|
|
Nucleic Acids Res, 2004 Oct 11, 32(18), 5379 - 91 Print 2004. A high resolution protein interaction map of the yeast Mediator complex; Guglielmi B et al.; Mediator is a large, modular protein complex remotely conserved from yeast to man that conveys regulatory signals from DNA-binding transcription factors to RNA polymerase II . In Saccharomyces cerevisiae, Mediator is thought to be composed of 24 subunits organized in four sub-complexes, termed the head, middle, tail and Cdk8 (Srb8-11) modules . In this work, we have used screening and pair-wise two-hybrid approaches to investigate protein-protein contacts between budding yeast Mediator subunits . The derived interaction map includes the delineation of numerous interaction domains between Mediator subunits, frequently corresponding to segments that have been conserved in evolution, as well as novel connections between the Cdk8 (Srb8-11) and head modules, the head and middle modules, and the middle and tail modules . The two-hybrid analysis, together with co-immunoprecipitation studies and gel filtration experiments revealed that Med31 (Soh1) is associated with the yeast Mediator that therefore comprises 25 subunits . Finally, analysis of the protein interaction network within the Drosophila Mediator middle module indicated that the structural organization of the Mediator complex is conserved from yeast to metazoans . The resulting interaction map provides a framework for delineating Mediator structure-function and investigating how Mediator function is regulated. Adv Biophys, 2004, 38(Complete), 215 - 232 Molecular mechanism of vde-initiated intein homing in yeast nuclear genome; Fukuda T et al.; In Saccharomyces cerevisiae, VMAI intein encodes a homing endonuclease termed VDE which is produced by an autocatalytic protein splicing reaction . VDE introduces a DSB at its recognition sequence on intein-minus allele, resulting in the lateral transfer of VMAI intein . In this review, we summarize a decade of in vitro study on VDE and describe our recent study on the in vivo behavior of both VDE and host proteins involved in intein mobility . Meiotic DSBs caused by VDE are repaired in the similar pathway to that working in meiotic recombination induced by Spollp-mediated DSBs . Meiosis-specific DNA cleavage and homing is shown to be guaranteed by the two distinct mechanisms, the subcellular localization of VDE and a requirement of premeiotic DNA replication . Based on these lines of evidence, we present the whole picture of molecular mechanism of VDEinitiated homing in yeast cells. Exp Cell Res, 2004 Nov 1, 300(2), 345 - 53 Starvation for an essential amino acid induces apoptosis and oxidative stress in yeast; Eisler H et al.; Protracted starvation of auxotrophic Saccharomyces cerevisiae strains for an essential amino acid is commonly used to allow investigation of adaptive mutation mechanisms during starvation-induced cell cycle arrest . Under these conditions, the majority of cells dies during the first 6 days . We investigated starving cells for markers of programmed cell death and for the production of reactive oxygen species (ROS) . We observed that protracted starvation for lysine or histidine resulted in an increasing number of cells exhibiting DNA fragmentation and chromatin condensation, thus an apoptotic phenotype . Not only respiration-competent cells but also respiratory deficient rho0 cells were able to undergo programmed cell death . In addition the starving cells rapidly exhibited indicators of oxidative stress, independently of their respiratory competence . These results indicate that starvation for an essential amino acid results in severe cell stress, which may finally be the trigger of programmed cell death. Biochem Biophys Res Commun, 2004 Nov 12, 324(2), 686 - 91 Enhancement of pheromone response by RGS9 and Gbeta5 in yeast; Ajit SK et al.; The G-protein gamma-subunit-like (GGL) domain present within a subfamily of RGS proteins binds specifically to Gbeta5 . This interaction and resulting biological effect impacts the standard model of heterotrimeric G-protein signaling . It has been hypothesized that the RGS/Gbeta5 may potentially substitute for Gbetagamma in the heterotrimeric complex . Saccharomyces cerevisiae pheromone responsive mating signaling pathway is primarily driven by Gbetagamma . We evaluated GGL containing RGS9 and RGS7 for functional complementation in a RGS (sst2Delta) knockout yeast strain . The potential of Gbeta5 to augment the function of these RGS proteins was also evaluated . While Gbeta5 had no effect on RGS7, coexpression of Gbeta5 with RGS9 enhanced cell cycle arrest, suggesting that under certain conditions, RGS9 and Gbeta5 may possibly function as betagamma dimer . Furthermore, we demonstrate that Gbeta5 can complement a ste4Delta, the yeast beta-subunit, thus providing the first evidence of functional complementation of a mammalian Gbeta. FEBS Lett, 2004 Oct 8, 576(1-2), 161 - 4 Mouse acetylcholinesterase interacts in yeast with the extracellular matrix component laminin-1beta; Paraoanu LE et al.; Acetylcholinesterase (AChE) is likely to have roles other than the hydrolysis of acetylcholine, e.g., related to developmental processes like neurite outgrowth, differentiation and adhesion . Here, we investigated whether AChE can function as a heterophilic cell adhesion molecule and searched for proteins interacting with it . Using the yeast two-hybrid method and a mouse brain cDNA library, we have identified an interaction between a partial cDNA encoding the globular domain IV of laminin chain beta1 and the amino acids 240-503 of mouse AChE . Biochemical co-immunoprecipitation assays confirmed the genetic results . We suggest that AChE, by interacting with laminin-1, is able to exert changes in adhesion signaling pathways . Annu Rev Cell Dev Biol, 2004, 20, 559 - 91 Mechanisms of polarized growth and organelle segregation in yeast; Pruyne D et al.; Cell polarity, as reflected by polarized growth and organelle segregation during cell division in yeast, appears to follow a simple hierarchy . On the basis of physical cues from previous cell cycles or stochastic processes, yeast cells select a site for bud emergence that also defines the axis of cell division . Once polarity is established, rho protein-based signal pathways set up a polarized cytoskeleton by activating localized formins to nucleate and assemble polarized actin cables . These serve as tracks for the transport of secretory vesicles, the segregation of the trans Golgi network, the vacuole, peroxisomes, endoplasmic reticulum, mRNAs for cell fate determination, and microtubules that orient the nucleus in preparation for mitosis, all by myosin-Vs encoded by the MYO2 and MYO4 genes . Most of the proteins participating in these processes in yeast are conserved throughout the kingdoms of life, so the emerging models are likely to be generally applicable . Indeed, several parallels to cellular organization in animals are evident. Annu Rev Cell Dev Biol, 2004, 20, 1 - 28 The budding yeast spindle pole body: structure, duplication, and function; Jaspersen SL et al.; Nucleation of microtubules by eukaryotic microtubule organizing centers (MTOCs) is required for a variety of functions, including chromosome segregation during mitosis and meiosis, cytokinesis, fertilization, cellular morphogenesis, cell motility, and intracellular trafficking . Analysis of MTOCs from different organisms shows that the structure of these organelles is widely varied even though they all share the function of microtubule nucleation . Despite their morphological diversity, many components and regulators of MTOCs, as well as principles in their assembly, seem to be conserved . This review focuses on one of the best-characterized MTOCs, the budding yeast spindle pole body (SPB) . We review what is known about its structure, protein composition, duplication, regulation, and functions . In addition, we discuss how studies of the yeast SPB have aided investigation of other MTOCs, most notably the centrosome of animal cells. Yi Chuan Xue Bao, 2004 Jul, 31(7), 668 - 74 {The Elp4 subunit of human Elongator complex partially complements the growth defects of yeast ELP4 deletion strain}; Li F et al.; In this study, we performed in vivo experiments to determine the function of human Elongator subunit Elp4 by using a yeast complementary system . Our results indicated that though human ELP4 was not able to complement the growth defects of the ELP4 deletion mutant strain to high concentration salt, it partially reduced the sensitivity of mutant strain to caffeine, high temperature and 6-AU . Gene expression analysis indicated that human ELP4 partially resumed the slow activation of the PHO5 gene caused by the deletion of yELP4 under the low phosphate concentration . Meanwhile, under the condition of heat shock treatment, hELP4 increased the expression level of SSA3 gene . All these data demonstrated that human ELP4 can partially complement the growth defects and restore the slow activation of certain genes of the yELP4 deletion strain . These results indicate that human Elp4 subunit has similar functions to that of the yeast. Cell Biochem Funct . 2004 Oct 7; {Epub ahead of print} A novel link between a Rab GTPase and Rvs proteins: the yeast amphiphysin homologues; Talarek N et al.; The BAR proteins are a well-conserved family of proteins including Rvsp in yeast, amphiphysins and Bin proteins in mammals . In yeast, as in mammals, BAR proteins are known to be implicated in vesicular traffic . The Gyp5p (Ypl249p) and Ymr192p proteins interact in two-hybrid tests with both Rvs161p and Rvs167p . Gyp5p is a Ypt/Rab-specific GAP and Ymr192p is highly similar to Gyp5p . To specify the interaction between Rvsp and Gyp5p, we used two-hybrid tests to determine the domains necessary for these interactions . The specific SH3 domain of Rvs167p interacted with the N-terminal domain of Gyp5p . Moreover, Gyp5p could form a homodimer . Fus2 protein is a specific partner of Rvs161p in two-hybrid tests . To characterize the functional relationships between these five proteins, we have studied cellular phenotypes in single, double and triple mutant strains for which rvs mutants present defects, such as polarity, cell fusion and meiosis . Phenotypic analysis showed that Gyp5p, Ymr192p and Fus2p were involved in bipolar budding pattern and in meiosis . Specific epistasis or suppressive phenomena were found between the five mutations . Finally, The Gyp5p-GFP fusion protein was localized at the bud tip during apical growth and at the mother-bud neck during cytokinesis . Moreover, Rvs167p and Rvs161p were shown to be essential for the correct localization of Gyp5p . Altogether, these data support the hypothesis that both Rvsp proteins act in vesicular traffic through physical and functional interactions with Ypt/Rab regulators . Copyright (c) 2004 John Wiley & Sons, Ltd. Lab Chip, 2004 Oct, 4(5), 488 - 94 Epub 2004 Sep 14. Microfluidic biosensing systems . Part II . Monitoring the dynamic production of glucose and ethanol from microchip-immobilised yeast cells using enzymatic chemiluminescent micro-biosensors; Davidsson R et al.; A microfluidic flow injection (microFIA) system was employed for handling and monitoring of cell-released products from living cells immobilised on silicon microchips . The dynamic release of glucose and ethanol produced from sucrose by immobilised Saccharomyces cerevisiae cells was determined using microchip biosensors (micro-biosensors) with either co-immobilised glucose oxidase-horseradish peroxidase (GOX-HRP), or alcohol oxidase-horseradish peroxidase (AOX-HRP), catalysing a series of reactions ending up with chemiluminescence (CL) generated from HRP-catalysed oxidation of luminol in presence of p-iodophenol (PIP) . The yeast cells were attached by first treating them with polyethylenimine (PEI) followed by adsorption to the microchip surface . The cell loss during assaying was evaluated qualitatively using scanning electron microscopy (SEM), showing that no cells were lost after 35 min liquid handling of the cell chip at 10 microl min(-1) . The enzymes were immobilised on microchips via PEI-treatment followed by glutaraldehyde (GA) activation . The GOX-HRP micro-biosensors could be used during five days without any noticeable decrease in response, while the AOX-HRP micro-biosensors showed continuously decreasing activity, but could still be used employing calibration correction . The glucose and ethanol released from the immobilised yeast chips were quantitatively monitored, by varying the incubation time with sucrose, showing the possibilities and advantages of using a microfluidic system set-up for cell-based assays. Biol Proced Online, 2004, 6, 209 - 219 Epub 2004 Oct 01. Using the cre-lox recombination system to assess functional impairment caused by amino acid substitutions in yeast proteins; Shirley RL et al.; A method was developed to assess the functional significance of a sequence motif in yeast Upf3p, a protein required for nonsense-mediated mRNA decay (NMD) . The motif lies at the edge of the Upf3p-Upf2p interaction domain, but at the same time resembles the canonical leucine-rich nuclear export sequence (NES) found in proteins that bind Crm1p exportin . To test the function of the putative NES, site-directed mutations that cause substitutions of conserved NES-A residues were first selected to identify hypermorphic alleles . Next, a portable Crm1p-binding NES from HIV-1 Rev protein that functions in yeast was fused en masse to the C-terminus of variant Upf3 proteins using loxP sites recognized by bacterial cre-recombinase . Finally, variant Upf3-Rev proteins that were functional in NMD were selected and examined for the types of amino acid substitutions present in NES-A . The mutational analysis revealed that amino acid substitutions in the Upf3 NES impair both nuclear export and the Upf2p-Upf3p interaction, both of which are required for Upf3p to function in NMD . The method described in this report could be modified for the genetic analysis of a variety of portable protein domains. Biol Proced Online, 2004, 6, 204 - 208 Epub 2004 Oct 01. Peptide substrate identification for yeast Hsp40 Ydj1 by screening the phage display library; Li J et al.; We have identified a peptide substrate for molecular chaperone Hsp40 Ydj1 by utilizing the combination of phage display library screening and isothemol titration calirimetry (ITC) . The initial peptide substrate screening for Hsp40 Ydj1 has been carried out by utilizing a 7-mer phage display library . The peptide sequences from the bio-panning were synthesized and object to the direct affinity measurement for Hsp40 Ydj1 by isothemol titration calirimetry studies . The peptide which has the measurable affinity with Ydj1 shows enriched hydrophobic residues in the middle of the substrate fragment . The peptide substrate specificity for molecular chaperone Hsp40 has been analyzed. EMBO Rep, 2004 Nov, 5(11), 1096 - 101 Iron-induced oligomerization of yeast frataxin homologue Yfh1 is dispensable in vivo; Aloria K et al.; The neurodegenerative disease Friedreich's ataxia is caused by reduced levels of frataxin, a mitochondrial matrix protein . The in vivo role of frataxin is under debate . Frataxin, as well as its yeast homologue Yfh1, binds multiple iron atoms as an oligomer and has been proposed to function as a crucial iron-storage protein . We identified a mutant Yfh1 defective in iron-induced oligomerization . This mutant protein was able to replace functionally wild-type Yfh1, even when expressed at low levels, when mitochondrial iron levels were high and in mutant strains having deletions of genes that had synthetic growth defects with a YFH1 deletion . The ability of an oligomerization-deficient Yfh1 to function in vivo suggests that oligomerization, and thus oligomerization-induced iron storage, is not a critical function of Yfh1 . Rather, the capacity of this oligomerization-deficient mutant to interact with the Isu protein suggests a more direct role of Yfh1 in iron-sulphur cluster biogenesis. Plant Cell, 2004 Nov, 16(11), 2940 - 53 Epub 2004 Oct 07. A mechanism related to the yeast transcriptional regulator Paf1c is required for expression of the Arabidopsis FLC/MAF MADS box gene family; Oh S et al.; The Arabidopsis thaliana VERNALIZATION INDEPENDENCE (VIP) gene class has multiple functions in development, including repression of flowering through activation of the MADSbox gene FLC . Epigenetic silencing of FLC plays a substantial role in the promotion of flowering through cold (vernalization) . To better understand how VIP genes influence development, we undertook a genetic and molecular study of the previously uncharacterized VIP5 and VIP6 genes . We found that loss of function of these genes also resulted in downregulation of other members of the FLC/MAF gene family, including the photoperiodic pathway regulator MAF1/FLM . We cloned VIP5 and VIP6 through mapping and transcriptional profiling . Both proteins are closely related to distinct components of budding yeast Paf1C, a transcription factor that assists in establishment and maintenance of transcription-promotive chromatin modifications such as ubiquitination of H2B by Bre1/Rad6 and methylation of histone H3 lysine-4 by the trithorax-related histone methylase Set1 . Genetic analysis and coimmunoprecipitation experiments suggest that VIP5 and VIP6 function in the same mechanism as the previously described VIP3 and VIP4 . Our findings suggest that an evolutionarily conserved transcriptional mechanism plays an essential role in the maintenance of gene expression in higher eukaryotes and has a central function in flowering. J Biol Chem, 2004 Dec 31, 279(53), 55520 - 30 Epub 2004 Oct 07. Chromatin domain boundaries delimited by a histone-binding protein in yeast; Ferrari S et al.; When located next to chromosomal elements such as telomeres, genes can be subjected to epigenetic silencing . In yeast, this is mediated by the propagation of the SIR proteins from telomeres toward more centromeric regions . Particular transcription factors can protect downstream genes from silencing when tethered between the gene and the telomere, and they may thus act as chromatin domain boundaries . Here we have studied one such transcription factor, CTF-1, that binds directly histone H3 . A deletion mutagenesis localized the barrier activity to the CTF-1 histone-binding domain . A saturating point mutagenesis of this domain identified several amino acid substitutions that similarly inhibited the boundary and histone binding activities . Chromatin immunoprecipitation experiments indicated that the barrier protein efficiently prevents the spreading of SIR proteins, and that it separates domains of hypoacetylated and hyperacetylated histones . Together, these results suggest a mechanism by which proteins such as CTF-1 may interact directly with histone H3 to prevent the propagation of a silent chromatin structure, thereby defining boundaries of permissive and silent chromatin domains. Biotechniques, 2004 Sep, 37(3), 383 - 8 Development of a universal gap repair vector for yeast-based screening of knockout rodents; Chen KS et al.; Recently, we reported the production of the first knockout rats by combining N-ethyl-N-nitrosourea (ENU)-induced mutagenesis with a yeast-based truncation screening method . To make this new knockout technology more applicable for other laboratories and for high-throughput applications, we have developed a universal gap repair vector that is ready for use in screening for gene knockouts without additional engineering . The universal gap repair vector was validated for its application in both cDNA- and genomic DNA-based yeast truncation mutation assays . Breast cancer genes Brca1, Brca2, and Adenomatosis polyposis coli (Apc) genes from N2 rats of Brca1 and Brca2 knockouts and (Atm x ApcMin/+)F1 mice were examined, respectively . The results indicate that the universal gap repair vector we developed, using randomly selected codons as a universal cassette, is equally efficient at identifying truncation mutations as are those gap repair vectors designed specifically for Brca1 and Brca2 . The availability of a universal gap repair vector should facilitate the broader screening of knockouts of most genes of many species using the combined approach of ENU-induced mutagenesis and yeast truncation assay. Eukaryot Cell, 2004 Oct, 3(5), 1261 - 71 PP2A phosphatase activity is required for stress and Tor kinase regulation of yeast stress response factor Msn2p; Santhanam A et al.; In response to stress and nutrient starvation, the Saccharomyces cerevisiae transcription factor Msn2p accumulates in the nucleus and activates expression of a broad array of genes . Here, we analyze the role of the Tor (target of rapamycin) signaling pathway in mediating these responses . Inactivation of the Tor pathway component Tap42p using tap42(Ts) alleles causes a sustained nuclear localization similar to that after the addition of the Tor kinase inhibitor rapamycin . Effects of Tap42p inactivation and rapamycin addition could be suppressed by deletion of TIP41, which encodes a Tap42p-interacting protein . These results support the notion that rapamycin affects Msn2p by inactivating Tap42p function . Tap42p interacts with the catalytic subunit of PP2A (protein phosphatase 2A) and PP2A-like phosphatases . Deletion of either the catalytic or regulatory subunit that forms the PP2A phosphatase complex prevents nuclear accumulation of Msn2p in the tap42(Ts) strain and in wild-type strains treated with rapamycin . These results suggest that Tap42p is an inhibitor of PP2A phosphatase, which in turn inhibits nuclear export of Msn2p . Interestingly, PP2A function is also required for nuclear accumulation of Msn2p in response to stresses, such as heat and osmotic shock, as well as nitrogen (but not glucose) starvation . Thus, PP2A and the Tor kinase pathway transduce stress and nitrogen starvation signals to Msn2p . Finally, Msn2p localization is unaffected by conditional loss of 14-3-3 protein function, ruling out the possibility that 14-3-3 proteins act as a scaffold to sequester Msn2p in the cytoplasm. Microbiology, 2004 Oct, 150(Pt 10), 3289 - 304 Differential roles of PDK1- and PDK2-phosphorylation sites in the yeast AGC kinases Ypk1, Pkc1 and Sch9; Roelants FM et al.; Saccharomyces cerevisiae Pkh1 and Pkh2 (orthologues of mammalian protein kinase, PDK1) are functionally redundant . These kinases activate three AGC family kinases involved in the maintenance of cell wall integrity: Ypk1 and Ypk2, two closely related, functionally redundant enzymes (orthologues of mammalian protein kinase SGK), and Pkc1 (orthologue of mammalian protein kinase PRK2) . Pkh1 and Pkh2 activate Ypk1, Ypk2 and Pkc1 by phosphorylating a Thr in a conserved sequence motif (PDK1 site) within the activation loop of these proteins . A fourth protein kinase involved in growth control and stress response, Sch9 (orthologue of mammalian protein kinase c-Akt/PKB), also carries the conserved activation loop motif . Like other AGC family kinases, Ypk1, Ypk2, Pkc1 and Sch9 also carry a second conserved sequence motif situated in a region C-terminal to the catalytic domain, called the hydrophobic motif (PDK2 site) . Currently, there is still controversy surrounding the identity of the enzyme responsible for phosphorylating this second site and the necessity for phosphorylation at this site for in vivo function . Here, genetic and biochemical methods have been used to investigate the physiological consequences of phosphorylation at the PDK1 and PDK2 sites of Ypk1, Pkc1 and Sch9 . It was found that phosphorylation at the PDK1 site in the activation loop is indispensable for the essential functions of all three kinases in vivo, whereas phosphorylation at the PDK2 motif plays a non-essential and much more subtle role in modulating the ability of these kinases to regulate the downstream processes in which they participate. Microbiology, 2004 Oct, 150(Pt 10), 3219 - 28 The ER-Golgi v-SNARE Bet1p is required for cross-linking alpha-agglutinin to the cell wall in yeast; Kipnis P et al.; In Saccharomyces cerevisiae, glycosylphosphatidylinositol (GPI)-anchored cell wall mannoproteins, including alpha-agglutinin, are secreted to the cell surface through vesicular transport pathways . At the cell surface the GPI anchors are cleaved within the glycan, then transglycosylated to form a covalent cross-link to 1,6-beta-glucan . Among mutants that were temperature-sensitive for growth and for ability to cross-link the mannoprotein alpha-agglutinin to the cell wall, one strain was complemented by BET1, which encodes an ER-Golgi v-SNARE . Temperature-sensitive mutations in BET1 caused aberrations in cell wall structure, including excretion of alpha-agglutinin into the medium, sensitivity to lysis with Zymolyase and hypersensitivity to Calcofluor White . At restrictive temperatures, bet1 mutations block secretion of invertase and other proteins, but alpha-agglutinin was excreted into the extracellular medium . In wild-type parental or bet1 cells, secretion of alpha-agglutinin also continued after protein synthesis was blocked with cycloheximide . This secretion was due to continued export of a significant amount of alpha-agglutinin from compartments distal to the BET1-dependent secretion step . Thus, in bet1 cells the ER-Golgi block allowed secretion to continue, but prevented cell wall incorporation of the alpha-agglutinin . Therefore, a mutation early in the secretion pathway caused aberrant cell wall synthesis by preventing localization of key components required in wall cross-links. Microbiology, 2004 Oct, 150(Pt 10), 3209 - 18 Yeast Kre1p is GPI-anchored and involved in both cell wall assembly and architecture; Breinig F et al.; Kre1p is a cell surface O-glycoprotein involved in a late stage of 1,6-beta-glucan formation in the yeast Saccharomyces cerevisiae . Disruption of KRE1 leads to a 40 % reduction in the overall 1,6-beta-glucan content of the cell wall . This paper shows that in a yeast Deltakre1 null mutant, neither an N-terminal-truncated Kre1p nor Kre1p variants lacking a C-terminal glycosylphospatidylinositol (GPI) attachment site are capable of achieving normal function in glucan assembly, while full-length Kre1p completely complements a Deltakre1 null mutation and restores cell wall 1,6-beta-glucan content up to wild-type level . In a yeast gpi1 mutant, a green-fluorescent-protein-tagged Kre1p derivative is secreted into the medium, indicating an at least transient GPI-anchoring stage of Kre1p during its processing within the yeast secretory pathway . In contrast to the severe defect in cell wall beta-d-glucan, the amount of cell wall mannoproteins is not significantly decreased in a Deltakre1 disruptant, as could be confirmed in competition assays by investigating toxin binding to isolated cell wall mannoproteins . Since the yeast Deltakre1 mutant differed in its sensitivity to zygocin and K28, two killer viral protein toxins that use different cell wall mannoprotein populations as a primary toxin receptor, it can be concluded that in a yeast Deltakre1 background, mannoproteins do not differ significantly in total amount from a Kre1+ wild-type but rather in their expression and distribution at the cell surface . Taken together, these data favour and suggest a structural, rather than enzymic, function of Kre1p in yeast cell wall assembly. Mol Cell, 2004 Oct 8, 16(1), 139 - 46 Delivery of yeast telomerase to a DNA break depends on the recruitment functions of Cdc13 and Est1; Bianchi A et al.; The yeast single-strand TG-repeat telomere binding protein Cdc13 and the telomerase accessory protein Est1 play essential roles in chromosome end replication . To determine whether a proposed Cdc13-Est1 interaction recruits telomerase (Est2), we used a simplified system in which telomere formation was monitored at an HO-induced DNA double-strand break (DSB) . Tethering of either Cdc13 or Est1 adjacent to a DSB promoted telomere formation, and tethering of Est1, even in the absence of a DSB, resulted in the recruitment of Est2 . Est1 association with a DSB containing an adjacent short TG-repeat sequence depended on the Cdc13-Est1 interaction affected by cdc13-2 and est1-60 mutations, whereas Cdc13 association did not . Similarly, Est2 binding to the DSB also required the Cdc13-Est1 interaction, but not synthesis of new TG repeats at the break site . These data demonstrate a critical role for Est1 in recruiting telomerase to its site of action, in cooperation with the telomere binding protein Cdc13. Macromol Biosci, 2004 Jul 14, 4(7), 674 - 9 Concanavalin a immobilized affinity adsorbents for reversible use in yeast invertase adsorption; Yavuz H et al.; Concanavalin A (Con A) immobilized poly(2-hydroxyethyl methacrylate) (PHEMA) beads were investigated for specific adsorption of yeast invertase from aqueous solutions . PHEMA beads were prepared by a suspension polymerization technique with an average size of 150-200 microm, and activated by epichlorohydrin . Con A was then immobilized by covalent binding onto these beads . The maximum Con A immobilization was found to be 10 mg/g . The invertase-loading capability of the PHEMA/Con A beads was 107 mg/g . The maximum invertase adsorption capacity on the PHEMA/Con A adsorbents was observed at pH 5.0 . The values of the Michaelis constant K(m) of invertase were significantly larger upon adsorption, indicating decreased affinity by the enzyme for its substrate, whereas V(max) was smaller for the adsorbed invertase . Adsorption improved the pH stability of the enzyme as well as its temperature stability . Thermal stability was found to increase with adsorption . The adsorbed enzyme activity was found to be quite stable in repeated experiments.Storage stability of adsorbed invertase. Glycoconj J, 2004, 21(1-2), 75 - 8 Expression of human glycosyltransferase genes in yeast as a tool for enzymatic synthesis of sugar chain; Shimma Y et al.; We planned the production of human glycosyltransferases in yeast for the enzymatic synthesis of various sugar chains . More than 160 genes encoding various glycosyltransferases were prepared as N-terminal transmembrane region truncated forms by PCR and were inserted into the entry vector of Invitrogen Ltd's Gateway system . About fifty glycosyltransferases were chosen for the synthesis of human type oligosaccharides, and expressed as two different forms in yeast . One is a soluble form, which is secreted into the culture medium by methylotrophic yeast, and the other is an immobilized form, which is displayed at the budding yeast cell wall as a fusion protein with Pir protein . To date, in both systems, some sialyltranferases and fucosyltransferases have been produced as active forms, indicating the potential usefulness of these systems for the enzymatic synthesis of various types of human sugar chains attached to proteins and lipids. Cytogenet Genome Res, 2004, 107(3-4), 180 - 90 A role for the MutL homologue MLH2 in controlling heteroduplex formation and in regulating between two different crossover pathways in budding yeast; Abdullah MF et al.; BACKGROUND AND AIMS: Mismatch repair proteins play important roles during meiotic recombination in the budding yeast Saccharomyces cerevisiae and most eukaryotic organisms studied to date . To study the functions of the mismatch repair protein Mlh2p in meiosis, we constructed mlh2Delta strains and measured rates of crossing over, gene conversion, post-meiotic segregation and spore viability . We also analysed mlh1Delta, mlh3Delta, msh4Delta, msh5Delta, exo1Delta and mus81Delta mutant strains singularly and in various combinations . RESULTS: Loss of MLH2 resulted in a small but significant decrease in spore viability and a significant increase in gene conversion frequencies but had no apparent effect on crossing over . Deletion of MLH2 in mlh3Delta, msh4Delta or msh5Delta strains resulted in significant proportion of the "lost" crossovers found in single deletion strains being regained in some genetic intervals . We and others propose that there are at least two pathways to generate crossovers in yeast (Ross-Macdonald and Roeder, 1994; Zalevsky et al., 1999; Khazanehdari and Borts, 2000; Novak et al., 2001; de los Santos et al., 2003) . Most recombination intermediates are processed by the "major", Msh4-dependent pathway, which requires the activity of Mlh1p/Mlh3p/Msh4p/Msh5p as well as a number of other proteins . The minor pathway(s) utilizes Mms4p/Mus81p . We suggest that the absence of Mlh2p allows some crossovers from the MSH4 pathway to traverse the MUS81-dependent pathway . Genome Res, 2004 Oct, 14(10A), 1975 - 86 Large-scale mutagenesis of the yeast genome using a Tn7-derived multipurpose transposon; Kumar A et al.; We present here an unbiased and extremely versatile insertional library of yeast genomic DNA generated by in vitro mutagenesis with a multipurpose element derived from the bacterial transposon Tn7 . This mini-Tn7 element has been engineered such that a single insertion can be used to generate a lacZ fusion, gene disruption, and epitope-tagged gene product . Using this transposon, we generated a plasmid-based library of approximately 300,000 mutant alleles; by high-throughput screening in yeast, we identified and sequenced 9032 insertions affecting 2613 genes (45% of the genome) . From analysis of 7176 insertions, we found little bias in Tn7 target-site selection in vitro . In contrast, we also sequenced 10,174 Tn3 insertions and found a markedly stronger preference for an AT-rich 5-base pair target sequence . We further screened 1327 insertion alleles in yeast for hypersensitivity to the chemotherapeutic cisplatin . Fifty-one genes were identified, including four functionally uncharacterized genes and 25 genes involved in DNA repair, replication, transcription, and chromatin structure . In total, the collection reported here constitutes the largest plasmid-based set of sequenced yeast mutant alleles to date and, as such, should be singularly useful for gene and genome-wide functional analysis. Proc Natl Acad Sci U S A, 2004 Oct 12, 101(41), 14841 - 6 Epub 2004 Oct 01. Effects of the U1C L13 mutation and temperature regulation of yeast commitment complex formation; Du H et al.; The U1 small nuclear ribonucleoprotein particle U1C protein has a zinc finger-like structure (C2H2 motif) at its N terminus, which is conserved from yeast to humans . Mutations of amino acid L13 within this domain rescue the essential function of the helicase protein Prp28p . Prp28p has been implicated in unwinding the 5' splice site (5'ss)-U1 small nuclear RNA (snRNA) base-pairing, to allow replacement of U1 snRNA with U6 snRNA during spliceosome assembly . The L13 phenotype has therefore been interpreted to indicate that WT U1C contributes to 5'ss-U1 snRNA stabilization by binding to the RNA duplex . We show here that an L13 mutant extract cannot form stable base-pairing at room temperature but is permissive for U1-5'ss base-pairing at low temperature . This phenotype is similar to that of a U1C-depleted extract, indicating that the U1C L13 mutation is a strong loss-of-function mutation . The two mutant extracts are unlike a WT extract, which undergoes stable pairing at room temperature but little or no pairing at low temperature . Taken together with previous results and the failure to observe a direct interaction of U1C with the U1-5'ss duplex, the data suggest that U1C contributes indirectly to stable U1-5'ss base-pairing under permissive conditions . A model is proposed to account for the L13 results. J Biol Chem, 2004 Dec 17, 279(51), 53584 - 92 Epub 2004 Oct 01. Yeast cox17 solution structure and Copper(I) binding; Abajian C et al.; Cox17 is a 69-residue cysteine-rich, copper-binding protein that has been implicated in the delivery of copper to the Cu(A) and Cu(B) centers of cytochrome c oxidase via the copper-binding proteins Sco1 and Cox11, respectively . According to isothermal titration calorimetry experiments, fully reduced Cox17 binds one Cu(I) ion with a K(a) of (6.15 +/- 5.83) x 10(6) M(-1) . The solution structures of both apo and Cu(I)-loaded Cox17 reveal two alpha helices preceded by an extensive, unstructured N-terminal region . This region is reminiscent of intrinsically unfolded proteins . The two structures are very similar overall with residues in the copper-binding region becoming more ordered in Cu(I)-loaded Cox17 . Based on the NMR data, the Cu(I) ion has been modeled as two-coordinate with ligation by conserved residues Cys(23) and Cys(26) . This site is similar to those observed for the Atx1 family of copper chaperones and is consistent with reported mutagenesis studies . A number of conserved, positively charged residues may interact with complementary surfaces on Sco1 and Cox11, facilitating docking and copper transfer . Taken together, these data suggest that Cox17 is not only well suited to a copper chaperone function but is specifically designed to interact with two different target proteins. J Biol Chem, 2004 Dec 3, 279(49), 51042 - 8 Epub 2004 Dec 3. Specificity of prion assembly in vivo . {PSI+} and {PIN+} form separate structures in yeast; Bagriantsev S et al.; The yeast prions {PSI+} and {PIN+} are self-propagating amyloid aggregates of the Gln/Asn-rich proteins Sup35p and Rnq1p, respectively . Like the mammalian PrP prion "strains," {PSI+} and {PIN+} exist in different conformations called variants . Here, {PSI+} and {PIN+} variants were used to model in vivo interactions between co-existing heterologous amyloid aggregates . Two levels of structural organization, like those previously described for {PSI+}, were demonstrated for {PIN+} . In cells with both {PSI+} and {PIN+} the two prions formed separate structures at both levels . Also, the destabilization of {PSI+} by certain {PIN+} variants was shown not to involve alterations in the {PSI+} prion size . Finally, when two variants of the same prion that have aggregates with distinct biochemical characteristics were combined in a single cell, only one aggregate type was propagated . These studies demonstrate the intracellular organization of yeast prions and provide insight into the principles of in vivo amyloid assembly. Arch Biochem Biophys, 2004 Nov 1, 431(1), 9 - 15 Identification of three phosphorylation sites in the alpha7 subunit of the yeast 20S proteasome in vivo using mass spectrometry; Iwafune Y et al.; The 26S proteasome complex, which consists of a 20S proteasome and a pair of 19S regulatory particles, plays important roles in the degradation of ubiquitinated proteins in eukaryotic cells . The alpha7 subunit of the budding yeast 20S proteasome is a major phosphorylatable subunit; serine residue(s) in its C-terminal region are phosphorylated in vitro by CKII . However, the exact in vivo phosphorylation sites have not been identified . In this study, using electrospray ionization quadrupole time-of-flight mass spectrometry analysis, we detected a mixture of singly, doubly, and triply phosphorylated C-terminal peptides isolated from a His-tagged construct of the alpha7 subunit by nickel-immobilized metal affinity chromatography . In addition, we identified three phosphorylation sites in the C-terminal region using MS/MS analysis and site-directed mutagenesis: Ser258, Ser263, and Ser264 residues . The MS/MS analysis of singly phosphorylated peptides showed that phosphorylation at these sites did not occur successively. Genome Biol . 