed pharyngo-cutaneous fistulae, both after total laryngectomy (six per cent of total) . Three patients developed skin cellulitis and five patients developed chest infection which required further treatment with antibiotics.

J Antimicrob Chemother, 1990 Mar, 25(3), 449 - 53
A prospective study of neutropenia induced by high doses of beta-lactam antibiotics; Olaison L et al.; A prospective study on the effect of beta-lactam antibiotics on granulopoiesis was carried out in 29 consecutive patients with bacterial endocarditis . Fourteen patients received a high dose of benzylpenicillin, up to 18 g/day, but in only three of them could the treatment be fulfilled as planned, for a mean time of 25 days . In 11 benzylpenicillin treated patients treatment had to be discontinued because of fever, rash or neutropenia . Neutropenia appeared in seven patients after 14-24 (mean 22) days . No superinfection occurred during the neutropenic phase which lasted 2-12 days . Patients with neutropenia differed significantly from others in having a lowered pretreatment neutrophil count (3.2 vs 10.4) . In 15 patients treated with other beta-lactams, three cases of fever and rash and one case of neutropenia were seen in patients treated with cloxacillin 12 g daily . It was concluded that a daily dose of 18 g of benzylpenicillin is too high for longer treatment periods and that patients with initial low counts of neutrophils have an increased risk of developing neutropenia.

Neurosurgery, 1990 Mar, 26(3), 537 - 9
Resolution of a recurrent/residual bacterial aneurysm during antibiotic therapy; Meyer YJ et al.; Management of patients harboring infectious intracranial aneurysms remains controversial because of the technical problems associated with the obliteration of these lesions as well as their frequent regression during antibiotic therapy . A case of a ruptured bacterial aneurysm of the distal middle cerebral artery in which a segment of the artery was found to be inflamed and necrotic is presented . The ruptured portion of the sac was clipped, leaving a small tag of aneurysmal tissue . Five days later, this tag was found to have expanded into a second aneurysm . This second lesion resolved with antibiotic therapy . Because of the responsiveness of infected cerebral arteries to the appropriate antibiotics, a less than radical surgical tactic may be a successful alternative to excision of the diseased arterial segment followed by distal revascularization in treating these lesions.

South Med J, 1990 Mar, 83(3), 274 - 6
Antibiotic prophylactic uterine lavage in cesarean section: a double-blind comparison of saline, ticarcillin, and cefoxitin irrigation in indigent patients; Lewis DF et al.; The purpose of this present study was to determine whether intraoperative antibiotic uterine irrigation was effective in reducing febrile morbidity (Part 1), and to determine whether ticarcillin disodium (Ticar) or cefoxitin sodium (Mefoxin) was the more effective solution (Part 2) . The indications for cesarean section had an effect on febrile morbidity . In patients having nonelective cesarean section, febrile morbidity was high, occurring in 62.7% of the saline control group and 32.9% of those receiving ticarcillin disodium irrigation . In patients having elective cesarean section, febrile morbidity was lower (28% in the saline control group and 8.3% in the ticarcillin group {P less than or equal to .05}) . Ticarcillin and cefoxitin were equal in reducing postoperative febrile morbidity . The use of prophylactic antibiotics, therefore, is indicated both in high-risk patients having nonelective cesarean section and in low-risk patients having elective repeat cesarean section.

Biochem Pharmacol, 1990 Mar 1, 39(5), 891 - 4
Activation of calcium uptake in rat liver mitochondria by aminoglucoside antibiotics; Kroner H; Ca uptake in rat liver mitochondria is accelerated by various aminoglucoside antibiotics and, to a lesser degree, by triethylenetetramine and by protamine . With 1 mM Mg2+ and at a concentration of Ca2+ = 2 microM maximal (about six-fold) activation is achieved with 20 microM neomycin; at higher concentrations of the antibiotic the velocity of Ca uptake decreases . Activation to the same degree by gentamicin, kanamycin or streptomycin requires higher concentrations of the antibiotics . The reason for the acceleration of Ca uptake by neomycin is an allosteric alteration of the kinetics corresponding to that previously observed in the presence of spermine . The conformity with effects of spermine and possible inferences of that conformity are discussed.

Antibiot Khimioter, 1990 Mar, 35(3), 7 - 10
{Study of the conditions for reproducing the processes of antibiotic biosynthesis . Calculating the process of sisomycin biosynthesis}; Kuz'mina LM et al.; Conditions were experimentally studied for reproducing sisomicin biosynthesis by up-to-down scaling . It was shown that respiration intensity as a parameter of antibiotic biosynthesis scaling-down had certain limitations connected with multistage oxygen mass transfer . The parameter could be used only when the limiting stages of oxygen mass transfer coincided . It was confirmed experimentally that it was possible to apply the previously proposed theoretical method to estimation of the limiting stage of oxygen mass transfer.

Genetika, 1990 Mar, 26(3), 443 - 7
{The effect of small concentrations of antibiotics blocking the synthesis of bacterial cell wall on the permeability of Escherichia coli cell wall for plasmid DNA}; Turkov MI et al.; Short treatment of Escherichia coli cells with antibiotics disturbing synthesis of bacterial cell wall in small concentrations renders the cells capable of absorbing foreign plasmid DNA . A novel express-method for transformation of E . coli cells by plasmid DNA has been developed on the basis of the results obtained . The whole procedure can be performed at room temperature . Depending on cell strain and the plasmid size, the efficiency of transformation can vary from 1.10(4) to 5.10(5) transformants per 1 mkg of DNA . The method suggested improves significantly the every-day work aimed at constructing plasmids.

Laryngorhinootologie, 1990 Mar, 69(3), 158 - 60
{Perioperative short-term preventive antibiotics in head-neck surgery}; Mann W et al.; A prospective perioperative trial with cefotiam and metronidazol was carried out in 114 patients undergoing head and neck surgery . The patients were stratified in one group receiving a single-dose prophylaxis and a second group receiving a 24-hour prophylaxis . The postoperative complication rates were analysed depending on various risk factors and the size and duration of surgery . For operations of similar size the long term prophylaxis had no advantage over the one-dose prophylaxis . It is concluded that a one-dose prophylaxis appears sufficient in major head and neck cases.

Rev Infect Dis, 1990 Mar-Apr, 12(2), 236 - 49
Adverse antibiotic effects associated with renal insufficiency; Manian FA et al.; We review the English-language literature on antibiotic-associated adverse reactions in patients with renal insufficiency in order to highlight this important but often overlooked clinical problem . Because many adverse reactions to antibiotics are not dependent on renal function, we have attempted to review only those reactions that are believed to be associated with renal insufficiency or that have been reported in patients with impaired renal function . Adverse effects of antibiotics in this setting can be divided into six major categories: neurologic toxicity, coagulopathy, nephrotoxicity, hypoglycemia, hematologic toxicity, and aminoglycoside inactivation by penicillins . Neurologic toxicity can be further divided into central nervous system toxicity consisting primarily of encephalopathy and seizures, ototoxicity, peripheral neuropathy, and neuromuscular blockade/respiratory depression . We explore the factors in uremia that may contribute to the susceptibility of patients with renal insufficiency to the adverse effects of antibiotics . Moreover, we make general recommendations regarding the use of the discussed antibiotics in patients with compromised renal function.

Nutr Hosp, 1990 Mar-Apr, 5(2), 77 - 84
{Pharmacokinetics of antibiotics in malnutrition}; Idoipe Tomas A; Human malnutrition is a complex, multirelated problem . Malnutrition and drug kinetics interaction was never studied in depth, despite the fact that as with antibiotics, medication is more often administered to malnourished than normonourished individuals, because of a higher rate of infection among members of the former group . We have studied the physiological changes resulting from malnutrition, and possible variations such state may have on absorption, distribution, protein binding capacity, drug metabolism and excretion processes in the body, in relation to possible dosage changes . Further studies are required on the effects of malnutrition on drug pharmacokinetics, especially in relation to antibiotics . Such assessment must be performed on different population subsets and under different environmental conditions, so as to obtain improved knowledge on each drug's clinical pharmacokinetics, that coupled with a more sensible way of handling plasma levels and careful patient clinical evaluation will lead to more rational therapy.

Hum Cell, 1990 Mar, 3(1), 37 - 44
{Elimination of mycoplasmas from cultured human cell lines utilizing a combination of two antibiotics, quinolone and a pleuromutilin derivative}; Mikamo S et al.; Forty three cultured human cell lines were treated with a combination of 2 antibiotics to eliminate contaminant mycoplasmas . One course of treatment was composed of consecutive 3 or 4 cycles . Each cycle grew cells in BM-1 (pleuromutilin derivative; Boehringer Mannheim) containing medium (10 micrograms BM-1/ml culture) for 3 days, alternating with MC-210 (quinolone; Dainihon Pharmaceutical) containing medium (0.625 micrograms MC-210/ml culture) for 4 days . No treatment failure was encountered with this procedure . Before treatments, 18 (90%) of 20 cell line samples were contaminated with mycoplasma, as tested by DNA hybridization method (MYCOPLASMA T.C . RAPID DETECTION SYSTEM; Gen-Probe Inc.) . Out of 43 cell lines treated, 7 were reduced in growth and dropped out . Among the other 36 cell lines, 27 became negative, 5 borderline and 4 slightly positive to the mycoplasma detection . All of the latter 9 cell lines, treated with one more similar course, found to be free from mycoplasma . Six of the dropout lines were cured of mycoplasma by a second treatment, under modified culture conditions . The last cell line (NATO) was successfully treated with another lot of FCS . Thus, the procedure proved successful even in treating promiscuously infected cell lines.

Agric Biol Chem, 1990 Mar, 54(3), 657 - 62
Stereoselective synthesis of marine antibiotic (-)-malyngolide and its stereoisomers; Ichimoto I et al.; A convenient synthetic method for the marine antibiotic (-)-malyngolide and its stereoisomers was accomplished from a chiral alpha-alkoxyketone (4), which was readily available as a chiron . Chiral quaternary carbon synthons (5a) and (5b) as the key intermediates were constructed by the chelation controlled addition of Grignard reagent to 4 . The diastereomeric mixture of 5a and 5b was readily transformed into a separable mixture of lactones (7a) and (7b), each of which could be easily separated by silica-gel column chromatography . (-)-Malyngolide and its three stereoisomers were obtained in optically pure form without the need for optical resolution.

Schweiz Med Wochenschr, 1990 Feb 17, 120(7), 209 - 16
{Antibiotic therapy of Lyme borreliosis}; Satz N et al.; There are still no definite patterns for antibiotic therapy of Lyme borreliosis . Recent studies have shown that ceftriaxone or tetracyclines are superior to the conventional penicillin . Against erythema chronica migrans (stage I) oral therapy, preferably with tetracycline, is sufficient . In cases with stage II symptoms, such as arthritis or neurological affections, high dose parenteral treatment, preferably with ceftriaxone, is recommended, although its effect on the neurologic symptoms is not yet proven . Carditis also calls for high dose parenteral administration of antibiotics, even though there are no published studies on this treatment as yet . Opinion is divided on the cutaneous symptoms such as acrodermatitis chronica atrophicans, morphea, lichen sclerosus et atrophicus (acute inflammatory stage) and lymphadenitis cutis benigna . Even if oral penicillin or tetracycline can cure existing symptoms, in the absence of longterm observations, it remains an open question whether oral treatment can prevent further complications or evolution to chronicity (stage III) . For these clinical pictures there is also a tendency to give high dose parenteral antibiotics, and ceftriaxone is likely to win favour . In stage II Lyme borreliosis, autoimmune processes occur which scarcely respond to antibiotics any longer . Nevertheless, parenteral administration of high dose antibiotics remains sensible as a means of eradicating pathogens from the tissues, CSF or synovial fluids, and to avoid further complications . Evaluation of the therapeutic effects of corticosteroids or other immunosuppressive agents would require prospective studies.

