|
|
|
Journal of Bacteriology, October 2003, p . 5831-5837, Vol . 185, No . 19 The Geobacillus stearothermophilus V iscS Gene, Encoding Cysteine Desulfurase, Confers Resistance to Potassium Tellurite in Escherichia coli K-12Juan C . Tantaleán,1 Manuel A . Araya,1 Claudia P . Saavedra,1 Derie E . Fuentes,1 José M . Pérez,1 Iván L . Calderón,1 Philip Youderian,2 and Claudio C . Vásquez1* Laboratorio de Microbiología Molecular, Facultad de Química y Biología, Universidad de Santiago de Chile, Santiago, Chile,1 Department of Biology, Texas A&M University, College Station, Texas 838432 Received 4 April 2003/ Accepted 16 July 2003
To understand the basis of tellurite toxicity at the molecular level, we are exploring the mechanisms by which microbes are resistant to this anion . Several bacteria are naturally resistant to potassium tellurite, and both the genetic and biochemical bases of this resistance appear to be diverse . Tellurite resistance determinants are found both in bacterial chromosomes and in plasmids (22, 27) . The gram-positive bacterium Geobacillus stearothermophilus V, formerly Bacillus stearothermophilus V (16), is naturally resistant to high levels of tellurite (30, 31) . Our work has focused on the identification and characterization of G . stearothermophilus genes that confer tellurite resistance when expressed in Escherichia coli . We have constructed gene libraries from G . stearothermophilus in high-copy-number plasmids, transformed sensitive E . coli hosts with these libraries, and selected for tellurite-resistant clones . Using this strategy, Vásquez et al . have found that the cysK gene of G . stearothermophilus confers a tellurite resistance phenotype in E . coli (30, 31) . CysK catalyzes the synthesis of cysteine from O-acetyl serine and sulfide as substrates, the terminal, rate-limiting step in cysteine biosynthesis . The cysK genes from other microorganisms have also been shown to confer tellurite resistance in E . coli (1, 17) . In this paper, we show that the expression of G . stearothermophilus cysteine desulfurase (IscS), a second enzyme involved in cysteine metabolism, also confers tellurite resistance in E . coli . Cysteine desulfurases sack the sulfur atom from cysteine to construct and repair [Fe-S] clusters in protein substrates that, in turn, catalyze essential redox reactions in critical metabolic pathways . We have sequenced the G . stearothermophilus iscS gene, expressed its product in E . coli, and purified the IscS enzyme to homogeneity . We show that tellurite resistance depends on the activity of the IscS enzyme, supporting the hypothesis that essential proteins with iron-sulfur [Fe-S] clusters are among the main targets of the oxidative damage caused by tellurite in E . coli .
Plasmid constructions and genetic manipulations. To clone the fragment of the G . stearothermophilus genome with the iscS gene, G . stearothermophilus DNA was cleaved with HindIII and ligated to plasmid vector pSP72 (Promega) . Ligation mixes were electroporated into E . coli JM109, and tellurite-resistant clones were selected (30, 31) . The sequence of the 3,461-bp G . stearothermophilus insert in p2VH (a plasmid that confers resistance to tellurite) was determined . DNA fragments used to subclone ORF687, ORF1200, and ORF963 of G . stearothermophilus were amplified using PCR with primer pair 5'-GGAATTCCATATGTATAAGGATGATCAGGAAATAGA and 5'-ACCCAAGCTTCTAGAGCGTGATCAGGTCTTTGT, primer pair 5'-GGAATTCCATATGAATCTTGAACAAATAAGAAAAGATACC and 5'-ACCCAAGCTTTCATTGCTGTCCCTCTTTCCTTAT, and primer pair 5'-GGAATTCCATATGAATAAATTTTTGCTTGAATCTGC and 5'-ACCCAAGCTTTCATATCAGAATCTTCCCATCCT, respectively (boldface characters indicate NdeI [CATATG] and HindIII [AAGCTT] restriction sites) . PCR products were cleaved with NdeI and HindIII and ligated to the same sites of pET21b (Novagen) to generate plasmids pJT687, pJT1200, and pJT963, respectively . pJT1200-Pr, which has the G . stearothermophilus iscS gene with its own promoter, was made by amplifying iscS with primers ACCCAAGCTTAAAACCGGGAATGGCATTCAC and ACCCAAGCTTCATTGCTGTCCCTCTTTCCTTAT, cleaving the product with HindIII, and ligating the product to plasmid pBluescript .