2004;5(10):243 . Epub 2004 Sep 30. Global nucleosome distribution and the regulation of transcription in yeast; Ercan S et al.; Recent studies show that active regulatory regions of the yeast genome have a lower density of nucleosomes than other regions, and that there is an inverse correlation between nucleosome density and the transcription rate of a gene . This may be the result of transcription factors displacing nucleosomes. Genome Biol . 2004;5(10):R76 . Epub 2004 Sep 15. A scale of functional divergence for yeast duplicated genes revealed from analysis of the protein-protein interaction network; Baudot A et al.; BACKGROUND: Studying the evolution of the function of duplicated genes usually implies an estimation of the extent of functional conservation/divergence between duplicates from comparison of actual sequences . This only reveals the possible molecular function of genes without taking into account their cellular function(s) . We took into consideration this latter dimension of gene function to approach the functional evolution of duplicated genes by analyzing the protein-protein interaction network in which their products are involved . For this, we derived a functional classification of the proteins using PRODISTIN, a bioinformatics method allowing comparison of protein function . Our work focused on the duplicated yeast genes, remnants of an ancient whole-genome duplication . RESULTS: Starting from 4,143 interactions, we analyzed 41 duplicated protein pairs with the PRODISTIN method . We showed that duplicated pairs behaved differently in the classification with respect to their interactors . The different observed behaviors allowed us to propose a functional scale of conservation/divergence for the duplicated genes, based on interaction data . By comparing our results to the functional information carried by GO annotations and sequence comparisons, we showed that the interaction network analysis reveals functional subtleties, which are not discernible by other means . Finally, we interpreted our results in terms of evolutionary scenarios . CONCLUSIONS: Our analysis might provide a new way to analyse the functional evolution of duplicated genes and constitutes the first attempt of protein function evolutionary comparisons based on protein-protein interactions. BMC Biochem . 2004 Oct 01;5(1):14. RNA integrity as a quality indicator during the first steps of RNP purifications : a comparison of yeast lysis methods; Lopez de Heredia M et al.; BACKGROUND: The completion of several genome-sequencing projects has increased our need to assign functions to newly identified genes . The presence of a specific protein domain has been used as the determinant for suggesting a function for these new genes . In the case of proteins that are predicted to interact with mRNA, most RNAs bound by these proteins are still unknown . In yeast, several protocols for the identification of protein-protein interactions in high-throughput analyses have been developed during the last years leading to an increased understanding of cellular proteomics . If any of these protocols or similar approaches shall be used for the identification of mRNA-protein complexes, the integrity of mRNA is a critical factor . RESULTS: We compared the effect of different lysis protocols on RNA integrity . We report dramatic differences in RNA stability depending on the method used for yeast cell lysis . Glass bead milling and French Press lead to degraded mRNAs even in the presence of RNase inhibitors . Thus, they are not suitable to purify intact mRNP complexes or to identify specific mRNAs bound to proteins . CONCLUSION: We suggest a novel protocol, grinding deep-frozen cells, for the preparation of protein extracts that contain intact RNAs, as lysis method for the purification of mRNA-protein complexes from yeast cells. Genes Cells, 2004 Oct, 9(10), 905 - 17 DNA topoisomerase II is required for the G0-to-S phase transition in Drosophila Schneider cells, but not in yeast; Hossain MS et al.; We previously reported that DNA topoisomerase II (topo II) is required for the G(0)-to-S phase transition in mammalian cells {Hossain et al . (2002) ICRF-193, a catalytic inhibitor of DNA topoisomerase II, inhibits re-entry into the cell division cycle from quiescent state in mammalian cells . Genes Cells 7, 285-294} . In this study, we examined whether the requirement for topo II is evolutionarily conserved in Drosophila and yeast . ICRF-193, a catalytic inhibitor of topo II, inhibited DNA synthesis in Drosophila Schneider cells released from the G(0) (stationary) phase, whereas the drug did not inhibit DNA synthesis in Schneider cells released from the M phase . Depletion of topo II mRNA by RNA-interference (RNAi) in G(0)-phase Schneider cells resulted in significant inhibition of DNA synthesis after release from G(0)-arrest . In the yeast topo II temperature-sensitive (ts) mutant, the initial cycle of DNA synthesis occurred at a restrictive temperature after release from starvation-induced G(0) phase and doubling of the DNA content in the cells was confirmed by both flow cytometry and fluorescence spectrophotometry . DNA synthesis in yeast cells after release from the G(0) phase was also observed in the presence of ICRF-193 . Doubling of the DNA content was observed during spore germination of topo II ts mutant yeast at a restrictive temperature as determined by fluorescence spectrophotometry . These results indicate that topo II is required for the G(0)-to-S phase transition in Drosophila Schneider cells, but not in yeast. J Biol Chem, 2004 Dec 10, 279(50), 52566 - 73 Epub 2004 Dec 10. Studies of the interaction of substituted mutants of BAX with yeast mitochondria reveal that the C-terminal hydrophobic alpha-helix is a second ART sequence and plays a role in the interaction with anti-apoptotic BCL-xL; Arokium H et al.; The role of the two ends of the pro-apoptotic protein BAX in its interaction with mitochondria was challenged by assaying substituted mutants in yeast cells for the ability to bind and insert into the mitochondrial membrane and to promote the release of cytochrome c . Mutations at the N-terminal end confirmed the inhibitory function of this zone, known as apoptotic regulation of targeting (ART) . On the other hand, mutations at the C-terminal end of the protein support the hypothesis that the hydrophobic helix alpha9 is not required for the insertion of BAX . In addition, three mutations (a T174D single substitution in the helix alpha9, a K189E/K190E double substitution at the end of the protein, and a P168A mutation in the loop before alpha9) exhibited a strong binding capacity, a strong insertion, as well as high ability to induce cytochrome c release . Considering the positions of these mutations and their potential effect on the movement of helix alpha9, we propose that the C-terminal end of the protein behaves like a second ART . Also, opposite to a mutation that changes the conformation of the N-terminal ART, the mutations in the C-terminal part of the protein impaired the inhibitory effect of anti-apoptotic BCL-xL over BAX insertion, suggesting that the conformation of the alpha9-helix plays a significant role in BAX/BCL-xL interaction. Mol Cell Biol, 2004 Oct, 24(20), 9221 - 38 Persistent activation by constitutive Ste7 promotes Kss1-mediated invasive growth but fails to support Fus3-dependent mating in yeast; Maleri S et al.; Mitogen-activated protein kinase kinase kinase-Ste11 (MAPKKK-Ste11), MAPKK-Ste7, and MAPK-Kss1 mediate pheromone-induced mating differentiation and nutrient-responsive invasive growth in Saccharomyces cerevisiae . The mating pathway also requires the scaffold-Ste5 and the additional MAPK-Fus3 . One contribution to specificity in this system is thought to come from stimulus-dependent recruitment of the MAPK cascade to upstream activators that are unique to one or the other pathway . To test this premise, we asked if stimulus-independent signaling by constitutive Ste7 would lead to a loss of biological specificity . Instead, we found that constitutive Ste7 promotes invasion without supporting mating responses . This specificity occurs because constitutive Ste7 activates Kss1, but not Fus3, in vivo and promotes filamentation gene expression while suppressing mating gene expression . Differences in the ability of constitutive Ste7 variants to bind the MAPKs and Ste5 account for the selective activation of Kss1 . These findings support the model that Fus3 activation in vivo requires binding to both Ste7 and the scaffold-Ste5 but that Kss1 activation is independent of Ste5 . This scaffold-independent activation of Kss1 by constitutive Ste7 and the existence of mechanisms for pathway-specific promoter discrimination impose a unique developmental fate independently of any distinguishing external stimuli. Mol Cell Biol, 2004 Oct, 24(20), 8823 - 33 Genome-wide analysis of the relationship between transcriptional regulation by Rpd3p and the histone H3 and H4 amino termini in budding yeast; Sabet N et al.; The histone amino termini have emerged as key targets for a variety of modifying enzymes that function as transcriptional coactivators and corepressors . However, an important question that has remained largely unexplored is the extent to which specific histone amino termini are required for the activating and repressive functions of these enzymes, Here we address this issue by focusing on the prototypical histone deacetylase, Rpd3p, in the budding yeast Saccharomyces cerevisiae . We show that targeting Rpd3p to a reporter gene in this yeast can partially repress transcription when either the histone H3 or the histone H4 amino terminus is deleted, indicating that the "tails" are individually dispensable for repression by Rpd3p . In contrast, we find that the effect of rpd3 gene disruption on global gene expression is considerably reduced in either a histone H3Delta1-28 (H3 lacking the amino-terminal 28 amino acids) or a histone H4(K5,8,12,16Q) (H4 with lysine residues 5, 8, 12, and 16 changed to glutamine residues) background compared to the wild-type background, indicating a requirement for one or both of these histone tails in Rpd3p-mediated regulation for many genes . These results suggest that acetylation of either the H3 or the H4 amino terminus could suffice to allow the activation of such genes . We also examine the relationship between H3 tails and H4 tails in global gene expression and find substantial overlap among the gene sets regulated by these histone tails . We also show that the effects on genome-wide expression of deleting the H3 or H4 amino terminus are similar but not identical to the effects of mutating the lysine residues in these same regions . These results indicate that the gene regulatory potential of the H3 and H4 amino termini is substantially but not entirely contained in these modifiable lysine residues. Mikrobiol Z, 2004 May-Jun, 66(3), 43 - 50 {Effect of chrome (VI) on growth physiology and sorptional capacity of yeast}; A novel yeast mutation et al.; Departamento de Genetica, Facultad de Biologia, Universidad de Sevilla, 41012, SpainWe isolated a novel rad52 mutation, rad52-L89F, which specifically impairs recombination in rad51Delta cells . rad52-L89F displays phenotypes similar to rad59Delta and encodes a mutant protein impaired in its ability to interact with Rad59 . These results support the idea that Rad59 acts in homologous recombination via physical interaction with Rad52. Genetics, 2004 Sep, 168(1), 547 - 51 Importance of the Sir3 N terminus and its acetylation for yeast transcriptional silencing; Wang X et al.; The N-terminal alanine residues of the silencing protein Sir3 and of Orc1 are acetylated by the NatA Nalpha-acetyltransferase . Mutations demonstrate that the N terminus of Sir3 is important for its function . Sir3 and, perhaps, also Orc1 are the NatA substrates whose lack of acetylation in ard1 and nat1 mutants explains the silencing defect of those mutants. Genetics, 2004 Sep, 168(1), 89 - 101 Increase in Ty1 cDNA recombination in yeast sir4 mutant strains at high temperature; Radford SJ et al.; Transposition of the Ty1 element of the yeast Saccharomyces cerevisiae is temperature sensitive . We have identified a null allele of the silent information regulator gene SIR4 as a host mutant that allows for transposition at high temperature . We show that the apparent increase in transposition activity in sir4 mutant strains at high temperature is dependent on the RAD52 gene and is thus likely resulting from an increase in Ty1 cDNA recombination, rather than in IN-mediated integration . General cellular recombination is not increased at high temperature, suggesting that the increase in recombination at high temperature in sir4 mutants is specific for Ty1 cDNA . Additionally, this high-temperature Ty1 recombination was found to be dependent on functional Sir2p and Sir3p . We speculate that the increase in recombination seen in sir4 mutants at high temperature may be due to changes in chromatin structure or Ty1 interactions with chromosomal structures resulting in higher recombination rates. Genetics, 2004 Sep, 168(1), 77 - 87 Abortive transposition by a group II intron in yeast mitochondria; Dickson L et al.; Group II intron homing in yeast mitochondria is initiated at active target sites by activities of intron-encoded ribonucleoprotein (RNP) particles, but is completed by competing recombination and repair mechanisms . Intron aI1 transposes in haploid cells at low frequency to target sites in mtDNA that resemble the exon 1-exon 2 (E1/E2) homing site . This study investigates a system in which aI1 can transpose in crosses (i.e., in trans) . Surprisingly, replacing an inefficient transposition site with an active E1/E2 site supports <1% transposition of aI1 . Instead, the ectopic site was mainly converted to the related sequence in donor mtDNA in a process we call "abortive transposition." Efficient abortive events depend on sequences in both E1 and E2, suggesting that most events result from cleavage of the target site by the intron RNP particles, gapping, and recombinational repair using homologous sequences in donor mtDNA . A donor strain that lacks RT activity carries out little abortive transposition, indicating that cDNA synthesis actually promotes abortive events . We also infer that some intermediates abort by ejecting the intron RNA from the DNA target by forward splicing . These experiments provide new insights to group II intron transposition and homing mechanisms in yeast mitochondria. Genetics, 2004 Sep, 168(1), 65 - 75 Heterochromatin spreading at yeast telomeres occurs in M phase; Martins-Taylor K et al.; Heterochromatin regulation of gene expression exhibits epigenetic inheritance, in which some feature of the structure is retained and can reseed formation in new cells . To understand the cell-cycle events that influence heterochromatin assembly and maintenance in budding yeast, we have conducted two types of experiments . First we have examined the kinetics of heterochromatin spreading at telomeres . We have constructed a strain in which the efficient silencing of a telomere-linked URA3 gene depends on the inducible expression of the Sir3 silencing factor . Prior studies determined that S-phase passage was required for the establishment of silencing at the HM loci in yeast . We find that establishment of silencing in our strain occurs at a point coincident with mitosis and does not require S-phase passage . In addition, we find that passage through mitosis is sufficient to establish silencing at the HML locus in a strain bearing a conditional allele of SIR3 . Finally, we have also assessed the stability of yeast heterochromatin in the absence of the cis-acting elements required for its establishment . We show that silencing is stable through S phase in the absence of silencers and therefore possesses the ability to self-propagate through DNA replication . However, silencing is lost in the absence of silencers during progression through M phase . These experiments point to crucial events in mitosis influencing the assembly and persistence of heterochromatin. Nucleic Acids Res, 2004 Sep 27, 32(17), 5076 - 86 Print 2004. A yeast arginine specific tRNA is a remnant aspartate acceptor; Fender A et al.; High specificity in aminoacylation of transfer RNAs (tRNAs) with the help of their cognate aminoacyl-tRNA synthetases (aaRSs) is a guarantee for accurate genetic translation . Structural and mechanistic peculiarities between the different tRNA/aaRS couples, suggest that aminoacylation systems are unrelated . However, occurrence of tRNA mischarging by non-cognate aaRSs reflects the relationship between such systems . In Saccharomyces cerevisiae, functional links between arginylation and aspartylation systems have been reported . In particular, it was found that an in vitro transcribed tRNAAsp is a very efficient substrate for ArgRS . In this study, the relationship of arginine and aspartate systems is further explored, based on the discovery of a fourth isoacceptor in the yeast genome, tRNA4Arg . This tRNA has a sequence strikingly similar to that of tRNAAsp but distinct from those of the other three arginine isoacceptors . After transplantation of the full set of aspartate identity elements into the four arginine isoacceptors, tRNA4Arg gains the highest aspartylation efficiency . Moreover, it is possible to convert tRNA4Arg into an aspartate acceptor, as efficient as tRNAAsp, by only two point mutations, C38 and G73, despite the absence of the major anticodon aspartate identity elements . Thus, cryptic aspartate identity elements are embedded within tRNA4Arg . The latent aspartate acceptor capacity in a contemporary tRNAArg leads to the proposal of an evolutionary link between tRNA4Arg and tRNAAsp genes. J Virol, 2004 Oct, 78(20), 11016 - 29 Anti-Vpr activity of a yeast chaperone protein; Benko Z et al.; Human immunodeficiency virus type 1 (HIV-1) viral protein R (Vpr) exerts multiple effects on viral and host cellular activities during viral infection, including nuclear transport of the proviral integration complex, induction of cell cycle G(2) arrest, and cell death . In this report, we show that a fission yeast chaperone protein Hsp16 inhibits HIV-1 by suppressing these Vpr activities . This protein was identified through three independent genome-wide screens for multicopy suppressors of each of the three Vpr activities . Consistent with the properties of a heat shock protein, heat shock-induced elevation or overproduction of Hsp16 suppressed Vpr activities through direct protein-protein interaction . Even though Hsp16 shows a stronger suppressive effect on Vpr in fission yeast than in mammalian cells, similar effects were also observed in human cells when fission yeast hsp16 was expressed either in vpr-expressing cells or during HIV-1 infection, indicating a possible highly conserved Vpr suppressing activity . Furthermore, stable expression of hsp16 prior to HIV-1 infection inhibits viral replication in a Vpr-dependent manner . Together, these data suggest that Hsp16 inhibits HIV-1 by suppressing Vpr-specific activities . This finding could potentially provide a new approach to studying the contribution of Vpr to viral pathogenesis and to reducing Vpr-mediated detrimental effects in HIV-infected patients. Biochem Biophys Res Commun, 2004 Oct 29, 323(4), 1172 - 83 Isolation of a dinoflagellate mitotic cyclin by functional complementation in yeast; Bertomeu T et al.; Dinoflagellates are protists with permanently condensed chromosomes that lack histones and whose nuclear membrane remains intact during mitosis . These unusual nuclear characters have suggested that the typical cell cycle regulators might be slightly different than those in more typical eukaryotes . To test this, a cyclin has been isolated from the dinoflagellate Gonyaulax polyedra by functional complementation in cln123 mutant yeast . This GpCyc1 sequence contains two cyclin domains in its C-terminal region and a degradation box typical of mitotic cyclins . Similar to other dinoflagellate genes, GpCyc1 has a high copy number, with approximately 5000 copies found in the Gonyaulax genome . An antibody raised against the N-terminal region of the GpCYC1 reacts with a 68kDa protein on Western blots that is more abundant in cell cultures enriched for G2-phase cells than in those containing primarily G1-phase cells, indicating its cellular level follows a pattern expected for a mitotic cyclin . This is the first report of a cell cycle regulator cloned and sequenced from a dinoflagellate, and our results suggest control of the dinoflagellate cell cycle will be very similar to that of other organisms. Biochim Biophys Acta, 2004 Oct 5, 1680(1), 34 - 45 Proteasome inhibition alters the transcription of multiple yeast genes; Dembla-Rajpal N et al.; The 26S proteasome degrades denatured proteins and other proteins targeted for destruction by covalent modification . Here we show that impaired proteasome function influences the transcription of numerous yeast genes . Of 6144 genes present on the macroarray filters used in this study, approximately 5% showed measurable mRNA decreases and 2% showed mRNA increases following 30 min of proteasome inhibition . Northern blot hybridization shows that this response is time- and dose-dependent and occurs with either pharmacological or genetic impairment of the proteasome . A number of splicing factors possess the PEST motif found in certain proteasome substrates . However, mRNA levels drop with proteasome inhibition without obvious increases in intron-bearing pre-mRNA, indicating that splicing is not generally impaired when proteome activity is blocked . Chimeric gene constructs, nuclear run-on experiments, and transcriptional inhibition studies show that for members of three functional groups (i.e., ribosomal protein genes, histone genes, and heat shock protein genes) changes in mRNA levels occur largely by transcriptional modulation . In addition, these studies reveal a possible new means of modulating kinetochore levels through CEP3 expression . Together these data strongly support the view that proteasome activity plays a significant role in the regulation of eukaryotic gene expression. FEMS Microbiol Lett, 2004 Oct 1, 239(1), 171 - 9 Multiple ubiquitin-specific protease genes are involved in degradation of yeast tryptophan permease Tat2 at high pressure; Miura T et al.; When Saccharomyces cerevisiae cells are exposed to high hydrostatic pressure, tryptophan permease Tat2 is degraded in a manner dependent on Rsp5 ubiquitin ligase . Consequently, cell growth is arrested in tryptophan auxotrophic strains . Here we show that of 17 ubiquitin-specific protease genes (UBP), deletion of DOA4, UBP6 or UBP14 causes stabilization of Tat2 and hence the cells can grow at 25 MPa . These disruptant cells displayed marked sensitivity to the arginine analogue canavanine . Internal free ubiquitin decreased 2- to 5-fold upon UBP deletion, although overproduction of ubiquitin did not affect their high-pressure growth and canavanine sensitivity . These results suggest that multiple ubiquitin-specific proteases are involved in pressure-induced degradation of Tat2, rather than free ubiquitin depletion. Biochem Pharmacol, 2004 Nov 1, 68(9), 1807 - 14 Using yeast to screen for inhibitors of protein tyrosine phosphatase 1B; Montalibet J et al.; Inhibition of protein tyrosine phosphatase 1B (PTP1B) has been proposed as a novel therapy to treat type 2 diabetes and obesity . In order to identify novel PTP1B inhibitors, we have developed a robust screen in Saccharomyces cerevisiae where growth is dependent on PTP1B catalytic activity . This was based on the observation that overexpression of v-Src, a tyrosine kinase, in yeast leads to lethality through mitotic dysfunction and this lethality can be reversed by co-expression of PTP1B . The expression levels of v-Src and PTP1B were optimized to obtain a balance between robust growth and sensitivity to inhibitors . Screening was carried out in 96-well plates and growth of the liquid culture measured by absorbance at 600 nm . Initial characterization was performed using vanadate as well as some novel PTP1B inhibitors . Vanadate specifically inhibited PTP1B-dependent growth in a dose dependent manner with an EC50 of 0.92 +/- 0.07 mM . This simple yeast growth interference assay has the potential for use as a high throughput screen for PTP1B inhibitors in sample collections or crude mixtures. FEMS Yeast Res, 2004 Sep, 4(8), 849 - 56 Botryozyma mucatilis sp . nov., an anamorphic ascomycetous yeast associated with nematodes in poplar slime flux; Kerrigan J et al.; A new species of Botryozyma, Botryozyma mucatilis, was isolated from the surface of free-living nematodes, Panagrellus dubius, inhabiting slime flux from hybrid poplars, Populus deltoidesxtrichocarpa, in Oregon, USA . This species was discovered in relatively close proximity to the teleomorphic species Ascobotryozyma americana and Ascobotryozyma cognata, both collected from P . dubius nematodes inhabiting beetle galleries in Populus spp . and Populus and Salix spp., respectively . B . mucatilis is recognized as a distinct species based on molecular and morphological data . Sequence divergence in both the D1/D2 domain of the nuclear large-subunit rDNA and internal transcribed spacer region rDNA, low DNA reassociation values, notably different amplified fragment-length polymorphic fingerprints, and significantly longer cells all support the designation of a novel species. Yeast, 2004 Sep, 21(12), 983 - 9 Cell shape and growth of budding yeast cells in restrictive microenvironments; Suzuki M et al.; Effects of limited growth space on the cell morphology and cell growth are investigated by creating rigid outside environments . The cube-shaped holes big enough for a single cell of the budding yeast Saccharomyces cerevisiae were prepared with a focused ion-beam (FIB), commonly used for processing semiconductors . We demonstrated that the outline of the cells changes their ellipsoidal morphology into a cubic form when the daughter cells are grown in the holes, indicating that yeast cells change their shape in response to external limited space . The yeast cells grown in the microenvironments exhibit neither bud formation nor nuclear division . Although restricted growth caused by the physical barriers leads to the block of cell cycle progression in the wild-type cells, swe1Delta cells defective in the morphogenesis checkpoint become binucleate after being grown in the microenvironments . These results suggest that yeast cells under spatial restriction arrest cell cycle progression in a Swelp-dependent manner . Copyright (c) 2004 John Wiley & Sons, Ltd. Mol Genet Genomics, 2004 Sep, 272(2), 173 - 80 Epub 2004 Jul 29. Complete DNA sequence of the linear mitochondrial genome of the pathogenic yeast Candida parapsilosis; Nosek J et al.; The complete sequence of the mitochondrial DNA of the opportunistic yeast pathogen Candida parapsilosis was determined . The mitochondrial genome is represented by linear DNA molecules terminating with tandem repeats of a 738-bp unit . The number of repeats varies, thus generating a population of linear DNA molecules that are heterogeneous in size . The length of the shortest molecules is 30,922 bp, whereas the longer molecules have expanded terminal tandem arrays (nx738 bp) . The mitochondrial genome is highly compact, with less than 8% of the sequence corresponding to non-coding intergenic spacers . In silico analysis predicted genes encoding fourteen protein subunits of complexes of the respiratory chain and ATP synthase, rRNAs of the large and small subunits of the mitochondrial ribosome, and twenty-four transfer RNAs . These genes are organized into two transcription units . In addition, six intronic ORFs coding for homologues of RNA maturase, reverse transcriptase and DNA endonucleases were identified . In contrast to its overall molecular architecture, the coding sequences of the linear mitochondrial DNA of C . parapsilosis are highly similar to their counterparts in the circular mitochondrial genome of its close relative C . albicans . The complete sequence has implications for both mitochondrial DNA replication and the evolution of linear DNA genomes. Arch Virol, 2004 Dec, 149(12), 2349 - 64 Epub 2004 Dec. Yeast two-hybrid systems confirm the membrane- association and oligomerization of BC1 but do not detect an interaction of the movement proteins BC1 and BV1 of Abutilon mosaic geminivirus; Frischmuth S et al.; Most of the plant begomoviruses use two proteins to transport their DNA from cell to cell, BV1 to shuttle it between nucleus and cytoplasm and BC1 to facilitate movement across plasmodesmata . In order to analyse their interaction for Abutilon mosaic geminivirus (AbMV) in yeast ( Saccharomyces cerevisiae), BC1 and BV1 genes were cloned into various plasmid vectors suitable for two-hybrid analysis . BC1 was fused to the binding domain (GBD) and BV1 to the activation domain (GAD) of the GAL4 transcription factor to check for interactions in the nucleus . Additionally, BC1 as well as BV1 were integrated into pMyr or pSos vectors to analyze protein binding at the plasma membrane using the CytoTraptrade mark system . Using freeze-fracture immuno-labelling (FreeFI), singly-expressed GBD:BC1 was localized at the plasma membrane although it was fused to a nuclear localization signal provided by the construct . GAD:BV1 was found in the nucleus of transformed cells as expected . Upon co-transformation of both constructs, cells grew poorly and exhibited symptoms of autolysis without any detectable level of GBD:BC1 or GAD:BV1, as revealed by FreeFI . In conclusion, both fusion proteins did not meet in the same compartment and appeared to be harmful to yeast if constitutively co-expressed . When expressed from pSos vector, BC1 induced the CytoTrap detection signal in the absence of pMyr indicating that BC1 protein alone is able to target the effector protein to the inner face of the plasma membrane . A mutated form of BC1 (DeltaBC1) lacking the previously identified membrane-binding domain was no longer able to auto-induce the CytoTrap signal cascade . Using DeltaBC1, an N-terminal, or a C-terminal third of BC1 revealed a homo-oligomerization of the C-terminal region of BC1 in two-hybrid analysis, but no interaction of BC1 with BV1. J Biol Chem, 2004 Dec 10, 279(50), 52319 - 23 Epub 2004 Dec 10. Hsp104 binds to yeast Sup35 prion fiber but needs other factor(s) to sever it; Inoue Y et al.; The interaction of Hsp104 with yeast prion fibers made of Sup35NM, a prion-inducing domain of Sup35, was tested . When fluorescently labeled Hsp104 was added to the preformed fibers, individual fibers were fluorescently decorated uniformly along the fiber length . However, the density of fluorescence differed from one fiber to another, indicating the presence of subspecies of Sup35NM fibers . The time course of fiber formation from monomer Sup35NM was delayed by Hsp104 . Hsp104-mediated fragmentation of fibers was tested using bead-tethered fibers . In contrast with the recent report (Shorter, J., and Lindquist, S . (2004) Science 304, 1793-1797), Hsp104 alone was unable to sever the fibers . Yeast cell lysate or the Hsp104-deficient cell lysate plus Hsp104 caused ATP-dependent, guanidine hydrochloride-sensitive fragmentation of the fibers . Thus, in our experimental setup, Hsp104 plus other factor(s) in the yeast cytosol are required for severing yeast prion fiber . The reason of discrepancy from the above report is unknown but is possibly caused by different conformational subspecies of prion fibers. Biochem J . 2004 Sep 24; Pt {Epub ahead of print} Specific interactions of PP2A and PP2A-like phosphatases with the yeast PTPA homologues, Ypa1 and Ypa2; Van Hoof C et al.; In order to elucidate the specific biological role of the yeast homologues of PTPA, Ypa1 and Ypa2, in the regulation of PP2A, we investigated the physical interaction of both Ypa proteins with the catalytic subunit of the different yeast PP2A-like phosphatases . Ypa1 interacts specifically with Pph3, Sit4 and Ppg1, whereas Ypa2 binds to Pph21 and Pph22 . The Ypa1 and Ypa2 proteins do not compete with Tap42 for binding to PP2A family members . The interaction of the Ypa proteins with the catalytic subunit of PP2A-like phosphatases is direct and independent of other regulatory subunits, implicating a specific function for the different PP2A-Ypa complexes . Strikingly, interaction of Ypa2 with yeast PP2A is promoted by the presence of Ypa1, suggesting a positive role of Ypa1 in the regulation of PP2A association with other interacting proteins . As in the mammalian system, all yeast PP2A-like enzymes associate as an inactive complex with yeast methylesterase, Yme . Ypa1 as well as Ypa2 can reactivate all these inactive complexes, except Pph22-Yme . Ypa1 is the most potent activator of PP2A activity, suggesting that there is no direct correlation between activation potential and binding capacity. Chaos, 2004 Sep, 14(3), 653 - 61 Bifurcation analysis of a model of the budding yeast cell cycle; Battogtokh D et al.; We study the bifurcations of a set of nine nonlinear ordinary differential equations that describe regulation of the cyclin-dependent kinase that triggers DNA synthesis and mitosis in the budding yeast, Saccharomyces cerevisiae . We show that Clb2-dependent kinase exhibits bistability (stable steady states of high or low kinase activity) . The transition from low to high Clb2-dependent kinase activity is driven by transient activation of Cln2-dependent kinase, and the reverse transition is driven by transient activation of the Clb2 degradation machinery . We show that a four-variable model retains the main features of the nine-variable model . In a three-variable model exhibiting birhythmicity (two stable oscillatory states), we explore possible effects of extrinsic fluctuations on cell cycle progression . J Cell Physiol, 2005 Jan, 202(1), 100 - 4 A novel role for Bsd2 in the resistance of yeast to adriamycin; Takahashi T et al.; In a search for undiscovered mechanisms of resistance to adriamycin, we screened a genomic library derived from Saccharomyces cerevisiae for genes related to adriamycin resistance . To our surprise, we found that overexpression of BSD2 rendered yeast cells resistant to adriamycin . Downregulation of the metal transporters Smf1 and Smf2 is the only activity of Bsd2 reported to date, and Bsd2 deficiency increases intracellular levels of Smf1 and Smf2 . SMF2-disrupted cells exhibited significantly greater resistance to adriamycin, whereas the resistance of SMF1-disrupted cells was only slightly improved . The sensitivity of the SMF1- and SMF2-disrupted yeast cell line overexpressing BSD2 was almost the same as that of the BSD2-overexpressing parental yeast cell . Thus the overexpression of BSD2 and the disruption of SMF1 and SMF2 might be involved in the same mechanism that confers resistance to adriamycin . Although both SMF1- and SMF2-disrupted cells were very sensitive to EGTA, overexpression of BSD2 had little or no effect on sensitivity to EGTA . However, a partial decrease in the intracellular level of FLAG-Smf2 was observed by overexpression of BSD2 . Thus, the resistance to adriamycin acquired by overexpression of BSD2 might be partially explained by down-regulation of Smf2, but in addition to Smf2, other as of yet unidentified targets of Bsd2 must also be responsible for the resistance . 