FEBS Lett, 1990 Feb 12, 261(1), 106 - 8
Allicin, a naturally occurring antibiotic from garlic, specifically inhibits acetyl-CoA synthetase; Focke M et al.; Allicin is shown to be a specific inhibitor of the acetyl-CoA synthetases from plants, yeast and mammals . The bacterial acetyl-CoA-forming system, consisting of acetate kinase and phosphotransacetylase, was inhibited too . Non-specific interaction with sulfhydryl-groups could be excluded in experiments with dithioerythritol and p-hydroxymercuribenzoate . Binding of allicin to the enzyme is non-covalent and reversible . {14C}-Acetate incorporation into fatty acids of isolated plastids was inhibited by allicin with an I50-value lower than 10 microM . Other enzymes of the fatty acid synthesis sequence were not affected, as was shown using precursors other than acetate.

J Biol Chem, 1990 Feb 5, 265(4), 2156 - 61
Chromophore activating enzyme involved in the biosynthesis of the mikamycin B antibiotic etamycin from Streptomyces griseoviridus; Schlumbohm W et al.; A 3-hydroxypicolinic acid activating enzyme from etamycin producing Streptomyces griseoviridus has been purified to apparent homogeneity . Etamycin is a member of mikamycin B antibiotics, chromopeptide lactones, which contain 3-hydroxypicolinic acid (3-HPA) as the chromophoric group . The enzyme catalyzes both the 3-HPA-dependent ATP-pyrophosphate exchange and the formation of 3-HPA adenylate from 3-HPA and ATP . SDS-polyacrylamide gel electrophoresis indicates that the enzyme is a single polypeptide chain with a Mr between 56,000 and 58,000 . The molecular mass of the native enzyme was in the same range . In addition to 3-HPA, the enzyme catalyzes the formation of adenylates from picolinic acid, nicotinic acid, and 2-pyrazinecarboxylic acid . Nicotinic acid and picolinic acid when added externally to etamycin producing S . griseoviridus cultures gave rise to the formation of etamycin analogues each containing nicotinic acid or picolinic acid instead of the genuine 3-HPA . The data strongly suggest that the enzyme is involved in the biosynthesis of the chromopeptide lactone etamycin and possibly in that of other mikamycin B antibiotics.

Nippon Ganka Gakkai Zasshi, 1990 Feb, 94(2), 219 - 23
{Penetration of antibiotics into the vitreous humor in man}; Tamai M et al.; Using newly invented method for collecting vitreous samples, we examined the permeability of antibiotics across the blood-ocular barrior in human eyes . One of the advantages of the present method is that it yields sufficient amounts of sample . This makes it possible to examine and compare the permeability of multiple drugs with the same sample . We studied two antibiotics, Flomoxef Sodium (FMOX) and Cefamandole Sodium (CMD) with proliferative vitreoretinopathy (8 cases), proliferative diabetica retinopathy (8 cases) and simple vitreous haemorrhage (9 cases: including 3 cases of Terson's syndrome) . A considerable amount of FMOX was detected in the vitreous sample and the permeability of FMOX was 50% better than that of CMD . Permeability also differed recording of different ocular diseases . The amount of the drug was lowest in cases with simple vitreous hemorrhage, especially in Terson's syndrome (p less than 0.05) . This is reasonable as the blood-ocular barrior must be less disturbed in this disease than the other two conditions.

Antibiot Khimioter, 1990 Feb, 35(2), 5 - 8
{Structure of surgumycin, a carbonyl-conjugated pentaenic antibiotic}; Shenin IuD; Degradation products of surgumycin, a pentaenic antibiotic, were investigated . Oxidation of perhydroantibiotic resulted in formation of brassilic acid . Ozonolysis of the antibiotic was followed by either complete reduction of the ozonolysis products and identification of the resultant hydrocarbon or oxidation by the glycol system and identification of the resultant polyols . The structure of the products of the antibiotic successive reduction was also studied . On the basis of the studies, the structure of 28-hydro-23-dehydroxy-24,29-dihydroxyflavofungin was assigned to surgumycin.

Klin Med (Mosk), 1990 Feb, 68(2), 88 - 91
{Treatment of patients with acute lung abscesses by intrapulmonary injections of antibiotics and endobronchial administration of autologous macrophages}; Provotorov VM et al.; The stay in hospital was compared for patients with acute abscesses of the lungs treated according to the standard scheme and a new method of intrapulmonary antibiotic injections and endobronchial administration of actologous macrophages . The proposed treatment proved more efficient, as it resulted in a 12.1 +/- 0.3 day decrease in the duration of hospital stay versus control group on conventional regime.

Nippon Hinyokika Gakkai Zasshi, 1990 Feb, 81(2), 282 - 8
{Basic study of nephrotoxicity of antibiotics . II . Studies of the effect of antibiotics on lysosomal stability in rat kidneys}; Saito S et al.; In order to assess the potential nephrotoxicity of antibiotics, effects of these agents on rat kidney lysosomal membrane were investigated in various conditions . Antibiotics were given to Wistar rats for 5 successive days . After nephrectomy rat lysosomes were separated and their membrane stability was examined by measuring the activities of acid-phosphatase . In addition, after separation of lysosomes from normal untreated Wistar rats, antibiotics were added in the incubation system to assess the in vitro effect of antibiotics . Effects of renal ischemia and the lysosomal membrane stabilizer (cortisol) were also examined . Aminoglycosides antibiotics (streptomycin, kanamycin, gentamycin), doxytetracycline, chloramphenicol, and cephems (cephalothin, cephaloridine, ceftezol, latamoxef) were used for this purpose . It was clearly pointed out that aminoglycosides interfered with the lysosomal stability in vivo and in vitro . After a 60 minutes ischemia of the rat kidneys by clamping the renal arteries, effects of antibiotics on administration of 5 successive days on rat lysosomal stability were investigated . It was demonstrated that aminoglycosides also made the lysosomal membrane more unstable . Effects of the lysosomal stabilizer, cortisol, on rat kidney lysosomes were examined . Use of cortisol simultaneously with an antibiotic was more effective than that before and after it.

J Antibiot (Tokyo), 1990 Feb, 43(2), 207 - 12
Antibiotics from basidiomycetes . XXXII . Strobilurin E: a new cytostatic and antifungal (E)-beta-methoxyacrylate antibiotic from Crepidotus fulvotomentosus Peck; Weber W et al.; Strobilurin E is a novel antibiotic of the (E)-beta-methoxyacrylate (MOA) class produced by mycelial cultures of the agaric Crepidotus fulvotomentosus . In addition to an inhibition of fungal respiration, a feature of all MOA-antibiotics, the compound exhibits very high cytostatic activities which are accompanied by reversible morphological alterations of the cells.

J Antibiot (Tokyo), 1990 Feb, 43(2), 135 - 7
Resorthiomycin, a novel antitumor antibiotic . II . Physico-chemical properties and structure elucidation; Tahara M et al.; Resorthiomycin was revealed to be a new antibiotic with a molecular weight of 284 and a chemical formula of C14H20O4S as determined by MS and elemental analysis . The structure of resorthiomycin was determined to be 6-acetyl-4-(3-hydroxybutyl)-2-methyl-5-methylthioresorcinol by IR spectrum and 1H and 13C NMR.

DICP, 1990 Feb, 24(2), 202 - 5
A team approach to reduce antibiotic costs; Karki SD et al.; After partial success in reducing antibiotic drug costs by traditional methods (i.e., closed formulary, use of generic drugs, retrospective drug usage review, continuing education), a study of a new "team approach" was implemented . The study involved a clinical pharmacist and physicians working together to select the most appropriate antibiotic therapy . The clinical pharmacist reviewed the culture and sensitivity data and the pattern of infectious disease over the six-month period prior to the initiation of the study and prepared a list of the most appropriate antibiotics based on clinical efficacy and cost effectiveness . He then joined the physicians on morning rounds to monitor therapy and help in the selection of the most appropriate drug regimen . At the end of the study period, antibiotic cost savings of 58.6 percent were achieved.

Kansenshogaku Zasshi, 1990 Feb, 64(2), 149 - 61
{Therapeutic evaluation of combination therapy using C-425 and antibiotics in severe bacterial infections--a double blind group comparative study . The C-425 Research Group for Infectious Comparative Study}; Katayama N et al.; Clinical usefulness of C-425, a native human immunoglobulin liquid preparation for intravenous injection, was studied in combination with antibiotics in severe bacterial infections in a double blind group comparison using an alkylated human immunoglobulin liquid preparation (Polyglobin, A.gamma G) as a reference drug . The following results were obtained: 1 . C-425 or A.gamma G was administered to a total of 117 patients, of whom 89 patients, 45 in C-425 group and 44 in A.gamma G group, were included in the present analysis of efficacy and usefulness . Analysis of safety of the drugs included a total of 113 patients, 58 in C-425 group and 55 in A.gamma G group . 2 . Efficacy and usefulness were graded according to a visual analog scale (VAS) . 3 . Mean efficacy values with standard deviations of VAS value were calculated at 52.0 +/- 34.9 for the C-425 group, and 47.2 +/- 34.8 for the A.gamma G group . The respective medians were 59.0 and 61.0 . The Mann-Whitney U-test revealed no significant differences between the two groups . When those with VAS values of 50 or above were regarded as cases of effective treatment, the efficacy rates of the two groups were also practically comparable . 4 . Side effects were not observed in either drug group . 5 . Mean usefulness values with standard deviations were 52.3 +/- 34.9 for the C-425 group, and 47.9 +/- 35.0 for the A.gamma G group . The respective medians were 60.0 and 61.0 . The Mann-Whitney U-test revealed no significant differences between the two groups . When the cases with VAS values of 50 or above were regarded as cases of useful treatment, there were no significant differences in the utility rates between the two groups . From these results, C-425 was considered to be useful for treating severe bacterial infections when used combined with antibiotics.

Aust Fam Physician, 1990 Feb, 19(2), 224 - 7, 230-4
Adverse effects of antibiotics in a general practice . The relative risk of co-trimoxazole; Bridges-Webb C et al.; A retrospective study in a general practice suggests that the pattern of prescribing of co-trimoxazole in relation to the age of patient and disease is different from that of other antibiotics . This precludes drawing conclusions about relative risks of side effects from the current system of notifications of adverse drug effects.

Ann Pediatr (Paris), 1990 Feb, 37(2), 127 - 30
{Acute otitis media in children: a randomized and open clinical trial of the efficacy of 2 major antibiotics (erythromycin ethylsuccinate/acetyl sulfafurazole vs amoxicillin/clavulanic acid)}; Begue P et al.; In a prospective randomized open study, 111 young children with otitis media were orally treated during 10 days with Pediazole (50 mg/kg/day in 3 divided doses) or amoxicillin + clavulanic acid (40 mg/kg/day in 3 or 4 divided doses) for efficacy and safety evaluation . 51 children wer assigned to amoxicillin + clavulanic acid (group I) and 60 to erythromycin-sulfisoxazole (group II) . Mean age was respectively 24.7 months in group I and 23.4 months in group II . Results of efficacy evaluation were as follows: (table; see text) there was no statistically significant difference between the two treatment groups for efficacy . Overall safety was good . The treatment was discontinued only in four cases (3 in the amoxicillin + clavulanic acid group and 1 in the EES-sulfisoxazole group) . In conclusion, Erythromycin sulfisoxazole combination (Pediazole) fits in with current epidemiological profile of Acute Otitis Media and represents a therapy of choice in this indication.

Cell Struct Funct, 1990 Feb, 15(1), 53 - 8
Dual inhibitory effects of the peptide antibiotics leucinostatins on oxidative phosphorylation in mitochondria; Shima A et al.; The effects of the hydrophobic peptide antibiotics leucinostatins A and B, originally isolated by Arai, T., Y . Mikami, K . Fukushima, T . Utsumi, and K . Yazawa . (J . Antibiotics (1973) 26: 157-161), on the functions of rat liver mitochondria were examined . At a concentration of 240 nM, these compounds completely inhibited state 3 respiration and ATPase activity that was stimulated by weakly acidic uncouplers . However, at higher concentrations, they induced uncoupling, probably by their protonophoric action . The uncoupling action was potentiated by known phosphoryl transfer inhibitors such as venturicidin, DCCD and oligomycin . The binding site of leucinostatins at lower concentrations was suggested to be located at, or very close to that of venturicidin . The potencies of the two analogues of leucinostatin were almost the same for all their actions . Their effects were very similar to those of the peptide antibiotics A20668's, which have been used as leucinostatins without any chemical and biological confirmation that they are in fact leucinostatins . Thus, the chemical structures of leucinostatins are thought to be analogues to those of the A20668's.