DNA fragments of G . stearothermophilus from which 90, 150, and 210 bp of the 3' end of the iscS gene were deleted were amplified by PCR and ligated to the NdeI and HindIII sites of pET21b to construct plasmids pJT1200( Overexpression and purification of cysteine desulfurase. E . coli JM109(DE3) cells carrying pJT1200 were grown in LB with ampicillin at 37°C to an optical density at 600 nanometers of 0.6 . Expression of iscS was induced with 1 mM isopropyl-ß-D-thiogalactopyranoside (IPTG) for an additional 5 h . Cells were harvested by centrifugation at 4,500 x g for 10 min and stored at -20°C or used immediately with identical results . Induced cells showed a characteristic intense yellow color due to the presence of the pyridoxal phosphate (PLP) cofactor in the overproduced cysteine desulfurase . Cell pellets were thawed on ice and resuspended in 5 ml of buffer A (20 mM Tris-HCl [pH 8.0], 5% glycerol) . Cells were sonicated in the presence of 10 µg of phenylmethylsulfonyl fluoride/ml and centrifuged at 13,000 x g for 15 min, and supernatants were diluted with an equal volume of buffer A and incubated at 70°C for 20 min with gentle swirling . After chilling on ice, extracts were centrifuged at 13,000 x g for 15 min and supernatants were applied to a series of AffiGel Blue (Bio-Rad; 2 ml), CM-Sepharose (Whatman; 4 ml), and DEAE-Sepharose (Whatman; 3 ml) columns . IscS flowed through the first two columns and adsorbed to the DEAE-Sepharose column, which was washed with buffer B (10 mM Tris-HCl [pH 8.0], 5% glycerol) prior to elution using a linear gradient of 0 to 0.15 M NaCl in buffer B . Protein in eluted fractions (1.0 ml) was monitored by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and UV spectrophotometry; fractions with IscS were pooled and applied to a BioHTP (Bio-Rad; 1 ml) column for concentration, washed, eluted with 0.25 M potassium phosphate buffer, and dialyzed against buffer A . Using bovine serum albumin as a standard, protein concentrations were determined with a Bradford protein assay kit (Bio-Rad) . The purity of IscS was estimated to be >98% as judged by SDS-PAGE . The apparent molecular mass of the IscS monomer was determined by SDS-PAGE using alcohol dehydrogenase (150 kDa), bovine serum albumin (66 kDa), ovalbumin (45 kDa), carbonic anhydrase (29 kDa), lysozyme (14 kDa), and cytochrome c (12.4 kDa) (Sigma) as prestained protein standards . The apparent molecular mass of the native enzyme in buffer A containing 250 mM NaCl was estimated by size exclusion chromatography using a Sephadex G 50-100 column (1 by 45 cm) and the same standards . Antibody preparation and Western immunoblotting. Antiserum against IscS was prepared by immunizing a female Rockefeller mouse intraperitoneally . Polyacrylamide gel slices containing IscS were fragmented, incubated with 0.5 ml of 0.9% NaCl for 24 h at 4°C, and centrifuged at 10,000 x g for 5 min at 4°C . A total of 100 µl of the supernatant (with about 100 µg of IscS) was mixed with an equal volume of Freund's incomplete adjuvant (Gibco-BRL) for each of three injections given to the mouse at 10-day intervals . At 1 week after the last injection, serum was obtained from blood by low-speed centrifugation . Western blotting experiments were performed as described previously (14) . Membranes were blocked with a suspension of 1% powdered milk in IS buffer (15 mM sodium phosphate, 1% NaCl, 0.002% KCl, pH 7.4) for 45 min, incubated with mouse anti-IscS antiserum (diluted 1:2,500 in IS buffer) for 45 min, washed three times with 0.02% Tween 20 in IS buffer for 5 min, incubated with alkaline phosphatase-conjugated goat anti-mouse immunoglobulin G serum (diluted 1:10,000) for 45 min, and washed three times for 5 min . Blots were developed in 20 ml of 0.1 M Tris-HCl (pH 9.5)-0.1 M NaCl-5 mM MgCl2-0.1 mg of Nitro Blue Tetrazolium/ml-0.05 mg of BCIP (5-bromo-4-chloro-3-indolylphosphate)/ml for 10 min at 37°C, washed with water, and dried . The anti-IscS antiserum cross-reacts with only one protein band in extracts from E . coli JM109(DE3)/pJT1200; this band is not present in extracts from E . coli JM109(DE3) . Enzyme assays for cysteine desulfurase activity. The activity of G . stearothermophilus IscS was determined by measuring the rate of production of thiocyanate from reaction mixtures (100 µl) containing 50 mM Tris-HCl (pH 8.0), 10 mM cysteine, 1 mM MgCl2, 10 mM KCN, and enzyme, as described previously (32) . After incubation for 2 h at 50°C, 250 µl of 15% formaldehyde and 750 µl of ferric nitrate [6.67% Fe(NO3)3 · 9H2O (wt/vol), 8.67% HNO3 (vol/vol) in H2O] were added, the mixtures were centrifuged at 13,000 x g for 3 min, and the concentrations of ferric thiocyanate were determined by absorbance at 460 nm . One unit of enzyme activity is defined as the amount of enzyme that catalyzes the formation of 1 nmol of thiocyanate/min; specific activities are given as units per milligram of total protein . Nucleotide sequence accession number. The sequence determined for the 3,461-bp G . stearothermophilus insert in p2VH has been assigned GenBank accession no . AF533655 .