2005 Wiley-Liss, Inc. Biotechnol Bioeng, 2004 Oct 5, 88(1), 84 - 93 Physicochemical surface properties of brewing yeast influencing their immobilization onto spent grains in a continuous reactor; Branyik T et al.; Immobilization of brewing yeast onto a cellulose-based carrier obtained from spent grains, a brewing byproduct, by acid/base treatment has been studied in a continuously operating bubble-column reactor . The aim of this work was to study the mechanisms of brewing yeast immobilization onto spent grain particles through the information on physicochemical surface properties of brewing yeast and spent grain particles . Three mechanisms of brewing yeast immobilization onto spent grains carrier were proposed: cell-carrier adhesion, cell-cell attachment, and cell adsorption (accumulation) inside natural shelters (carrier's surface roughness) . The possibility of stable cell-carrier adhesion regarding the free energy of interaction was proved and the relative importance of long-range forces (Derjaguin-Landau-Verwey-Overbeek theory) and interfacial free energies was discussed . As for the cell-cell attachment leading to a multilayer yeast immobilization, a physicochemical interaction through localized hydrophobic regions on cell surface was hypothesized . However, neither flocculation nor chain formation mechanism can be excluded so far . The adsorption of brewing yeast inside sufficiently large crevices (pores) was documented with photomicrographs . A positive effect of higher dilution rate and increased hydrophobicity of base-treated spent grains on the yeast immobilization rate has also been found. Nucleic Acids Res, 2004 Sep 23, 32(16), 4945 - 53 Print 2004. Identification and cloning of two putative subunits of DNA polymerase epsilon in fission yeast; Spiga MG et al.; DNA polymerase epsilon (Pol epsilon) is a multi-subunit enzyme required for the initiation of chromosomal DNA replication . Here, we report the cloning of two fission yeast genes, called dpb3+ and dpb4+ that encode proteins homologous to the two smallest subunits of Pol epsilon . Although Dpb4 is not required for cell viability, Deltadpb4 mutants are synthetically lethal with mutations in four genes required for DNA replication initiation, cdc20+ (encoding DNA Pol epsilon), cut5+ (homologous to DPB11/TopBP1), sna41+ (homologous to CDC45) and cdc21+ (encoding Mcm4, a component of the pre-replicative complex) . In contrast to Dpb4, Dpb3 is essential for cell cycle progression . A glutathione S-transferase pull-down assay indicates that Dpb3 physically interacts with both Dpb2 and Dpb4, suggesting that Dpb3 associates with other members of the Pol epsilon complex . Depletion of Dpb3 leads to an accumulation of cells in S phase consistent with Dpb3 having a role in DNA replication . In addition, many of the cells have a bi-nucleate or multinucleate phenotype, indicating that cell separation is also inhibited . Finally, we have examined in vivo localization of green fluorescent protein (GFP)-tagged Dpb3 and Dpb4 and found that both proteins are localized to the nucleus consistent with their proposed role in DNA replication . However, in the absence of Dpb3, GFP-Dpb4 appears to be more dispersed throughout the cell, suggesting that Dpb3 may be important in establishing or maintaining normal localization of Dpb4. Int J Syst Evol Microbiol, 2004 Sep, 54(Pt 5), 1877 - 82 Bullera cylindrica sp . nov., Bullera hubeiensis sp . nov . and Bullera nakasei sp . nov., ballistoconidium-forming yeast species from plant leaves; Wang QM et al.; Among yeasts isolated from plant leaves collected in different regions of China that form whitish or yellowish colonies and symmetrical ballistoconidia, four strains were shown to represent three novel Bullera species by conventional and molecular taxonomic characterization . The novel species are described as Bullera cylindrica sp . nov . (type strain CB 169T = AS 2.2308T = CBS 9744T), Bullera hubeiensis sp . nov . (type strain HX 19.3T = AS 2.2466T = CBS 9747T) and Bullera nakasei sp . nov . (type strain HX 15.5T = AS 2.2435T = CBS 9746T) . These three species, and another eight previously described Bullera species represented by Bullera mrakii, formed a strongly supported distinct clade among the hymenomycetous yeasts in each of the phylogenetic trees drawn from the 26S rDNA D1/D2 domain and the internal transcribed spacer region sequences. Int J Syst Evol Microbiol, 2004 Sep, 54(Pt 5), 1857 - 9 Candida bombiphila sp . nov., a new asexual yeast species in the Wickerhamiella clade; Brysch-Herzberg M et al.; Two yeast strains were isolated from a bumblebee and bumblebee honey . The strains were almost identical in their D1/D2 domain of the large-subunit rDNA and their physiological abilities . In both respects the strains resembled Wickerhamiella domercqiae . On the basis of these data, it is proposed that the strains represent a novel species with the name Candida bombiphila sp . nov . The type strain is CBS 9712T (= NRRL Y-27640T = MH268T). Immunol Lett, 2004 Sep, 95(2), 155 - 9 Identification of cyclophilin A as a CD99-binding protein by yeast two-hybrid screening; Kim HJ et al.; CD99 is a 32kDa surface glycoprotein, which is involved in the migration of leukocytes and the transport of ganglioside GM1 and transmembrane proteins . To identify signaling mechanisms triggered by CD99 engagement, a LexA-based yeast two-hybrid system was utilized to identify proteins interacting with the cytoplasmic domains of CD99 . In seven positive clones, we attempted to ascertain whether cyclophilin A (CypA) was involved in CD99-mediated signaling, since CypA had been implicated as a signaling regulator for kinases and phosphatases . The interaction between CD99 and CypA was confirmed by co-immunoprecipitation and confocal immunofluorescence studies . Interestingly, the amounts of CypA associated with CD99 increased upon CD99 engagement . We prepared an expression plasmid by inserting CypA cDNA into pEGFP, in order to visualize cellular CypA . In HeLa or HEK 293T cells transfected with the pEGFP-CypA plasmid, GFP-tagged CypA was diffusely present in the cytoplasm of untreated cells . However, CypA-GFP moved to the cell periphery and membrane blebbing, and became colocalized with CD99 upon CD99 engagement . These results suggest that CypA may be either a signaling mediator or a signaling regulator for CD99. Curr Microbiol, 2004 Oct, 49(4), 274 - 81 MAP kinase and cAMP signaling pathways modulate the pH-induced yeast-to-mycelium dimorphic transition in the corn smut fungus Ustilago maydis; Martinez-Espinoza AD et al.; Acid pH induces the yeast-to-mycelium transition in haploid cells of Ustilago maydis . We tested two signal transduction pathways known to be involved in dimorphism for roles in acid-induced filamentation . In wild-type cells intracellular cAMP levels were reduced under acid growth . A mutant defective in the regulatory subunit of PKA, ubc1, failed to respond to acid induction on solid medium, but in liquid medium showed a mycelial phenotype at acid pH . Mutants in the pheromone-responsive MAP kinase pathway lost the capacity to grow as mycelium at acid pH, while a mutant in the pheromone response-transcriptional regulator, prf1, behaved as wild-type . Filamentation by both ubc1 and prf1 mutants was inhibited by addition of cAMP . A putative MAP kinase cascade adaptor protein gene, ubc2, complemented a previously identified myc mutant strain defective in pH-induced myceliation . These results indicate that pH-dependent dimorphism is regulated by two known signaling pathways but that an effector for cAMP signaling alternative to Ubc1 is present in U . maydis and that Prf1 is not the sole downstream target of MAP kinase signaling. EMBO J, 2004 Oct 13, 23(20), 4040 - 50 Epub 2004 Sep 23. Targeting of Swi/Snf to the yeast GAL1 UAS G requires the Mediator, TAF IIs, and RNA polymerase II; Lemieux K et al.; The chromatin remodeling activity of the Swi/Snf complex is essential for the expression of several yeast genes . Previous studies have suggested that recruitment of Swi/Snf requires the action of transcriptional activators . However, reports in metazoans and in yeast have provided evidence of interactions between Swi/Snf and the RNA polymerase II holoenzyme/Mediator complex . Here we show that recruitment of Swi/Snf to the galactose-inducible gene GAL1 cannot be fully achieved without the integrity of the Mediator complex, TAF IIs, and RNA polymerase II . Moreover, artificial recruitment of Mediator is sufficient to tether both Swi/Snf and SAGA to the GAL1 UAS G . We further demonstrate that Swi/Snf recruitment at GAL1 does not require acetylation of chromatin by Gcn5 nor the presence of SAGA . Based on these results, we conclude that interactions between the Gal4 activator and Swi/Snf are not sufficient to recruit the latter to the GAL1 UAS G, since interactions with the Mediator, TAF IIs, and RNA polymerase II are also important. Mol Biol Cell, 2004 Dec, 15(12), 5551 - 64 Epub 2004 Dec. Requirements of fission yeast septins for complex formation, localization, and function; An H et al.; Septins are GTP binding proteins important for cytokinesis in many eukaryotes . The Schizosaccaromyces pombe genome sequence predicts orthologues of four of five Saccharomyces cerevisiae septins involved in cytokinesis and these are named Spns1-4p . That spns1-4 are not essential genes permitted the application of a combined genetic and proteomics approach to determine their functional relationships . Our findings indicate that Spns1-4p are present throughout interphase as a diffusely localized approximately 8.5S complex containing two copies of each septin linked together as a chain in the order Spn3p-Spn4p-Spn1p-Spn2p . Septin recruitment to the medial region of the cell is genetically separable from ring formation, and whereas it is normally restricted to mitosis, it can be promoted without activation of the mitotic cell cycle machinery . Coalescence into ring structures requires Spn1p and Spn4p associate with at least one other septin subunit and the expression of Mid2p that is normally restricted to mitosis . This study establishes the functional requirements for septin complex organization in vivo. Mol Biol Cell, 2004 Dec, 15(12), 5219 - 30 Epub 2004 Dec. Spindle pole body duplication in fission yeast occurs at the G1/S boundary but maturation is blocked until exit from S by an event downstream of cdc10+; Uzawa S et al.; The regulation and timing of spindle pole body (SPB) duplication and maturation in fission yeast was examined by transmission electron microscopy . When cells are arrested at G1 by nitrogen starvation, the SPB is unduplicated . On release from G1, the SPBs were duplicated after 1-2 h . In cells arrested at S by hydroxyurea, SPBs are duplicated but not mature . In G1 arrest/release experiments with cdc2.33 cells at the restrictive temperature, SPBs remained single, whereas in cells at the permissive temperature, SPBs were duplicated . In cdc10 mutant cells, the SPBs seem not only to be duplicated but also to undergo partial maturation, including invagination of the nuclear envelope underneath the SPB . There may be an S-phase-specific inhibitor of SPB maturation whose expression is under control of cdc10(+) . This model was examined by induction of overreplication of the genome by overexpression of rum1p or cdc18p . In cdc18p-overexpressing cells, the SPBs are duplicated but not mature, suggesting that cdc18p is one component of this feedback mechanism . In contrast, cells overexpressing rum1p have large, deformed SPBs accompanied by other features of maturation and duplication . We propose a feedback mechanism for maturation of the SPB that is coupled with exit from S to trigger morphological changes. J Biol Chem, 2004 Dec 10, 279(50), 51817 - 27 Epub 2004 Dec 10. Mitochondrial protein oxidation in yeast mutants lacking manganese-(MnSOD) or copper- and zinc-containing superoxide dismutase (CuZnSOD): evidence that MnSOD and CuZnSOD have both unique and overlapping functions in protecting mitochondrial proteins from oxidative damage; O'Brien KM et al.; Saccharomyces cerevisiae expresses two forms of superoxide dismutase (SOD): MnSOD, encoded by SOD2, which is located within the mitochondrial matrix, and CuZnSOD, encoded by SOD1, which is located in both the cytosol and the mitochondrial intermembrane space . Because two different SOD enzymes are located in the mitochondrion, we examined the relative roles of each in protecting mitochondria against oxidative stress . Using protein carbonylation as a measure of oxidative stress, we have found no correlation between overall levels of respiration and the level of oxidative mitochondrial protein damage in either wild type or sod mutant strains . Moreover, mitochondrial protein carbonylation levels in sod1, sod2, and sod1sod2 mutants are not elevated in cells harvested from mid-logarithmic and early stationary phases, suggesting that neither MnSOD nor CuZnSOD is required for protecting the majority of mitochondrial proteins from oxidative damage during these early phases of growth . During late stationary phase, mitochondrial protein carbonylation increases in all strains, particularly in sod1 and sod1sod2 mutants . By using matrix-assisted laser desorption ionization time-of-flight mass spectrometry, we have found that specific proteins become carbonylated in sod1 and sod2 mutants . We identified six mitochondrial protein spots representing five unique proteins that become carbonylated in a sod1 mutant and 19 mitochondrial protein spots representing 11 unique proteins that become carbonylated in a sod2 mutant . Although some of the same proteins are carbonylated in both mutants, other proteins are not . These findings indicate that MnSOD and CuZnSOD have both unique and overlapping functions in the mitochondrion. J Biol Chem, 2004 Dec 3, 279(49), 50764 - 72 Epub 2004 Dec 3. Taz1 binding to a fission yeast model telomere: formation of telomeric loops and higher order structures; Tomaska L et al.; Similar to its human homologues TRF1 and TRF2, fission yeast Taz1 protein is a component of telomeric chromatin regulating proper telomere maintenance . As mammalian TRF1 and TRF2 proteins have been shown to directly bind telomeric DNA to form protein arrays and looped structures, termed t-loops, the ability of Taz1p to act on fission yeast telomeric DNA in similar ways was examined using purified protein and model DNA templates . When incubated with Taz1p, model telomeres containing 3' single-stranded telomeric overhangs formed t-loops at a frequency approaching 13% . Termini with blunt ends and non-telomeric overhangs were deficient in t-loop formation . In addition, we observed arrays of multiple Taz1p molecules bound to the telomeric regions, resembling the pattern of TRF1 binding . The presence of t-loops larger than the telomeric tract, a high frequency of end-bound DNAs and a donut shape of the Taz1p complex suggest that Taz1p binds the 3' overhang then extrudes a loop that grows in size as the donut slides along the duplex DNA . Based on these in vitro results we discuss possible general implications for fission yeast telomere dynamics. Mol Biochem Parasitol, 2004 Oct, 137(2), 239 - 45 3' UTR signals necessary for expression of the Plasmodium gallinaceum ookinete protein, Pgs28, share similarities with those of yeast and plants; Cann H et al.; During metazoan development, 3' UTR signals mediate the time and place of gene expression . For protozoan Plasmodium parasites, the formation of ookinetes from gametes in the mosquito midgut is an analogous developmental process . Previous studies of the 3' UTR signals necessary for expression of Pgs28, the major surface protein of Plasmodium gallinaceum ookinetes, suggested that a 3' UTR T-rich region and DNA sequences containing an ATTAAA eukaryotic polyadenylation consensus motif were necessary for its expression . During metazoan development, U-rich elements may function in conjunction with eukaryotic polyadenylation consensus signals to mediate developmental protein expression . To define whether the putative Plasmodium elements were mediators of Pgs28 expression mutations of these nucleotide sequences were made in plasmid constructs . The effect of the mutations on Pgs28 expression was tested by the transient gene transfection of sexual stage P . gallinaceum parasites . These studies reveal that two different mutations of the ATTAAA motif, which alter gene expression in higher eukaryotes and yeast, do not alter the expression of Pgs28 . However, the U-rich element, adjacent nucleotides UUUACAAAAUUGUUUUAACU and downstream nucleotides UAUAUAAAA are able to mediate expression to varying degrees . The organization and overlapping function of these elements appears to more closely resemble that of yeasts or plants than those of metazoans. J Cell Biol, 2004 Sep 27, 166(7), 969 - 74 Epub 2004 Sep 20. An AIF orthologue regulates apoptosis in yeast; Wissing S et al.; Apoptosis-inducing factor (AIF), a key regulator of cell death, is essential for normal mammalian development and participates in pathological apoptosis . The proapoptotic nature of AIF and its mode of action are controversial . Here, we show that the yeast AIF homologue Ynr074cp controls yeast apoptosis . Similar to mammalian AIF, Ynr074cp is located in mitochondria and translocates to the nucleus of yeast cells in response to apoptotic stimuli . Purified Ynr074cp degrades yeast nuclei and plasmid DNA . YNR074C disruption rescues yeast cells from oxygen stress and delays age-induced apoptosis . Conversely, overexpression of Ynr074cp strongly stimulates apoptotic cell death induced by hydrogen peroxide and this effect is attenuated by disruption of cyclophilin A or the yeast caspase YCA1 . We conclude that Ynr074cp is a cell death effector in yeast and rename it AIF-1 (Aif1p, gene AIF1). Biochem Biophys Res Commun, 2004 Oct 22, 323(3), 789 - 95 Copper-dependent protein-protein interactions studied by yeast two-hybrid analysis; van Dongen EM et al.; An important step in copper homeostasis is delivery of copper to a specific P-type ATPase in the Golgi apparatus (Ccc2 in yeast, ATP7A and ATP7B in humans) by a small copper chaperone protein (Atx1 in yeast, ATOX1 in humans) . Atx1 and ATOX1 both contain an MXCXXC motif that is also present in Ccc2 (two motifs) and ATP7A/B (six motifs) . Protein-protein interactions probably require coordination of one Cu(I) by cysteines from both MXCXXC motifs . We applied yeast two-hybrid analysis to screen systematically all possible interactions between MXCXXC-containing domains in these proteins . We demonstrate that ATOX1 and Atx1 preferentially interact with domains 2 and 4 of ATP7B and that Atx1 interacts with both Ccc2 domains . All combinations show a remarkable bell-shaped dependency on copper concentration that is maximal just below normal copper levels . Our results suggest that yeast two-hybrid analysis can be used to study the intracellular copper status of a cell. Curr Biol, 2004 Sep 21, 14(18), R748 - 50 Mitotic spindle: laser microsurgery in yeast cells; Carvalho P et al.; Laser microsurgery has led to remarkable discoveries in a number of cell types . Two recent studies have shown that this classical technology can now be employed with small yeast cells . This advance will enable regional ablation to be combined with facile genetic manipulation in a eukaryotic cell. Curr Biol, 2004 Sep 21, 14(18), 1675 - 9 Activation of the Gal1 gene of yeast by pairs of 'non-classical' activators; Cheng JX et al.; Eukaryotic transcriptional activators work by recruiting to DNA the transcriptional machinery, including protein complexes required for chromatin modification, transcription initiation, and elongation . Which of these complexes must be directly recruited to trigger transcription? We test various "non-classical" transcription activators (comprising a component of the transcriptional machinery fused to a DNA binding domain) for their abilities to activate transcription of a chromosomally integrated reporter in yeast . Among these newly constructed fusion proteins, none efficiently activated transcription when working on its own . However, in several instances transcription was activated by a pair of such fusion proteins tethered to adjacent sites on DNA . In each of these cases, one fusion protein bore a component of the SAGA complex, and the other bore a component of the Mediator complex . Transcription was also activated by certain tripartite fusion proteins comprising a Mediator and a SAGA component fused to a DNA binding domain . The results are consistent with the finding that the classical activator Gal4, working at the GAL1 promoter, activates transcription by (at least in part) independently recruiting SAGA and Mediator. Langmuir, 2004 Sep 28, 20(20), 8812 - 6 Grabbing yeast iso-1-cytochrome c by Cys102: an effective approach for the assembly of functionally active metalloprotein carpets; Gerunda M et al.; We report an approach for immobilizing iso-1-cytochrome c from Saccharomyces cerevisiae on oxygen exposing surfaces derivatized with SH-terminated silanes . The SH moieties from silanes have been brought to react with the partially buried Cys102, forming an intermolecular disulfide bond which anchored covalently cytochrome c to the surface . The presence of a single cysteine residue on the protein surface imparted a well-defined orientation to the molecular edifice . Molecular constructs obtained with native cytochrome c and with a cysteine-depleted mutant (C102T) have been investigated by means of scanning force microscopy under liquid, which was performed to assay the quality of the molecular carpet, showing that the native protein formed a robust monolayer at the surface, whereas only a negligible amount of physisorbed molecules were detected in the case of a mutant . UV-vis absorption spectroscopy was performed to confirm that immobilization takes place via the Cys102 residue . Linear sweep voltammetric measurements showed retention of the redox activity of the covalently immobilized cytochrome c, confirming the viability of the proposed immobilization method for obtaining monolayers of redox active molecules. World J Gastroenterol, 2004 Oct 15, 10(20), 2989 - 93 Yeast expression and DNA immunization of hepatitis B virus S gene with second-loop deletion of alpha determinant region; Hu H et al.; AIM: Immune escape mutations of HBV often occur in the dominant epitope, the second-loop of the a determinant of hepatitis B surface antigen (HBsAg) . To let the hosts respond to the subdominant epitopes in HBsAg may be an effective way to decrease the prevalence of immune escape mutants . For this reason, a man-made clone of HBV S gene with the second-loop deletion was constructed . Its antigenicity was evaluated by yeast expression analysis and DNA immunization in mice . METHODS: HBV S gene with deleted second-loop, amino acids from 139 to 145, was generated using splicing by overlap extension . HBV deleted S gene was then cloned into the yeast expression vector pPIC9 and the mammalian expression vector pcDNA3 to generate pHB-SDY and pHB-SD, respectively . The complete S gene was cloned into the same vectors as controls . The deleted recombinant HBsAg expressed in yeasts was detected using Abbott IMx HBsAg test kits, enzyme-linked immunoadsorbent assay (ELISA) and immune dot blotting to evaluate its antigenicity in vitro . The anti-HBs responses to DNA immunization in BALB/c mice were detected using Abbott IMx AUSAB test kits to evaluate the antigenicity of that recombinant protein in vivo . RESULTS: Both deleted and complete HBsAg were successfully expressed in yeasts . They were intracellular expressions . The deleted HBsAg could not be detected by ELISA, in which the monoclonal anti-HBs against the alpha determinant was used, but could be detected by Abbott IMx and immune dot blotting, in which multiple monoclonal anti-HBs and polyclonal anti-HBs were used, respectively . The activity of the deleted HBsAg detected by Abbott IMx was much lower than that of complete HBsAg (the ratio of sample value/cut off value, 106+/-26.7 vs 1 814.4+/-776.3, P<0.01, t = 5.02) . The anti-HBs response of pHB-SD to DNA immunization was lower than that of complete HBV S gene vector pHB (the positive rate 2/10 vs 6/10, 4.56+/-3.52 mIU/mL vs 27.60+/-17.3 mIU/mL, P = 0.02, t = 2.7) . CONCLUSIONS: HBsAg with deleted second-loop of the alpha determinant still has antigenicity, and can also raise weak anti-HBs response in mice to DNA immunization, suggesting that it is possible to develop a subdominant vaccine for preventing infections of immune escape mutants of HBV. J Biol Chem, 2004 Nov 26, 279(48), 49780 - 6 Epub 2004 Nov 26. The contributions of protein disulfide isomerase and its homologues to oxidative protein folding in the yeast endoplasmic reticulum; Xiao R et al.; In vitro, protein disulfide isomerase (Pdi1p) introduces disulfides into proteins (oxidase activity) and provides quality control by catalyzing the rearrangement of incorrect disulfides (isomerase activity) . Protein disulfide isomerase (PDI) is an essential protein in Saccharomyces cerevisiae, but the contributions of the catalytic activities of PDI to oxidative protein folding in the endoplasmic reticulum (ER) are unclear . Using variants of Pdi1p with impaired oxidase or isomerase activity, we show that isomerase-deficient mutants of PDI support wild-type growth even in a strain in which all of the PDI homologues of the yeast ER have been deleted . Although the oxidase activity of PDI is sufficient for wild-type growth, pulse-chase experiments monitoring the maturation of carboxypeptidase Y reveal that oxidative folding is greatly compromised in mutants that are defective in isomerase activity . Pdi1p and one or more of its ER homologues (Mpd1p, Mpd2p, Eug1p, Eps1p) are required for efficient carboxypeptidase Y maturation . Consistent with its function as a disulfide isomerase in vivo, the active sites of Pdi1p are partially reduced (32 +/- 8%) in vivo . These results suggest that PDI and its ER homologues contribute both oxidase and isomerase activities to the yeast ER . The isomerase activity of PDI can be compromised without affecting growth and viability, implying that yeast proteins that are essential under laboratory conditions may not require efficient disulfide isomerization. J Biol Chem, 2004 Nov 26, 279(48), 49762 - 72 Epub 2004 Nov 26. Roles of O-mannosylation of aberrant proteins in reduction of the load for endoplasmic reticulum chaperones in yeast; Nakatsukasa K et al.; The protein quality control system in the endoplasmic reticulum (ER) ensures that only properly folded proteins are deployed throughout the cells . When nonnative proteins accumulate in the ER, the unfolded protein response is triggered to limit further accumulation of nonnative proteins and the ER is cleared of accumulated nonnative proteins by the ER-associated degradation (ERAD) . In the yeast ER, aberrant nonnative proteins are mainly directed for the ERAD, but a distinct fraction of them instead receive O-mannosylation . In order to test whether O-mannosylation might also be a mechanism to process aberrant proteins in the ER, here we analyzed the effect of O-mannosylation on two kinds of model aberrant proteins, a series of N-glycosylation site mutants of prepro-alpha-factor and a pro-region-deleted derivative of Rhizopus niveus aspartic proteinase-I (Deltapro) both in vitro and in vivo . O-Mannosylation increases solubilities of the aberrant proteins and renders them less dependent on the ER chaperone, BiP, for being soluble . The release from ER chaperones allows the aberrant proteins to exit out of the ER for the normal secretory pathway transport . When the gene for Pmt2p, responsible for the O-mannosylation of these aberrant proteins, and that for the ERAD were simultaneously deleted, the cell exhibited enhanced unfolded protein response . O-Mannosylation may therefore function as a fail-safe mechanism for the ERAD by solubilizing the aberrant proteins that overflowed from the ERAD pathway and reducing the load for ER chaperones. Peptides, 2004 Sep, 25(9), 1465 - 76 A walk-through of the yeast mating pheromone response pathway; Bardwell L; The intracellular signal transduction pathway by which the yeast Saccharomyces cerevisiae responds to the presence of peptide mating pheromone in its surroundings is one of the best understood signaling pathways in eukaryotes, yet continues to generate new surprises and insights . In this review, we take a brief walk down the pathway, focusing on how the signal is transmitted from the cell-surface receptor-coupled G protein, via a MAP kinase cascade, to the nucleus. Eur J Biochem, 2004 Oct, 271(19), 3897 - 904 Use of hydrostatic pressure to produce 'native' monomers of yeast enolase; Kornblatt MJ et al.; The effects of hydrostatic pressure on yeast enolase have been studied in the presence of 1 mm Mn(2+) . When compared with apo-enolase, and Mg-enolase, the Mn-enzyme differs from the others in three ways . Exposure to hydrostatic pressure does not inactivate the enzyme . If the experiments are performed in the presence of 1 mm Mg(2+), or with apo-enzyme, the enzyme is inactivated {Kornblatt, M.J., Lange R., Balny C . (1998) Eur . J . Biochem 251, 775-780} . The UV spectra of the high pressure forms of the Mg(2+)- and apo-forms of enolase are identical and distinct from the spectrum of the form obtained in the presence of 1 mm Mn(2+); this suggests that Mn(2+) remains bound to the high pressure form of enolase . With Mn-enolase, the various spectral changes do not occur in the same pressure range, indicating that multiple processes are occurring . Pressure experiments were performed as a function of {Mn(2+)} and {protein} . One of the changes in the UV spectra shows a dependence on protein concentration, indicating that enolase is dissociating into monomers . The small changes in the UV spectrum and the retention of activity lead to a model in which enolase, in the presence of high concentrations of Mn(2+), dissociates into native monomers; upon release of pressure, the enzyme is fully active . Although further spectral changes occur at higher pressures, there is no inactivation as long as Mn(2+) remains bound . We propose that the relatively small and polar nature of the subunit interface of yeast enolase, including the presence of several salt bridges, is responsible for the ability of hydrostatic pressure to dissociate this enzyme into monomers with a native-like structure. Anal Chem, 2004 Sep 1, 76(17), 5149 - 56 Determination of methionine and selenomethionine in yeast by species-specific isotope dilution GC/MS; Yang L et al.; A method for the simultaneous determination of methionine (Met) and selenomethionine (SeMet) in yeast using species-specific isotope dilution (ID) gas chromatography/mass spectrometry (GC/MS) is described . Samples were digested by refluxing for 16 h with 4 M methanesulfonic acid . Analytes were derivatized with methyl chloroformate and extracted into chloroform for GC/MS analysis . In addition to use of commercially available 13C-enriched Met and SeMet spikes for species specific ID analysis, a 74Se-enriched SeMet spike was also available for comparison of results . In selective ion monitoring mode, the intensities of ions at m/z 221, 222, 269, 270, and 263 were used to calculate the 221/222, 269/270, and 269/263 ion ratios for quantification of Met and SeMet . Concentrations of 5959 +/- 33 and 3404 +/- 12 microg g(-1) (one standard deviation, n = 6) with relative standard deviations of 0.55 and 0.36% for Met and SeMet, respectively, were obtained using 13C-enriched spikes . A concentration of 3417 +/- 8 microg g(-1) (one standard deviation, n = 6) was obtained using the 74Se-enriched SeMet spike . The concentration of SeMet measured in the yeast is equivalent to 66.43 +/- 0.24% of total Se and 30.31 +/- 0.11% of total Met is in the form of SeMet . Method detection limits (three times the standard deviation) of 3.4 and 1.0 microg g(-1) were estimated for Met and SeMet, respectively, based on a 0.25-g subsample of yeast with 1 mL of extract used for derivatization . A similar concentration of 5930 +/- 29 microg g(-1) (one standard deviation, n = 4) for Met and a lower concentration of 2787 +/- 49 microg g(-1) (one standard deviation, n = 4) for SeMet were obtained for this yeast sample using species-specific ID analysis based on GC/MS with 13C-enriched Met and SeMet spikes when a 2-h open microwave digestion approach using 8 M methanesulfonic acid was used. EMBO J, 2004 Sep 29, 23(19), 3825 - 35 Epub 2004 Sep 16. A chromodomain protein, Chp1, is required for the establishment of heterochromatin in fission yeast; Sadaie M et al.; The chromodomain is a conserved motif that functions in the epigenetic control of gene expression . Here, we report the functional characterization of a chromodomain protein, Chp1, in the heterochromatin assembly in fission yeast . We show that Chp1 is a structural component of three heterochromatic regions-centromeres, the mating-type region, and telomeres-and that its localization in these regions is dependent on the histone methyltransferase Clr4 . Although deletion of the chp1(+) gene causes centromere-specific decreases in Swi6 localization and histone H3-K9 methylation, we show that the role of Chp1 is not exclusive to the centromeres . We found that some methylation persists in native centromeric regions in the absence of Chp1, which is also true for the mating-type region and telomeres, and determined that Swi6 and Chp2 are critical to maintaining this residual methylation . We also show that Chp1 participates in the establishment of repressive chromatin in all three chromosomal regions . These results suggest that different heterochromatic regions share common structural properties, and that centromeric heterochromatin requires Chp1-mediated establishment steps differently than do other heterochromatic regions. Mol Biol Cell, 2004 Nov, 15(11), 4971 - 89 Epub 2004 Sep 15. Stable and dynamic axes of polarity use distinct formin isoforms in budding yeast; Pruyne D et al.; Bud growth in yeast is guided by myosin-driven delivery of secretory vesicles from the mother cell to the bud . We find transport occurs along two sets of actin cables assembled by two formin isoforms . The Bnr1p formin assembles cables that radiate from the bud neck into the mother, providing a stable mother-bud axis . These cables also depend on septins at the neck and are required for efficient transport from the mother to the bud . The Bni1p formin assembles cables that line the bud cortex and target vesicles to varying locations in the bud . Loss of these cables results in morphological defects as vesicles accumulate at the neck . Assembly of these cables depends on continued polarized secretion, suggesting vesicular transport provides a positive feedback signal for Bni1p activation, possibly by rho-proteins . By coupling different formin isoforms to unique cortical landmarks, yeast uses common cytoskeletal elements to maintain stable and dynamic axes in the same cell. Mol Biol Cell, 2004 Dec, 15(12), 5659 - 69 Epub 2004 Dec. Disruption of yeast forkhead-associated cell cycle transcription by oxidative Stress; Shapira M et al.; The effects of oxidative stress on yeast cell cycle depend on the stress-exerting agent . We studied the effects of two oxidative stress agents, hydrogen peroxide (HP) and the superoxide-generating agent menadione (MD) . We found that two small coexpressed groups of genes regulated by the Mcm1-Fkh2-Ndd1 transcription regulatory complex are sufficient to account for the difference in the effects of HP and MD on the progress of the cell cycle, namely, G1 arrest with MD and an S phase delay followed by a G2/M arrest with HP . Support for this hypothesis is provided by fkh1fkh2 double mutants, which are affected by MD as we find HP affects wild-type cells . The apparent involvement of a forkhead protein in HP-induced cell cycle arrest, similar to that reported for Caenorhabditis elegans and human, describes a potentially novel stress response pathway in yeast. Mol Biol Cell, 2004 Dec, 15(12), 5255 - 67 Epub 2004 Dec. The fission yeast kinetochore component Spc7 associates with the EB1 family member Mal3 and is required for kinetochore-spindle association; Kerres A et al.; A critical aspect of mitosis is the interaction of the kinetochore with spindle microtubules . Fission yeast Mal3 is a member of the EB1 family of microtubule plus-end binding proteins, which have been implicated in this process . However, the Mal3 interaction partner at the kinetochore had not been identified . Here, we show that the mal3 mutant phenotype can be suppressed by the presence of extra Spc7, an essential kinetochore protein associated with the central centromere region . Mal3 and Spc7 interact physically as both proteins can be coimmunoprecipitated . Overexpression of a Spc7 variant severely compromises kinetochore-microtubule interaction, indicating that the Spc7 protein plays a role in this process . Spc7 function seems to be conserved because, Spc105, a Saccharomyces cerevisiae homolog of Spc7, identified by mass spectrometry as a component of the conserved Ndc80 complex, can rescue mal3 mutant strains. J Biol Chem, 2004 Nov 26, 279(48), 50025 - 30 Epub 2004 Nov 26. The yeast prion protein ure2 shows glutathione peroxidase activity in both native and fibrillar forms; Bai M et al.; Ure2p is the precursor protein of the Saccharomyces cerevisiae prion {URE3} . Ure2p shows homology to glutathione transferases but lacks typical glutathione transferase activity . A recent study found that deletion of the Ure2 gene causes increased sensitivity to heavy metal ions and oxidants, whereas prion strains show normal sensitivity . To demonstrate that protection against oxidant toxicity is an inherent property of native and prion Ure2p requires biochemical characterization of the purified protein . Here we use steady-state kinetic methods to characterize the multisubstrate peroxidase activity of Ure2p using GSH with cumene hydroperoxide, hydrogen peroxide, or tert-butyl hydroperoxide as substrates . Glutathione-dependent peroxidase activity was proportional to the Ure2p concentration and showed optima at pH 8 and 40 degrees C . Michaelis-Menten behavior with convergent straight lines in double reciprocal plots was observed . This excludes a ping-pong mechanism and implies either a rapid-equilibrium random or a steady-state ordered sequential mechanism for Ure2p, consistent with its classification as a glutathione transferase . The mutant 90Ure2, which lacks the unstructured N-terminal prion domain, showed kinetic parameters identical to wild type . Fibrillar aggregates showed the same level of activity as native protein . Demonstration of peroxidase activity for Ure2 represents important progress in elucidation of its role in vivo . Further, establishment of an in vitro activity assay provides a valuable tool for the study of structure-function relationships of the Ure2 protein as both a prion and an enzyme. Genes Dev, 2004 Sep 15, 18(18), 2283 - 91 Epub 2004 Sep 01. Requirement of yeast Rad1-Rad10 nuclease for the removal of 3'-blocked termini from DNA strand breaks induced by reactive oxygen species; Guzder SN et al.; The Rad1-Rad10 nuclease of yeast and its human counterpart ERCC1-XPF are indispensable for nucleotide excision repair, where they act by cleaving the damaged DNA strand on the 5'-side of the lesion . Intriguingly, the ERCC1- and XPF-deficient mice show a severe postnatal growth defect and they die at approximately 3 wk after birth . Here we present genetic and biochemical evidence for the requirement of Rad1-Rad10 nuclease in the removal of 3'-blocked termini from DNA strand breaks induced on treatment of yeast cells with the oxidative DNA damaging agent H(2)O(2) . Our genetic studies indicate that 3'-blocked termini are removed in yeast by the three competing pathways that involve the Apn1, Apn2, and Rad1-Rad10 nucleases, and we show that the Rad1-Rad10 nuclease proficiently cleaves DNA modified with a 3'-phosphoglycolate terminus . From these observations, we infer that deficient removal of 3'-blocking groups formed from the action of oxygen free radicals generated during normal cellular metabolism is the primary underlying cause of the inviability of apn1Delta apn2Delta rad1Delta and apn1Deltaapn2Delta rad10Delta mutants and that such a deficiency accounts also for the severe growth defects of ERCC1- and XPF-deficient mice. Genes Dev, 2004 Sep 15, 18(18), 2249 - 54 Two modes of DNA double-strand break repair are reciprocally regulated through the