Antibiot Khimioter, 1990 Feb, 35(2), 3 - 5
{Isolation of Actinomycetales from the soil of Kazakhstan on selective media with antibiotics}; Vetlugina LA et al.; About 3000 actinomycetes were isolated from various soil samples collected in 11 regions of Kazakhstan . 62.7 per cent of them proved to be antagonists . For isolation of the strains, selective media supplemented with antibiotics were used . Kanamycin promoted growth of Actinomadura and Nocardia . Rubomycin promoted growth of Actinomadura . Tavromycetin and roseofungin were used as selective agents for the first time . Tavromycetin favoured isolation of Actinomadura and Nocardia . Roseofungin favoured isolation of Actinomadura . Light chestnut and serozemic soils were the most rich in antagonists (67.1 and 61.3 per cent, respectively) while saline and chestnut soils were the poorest in antagonists (32.2 and 30.6 per cent, respectively) . Actinomadura were more frequent in light-chestnut light-loamy and serozemic soils . Half of the antibiotics isolated in the form of concentrates were identified with the known antibiotics or classified as belonging to various groups . A culture producing a novel antibiotic was isolated.

Antimicrob Agents Chemother, 1990 Feb, 34(2), 332 - 6
Enhanced phagocytosis of encapsulated Escherichia coli strains after exposure to sub-MICs of antibiotics is correlated to changes of the bacterial cell surface; Raponi G et al.; The influence of five antibiotics (netilmicin, ceftriaxone, cefepime, fleroxacin, and ciprofloxacin) on capsular polysaccharide distribution and on opsonophagocytosis by human polymorphonuclear leukocytes of unencapsulated and encapsulated Escherichia coli strains was studied . Unencapsulated E . coli strains were readily opsonized in serum and easily ingested by polymorphonuclear leukocytes, and antibiotics did not further enhance the phagocytosis rates . In contrast, encapsulated bacteria were poorly opsonized in human serum, and phagocytosis was enhanced after overnight exposure to 0.5x the MICs of the antibiotics, with the exception of cefepime . Incubation of unencapsulated as well as encapsulated bacteria in complement-inactivated serum markedly reduced the bacterial uptake by polymorphonuclear leukocytes regardless of the presence of antibiotics . Slide agglutination assays, performed either with a monoclonal antibody for capsular polysaccharide or with an antiserum raised against the stable unencapsulated mutant E . coli O7:K-, showed reduction but not lack of the capsular polysaccharide of encapsulated E . coli O7:K1, and better exposure of subcapsular epitopes, after incubation with 0.5x the MICs of antibiotics . Flow cytometric analysis of encapsulated E . coli exposed to netilmicin, ciprofloxacin, and fleroxacin revealed that the reduction in capsular material was homogeneous among the bacterial population . Treatment with cefepime and ceftriaxone induced two populations of bacteria that differed in the amount of K antigen present . These results indicate that sub-MICs of netilmicin, ceftriaxone, fleroxacin, and ciprofloxacin influenced complement-mediated opsonization, probably due to changes in the capsular polysaccharide structure.

Aust Dent J, 1990 Feb, 35(1), 50 - 60
Antibiotics and endodontics; Abbott PV et al.; Antibiotics can be used as an adjunct to endodontic treatment in a number of ways--locally, systemically and prophylactically . The local or intra-canal use of antibiotics in the form of medicaments is common . However, the commercially available agents for this purpose may not be the ideal mixtures . Systemic antibiotics should be restricted to patients who have local signs of infection, malaise and elevated body temperature . Prophylactic use of antibiotics has been recommended for patients 'at risk' of infective endocarditis, in some pre-surgical situations and following avulsion and replantation of teeth . The tendency towards indiscriminate antibiotic use should be discouraged . The use of broad spectrum drugs should be restricted so that these medications remain effective in serious situations.

Nippon Hinyokika Gakkai Zasshi, 1990 Feb, 81(2), 275 - 81
{Basic study of nephrotoxicity of antibiotics . I . Studies of the effects of antibiotics on nucleic acids and protein metabolism in rat kidneys}; Saito S et al.; In order to evaluate the nephrotoxicity by antibiotics, effects of these agents were investigated in terms of protein synthesis and nucleic acid metabolism in the kidneys of Wistar rats . Aminoglycoside antibiotics (streptomycin, kanamycin, gentamycin), tetracycline (doxytetracycline), chloramphenicol, and cephems (cephalothin, cephaloridine, ceftezol, latamoxef) were used . These antibiotics were given to the rats for 5 successive days . On the 6th day 14C-6-orotic acid and 14C-1-leucine were administered intraperitoneally . Incorporation rates of these tracers into ribonucleic acid and protein fraction in rat kidney ribosomes (polysomes) were measured . Another experiment was undertaken in vitro by separating the polysome fraction from the rat kidneys . In vitro acellular protein synthesis using these polysomes was established . Effects of antibiotics on the incorporation rates of 14C-1-leucine were examined . Marked reduction of incorporation of these tracers into nucleic acid and protein in vivo and in vitro was induced by aminoglycoside antibiotics . These facts suggest that aminoglycoside antibiotics develop nephrotoxicity by interfering with the metabolism of ribosomal RNA and protein.

Biotechnology (N Y), 1990 Feb, 8(2), 115 - 21
The improving prospects for yield increase by genetic engineering in antibiotic-producing Streptomycetes; Chater KF; Molecular genetics has spawned a dramatic expansion of the biotechnology industry in the direction of the products of single genes . On the other hand, antibiotics--some of the classical products of biotechnology--result from the concerted action of many genes, and it is therefore less straightforward to apply the new techniques to antibiotic production . Studies of cloned genes for antibiotic biosynthesis are now providing information that should allow the application of a combination of traditional and recombinant DNA methodology to the improvement of yield in antibiotic-producing Streptomyces species.

Arch Surg, 1990 Jan, 125(1), 97 - 100
Oxygen as an antibiotic . The effect of inspired oxygen on bacterial clearance; Knighton DR et al.; Previous experimentation with the guinea pig skin injection model showed that altering the fraction of inspired oxygen had a significant effect on infectious necrosis . Using the same model, we performed quantitative bacterial cultures to determine the number of viable injected bacteria 24 and 48 hours after injection . Animals were randomized to receive 12%, 21%, and 45% inspired oxygen . A significant decrease in bacterial number was seen at 45% inspired oxygen between 24 and 48 hours, and a significant decrease occurred at 48 hours between 12% and 45% inspired oxygen . These results demonstrated a prominent role for oxygen in bacterial clearance and host defense.

Surg Gynecol Obstet, 1990 Jan, 170(1), 12 - 6
A prospective, randomized double-blind study of the use of antibiotics at the time of mastectomy; Wagman LD et al.; The ability of perioperative cefazolin to reduce the incidence of postoperative wound infection in patients undergoing ablative surgical treatment for carcinoma of the breast was tested in this prospective, randomized, double-blinded study . From May 1983 until December 1985, 118 women were divided into two groups at random . Group 1 consisted of 59 patients and received cefazolin and group 2 was made up of 59 patients who received a placebo . The groups were similar with respect to age, operative procedure, operative time and time to discharge after operation . Three infections occurred among those in group 1 and five among those in group 2 (p = 0.72) . The time to onset of infection was delayed in the patients in group 1 versus those in group 2 (17.7 days versus 9.6 days, p = 0.04) . Six of eight infections occurred in patients in whom an interval between biopsy and definitive surgical treatment was present . Prophylactic antibiotics in mammary operations did not reduce postoperative wound infections in this study.

Dev Pharmacol Ther, 1990, 14(4), 223 - 30
Comparison of the pharmacokinetics of five beta-lactam antibiotics between neonatal and adult rats; Morita E et al.; The pharmacokinetics of beta-lactam antibiotics in adult and neonatal rats were compared after their intravenous or oral administration . The distribution volumes of cefazolin, cefamandole and cefmetazole were larger for the neonatal than the adult rats, whereas the distribution volumes of cephradine and cephalexin were smaller for the neonates . Neonatal rats showed lower clearances than adults for all antibiotics tested . The maximum plasma concentrations (Cmax) after oral administration of cefazolin, cefamandole and cefmetazole were significantly higher (3-15 times) for neonatal than for adult rats . However, in the case of cephradine and cephalexin, the increase of Cmax for neonatal rats was small . The absolute bioavailabilities for cefazolin, cefamandole and cefmetazole were significantly larger in the neonates . Thus, cefazolin, cefamandole and cefmetazole, which were poorly absorbed by adults, were found to be easily absorbed by the intestines of neonatal rats.

Ann N Y Acad Sci, 1990, 590, 297 - 305
Unexpected antibiotic susceptibility of a chronic isolate of Coxiella burnetii; Yeaman MR et al.; Evidence is mounting in support of the idea that different isolates of Coxiella burnetii, the etiologic agent of Q fever, are responsible for the distinct disease syndromes observed clinically . Recent studies have shown distinct antibiotic susceptibilities of different isolates of C . burnetii implicated in distinct clinical Q fever syndromes . With this in mind, we performed antibiotic susceptibility testing of the "S" isolate, a chronic-type isolate retrieved from a human patient with chronic disease . Antibiotics with differing efficacies upon the Nine Mile and Priscilla isolates were tested for their abilities to control acute and persistent "S" isolate infection of L-929 cells in vitro . The efficacies of doxycycline, rifampin, and three fluoroquinolone drugs--ciprofloxacin, ofloxacin, and norfloxacin--were tested . Compared to the chronic Q fever-implicated Priscilla isolate, which has been shown to exhibit a significant resistance to these antibiotics, the "S" isolate was much more susceptible . In persistently infected cells (greater than 300 d), the "S" isolate proved to be significantly more resistant to doxycycline, slightly more resistant to ciprofloxacin, slightly more susceptible to rifampin, and equally sensitive to ofloxacin and norfloxacin compared to the acute Q fever-implicated Nine Mile isolate . As with both the Nine Mile and Priscilla isolates, the "S" isolate was more susceptible to doxycycline, rifampin, and ofloxacin in recently infected cells (22 d) compared to cells having been persistently infected . With respect to the resistant nature of the chronic Q fever-implicated Priscilla isolate, as well as the lack of success in treating the "S" isolate in vivo, these results were unexpected . Such data supports an evolving hypothesis that the distinct C . burnetii isolates which may be responsible for the clearly different Q fever syndromes exhibit a spectrum of antibiotic susceptibility ranging from very susceptible (acute-implicate), Nine Mile isolate), to moderately susceptible (chronic-implicated "S" isolate), to moderately resistant (chronic-implicated Priscilla isolate).

Infection, 1990, 18 Suppl 1, S14 - 8
Short-term parenteral antibiotics used as a supplement to SDD regimens; Alcock SR; This discussion has presented detailed data relating to the use of systemic agents (in particular, cefotaxime) as a supplement to selective decontamination of the digestive tract (SDD) during the first few days of an intensive care unit admission . It suggests that this practice is rational and that it is employed for two distinct reasons--treatment of infection already present or developing on admission, and prophylaxis of infection acquired on the unit during the early days of admission . It is also suggested that this use of a systemic agent is an important factor in the striking reduction in unit acquired infection ascribed to SDD regimens.

Ann Biol Clin (Paris), 1990, 48(5), 294 - 6
Value of a novel antibiotic association for the study of sperm motility in vitro; Le Faou A et al.; An association of mezlocillin and amikacin was compared to the commonly used penicillin and streptomycin for ridding of bacterial flora in 31 contaminated semen, when sperm motility after 24 hour incubation was checked . The former association proved efficient in 30 cases and the latter in only 19 . Thus the mezlocillin/amikacin association might be of interest when semen is manipulated.