We favor a combination of the last two mechanisms named, in which tellurite toxicity results from the generation of O2- radicals formed upon tellurite reduction (27) which in turn causes specific damage to one or more critical proteins with [Fe-S] clusters . Two lines of evidence support this hypothesis . As shown in Table 1, a mutant of E . coli deficient in superoxide dismutase activity was hypersensitive to tellurite . Because superoxide is the substrate of superoxide dismutase, this result demonstrates genetically that tellurite toxicity results from the generation of superoxide radicals . Consistent with this genetic result, when E . coli cells were grown anaerobically they were less sensitive to tellurite and this toxic compound had a MIC 10-fold higher than that seen when cells were grown aerobically (data not shown) .
When E . coli is grown in minimal medium, the principal target of superoxide damage is dihydroxy-acid dehydratase (8, 12) . This result suggests that when E . coli is grown in rich medium, other, essential enzymes with [Fe-S] clusters are the principal targets of superoxide damage . The G . stearothermophilus V iscS gene confers tellurite resistance in E . coli. G . stearothermophilus is naturally resistant to potassium tellurite . To identify potential genes involved in this resistance, we constructed libraries of G . stearothermophilus genomic DNA in several different plasmid vectors . One of these libraries was made with plasmid vector pSP72 and electroporated into E . coli strain JM109 . Subclones with a tellurite resistance phenotype were selected as colonies able to grow on plates with 10 µM potassium tellurite . As shown in Table 1, the host E . coli K-12 strain JM109, as well as JM109 with plasmid pSP72, is sensitive to the toxic anion tellurite, which has a MIC of 1.25 µg/ml for this strain . In contrast, strain JM109 carrying plasmid p2VH, a derivative of pSP72 containing an insert of 3.5 kb, is resistant to tellurite (MIC of 12.5 µg/ml) . The sequence of the insert in this plasmid contains three large open reading frames (ORFs) of 687, 1,200, and 963 bp . BLASTp analysis (2) showed that the predicted products of these ORFs were most similar to a Bacillus anthracis A2012 metallopeptidase (53% identity/69% similarity) (18), a putative cysteine desulfurase of Methanosarcina mazei Goe1 (35% identity/57% similarity) (6), and a Methanopyrus kandleri AV19 aminodipeptidase (29% identity/42% similarity) (24) . To determine which of these three ORFs conferred tellurite resistance, DNA fragments corresponding to each ORF were amplified using the PCR and ligated to plasmid vector pET21b . Derivatives of E . coli JM109(DE3) with the recombinant plasmids, pJT687, pJT1200 and pJT963, were tested for tellurite resistance . Plasmid pET21b placed the expression of a cloned gene under the transcriptional control of the coliphage T7 early promoter . In the host strain E . coli JM109(DE3), the addition of IPTG induced the expression of T7 RNA polymerase, which in turn directed the high-level expression of a subcloned gene . In the absence of IPTG, there was a basal level of transcription of genes cloned in the proper orientation in this plasmid from fortuitous promoters overlapping the early T7 promoter and a low level of expression of their products . As shown in Table 1, tellurite had a low MIC of 1.25 µg/ml for the E . coli K-12 host strain JM109(DE3) as well as for JM109(DE3) carrying pET21b (and similar to the tellurite MIC for JM109) . Among the three plasmids with subcloned inserts, only plasmid pJT1200 (with the iscS gene) conferred tellurite resistance (Table 1) . To support our gene assignments, derivatives of JM109(DE3) carrying each plasmid derivative of pET21b were grown in liquid culture to the exponential phase and the production of proteins encoded by each inserted ORF was induced by the addition of IPTG . Samples were taken before and after induction; intracellular proteins were resolved by SDS-PAGE, and their patterns were revealed by staining with Coomassie blue . After induction, each protein profile contained a single additional band corresponding in apparent molecular mass (35, 45, and 25 kDa) to the molecular mass of the predicted product of each ORF (34.5, 44.8, and 25.2 kDa, respectively) (data not shown) . As we show below by the results of a combination of biochemical and genetic experiments, the iscS gene, ORF1200, encodes a cysteine desulfurase . Unlike the case for other microbes, the G . stearothermophilus iscS gene does not appear to be within an operon containing other genes involved in de novo [Fe-S] cluster formation . In the genomes of most microbes, homologues of iscS are adjacent to homologues of the