fission yeast cell cycle; Ferreira MG et al.; Several considerations suggest that levels of the two major modes of double-strand break (DSB) repair, homologous recombination (HR), and nonhomologous end joining (NHEJ), are regulated through the cell cycle . However, this idea has not been explicitly tested . In the absence of the telomere-binding protein Taz1, fission yeast undergo lethal telomere fusions via NHEJ . These fusions occur only during periods of nitrogen starvation and fail to accumulate during logarithmic growth, when the majority of cells are in G2 . We show that G1 arrest is the specific nitrogen starvation-induced event that promotes NHEJ between taz1(-) telomeres . Furthermore, the general levels of NHEJ and HR are reciprocally regulated through the cell cycle, so that NHEJ is 10-fold higher in early G1 than in other cell cycle stages; the reverse is true for HR . Whereas NHEJ is known to be dispensable for survival of DSBs in cycling cells, we find that it is critical for repair and survival of DSBs arising during G1. J Microbiol Methods, 2004 Nov, 59(2), 289 - 92 Adaptation of FUN-1 and Calcofluor white stains to assess the ability of viable and nonviable yeast to adhere to and be internalized by cultured mammalian cells; Henry-Stanley MJ et al.; The FUN-1 and Calcofluor white stains can be used in concert to assess the ability of viable and nonviable yeast to adhere to, and be internalized by, host mammalian cells in vitro . With this method, only extracellular yeast stain with Calcofluor, dead yeast cells have diffuse cytoplasmic yellow-green fluorescence, and live yeast have cytoplasmic orange-red or yellow-orange fluorescent intravacuolar structures. Biochem Biophys Res Commun, 2004 Oct 15, 323(2), 534 - 40 Athb-12, a homeobox-leucine zipper domain protein from Arabidopsis thaliana, increases salt tolerance in yeast by regulating sodium exclusion; Shin D et al.; An Arabidopsis cDNA clone that encodes Athb-12, a homeobox-leucine zipper domain protein (HD-Zip), was isolated by functional complementation of the NaCl-sensitive phenotype of a calcineurin (CaN)-deficient yeast mutant (cnbDelta, regulatory subunit null) . CaN, a Ca2+/calmodulin-dependent protein phosphatase, regulates Na+ ion homeostasis in yeast . Expression of Athb-12 increased NaCl tolerance but not osmotic stress tolerance of these cnbDelta cells . Furthermore, expression of two other HD-Zip from Arabidopsis, Athb-1 and -7, did not suppress NaCl sensitivity of cnbDelta cells . These results suggest that Athb-12 specifically functions in Na+ ion homeostasis in yeast . Consistent with these observations, expression of Athb-12 in yeast turned on transcription of the NaCl stress-inducible PMR2A, which encodes a Na+/Li+ translocating P-type ATPase, and decreased Na+ levels in yeast cells . To investigate the biological function of Athb-12 in Arabidopsis, we performed Northern blot analysis . Expression of Athb-12 was dramatically induced by NaCl and ABA treatments, but not by KCl . In vivo targeting experiments using a green fluorescent protein reporter indicated that Athb-12 was localized to the nucleus . These results suggest that Athb-12 is a putative transcription factor that may be involved in NaCl stress responses in plants . Biochem Biophys Res Commun, 2004 Oct 15, 323(2), 425 - 8 Predicting 22 protein localizations in budding yeast; Cai YD et al.; According to the recent experiments, proteins in budding yeast can be distinctly classified into 22 subcellular locations . Of these proteins, some bear the multi-locational feature, i.e., occur in more than one location . However, so far all the existing methods in predicting protein subcellular location were developed to deal with only the mono-locational case where a query protein is assumed to belong to one, and only one, subcellular location . To stimulate the development of subcellular location prediction, an augmentation procedure is formulated that will enable the existing methods to tackle the multi-locational problem as well . It has been observed thru a jackknife cross-validation test that the success rate obtained by the augmented GO-FnD-PseAA algorithm {BBRC 320 (2004) 1236} is overwhelmingly higher than those by the other augmented methods . It is anticipated that the augmented GO-FunD-PseAA predictor will become a very useful tool in predicting protein subcellular localization for both basic research and practical application . Planta Med, 2004 Aug, 70(8), 728 - 35 Estrogenic activity of isolated compounds and essential oils of Pimpinella species from Turkey, evaluated using a recombinant yeast screen; Tabanca N et al.; Several plants and plant-derived pure compounds, designated as phytoestrogens, have been reported to cause estrogenic effects . They have been used for alleviation of menopausal symptoms, prevention of osteoporosis, heart disease and cancer . There is an increased interest in studying phytoestrogens such as isoflavones and lignans for their use as replacements for synthetic estrogens . In this study, the estrogenic activity of essential oils of eleven Pimpinella species and the compounds isolated from these species were evaluated using the yeast estrogen screen (YES) assay . The essential oils containing (E)-anethole as major compound showed estrogenic activity in the YES assay, except for the aerial parts without fruits of P . anisetum and P . flabellifolia . The percent maximal response produced by most anethole-containing oils was 30-50% . Fruits of P . isaurica and P . peucedanifolia were estrogenic in spite of the absence or trace amount of anethole, respectively . This study indicates that the estrogenic activity of Pimpinella oils is not solely due to the presence of anethole . Components other than anethole may be responsible for contributing towards the estrogenic activity . The essential oils from different species varied in their estrogenic potencies (relative potency from 8.3 x 10(-8) to 1.2 x 10(-6) compared to 17 beta-estradiol) and among the different plant parts, the fruit oils of most species were estrogenic followed by the aerial parts without fruits and the root oils and their EC50 values varied from 45 micrograms/mL to 650 micrograms/mL. Ann Ig, 2004 Jul-Aug, 16(4), 579 - 85 A recombinant yeast strain as a short term bioassay to assess estrogen-like activity of xenobiotics; Pinto B et al.; The study investigated the responsiveness of a recombinant Saccharomyces cerevisiae yeast strain to screen estrogen-like chemicals in order to use it as a first level short-term bioassay for environmental preventive medicine purposes . We used the yeast strain RMY326 ER-ERE, containing the human estrogen receptor alpha and a reporter gene lacZ encoding the enzyme b-galactosidase . We tested the natural steroid hormone 17beta-estradiol, diethylstilbestrol, colchicine, some phytoestrogens and pesticides, and organochlorine insecticides . The relative inductive efficiency (RIE) and EC50 values confirmed the sensitivity and specificity of the yeast strain . A statistically significant reproducibility of results in repeated experiments was assessed. Mutat Res, 2004 Oct 10, 563(2), 159 - 69 Mutagen X and chlorinated tap water are recombinagenic in yeast; Egorov AI et al.; This study determines the effects of a water disinfection by-product, 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone (also known as mutagen X or MX) and chlorinated tap water on genomic instability in the yeast Saccharomyces cerevisiae . Tap water samples collected from Cherepovets (Russia) and Boston (MA, USA), were extracted using XAD absorption and ethyl acetate elution . MX and these water extracts were then tested for their ability to induce intrachromosomal recombination (deletions or DEL events), interchromosomal recombination (ICR) and aneuploidy (ANEU) using the yeast DEL assay . MX strongly induced DEL, ICR and ANEU events with a positive dose response and no threshold . Cherepovets tap water induced DEL and ICR events while evidence of ANEU induction was weak . The DEL induction potencies were stronger at higher concentrations . The estimated contribution of MX to DEL induction varied from over 50% at low concentrations (which is comparable to a typical contribution of MX to Ames mutagenicity of tap water) to between 2 and 10% at highest concentrations . For Boston tap water, there was only weak evidence of DEL induction and no evidence of ICR and ANEU induction . This is consistent with the results of other studies, which reported much higher concentrations of MX and stronger Ames mutagenicity in Cherepovets tap water than in Boston tap water. Anal Chem, 2004 Sep 15, 76(18), 5282 - 92 A three-dimensional flow control concept for single-cell experiments on a microchip . 2 . Fluorescein diacetate metabolism and calcium mobilization in a single yeast cell as stimulated by glucose and pH changes; Peng XY et al.; Using a three-dimensional flow control concept to manipulate and retain a single yeast cell in a microchip, we were able to study the kinetics of intracellular metabolism and calcium mobilization at the single-cell level, as stimulated by glucose and pH changes . As a model study, the fluorogenic substrate fluorescein diacetate (FDA) was chosen to study how the intracellular carboxylesterase metabolize it . A single yeast cell was first cultured in the microchip . Thereafter, under a constant concentration of FDA, influx of FDA into the yeast cell occurred and FDA was hydrolyzed or metabolized . It was found that changes in both pH and glucose stimulated the FDA metabolism in a yeast cell, and the stimuli can elicit multiple responses from the cell . Since it was carried out within the microchip, the whole experiment on one single yeast cell could last for as long as 10 h . The dormant cell, budding cell, and pretreated budding cell (in low-pH buffer) of yeast resulted in different responses . Experimental data provided details on the FDA metabolism at the single-cell level and revealed strong correlations between FDA metabolism and calcium mobilization . Furthermore, efflux of the FDA metabolite fluorescein could start spontaneously if there was glucose in the medium . The experiments on a single cell were of the "human cell conservation" style because the cell responded to the reagent changes implemented by the human researcher . A mathematical model was also developed to study the influx-hydrolysis-efflux processes of the FDA metabolism using single-cell fluorescent data . These long overdue single-cell experiments are now rendered possible using the three-dimensional flow control in the microchip. EMBO J, 2004 Sep 29, 23(19), 3844 - 53 Epub 2004 Sep 09. Role of the fission yeast SUMO E3 ligase Pli1p in centromere and telomere maintenance; Xhemalce B et al.; Sumoylation represents a conserved mechanism of post-translational protein modification . We report that Pli1p, the unique fission yeast member of the SP-RING family, is a SUMO E3 ligase in vivo and in vitro . pli1Delta cells display no obvious mitotic growth defects, but are sensitive to the microtubule-destabilizing drug TBZ and exhibit enhanced minichromosome loss . The weakened centromeric function of pli1Delta cells may be related to the defective heterochromatin structure at the central core, as shown by the reduced silencing of an ura4 variegation reporter gene inserted at cnt and imr . Interestingly, pli1Delta cells also exhibit enhanced loss of the ura4 reporter at these loci, likely by gene conversion using homologous sequences as information donors . Moreover, pli1Delta cells exhibit consistent telomere length increase, possibly achieved by a similar process . Point mutations within the RING finger of Pli1p totally or partially reproduce the pli1 deletion phenotypes, thus correlating with their sumoylation activity . Altogether, these results strongly suggest that Pli1p, and by extension sumoylation, is involved in mechanisms that regulate recombination in particular heterochromatic repeated sequences. EMBO J, 2004 Sep 29, 23(19), 3836 - 43 Epub 2004 Sep 09. Reaction cycle of the yeast Isw2 chromatin remodeling complex; Fitzgerald DJ et al.; Members of the ISWI family of chromatin remodeling factors hydrolyze ATP to reposition nucleosomes along DNA . Here we show that the yeast Isw2 complex interacts with DNA in a nucleotide-dependent manner at physiological ionic strength . Isw2 efficiently binds DNA in the absence of nucleotides and in the presence of a nonhydrolyzable ATP analog . Conversely, ADP promotes the dissociation of Isw2 from DNA . In contrast, Isw2 remains bound to mononucleosomes through multiple cycles of ATP hydrolysis . Solution studies show that Isw2 undergoes nucleotide-dependent alterations in conformation not requiring ATP hydrolysis . Our results indicate that during an Isw2 remodeling reaction, hydrolysis of successive ATP molecules coincides with cycles of DNA binding, release, and rebinding involving elements of Isw2 distinct from those interacting with nucleosomes . We propose that progression of the DNA-binding site occurs while nucleosome core contacts are maintained and generates a force dissipated by disruption of histone-DNA interactions. Mol Cells, 2004 Aug 31, 18(1), 122 - 6 A protein interaction map of soybean mosaic virus strain G7H based on the yeast two-hybrid system; Kang SH et al.; A protein interaction map of Soybean mosaic virus (SMV) strain G7H was generated by the yeast two-hybrid system . Clones encoding the genes P1, HC-Pro, P3, 6K1, CI, 6K2, VPg, NIa, NIb, and CP were fused downstream of the GAL4 binding domain (GAL4-BD) and of the GAL4 activation domain (GAL4-AD) . The GAL4-BD and GAL4-AD fusion derivatives of each gene were co-transformed into yeast and transformants in which interaction took place were identified on selective media . Interacting fusion proteins were extracted from the yeast cells, run on SDS-PAGE gels and finally checked by Western blotting with GAL4 polyclonal antibodies . Strong interactions were detected between the pairs CP/CP, HC-Pro/HC-Pro, NIa/NIa, and CP/HC-Pro . Relatively weak but significant interaction was detected between VPg and NIa . Although not all of the protein-protein interactions previously reported in other potyviruses were detected, the interactions revealed here were, in general, similar to those reported previously. Protein Expr Purif, 2004 Oct, 37(2), 479 - 85 Ni-chelate-affinity purification and crystallization of the yeast mitochondrial F1-ATPase; Mueller DM et al.; The yeast mitochondrial ATPase has been genetically modified to include a His(6) Ni-affinity tag on the amino end of the mature beta-subunit . The modified beta-subunit is imported into the mitochondrion, properly processed to the mature form, and assembled into a mature and fully active ATP synthase . The F(1)-ATPase has been purified from submitochondrial particles after release from the membrane with chloroform, followed by Ni-chelate-affinity and gel filtration chromatography . The final enzyme is a homogeneous preparation with full activity and no apparent degradation products . This enzyme preparation has been used to obtain crystals that diffract to better than 2.8 A resolution. Nucleic Acids Res, 2004 Sep 08, 32(16), 4804 - 11 Print 2004. The interactome as a tree--an attempt to visualize the protein-protein interaction network in yeast; Lu H et al.; The refinement and high-throughput of protein interaction detection methods offer us a protein-protein interaction network in yeast . The challenge coming along with the network is to find better ways to make it accessible for biological investigation . Visualization would be helpful for extraction of meaningful biological information from the network . However, traditional ways of visualizing the network are unsuitable because of the large number of proteins . Here, we provide a simple but information-rich approach for visualization which integrates topological and biological information . In our method, the topological information such as quasi-cliques or spoke-like modules of the network is extracted into a clustering tree, where biological information spanning from protein functional annotation to expression profile correlations can be annotated onto the representation of it . We have developed a software named PINC based on our approach . Compared with previous clustering methods, our clustering method ADJW performs well both in retaining a meaningful image of the protein interaction network as well as in enriching the image with biological information, therefore is more suitable in visualization of the network. Nucleic Acids Res, 2004 Sep 08, 32(16), 4768 - 75 Print 2004. Both KH and non-KH domain sequences are required for polyribosome association of Scp160p in yeast; Li AM et al.; Scp160p is a 160 kDa RNA-binding protein in yeast previously demonstrated to associate with specific messages as an mRNP component of both soluble and membrane-bound polyribosomes . Although the vast majority of Scp160p sequence consists of 14 closely spaced KH domains, comparative sequence analyses also demonstrate the presence of a potential nuclear localization sequence located between KH domains 3 and 4, as well as a 110 amino acid non-KH N-terminal region that includes a potential nuclear export sequence (NES) . As a step toward investigating the structure/function relationships of Scp160p, we generated two truncated alleles, FLAG.SCP160DeltaN1, encoding a protein product that lacks the first 74 amino acids, including the potential NES, and FLAG.SCP160DeltaC1, encoding a protein product that lacks the final KH domain (KH14) . We report here that the N-truncated protein, expressed as a green fluorescent protein fusion in yeast, remains cytoplasmic, with no apparent nuclear accumulation . Biochemical studies further demonstrate that although the N-truncated protein remains competent to form RNPs, the C-truncated protein does not . Furthermore, polyribosome association is severely compromised for both truncated proteins . Perhaps most important, both truncated alleles appear only marginally functional in vivo, as demonstrated by the inability of each to complement scp160/eap1 synthetic lethality in a tester strain . Together, these data challenge the notion that Scp160p normally shuttles between the nucleus and cytoplasm, and further implicate polyribosome association as an essential component of Scp160p function in vivo . Finally, these data underscore the vital roles of both KH and non-KH domain sequences in Scp160p. Mol Biol Evol, 2005 Jan, 22(1), 40 - 50 Epub 2004 Sep 8. Comparative Methods for the Analysis of Gene-Expression Evolution: An Example Using Yeast Functional Genomic Data; Oakley TH et al.; Understanding the evolution of gene function is a primary challenge of modern evolutionary biology . Despite an expanding database from genomic and developmental studies, we are lacking quantitative methods for analyzing the evolution of some important measures of gene function, such as gene-expression patterns . Here, we introduce phylogenetic comparative methods to compare different models of gene-expression evolution in a maximum-likelihood framework . We find that expression of duplicated genes has evolved according to a nonphylogenetic model, where closely related genes are no more likely than more distantly related genes to share common expression patterns . These results are consistent with previous studies that found rapid evolution of gene expression during the history of yeast . The comparative methods presented here are general enough to test a wide range of evolutionary hypotheses using genomic-scale data from any organism. Mol Biol Cell, 2004 Nov, 15(11), 5075 - 91 Epub 2004 Sep 08. Role of Vma21p in assembly and transport of the yeast vacuolar ATPase; Malkus P et al.; The Saccharomyces cerevisiae vacuolar H+-ATPase (V-ATPase) is a multisubunit complex composed of a peripheral membrane sector (V1) responsible for ATP hydrolysis and an integral membrane sector (V0) required for proton translocation . Biogenesis of V0 requires an endoplasmic reticulum (ER)-localized accessory factor, Vma21p . We found that in vma21Delta cells, the major proteolipid subunit of V0 failed to interact with the 100-kDa V0 subunit, Vph1p, indicating that Vma21p is necessary for V0 assembly . Immunoprecipitation of Vma21p from wild-type membranes resulted in coimmunoprecipitation of all five V0 subunits . Analysis of vmaDelta strains showed that binding of V0 subunits to Vma21p was mediated by the proteolipid subunit Vma11p . Although Vma21p/proteolipid interactions were independent of Vph1p, Vma21p/Vph1p association was dependent on all other V0 subunits, indicating that assembly of V0 occurs in a defined sequence, with Vph1p recruitment into a Vma21p/proteolipid/Vma6p complex representing the final step . An in vitro assay for ER export was used to demonstrate preferential packaging of the fully assembled Vma21p/proteolipid/Vma6p/Vph1p complex into COPII-coated transport vesicles . Pulse-chase experiments showed that the interaction between Vma21p and V0 was transient and that Vma21p/V0 dissociation was concomitant with V0/V1 assembly . Blocking ER export in vivo stabilized the interaction between Vma21p and V0 and abrogated assembly of V0/V1 . Although a Vma21p mutant lacking an ER-retrieval signal remained associated with V0 in the vacuole, this interaction did not affect the assembly of vacuolar V0/V1 complexes . We conclude that Vma21p is not involved in regulating the interaction between V0 and V1 sectors, but that it has a crucial role in coordinating the assembly of V0 subunits and in escorting the assembled V0 complex into ER-derived transport vesicles. Mol Biol Cell, 2004 Nov, 15(11), 5145 - 57 Epub 2004 Sep 08. Interactions among Rax1p, Rax2p, Bud8p, and Bud9p in marking cortical sites for bipolar bud-site selection in yeast; Kang PJ et al.; In the budding yeast Saccharomyces cerevisiae, selection of the bud site determines the axis of polarized cell growth and eventual oriented cell division . Bud sites are selected in specific patterns depending on cell type . These patterns appear to depend on distinct types of marker proteins in the cell cortex; in particular, the bipolar budding of diploid cells depends on persistent landmarks at the birth-scar-distal and -proximal poles that involve the proteins Bud8p and Bud9p, respectively . Rax1p and Rax2p also appear to function specifically in bipolar budding, and we report here a further characterization of these proteins and of their interactions with Bud8p and Bud9p . Rax1p and Rax2p both appear to be integral membrane proteins . Although commonly used programs predict different topologies for Rax2p, glycosylation studies indicate that it has a type I orientation, with its long N-terminal domain in the extracytoplasmic space . Analysis of rax1 and rax2 mutant budding patterns indicates that both proteins are involved in selecting bud sites at both the distal and proximal poles of daughter cells as well as near previously used division sites on mother cells . Consistent with this, GFP-tagged Rax1p and Rax2p were both observed at the distal pole as well as at the division site on both mother and daughter cells; localization to the division sites was persistent through multiple cell cycles . Localization of Rax1p and Rax2p was interdependent, and biochemical studies showed that these proteins could be copurified from yeast . Bud8p and Bud9p could also be copurified with Rax1p, and localization studies provided further evidence of interactions . Localization of Rax1p and Rax2p to the bud tip and distal pole depended on Bud8p, and normal localization of Bud8p was partially dependent on Rax1p and Rax2p . Although localization of Rax1p and Rax2p to the division site did not appear to depend on Bud9p, normal localization of Bud9p appeared largely or entirely dependent on Rax1p and Rax2p . Taken together, the results indicate that Rax1p and Rax2p interact closely with each other and with Bud8p and Bud9p in the establishment and/or maintenance of the cortical landmarks for bipolar budding. J Biol Chem, 2004 Nov 12, 279(46), 47464 - 72 Epub 2004 Sep 08. A yeast mitochondrial membrane methyltransferase-like protein can compensate for oxa1 mutations; Lemaire C et al.; Members of the Oxa1p/Alb3/YidC family mediate the insertion of various organelle or bacterial hydrophobic proteins into membranes . They present at least five transmembrane segments (TM) linked by hydrophilic domains located on both sides of the membrane . To examine how Oxa1p structure relates to its function, we have introduced point mutations and large deletions into various domains of the yeast mitochondrial protein . These mutants allowed us to show the importance of the first TM domain as well as a synergistic interaction between the first loop and the C-terminal tail, which both protrude into the matrix . These mutants also led to the isolation of a high copy suppressor, OMS1, which encodes a member of the methyltransferase family . Overexpression of OMS1 seems to increase the steady-state level of both the mutant and wild-type Oxa1p . We show that Oms1p is a mitochondrial inner membrane protein inserted independently of Oxa1p . Oms1p presents one TM and a N-in C-out topology with the C-terminal domain carrying the methyltransferase-like domain . A conserved motif within this domain is essential for the suppression of oxa1 mutations . We discuss the possible role of Oms1p on Oxa1p intermembrane space domain. Annu Rev Genet . 2004 Jun 22; {Epub ahead of print} Recombination Proteins in Yeast; Krogh BO et al.; The process of homologous recombination promotes error-free repair of double-strand breaks and is essential for meiosis . Central to the process of homologous recombination are the RAD52 group genes (RAD50, RAD51, RAD52, RAD54, RDH54/TID1, RAD55, RAD57, RAD59, MRE11, and XRS2), most of which were identified by their requirement for the repair of ionizing radiation-induced DNA damage in Saccharomyces cerevisiae . The Rad52 group proteins are highly conserved among eukaryotes . Recent studies showing defects in homologous recombination and double-strand break repair in several human cancer-prone syndromes have emphasized the importance of this repair pathway in maintaining genome integrity . Herein, we review recent genetic, biochemical, and structural analyses of the genes and proteins involved in recombination . Expected online publication date for the Annual Review of Genetics Volume 38 is November 10, 2004 . Please see for revised estimates. Biochem Biophys Res Commun, 2004 Oct 8, 323(1), 149 - 55 The N-terminus of yeast peptide: N-glycanase interacts with the DNA repair protein Rad23; Biswas S et al.; Yeast peptide: N-glycanase (PNGase) is involved in the proteasomal degradation of misfolded glycoproteins where it interacts with the DNA repair protein Rad23 as first detected in a yeast two-hybrid assay and subsequently confirmed by biochemical in vivo analyses . Limited proteolysis of PNGase with trypsin led to the removal of both an N-terminal and a C-terminal stretch . Based on these truncations the N-terminal region of yeast PNGase was identified as being responsible for binding to Rad23 . Secondary structure predictions of this region suggest that it is composed of a single, solvent-exposed alpha-helix . The interaction between PNGase and Rad23 was studied using surface plasmon resonance revealing an equilibrium binding constant of approximately 2.5 microM . The oligomeric nature of Rad23 was also investigated using sedimentation equilibrium analysis . Although Rad23 exists as a dimer in solution, the monomeric form of Rad23 associates with a PNGase monomer in a 1:1 stoichiometric ratio . Microb Pathog, 2004 Sep, 37(3), 131 - 40 Immunofluorescence and flow cytometry analysis of fibronectin and laminin binding to Sporothrix schenckii yeast cells and conidia; Lima OC et al.; The adherence of Sporothrix schenckii yeast cells to several extracellular matrix (ECM) components has already been demonstrated, but the mechanisms of these interactions remained to be defined . In indirect immunofluorescence assays with polyclonal antibodies directed towards the ECM proteins, both hyphae and yeast cells of S . schenckii exhibited the ability to bind laminin and fibronectin . Flow cytometry confirmed the binding of these proteins, and revealed a significant greater binding capability for the yeast cells than for the conidia . Fibronectin and laminin binding was dose-dependent and specific . In addition, competition experiments with synthetic peptides mimicking the adhesive sequences of these proteins, or with cell wall fractions and carbohydrates constitutive of their sugar chains, were performed in order to specify the peptide or carbohydrate motifs involved in the recognition process . A 50% reduction was noticed in fibronectin binding in the presence of the synthetic peptide RGD, and a 38% reduction in laminin binding with the peptide YIGSR . Some carbohydrate-containing fractions of the yeast cell wall also inhibited the binding of fibronectin, but had no significant effect on laminin binding . Together, these results suggest the presence at the yeast surface of distinct receptors for laminin and fibronectin. J Biol Chem, 2004 Nov 5, 279(45), 47372 - 8 Epub 2004 Sep 02. DNA replication checkpoint control mediated by the spindle checkpoint protein Mad2p in fission yeast; Sugimoto I et al.; The relationship between the DNA replication and spindle checkpoints of the cell cycle is unclear, given that in most eukaryotes, spindle formation occurs only after DNA replication is complete . Fission yeast rad3 mutant cells, which are deficient in DNA replication checkpoint function, enter, progress through, and exit mitosis even when DNA replication is blocked . In contrast, the entry of cds1 mutant cells into mitosis is delayed by several hours when DNA replication is inhibited . We show here that this delay in mitotic entry in cds1 cells is due in part to activation of the spindle checkpoint protein Mad2p . In the presence of the DNA replication inhibitor hydroxyurea (HU), cds1 mad2 cells entered and progressed through mitosis earlier than did cds1 cells . Overexpression of Mad2p or inactivation of Slp1p, a regulator of the anaphase-promoting complex, also rescued the checkpoint defect of HU-treated rad3 cells . Rad3p was shown to be involved in the physical interaction between Mad2p and Slp1p in the presence of HU . These results suggested that Mad2p and Slp1p act downstream of Rad3p in the DNA replication checkpoint and that Mad2p is required for the DNA replication checkpoint when Cds1p is compromised. Genome Biol . 2004;5(9):240 . Epub 2004 Aug 27. Chemical genomics in yeast; Brenner C; Many drugs have unknown, controversial or multiple mechanisms of action . Four recent 'chemical genomic' studies, using genome-scale collections of yeast gene deletions that were either arrayed or barcoded, have presented complementary approaches to identifying gene-drug and pathway-drug interactions. Analyst, 2004 Sep, 129(9), 846 - 9 Epub 2004 Aug 09. Identification of non-peptide species in selenized yeast by MALDI mass spectrometry using post-source decay and orthogonal Q-TOF detection; Ruiz Encinar J et al.; The potential of tandem mass spectrometry following matrix-assisted laser desorption ionization (MALDI) was studied for speciation of selenium . Non-peptide selenium-containing compounds were isolated from a selenized yeast aqueous extract by size-exclusion chromatography . Post-source decay (PSD) was compared with orthogonal quadrupole collision cell dissociation for the purpose of obtaining fragmentation and structural information . In the PSD mode, the use of ion gate covering the whole isotopic cluster of the parent compound allowed the immediate recognition of fragments containing Se and those in which this element was absent . The tandem mass spectra obtained by orthogonal MALDI Q-TOF were equally informative in terms of the number of fragments but suffered from a poorer sensitivity . The mass accuracy was ca . 20 times better in the oMALDI configuration than in the PSD mode . An unknown selenium compound with an m/z 388 was detected with a mass accuracy of 3 ppm according to the proposed empiric formula . Mol Biol Cell, 2004 Nov, 15(11), 4787 - 97 Epub 2004 Sep 01. Distinct roles for the Hsp40 and Hsp90 molecular chaperones during cystic fibrosis transmembrane conductance regulator degradation in yeast; Youker RT et al.; Aberrant secreted proteins can be destroyed by ER-associated protein degradation (ERAD), and a prominent, medically relevant ERAD substrate is the cystic fibrosis transmembrane conductance regulator (CFTR) . To better define the chaperone requirements during CFTR maturation, the protein was expressed in yeast . Because Hsp70 function impacts CFTR biogenesis in yeast and mammals, we first sought ER-associated Hsp40 cochaperones involved in CFTR maturation . Ydj1p and Hlj1p enhanced Hsp70 ATP hydrolysis but CFTR degradation was slowed only in yeast mutated for both YDJ1 and HLJ1, suggesting functional redundancy . In contrast, CFTR degradation was accelerated in an Hsp90 mutant strain, suggesting that Hsp90 preserves CFTR in a folded state, and consistent with this hypothesis, Hsp90 maintained the solubility of an aggregation-prone domain (NBD1) in CFTR . Soluble ERAD substrate degradation was unaffected in the Hsp90 or the Ydj1p/Hlj1p mutants, and surprisingly CFTR degradation was unaffected in yeast mutated for Hsp90 cochaperones . These results indicate that Hsp90, but not the Hsp90 complex, maintains CFTR structural integrity, whereas Ydj1p/Hlj1p catalyze CFTR degradation. Genetics, 2004 Aug, 167(4), 2121 - 5 Genes encoding subunits of stable complexes are clustered on the yeast chromosomes: an interpretation from a dosage balance perspective; Teichmann SA et al.; Genomic evidence for colocalization of functionally related genes on eukaryote chromosomes is mounting . Here we show that a statistically significant fraction of yeast genes coding for subunits of stable complexes are located within 10-30 kb of each other . Clustering of genes encoding subunits of complexes may ensure better coregulation and maintain the right stoichiometry of complexes upon duplication of chromosomal segments . Genetics, 2004 Aug, 167(4), 1621 - 8 Cyclin B-cdk activity stimulates meiotic rereplication in budding yeast; Strich R et al.; Haploidization of gametes during meiosis requires a single round of premeiotic DNA replication (meiS) followed by two successive nuclear divisions . This study demonstrates that ectopic activation of cyclin B/cyclin-dependent kinase in budding yeast recruits up to 30% of meiotic cells to execute one to three additional rounds of meiS . Rereplication occurs prior to the meiotic nuclear divisions, indicating that this process is different from the postmeiotic mitoses observed in other fungi . The cells with overreplicated DNA produced asci containing up to 20 spores that were viable and haploid and demonstrated Mendelian marker segregation . Genetic tests indicated that these cells executed the meiosis I reductional division and possessed a spindle checkpoint . Finally, interfering with normal synaptonemal complex formation or recombination increased the efficiency of rereplication . These studies indicate that the block to rereplication is very different in meiotic and mitotic cells and suggest a negative role for the recombination machinery in allowing rereplication . Moreover, the production of haploids, regardless of the genome content, suggests that the cell counts replication cycles, not chromosomes, in determining the number of nuclear divisions to execute . Genes Dev, 2004 Sep 1, 18(17), 2108 - 19 Human Rif1, ortholog of a yeast telomeric protein, is regulated by ATM and 53BP1 and functions in the S-phase checkpoint; Silverman J et al.; We report on the function of the human ortholog of Saccharomyces cerevisiae Rif1 (Rap1-interacting factor 1) . Yeast Rif1 associates with telomeres and regulates their length . In contrast, human Rif1 did not accumulate at functional telomeres, but localized to dysfunctional telomeres and to telomeric DNA clusters in ALT cells, a pattern of telomere association typical of DNA-damage-response factors . After induction of double-strand breaks (DSBs), Rif1 formed foci that colocalized with other DNA-damage-response factors . This response was strictly dependent on ATM (ataxia telangiectasia mutated) and 53BP1, but not affected by diminished function of ATR (ATM- and Rad3-related kinase), BRCA1, Chk2, Nbs1, and Mre11 . Rif1 inhibition resulted in radiosensitivity and a defect in the intra-S-phase checkpoint . The S-phase checkpoint phenotype was independent of Nbs1 status, arguing that Rif1 and Nbs1 act in different pathways to inhibit DNA replication after DNA damage . These data reveal that human Rif1 contributes to the ATM-mediated protection against DNA damage and point to a remarkable difference in the primary function of this protein in yeast and mammals. J Mol Biol, 2004 Sep 17, 342(3), 901 - 12 Development of a human light chain variable domain (V(L)) intracellular antibody specific for the amino terminus of huntingtin via yeast surface display; Colby DW et al.; Intracellular antibodies (intrabodies) provide an attractive means for manipulating intracellular protein function, both for research and potentially for therapy . A challenge in the isolation of effective intrabodies is the ability to find molecules that exhibit sufficient binding affinity and stability when expressed in the reducing environment of the cytoplasm . Here, we have used yeast surface display of proteins to isolate novel scFv clones against huntingtin from a non-immune human antibody library . We then applied yeast surface display to affinity mature this scFv pool and analyze the location of the binding site of the mutant with the highest affinity . Interestingly, the paratope was mapped exclusively to the variable light chain domain of the scFv . A single domain antibody was constructed consisting solely of this variable light chain domain, and was found to retain full binding activity to huntingtin . Cytoplasmic expression levels in yeast of the single domain were at least fivefold higher than the scFv . The ability of the single-domain intrabody to inhibit huntingtin aggregation, which has been implicated in the pathogenesis of Huntington's disease (HD), was confirmed in a cell-free in vitro assay as well as in a mammalian cell culture model of HD . Significantly, a single-domain intrabody that is functionally expressable in the cytoplasm was derived from a non-functional scFv by performing affinity maturation and binding site analysis on the yeast cell surface, despite the differences between the cytoplasmic and extracellular environment . This approach may find application in the development of intrabodies to a wide variety of intracellular targets. Biochim Biophys Acta, 2004 Sep 6, 1674(1), 29 - 39 Yeast growth selection system for the identification of cell-active inhibitors of beta-secretase; Middendorp O et al.; Abeta peptides, which are believed to be at the origin of Alzheimer's disease (AD), are produced through the sequential processing of the transmembrane amyloid precursor protein (APP) by the beta- and gamma-secretase . The identification of small molecules that penetrate the brain and inhibit these secretases is of great therapeutic potential . Here, we describe a cellular selection system in yeast for the identification of inhibitors of the human beta-secretase BACE-1 . Similar to the natural situation in mammalian cells, BACE-1 and its substrate APP are bound to membranes in secretory pathway compartments . Yeast cells expressing these human proteins have been engineered so as to grow under selective conditions only upon reduction of BACE-1 activity, thus allowing identification of compounds that, in addition to inhibiting BACE-1, must permeate cellular membranes and present no cytotoxic effects . Our results show that gradual reduction of BACE-1 expression in the engineered yeast strain resulted in gradual increase of cell growth rate . Moreover, two validated BACE-1 inhibitors, which have IC50 values between 7 and 8 microM in mammalian cell assays, stimulated yeast growth in a concentration-dependent manner . This effect was specific for BACE-1 since these compounds had no effect on yeast cells expressing a different secretase cleaving the APP substrate at the alpha-site . The target-specific cellular assay presented here is applicable in high-throughput screens for selecting inhibitors of defined secretases acting on natural substrates in a membrane-bound protein configuration. Curr Biol, 2004 Sep 7, 14(17), 1604 - 9 Dynamics of yeast Myosin I: evidence for a possible role in scission of endocytic vesicles; Jonsdottir GA et al.; Cortical actin patches are dynamic structures required for endocytosis in yeast . Recent studies have shown that components of cortical patches localize to the plasma membrane in a precisely orchestrated manner, and their movements at and away from the plasma membrane may define the endocytic membrane invagination and vesicle scission events, respectively . Here, through live-cell imaging, we analyze the dynamics of the highly conserved class I unconventional myosin, Myo5, which also localizes to cortical patches and is known to be involved in endocytosis and actin nucleation . Myo5 exhibits a pattern of dynamic localization different from all cortical patch components analyzed to date . Myo5 associates with cortical patches only transiently and remains stationary during its brief cortical lifespan . The peak of Myo5 association with cortical patches immediately precedes the fast movement of Arp2/3 complex-associated structures away from the plasma membrane, thus correlating precisely with the proposed vesicle scission event . To further test the role of Myo5, we generated a temperature-sensitive mutant myo5 allele . In the myo5 mutant cells, Myo5 exhibits a significantly extended cortical lifespan as a result of a general impairment of Myo5 function, and Arp2 patches exhibit an extended slow-movement phase prior to the fast movement toward the cell interior . The myo5 mutant cells are defective in fluid-phase endocytosis and exhibit an increased number of invaginations on the membrane . Based on these results, we hypothesize that the myosin I motor protein facilitates the membrane fusion/vesicle scission event of endocytosis. Tsitologiia, 2004, 46(6), 498 - 505 {Increase in the number of contacts of endoplasmic reticulum with mitochondria and plasma membrane in yeast cells stimulated to division with He-Ne laser light}; Manteifel' VM et al.; We studied the ultrastructure of Torulopsis sphaerica yeast cells irradiated with He-Ne laser (lambda = 632.8 nm, dose--460 J/m2) and then cultured for 6 h in the nutrient with 1% glucose by aeration . The length of membranes of endoplasmic reticulum (ER) and the number of its associations with mitochondria (M) and plasma membrane (PM) were measured on ultrathin sections . A distance of less than 50 nm between heterogeneous membranes was considered as an "association" . The cells from irradiated cultures are characterized by the following features: 1) the length of cortical ER membranes in relation to cellular perimeter, and the length of perinuclear ER membranes in relation to nuclear perimeter increase, resp., by 21 and 79%; 2) the number of ER-PM associations per cellular section, and that per unit of PM length increase, resp., by 26 and 41%; 3) the number of ER-M association in relation to the total mitochondrial perimeter, and to perimitochondrial ER increase by 80 and 87%, resp . The latter may be associated with Ca2+ uptake by mitochondria associated with ER, which results in activation of respiration and ATP production. Ross Fiziol Zh Im I M Sechenova, 2004 May, 90(5), 645 - 57 {Yeast as a model for studying the prion and amyloid occurrence} {Construction and expression of DNA-binding domain plasmid with hepatitis B virus e antigen in yeast double hybrid system} Li BA, Qi Y, Shu CL, Liu Y, Cheng H, Li J, Gao R, Hou J, Cheng Y. Department of Immunology, The No . 