Klin Khir, 1990, (3), 30 - 2
{Endolymphatic antibiotic therapy in the prevention and treatment of purulent-septic complications in vascular surgery}; Zatevakhin II et al.; With the aim of prophylaxis and treatment of purulent-septic complications, in 12 patients with IV stage chronic arterial insufficiency (group 1) before the operation, the direct endolymphatic antibioticotherapy (ELAT) was performed, in 13 patients with IIB-III stage of the disease (group 2) after the operation with the aim of treating purulent septic complications . The control group consisted of 10 patients with IV stage chronic arterial insufficiency . In group 1 patients, after the operation, there were no inflammatory changes in the wound, the wound healed by primary intention . In 7 control patients, the suppuration of inguinal wounds was noted . In group 2 patients, against the ELAT background, the regress of inflammation, reduction of the degree of bacterial contamination of the wounds, their cleaning and healing by secondary intention were noted.

Chem Biol Interact, 1990, 74(3), 315 - 24
A scanning calorimetric study of natural DNA and antitumoral anthracycline antibiotic-DNA complexes; Barcelo F et al.; Thermal denaturation of natural DNA in the absence and presence of antitumor anthracycline antibiotics has been studied by adiabatic differential scanning calorimetry . The helix-coil transition is operationally irreversible as measured by DSC . Both the melting temperature and the overall molar transition enthalpy of the DNA samples was dependent on the percentage of GC base pairs . Calorimetric traces of anthracycline-DNA complexes have qualitatively similar features and the significance of this characteristic is discussed . The unsaturated drug-DNA complex melts through complex thermal transitions with one broad endotherm in the same temperature region as free DNA and the other at a higher temperature which is rf (mol ligand per mol DNA in base pairs) value dependent . Antibiotic binding at concentrations close to saturating conditions (rf = 0.2) reverts the melting range to a value near to its original one and increases the thermal stability of the duplex structure by around 30 degrees C . In addition, the calorimetric enthalpy is increased by between 64% and 150%, depending on which ligand was used.

Ann Chir Main Memb Super, 1990, 9(1), 65 - 71
{Comparative study of the effects of a local antibiotic and a local antiseptic in emergency hand surgery}; Iselin F et al.; An open randomised comparative study was conducted in patients presenting with a hand injury requiring a surgical operation, in order to compare the efficacy of topical application of rifamycin SV with that of iodinated polyvidone dermal solution, in terms of the quality and rate of healing evaluated by the clinician, 268 patients were included in the study and 223 of them participated in the analysis of the results . Analysis of the results demonstrated the following conclusions: signs of infection developed in 8 patients in the rifamycin SV group (7%) and in 20 patients in the iodinated polyvidone group (18.5%) . This difference was significant (p = 0.011) in favour of rifamycin SV . The rate of healing was considered to be rapid in 10% of patients in the rifamycin SV group and in 4% of patients in the iodinated polyvidone group . It was considered to be slow in 14% of the subjects in the rifamycin SV group and in 21% of those in the iodinated polyvidone group . This difference was also significant in favour of the rifamycin SV group (p = 0.038) . In terms of local tolerance, 32 patients equally distributed between the two treatment groups developed signs of cutaneous intolerance.

Klin Khir, 1990, (2), 32 - 3
{Intralymphatic antibiotic therapy of inflammatory complications in colonic cancer}; Bondar' GB et al.; In 18 patients with the inflammatory complications of colonic cancer before and after the operation, kanamycin, or one of the antibiotics of a cephalosporin group was administered into the lymphatic vessels of the upper third of a thigh at a daily dose of 20-25 mg/kg of body weight . After 3-4 days, the state of the patients considerably improved . All the patients underwent radical operations with primary restoration of intestinal continuity . There were no progression of purulent complications, postoperative lethality.

Klin Khir, 1990, (1), 42 - 3
{Endolymphatic administration of antibiotics in the complex treatment of patients with postoperative infiltrate in the abdominal cavity}; Zubarev PN et al.; Endolymphatic administration of antibiotics through a depulped lymph node at the region of the oval femoral fossa in the complex treatment of 17 patients with postoperative intraabdominal infiltrates contributed to reduction in the period of intoxication, recovery of the patients . There were no complications in treating by this method.

Klin Khir, 1990, (1), 33 - 5
{Effectiveness of endolymphatic administration of antibiotics in the complex treatment of suppurative and inflammatory processes of the soft tissues}; Dudenko GI et al.; The endolymphatic administration of antibiotics, which was used in the complex treatment of 78 patients with purulent-inflammatory processes in the soft tissues, contributed to acceleration of the transition of a wound process from hydratation phase into the dehydratation phase, shortening of the duration of treatment.

Antibiot Khimioter, 1990 Jan, 35(1), 3 - 4
{Study of the effect of protoplast formation on the antibiotic activity of erythromycin producers}; Zakharova GM et al.; The influence of protoplasting and regeneration on the strains of the erythromycin-producing organism differing by their origin was studied with respect to changes in the antibiotic production property . 223 regenerates of the erythromycin-producing culture were tested in several generations and it was shown that there was a marked change in the range of the variation by that property . 40 to 70 per cent of the variants in the IInd generation increased their levels of erythromycin biosynthesis by 20 to 60 per cent as compared to the intact cultures . However, in the subcultures the antibiotic production level decreased and by the IVth generation only 3 to 6 per cent of the variants preserved its increase by 10 to 20 per cent over the control level because of the culture high instability.

Antimicrob Agents Chemother, 1990 Jan, 34(1), 167 - 9
Ciprofloxacin does not inhibit mitochondrial functions but other antibiotics do; Riesbeck K et al.; At clinical concentrations, ciprofloxacin did not inhibit mitochondrial DNA replication, oxidative phosphorylation, protein synthesis, or mitochondrial mass (transmembrane potential) . No difference in supercoiled forms of DNA was observed . The tetracyclines and chloramphenicol inhibited protein synthesis at clinically achievable concentrations, while rifampin, fusidic acid, and clindamycin did not.

Chemotherapy, 1990, 36(2), 91 - 7
Interaction of beta-lactam antibiotics on bilirubin-albumin complex: comparison by three methods, total bilirubin, unbound bilirubin and erythrocyte-bound bilirubin; Gulian JM et al.; The effects of 'third-generation' cephalosporins and penicillin analogues on the concentrations of total unconjugated bilirubin, unbound bilirubin and erythrocyte-bound bilirubin were determined in blood samples . This study was performed, in vitro, at two bilirubin/albumin molar ratios and at various concentrations of antibiotics . The most effective displacers, considering the three methods, were antibiotics tightly bound to albumin: ceftriaxone and cefotetan . Cefoperazone, which is bound to albumin as tightly as these two antibiotics, caused no significant increase in unbound bilirubin but should be considered as a displacer drug on the basis of the variations of erythrocyte-bound bilirubin and total bilirubin . We suggest that drug interaction on bilirubin-albumin binding be investigated by several methods.

J Bone Joint Surg Am, 1990 Jan, 72(1), 104 - 10
Oral ciprofloxacin compared with standard parenteral antibiotic therapy for chronic osteomyelitis in adults; Mader JT et al.; A group of fourteen patients who had chronic osteomyelitis and were treated with oral ciprofloxacin was compared with a group of twelve patients of similar age who had chronic osteomyelitis and received standard parenteral antibiotic therapy consisting of nafcillin, clindamycin, and gentamicin, singly or in combination . The osteomyelitis was arrested at the end of therapy and on follow-up examination of eleven patients in the first group and ten in the second group . The average duration of antibiotic therapy (thirty-eight days) and follow-up (approximately thirty months) were about the same for both groups . Oral administration of ciprofloxacin was as effective and safe as parenteral therapy for the treatment of osteomyelitis in these adults.

Intensive Care Med, 1990, 16 Suppl 3, S235 - 8
Pharmacokinetics of antibiotics in critically ill patients; van Dalen R et al.; Differences in pharmacokinetic data of aminoglycosides, ceftazidime and ceftriaxone between intensive care patients and volunteers or patients who are less severely ill, are described . Similar differences are observed for midazolam . In severely ill patients with normal renal function a wide interpatient variability of aminoglycoside half-life (t1/2) and increased distribution volume (Vd) are observed . This results in inadequate serum levels . A pharmacokinetic approach of drug dosing, based on serum concentrations in individual patients, is advised . For ceftazidime and ceftriaxone similar changes of t1/2 and Vd are observed . Since protein binding is frequently reduced in severely ill patients, the influence of altered binding of highly bound drugs on Vd and drug clearance is discussed . As both may be increased by reduced protein binding, the change of t1/2 to be expected is unpredictable . Dosing regimens should be based on pharmacokinetic data derived from patients whose severity of disease is comparable to that of the patients to be treated.

Pharmacotherapy, 1990, 10(6), 378 - 82
Risk of nephrotoxicity with combination vancomycin-aminoglycoside antibiotic therapy; Pauly DJ et al.; One hundred five patients receiving concurrent aminoglycoside and vancomycin therapy of at least 5 days' duration were retrospectively reviewed for development of nephrotoxicity . All had their vancomycin and aminoglycoside serum concentrations controlled by a clinical pharmacokinetics service . Nephrotoxicity occurred in 28 (27%) of the patients . Twenty-two of the 28 had other factors that are known to contribute to renal failure (amphotericin B therapy, sepsis, liver disease, obstructive uropathy, pancreatitis, anesthesia) . The remaining six developed nephrotoxicity without other known contributing factors . Logistic regression analysis revealed associations between nephrotoxicity and age, sex, aminoglycoside trough and vancomycin peak and trough serum concentrations, length of aminoglycoside and vancomycin therapy, concurrent amphotericin B therapy, liver disease, neutropenia, and peritonitis (p less than 0.05) . In addition to factors previously reported, this study found that neutropenia and peritonitis are associated with an increased risk of nephrotoxicity . Patients with one or more risk factors warrant close monitoring of renal function as well as vancomycin and aminoglycoside serum concentrations.

Vestn Dermatol Venerol, 1990, (10), 43 - 5
{A comparative evaluation of antibiotic-enzyme therapy and of generally accepted methods for treating gonorrhea patients}; Glozman VN et al.; The authors analyze the immunity-correcting effect of antibiotic and enzyme therapy in 32 patients with gonorrheal orchidoepididymitis and 31 with gonorrhea relapses and compare it to the results of routine therapy in 60 patients with chronic and complicated gonorrhea . They come to a conclusion that combined administration of proteolytic enzymes and antibiotics more effectively corrects a number of disordered immunity nonspecific defense parameters (blood serum levels of circulating immune complexes and lysozyme).

Eur J Clin Pharmacol, 1990, 39(1), 9 - 12
Prescription of antibiotics to out-patients in hospital clinics, community health centres and private practice; Molstad S et al.; Prescription of antibiotics in Sweden varies between countries within a range of 13-20 DDD/1000 inhabitants/day . In Malmohus county, which accounts for the highest prescription rate, the amounts and proportions of erythromycin and tetracyclin prescribed are particularly large . All prescriptions for antibiotics dispensed in half of the pharmacies in the county during a one-week period were examined with respect to type of antibiotic and category of physician responsible for the prescription . Among 5,165 antibiotic prescriptions examined, broad spectrum antibiotics were more frequent in urban than in rural areas, and were more often prescribed by hospital physicians and private practitioners than by district physicians . Erythromycin was particularly often prescribed by paediatricians, the frequency being comparable to that of phenoxymethylpenicillin . Retrospective analysis of consultations at the ENT and paediatric clinics for respiratory tract infections showed that phenoxymethylpenicillin was not always the drug of choice by hospital physicians, despite a recommendation to that effect by the Board of Health and Welfare . The findings suggest that the choice of antibiotics is determined not only by medically relevant factors and Board recommendations but also by the habits of the consulting physicians.

Rev Mal Respir, 1990, 7(6), 551 - 7
{From the parenchyma to the mucosa biopsy: significance and importance of local assays of antibiotics . A critical study}; Bergogne-Berezin E et al.; The authors discussed the relevance of antibiotic concentrations as measured in tissues and fluids of the respiratory tract . They analysed theoretical factors which influence tissue distribution of antibiotics as well as the results of studies carried out in animal and in human tissues . Various factors may interfere with the results of antibiotic assays: but the data published by various groups were usually convergent: this confirms the significance of "tissue pharmacokinetics" . New protocols based on more refined and reliable techniques were proposed recently, which underlines the attention payed to these studies.