icsU gene; however, this is not the case for several gram-positive bacterial genomes, including that of G . stearothermophilus . The G . stearothermophilus IscS protein is a cysteine desulfurase. The G . stearothermophilus iscS gene, subcloned in plasmid pJT1200, codes for a protein that has 35% identity and 57% similarity with the putative cysteine desulfurase of M . mazei and lower identities with other cysteine desulfurases . We purified G . stearothermophilus IscS to homogeneity and demonstrated that it has cysteine desulfurase activity . To purify G . stearothermophilus IscS, we grew E . coli strain JM109(DE3) with plasmid pJT1200 to exponential density and induced the expression of the iscS gene from the T7 promoter by the addition of IPTG . As shown in Fig . 1, after induction, a band of the apparent molecular mass of the predicted product of iscS represented about 10 to 20% of the total protein in soluble cell extracts made from induced cells . Because G . stearothermophilus is a thermophile, the next step in this purification involved the incubation of soluble cell extracts at 70°C for 20 min . This step eliminated almost 75% of the starting total protein in these extracts without an appreciable loss of IscS protein or cysteine desulfurase activity . Subsequent column chromatography steps resulted in enzyme preparations that were >98% pure (Fig . 1) .
Then we elected to make a directed change of residue Lys-213, a residue that likely binds the PLP cofactor, because it is conserved in the predicted primary sequences of the cysteine desulfurases from both gram-positive and -negative bacteria as well as Saccharomyces cerevisiae (32) . The codon for this residue was replaced with a codon for alanine to make the mutant iscS-K213A gene, which was then cloned into plasmid expression vector pET21b and introduced into host E . coli JM109(DE3) . Table 1 shows that a strain carrying this plasmid did not confer increased tellurite resistance in E . coli . This strain was grown to exponential density, production of the mutant K213A protein was induced with IPTG, and the mutant K213A protein was purified to homogeneity . To purify this protein we used the procedure used for the wild-type enzyme with the exception that the step involving the initial heat treatment of the crude lysate was omitted, because the mutant protein could not be recovered if this step was included . Unlike extracts containing the wild-type IscS protein, extracts with the mutant K213A protein did not have an intense yellow color (consistent with the idea that residue Lys213 is critical for PLP adduction) . The UV-visible spectrum of the purified mutant protein was missing the absorbance peak characteristic of PLP-containing enzymes (Fig . 2B), and enzyme assays showed that the purified mutant protein had less than 10% of the specific activity of the wild-type protein (data not shown) . The G . stearothermophilus V iscS gene partially complements an E . coli iscS defect. Cysteine desulfurases are required for the assembly of [Fe-S] clusters in other enzymes, including dehydratases, aconitase (11), and fumarase (13) . In E . coli K-12, the predominant cysteine desulfurase activity is the product of the E . coli iscS gene . Under aerobic growth conditions, mutations in E . coli iscS confer auxotrophy for thiamine and nicotinic acid in minimal medium and slow its rate of growth in rich medium (20, 23) . To confirm by a genetic test that the G . stearothermophilus IscS protein is a cysteine desulfurase, we asked whether a plasmid with the G . stearothermophilus iscS gene could complement an E . coli iscS defect . As shown in Table 1, PK6311, a strain of E . coli with a substitution of a kanamycin resistance cassette for the iscS gene (21), was hypersensitive to tellurite . In contrast, a recombinant derivative of this strain with plasmid pJT1200-Pr (carrying both the G . stearothermophilus iscS gene and its upstream promoter) was resistant to tellurite (Table 1) . In addition, the recombinant strain retained the auxotrophy for nicotinic acid but not for thiamine (Table 3) . These results show that the G . stearothermophilus iscS gene can complement only one of the two auxotrophies of the E . coli iscS mutant . Although the overproduction of another cysteine desulfurase in E . coli has been shown to be toxic (26), it is unlikely that the constitutive expression of the G . stearothermophilus iscS gene from plasmid pJT1200-Pr is toxic under these conditions . An iscS+ E . coli strain with this plasmid grew in rich medium at the same rate as otherwise isogenic strains that included the plasmid vector used to clone the G . stearothermophilus iscS gene or that had no plasmid (unpublished results) .