302 Hospital of PLA, Beijing 100039, ChinaBACKGROUND: Using hepatitis B virus e antigen (HBeAg) gene to construct the DNA-binding domain vector, which can express HBeAg in yeast cell, and can be used in yeast double hybrid as "bait plasmid" to look for the gene from the cDNA library, which expresses the protein that can interact with HBeAg . METHODS: PCR was performed to amplify the HBeAg gene from a sera of hepatitis B patient . The product of the amplification was inserted into T-vector and was verified by sequencing . Then it was inserted into the "bait" plasmid pGBKT7 after the digestion with the restricted endonuclease of EcoR I and Sal I . The plasmid was transformed into the yeast cell . PCR was used to verify whether the plasmid was transformed into yeast . The HBeAg protein expressed in the cell was confirmed by Western blot . Using nutrition selection assay to verify the constructed plasmid alone could not activate the reporter gene in the yeast cell . RESULTS: Sequenced and digested by two endonuc1eases, the recombined vectors pGBKT7-eAg produced anticipated fragment . PCR verified that there was HBeAg fragment in the yeast . Having assayed by Western blotting, it was shown that the yeast cell transformed with pGBKT7-eAg vector had positive signal which could not be seen in the control . Tested by the nutrition selection assay, the recombined vectors pGBKT7-eAg could not activate LacZ reporter gene in the yeast . CONCLUSION: DNA-binding domain plasmid was successfully constructed and could express HBeAg proteins in the yeast cell but could not activate transcription of LacZ reporter gene alone . The recombined plasmid can be used in yeast double hybrid. Mol Cell Biol, 2004 Sep, 24(18), 8276 - 87 Yeast Asc1p and mammalian RACK1 are functionally orthologous core 40S ribosomal proteins that repress gene expression; Gerbasi VR et al.; Translation of mRNA into protein is a fundamental step in eukaryotic gene expression requiring the large (60S) and small (40S) ribosome subunits and associated proteins . By modern proteomic approaches, we previously identified a novel 40S-associated protein named Asc1p in budding yeast and RACK1 in mammals . The goals of this study were to establish Asc1p or RACK1 as a core conserved eukaryotic ribosomal protein and to determine the role of Asc1p or RACK1 in translational control . We provide biochemical, evolutionary, genetic, and functional evidence showing that Asc1p or RACK1 is indeed a conserved core component of the eukaryotic ribosome . We also show that purified Asc1p-deficient ribosomes have increased translational activity compared to that of wild-type yeast ribosomes . Further, we demonstrate that asc1Delta null strains have increased levels of specific proteins in vivo and that this molecular phenotype is complemented by either Asc1p or RACK1 . Our data suggest that one of Asc1p's or RACK1's functions is to repress gene expression. Acta Pharmacol Sin, 2004 Sep, 25(9), 1171 - 5 Selective inhibition of purified human phosphodiesterase 4A expressed in yeast cell GL62 by ciclamilast, piclamilast, and rolipram; Chen JC et al.; AIM: To improve the specific activity of human phosphodiesterase 4A (PDE4A) expressed in yeast cell GL62 and investigate the effects of selective phosphodiesterase 4 (PDE4) inhibitors (ciclamilast, piclamilast, and rolipram), selective phosphodiesterase 5 (PDE5) inhibitor zaprinast, and cyclooxygenase (COX) inhibitors (aspirin, indomethacin) on human PDE4A activity expressed in yeast cell GL62 . METHODS: Human PDE4A was expressed in yeast cell GL62 after CuSO4 induction and the specific activity of human PDE4A was improved by ammonium sulfate fractionation, DEAE Sephadex A-50 chromatography, and Sephadex G-100 chromatography . The activity of PDE4A was measured by high performance liquid chromatography (HPLC) . RESULTS: Induced PDE4A activity expressed in crude yeast cell GL62 supernatant and pellet was (340+/-21) nmol/g/min and (250+/-25) nmol/g/min respectively . The specific activity of recombinant PDE4A in supernatant was improved 6.4 fold . Ciclamilast, piclamilast, and rolipram could inhibit PDE4A activity . The IC50 values (95 % confidence limits) of ciclamilast, piclamilast, and rolipram were 1.27 (0.84-1.91), 66.4 (33.3-132.2), and 3.73 (2.51-5.53) micromol/L respectively . Zaprinast, aspirin, and indomethacin had no obvious inhibitory effect on PDE4A activity . CONCLUSION: The specific activity of PDE4A expressed in yeast cell GL62 can be improved by ammonium sulfate fractionation, DEAE Sephadex A-50 chromatography, and Sephadex G-100 chromatography . Ciclamilast, piclamilast, and rolipram can inhibit PDE4A activity while zaprinast, aspirin, and indomethacin have no obvious inhibitory effect on PDE4A activity . Human PDE4A expressed in GL62 might be useful in the research and screening of new selective PDE4 inhibitors. Cell Mol Life Sci, 2004 Sep, 61(17), 2253 - 63 Global gene expression of fission yeast in response to cisplatin; Gatti L et al.; The cellular response to the antitumor drug cisplatin is complex, and resistance is widespread . To gain insights into the global transcriptional response and mechanisms of resistance, we used microarrays to examine the fission yeast cell response to cisplatin . In two isogenic strains with differing drug sensitivity, cisplatin activated a stress response involving glutathione-S-transferase, heat shock, and recombinational repair genes . Genes required for proteasome-mediated protein degradation were up-regulated in the sensitive strain, whereas genes for DNA damage recognition/repair and for mitotic progression were induced in the resistant strain . The response to cisplatin overlaps in part with the responses to cadmium and the DNA-damaging agent methylmethane sulfonate . The different gene groups involved in the cellular response to cisplatin help the cells to tolerate and repair DNA damage and to overcome cell cycle blocks . These findings are discussed with respect to known cisplatin response pathways in human cells. RNA, 2004 Oct, 10(10), 1625 - 36 Epub 2004 Aug 30. Recruitment of the Puf3 protein to its mRNA target for regulation of mRNA decay in yeast; Jackson JS Jr et al.; The Puf family of RNA-binding proteins regulates mRNA translation and decay via interactions with 3' untranslated regions (3' UTRs) of target mRNAs . In yeast, Puf3p binds the 3' UTR of COX17 mRNA and promotes rapid deadenylation and decay . We have investigated the sequences required for Puf3p recruitment to this 3' UTR and have identified two separate binding sites . These sites are specific for Puf3p, as they cannot bind another Puf protein, Puf5p . Both sites use a conserved UGUANAUA sequence, whereas one site contains additional sequences that enhance binding affinity . In vivo, presence of either site partially stimulates COX17 mRNA decay, but full decay regulation requires the presence of both sites . No other sequences outside the 3' UTR are required to mediate this decay regulation . The Puf repeat domain of Puf3p is sufficient not only for in vitro binding to the 3' UTR, but also in vivo stimulation of COX17 mRNA decay . These experiments indicate that the essential residues involved in mRNA decay regulation are wholly contained within this RNA-binding domain . J Cell Biol, 2004 Aug 30, 166(5), 629 - 35 Yeast actin patches are networks of branched actin filaments; Young ME et al.; Cortical actin patches are the most prominent actin structure in budding and fission yeast . Patches assemble, move, and disassemble rapidly . We investigated the mechanisms underlying patch actin assembly and motility by studying actin filament ultrastructure within a patch . Actin patches were partially purified from Saccharomyces cerevisiae and examined by negative-stain electron microscopy (EM) . To identify patches in the EM, we correlated fluorescence and EM images of GFP-labeled patches . Patches contained a network of actin filaments with branches characteristic of Arp2/3 complex . An average patch contained 85 filaments . The average filament was only 50-nm (20 actin subunits) long, and the filament to branch ratio was 3:1 . Patches lacking Sac6/fimbrin were unstable, and patches lacking capping protein were relatively normal . Our results are consistent with Arp2/3 complex-mediated actin polymerization driving yeast actin patch assembly and motility, as described by a variation of the dendritic nucleation model. Curr Biol, 1993 Jan, 3(1), 13 - 26 Mitotic regulation of protein phosphatases by the fission yeast sds22 protein; Stone EM et al.; Background: Cell cycle progression requires the activity of protein kinases and phosphatases at critical points in the cell cycle in all eukaryotes . We have previously reported that the dis2(+) and sds2(+) genes of fission yeast encode redundant catalytic subunits of a type 1-like protein phosphatase . The sds22(+) gene was shown to be essential for cell viability and to interact genetically with dis2(+) and sds21(+) . Results: Here we show by immunoprecipitation that the sds22 protein physically interacts with the dis2 and sds21 proteins, and that sds22-associated phosphatase activity has altered substrate specificity, The loss of sds22 function by a temperature sensitive mutation leads to cell cycle arrest at mid-mitosis, at which point cdc2-dependent histone Hl kinase activity is high while sds22-dependent H1 phosphatase activity is low . To examine the unusual properties of sds22 protein structure, we analyzed a collection of sds22 deletion and point mutants by a variety of functional criteria . Conclusion: We propose that sds22 is a regulatory subunit of the dis2/sds21 phosphatase catalytic subunits and that sds22-bound phosphatase carries a key phosphatase activity essential for the progression from metaphase to anaphase . Mutational analysis indicates that dis2/sds21 interacts with the central repetitive domain of sds22, while the C-terminal and central regions of sds22 may be involved in subcellular targeting and the N-terminus is important for stability. World J Gastroenterol, 2004 Oct 1, 10(19), 2805 - 8 Cytochrome C oxidase III interacts with hepatitis B virus X protein in vivo by yeast two-hybrid system; Li D et al.; AIM: To screen and identify the proteins which interact with hepatitis B virus (HBV) X protein in hepatocytes by yeast two-hybrid system and to explore the effects of X protein in the development of hepatocellular carcinoma (HCC) . METHODS: With HBV X gene amplified by polymerase chain reaction (PCR), HBV X bait plasmid, named pAS2-1-X, was constructed by yeast-two hybridization system3 and verified by auto-sequencing assay . pAS2-1-X was transformed into the yeast AH109, and X-BD fusion protein expressed in the yeast cells was detected by Western blotting . The yeast cells cotransformed with pAS2-1-X and normal human liver cDNA library were grown in selective SC/-trp-leu-his-ade medium . The second screen was performed with beta-gal activity detection, and false positive clones were eliminated by segregation analysis, true positive clones were amplified, sequenced and analyzed with bioinformatics . Mating experiment was performed to confirm the binding of putative proteins to X protein in the yeast cells . RESULTS: Bait plasmid pAS2-1-X was successfully constructed and pAS2-1-X correctly expressed BD-X fusion protein in yeast AH109 . One hundred and three clones grew in the selective SC/-trp-leu-his-ade medium, and only one clone passed through beta-gal activity detection and segregation analysis . The inserted cDNA fragment showed high homology with Homo sapiens cytochrome C oxidase III (COXIII) . Furthermore, mating experiment identified that the binding of COXIII to X protein was specific . CONCLUSION: COXIII protein is a novel protein that can interact with X protein in vivo by yeast two-hybrid system, and may contribute to the development of HCC through the interaction with X protein. Yeast, 2004 Aug, 21(11), 963 - 72 Prions of yeast fail to elicit a transcriptional response; Ross ED et al.; Amyloid deposits are associated with numerous human diseases . The {URE3} prion of Saccharomyces is an infectious, inactive, amyloid form of the Ure2p protein . Despite the presence of large prion aggregates in {URE3} yeast, the only apparent phenotypes associated with the prion are attributable to loss of Ure2p function . We used cDNA microarrays to look for genes in yeast that are differentially expressed in the presence of the {URE3} prion and which might act to mitigate the detrimental effects of the prion aggregates . On comparing {URE3} vs . ure2 yeast, we were surprised to find that the only expression changes detected were attributable to the low level of residual Ure2p activity in the {URE3} cells . Interestingly, in addition to repressing the activity of genes required for utilization of poor nitrogen sources when yeast are grown in the presence of a good nitrogen source, Ure2p appears to be involved in stimulating some of these same genes in the absence of a good nitrogen source . Yeast, 2004 Aug, 21(11), 947 - 62 A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes; Janke C et al.; Tagging of genes by chromosomal integration of PCR amplified cassettes is a widely used and fast method to label proteins in vivo in the yeast Saccharomyces cerevisiae . This strategy directs the amplified tags to the desired chromosomal loci due to flanking homologous sequences provided by the PCR-primers, thus enabling the selective introduction of any sequence at any place of a gene, e.g . for the generation of C-terminal tagged genes or for the exchange of the promoter and N-terminal tagging of a gene . To make this method most powerful we constructed a series of 76 novel cassettes, containing a broad variety of C-terminal epitope tags as well as nine different promoter substitutions in combination with N-terminal tags . Furthermore, new selection markers have been introduced . The tags include the so far brightest and most yeast-optimized version of the red fluorescent protein, called RedStar2, as well as all other commonly used fluorescent proteins and tags used for the detection and purification of proteins and protein complexes . Using the provided cassettes for N- and C-terminal gene tagging or for deletion of any given gene, a set of only four primers is required, which makes this method very cost-effective and reproducible . This new toolbox should help to speed up the analysis of gene function in yeast, on the level of single genes, as well as in systematic approaches . Yeast, 2004 Aug, 21(11), 927 - 46 Screening the yeast deletant mutant collection for hypersensitivity and hyper-resistance to sorbate, a weak organic acid food preservative; Mollapour M et al.; Certain yeasts cause large-scale spoilage of preserved food materials, partly as a result of their ability to grow in the presence of the preservatives allowed in food and beverage preservation . This study used robotic methods to screen the collection of Saccharomyces cerevisiae gene deletion mutants for both increased sensitivity and increased resistance to sorbic acid, one of the most widely-used weak organic acid preservatives . In this way it sought to identify the non-essential, non-redundant activities that influence this resistance, activities that might be the potential targets of new preservation strategies . 237 mutants were identified as incapable of growth at pH 4.5 in presence of 2 mM sorbic acid, while 34 mutants exhibit even higher sorbate resistance than the wild-type parental strain . A number of oxidative stress-sensitive mutants, also mitochondrial mutants, are sorbate-sensitive . This appears to reflect the importance of sustaining a reducing intracellular environment (high reduced glutathione levels and NADH/NAD and NADPH/NADP ratios) . Sorbate resistance is also very severely compromised in mutants lacking an acidified vacuole, in vacuolar protein sorting (vps) mutants, in mutants defective in ergosterol biosynthesis (erg mutants) and with several defects in actin and microtubule organization . Sorbate resistance is, however, elevated with the loss of the Yap5 transcription factor; with single losses of two B-type cyclins (Clb3p, Clb5p); and with loss of a plasma membrane calcium channel activated by endoplasmic reticulum stress (Cch1p/Mid1p) . Yeast, 2004 Aug, 21(11), 903 - 18 Yeast Pho85 kinase is required for proper gene expression during the diauxic shift; Nishizawa M et al.; The budding yeast Saccharomyces cerevisiae changes its gene expression profile when environmental nutritional conditions are changed . Protein kinases including cyclic AMP-dependent kinase, Snf1 and Tor kinases play important roles in this process . Pho85 kinase, a member of the yeast cyclin-dependent kinase family, is involved in the regulation of phosphate metabolism and reserve carbohydrates, and thus is implicated to function as a nutrient-sensing kinase . Upon depletion of glucose in the medium, yeast cells undergo a diauxic shift, accompanied by a carbon metabolic pathway shift, stimulation of mitochondrial function and downregulation of ribosome biogenesis and protein synthesis . We analysed the effect of a pho85Delta mutation on the expression profiles of the genes in this process to investigate whether Pho85 kinase participates in the yeast diauxy . We found that, in the absence of PHO85, a majority of mitochondrial genes were not properly induced, that proteasome-related and chaperonin genes were more repressed, and that, when glucose was still present in the medium, a certain class of genes involved in ribosome biogenesis (ribosomal protein and rRNA processing genes) was repressed, whereas those involved in gluconeogenesis and the glyoxylate cycle were induced . We also found that PHO85 is required for proper expression of several metal sensor genes and their regulatory genes . These results suggest that Pho85 is required for proper onset of changes in expression profiles of genes responsible for the diauxic shift. J Cell Sci, 2004 Sep 15, 117(Pt 20), 4757 - 67 Epub 2004 Aug 25. Gyp5p and Gyl1p are involved in the control of polarized exocytosis in budding yeast; Chesneau L et al.; We report here elements for functional characterization of two members of the Saccharomyces cerevisiae Ypt/Rab GTPase activating proteins family (GAP): Gyp5p, a potent GAP in vitro for Ypt1p and Sec4p, and the protein Ymr192wp/APP2 that we propose to rename Gyl1p (GYp like protein) . Immunofluorescence experiments showed that Gyp5p and Gyl1p partly colocalize at the bud emergence site, at the bud tip and at the bud neck during cytokinesis . Subcellular fractionation and co-immunoprecipitation experiments showed that Gyp5p and Gyl1p co-fractionate with post-Golgi vesicles and plasma membrane, and belong to the same protein complexes in both localizations . We found by co-immunoprecipitation experiments that a fraction of Gyp5p interacts with Sec4p, a small GTPase involved in exocytosis, and that a fraction of Gyl1p associates at the plasma membrane with the Gyp5p/Sec4p complexes . We showed also that GYP5 genetically interacts with SEC2, which encodes the Sec4p exchange factor . Examination of the gyp5Deltagyl1Delta mutants grown at 13 degrees C revealed a slight growth defect, a secretion defect and an accumulation of secretory vesicles in the small-budded cells . These data suggest that Gyp5p and Gyl1p are involved in control of polarized exocytosis. BMC Genomics . 2004 Aug 26;5(1):59. Combined analysis of expression data and transcription factor binding sites in the yeast genome; Nagaraj VH et al.; BACKGROUND: The analysis of gene expression using DNA microarrays provides genome wide profiles of the genes controlled by the presence or absence of a specific transcription factor . However, the question arises of whether a change in the level of transcription of a specific gene is caused by the transcription factor acting directly at the promoter of the gene or through regulation of other transcription factors working at the promoter . RESULTS: To address this problem we have devised a computational method that combines microarray expression and site preference data . We have tested this approach by identifying functional targets of the a1-alpha2 complex, which represses haploid-specific genes in the yeast Saccharomyces cerevisiae . Our analysis identified many known or suspected haploid-specific genes that are direct targets of the a1-alpha2 complex, as well as a number of previously uncharacterized targets . We were also able to identify a number of haploid-specific genes which do not appear to be direct targets of the a1-alpha2 complex, as well as a1-alpha2 target sites that do not repress transcription of nearby genes . Our method has a much lower false positive rate when compared to some of the conventional bioinformatic approaches . CONCLUSIONS: These findings show advantages of combining these two forms of data to investigate the mechanism of co-regulation of specific sets of genes. Genetica, 2004 Jun, 121(2), 181 - 5 Transposable element distribution in the yeast genome reflects a role in repeated genomic rearrangement events on an evolutionary time scale; Hughes AL et al.; Statistical analysis of the distribution of transposable elements (TEs) and tRNA genes in the genome of yeast Saccharomyces cerevisiae indicated that, although tRNA genes and other genes transcribed by RNA polymerase III are targets for TE insertion, the distribution of TEs was significantly more clumped than that of tRNAs . Genomic blocks putatively duplicated as the result of an ancient polyploidization event contained fewer TEs than expected by their length, and nearly two thirds of duplicated blocks lacked TEs altogether . In addition, the edges of duplicated blocks tended to be located in TE-poor genomic regions . These results can be explained by the hypotheses: (1) that transposition events have occurred well after block duplication; (2) that TEs have frequently played a role in genomic rearrangement events in yeast . According to this model, duplicated blocks identifiable as such in the present-day yeast genome are found largely in regions with low TE density because in such regions the duplicated structure has not been obscured by TE-mediated rearrangements. Zhonghua Wai Ke Za Zhi, 2004 Jun 7, 42(11), 672 - 4 {The construction of yeast two-hybrid method in the protein-interactions and its significance in hepatic metastasis of colorectal carcinoma}; Zuo FY et al.; OBJECTIVE: To construct the yeast two-hybrid system, and screen the proteins which interact with FasL, and investigate the relationship of FasL and hepatic metastasis of colorectal carcinoma . METHODS: We have cloned the FasL gene into the pGBKT7 vector as the bait, then screened the fetal liver cDNA library, and have got a series of specific proteins that interact with FasL protein . Using the bioinformatics, we analyzed the interacting proteins in the mechanism of hepatic metastasis of colorectal carcinoma . RESULTS: We have screened several proteins that interaction with FasL protein, including metallothionein 1K, 1G, 2A, cathepsin B, fatty acid synthase, interferon alpha-inducible protein 27, phospholipid scramblase, Ser/Thr-like kinase, anchor attachment protein, fibulin-5 . CONCLUSIONS: We have successfully constructed the yeast two-hybrid system, and preliminary identified that the interaction between FasL, metallothionein, cathepsin and anchor attachment protein is radically related to the hepatic metastasis of colorectal carcinoma. PLoS Biol . 2004 Sep;2(9):E296 . Epub 2004 Aug 24. Sir2-independent life span extension by calorie restriction in yeast; Kaeberlein M et al.; Calorie restriction slows aging and increases life span in many organisms . In yeast, a mechanistic explanation has been proposed whereby calorie restriction slows aging by activating Sir2 . Here we report the identification of a Sir2-independent pathway responsible for a majority of the longevity benefit associated with calorie restriction . Deletion of FOB1 and overexpression of SIR2 have been previously found to increase life span by reducing the levels of toxic rDNA circles in aged mother cells . We find that combining calorie restriction with either of these genetic interventions dramatically enhances longevity, resulting in the longest-lived yeast strain reported thus far . Further, calorie restriction results in a greater life span extension in cells lacking both Sir2 and Fob1 than in cells where Sir2 is present . These findings indicate that Sir2 and calorie restriction act in parallel pathways to promote longevity in yeast and, perhaps, higher eukaryotes. J Mol Biol, 2004 Sep 10, 342(2), 539 - 50 Fine epitope mapping of anti-epidermal growth factor receptor antibodies through random mutagenesis and yeast surface display; Chao G et al.; Fine epitope mapping of therapeutically relevant monoclonal antibodies (mAbs) specific for the epidermal growth factor receptor (EGFR) was accomplished through random mutagenesis and yeast surface display . Using this method, we have identified key residues energetically important for the binding of EGFR to the mAbs 806, 225, and 13A9 . A yeast-displayed library of single point mutants of an EGFR ectodomain fragment (residues 273-621) was constructed by random mutagenesis and was screened for reduced binding to EGFR mAbs . If an EGFR mutant showed loss of binding to a mAb, this suggested that the mutated residue was potentially a contact residue . The mAb 806 binding epitope was localized to one face of a loop comprised of EGFR residues Cys287-Cys302, which is constrained by a disulfide bond and two salt bridges . The mAb 806 epitope as identified here is not fully accessible in the autoinhibited EGFR monomer conformation, which is consistent with the hypothesis that mAb 806 binds to a transitional form of EGFR as it changes from an autoinhibited to extended monomer . The amino acids Lys465 and Ile467 were identified as energetic hot spot residues for mAb 225 binding to EGFR . These residues are adjacent to the EGFR ligand-binding site, which is consistent with the ability of mAb 225 to block binding of epidermal growth factor (EGF) and transforming growth factor-alpha (TGF-alpha) ligands . Ser468 and Glu472 were identified as energetically important for mAb 13A9 binding to EGFR, and the location of this epitope suggests that mAb 13A9 mediates observed TGF-alpha blocking effects through conformational perturbation of EGFR domain III . Combinatorial library screening of yeast-displayed mutagenic proteins is a novel method to identify discontinuous and heat-denaturable mAb binding epitopes with residue-level resolution. Proc Natl Acad Sci U S A, 2004 Aug 31, 101(35), 12934 - 9 Epub 2004 Aug 23. Effects of Q/N-rich, polyQ, and non-polyQ amyloids on the de novo formation of the {PSI+} prion in yeast and aggregation of Sup35 in vitro; Derkatch IL et al.; Prions are infectious protein conformations that are generally ordered protein aggregates . In the absence of prions, newly synthesized molecules of these same proteins usually maintain a conventional soluble conformation . However, prions occasionally arise even without a homologous prion template . The conformational switch that results in the de novo appearance of yeast prions with glutamine/aspargine (Q/N)-rich prion domains (e.g., {PSI+}), is promoted by heterologous prions with a similar domain (e.g., {RNQ+}, also known as {PIN+}), or by overexpression of proteins with prion-like Q-, N-, or Q/N-rich domains . This finding led to the hypothesis that aggregates of heterologous proteins provide an imperfect template on which the new prion is seeded . Indeed, we show that newly forming Sup35 and preexisting Rnq1 aggregates always colocalize when {PSI+} appearance is facilitated by the {RNQ+} prion, and that Rnq1 fibers enhance the in vitro formation of fibers by the prion domain of Sup35 (NM) . The proteins do not however form mixed, interdigitated aggregates . We also demonstrate that aggregating variants of the polyQ-containing domain of huntingtin promote the de novo conversion of Sup35 into {PSI+}; whereas nonaggregating variants of huntingtin and aggregates of non-polyQ amyloidogenic proteins, transthyretin, alpha-synuclein, and synphilin do not . Furthermore, transthyretin and alpha-synuclein amyloids do not facilitate NM aggregation in vitro, even though in {PSI+} cells NM and transthyretin aggregates also occasionally colocalize . Our data, especially the in vitro reproduction of the highly specific heterologous seeding effect, provide strong support for the hypothesis of cross-seeding in the spontaneous initiation of prion states . Phys Rev Lett . 