Parasitol Res, 1990, 76(8), 643 - 7
A new medium containing antibiotics for the xenic cultivation of Entamoeba gingivalis; Gannon JT et al.; Diamond's trypticase-yeast extract-serum-gastric mucin (TYSGM-9) medium was studied for its suitability to support the xenic growth of the oral protozoan Entamoeba gingivalis . Amoebic growth was found to be best when the inoculum for transfer was 0.1 ml, the incubation temperature was 35 degrees C, and the interval between transfers was 48 h . These parameters were also useful for controlling the growth of accompanying bacteria . In addition, bacterial growth in xenic stock cultures, which had a direct effect on the activity of E . gingivalis trophozoites, was kept to a minimum by addition of the antibiotics piperacillin, erythromycin, neomycin, and penicillin . Varying substitutions and selected supplementations of TYSGM-9 medium led to the development of an improved medium for E . gingivalis . Supplements most beneficial for the growth of E . gingivalis trophozoites were ascorbic acid, ferric ammonium citrate, and special NCTC 107 vitamin mixture . As compared with TYSGM-9 medium (6-10 E . gingivalis trophozoites observed per field), the new E . gingivalis medium supported excellent growth (16-20 E . gingivalis trophozoites observed per field during optimal growth) of the oral protozoan . The medium is suitable for clinical isolation of E . gingivalis.

Padiatr Grenzgeb, 1990, 29(5), 377 - 85
The effect of antibiotics on the function of the phagocytic system; Miler I et al.; The present paper reviews the effect of various antibiotics (ATB) on the cells of the phagocytic system . The first part deals with an indirect mechanism of action of ATB, i.e . with changes induced in the bacterial cell which in turn renders these bacteria susceptible to phagocytosis . In the second part, the direct effect of ATB on phagocytic cells is discussed: binding of ATB to phagocytes, penetration into the cell, change in chemotactic (migratory) activity, effects on ingestion of particles, intracellular killing of bacteria and on phagocytosis-associated metabolic changes (e.g . chemiluminescence).

Klin Khir, 1990, (7), 10 - 1
{Use of ultrasonics and antibiotics in the treatment of wounds in patients with high risk of infection of vascular transplants}; Komrakov VE et al.; The level of bacterial colonization of the operative wounds in performance of the reconstructive operations on the vessels equal to 10(3) bacteria in 1 g of tissue is critical for the development of suppuration . The use for treating the wounds of the low-frequency ultrasound and gentamycin solution in 17 patients permitted to reduce the critical level of bacterial wound colonization, and due to this, to decrease the incidence of the purulent-septic complications from 35.7 to 5.9% . In 14 patients after the operations for late reocclusion performed in presence of cicatrices of the tissues, there was no wound suppuration.

Chemotherapy, 1990, 36(5), 381 - 4
Influence of macrolide antibiotics on the chemiluminescence of zymosan-activated human neutrophils; Dumas R et al.; No statistically significant changes in the chemiluminescence response of the whole blood were noted following in vitro treatment with 0, 2, 10, 25, or 50 micrograms/ml of erythromycin, josamycin, miomycin, roxithromycin, and spiramycin . These results suggest that these macrolide antibiotics are unlikely to impair the phagocytizing abilities of human neutrophils, in agreement with previous findings indicating their lack of influence upon neutrophil chemotaxis.

Schweiz Arch Tierheilkd, 1990, 132(5), 227 - 37
{Intravenous congestion anesthesia/-antibiotic administration in cattle--indications,technics, complications}; Steiner A et al.; We present a literature review on current techniques of intravenous regional anesthesia and intravenous regional antibiosis of the distal limb in cattle . Our own experiences performing a combined procedure of intravenous anesthesia and antibiosis (10 million I.U . benzylpenicillin sodium dissolved in 15-20 ml 2%-lidocaine hydrochloride) are discussed in detail . Complete anesthesia of the treated limb was achieved in 22 out of 23 cases (96%) . The successfully treated animals did not express any symptoms of pain for the entire surgical procedure . In 2 out of 15 patients (13%) we observed serious post-surgical complications . The reason of which was extensive thrombosis of all veins distal of the tourniquet . The age of the clots at the time of slaughtering of the cows was determined histologically . A direct cause effect relationship between intravenous anesthesia/antibiosis and complication is indicated . We conclude that direct toxicity of the 2000-fold overdose of benzylpenicillin (as compared to generally accepted therapeutic levels) most likely caused the problem . We recommend to reduce the dose of penicillin in regional intravenous antibiosis to maximally 100,000 I.U., even in the case of local sepsis.

Acta Pharm Nord, 1990, 2(3), 155 - 60
Stereoselective synthesis and the polyene macrolide antibiotics; Rychnovsky SD; The stereochemical complexity of roflamycoin and other polyene macrolide antibiotics presents a formidable challenge to the synthetic chemist, and the lack of obvious disconnections makes the retrosynthetic analysis very complex . The alternating (1, 3, 5, ...) polyol chain in roflamycoin is difficult to synthesize in part because there is no simple method to assemble these chains from smaller subunits . We have addressed this problem and developed a simple, convergent method for assembling alternating polyol chains . It is designed around a new class of 1,3-diol synthons: 6-alkyl-4-thiophenyl-1,3-dioxanes . These 1,3-diol synthons are readily available from either homoallylic alcohols or beta-hydroxyesters, which are themselves readily prepared in optically pure form . Reduction of these synthons under the appropriate conditions gives configurationally stable alkyllithiums with either syn or anti stereochemistry . Reaction with electrophiles produces protected syn or anti-1,3-diols.

Jpn J Antibiot, 1990 Jan, 43(1), 63 - 9
Randomized trial of combination antibiotic therapy in patients with hematological disorders . Hanshin Study Group of Hematopoietic Disorders and Infection; Takemoto Y et al.; A 3 arm prospective randomized trial was designed to compare the effectiveness of aztreonam (AZT) + clindamycin (CLDM), amikacin (AMK) + AZT and CLDM + AMK as antibiotic therapy for fever in patients with hematological disorders . Between July 1987 and June 1988, one hundred and sixty of the 199 febrile episodes entered in this study were evaluated for response . Underlying diseases were hematological malignancies in 88.8% of the subjects, and there was no statistically significant differences in incidences of the diseases among the 3 groups . Efficacy rates were 64.2% in the AZT + CLDM group, 52.8% in the AMK + AZT group and 35.2% in the CLDM + AMK group . Efficacy rates in those with neutrophil counts was less than 500/microliters before starting the antibiotics were 53.3%, 43.8% and 25.0%, respectively, in the 3 groups . The combination of AZT + CLDM was found to be the most effective even in the treatment of infections associated with febrile neutropenic patients.

Antibiot Khimioter, 1990 Jan, 35(1), 26 - 7
{Study of the inactivation of antibiotics by bacterial colonies}; Babkov VV et al.; A procedure of bacteria application to disks from the colonies was used for determining antibiotic inactivation in the disks by the bacteria colonies after the disk direct contact with the colonies . Changes in the antibiotic activity in the disks were registered after incubation at 37 degrees C for 2 hours . It was shown that ampicillin resistant strains of E . coli K12 carrying R plasmids and strains of S . typhimurium and S . aureus inactivated the antibiotics in the disks and their population were homogenous in this respect . It is advisable to use the procedure in assaying drug resistance of bacterial populations.

Gen Pharmacol, 1990, 21(5), 635 - 8
High calcium solutions prevent the depressant effects of aminoglycoside antibiotics on central synaptic transmission in rat hippocampal slices; Sagratella S et al.; 1 . The aminoglycoside antibiotics neomycin and streptomycin were tested on the synaptic activity of the CA1 pyramidal neuron-Schaffer collateral interconnections in rat hippocampal slices . 2 . Neomycin (0.5 mM) decreased the magnitude and shifted to the right the stimulus-response curve of the somatic and dendritic excitatory postsynaptic potential (EPSP) and the somatic population spike (PS) . 3 . Streptomycin (1 mM) decreased the magnitude and shifted to the right the stimulus-response curve of the somatic and dendritic EPSP and the somatic PS . 4 . High (+2 mM) calcium solutions were able to prevent the effects induced by the antibiotics and to shift to the left the stimulus-response curve of the 0.5 mM neomycin and 1 mM streptomycin treated hippocampal slices . 5 . The data demonstrate an effect of aminoglycoside antibiotics on a central mammalian hippocampal synapses, that may depend on an interference of the drugs on calcium conductances.

Cancer Chemother Pharmacol, 1990, 27(1), 41 - 6
Mode of action of C-1027, a new macromolecular antitumor antibiotic with highly potent cytotoxicity, on human hepatoma BEL-7402 cells; Xu YJ et al.; C-1027, a new macromolecular peptide antitumor antibiotic produced by a Streptomyces strain, was extremely cytotoxic to cultured cancer cells and markedly inhibited the growth of transplantable tumors in mice . As determined by tritium-labeled precursor-incorporation assay, C-1027 strongly inhibited DNA and RNA synthesis in hepatoma BEL-7402 cells without affecting protein synthesis . After incubation with the hepatoma cells for 4 h, IC50 values for {3H}-thymidine and {3H}-uridine incorporation were 0.00012 and 0.00032 microM, respectively . After 30 min incubation, C-1027 showed much stronger inhibition of {3H}-thymidine incorporation than did Adriamycin, mitomycin C or methotrexate, even at a concentration 10,000 times lower . The effect of C-1027 on pBR322 DNA suggested that the drug could cause single- or double-strand scission of DNA . As determined by flow cytometry, C-1027 delayed the progression of hepatoma cells through the S-phase and blocked the cells at G2+M . Cytological study showed that C-1027 caused a drastic reduction of the mitotic index within 1 h and that an overshot of the mitotic index occurred at 48 h . Our results indicate that C-1027 is an interesting compound with highly potent activity on cellular DNA.

Biochem Int, 1990, 20(6), 1135 - 9
Inhibition of erythrocyte ghost ATPase by polyene antibiotics; Capuozzo E et al.; The effect of micromolar concentrations of polyene antibiotics on erythrocyte ghost ATPase activities has been studied . (Mg2+)-ATPase is inhibited by amphotericin B and amphotericin B methyl ester, whereas (Na+ + K+ + Mg2+)-ATPase is inhibited by amphotericin B and lucensomycin . (Ca2+ + Mg2+)-ATPase is only slightly affected by polyene antibiotics.

Dtsch Tierarztl Wochenschr, 1990 Jan, 97(1), 48 - 51
{Antibiotic-free weaning of piglets}; Glawischnig E; In a problem herd the losses by E . coli-infection of weaning piglets could not be reduced neither applicating an oral vaccine before 4-2 weeks to weaning nor via feed of antibiotics or sulfonamides . Therefore many feeding trials were carried out by 1247 weaning piglets which are feeded with high raw fibre rations (wheatbran coarse grained, strawmeal) beginning 2 weeks before weaning till 3 weeks afterwards . The most effective feeding additive was 25-30% wheatbran . In fact of this results the diarrhea, a problem in many herds infected with a lot of EEC (08, 045, 0138, 0139, 0141, 0147 and 0149) could be reduced effectively . Light cases of diarrhea during the trials could be stopped by two applications of TMQ (20 mg Terramycin/kg BW) . Based on these results the use of the supplementing wheatbran to the normal feed during the weaning period can be recommended for such problem herds.

Drugs Exp Clin Res, 1990, 16(8), 385 - 9
Comparison of the target sites and mechanisms of action of glycopeptide and lipoglycodepsipeptide antibiotics; Reynolds PE et al.; In this brief review of glycopeptides (teicoplanin and vancomycin) and lipoglycodepsipeptides (ramoplanin), comparison is made of their structure, general mode of action, specific target site and the mechanism by which inhibition of the sensitive enzyme is achieved . Although these two groups of antibiotics are chemically very different, they both inhibit late stages in the biosynthesis of bacterial cell wall peptidoglycan and cause the accumulation of the identical cell wall precursor, UDP-MurNAc-pentapeptide, in the cytoplasm . The specific target site is at the level of the membrane-bound enzymes which catalyse the attachment of wall precursors to a lipid carrier and subsequent polymerisation: ramoplanin inhibits transfer of one of the two precursors, whereas the glycopeptides block polymerisation . As different targets are involved, cross-resistance between glycopeptides and ramoplanin is unlikely and has not yet been reported . The actual mechanisms of action are totally different: glycopeptides inhibit the sensitive reaction by binding firmly, as a result of substantial hydrogen bonding, to acyl-D-Ala-D-Ala termini of the nascent peptidoglycan chains or lipid-linked wall subunits . The substrate is sequestered in a cleft of the antibiotic molecule and cannot interact with the polymerase enzyme . The precise mechanism of action of ramoplanin has not been elucidated, but its action is not dependent on the presence of the acyl-D-Ala-D-Ala group in the substrate and its binding characteristics are different from those of the glycopeptides . It therefore has a different mechanism of action as well as a different site, compared with the glycopeptides.