Why does the overexpression of G . stearothermophilus IscS confer tellurite resistance in E . coli? Three other metabolic enzymes have been shown to contribute to tellurite resistance in eubacteria: nitrate reductase (3), thiopurine methyltransferase (5), and cysteine synthase (1, 15, 31) . Both nitrate reductase (3) and thiopurine methyltransferase (5) catalyze covalent modifications of tellurite which result in the direct detoxification of this strong oxidizing agent . The overexpression of cysteine synthase results in increased resistance to tellurite in E . coli (31), likely because cysteine synthase immediately precedes cysteine desulfurase in the pathway for de novo [Fe-S] cluster biosynthesis . Cysteine synthase catalyzes the rate-limiting step in the biosynthesis of cysteine, a substrate of cysteine desulfurase, which may be a rate-limiting step in the pathway for de novo [Fe-S] cluster biosynthesis . Alternatively, iron availability may be rate limiting for this step in [Fe-S] cluster formation . These results support the idea that the primary targets for damage by superoxide radicals are one or more essential proteins with [Fe-S] clusters . The simplest version of this hypothesis is that the primary targets for oxidative damage caused by tellurite in E . coli are essential proteins containing [Fe-S] clusters . Expression of G . stearothermophilus iscS in an E . coli iscS mutant conferred increased resistance to tellurite, suggesting that G . stearothermophilus V IscS can replenish or repair these essential target proteins . An E . coli iscS mutant showed increased sensitivity to tellurite, arguing that E . coli IscS also replenishes or repairs these essential targets . However, mutations in the E . coli iscS gene are not lethal . An E . coli iscS mutant was able to grow in rich medium, arguing that if this hypothesis is correct, E . coli must make a cysteine desulfurase in addition to IscS that can insert [Fe-S] clusters into these essential target proteins . The E . coli K-12 genome includes three genes, iscS, sufS, and nifS, predicted to encode cysteine desulfurases . These enzymes use as their substrates not only cysteine (and/or selenocysteine) but also the large number of proteins that accept [Fe-S] clusters . Therefore, members of the small family of cysteine desulfurases must have broad, overlapping protein substrate specificities . This conclusion is supported by the recent finding that pseudorevertants of mutants with an iscS defect overexpress the suf operon and that isc suf double mutants are likely synthetically lethal (26) . We have shown that although the cysteine desulfurase from G . stearothermophilus V can complement the thiamine auxotrophy, one of the metabolic defects due to a mutation in the E . coli iscS gene, it cannot complement the auxotrophy of this mutant for nicotinic acid and cannot fully restore the slow-growth phenotype of an E . coli iscS mutant grown in rich medium . On the other hand, it is surprising that G . stearothermophilus IscS, which shares little sequence similarity with E . coli IscS, was able to complement a subset of the defective functions in an E . coli iscS mutant . Thus, the cysteine desulfurases are likely to have different spectra of specificities for their protein substrates . We are now testing whether mutations in sufS confer increased sensitivity to tellurite, because this redundant desulfurase may also contribute to the kinetics of insertion or repair of [Fe-S] clusters in these essential target proteins .
J.C.T . was supported by a doctoral fellowship from the DAAD (Germany), and M.A.A . and D.E.F . were supported by doctoral fellowships from MECESUP (Chile) . This work was supported by grants 1990917 and 1030234 from FONDECYT (Chile) to C.C.V . and by grant GM53392 from the National Institutes of Health to P.Y .
What Is Botulism?,
What Is Pcr?,
What Is Water Purification?,
What Is MIC?,
What Is Biofilter?,
s,
Microorganisms,
i,
Microbiology,
o,
Microbe,
e,
Microorganism,
n,
Microbes,
r,
Escherichia coli,
r,
Yeasts,
a,
Antimicrobials,
e,
Yeasts,
e,
Bacillus,
i,
Escherichia coli,
r,
Yeasts,
n,
Microorganisms,
r,
Culture medium,
e,
Prokaryotes,
r,
Escherichia coli,
i,
Bacteriophage,
r,
Antimicrobials,
o,
Haemophilus,
n,
Vibriosis,
r,
S. cerevisiae,
e,
Burkholderia,
n,
Staphylococcus,
o,
Vibriosis,
o,
Staphylococcus aureus,
c,
Vibriosis
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||