2004 Aug 13;93(7):078102 . Epub 2004 Aug 13. Anomalous diffusion in living yeast cells; Tolic-Norrelykke IM et al.; The viscoelastic properties of the cytoplasm of living yeast cells were investigated by studying the motion of lipid granules naturally occurring in the cytoplasm . A large frequency range of observation was obtained by a combination of video-based and laser-based tracking methods . At time scales from 10(-4) to 10(2) s, the granules typically perform subdiffusive motion with characteristics different from previous measurements in living cells . This subdiffusive behavior is thought to be due to the presence of polymer networks and membranous structures in the cytoplasm . Consistent with this hypothesis, we observe that the motion becomes less subdiffusive upon actin disruption. J Biol Chem, 2004 Oct 29, 279(44), 45613 - 7 Epub 2004 Aug 20. Heat of PPi hydrolysis varies depending on the enzyme used . Yeast and corn vacuolar pyrophosphatase; da-Silva WS et al.; With yeast-soluble inorganic pyrophosphatase, the heat released during PP(i) hydrolysis was -6.3 kcal/mol regardless of the KCl concentration in the medium . With the membrane-bound pyrophosphatase of corn vacuoles, the heat released varies between -23.5 and -7.5 kcal/mol depending on the KCl concentration in the medium and whether or not a H(+) gradient is formed across the vacuole membranes . The data support the proposal that enzymes are able to handle the energy derived from phosphate compound hydrolysis in such a way as to determine the parcel that is used for work and the fraction that is converted into heat. J Mol Biol, 2004 Aug 27, 341(5), 1343 - 54 Model for the yeast cofactor A-beta-tubulin complex based on computational docking and mutagensis; You L et al.; Virtually every biological process involves protein-protein contact but relatively few protein-protein complexes have been solved by X-ray crystallography . As more individual protein structures become available, computational methods are likely to play increasingly important roles in defining these interactions . Tubulin folding and dimer formation are complex processes requiring a variety of protein cofactors . One of these is cofactor A, which interacts with beta-tubulin prior to assembly of the alpha-tubulin-beta-tubulin heterodimer . In the yeast Saccharomyces cerevisiae, beta-tubulin is encoded by TUB2 and cofactor A by RBL2 . We have used computational docking and site-directed mutagenesis to generate a model of the Rbl2-Tub2 complex from the solved structures of these two proteins . Residues in the N termini and the loops of the Rbl2 homodimer appear to mediate binding to beta-tubulin . These interact with beta-tubulin residues in the region that contains helices H9 and H10 . Rbl2 and alpha-tubulin share overlapping binding sites on the beta-tubulin molecule providing a structural explanation for the mutually exclusive binding of Rbl2 and alpha-tubulin to beta-tubulin. FEMS Microbiol Lett, 2004 Aug 15, 237(2), 213 - 8 Elongation of C16:0 to C18:0 fatty acids in methylotrophic yeast Hansenula polymorpha CBS 1976 and fatty acid auxotrophic mutants; Wongsumpanchai W et al.; Fatty acid elongation defective mutant was isolated from the ethyl methanesulfonate treated Hansenula polymorpha based on the growth ability . Using biochemical and genetic approaches, the mutant was characterized . When compared with the fatty acid phenotype of the parental strain, the differences in profile and content of fatty acids in V1 mutant were found . In this V1 mutant, polyunsaturated fatty acids, linoleic and alpha-linolenic acids, could not be detected with a corresponding increase in the content of mono-unsaturated fatty acids . The ratio of C16/C18 fatty acids revealed that the accumulation of C16 fatty acids was increased significantly . The experiments on fatty acid supplementation indicated that the mutant required C18:0 for the proper growth . The results of genetic complementation with the elongase genes of Saccharomyces cerevisiae confirmed that the lesion was occurred at least in the extension of C16:0 to C18:0 of V1 . The H . polymorpha mutant obtained in this work will be used as a useful tool for unraveling the pathway of fatty acid synthesis and the role of fatty acids on biological processes. Biochem J, 2005 Jan 1, 385(Pt 1), 173 - 80 A cryptic matrix targeting signal of the yeast ADP/ATP carrier normally inserted by the TIM22 complex is recognized by the TIM23 machinery; Vergnolle MA et al.; The yeast ADP/ATP carrier (AAC) is a mitochondrial protein that is targeted to the inner membrane via the TIM10 and TIM22 translocase complexes . AAC is devoid of a typical mitochondrial targeting signal and its targeting and insertion are thought to be guided by internal amino acid sequences . Here we show that AAC contains a cryptic matrix targeting signal that can target up to two thirds of the N-terminal part of the protein to the matrix . This event is coordinated by the TIM23 translocase and displays all the features of the matrix-targeting pathway . However, in the context of the whole protein, this signal is 'masked' and rendered non-functional as the polypeptide is targeted to the inner membrane via the TIM10 and TIM22 translocases . Our data suggest that after crossing the outer membrane the whole polypeptide chain of AAC is necessary to commit the precursor to the TIM22-mediated inner membrane insertion pathway. Mikrobiologiia, 2004 May-Jun, 73(3), 300 - 6 {The isolation, purification, and some properties of NAD-dependent isocitrate dehydrogenase from the organic acid-producing yeast Yarrowia lipolytica}; Morgunov IG et al.; The NAD+-dependent isocitrate dehydrogenase of the organic acid-producing yeast Yarrowia lipolytica was isolated, purified, and partially characterized . The purification procedure included four steps: ammonium sulfate precipitation, acid precipitation, hydrophobic chromatography, and gel-filtration chromatography . The enzyme was purified 129-fold with a yield of 31% and had a specific activity of 22 U/mg protein . The molecular mass of the enzyme was found to be 412 kDa . The enzyme consists of eight identical subunits with a molecular mass of about 52 kDa . The Km for NAD+ is 136 microM, and that for isocitrate is 581 microM . The effect of some intermediates of the citric acid cycle and nucleotides on the enzyme activity was studied . The role of isocitrate dehydrogenase (NAD+) in the overproduction of citric and keto acids is discussed. Nat Genet, 2004 Sep, 36(9), 1014 - 8 Epub 2004 Aug 15. Gene loops juxtapose promoters and terminators in yeast; O'Sullivan JM et al.; Mechanistic analysis of transcriptional initiation and termination by RNA polymerase II (PolII) indicates that some factors are common to both processes . Here we show that two long genes of Saccharomyces cerevisiae, FMP27 and SEN1, exist in a looped conformation, effectively bringing together their promoter and terminator regions . We also show that PolII is located at both ends of FMP27 when this gene is transcribed from a GAL1 promoter under induced and noninduced conditions . Under these conditions, the C-terminal domain of the large subunit of PolII is phosphorylated at Ser5 . Notably, inactivation of Kin28p causes a loss of both Ser5 phosphorylation and the loop conformation . These data suggest that gene loops are involved in the early stages of transcriptional activation . They also predict a previously unknown structural dimension to gene regulation, in which both ends of the transcription unit are defined before and during the transcription cycle. Mol Cell Biol, 2004 Sep, 24(17), 7402 - 18 Molecular interactions of yeast Neo1p, an essential member of the Drs2 family of aminophospholipid translocases, and its role in membrane trafficking within the endomembrane system; Wicky S et al.; Neo1p is an essential yeast member of the highly conserved Drs2 family of P-type ATPases with proposed aminophospholipid translocase activity . Here we present evidence that Neo1p localizes to endosomes and Golgi elements . In agreement with that finding, the temperature-sensitive neo1-37 and neo1-69 mutants exhibit defects in receptor-mediated endocytosis, vacuole biogenesis, and vacuolar protein sorting . Furthermore, neo1 mutants accumulate aberrantly shaped membranous structures most likely derived from vacuoles and the endosomal/Golgi system . At permissive temperatures, HA-Neo1-69p, like wild-type Neo1p, is stable and associates with endosomes . In contrast, HA-Neo1-37p is rapidly degraded and is predominantly retained within the endoplasmic reticulum (ER) . Thus, the two neo1 alleles affect the stability and localization of the mutant polypeptides in different ways . A C-terminally truncated and a C-terminally epitope-tagged version of Neo1p are nonfunctional and also mislocalize to the ER . In agreement with a role within the endomembrane system, Neo1p exhibits genetic and physical interactions with Ysl2p, a potential guanine nucleotide exchange factor for Arl1p . Interestingly, deletion of ARL1 rescues the temperature sensitivity of neo1-37 and neo1-69 . We demonstrate that Arl1p in its myristoylated and GTP-bound form is responsible for the inhibitory effect . Thus, Neo1p, Ysl2p, and Arl1p represent three proteins that collaborate in membrane trafficking within the endosomal/Golgi system . Methods Enzymol, 2004, 389, 399 - 409 Identification of yeast pheromone pathway modulators by high-throughput agonist response profiling of a yeast gene knockout strain collection; Chasse SA et al.; Gene deletion analysis is a powerful tool for resolving the contributions of individual open reading frames to the physiology of cells . Analysis of deletion phenotypes in conjunction with a specific pathway reporter can identify constituents of a physiological pathway and reveal potential effectors that regulate the pathway by quantifying the phenotypic responses of the mutant cells . This article describes a high-throughput method of analyzing a yeast gene deletion library for novel G-protein signaling modulators using a yeast pheromone pathway-specific reporter. Methods Enzymol, 2004, 389, 383 - 98 Mathematical modeling of RGS and G-protein regulation in yeast; Yildirim N et al.; G-protein-activated signaling pathways are capable of adapting to a persistent external stimulus . Desensitization is thought to occur at the receptor level as well as through negative feedback by a family of proteins called regulators of G-protein signaling (RGS) . The pheromone response pathway in yeast is a typical example of such a system, and the relative simplicity of this pathway makes it an attractive system in investigating the regulatory role of RGS proteins . Two studies have used computational modeling to gain insight into how this pathway is regulated (Hao et al., 2003; Yi et al., 2003) . This article provides an introduction to computational analysis of signaling pathways by developing a mathematical model of the pheromone response pathway that synthesizes the results of these two investigations . Our model qualitatively captures many features of the pathway and suggests an additional mechanism for pathway inactivation . It also illustrates that a complete understanding of signaling pathways requires an investigation of their time-dependent behavior. Methods Enzymol, 2004, 389, 277 - 301 Yeast-based screening for inhibitors of RGS proteins; Young KH et al.; This article provides information on two screening platforms for the identification of regulators of G-protein signaling (RGS) protein modulators . Utilization of the yeast pheromone response pathway enabled the creation of a functional screen for RGS4 modulators . The RGSZ1-focused screen employs advances in yeast two-hybrid screening technologies and targets the protein-protein interface of the RGS domain/Galpha interaction . Moreover, the RGSZ1 screen provides the opportunity to multiplex the screening of two targets of interest, given the development of two different luciferase reporter genes that enabled sequential determination and intraassay controls . The screen formats were validated, implemented, and conducted as automated 384-well, liquid-based, high-throughput small molecule screens . Primary "hits" were confirmed using benchtop 96-well formats of these assays and advanced to in vitro functional evaluation assays . The yeast-based assay platforms provide robust cellular assays that result in the identification of small molecule modulators for both RGS targets . These molecules can serve both as tools with which to probe biological implications of RGS proteins and as potential starting points toward the development of novel modulators of G-protein signaling pathways . Such modulators may show potential for controlling and treating diseases resulting from inappropriate activity of G-protein signaling pathways. Trends Genet, 2004 Sep, 20(9), 403 - 7 How much expression divergence after yeast gene duplication could be explained by regulatory motif evolution? Zhang Z, Gu J, Gu X. We used the yeast genome sequences of gene families, microarray profiles and regulatory motif data to test the current wisdom that there is a strong correlation between regulatory motif structure and gene expression profile . Our results suggest that duplicate genes tend to be co-expressed but the correlation between motif content and expression similarity is generally poor, only approximately 2-3% of expression variation can be explained by the motif divergence . Our observations suggest that, in addition to the cis-regulatory motif structure in the upstream region of the gene, multiple trans-acting factors in the gene network can influence the pattern of gene expression significantly. Nat Cell Biol, 2004 Sep, 6(9), 840 - 8 Epub 2004 Aug 15. Yeast centrin Cdc31 is linked to the nuclear mRNA export machinery; Fischer T et al.; Centrins are calmodulin-like proteins that function in the duplication of microtubule-organizing centres . Here we describe a new function of the yeast centrin Cdc31 . We show that overproduction of a sequence, termed CID, in the carboxy-terminal domain of the nuclear export factor Sac3 titrates Cdc31, causing a dominant-lethal phenotype and a block in spindle pole body (SPB) duplication . Under normal conditions, the CID motif recruits Cdc31 and Sus1 (a subunit of the SAGA transcription complex) to the Sac3-Thp1 complex, which functions in mRNA export together with specific nucleoporins at the nuclear basket . A previously reported cdc31 temperature-sensitive allele, which is neither defective in SPB duplication nor Kic1 kinase activation, induces mRNA export defects . Thus, Cdc31 has an unexpected link to the mRNA export machinery. Proc Natl Acad Sci U S A, 2004 Aug 24, 101(34), 12616 - 21 Epub 2004 Aug 12. Role of the yeast acetyltransferase Mpr1 in oxidative stress: regulation of oxygen reactive species caused by a toxic proline catabolism intermediate; Nomura M et al.; The MPR1 gene, which is found in the Sigma1278b strain but is not present in the sequenced laboratory strain S288C, of the budding yeast Saccharomyces cerevisiae encodes a previously uncharacterized N-acetyltransferase that detoxifies the proline analogue azetidine-2-carboxylate (AZC) . However, it is unlikely that AZC is a natural substrate of Mpr1 because AZC is found only in some plant species . In our search for the physiological function of Mpr1, we found that mpr1-disrupted cells were hypersensitive to oxidative stresses and contained increased levels of reactive oxygen species (ROS) . In contrast, overexpression of MPR1 leads to an increase in cell viability and a decrease in ROS level after oxidative treatments . These results indicate that Mpr1 can reduce intracellular oxidation levels . Because put2-disrupted yeast cells lacking Delta(1)-pyrroline-5-carboxylate (P5C) dehydrogenase have increased ROS, we examined the role of Mpr1 in put2-disrupted strains . When grown on media containing urea and proline as the nitrogen source, put2-disrupted cells did not grow as well as WT cells and accumulated intracellular levels of P5C that were first detected in yeast cells and ROS . On the other hand, put2-disrupted cells that overexpressed MPR1 had considerably lower ROS levels . In vitro studies with bacterially expressed Mpr1 demonstrated that Mpr1 can acetylate P5C, or, more likely, its equilibrium compound glutamate-gamma-semialdehyde, at neutral pH . These results suggest that the proline catabolism intermediate P5C is toxic to yeast cells because of the formation of ROS, and Mpr1 regulates the ROS level under P5C-induced oxidative stress. J Biol Chem, 2004 Oct 15, 279(42), 44219 - 28 Epub 2004 Aug 11. The bipartite 3'-cis-acting signal for replication is required for formation of a ribonucleoprotein complex in vivo between the viral genome and its RNA polymerase in yeast 23 S RNA virus; Fujimura T et al.; 23 S RNA narnavirus is a persistent positive strand RNA virus found in Saccharomyces cerevisiae . The viral genome (2.9 kb) encodes only its RNA-dependent RNA polymerase, p104, and forms a ribonucleoprotein complex with p104 in vivo . Previously we succeeded in generating 23 S RNA virus in yeast from an expression vector containing the entire viral cDNA sequence . Using this system, we have recently identified a bipartite 3' cis-acting signal for replication . The signal consists of a stretch of four cytidines (Cs) at the 3' end and a mismatched pair of purines in a stem-loop structure that partially overlaps the terminal four Cs . Although the 3' terminal and penultimate Cs are not essential for virus launching, the generated viruses efficiently recovered these terminal nucleotides . In this work, we expressed RNA transcripts containing the entire 23 S RNA genome but incapable of generating the virus because of the presence of non-viral extra sequences at the 3' ends . These transcripts could form complexes with p104 in vivo, and a detailed analysis indicated that the mismatched pair of purines as well as the third and fourth Cs from the viral 3' end was essential for this complex-forming activity . Given that 23 S RNA virus does not have genes for capsid proteins, the binding of p104 to the viral 3' end, in addition to the efficient 3' terminal repair, may play a crucial role in virus persistence by protecting and maintaining the correct viral 3' end in vivo. Biochem J, 2004 Dec 1, 384(Pt 2), 411 - 20 Thermodynamics of ligand binding by the yeast mRNA-capping enzyme reveals different modes of binding; Bougie I et al.; RNA-capping enzymes are involved in the synthesis of the cap structure found at the 5'-end of eukaryotic mRNAs . The present study reports a detailed study on the thermodynamic parameters involved in the interaction of an RNA-capping enzyme with its ligands . Analysis of the interaction of the Saccharomyces cerevisiae RNA-capping enzyme (Ceg1) with GTP, RNA and manganese ions revealed significant differences between the binding forces that drive the interaction of the enzyme with its RNA and GTP substrates . Our thermodynamic analyses indicate that the initial association of GTP with the Ceg1 protein is driven by a favourable enthalpy change (DeltaH=-80.9 kJ/mol), but is also clearly associated with an unfavourable entropy change (TDeltaS=-62.9 kJ/mol) . However, the interaction between Ceg1 and RNA revealed a completely different mode of binding, where binding to RNA is clearly dominated by a favourable entropic effect (TDeltaS=20.5 kJ/mol), with a minor contribution from a favourable enthalpy change (DeltaH=-5.3 kJ/mol) . Fluorescence spectroscopy also allowed us to evaluate the initial binding of GTP to such an enzyme, thereby separating the GTP binding step from the concomitant metal-dependent hydrolysis of GTP that results in the formation of a covalent GMP-protein intermediate . In addition to the determination of the energetics of ligand binding, our study leads to a better understanding of the molecular basis of substrate recognition by RNA-capping enzymes. Dermatol Nurs, 2004 Jun, 16(3), 259 - 65 Resistance of the yeast-like fungi strains isolated from different ontogeneses of patients; Krajewska-Kulak E et al.; The susceptibility of the yeast-like fungi strains was assessed using the Fungitest method . The yeast-like fungi strains isolated from 406 patients with symptoms of candidiasis (oral cavity, vagina, urethra, skin, nails, and stomach) were evaluated . Differences between the susceptibility of strains isolated from different sites of the body to tested drugs were found . High resistance of tested strains to several antimycotics were identified . Fungitest is an easy and effective method in assessing the susceptibility of yeast-like fungi strains to antimycotics. J Radiat Res (Tokyo), 2004 Jun, 45(2), 169 - 74 Detection of gamma-irradiation induced DNA damage and radioprotection of compounds in yeast using comet assay; Nemavarkar PS et al.; The single cell gel electrophoresis assay (SCGE), a very rapid and sensitive method, has been applied to follow gamma-irradiation induced DNA damage in budding yeast, Saccharomyces cerevisiae . Spheroplasting the gamma-irradiated yeast cells by enzyme glusulase, before subjecting them to electrophoresis, resulted in a well-defined appearance of comets . Yeast comets look quite different from mammalian comets . A linear relationship was observed between the doses of irradiation and the tail moments of comets . These studies were extended to follow the action of known radio-protectors, i.e., caffeine and disulfiram . The results revealed the usefulness SCGE as applied to yeast in studies of the gamma-irradiation-induced DNA breaks and also radio-protection by chemicals at doses that are not feasible with other eukaryotes. Appl Biochem Biotechnol, 1999 Feb, 76(2), 129 - 42 Cyclic AMP and Low Molecular Weight Effector(s) Present in Yeast Extract Are Involved in Pectin Lyase Production by Penicillium griseoroseum Cultured on Sucrose; Baracat-Pereira MC et al.; Pectin lyase (PL) induction by organic and inorganic components of yeast extract (YE) was evaluated in Penicillium griseoroseum, cultured in a mineral medium containing sucrose, by determining PL activity (A235) and mycelial growth (mycelial dry weight) . The lowest YE concentration that promoted significant PL induction without acting as a carbon source for the fungus corresponded to 0.0075% . Neither calcined YE nor a nutrient solution containing micronutrients induced PL production, indicating that the inducer was an organic compound . Vitamins, phospholipid components, amino acids, and nitrogenous bases were tested in place of YE and promoted no significant PL induction . A PL inducer compound was found to be soluble in the nucleotide fraction obtained during extraction of YE . The inducer was shown to be a thermostable polar substance dialyzable at 2000 Daltons, hydrolyzable by HCl, and activated by boiling for up to 60 min . Cyclic AMP (cAMP) exogenously added to the culture medium at 5 and 10 mM was capable of inducing PL in P . griseoroseum grown on sucrose, suggesting that at least one compound may be present in YE acting in a cooperative fashion for the maintenance of high levels of cAMP into the cell . PL activity and the level of cAMP inside the fungal cells increased after the addition of YE to the culture medium, suggesting the participation of this messenger in this enzyme's synthesis. J Biol Chem, 2004 Oct 22, 279(43), 44394 - 9 Epub 2004 Aug 10. The human TAZ gene complements mitochondrial dysfunction in the yeast taz1Delta mutant . Implications for Barth syndrome; Ma L et al.; Barth syndrome is a genetic disorder that is caused by different mutations in the TAZ gene G4.5 . The yeast gene TAZ1 is highly homologous to human TAZ, and the taz1Delta mutant has phospholipid defects similar to those observed in Barth syndrome cells, including aberrant cardiolipin species and decreased cardiolipin levels . Subcellular fractionation studies revealed that Taz1p is localized exclusively in mitochondria, which supports the theory that tafazzins are involved in cardiolipin remodeling . Because cardiolipin plays an important role in respiratory function, we measured the energy transformation and osmotic properties of isolated mitochondria from the taz1Delta mutant . Energy coupling in taz1Delta mitochondria was dependent on the rate of oxidative phosphorylation, as coupling was diminished when NADH was used as a respiratory substrate but was unaffected when ethanol was the substrate . Membrane stability was compromised in taz1Delta mitochondria exposed to increased temperature and hypotonic conditions . Mitochondria from taz1Delta also displayed decreased swelling in response to ATP, which induces the yeast mitochondrial unspecific channel, and to alamethicin, a membrane-disrupting agent . Coupling was measured in taz1Delta cells containing different splice variants of the human TAZ gene . Only the variant that restores wild type cardiolipin synthesis (lacking exon 5) restored coupling in hypotonic conditions and at elevated temperature . These findings may shed light on the mitochondrial deficiencies observed in Barth syndrome. Eukaryot Cell, 2004 Aug, 3(4), 1049 - 61 The exchange factor Cdc24 is required for cell fusion during yeast mating; Barale S et al.; During Saccharomyces cerevisiae mating, chemotropic growth and cell fusion are critical for zygote formation . Cdc24p, the guanine nucleotide exchange factor for the Cdc42 G protein, is necessary for oriented growth along a pheromone gradient during mating . To understand the functions of this critical Cdc42p activator, we identified additional cdc24 mating mutants . Two mating-specific mutants, the cdc24-m5 and cdc24-m6 mutants, each were isolated with a mutated residue in the conserved catalytic domain . The cdc24-m6 mutant responds normally to pheromone and orients its growth towards a mating partner yet accumulates prezygotes during mating . cdc24-m6 prezygotes have two apposed intact cell walls and do not correctly localize proteins required for cell fusion, despite normal exocytosis . Our results indicate that the exchange factor Cdc24p is necessary for maintaining or restricting specific proteins required for cell fusion to the cell contact region during mating. Biochemistry, 2004 Aug 17, 43(32), 10592 - 9 Self-association of the yeast nucleosome assembly protein 1; McBryant SJ et al.; The self-association properties of the yeast nucleosome assembly protein 1 (yNAP1) have been investigated using biochemical and biophysical methods . Protein cross-linking and calibrated gel filtration chromatography of yNAP1 indicate the protein exists as a complex mixture of species at physiologic ionic strength (75-150 mM) . Sedimentation velocity reveals a distribution of species of 4.5-12 Svedbergs (S) over a 50-fold range of concentrations . The solution-state complexity is reduced at higher ionic strength, allowing for examination of the fundamental oligomer . Sedimentation equilibrium of a homogeneous 4.5 S population at 500 mM sodium chloride reveals these species to be yNAP1 dimers . These dimers self-associate to form higher order oligomers at more moderate ionic strength . Titration of guanidine hydrochloride converts the higher order oligomers to the homogeneous 4.5 S dimer and then converts the 4.5 S dimers to 2.5 S monomers . Circular dichroism shows that guanidine-mediated dissociation of higher order oligomers into yNAP1 dimers is accompanied by only slight changes in secondary structure . Dissociation of the dimer requires a nearly complete denaturation event. Cell Cycle, 2004 Apr, 3(4), 462 - 8 The novel yeast PAS kinase Rim 15 orchestrates G0-associated antioxidant defense mechanisms; Cameroni E et al.; The highly conserved PKA and TOR proteins define key signaling pathways that control cell proliferation in response to growth factors and/or nutrients . In yeast, inactivation of PKA and/or TOR causes cells to arrest growth early G1 and induces a program that is characteristic of G0 cells . We have recently shown that the protein kinase Rim15 integrates both PKA- and TOR-mediated signals . In this work, we demonstrate that the Rim15-activated genomic expression program following glucose limitation at the diauxic shift is mediated by the three transcription factors Gis1, Msn2, and Msn4 . The Rim15 regulon comprises several gene clusters implicated in the adaptation to respiratory growth, including classical oxidative stress genes such as SOD1 and SOD2, suggesting that the reduced life span of rim15delta cells may be due to their deficiency in oxidative damage prevention . Interestingly, we found that the primary amino acid sequence of Rim15 includes in its amino-terminal part a conserved PAS domain, known to act as a sensor for a variety of stimuli, We propose that Rim15 has evolved to integrate nutrient signals (transduced via TOR and PKA) and redox and/or oxidative stress signals to appropriately induce a transcriptional program that ensures survival in G0. Yeast, 2004 Jul 30, 21(10), 831 - 50 Modelling the dynamics of the yeast pheromone pathway; Kofahl B et al.; We present a mathematical model of the dynamics of the pheromone pathways in haploid yeast cells of mating type MATa after stimulation with pheromone alpha-factor . The model consists of a set of differential equations and describes the dynamics of signal transduction from the receptor via several steps, including a G protein and a scaffold MAP kinase cascade, up to changes in the gene expression after pheromone stimulation in terms of biochemical changes (complex formations, phosphorylations, etc.) . The parameters entering the models have been taken from the literature or adapted to observed time courses or behaviour . Using this model we can follow the time course of the various complex formation processes and of the phosphorylation states of the proteins involved . Furthermore, we can explain the phenotype of more than a dozen well-characterized mutants and also the graded response of yeast cells to varying concentrations of the stimulating pheromone. Acta Crystallogr D Biol Crystallogr, 1996 Mar, 52(Pt 2), 405 - 6 Crystallization and preliminary X-ray diffraction study of aldehyde reductase from a red yeast, Sporobolomyces salmonicolor; Kataoka M; Crystals of aldehyde reductase from a red yeast, Sporobolomyces salmonicolor, have been grown from an ammonium sulfate solution, pH 7.0, by means of the vapor-diffusion procedure . The crystals belong to the hexagonal system, space group P6(1)22 or its enantiomorph, P6(5)22, with unit-cell dimensions of a = 72.2 and c = 320 A . The X-ray diffraction patterns extend to at least 2 A resolution with the use of synchrotron radiation . The crystals are stable on exposure to X-rays and suitable for high-resolution X-ray structure determination. Acta Crystallogr D Biol Crystallogr, 1994 Mar, 50(Pt 2), 210 - 8 Analysis of diffuse scattering from yeast initiator tRNA crystals; Kolatkar AR; Yeast initiator tRNA crystals exhibit strong X-ray diffuse scattering . This scattering can be used to extract information about lattice-coupled and intramolecular motions in the crystals . The amplitudes and correlation distances of these motions can be estimated by calculating the diffuse scattering and comparing the results with the observed scattering . Results indicate that both anisotropic, lattice-coupled motions as well as short-range correlated local disorder in the anticodon arm contribute to the overall disorder in the crystals . These types of motions can be correlated with aspects of tRNA function . This additional information complements the results from analysis of crystallographic data and provides a more detailed picture of the structure and dynamics of the molecule . The degree to which the methodology presented here can account for the observed diffuse scattering from tRNA represents a significant step forward in the ability to use this conventionally discarded information, and encourages the ultimate extension of these ideas to a wide variety of macromolecular systems. Acta Crystallogr D Biol Crystallogr, 1994 May, 50(Pt 3), 335 - 6 Crystallization at low salt concentration and alkaline pH and preliminary crystallographic data for a monoclinic form of yeast enolase; Zhang E; Yeast enolase (2-phospho-D-glycerate hydrolyase, E.C . 4.2.1.11) has been crystallized by vapor diffusion from a solution containing 22% PEG 4000, 100 mM Tris buffer pH = 9.3, 200 mM Li(2)SO(4) . The crystals are monoclinic with a = 122.5, b = 111.8, c = 63.7 A, beta = 95.6 degrees, space group P2(1) and two dimeric molecules are present in an asymmetric part of the unit cell . Crystals have been successfully transferred to an artificial mother liquor, pH = 7.8, 20 mM in Mg(2+) and 5 mM in 2-phospho-D-glycerate . We believe that under these lower salt concentration and more alkaline conditions we should be able to localize the two metal ions that participate in catalysis as well as examine binding of high-affinity inhibitors. Biophys J, 2004 Aug, 87(2), 907 - 11 Homology-modeled structure of the yeast mitochondrial citrate transport protein; Walters DE et al.; We have used homology modeling to construct a three-dimensional model of the yeast mitochondrial citrate transport protein (CTP), based on the recently published x-ray crystal structure of another mitochondrial transport protein, the ADP/ATP carrier . Superposition of the backbone traces of the homology-modeled CTP onto the crystallographically determined ADP carrier structure indicates that the CTP transmembrane domains are well modeled (i.e., root mean square deviation of 0.94 A), whereas the loops facing the intermembrane space and the mitochondrial matrix are less certain (i.e., root mean square deviation values of 0.72-2.06 A) . The homology-modeled CTP is consistent with our earlier de novo models of the transporter's transmembrane domains, with respect to residues which face into the transport path . Importantly, the resulting model is consistent with our previous experimental data obtained from measuring reactivity of 34 single cysteine mutants in transmembrane domains 3 and 4 with methanethiosulfonate reagents . The model also points to a likely dimer interface region . In conclusion, our data help to define the substrate translocation pathway in both the modeled CTP structure and the crystallographic ADP carrier structure. Genes Cells, 2004 Aug, 9(8), 685 - 96 The role of pre-existing aggregates in Hsp104-dependent polyglutamine aggregate formation and epigenetic change of yeast prions; Kimura Y et al.; Amyloid-like protein aggregates have been implicated in various diseases and in the protein-based inheritance of yeast prions . The molecular chaperone Hsp104 has been shown to be necessary for the aggregate formation of polyglutamine in yeast, and for the maintenance of several yeast prion phenotypes through the formation of self-propagating aggregates . In this paper, we show that the polyglutamine aggregates that are formed independently of Hsp104, are required for Hsp104 to efficiently produce more aggregates . Similarly, in the yeast prion {PSI+} system, Hsp104-dependent epigenetic changes to the {PSI+} prion phenotype require the presence of prion aggregates in the normal {psi-} state . We also show that the co-localization of different prion aggregates suggests that cross-seeding by different yeast prions increases the probability of Hsp104-dependent epigenetic change . These findings highlight the role of pre-existing aggregates in chaperone-dependent establishment of the epigenetic trait in yeast prions, and possibly in the pathology of several neurodegenerative diseases. Plant Cell Physiol, 2004 Jul, 45(7), 823 - 30 Water channel activity of radish plasma membrane aquaporins heterologously expressed in yeast and their modification by site-directed mutagenesis; Suga S et al.; Plants contain a number of aquaporin isoforms . We developed a method for determining the water channel activity of individual isoforms of aquaporin . Six plasma membrane aquaporins (RsPIPs) and two vacuolar membrane aquaporins (RsTIPs) of radish (Raphanus sativus) were expressed heterologously in Saccharomyces cerevisiae BJ5458, which is deficient in endogenous functional aquaporin . Aquaporins were detected by immunoblot analysis with corresponding antibodies . Water permeability of membranes from yeast transformants was assayed by stopped-flow spectrophotometry . The water channel activity of members of the RsPIP2 and RsTIP subfamilies was about 10 times and 5 times greater, respectively, than that of the control; however, RsPIP1s had little (RsPIP1-2 and RsPIP1-3) or no activity (RsPIP1-1) . Site-directed mutation of several residues conserved in RsPIP1s or RsPIP2s markedly altered the water transport activity . Exchange of Ile244 of RsPIP1-3 with valine increased the activity to 250% of the wild type RsPIP1-3 . On the other hand, exchange of Val235 of RsPIP2-2, which corresponds to RsPIP1-3 Ile244, with isoleucine caused a marked inactivation to 45% of the original RsPIP2-2 . Mutation at possible phosphorylation sites at the N- and C-terminal tails also altered the activity . These results suggest that these residues in the half-helix loop E and the tails are involved in the water transport and the functional regulation of RsPIP1 and RsPIP2. Protein Expr Purif, 2004 Sep, 37(1), 134 - 43 Decreases in yeast expression yields of the human adenosine A2a receptor are a result of translational or post-translational events; Niebauer RT et al.; The human adenosine receptor (A2a), a G-protein-coupled receptor (GPCR), was C-terminally tagged with the green fluorescent protein (GFP) and expressed in the yeast Saccharomyces cerevisiae to gain an understanding of the expression limitations of this medically relevant class of membrane proteins . The A2a-GFP protein was able to bind adenosine analogs indicating that the GFP tag did not alter the ligand binding activity of the receptor . A screen based on whole cell fluorescence was developed and a library of clones with various gene copy numbers was screened via flow cytometry to isolate clones with the highest protein expression levels . All clones studied exhibited a decrease in the net A2a-GFP protein production rate over time as determined by whole cell fluorescence, Western blotting, confocal microscopy, and ligand binding . Quantitative PCR showed that A2a-GFP mRNA levels remained relatively high even as the protein production rate decreased . A cycloheximide chase experiment showed that the mature protein was stable over time and was not significantly degraded . Taken together, these results suggest that heterologous expression of GPCRs is limited by a translational or post-translational bottleneck that is unique from expression limitations seen for soluble proteins. Protein Expr Purif, 2004 Sep, 37(1), 97 - 101 Functional expression of hexahistidine-tagged beta-subunit of yeast F1-ATPase and isolation of the enzyme by immobilized metal affinity chromatography; Ichikawa N et al.; Mitochondrial ATP synthase (F1Fo-ATPase) catalyzes the terminal step of oxidative phosphorylation . In this paper, we demonstrate the functional expression of the hexahistidine-tagged beta-subunit of yeast ATP synthase and the purification of the F1-ATPase from yeast cells . A gene encoding the beta-subunit from Saccharomyces cerevisiae was modified to encode a protein of which the original N-terminus import signal sequence was replaced by a sequence containing the import signal sequence of a mitochondrial ATPase inhibitor, its processing site, and six consecutive histidines . Expression of the modified gene generated a functional F1Fo complex in host yeast cells lacking a functional copy of the endogenous ATP2 gene, as judged by growth of rescued cells on lactate medium . F1 was extracted from the yeast mitochondria by chloroform treatment and purified by immobilized metal affinity chromatography and gel filtration chromatography . The specific activity of the purified F1 was comparable to that of the wild-type enzyme, and the F1 contained all of the 5 known subunits (alpha, beta, gamma, delta, and epsilon) . Moreover, the activity of the F1 was completely inhibited by the specific ATPase inhibitor protein, IF1 . These results indicate that F1 containing the tagged beta-subunit is fully assembled and active . The application of this novel procedure simplifies the number of steps required for the isolation of F1 used for studying the molecular mechanism of catalysis and regulation of the enzyme. J Biol Chem, 2004 Oct 1, 279(40), 41346 - 51 Epub 2004 Jul 30. A proteome-wide approach identifies sumoylated substrate proteins in yeast; Panse VG et al.; The ubiquitin-related protein SUMO-1 is covalently attached to proteins by SUMO-1 ligases . We have performed a proteome-wide analysis of sumoylated substrate proteins in yeast . Employing the powerful affinity purification of Protein A-Smt3 (Smt3 is the yeast homologue of SUMO-1) from yeast lysates in combination with tandem liquid chromatography mass spectrometry, we have isolated potential Smt3-carrying substrate proteins involved in DNA replication and repair, chromatin remodeling, transcription activation, Pol-I, Pol-II, and Pol-III transcription, 5' pre-mRNA capping, 3' pre-mRNA processing, proteasome function, and tubulin folding . Employing tandem affinity purifications or a rapid biochemical assay referred to as "SUMO fingerprint," we showed that several subunits of RNA polymerases I, II, and III, members of the transcription repression and chromatin remodeling machineries previously not known to be sumoylated, are modified by SUMO-1 . Thus, the identification of a broad range of SUMO-1 substrate proteins is expected to lead to further insight into the regulatory aspects of sumoylation. J Biol Chem, 2004 Oct 8, 279(41), 43296 - 306 Epub 2004 Jul 29. Structure of the conserved core of the yeast Dot1p, a nucleosomal histone H3 lysine 79 methyltransferase; Sawada K et al.; Methylation of Lys79 on histone H3 by Dot1p is important for gene silencing . The elongated structure of the conserved core of yeast Dot1p contains an N-terminal helical domain and a seven-stranded catalytic domain that harbors the binding site for the methyl-donor and an active site pocket sided with conserved hydrophobic residues . The S-adenosyl-L-homocysteine exhibits an extended conformation distinct from the folded conformation observed in structures of SET domain histone lysine methyltransferases . A catalytic asparagine (Asn479), located at the bottom of the active site pocket, suggests a mechanism similar to that employed for amino methylation in DNA and protein glutamine methylation . The acidic, concave cleft between the two domains contains two basic residue binding pockets that could accommodate the outwardly protruding basic side chains around Lys79 of histone H3 on the disk-like nucleosome surface . Biochemical studies suggest that recombinant Dot1 proteins are active on recombinant nucleosomes, free of any modifications. J Bioinform Comput Biol, 2004 Jan, 1(4), 695 - 709 Development of image processing program for yeast cell morphology; Ohtani M et al.; Every living organism has its own species-specific morphology . Despite the relatively simple ellipsoidal shape of budding yeast cells, the global regulation of yeast morphology remains unclear . In the past, each mutated gene from many mutants with abnormal morphology had to be classified manually . To investigate the morphological characteristics of yeast in detail, we developed a novel image-processing program that extracts quantitative data from microscope images automatically . This program extracts data on cells that are often used by yeast morphology researchers, such as cell size, roundness, bud neck position angle, and bud growth direction, and fits an ellipse to the cell outline . We evaluated the ability of the program to extract quantitative parameters . The results suggest that our image-processing program can play a central objective role in yeast morphology studies. Mol Genet Genomics . 