Scand J Infect Dis Suppl, 1990, 72, 9 - 13
Comparative pharmacokinetics of glycopeptide antibiotics, and the influence of teicoplanin on granulocyte function; Lode H et al.; The glycopeptide antibiotics teicoplanin and vancomycin differ in their pharmacokinetic properties . Teicoplanin is characterized by a high and prolonged serum concentration as a result of its long elimination half-life, which can be explained by high serum protein binding and renal tubular resorption . The apparent volume of distribution of teicoplanin is much larger than the extracellular space of the human body, indicating intracellular accumulation in different tissues . Elimination is primarily via the kidneys, though 15-20% is eliminated by non-renal mechanisms . Vancomycin has a shorter elimination half-life and lower protein binding than teicoplanin . At therapeutically relevant serum concentrations, teicoplanin has no influence on superoxide anion production and enzyme release by granulocytes.

Gig Tr Prof Zabol, 1990, (8), 19 - 24
{Necessity to include allergic vasculitis caused by antibiotics in the list of occupational diseases}; Gerasimova MM; Basing on the results of original research and foreign literature data, the author proved the necessity of including antibiotic induced allergic vasculitis in the occupational diseases list . These forms of vasculitis are characterized by specific clinical features, including nervous system, internal organs and skin disorders, and can be referred to as the secondary allergic vasculitis . Their including in the OD list in important for proper diagnosing occupational pathology and subsequent labour ability expertise, since resulting occupational disability is in most cases caused by NS disorders.

Acta Univ Palacki Olomuc Fac Med, 1990, 125, 79 - 98
Postirradiation changes in small intestine mucosa of piglets selectively decontaminated by peroral antibiotics; Pospisilova J et al.; There was performed light microscopic and morphometric comparison of changes in the intestinal mucosa structure after the irradiation of the lower part of body by radiation 60Co in a dose of 12 Gy, observed the third day after irradiation in piglets kept under conventional conditions and the fifth, the fifteenth and the twentieth days after irradiation in piglets kept under the conditions of selective decontamination by peroral antibiotics . The non-irradiated animals kept conventionally as well as under the conditions of decontamination served as controls . The estimation was performed on transverse slices of the cranial part of jejunum and of the caudal part of ileum . The slices were stained by the method hematoxylin-eosin . The drawings prepared with the help of the projective microscope Pictoval were used for measuring on the apparatus for the quantitative analysis of image MOP AM 03 . A markedly lower damage of the intestinal mucosa was evidenced in piglets selectively decontaminated by peroral antibiotics . In the studied time intervals after irradiation in a dose of 12 Gy, the epithelial cover of mucosa, the crypt epithelium and the general outline of mucosa are much better maintained . The favourable effect of the selective decontamination on the maintenance and regeneration of the mucosa of jejunum and ileum is confirmed by a range of morphometric parameters.

J Gynecol Obstet Biol Reprod (Paris), 1990, 19(6), 765 - 72
{Acute bacterial salpingitis . The importance of residual inflammation . A comparative study with celioscopic control of 2 antibiotic protocols: sulbactam-ampicillin versus cefoxitin}; Le Bouedec G et al.; The combination of sulbactam-ampicillin was compared to cefoxitin for the treatment of acute salpingitis in 40 women divided into two groups of 20 women each . There were 11 patients in each group who were given doxycycline because of evidence of chlamydial infection . All patients were diagnosed by laparoscopic examination and evaluated by the same procedure 7-12 weeks later: At the second laparoscopy, only 1 of the 20 patients (5%) treated with sulbactam/ampicillin had severe adhesions, while 6 of the 20 patients (40%) treated with cefoxitin had severe adhesions . Tubal patency was without obstruction in 14 patients (70%) given the combination treatment and in 12 patients (60%) given cefoxitin . Side effects were essentially absent in both groups.

Fundam Appl Toxicol, 1990 Jan, 14(1), 60 - 70
Hepatic changes produced by 30-day administration of a novel aminocyclitol antibiotic, trospectomycin sulfate, to laboratory animals; Ulrich RG et al.; The studies described here were done to characterize the hepatic response to a new aminocyclitol antibiotic, trospectomycin sulfate, administered intravenously (beagle dog) or subcutaneously (Sprague-Dawley rat) at a variety of dose levels, to investigate reversibility of observed changes, and to document any untoward effects of subchronic trospectomycin sulfate administration . Both species showed significant elevations in serum levels of alanine and aspartate transaminases in higher dose groups . In the dog only, a transient neuromuscular blockade was also observed within higher dose groups . No other functional, morphological, or serum chemical changes were observed . Examination of liver by electron microscopy revealed the presence of cytoplasmic lamellar inclusion bodies, concentrated in the bile canalicular region of the hepatocytes . Occurrence of the lamellar bodies and coincident transaminase increases were found to be reversible upon discontinuance of treatment (studied in the dog) . Electron microscopy of acid phosphatase cytochemistry in the rat indicated that most, but not all, of the lamellar bodies contained this enzyme . This observation suggests that they may be derived from the lysosome, or once formed become lysosomal.

Biochem J, 1990 Jan 1, 265(1), 69 - 77
Thermodynamic analysis of the interaction of the antibiotic teicoplanin and its aglycone with cell-wall peptides; Arriaga P et al.; The thermodynamics of the interaction of the glycopeptidic antibiotic teicoplanin and its peptidic moiety with analogues of bacterial cell-wall peptides were studied by means of calorimetric and spectrophotometric techniques . The analysis of the thermodynamic data has allowed us to evaluate the contributions of the different peptide groups to the binding process . The nature of the primary binding forces is also discussed for each interacting group, on the basis of their enthalpic and entropic contribution and in connection with the detailed structural information available for these antibiotics from n.m.r . data . Similar analyses for the case of vancomycin and ristocetin are also reported.

J Pharm Biomed Anal, 1990, 8(1), 67 - 71
High-performance liquid chromatographic assay and erythrocyte partitioning of fleroxacin, a new fluoroquinolone antibiotic; Brunt E et al.; A rapid technique for sample preparation and HPLC was developed to study in vitro the erythrocyte binding and plasma protein binding of fleroxacin in the concentration range 0.2-15 micrograms ml-1 . The red blood cell partition coefficient of fleroxacin was 1.45 +/- 0.18 at 25 degrees C and was independent of concentration, incubation time and temperature . The in vitro plasma protein binding of fleroxacin in humans, determined by two independent methods, was 47-51% . Partition studies using erythrocytes as a simple in vitro model may be useful to predict the degree of tissue uptake and the volume of distribution.

J Gynecol Obstet Biol Reprod (Paris), 1990, 19(8), 1061 - 4
{Economic benefit of using antibiotics prophylactically in cesarean sections with little risk of infection}; Mallaret MR et al.; A randomised double trial was carried out in 266 women who had Caesarean without any high risk of infection in order to study the efficacy of prophylactic antibiotics given during the operation . One group received 1 gram of cefotetan when the cord was being clamped and the other had an injection of placebo under the self-same conditions . Apart from studying the clinical efficacy, evaluation of the economics of the treatment was carried out using, as parameters, the length of stay in hospital and the cost of the antibiotics which were prescribed after the operation . The following results were obtained: 75% of the Caesarean operations carried out in the Maternity Units of the University Regional Hospital Centre were without high risk of infection . Prophylactic antibiotics are proficient because they reduce post Caesarean morbidity due to: endometritis, superficial and deep abscesses and septicaemia . 12.5% in the group who had antibiotics developed infections as against 26% in the placebo group . Post Caesarean infections which required antibiotics cost on an average for each Caesarean 16 francs in the groups who received antibiotics as against 52 francs in the groups that received the placebo . Even including the cost of the antibiotics given prophylactically the costs of antibiotics (prophylactic and curative) was higher in the antibiotic group than in the placebo group . The length of hospital stay was significantly reduced in the group that received prophylactic antibiotics.

Arch Microbiol, 1990, 155(1), 99 - 102
Effect of aminoglycoside antibiotics on the autolytic enzyme of Streptomyces griseus; Szabo I et al.; The isolated cell wall of Streptomyces griseus 52-1 strain labelled with fluorescein isothiocyanate (FITC) and containing wall-bound autolytic enzyme was lysed as a function of different cations . The autolysis was accelerated by aminoglycoside antibiotics (streptomycin and the structurally closely related neomycin) which have a polycationic character . Since this strain is a streptomycin producer it is suggested that streptomycin may have a regulatory function on autolysis.

J Int Med Res, 1990, 18 Suppl 4, 37D - 47D
Evolution of enzymatic mechanisms of resistance among beta-lactam antibiotics; Gutmann L et al.; Resistance to third-generation cephalosporins occurs as a result of either the production of high concentrations of chromosomal cephalosporinase or, increasingly, the presence of broad-spectrum plasmid-mediated beta-lactamases . Both cases represent the response of bacteria in the hospital setting to the selection pressure brought to bear by the use of these antibiotics . Continued evolution of the plasmid-mediated enzymes is occurring as new antibiotics are introduced, probably reflecting the process that began when the first beta-lactamase apparently evolved from the penicillin-binding proteins . beta-Lactamase inhibitors offer one approach to dealing with the evolution of resistance to previously beta-lactamase-stable antibiotics.

Chemotherapy, 1990, 36(4), 300 - 7
Influences of cephem antibiotics on the immune response in mice; Akahane K et al.; The effects of six cephem antibiotics, including ceftezole, cefmetazole, cefoxitin, cefotiam, cefoperazone, and cefotaxime, on murine humoral immunity were examined . In female BDF1 mice each cephem antibiotic was administered at a dose of 800 mg/kg/day i.v . for 7 consecutive days . Among the antibiotics tested, only ceftezole and cefoperazone induced a significant increase in serum total IgM, but not in serum total IgG . Especially in case of ceftezole, the mice developed splenomegaly due to the proliferation of IgM-producing cells in the germinal centers . The proliferation of splenic IgM-producing cells was also observed in female thymus-deficient Balb/c-nu/nu mice receiving intravenous ceftezole . Thus, the drug was indicated to enhance the polyclonal IgM production in mice by acting as a B cell mitogen . This is consistent with the in vitro finding that ceftezole exhibited a mitogenic effect on whole spleen cells from BDF1 mice, but not on B cell depleted spleen cells.

Pharmacotherapy, 1990, 10(3), 199 - 204
Patterns of antibiotic use and expenditures during 7 years at a university hospital; Fletcher CV et al.; Before 1982, annual retrospective drug-use audits clearly established the pattern of increased antibiotic use and expenditures at the University of Minnesota Hospital . At that point, a concurrent trend analysis system was developed to track this use by individual drug and therapeutic class, to identify trends in use for qualitative evaluation, and to provide an assessment of any intervention intended to alter use . Monthly use of all injectable antibiotics and antifungal agents, and selected oral antifungals has been tracked since 1982 as both defined daily doses and dollars . Use patterns in 1981 served as baseline . The defined daily dose index, which captures changes associated with intensity of antibiotic use per patient, increased 62% from baseline through 1988 . This increase, however, resulted in a disproportionate 228% rise from baseline in antibiotic expenditures to nearly $3 million/year for 1988 . The defined daily dose index peaked in 1985, declined in 1986, and remained stable for 1987 and 1988 . Qualitative drug-use review programs were associated with this positive change . These results demonstrate the utility of concurrent trend analysis as a resource-management tool and as a measure of effectiveness for collaborative physician-pharmacist programs to foster safe, appropriate, and economical use of antiinfective agents.