2004 Jul 29; {Epub ahead of print} Complete DNA sequence of the linear mitochondrial genome of the pathogenic yeast Candida parapsilosis; Nosek J et al.; The complete sequence of the mitochondrial DNA of the opportunistic yeast pathogen Candida parapsilosis was determined . The mitochondrial genome is represented by linear DNA molecules terminating with tandem repeats of a 738-bp unit . The number of repeats varies, thus generating a population of linear DNA molecules that are heterogeneous in size . The length of the shortest molecules is 30,922 bp, whereas the longer molecules have expanded terminal tandem arrays (nx738 bp) . The mitochondrial genome is highly compact, with less than 8% of the sequence corresponding to non-coding intergenic spacers . In silico analysis predicted genes encoding fourteen protein subunits of complexes of the respiratory chain and ATP synthase, rRNAs of the large and small subunits of the mitochondrial ribosome, and twenty-four transfer RNAs . These genes are organized into two transcription units . In addition, six intronic ORFs coding for homologues of RNA maturase, reverse transcriptase and DNA endonucleases were identified . In contrast to its overall molecular architecture, the coding sequences of the linear mitochondrial DNA of C . parapsilosis are highly similar to their counterparts in the circular mitochondrial genome of its close relative C . albicans . The complete sequence has implications for both mitochondrial DNA replication and the evolution of linear DNA genomes. Chromosome Res, 2004, 12(6), 521 - 34 Kinetochore and heterochromatin domains of the fission yeast centromere; Pidoux AL et al.; Fission yeast centromeres are composed of two distinctive chromatin domains . The central domain nucleosomes contain the histone H3-like protein CENP-A(Cnp1) . In contrast, the flanking repeats are coated with silent chromatin in which Swi6 (HP1) binds histone H3 methylated on lysine 9 that is induced by the action of the RNA interference pathway on non-coding centromeric transcripts . The overall structure is similar to that of metazoan centromeres where the kinetochore is embedded in surrounding heterochromatin . Kinetochore specific proteins associate with the central domain and affect silencing in that region . The flanking heterochromatin is required to recruit cohesin and mediate tight physical cohesion between sister centromeres . The loss of silencing that accompanies defects in heterochromatin has been invaluable as a tool in the investigation of centromere function . Both the heterochromatin and kinetochore regions are required for the de novo assembly of a functional centromere on DNA constructs, suggesting that heterochromatin may provide an environment that promotes kinetochore assembly within the central domain . The process is clearly epigenetically regulated . Fission yeast kinetochores associate with 2-4 microtubules, and flanking heterochromatin may be required to promote the orientation of multiple microtubule binding sites on one kinetochore towards the same pole and thus prevent merotelic orientation. J Cell Biol, 2004 Aug 2, 166(3), 311 - 6 Yeast cell death during DNA damage arrest is independent of caspase or reactive oxygen species; Wysocki R et al.; CDC13 encodes a telomere-binding protein that prevents degradation of telomeres . cdc13-1 yeast grown at the nonpermissive temperature undergo G2/M arrest, progressive chromosome instability, and subsequent cell death . Recently, it has been suggested that cell death in the cdc13-1 mutant is an active process characterized by phenotypic hallmarks of apoptosis and caspase activation . In this work, we show that cell death triggered by cdc13-1 is independent of the yeast metacaspase Yca1p and reactive oxygen species but related to cell cycle arrest per se . Inactivating YCA1 or depleting reactive oxygen species does not increase viability of cdc13-1 cells . In turn, caspase activation does not precede cell death in the cdc13-1 mutant . Yca1p activity assayed by cell binding of mammalian caspase inhibitors is confounded by artifactual labeling of dead yeast cells, which nonspecifically bind fluorochromes . We speculate that during a prolonged cell cycle arrest, cdc13-1 cells reach a critical size and die by cell lysis. Cancer Res, 2004 Aug 1, 64(15), 5084 - 8 Mutation-selective tumor remission with Ras-targeted, whole yeast-based immunotherapy; Lu Y et al.; Activating mutations in Ras oncoproteins represent attractive targets for cancer immunotherapy, but few vectors capable of generating immune responses required for tumor killing without vector neutralization have been described . Whole recombinant yeast heterologously expressing mammalian mutant Ras proteins were used to immunize mice in a carcinogen-induced lung tumor model . Therapeutic immunization with the whole recombinant yeast caused complete regression of established Ras mutation-bearing lung tumors in a dose-dependent, antigen-specific manner . In combination with the genomic sequencing of tumors in patients, the yeast-based immunotherapeutic approach could be applied to treat Ras mutation-bearing human cancers. Arch Biochem Biophys, 2004 Sep 1, 429(1), 16 - 22 A compensatory double mutation of the alanine-86 to leucine mutant located in the hinge region of the iron-sulfur protein of the yeast cytochrome bc1 complex; Ebert CE et al.; Mutations in the hinge region connecting the membrane anchor to the extra-membranous head-group of the iron-sulfur protein can impede proper assembly and function of the cytochrome bc(1) complex . Mutating the conserved alanines, residues 86, 90, and 92, located in the hinge region resulted in a 30-50% decrease in enzymatic activity without loss of the iron-sulfur protein {J . Bioenerg . Biomembr . 31 (1999) 215} . The lowered enzymatic activity in the A86L mutant was shown to result from steric interference between the side chains of Leu-86 and Leu-89 {Biochemistry 40 (2001) 327} . The compensatory double mutant A86L/L89A restored activity to wild type levels and relieved the steric hindrance; however, the L89A mutant did not assemble properly into the bc(1) complex . Molecular modeling studies of these mutants compared to the wild type have suggested that the hydrophobic residues located in the hinge region are critical to the motion of the head group of the iron-sulfur protein during catalysis. Free Radic Biol Med, 2004 Sep 1, 37(5), 713 - 23 Inhibition of the yeast metal reductase heme protein fre1 by nitric oxide (NO): a model for inhibition of NADPH oxidase by NO; Shinyashiki M et al.; Nitric oxide (NO) has been found to inhibit the actions of the transmembrane metal reductase Fre1 in the yeast Saccharomyces cerevisiae . This membrane-spanning heme protein is homologous to the gp91(PHOX) protein of the NADPH oxidase enzyme complex and is responsible for reducing extracellular oxidized metals (i.e., ferric and cupric ions) before high-affinity uptake . Consistent with its role in metal metabolism, inhibition of Fre1 by NO also inhibited yeast growth in low-iron medium . Inhibition by NO was found to be O(2)-dependent and irreversible . Further examination of the chemistry responsible for activity loss shows that the generation of N(2)O(3) via NO-O(2) chemistry was responsible for the activity loss, possibly via nitrosation of the protein followed by loss of the heme prosthetic group. J Exp Zoolog B Mol Dev Evol, 2004 Jul 15, 302(4), 392 - 411 Molecular evolution in the yeast transcriptional regulation network; Evangelisti AM et al.; We analyze the structure of the yeast transcriptional regulation network, as revealed by chromatin immunoprecipitation experiments, and characterize the molecular evolution of both its transcriptional regulators and their target (regulated) genes . We test the hypothesis that highly connected genes are more important to the function of gene networks . Three lines of evidence-the rate of molecular evolution of network genes, the rate at which network genes undergo gene duplication, and the effects of synthetic null mutation in network genes-provide no strong support for this hypothesis . In addition, we ask how network genes diverge in their transcriptional regulation after duplication . Both loss (subfunctionalization) and gain (neofunctionalization) of transcription factor binding play a role in this divergence, which is often rapid . On the one hand, gene duplicates experience a net loss in the number of transcription factors binding to them, indicating the importance of losing transcription factor binding sites after gene duplication . On the other hand, the number of transcription factors that bind to highly diverged duplicates is significantly greater than would be expected if loss of binding played the only role in the divergence of duplicate genes . Biol Reprod, 2004 Dec, 71(6), 1943 - 7 Epub 2004 Dec. Efficient generation of transgenic mice with intact yeast artificial chromosomes by intracytoplasmic sperm injection; Moreira PN et al.; The production of animals with large transgenes is an increasingly valuable tool in biotechnology and for genetic studies, including the characterization and manipulation of large genes and polygenic traits . In the present study, we describe an intracytoplasmic sperm injection (ICSI) method for the stable incorporation and phenotypic expression of large yeast artificial chromosomes (YAC) constructs of submegabase and megabase magnitude . By coinjecting spermatozoa and YACs into metaphase II oocytes, we were able to produce founders exhibiting germline transmission of an intact and functional transgene of 250 kilobases, carrying the mouse tyrosinase locus, used here as a reporter gene to rescue the albinism of recipient mice . More than 35% transgenesis was obtained for this YAC transgene . When compared with the pronuclear microinjection standard method, the efficiency of the ICSI-mediated YAC transfer system was significantly greater . In summary, we describe, for the first time, stable incorporation in the host genome and correct phenotypic expression of large DNA constructs mediated by ICSI. Biochem Cell Biol, 2004 Aug, 82(4), 413 - 8 Molecular basis of transcriptional silencing in budding yeast; Chen L et al.; Transcriptional silencing is a phenomenon in which the transcription of genes by RNA polymerase II or III is repressed, dependent on the chromosomal location of a gene . Transcriptional silencing normally occurs in highly condensed heterochromatin regions of the genome, suggesting that heterochromatin might repress transcription by restricting the ability of sequence-specific gene activator proteins to access their DNA target sites . However, recent studies show that heterochromatin structure is inherently dynamic, and that sequence-specific regulatory proteins are able to bind to their target sites in heterochromatin . The molecular basis of transcriptional silencing is plainly more complicated than simple steric exclusion . New ideas and experiments are needed. Nucleic Acids Res, 2004 Jul 29, 32(13), 3984 - 94 Print 2004. Role of DNA polymerase eta in the bypass of abasic sites in yeast cells; Zhao B et al.; Abasic (AP) sites are major DNA lesions and are highly mutagenic . AP site-induced mutagenesis largely depends on translesion synthesis . We have examined the role of DNA polymerase eta (Poleta) in translesion synthesis of AP sites by replicating a plasmid containing a site-specific AP site in yeast cells . In wild-type cells, AP site bypass resulted in preferred C insertion (62%) over A insertion (21%), as well as -1 deletion (3%), and complex event (14%) containing multiple mutations . In cells lacking Poleta (rad30), Rev1, Polzeta (rev3), and both Poleta and Polzeta, translesion synthesis was reduced to 30%, 30%, 15% and 3% of the wild-type level, respectively . C insertion opposite the AP site was reduced in rad30 mutant cells and was abolished in cells lacking Rev1 or Polzeta, but significant A insertion was still detected in these mutant cells . While purified yeast Polalpha effectively inserted an A opposite the AP site in vitro, purified yeast Poldelta was much less effective in A insertion opposite the lesion due to its 3'-->5' proofreading exonuclease activity . Purified yeast Poleta performed extension synthesis from the primer 3' A opposite the lesion . These results show that Poleta is involved in translesion synthesis of AP sites in yeast cells, and suggest that an important role of Poleta is to catalyze extension following A insertion opposite the lesion . Consistent with these conclusions, rad30 mutant cells were sensitive to methyl methanesulfonate (MMS), and rev1 rad30 or rev3 rad30 double mutant cells were synergistically more sensitive to MMS than the respective single mutant strains. Prikl Biokhim Mikrobiol, 2004 May-Jun, 40(3), 323 - 31 {Zeta-potential of n-alkane emulsion droplets and its role in substrate transport into yeast cells}; Komarov EV et al.; Zeta-potential of n-alkane droplets, formed by fatty acids, were studied in model systems of culture liquid of yeasts (Candida maltosa) capable of utilizing n-alkanes . The value of zeta-potential was found to depend on the droplet size . The negative zeta-potential of submicron droplets was so high that it prevented the droplets from being coagulated with cells possessing a high negative zeta-potential . The dominant role of submicron n-alkane droplets in the kinetics of yeast growth could be accounted for by the existence of a mechanism regulating contact interactions of individual cells with the droplets followed by uptake of the substrate. Med Mycol, 2004 Jun, 42(3), 287 - 92 Histoplasma capsulatum yeast cells attach and agglutinate human erythrocytes; Taylor ML et al.; The ability of yeast cells of Histoplasma capsulatum to attach and agglutinate human erythrocytes has been described . This is the first report involving these yeasts in the hemagglutination phenomenon . Results revealed that the yeast cells were able to bind to erythrocytes irrespective of blood groups and to agglutinate them when a high density of yeast cells was used . Assays on the inhibition of yeast attachment to erythrocytes were also performed, using sugar-treated yeast cells . Results indicate that galactose (Gal), mainly the beta-anomer, specially inhibited yeast attachment . Disaccharides (Gal-derivatives) and glycosaminoglycans containing Gal residues, mainly chondroitin sulfate C, promote this type of inhibition . In addition, preliminary data of inhibition assays also involved a probable ionic strength driven mechanism mediated by sialic acid and heparan sulfate, suggesting that yeast binding to erythrocytes could be associated with negative charges of both molecules. Mol Cell Biol, 2004 Aug, 24(16), 6931 - 46 Budding yeast silencing complexes and regulation of Sir2 activity by protein-protein interactions; Tanny JC et al.; Gene silencing in the budding yeast Saccharomyces cerevisiae requires the enzymatic activity of the Sir2 protein, a highly conserved NAD-dependent deacetylase . In order to study the activity of native Sir2, we purified and characterized two budding yeast Sir2 complexes: the Sir2/Sir4 complex, which mediates silencing at mating-type loci and at telomeres, and the RENT complex, which mediates silencing at the ribosomal DNA repeats . Analyses of the protein compositions of these complexes confirmed previously described interactions . We show that the assembly of Sir2 into native silencing complexes does not alter its selectivity for acetylated substrates, nor does it allow the deacetylation of nucleosomal histones . The inability of Sir2 complexes to deacetylate nucleosomes suggests that additional factors influence Sir2 activity in vivo . In contrast, Sir2 complexes show significant enhancement in their affinities for acetylated substrates and their sensitivities to the physiological inhibitor nicotinamide relative to recombinant Sir2 . Reconstitution experiments showed that, for the Sir2/Sir4 complex, these differences stem from the physical interaction of Sir2 with Sir4 . Finally, we provide evidence that the different nicotinamide sensitivities of Sir2/Sir4 and RENT in vitro could contribute to locus-specific differences in how Sir2 activity is regulated in vivo. Mol Cell Biol, 2004 Aug, 24(16), 6900 - 6 Efficient and error-free replication past a minor-groove N2-guanine adduct by the sequential action of yeast Rev1 and DNA polymerase zeta; Washington MT et al.; Rev1, a member of the Y family of DNA polymerases, functions in lesion bypass together with DNA polymerase zeta (Pol zeta) . Rev1 is a highly specialized enzyme in that it incorporates only a C opposite template G . While Rev1 plays an indispensable structural role in Pol zeta-dependent lesion bypass, the role of its DNA synthetic activity in lesion bypass has remained unclear . Since interactions of DNA polymerases with the DNA minor groove contribute to the nearly equivalent efficiencies and fidelities of nucleotide incorporation opposite each of the four template bases, here we examine the possibility that unlike other DNA polymerases, Rev1 does not come into close contact with the minor groove of the incipient base pair, and that enables it to incorporate a C opposite the N(2)-adducted guanines in DNA . To test this idea, we examined whether Rev1 could incorporate a C opposite the gamma-hydroxy-1,N(2)-propano-2'deoxyguanosine DNA minor-groove adduct, which is formed from the reaction of acrolein with the N(2) of guanine . Acrolein, an alpha,beta-unsaturated aldehyde, is generated in vivo as the end product of lipid peroxidation and from other oxidation reactions . We show here that Rev1 efficiently incorporates a C opposite this adduct from which Pol zeta subsequently extends, thereby completing the lesion bypass reaction . Based upon these observations, we suggest that an important role of the Rev1 DNA synthetic activity in lesion bypass is to incorporate a C opposite the various N(2)-guanine DNA minor-groove adducts that form in DNA. Biochim Biophys Acta, 2004 Jul 23, 1658(1-2), 148 - 56 Subunit composition of mitochondrial complex I from the yeast Yarrowia lipolytica; Abdrakhmanova A et al.; Here we present a first assessment of the subunit inventory of mitochondrial complex I from the obligate aerobic yeast Yarrowia lipolytica . A total of 37 subunits were identified . In addition to the seven central, nuclear coded, and the seven mitochondrially coded subunits, 23 accessory subunits were found based on 2D electrophoretic and mass spectroscopic analysis in combination with sequence information from the Y . lipolytica genome . Nineteen of the 23 accessory subunits are clearly conserved between Y . lipolytica and mammals . The remaining four accessory subunits include NUWM, which has no apparent homologue in any other organism and is predicted to contain a single transmembrane domain bounded by highly charged extramembraneous domains . This structural organization is shared among a group of 7 subunits in the Y . lipolytica and 14 subunits in the mammalian enzyme . Because only five of these subunits display significant evolutionary conservation, their as yet unknown function is proposed to be structure- rather than sequence-specific . The NUWM subunit could be assigned to a hydrophobic subcomplex obtained by fragmentation and sucrose gradient centrifugation . Its position within the membrane arm was determined by electron microscopic single particle analysis of Y . lipolytica complex I decorated with a NUWM-specific monoclonal antibody. Antonie Van Leeuwenhoek, 2004 Aug, 86(2), 121 - 34 Characterization of the AINV gene and the encoded invertase from the dimorphic yeast Arxula adeninivorans; Boer E et al.; The invertase-encoding of AINV gene Arxula adeninivorans was isolated and characterized . The gene includes a coding sequence of 2700 bp encoding a putative 899 amino acid protein of 101.7 kDa . The identity of the gene was confirmed by a high degree of homology of the derived amino acid sequence to that of alpha-glucosidases from different sources . The gene activity is regulated by carbon source . In media supplemented with sucrose induction of the AINV gene and accumulation of the encoded invertase in the medium was observed . In addition the extracellular enzyme level is influenced by the morphological status of the organism, with mycelia secreting the enzyme in titres higher than those observed in budding yeasts . The enzyme characteristics were analysed from isolates of native strains as well as from those of recombinant strains expressing the AINV gene under control of the strong A . adeninivorans -derived TEF1 promoter . For both proteins a molecular mass of 600 kDa was determined, a pH optimum at pH 4.5 and a temperature optimum at 55 degrees C . The preferred substrates for the enzyme included the ss-D-fructofuranosides sucrose, inulin and raffinose . Only a weak enzyme activity was observed for the alpha-D-glucopyranosides maltotriose, maltose and isomaltose . Thus the invertase primarily is a ss-fructosidase and not an alpha-glucosidase as suggested by the homology to such enzymes. Antonie Van Leeuwenhoek, 2004 Aug, 86(2), 105 - 10 Candida galli sp . nov., a new yeast from poultry; Peter G et al.; Six strains of an unknown yeast species, phenotypically resembling Yarrowia lipolytica and isolated from chicken breast and chicken liver, were studied . The investigation of their small (18S) and large (26S) subunit rDNA revealed a robust genetic difference between these strains and the type strain of Y . lipolytica . A consistent difference in the physiological properties, suitable for separation of the two taxa, was also found . The description of the new anamorphic yeast species, Candida galli is given. J Cell Sci, 2004 Aug 15, 117(Pt 18), 4189 - 97 Epub 2004 Jul 27. Stress response in yeast mRNA export factor: reversible changes in Rat8p localization are caused by ethanol stress but not heat shock; Takemura R et al.; Ethanol stress (10% v/v) causes selective mRNA export in Saccharomyces cerevisiae in a similar manner to heat shock (42 degrees C) . Bulk poly(A)(+) mRNA accumulates in the nucleus, whereas heat shock protein mRNA is exported under such conditions . Here we investigated the effects of stress on mRNA export factors . In cells treated with ethanol stress, the DEAD box protein Rat8p showed a rapid and reversible change in its localization, accumulating in the nucleus . This change correlated closely with the blocking of bulk poly(A)(+) mRNA export caused by ethanol stress . We also found that the nuclear accumulation of Rat8p is caused by a defect in the Xpo1p/Crm1p exportin . Intriguingly, the localization of Rat8p did not change in heat shocked cells, suggesting that the mechanisms blocking bulk poly(A)(+) mRNA export differ for heat shock and ethanol stress . These results suggest that changes in the localization of Rat8p contribute to the selective export of mRNA in ethanol stressed cells, and also indicate differences in mRNA export between the heat shock response and ethanol stress response. Int J Syst Evol Microbiol, 2004 Jul, 54(Pt 4), 1409 - 14 Candida asparagi sp . nov., Candida diospyri sp . nov . and Candida qinlingensis sp . nov., novel anamorphic, ascomycetous yeast species; Lu HZ et al.; Among ascomycetous yeasts that were isolated from several nature reserve areas in China, three anamorphic strains isolated from soil (QL 5-5T) and fruit (QL 21-2T and SN 15-1T) were revealed, by conventional characterization and molecular phylogenetic analysis based on internal transcribed spacer and large subunit (26S) rRNA gene D1/D2 region sequencing, to represent three novel species in the genus Candida . Candida qinlingensis sp . nov . (type strain, QL 5-5T=AS 2.2524T=CBS 9768T) was related closely to a teleomorphic species, Williopsis pratensis . The close relatives of Candida diospyri sp . nov . (type strain, QL 21-2T=AS 2.2525T=CBS 9769T) are Candida friedrichii and Candida membranifaciens . Candida asparagi sp . nov . (type strain, SN 15-1T=AS 2.2526T=CBS 9770T) forms a clade with Candida fructus. DNA Repair (Amst), 2004 Aug-Sep, 3(8-9), 797 - 815 DSB repair: the yeast paradigm; Aylon Y et al.; Genome stability is of primary importance for the survival and proper functioning of all organisms . Double-strand breaks (DSBs) arise spontaneously during growth, or can be created by external insults . In response to even a single DSB, organisms must trigger a series of events to promote repair of the DNA damage in order to survive and restore chromosomal integrity . In doing so, cells must regulate a fine balance between potentially competing DSB repair pathways . These are generally classified as either homologous recombination (HR) or non-homologous end joining (NHEJ) . The yeast Saccharomyces cerevisiae is an ideal model organism for studying these repair processes . Indeed, much of what we know today on the mechanisms of repair in eukaryotes come from studies carried out in budding yeast . Many of the proteins involved in the various repair pathways have been isolated and the details of their mode of action are currently being unraveled at the molecular level . In this review, we focus on exciting new work eminating from yeast research that provides fresh insights into the DSB repair process . This recent work supplements and complements the wealth of classical genetic research that has been performed in yeast systems over the years . Given the conservation of the repair mechanisms and genes throughout evolution, these studies have profound implications for other eukaryotic organisms. Biosci Biotechnol Biochem, 2004 Jul, 68(7), 1525 - 32 Metabolism of benzoquinone by yeast cells and oxidative characteristics of corresponding hydroquinone: application to highly sensitive measurement of yeast cell density by using benzoquinone and a chemiluminescent probe; Tsukatani T et al.; The metabolic efficiency of seven derivatives of 1,4-benzoquinone (BQ) by yeast cells and the oxidative characteristics of the corresponding hydroquinones (HQs) were studied by electrochemical, spectrophotometric and chemiluminescent methods . The spectrophotometric method was based on the reduction of a tetrazolium salt to formazan dye during the autoxidation of HQs generated by yeast cells under alkaline conditions . The amounts of HQs detected directly by the electrochemical method did not agree with those calculated from the formazan dye obtained by the spectrophotometric method . A tetrazolium salt was reduced to a formazan dye by both the superoxide anion radical (O2-*) generated during the autoxidation of 2,3,5,6-tetramethyl-1,4-HQ and by HQ itself . Little formazan dye was formed, and hydrogen peroxide (H2O2) was then finally produced during the autoxidation of 1,4-HQ or 2-methyl-1,4-HQ . Formazan dye and H2O2 were generated at a certain ratio during the autoxidation of derivatives of dimethyl-1,4-HQ or 2,3,5-trimethyl-1,4-HQ . The analytical method based on chemiluminescence with lucigenin and 2,3,5,6-tetramethyl-1,4-BQ was applied to highly sensitive measurement of the yeast cell density . A linear relationship between the chemiluminescence intensity and viable cell density was obtained in the range of 1.2 x 10(3) - 4.8 x 10(4) cells/ml . The detection limit was 4.8 x 10(2) cells/ml. J Mol Biol, 2004 Aug 6, 341(2), 375 - 88 A conserved element in the yeast RNase MRP RNA subunit can participate in a long-range base-pairing interaction; Walker SC et al.; RNase MRP is a ribonucleoprotein endoribonuclease involved in eukaryotic pre-rRNA processing . The enzyme possesses a putatively catalytic RNA subunit, structurally related to that of RNase P . A thorough structure analysis of Saccharomyces cerevisiae MRP RNA, entailing enzymatic and chemical probing, mutagenesis and thermal melting, identifies a previously unrecognised stem that occupies a position equivalent to the P7 stem of RNase P . Inclusion of this P7-like stem confers on yeast MRP RNA a greater degree of similarity to the core RNase P RNA structure than that described previously and better delimits domain 2, the proposed specificity domain . The additional stem is created by participation of a conserved sequence element (ymCR-II) in a long-range base-pairing interaction . There is potential for this base-pairing throughout the known yeast MRP RNA sequences . Formation of a P7-like stem is not required, however, for the pre-rRNA processing or essential function of RNase MRP . Mutants that can base-pair are nonetheless detrimental to RNase MRP function, indicating that the stem will form in vivo but that only the wild-type pairing is accommodated . Although the alternative MRP RNA structure described is clearly not part of the active RNase MRP enzyme, it would be the more stable structure in the absence of protein subunits and the probability that it represents a valid intermediate species in the process of yeast RNase MRP assembly is discussed. J Steroid Biochem Mol Biol, 2004 Jul, 91(3), 99 - 109 Rapid yeast estrogen bioassays stably expressing human estrogen receptors alpha and beta, and green fluorescent protein: a comparison of different compounds with both receptor types; Bovee TF et al.; Previously, we described the construction of a rapid yeast bioassay stably expressing human estrogen receptor (hERalpha) and yeast enhanced green fluorescent protein (yEGFP) in response to estrogens . In the present study, the properties of this assay were further studied by testing a series of estrogenic compounds . Furthermore, a similar assay was developed based on the stable expression of human estrogen receptor beta (hERbeta) . When exposed to 17beta-estradiol, the maximum transcriptional activity of the ERbeta cytosensor was only about 40% of the activity observed with ERalpha, but the concentration where half-maximal activation is reached (EC50), was about five times lower . The relative estrogenic potencies (REP), defined as the ratio between the EC50 of 17beta-estradiol and the EC50 of the compound, of the synthetic hormones dienestrol, hexestrol and especially mestranol were higher with ER, while DES was slightly more potent with ERbeta . The gestagens progesterone and medroxyprogesterone-acetate showed no response, whereas the androgen testosterone showed a very weak response . The anabolic agent, 19-nortestosterone showed a clear dose-related response with estrogen receptor but not beta . The phytoestrogens coumestrol, genistein, genistin, daidzein, daidzin and naringenin were relatively more potent with ERbeta . Ranking of the estrogenic potency with ER was: 17beta-estradiol >> 8-prenylnaringenin > coumestrol > zearalenone >> genistein >> genistin > naringenin . The ranking with the ERbeta was: 17beta-estradiol >> coumestrol > genistein > zearalenone > 8-prenylnaringen >> daidzein > naringenin > genistin >> daidzin . The hop estrogen 8-prenylnaringenin is relatively more potent with ERalpha . These data show that the newly developed bioassays are valuable tools for the rapid and high-throughput screening for estrogenic activity . Gene, 2004 Aug 4, 337, 113 - 9 A genetic, non-transcriptional assay for nuclear receptor ligand binding in yeast; Kohler F et al.; We describe the development of a genetic, non-transcriptional assay for the detection of ligand binding to nuclear receptors based on the ligand-dependent reconstitution of the defective Ras/cAMP viability pathway of the Saccharomyces cerevisiae strain CDC25-2 . We have characterized the assay using the estrogen receptor (ER) alpha as an example and found it to be extremely sensitive, stringent, rapid and selective . We applied this assay to different ligands and ligand-binding domains (LBDs) and analyzed co-stimulation with 17beta-estradiol (E2) and the synthetic ligand 4-hydroxytamoxifen (4-OHT) in vivo . This simple and inexpensive assay may be useful for the study of steroid hormone receptor (SHR) actions at the plasma membrane and for the analysis of ligand binding in vivo . Furthermore, it may allow for the selection of novel ligands and ligand-binding domains and has significant potential for application in compound screening. Fungal Genet Biol, 2004 Jul, 41(7), 708 - 20 Penicillium chrysogenum Pex5p mediates differential sorting of PTS1 proteins to microbodies of the methylotrophic yeast Hansenula polymorpha; Kiel JA et al.; We have isolated the Penicillium chrysogenum pex5 gene encoding the receptor for microbody matrix proteins containing a type 1 peroxisomal targeting signal (PTS1) . Pc-pex5 contains 2 introns and encodes a protein of approximately 75 kDa . P . chrysogenum pex5 disruptants appear to be highly unstable, show poor growth, and are unable to sporulate asexually . Furthermore, pex5 cells mislocalize a fluorescent PTS1 reporter protein to the cytosol . Pc-pex5 was expressed in a PEX5 null mutant of the yeast Hansenula polymorpha . Detailed analysis demonstrated that the PTS1 proteins dihydroxyacetone synthase and catalase were almost fully imported into microbodies . Surprisingly, alcohol oxidase, which also depends on Pex5p for import into microbodies, remained mainly in the cytosol . Thus, P . chrysogenum Pex5p has a different specificity of cargo recognition than its H . polymorpha counterpart . This was also suggested by the observation that Pc-Pex5p sorted a reporter protein fused to various functional PTS1 signals with different efficiencies. BMC Biochem . 