Chem Biol Interact, 1990, 73(2-3), 297 - 307
Specific drug binding to rat liver cytochrome P-450 isozymes induced by pregnenolone-16 alpha-carbonitrile and macrolide antibiotics . Implications for drug interactions; Sartori E et al.; Clinical interactions of macrolides with various drugs lead to elimination impairment, increase of plasma concentration and overdose-like effects, resulting from modifications of their metabolism . Previous studies have shown that treatment of rats by the macrolide antibiotics of the oleandomycin and erythromycin series lead to the induction of an hepatic cytochrome P-450 which is implicated into their own metabolism . We have characterized PCN or macrolides induced cytochromes P-450 by their specific ability to interact with macrolide derivatives and, using the cytochrome P-450 spectral binding assays, we have shown that some compounds, implicated in drug interaction with macrolides, interact preferentially with the same cytochromes . This strongly suggests that specific blockage of cytochrome P-450 IIIA1 family by macrolides, is responsible for these drug interactions and that these interactions can be predicted easily by simple in vitro tests such as those described herein.

J Antibiot (Tokyo), 1990 Jan, 43(1), 8 - 18
Eponemycin, a new antibiotic active against B16 melanoma . I . Production, isolation, structure and biological activity; Sugawara K et al.; Streptomyces hygroscopicus No . P247-71(ATCC 53709)produced a novel antibiotic eponemycin which exhibited specific in vivo antitumor effect against B16 melanoma . Structural studies assigned (4S)-1,2-epoxy-2-hydroxymethyl-4-(N-isooctanoyl-L- serylamino)-6-methylhept-6-ene-3-one to eponemycin which is unrelated to the known antitumor antibiotics.

Nucleic Acids Symp Ser, 1990, (22), 33 - 4
Switch-function of amino sugar on elsamicin A, a DNA binding antitumor antibiotic; Uesugi M et al.; There are a considerable number of DNA binding natural products equipped with amino sugar residues . The amino sugar of elsamicin A significantly takes part in DNA binding and antitumor activity . In addition, we found that an acetylation of the amino group on elsamicin A sugar portion plays an important switch-function for the activity of elsamicin A . The biological implication of this switch has been discussed.

Nucleic Acids Symp Ser, 1990, (22), 19 - 20
Identification of DNA degradation products by antitumor antibiotic, esperamicin; Ebata T et al.; Esperamicin A1 is a DNA-damaging agent characterized by a unique ten-membered ene-diyne core . We studied the detailed reaction mechanism by using synthetic DNA oligomers . The cleavage site and activity depend on the sequence of the oligomers . d(GGATCC) and d(GGTACC) were cleaved by the drug while d(CCATGG) and d(CCTAGG) were not cleaved under the present conditions . d(GGTACC) gave two major 5'-fragments . The result of partial nuclease digestion experiments suggests that these products are trimer and pentamer with a modified 3'-end.

Scand J Infect Dis Suppl, 1990, 74, 23 - 33
Pharmacokinetics of antibiotics in tissues and tissue fluids: a review; Cars O; The majority of bacterial infections occur outside the vascular compartment and, thus, considerable interest has been devoted to studies of antibiotic concentrations in different tissues . This review deals with the pharmacokinetics of antibiotics in tissues where the drug is distributed by passive diffusion . It is not always recognized that tissue levels of antibiotics represent the means of different concentrations in the major tissue compartments: interstitial fluid, cells and blood capillaries . Non-lipophilic drugs, such as beta-lactam antibiotics, which do not penetrate cells, are confined to the extracellular fluid volume, which constitutes approximately 20% of the tissue . Consequently, whole tissue levels are low . Conversely, drugs that penetrate and accumulate in cells may well yield tissue levels exceeding the serum levels . Since most bacterial infections start and progress in the interstitial fluid, whole tissue levels are therapeutically meaningless, but are nevertheless often compared to the MICs of bacteria . For protein-bound drugs, the lower albumin concentrations in extracellular fluids is another important factor that may lead to erroneous conclusions regarding the ability of an antibiotic to distribute into tissues . Different models have been developed to study antibiotic levels in the interstitial fluid . The geometry of the tissue fluid compartment (ratio of surface area to volume: SA/V) has been recognized as one of the most important determinants of antibiotic pharmacokinetics in these models . In healthy tissues (high SA/V) similar concentrations are found in serum and tissue fluid . Although limited information is available regarding antibiotic pharmacokinetics in infected tissues, it seems that in acute bacterial infections, the most relevant concentrations to relate to pharmacodynamic parameters are the unbound levels of the drug in serum.

Scand J Infect Dis Suppl, 1990, 74, 155 - 62
Impact of the antibiotic dosage schedule on efficacy in experimental lung infections; Roosendaal R et al.; In agreement with results obtained in the thigh infection model for which there is no human equivalent, the impact of the dosage schedule on efficacy in various clinically relevant experimental lung infections is related to the class of antibiotic . The efficacy of beta-lactams increases with increasing frequency of administration . Sustained antibiotic concentrations in serum at a relatively low level are more effective than high peak concentrations at intervals . In contrast, the dosing interval has little impact on the activity of aminoglycosides, which is mainly dependent on the total amount of antibiotic in serum during treatment, either as short lasting high peaks or as long lasting relatively low concentrations . Limited data available on quinolones suggest a slight increase in efficacy with increasing dosing intervals . These differences in efficacy correlate with differences in the pharmacodynamics of antibiotics of different classes as seen in vitro as well as in the lungs of infected animals . Knowledge about both the pharmacokinetics and pharmacodynamics of antibiotics is required for the correct interpretation of comparative studies on antibiotic efficacy in experimental infections, and also for the evaluation of experimental data as support for the proper design of clinical trials.

Alpha Omegan, 1990, 83(4), 26 - 31
Use of analgesics and antibiotics in endodontics: current concepts; Morse DR; In this review, the principal drugs used for prevention and treatment of pain--analgesics, and swelling--antibiotics, are examined . The rationale for prevention of pain and swelling is given . Then the specific drugs are considered . The analgesics evaluated include: the non-steroidal anti-inflammatory agents (e.g., aspirin, acetaminophen, ibuprofen, diflunisal); and the narcotics (e.g., codeine, oxycodone, hydrocodone, meperidine) . The antibiotics evaluated include: the penicillins (e.g., penicillin V, ampicillin, methicillin); the cephalosporins (e.g., cephalexin, cefadroxil); the erythromycins (e.g., erythromycin stearate, erythromycin base); clindamycin; metronidazole; and some rarely used drugs (e.g., ciprofloxacin).

Przegl Epidemiol, 1990, 44(3), 199 - 201
{Antibiotic sensitivity of enteropathogenic strains of Escherichia coli isolated from children with diarrhea}; Ruczkowska J et al.; Enteropathogenic E . coli strains (n = 120), isolated from faeces in 1988-1989, were sensitive to cefotaxime and ceftriaxone (100%) and to colistin, amikacin, cefoperazone, cefuroxime, cefamandole, netilmicin, gentamicin, tobramycin and neomycin (94.2-99.2%) . These strains were resistant to ampicillin (55.6%) and carbenicillin (52.5%) . It was found that E . coli strains of serotype 018:K76 were resistant mainly to ampicillin and carbenicillin, whereas E . coli strains of serotype 0119:K69 were resistant mainly to tetracyclines and carbenicillin.

Acta Cardiol, 1990, 45(6), 441 - 53
Dental health, prophylactic antibiotic measures and infective endocarditis: an analysis of the knowledge of susceptible patients; De Geest AF et al.; A questionnaire was administered to 338 cardiac patients susceptible to infective endocarditis seen at the outpatient clinic or a cardiac ward . The questionnaire consisted of a series of questions on the educational, social, familial and professional background, the medical and dental history and the knowledge of the patient on prophylaxis of infective endocarditis . Univariate analysis (chi-square test) and stepwise discriminant analysis were used to evaluate the factors responsible for the presence or absence of an acceptable degree of awareness of infective endocarditis . More than half of the patients had no knowledge on prophylactic measures . The time since the diagnosis of heart disease, an edentulous state, written instructions received in the past on prophylaxis, the location of the follow-up, the level of education and previous prosthetic valve surgery were factors retained by discriminant analysis . A discriminant score was calculated for each patient and permitted classification in subgroups with a high, intermediate and low probability of presence of knowledge . This was simplified by classifying patients according to the number of risk factors . An answer to one of the six variables, selected by discriminant analysis, unfavorable for the presence of knowledge, was considered as a risk factor . Risk factor analysis must be considered as an important tool in the education of patients on the risk and prophylaxis of infective endocarditis.

Scand J Infect Dis Suppl, 1990, 74, 102 - 12
Mechanism of phenotypic tolerance of nongrowing pneumococci to beta-lactam antibiotics; Tuomanen E et al.; Within minutes after the onset of deprivation of an essential nutrient, all bacteria develop resistance to lysis by beta-lactam antibiotics, a phenomenon termed phenotypic tolerance . Two phases of this process were identified in pneumococci and the activity of the major autolysin, an N-acetylmuramyl-L-alanine amidase, was studied in each phase . Autolysin was detectable by immunofluorescence in a uniform distribution over the surface of growing pneumococci, but became progressively depleted during amino acid deprivation . Lysis of nongrowing cells by beta-lactam antibiotics could be reconstituted by addition of exogenous autolysin during the first 80 minutes of starvation (Phase I) but not thereafter (Phase II) . Similarly, Triton X-100 or deoxycholate lysed nongrowing cells in Phase I but not Phase II . Cell wall isolated from Phase II cells was found to be more resistant to hydrolysis by the autolysin in vitro than that from growing cells . Lysis of growing cells could also be inhibited by incorporation of a pulse of nonhydrolysable cell wall or autolysin deficient cell wall into the growth zone . These results suggest that phenotypic tolerance in nongrowing pneumococci involves rapid loss or disengagement of autolysin molecules from their in situ attack-sites (Phase I) followed by a second slower process that involves a progressive change in the cell wall structure to a form less susceptible to hydrolysis by the autolysin (Phase II).

Gig Tr Prof Zabol, 1990, (6), 48 - 51
{Principles of treatment of occupational diseases caused by antibiotics}; Penknovich AA et al.; The contributors expound the major principles of occupational diseases treatment from antibiotics and propose to cope with the allergic reactions and dysbacteriosis with due account of the underlying pathogenic mechanisms . Microcirculation influencing drugs and corticosteroid therapies were proposed to deal with more severe cases, particularly with secondary allergic NS vasculites . Abstention from antibiotics and a long-term complex treatment resulted in health improvement and working capacity rehabilitation.

Gene, 1989 Dec 28, 85(2), 293 - 301
Production of a hybrid macrolide antibiotic in Streptomyces ambofaciens and Streptomyces lividans by introduction of a cloned carbomycin biosynthetic gene from Streptomyces thermotolerans; Epp JK et al.; The structurally related macrolide antibiotics carbomycin (Cb) and spiramycin (Sp) are produced by Streptomyces thermotolerans and Streptomyces ambofaciens, respectively . Both antibiotics contain 16-membered lactone rings to which deoxysugars are attached . There are three sugars in Sp (forosamine, mycaminose and mycarose) and two sugars in Cb (mycaminose and a derivative of mycarose containing an isovaleryl group at position 4) . We have identified the gene from S . thermotolerans (designated carE), which appears to encode an enzyme that acylates this mycarose sugar, and have shown that recombinant strains containing carE can use Sp as a substrate and convert it to the hybrid antibiotic, isovaleryl Sp (ivSp) . Expression of carE was demonstrated in two heterologous hosts: in S . ambofaciens, where endogenously synthesized Sp was converted to ivSp, and in Streptomyces lividans where exogenously added Sp was converted to ivSp . The carE gene was isolated on a cosmid that also encodes genes required for Cb-lactone formation . These genes reside on a DNA segment of about 70 kb and are part of a Cb biosynthetic gene cluster that is flanked by two Cb-resistance genes, carA and carB . Mapping studies and nucleotide sequence analysis revealed that carE is located at one end of this gene cluster, immediately adjacent to the carB gene . Genes carB and carE are transcribed convergently and may share a common transcriptional terminator sequence.

Nippon Gan Chiryo Gakkai Shi, 1989 Dec 20, 24(11), 2499 - 503
{Effect of vaginal antibiotics suppository on retroperitoneal-space infection after hysterectomy and lymphadenectomy for uterine cancer}; Yakabe A et al.; Effects of vaginal antibiotics suppository on the retroperitoneal-space infection were studied in 42 patients who had hysterectomy and lymphadenectomy with diagnosis of uterine cancer stage I or II . All patients received intravenous administration of 1 g LMOX (3 times/day) for 7 days after operation . One group of patients (21 cases) received 0.5 g of ABPC vaginal suppository (twice/day) for 10 days immediately after operation . Another group of 21 patients did not received vaginal suppository . The LMOX concentrations in the exudate decreased rapidly from the 3rd day to the 7th day . The frequencies of bacterial appearance in the retroperitoneal-space in the vaginal suppository group were 33% on 5th day, 33% on 7th day and 20% on 9th day, while those in the control group were 100%, 100% and 76%, respectively . It was concluded that the administration of vaginal antibiotics suppository was easy to handle and effective for preventing the retroperitoneal-space infection after hysterectomy and lymphadenectomy.

Gene, 1989 Dec 14, 84(2), 267 - 77
Analysis of the promoter region of the melanin locus from Streptomyces antibioticus; Leu WM et al.; Several approaches were used to study the transcriptional control region of the melanin-production locus (melC) of Streptomyces antibioticus . Filter-binding in combination with exonuclease III protection localized the 3' boundary of a Streptomyces RNA polymerase-binding site predominantly about 39 nucleotides (nt) upstream from the start codon of melC1, the first open reading frame in the melC locus . Deletion of nt 112-197 upstream from the melC1 start codon reduced melC expression to less than 10%, and deletion of nt 28-107 or 28-120 upstream from melC1 totally inactivated melC . High-resolution nuclease S1 mapping identified the in vitro transcriptional start point (tsp) at 33-34 nt upstream from the start codon of melC1 . No sequence resembling the E . coli consensus promoter sequence was found in this region, and site-directed mutagenesis of such a sequence located 101-132 nt upstream from melC1 did not influence melC expression . These studies suggest that transcription of melC is principally from a single tsp and is positively regulated by a mechanism that involves sequences 87-163 nt upstream from the tsp.

Biol Chem Hoppe Seyler, 1989 Dec, 370(12), 1295 - 303
Secondary fungal metabolites and their biological activities, I . Isolation of antibiotic compounds from cultures of Heterobasidion annosum synthesized in the presence of antagonistic fungi or host plant cells; Sonnenbichler J et al.; Heterobasidion annosum (Syn . Fomes annosus), one of the most pathogenic basidiomycetes in conifer forests, produces a series of new metabolites specifically in the presence of antagonistic fungi or some plant cells . These "ecological metabolites" have been isolated and chemically characterized . The time course of production was measured with regard to their biosynthetic pathway . In bio-assays with other fungi, E . coli and cell cultures of Picea abies and Nicotiana tabacum, it could be shown that some of the compounds have antibiotic and growth-inhibiting properties.

Pathol Biol (Paris), 1989 Dec, 37(10), 1085 - 9
{The effect of previous antibiotherapy on the colonization of an Escherichia coli strain sensitive to antibiotics in the digestive tract of hospitalized children}; Rastegar Lari A et al.; The administration of the Escherichia coli (az) strain has already been used successfully to protect premature infants against intestinal colonization by nosocomial strains of antibiotic resistant enteric organisms . The purpose of the present study was to assess the protective value of this strain in older full term babies after cessation of an antibiotics treatment . Two groups of children treated with antibiotics of respectively 8-90 days and 3-12 months of age were studied and compared to two control groups of untreated children . In both groups of children, the implantation of E . coli az was higher in treated than in untreated subjects . The group of younger children was significantly less colonized by antibiotic resistant hospital acquired enteric organisms, whereas in 3-12 months old children non protective effect of E . coli az was recorded . Therefore, the antagonistic effect of the strain studied appeared as age dependent.

Infect Dis Clin North Am, 1989 Dec, 3(4), 723 - 34
Strategies to improve antibiotic use; Bryan CS; The desideratum of "appropriate" antibiotic therapy include efficacy, safety, and low cost . Strategies for achieving these goals include education, control of the hospital formulary, written justification forms and automatic stop orders, ongoing utilization review, restriction, required consultation, control of laboratory susceptibility testing, and limitation of contact time between physicians and pharmaceutical representatives . Because traditional education methods have had limited impact on "appropriate" antibiotic use, the potential of the newer strategies must be explored . Most published studies emanate from teaching hospitals, leaving the applicability of the findings to community hospitals largely unsettled . At each hospital, it should be determined which combination of strategies will strike the best balance between effectiveness and palatability . Computer technology continues to hold promise as a way to provide instantaneous, nonthreatening feedback to prescribing physicians.

J Can Dent Assoc, 1989 Dec, 55(12), 967 - 70
The role of systemic antibiotics in periodontal therapy; Quee TC; The Specific Plaque Hypothesis (SPH) has resulted in a renewed interest in the use of systemic antibiotics in the treatment of periodontal disease . Current data indicate that most cases of periodontitis can be treated satisfactorily with scaling and root planing alone . There are some cases of periodontitis however which remain refractory to mechanical debridement or which recur shortly after treatment . The data indicate that the use of antibiotics along with scaling and root planing during the treatment of these cases of periodontitis will result in significant improvement in the periodontal health of these patients . Antibiotics may also be indicated in patients with systemic diseases which may adversely affect the periodontium.

Endod Dent Traumatol, 1989 Dec, 5(6), 287 - 91
Antibiotics in exudate from periapical lesions in dogs; Allard U; Forty-eight periapical lesions were induced in the mandible of dogs . Subsequently, the dogs were given a single intramuscular injection of either benzylpenicillin, erythromycin, lincomycin or clindamycin . The antibiotic concentration in serum and exudate from the periapical lesions was measured . The highest concentration of benzylpenicillin in serum (4.3 micrograms/ml) was obtained 30 min after the injection and in exudate (1.8 micrograms/ml) 60 min after injection . The highest concentration of erythromycin in serum (0.8 microgram/ml) was reached after 120 min and in exudate (0.6 microgram/ml) 240 min after the injection . The highest concentration of clindamycin in serum (2.3 micrograms/ml) was obtained 120 min after the injection and in the exudate (2.2 micrograms/ml) after 240 min . The highest concentration of lincomycin in serum (4.2 micrograms/ml) was noted 120 min after the injection and in exudate (4.5 micrograms/ml) 240 min after the injection . The results of this study indicated that the sampling method used might be suitable for analyzing the concentration of antibiotics in a clinical situation.

Bull Group Int Rech Sci Stomatol Odontol, 1989 Dec, 32(4), 227 - 37
{The evaluation of the efficacy of antibiotic therapy in human periodontal disease}; Cigana F et al.; 12 patients suffering from advanced periodontitis with probing depths of 4 mm or more, were selected to assess the efficiency of an oral antibiotic during a period of 15 days in the treatment of periodontal disease . Our double-blind test, shows a decrease of gingival inflammation involving a comparison of clinical and histological parameters . thus highlighting the indisputable therapeutic role of antibiotic therapy . By means of a "t" test of Student a significant decrease in the plaque index, the gingival index and the bleeding index was noted between day 0 and day 15 as well as a significant increase in the recessions . However, no significant difference was obtained in the probing depths and the attachment level . These clinical results were correlated with histological parameters, namely a significant drop in the volumetric density of the infiltrated connective tissue, of the non collagenases structures, the blood vessels and the number of plasma cells, in addition to a significant increase in the volumetric density of the noninfiltrated connective tissue, in the collagenous structures and the number of fibroblasts.

Antibiot Khimioter, 1989 Dec, 34(12), 885 - 90
{The dependence of the distribution of ionophoric macrotetrolide antibiotics on the composition of their immiscible phases}; Sverdlova AN et al.; Influence of various solvents on the content of macrotetrolides during their prolonged storage in solution was shown . Under the conditions of room temperature 90 per cent acetone induced hydrolysis of polyether antibiotics . 90 per cent ethanol and dry chloroform induced respectively slight and intensive cyclization of linear precursors (oxyacids) . The study on distribution of macrotetrolides between immiscible phases of various composition revealed that addition of ethanol or acetone to the water-chloroform system of organic solvents induced the antibiotic liberation into the water phase which increased with increasing concentration of the substances being added . Inorganic cations intensified the process during either the oxyacid cyclization or the antibiotic hydrolysis and liberated the reaction products from the equilibrium mixture . Under such conditions the value of the ion radius or selectivity of the macrotetrolides to definite cations was in principle of no importance.

J Antimicrob Chemother, 1989 Dec, 24(6), 921 - 5
In-vitro activity of flomoxef, a new oxacephem group antibiotic, against Nocardia in comparison with other cephalosporins; Yazawa K et al.; The susceptibility of 113 strains of pathogenic Nocardia, N . asteroides, N . farcinica, N . nova, N . brasiliensis and N . otitidiscaviarum to a new oxacephem antibiotic flomoxef was determined by an agar dilution method in comparison with those of 13 other cephalosporins . Flomoxef was two to 50 times more active against these pathogenic Nocardia than other cephalopsorins tested . However, there were differences in susceptibility to this antibiotic among these Nocardia strains . N . asteroides was the most sensitive species, followed by N . farcinica and N . nova . N . brasiliensis was moderately sensitive and N . otitidiscaviarum was resistant.

J Antibiot (Tokyo), 1989 Dec, 42(12), 1790 - 7
Eremomycin--new glycopeptide antibiotic: chemical properties and structure; Gause GF et al.; By a combination of chemical and spectroscopic (1H and 13C NMR) studies the structure of a glycopeptide antibiotic eremomycin has been elucidated . It is closely related to vancomycin, but differs in sugar and chlorine content . The eremomycin aglycone contains monodechlorovancomycinic acid; the only chlorine atom is situated in the second amino acid after the N-terminal amino acid residue of the peptide . The sugar part is composed of glucose and two residues of an amino sugar shown to be 2,3,6-trideoxy-3-amino-C-3-methyl-L-arabino-hexopyranose (4-epi-vancosamine) . One of the amino sugar residues is a component of the disaccharide 2-O-(alpha-L-4-epi-vancosaminyl)-beta-D-glucopyranose, attached to a triphenyl ether moiety; the position of another one is at the serine oxygen in the C-terminal region of the aglycone.

What Is Genome?, What Is Nitrification?, What Is MIC?, What Is Molecular Biology?, What Is Biofilter?, r, Microbe, i, Bacterium, n, Microorganism, s, Microbiology, o, Bacteria, o, Microbiological, n, Multidrug resistant, e, Lactobacillus, a, Thermophile, e, Streptococcal, n, Antibiotics, e, Yeasts, e, Antibiotics, n, Microbial, s, Staphylococcus, r, Antibiotics, c, Microbial, i, Schizosaccharomyces, o, Cell cultures, i, Anaerobe, a, Prokaryotes, s, Yeasts, e, Bactericidal, i, Escherichia coli, a, Cell suspensions, o, Pseudomonas aeruginosa

Scientific Publications - Work Done by Microbiology Reader Bioscreen C
Agricultural Microbiology Anaerobic Microbiology Antimicrobial Susceptibility Artificial Atmosphere Bioassay of Antibiotics Biofilm Microbiology Bioreactor Technology Biotechnology Cell Biology Clinical Microbiology Environmental Microbiology Experiments with Yeast	Fermentation Food Microbiology Functional Genomics Gene Technology Growth Media Development Growth Rate and Lag Time Industrial Microbiology Medical/Pharmaceutical Field Microbiological Assay Microbiological Research Microbiology of Cosmetics go to a specific theme...	Military Microbiology Molecular Microbiology Mutagenicity and Genotoxicity Oral Microbiology Patents Postantibiotic Studies Soil Microbiology Spore Microbiology Veterinary Microbiology Waste/Wastewater Treatment Water Microbiology Wine Microbiology

� 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com

Last modified: May 25, 2005