2004 Jul 26;5(1):11. Characterization of yeast histone H3-specific type B histone acetyltransferases identifies an ADA2-independent Gcn5p activity; Sklenar AR et al.; BACKGROUND: The acetylation of the core histone NH2-terminal tails is catalyzed by histone acetyltransferases . Histone acetyltransferases can be classified into two distinct groups (type A and B) on the basis of cellular localization and substrate specificity . Type B histone acetyltransferases, originally defined as cytoplasmic enzymes that acetylate free histones, have been proposed to play a role in the assembly of chromatin through the acetylation of newly synthesized histones H3 and H4 . To date, the only type B histone acetyltransferase activities identified are specific for histone H4 . RESULTS: To better understand the role of histone acetylation in the assembly of chromatin structure, we have identified additional type B histone acetyltransferase activities specific for histone H3 . One such activity, termed HatB3.1, acetylated histone H3 with a strong preference for free histones relative to chromatin substrates . Deletion of the GCN5 and ADA3 genes resulted in the loss of HatB3.1 activity while deletion of ADA2 had no effect . In addition, Gcn5p and Ada3p co-fractionated with partially purified HatB3.1 activity while Ada2p did not . CONCLUSIONS: Yeast extracts contain several histone acetyltransferase activities that show a strong preference for free histone H3 . One such activity, termed HatB3.1, appears to be a novel Gcn5p-containing complex which does not depend on the presence of Ada2p. RNA, 2004 Sep, 10(9), 1352 - 8 Epub 2004 Jul 23. The yeast Apq12 protein affects nucleocytoplasmic mRNA transport; Baker KE et al.; An important step in mRNA biogenesis is the export of mRNA from the nucleus to the cytoplasm . In this work, we provide evidence that the previously uncharacterized gene APQ12 functions in nucleocytoplasmic mRNA transport in Saccharomyces cerevisiae . First, apq12delta strains manifest 3' hyperadenylated mRNA similar to other previously characterized RNA export mutants . Second, bulk poly(A)+ RNA is retained in the nucleus in apq12delta cells . Third, an Apq12p-GFP chimeric protein is localized to the nuclear periphery . Fourth, mRNA in apq12delta cells is stabilized, consistent with a defect in the rate of nuclear export . Interestingly, apq12delta mutants are severely compromised for growth and display atypical cell morphology . Because this aberrant cell morphology is not seen with other viable export mutants, Apq12p must have either an additional cellular function, or preferentially impinge on the export of mRNAs regulating cell growth . Together, these findings support a role for APQ12 in nucleocytoplasmic transport of mRNA. Genetika, 2004 May, 40(5), 592 - 8 {Isolation and primary identification of methylotrophic yeast Hansenula polymorpha mutants for peroxisome biogenesis}; New tertiary constraints between the RNA components of active yeast spliceosomes: a photo-crosslinking study; Division of Biology 147-75, California Institute of Technology, Pasedena 91125, USA . danieleryan@earthlink.net Elucidation of the three-dimensional (3D) structures of the two sequential active sites in spliceosomes is essential for understanding the mechanism of premessenger RNA splicing . The mechanism is predicted to be catalyzed by the small nuclear RNA (snRNA) components of spliceosomes . To obtain new tertiary constraints between the RNA components, we produced and mapped crosslinks between U6 snRNA and the proximal RNAs of active yeast spliceosomes ("yeast" in this report is Saccharomyces cerevisiae) . Thus, specific sites in U6, when substituted with a photoreactive 4-thiouridine or 5-iodouridine, produced spliceosome-dependent crosslinks to U2 snRNA, or in one case, to the pre-mRNA substrate . One set of U2-U6 crosslinks formed before the Prp2p-dependent step of spliceosome assembly, whereas another set formed during or after this step but before the first chemical step of splicing . This latter set of crosslinks formed across U2-U6 helix I . Importantly, this set provides new tertiary constraints for developing 3D models of fully assembled yeast spliceosomes, which are poised for the first chemical step of splicing. Infect Immun, 2004 Aug, 72(8), 4628 - 36 Pneumocystis carinii cell wall biosynthesis kinase gene CBK1 is an environmentally responsive gene that complements cell wall defects of cbk-deficient yeast; Kottom TJ et al.; Pneumocystis species remain an important cause of life-threatening pneumonia in immunocompromised hosts, including those with AIDS . Responses of the organism to environmental cues both within the lung and elsewhere have been poorly defined . Herein, we report the identification of a cell wall biosynthesis kinase gene (CBK1) homologue in Pneumocystis carinii, isolated by differential display PCR, that is expressed optimally at physiological pH (7 to 8) as opposed to more acidic environments . Expression of Pneumocystis CBK1 was also induced by contact with lung epithelial cells and extracellular matrix . Translation of this gene revealed extensive homology to other fungal CBK1 kinases . Pneumocystis CBK1 expression was equal in the cyst and trophic life forms of the organisms . We further demonstrate that Pneumocystis CBK1 expressed in cbk1 Delta Saccharomyces cerevisiae cells restored defective cell wall separation during proliferation . Consistent with this, Pneumocystis CBK1 expression also stimulated transcription of the CTS1 chitinase in cbk1 Delta mutant yeast cells, an event necessary for cell wall separation . In addition, Pneumocystis CBK1 cDNA supported normal mating projection formation in response to alpha-factor in the cbk1 Delta yeast cells . Site-directed mutations of serine-303 and threonine-494, potential regulatory phosphorylation sites in Pneumocystis CBK1, abolished mating projection formation, indicating a role for these amino acid residues in CBK1 activity . These findings indicate that Pneumocystis CBK1 is an environmentally responsive gene that may function in signaling pathways necessary for cell growth and mating. J Inorg Biochem, 2004 Aug, 98(8), 1307 - 14 N-benzoyl-N'-alkylthioureas and their complexes with Ni(II), Co(III) and Pt(II) - crystal structure of 3-benzoyl-1-butyl-1-methyl-thiourea: activity against fungi and yeast; del Campo R et al.; The thiourea derivatives of N-butylmethylamine (3-benzoyl-1-butyl-1-methyl-thiourea) (1), N-ethylisopropylamine (3-benzoyl-1-ethyl-1-isopropyl-thiourea) (2) and the corresponding complexes of 1 and 2 with Ni(II), Co(III) and Pt(II) have been synthesized . The compounds obtained were characterized by elemental analysis, spectroscopic methods (FT-IR, UV-Vis and NMR) and mass spectrometry . Compound 1, crystallized in the triclinic space group . The antifungal activities of compounds 1 and 2 and their corresponding complexes against the fungus Penicillium digitatum and against the yeast Saccharomyces cerevisiae were investigated . In general, fungal growth inhibition was higher with compound 1 and its complexes than with compound 2, except for the Co(III) complex of 2. Biochem J, 2004 Aug 1, 381(Pt 3), 941 - 9 Identification and biophysical characterization of a very-long-chain-fatty-acid-substituted phosphatidylinositol in yeast subcellular membranes; Schneiter R et al.; Morphological analysis of a conditional yeast mutant in acetyl-CoA carboxylase acc1ts/mtr7, the rate-limiting enzyme of fatty acid synthesis, suggested that the synthesis of C26 VLCFAs (very-long-chain fatty acids) is important for maintaining the structure and function of the nuclear membrane . To characterize this C26-dependent pathway in more detail, we have now examined cells that are blocked in pathways that require C26 . In yeast, ceramide synthesis and remodelling of GPI (glycosylphosphatidylinositol)-anchors are two pathways that incorporate C26 into lipids . Conditional mutants blocked in either ceramide synthesis or the synthesis of GPI anchors do not display the characteristic alterations of the nuclear envelope observed in acc1ts, indicating that the synthesis of another C26-containing lipid may be affected in acc1ts mutant cells . Lipid analysis of isolated nuclear membranes revealed the presence of a novel C26-substituted PI (phosphatidylinositol) . This C26-PI accounts for approx . 1% of all the PI species, and is present in both the nuclear and the plasma membrane . Remarkably, this C26-PI is the only C26-containing glycerophospholipid that is detectable in wild-type yeast, and the C26-substitution is highly specific for the sn-1 position of the glycerol backbone . To characterize the biophysical properties of this lipid, it was chemically synthesized . In contrast to PIs with normal long-chain fatty acids (C16 or C18), the C26-PI greatly reduced the bilayer to hexagonal phase transition of liposomes composed of 1,2-dielaidoyl-sn-glycero-3-phosphoethanolamine (DEPE) . The biophysical properties of this lipid are thus consistent with a possible role in stabilizing highly curved membrane domains. J Cell Sci, 2004 Aug 1, 117(Pt 17), 3839 - 53 Epub 2004 Jul 20. The yeast dynamin-related GTPase Vps1p functions in the organization of the actin cytoskeleton via interaction with Sla1p; Yu X et al.; Recent studies have suggested that the function of the large GTPase dynamin in endocytosis in mammalian cells may comprise a modulation of actin cytoskeleton . The role of dynamin in actin cytoskeleton organization in the yeast Saccharomyces cerevisiae has remained undefined . In this report, we found that one of the yeast dynamin-related proteins, Vps1p, is required for normal actin cytoskeleton organization . At both permissive and non-permissive temperatures, the vps1 mutants exhibited various degrees of phenotypes commonly associated with actin cytoskeleton defects: depolarized and aggregated actin structures, hypersensitivity to the actin cytoskeleton toxin latrunculin-A, randomized bud site selection and chitin deposition, and impaired efficiency in the internalization of membrane receptors . Over-expression of the GTPase mutants of vps1 also led to actin abnormalities . Consistent with these actin-related defects, Vps1p was found to interact physically, and partially co-localize, with the actin-regulatory protein Sla1p . The normal cellular localization of Sla1p required Vps1p and could be altered by over-expression of a region of Vps1p that was involved in the interaction with Sla1p . The same region also promoted mis-sorting of the vacuolar protein carboxypeptidase Y upon over-expression . These findings suggest that the functions of the dynamin-related protein Vps1p in actin cytoskeleton dynamics and vacuolar protein sorting are probably related to each other. Mass Spectrom Rev, 2004 Sep-Oct, 23(5), 350 - 67 Studying the interactome with the yeast two-hybrid system and mass spectrometry; Causier B; Protein interactions are crucial to the life of a cell . The analysis of such interactions is allowing biologists to determine the function of uncharacterized proteins and the genes that encode them . The yeast two-hybrid system has become one of the most popular and powerful tools to study protein-protein interactions . With the advent of proteomics, the two-hybrid system has found a niche in interactome mapping . However, it is clear that only by combining two-hybrid data with that from complementary approaches such as mass spectrometry (MS) can the interactome be analyzed in full . This review introduces the yeast two-hybrid system to those unfamiliar with the technique, and discusses how it can be used in combination with MS to unravel the network of protein interactions that occur in a cell. Mol Cell Proteomics, 2004 Nov, 3(11), 1053 - 64 Epub 2004 Nov. The phox homology (PX) domain protein interaction network in yeast; Vollert CS et al.; The phox homology (PX) domain is a phosphoinositide-binding domain that is conserved from yeast to human . Here we show for the first time by genome-wide two-hybrid screens and in vitro binding assays that the PX domain is a bona fide protein interaction domain . The yeast PX domain-only proteins Grd19p (YOR357C) and Ypt35p (YHR105W), as well as the isolated PX domains from Mvp1p (YMR004W), Snx42p/Cvt20p/Atg20p (YDL113C), Vam7p (YGL212W), and Vps17p (YOR132W), yielded a total of 40 reproducible two-hybrid interactions . Thirty-five interactions were found for the full-length proteins of Bem1p (YBR200W), Snx42p, Snx4p/Cvt13p (YJL036W), Vam7p, Vps5p (YOR069W), and Vps17p, but these appear not to require the PX domain, because these interactions could not be reproduced with PX-only baits . Interactions of Grd19p, Vam7p, Vps5p, Vps17p, and Ypt35p with members of the Yip1p family of proteins were detected consistently and were verified by in vitro binding assays . The N-terminal cytoplasmic domain of Yip1p and Yif1p mediates these interactions with PX domains . A mutation in the lipid-binding pocket of Ypt35p that reduces lipid binding markedly does not affect these PX domain protein interactions, arguing that lipid binding uses a different interaction surface than protein binding. J Biol Chem, 2004 Sep 24, 279(39), 40392 - 9 Epub 2004 Jul 15. The modulation in subunits e and g amounts of yeast ATP synthase modifies mitochondrial cristae morphology; Arselin G et al.; Subunits e and g of Saccharomyces cerevisiae ATP synthase are required to maintain ATP synthase dimeric forms . Mutants devoid of these subunits display anomalous mitochondrial morphologies . An expression system regulated by doxycycline was used to modulate the expression of the genes encoding the subunits e and g . A decrease in the amount of subunit e induces a decrease in the amount of subunit g, but a decrease in the amount of subunit g does not affect subunit e . The loss of subunit e or g leads to the loss of supramolecular structures of ATP synthase, which is fully reversible upon removal of doxycycline . In the absence of doxycycline, mitochondria present poorly defined cristae . In the presence of doxycycline, onion-like structures are formed after five generations . When doxycycline is removed after five generations, cristae are mainly observed . The data demonstrate that the inner structure of mitochondria depends upon the ability of ATP synthase to make supramolecular structures . Bioinformatics, 2004 Aug 4, 20 Suppl 1, I55 - I62 Analysis of domain correlations in yeast protein complexes; Betel D et al.; MOTIVATION: A growing body of research has concentrated on the identification and definition of conserved sequence motifs . It is widely recognized that these conserved sequence and structural units often mediate protein functions and interactions . The continuing advancements in high-throughput experiments necessitate the development of computational methods to critically assess the results . In this work, we analyzed high-throughput protein complexes using the domain composition of their protein constituents . Domains that mediate similar or related functions may consistently co-occur in protein complexes . RESULTS: We analyzed Saccharomyces cerevisiae protein complexes from curated and high-throughput experimental datasets to identify statistically significant functional associations between domains . The resulting correlations are represented as domain networks that form the basis of comparison between the datasets, as well as to binary protein interactions . The results show that the curated datasets produce domain networks that map to known biological assemblies, such as ribosome, RNA polymerase, proteasome regulators, transcription initiation and histones . Furthermore, many of these domain correlations were also found in binary protein interactions . In contrast, the high-throughput datasets contain one large network of domain associations . High connectivity of RNA processing and binding domains in the high-throughput datasets reflects the abundance of RNA binding proteins in yeast, in agreement with a previous report that identified a nucleolar protein cluster, possibly mediated by rRNA, from these complexes . AVAILABILITY: The software is available upon request from the authors and is dependent on the NCBI C++ toolkit. Curr Opin Cell Biol, 2004 Aug, 16(4), 350 - 5 Differential ER exit in yeast and mammalian cells; Watanabe R et al.; The coat complex COPII forms vesicles at the endoplasmic reticulum to transport a variety of cargo proteins to the Golgi structure . Recent biochemical and structural studies reveal the molecular mechanism of cargo protein recognition by COPII components . Furthermore, there are at least two distinct ER-to-Golgi transport carrier structures carrying different cargo proteins in yeast and mammalian cells, suggesting several distinct mechanisms for the concentration, selection and exit of cargo proteins from the ER . It will be essential to follow the dynamics of transitional ER sites and cargo protein concentration within the ER in order to understand how these transport processes occur in living cells. J Immunol Methods, 2004 Jul, 290(1-2), 69 - 80 Yeast display of antibody fragments: a discovery and characterization platform; Feldhaus MJ et al.; Yeast display of antibody fragments has proven to be an efficient and productive means for directed evolution of single-chain Fv (scFv) antibodies for increased affinity and thermal stability and, more recently, for the display and screening of a non-immune scFv and immune Fab libraries . A major strength of yeast display as a novel antibody discovery platform is the ability to characterize the binding properties, i.e., the affinity and epitope binding characteristics, of a clone without the need for subcloning, expression and purification of the scFv . This review focuses on novel attributes of yeast display for antibody engineering endeavors. Biol Trace Elem Res, 2004 Jul, 100(1), 87 - 94 Validation of method for total selenium determination in yeast by flame atomic absorption spectrometry; Connolly CD et al.; A procedure using open digestion followed by flame atomic absorption spectrometry is described for measuring the total selenium content of Se-enriched yeast . The limits of detection and quantitation were 2.5 mg/L and 5 mg/L Se, respectively . The signal response was linear over the range of 5-50 mg/L Se, and the average recovery from spiked samples was 98.9% . The validated method was used to measure the Se content of Se-enriched yeast reference material and produced a result of 2145 +/- 38 mg/kg (n = 3), which is in good agreement with the certified level of 2125 +/- 65 mg/kg. J Biol Chem, 2004 Sep 24, 279(39), 40314 - 9 Epub 2004 Jul 16. The yeast phospholipid N-methyltransferases catalyzing the synthesis of phosphatidylcholine preferentially convert di-C16:1 substrates both in vivo and in vitro; Boumann HA et al.; Phosphatidylcholine (PC) is an important and abundant structural component of the membranes of eukaryotic cells . In the yeast Saccharomyces cerevisiae, the primary route for the biosynthesis of PC consists of three consecutive methylation steps of phosphatidylethanolamine (PE) catalyzed by the phospholipid N-methyltransferases Cho2p and Opi3p . To investigate how these biosynthetic enzymes contribute to the composition of the PC species profile, the precursor-product relationships between PE and newly synthesized PC were determined at the level of the molecular species by using electrospray ionization tandem mass spectrometry and stable isotope labeling . In vivo labeling of yeast cells for 10 min with {methyl-D3}methionine revealed the preferential methylation of di-C16:1 PE over a range of PE species compositions . A similar preferential conversion of di-C16:1 PE to PC was found in vitro upon incubating isolated microsomes with S-adenosyl{methyl-D3}methionine . Yeast opi3 and cho2 deletion strains were used to distinguish between the substrate selectivities of Cho2p and Opi3p, respectively . Both biosynthetic enzymes were found to participate in the speciesselective methylation with Cho2p contributing the most . The combined results indicate that the selective methylation of PE species by the methyltransferases plays an important role in shaping the steady-state profile of PC molecular species in yeast . Biochem J, 2004 Oct 15, 383(Pt 2), 383 - 91 Requirement of different mitochondrial targeting sequences of the yeast mitochondrial transcription factor Mtf1p when synthesized in alternative translation systems; Biswas TK et al.; Mitochondrial (mt) translocation of the nuclearly encoded mt transcription factor Mtf1p appears to occur independent of a cleavable presequence, mt receptor, mt membrane potential or ATP {Biswas and Getz (2002) J . Biol . Chem . 277, 45704-45714} . To understand further the import strategy of Mtf1p, we investigated the import of the wild-type and N-terminal-truncated Mtf1p mutants synthesized in two different in vitro translation systems . These Mtf1p derivatives were generated either in the RRL (rabbit reticulocyte lysate) or in the WGE (wheat germ extract) translation system . Under the in vitro import conditions, the RRL-synthesized full-length Mtf1p but not the N-terminal-truncated Mtf1p product was efficiently imported into mitochondria, suggesting that the N-terminal sequence is important for its import . On the other hand, when these Mtf1p products were generated in the WGE system, surprisingly, the N-terminal-truncated products, but not the full-length protein, were effectively translocated into mitochondria . Despite these differences between the translation systems, in both cases, import occurs at a low temperature and has no requirement for a trypsin-sensitive mt receptor, mt membrane potential or ATP hydrolysis . Together, these observations suggest that, in the presence of certain cytoplasmic factors (derived from either RRL or WGE), Mtf1p is capable of using alternative import signals present in different regions of the protein . This appears to be the first example of usage of different targeting sequences for the transport of a single mt protein into the mt matrix. Microbiology, 2004 Jul, 150(Pt 7), 2185 - 95 Identification and characterization of two alpha-1,6-mannosyltransferases, Anl1p and Och1p, in the yeast Yarrowia lipolytica; Barnay-Verdier S et al.; In this study, the identification and characterization of the Yarrowia lipolytica homologues of Saccharomyces cerevisiae alpha-1,6-mannosyltransferases Anp1p and Och1p, designated YlAnl1p and YlOch1p, are described . In order to confirm the function of the Y . lipolytica proteins, including the previously isolated YlMnn9p, in the N-glycosylation pathway, a phenotypic analysis of the disrupted strains Delta Ylmnn9, Delta Ylanl1, Delta Yloch1, Delta Ylanl1 Delta Ylmnn9 and Delta Ylmnn9 Delta Yloch1 was performed . Disruption of the YlMNN9, YlANL1 and YlOCH1 genes caused an increased sensitivity to SDS, compatible with a glycosylation defect, and to Calcofluor White, characteristic of cell-wall defects . Moreover, Western-blot analysis of a heterologous glycosylated protein confirmed a direct role of YlMnn9p and YlAnl1p in the N-glycosylation process . These mutant strains, Delta Ylmnn9, Delta Ylanl1, Delta Yloch1, Delta Ylanl1 Delta Ylmnn9 and Delta Ylmnn9 Delta Yloch1 may thus be used to establish a model for the Y . lipolytica N-linked glycosylation pathway. Genes Dev, 2004 Jul 15, 18(14), 1695 - 708 A signaling mucin at the head of the Cdc42- and MAPK-dependent filamentous growth pathway in yeast; Cullen PJ et al.; Signaling molecules such as Cdc42 and mitogen-activated protein kinases (MAPKs) can function in multiple pathways in the same cell . Here, we propose one mechanism by which such factors may be directed to function in a particular pathway such that a specific response is elicited . Using genomic approaches, we identify a new component of the Cdc42- and MAPK-dependent signaling pathway that regulates filamentous growth (FG) in yeast . This factor, called Msb2, is a FG-pathway-specific factor that promotes differential activation of the MAPK for the FG pathway, Kss1 . Msb2 is localized to polarized sites on the cell surface and interacts with Cdc42 and with the osmosensor for the high osmolarity glycerol response (HOG) pathway, Sho1 . Msb2 is glycosylated and is a member of the mucin family, proteins that in mammalian cells promote disease resistance and contribute to metastasis in cancer cells . Remarkably, loss of the mucin domain of Msb2 causes hyperactivity of the FG pathway, demonstrating an inhibitory role for mucin domains in MAPK pathway activation . Taken together, our data suggest that Msb2 is a signaling mucin that interacts with general components, such as Cdc42 and Sho1, to promote their function in the FG pathway . Mol Microbiol, 2004 Aug, 53(3), 953 - 68 The bromodomain-containing protein Bdf1p acts as a phenotypic and transcriptional multicopy suppressor of YAF9 deletion in yeast; Bianchi MM et al.; It was observed previously that the deletion of the open reading frame YNL107w (YAF9) was highly pleiotropic in yeast and caused defective growth phenotypes in the presence of several unrelated inhibitors, including caesium chloride . We have selected multicopy extragenic suppressor genes, revealing that this phenotype can be suppressed by overdosing the transcription factors BDF1 and GAT1 in the yaf9Delta strain . We focused our analysis on suppression by BDF1 and performed a genome-wide transcript analysis on a yaf9Delta strain, compared with the wild-type and BDF1-suppressed strains . YAF9 deletion has a clear effect on transcription and leads to modulation of the level of expression of several genes . Transcription of a considerable portion of the underexpressed genes is restored to wild-type levels in the BDF1-suppressed strain . We show by chromatin immunoprecipitation that both Yaf9p and Bdf1p bind to promoters of some of these genes and that the level of H3 and H4 acetylation at one of these promoters is significantly lowered in the yaf9 deleted strain, compared with the wild-type and the BDF1-suppressed strains . J Virol, 2004 Aug, 78(15), 8254 - 63 Purification of the cucumber necrosis virus replicase from yeast cells: role of coexpressed viral RNA in stimulation of replicase activity; Panaviene Z et al.; Purified recombinant viral replicases are useful for studying the mechanism of viral RNA replication in vitro . In this work, we obtained a highly active template-dependent replicase complex for Cucumber necrosis tombusvirus (CNV), which is a plus-stranded RNA virus, from Saccharomyces cerevisiae . The recombinant CNV replicase showed properties similar to those of the plant-derived CNV replicase (P . D . Nagy and J . Pogany, Virology 276:279-288, 2000), including the ability (i) . to initiate cRNA synthesis de novo on both plus- and minus-stranded templates, (ii) . to generate replicase products that are shorter than full length by internal initiation, and (iii) . to perform primer extension from the 3' end of the template . We also found that isolation of functional replicase required the coexpression of the CNV p92 RNA-dependent RNA polymerase and the auxiliary p33 protein in yeast . Moreover, coexpression of a viral RNA template with the replicase proteins in yeast increased the activity of the purified CNV replicase by 40-fold, suggesting that the viral RNA might promote the assembly of the replicase complex and/or that the RNA increases the stability of the replicase . In summary, this paper reports the first purified recombinant tombusvirus replicase showing high activity and template dependence, a finding that will greatly facilitate future studies on RNA replication in vitro. J Biol Chem, 2004 Sep 17, 279(38), 39396 - 400 Epub 2004 Jul 14. Cargo sequences are important for Som1p-dependent signal peptide cleavage in yeast mitochondria; Liang H et al.; The inner membrane protease (IMP) has two catalytic subunits, Imp1p and Imp2p, that exhibit nonoverlapping substrate specificity in mitochondria of the yeast Saccharomyces cerevisiae . The IMP also has at least one noncatalytic subunit, Som1p, which is required to cleave signal peptides from a subset of Imp1p substrates . To understand how Som1p mediates Imp1p substrate specificity, we addressed the possibility that Som1p functions as a molecular chaperone, which binds to specific substrates and directs them to the catalytic site . Our results show that cargo sequences attached to the signal peptide are important for Som1p-dependent presequence cleavage; however, no specific cargo sequence is required . Indeed, we show that a substrate normally destined for Imp2p is cleaved in a Som1p-dependent manner when the substrate is directed to Imp1p . These results argue against the notion that Som1p is a molecular chaperone . Instead, we propose that the cargo of some Imp1p substrates can assume a conformation incompatible with presequence cleavage . Som1p could thus act through Imp1p to improve cleavage efficiency early during substrate maturation. Chromosome Res, 2004, 12(5), 427 - 38 Behaviour of nucleolus organizing regions (NORs) and nucleoli during mitotic and meiotic divisions in budding yeast; Fuchs J et al.; Spatial organization and segregation behaviour in mitosis and meiosis of nucleoli and NORs of Saccharomyces cerevisiae were examined by fluorescence in situ hybridization (FISH) and immunostaining, and integrated with previous ultrastructural studies . Our observations suggest that in interphase the NOR-bearing chromosome arm forms a hairpin-shaped loop inside the nucleolus, unlike the other arms which adopt a Rabl-like orientation . Prior to mitosis and meiosis, the appearance of the NOR changes from puffed to thread-shaped . In mitosis, it is stretched between the mother and daughter nuclei and seems to be among the last regions where chromatids separate . The nucleoli remain intact and split at the end of anaphase . Similarly, during meiosis I, intact nucleoli trail behind the separating homologous NORs and are partitioned equally to the two half-nuclei . During the second meiotic division, however, the nucleolus, together with a major portion of the nucleoplasm and the nuclear pore complexes, are not included in the spores . The behaviour of nucleoli in meiotic mutants and a strain with extrachromosomal rDNA suggests that they are not actively extruded but rather are lost due to their detachment from the separating chromosomes . We discuss the possibility that the exclusion of the nucleolus from the spores serves the disposal of agents that resort to the nucleolus, and has a role in spore dormancy or rejuvenation. FEMS Microbiol Lett, 2004 Jul 15, 236(2), 301 - 5 Over-production of dihydrofolate reductase leads to sulfa-dihydropteroate resistance in yeast; Patel O et al.; Dihydropteroate synthase (DHPS) can metabolise sulfa drugs into sulfa-dihydropteroate (sulfa-DHP), which inhibits cell growth through competition with dihydrofolate (DHF), possibly indicating dihydrofolate reductase (DHFR) as the target of sulfa-DHP . The effect of over-production of DHFR on sulfa-DHP resistance was examined in Saccharomyces cerevisiae using a strain that requires DHF for growth . This strain was transformed with a plasmid which encodes over-production of DHFR in the presence of CuSO4 . Over-production led to resistance to sulfa-DHP suggesting that sulfa-DHP targets DHFR . Spontaneous mutants hyper-resistant to sulfa-DHP did not show any changes within DHFR. Methods Mol Biol, 2004, 259, 353 - 69 Identification of protein interactions by yeast two-hybrid screening and coimmunoprecipitation; Tanowitz M et al.; Many protein interactions with G-protein-coupled receptors (GPCRs) appear to influence receptor signaling and functional regulation . There is great interest therefore in methods for the identification of novel or unanticipated GPCR binding proteins . A proven method for identifying such protein interactions is the yeast two-hybrid screen, which involves screening the protein products of a cDNA library with a selected domain derived from a GPCR . Once it is established that a candidate protein produces a specific positive interaction within the yeast two-hybrid system, it is important to demonstrate further that this interaction is likely to occur in vivo . Coimmunoprecipitation, in which proteins of interest are copurified with the receptor under study, is a good way to address this important issue . Together, the yeast two-hybrid screen and coimmunoprecipitation are a useful way to identify and sort through candidate GPCR-interacting proteins prior to analysis in physiological studies. Proc Natl Acad Sci U S A, 2004 Jul 20, 101(29), 10614 - 9 Epub 2004 Jul 12. Drs2p-coupled aminophospholipid translocase activity in yeast Golgi membranes and relationship to in vivo function; Natarajan P et al.; Aminophospholipid translocases (APLTs) are defined primarily by their ability to flip fluorescent or spin-labeled derivatives of phosphatidylserine (PS) and phosphatidylethanolamine (PE) from the external leaflet of a membrane bilayer to the cytosolic leaflet and are thought to establish phospholipid asymmetry in biological membranes . The identities of APLTs remain unknown, although candidate proteins include the Drs2p/ATPase II subfamily of P-type ATPases . Drs2p from budding yeast localizes to the trans-Golgi network (TGN), and here we show that this membrane contains an ATP-dependent APLT that flips 7-nitro-2-1,3-benzoxadiazol-4-yl (NBD) PS and PE derivatives from the luminal to the cytosolic leaflet . To assess the contribution of Drs2p to this activity, TGN membranes were prepared from strains harboring WT or temperature-sensitive alleles of DRS2 and null alleles of three other potential APLT genes (DNF1, DNF2, and DNF3) . Assay of these membranes indicated that Drs2p was required for the ATP-dependent translocation of NBD-PS, whereas no active translocation of NBD-PE or NBD-phosphatidylcholine was detected . The specificity of Drs2p for NBD-PS suggested that translocation of PS would be required for the function of Drs2p in protein transport from the TGN . However, cho1 yeast strains that are unable to synthesize PS do not phenocopy drs2 but instead transport proteins normally via the secretory pathway . In addition, a drs2 cho1 double mutant retains drs2 transport defects . Therefore, whereas NBD-PS is a preferred substrate for Drs2p in vitro, endogenous PS is not an obligatory substrate in vivo for the role Drs2p plays in protein transport. Int J Food Microbiol, 2004 Aug 1, 94(3), 263 - 7 Characterization of a carotenoid-hyperproducing yeast mutant isolated by low-dose gamma irradiation; Sun N et al.; To isolate a carotenoid-hyperproducing yeast, Phaffia rhodozyma was treated by low-dose gamma irradiation below 10 kGy . Through repeated rounds of gamma irradiation and visual screening, a mutant 3A4-8 was isolated . It produced 3.3 mg of carotenoid per gram of yeast, 50% higher carotenoid content than that of the unirradiated strain . Glucose and peptone were the most suitable carbon and nitrogen sources for production of carotenoid based on the growth experiment of the mutant under various carbon and nitrogen sources . This result suggests that low-dose gamma irradiation could be used as a means of mutagenesis for isolation of a carotenoid-hyperproducing strain of P . rhodozyma because only the carotenoid-hyperproducing yeast survives gamma irradiation by scavenging oxygen radicals generated by radiolysis of water. Structure (Camb), 2004 Jul, 12(7), 1165 - 76 Joint X-ray and NMR refinement of the yeast L30e-mRNA complex; Chao JA et al.; L30e, a Saccharomyces cervisiae ribosomal protein, regulates its own expression by binding to a purine-rich asymmetric internal loop located in both its pre-mRNA and mature mRNA . A crystal structure of an MBP-L30e fusion protein in complex with an RNA containing the pre-mRNA regulatory site was solved at 3.24 A . Interestingly, the structure of the RNA differed from that observed in a previously determined NMR structure of the complex . Analysis of the NMR data led to the identification of a single imino proton resonance in the internal loop that had been incorrectly assigned and was principally responsible for the erroneous RNA structure . A structure refinement was performed using both the X-ray diffraction data and the NMR-derived distance and angle restraints . The joint NMR and X-ray refinement resulted in improved stereochemistry and lower crystallographic R factors . The RNA internal loop of the MBP-L30e-mRNA complex adopts the canonical K-turn fold. Curr Genet, 2004 Aug, 46(2), 82 - 91 Epub 2004 Jul 06. The Iml3 protein of the budding yeast is required for the prevention of precocious sister chromatid separation in meiosis I and for sister chromatid disjunction in meiosis II; Ghosh SK et al.; The mitotic kinetochore of the budding yeast contains a number of proteins which are required for chromosome transmission but are non-essential for vegetative growth . We show that one such protein, Iml3, is essential for meiosis, in that the absence of this protein results in reduced spore viability, precocious sister chromatid segregation of artificial and natural chromosomes in meiosis I and chromosome non-disjunction in meiosis II. J Biomed Biotechnol, 2004, 2004(2), 106 - 112 Serial Analysis of Gene Expression: Applications in Malaria Parasite, Yeast, Plant, and Animal Studies; Tuteja R et al.; The serial analysis of gene expression (SAGE) method is based on the isolation of unique sequence tags from individual transcripts and concatenation of tags serially into long DNA molecules . SAGE is an innovative technique that offers the potential of cataloging both the identity and relative frequencies of mRNA transcripts in a given RNA preparation . It can quantify low-abundance transcripts and reliably detect relatively small differences in transcript abundance between cell populations . SAGE data can be used to complement studies in cases where other gene expression methods may be more convenient or efficient . SAGE can be used in a wide variety of applications to identify disease-related genes, to analyze the effect of drugs on tissues, and to provide insights into the disease pathways . The most important application of SAGE is the identification of differentially expressed genes . In this review, we describe various applications of this powerful technology in malarial parasite, yeast, plant, and animal systems. Nucleic Acids Res, 2004 Jul 07, 32(12), 3590 - 600 Print 2004. The 'scavenger' m7GpppX pyrophosphatase activity of Dcs1 modulates nutrient-induced responses in yeast; Malys N et al.; Dcs1, the m7GpppX pyrophosphatase of Saccharomyces cerevisiae, has been reported to 'scavenge' capped 5' end fragments generated by 3'-->5' mRNA degradation . We now show that the absence of Dcs1, and the closely related Dcs2 protein, compromises cellular responses to glucose-deprivation stress as well as to step changes in glucose availability . Dcs1 and Dcs2 form homo- and heterodimers, with the heterodimer appearing as cells enter diauxie . Despite the previously observed increase in abundance of the mRNA encoding the neutral trehalase (Nth1) in the stationary phase, the total enzyme activity of Nth1 decreases in this phase of growth . Changes in trehalase activity are significant because the non-reducing disaccharide trehalose is thought to stabilize cellular components under stress conditions . In the dcs1Delta and dcs1Deltadcs2Delta mutants, normal regulation of trehalase activity is lost . Nutrient stress induces DCS1 and DCS2 transcription via the cAMP-PKA signalling pathway . Dcs1 also becomes phosphorylated as the availability of glucose diminishes, and we test the role of this phosphorylation in the stress response . Further evidence indicates that Dcs1 plays a complementary role to the translation factor eIF4E in preventing capped 5' fragments of mRNA from interfering with translation initiation . We conclude that Dcs1 function influences cellular responses to changes in nutrient avialability, while Dcs2 seems to act as a modulator of Dcs1 function. Appl Environ Microbiol, 2004 Jul, 70(7), 3918 - 24 Lipid accumulation, lipid body formation, and acyl coenzyme A oxidases of the yeast Yarrowia lipolytica; Mlickova K et al.; Yarrowia lipolytica contains five acyl-coenzyme A oxidases (Aox), encoded by the POX1 to POX5 genes, that catalyze the limiting step of peroxisomal beta-oxidation . In this study, we analyzed morphological changes of Y . lipolytica growing in an oleic acid medium and the effect of POX deletions on lipid accumulation . Protrusions involved in the uptake of lipid droplets (LDs) from the medium were seen in electron micrographs of the surfaces of wild-type cells grown on oleic acid . The number of protrusions and surface-bound LDs increased during growth, but the sizes of the LDs decreased . The sizes of intracellular lipid bodies (LBs) and their composition depended on the POX genotype . Only a few, small, intracellular LBs were observed in the mutant expressing only Aox4p (Deltapox2 Deltapox3 Deltapox5), but strains expressing either Aox3p or both Aox3p and Aox4p had the same number of LBs as did the wild type . In contrast, strains expressing either Aox2p or both Aox2p and Aox4p formed fewer, but larger, LBs than did the wild type . The size of the LBs increased proportionately with the amount of triacylglycerols in the LBs of the mutants . In summary, Aox2p expression regulates the size of cellular triacylglycerol pools and the size and number of LBs in which these fatty acids accumulate. Genome Biol . 2004;5(7):229 . Epub 2004 Jun 25. The uses of genome-wide yeast mutant collections; Scherens B et al.; We assess five years of usage of the major genome-wide collections of mutants from Saccharomyces cerevisiae: single deletion mutants, double mutants conferring 'synthetic' lethality and the 'TRIPLES' collection of mutants obtained by random transposon insertion . Over 100 experimental conditions have been tested and more than 5,000 novel phenotypic traits have been assigned to yeast genes using these collections. Glycoconj J, 2004, 20(6), 385 - 97 Monitoring of the tissue distribution of fibroblast growth factor containing a high mannose-type sugar chain produced in mutant yeast; Takamatsu S et al.; Most therapeutic glycoproteins have been produced in mammalian cell lines . However, the mammalian cell culture system has various disadvantages, i.e., a high culture cost, difficulty in performing a large scale-up because of complicated handling requirements, and the risk of contamination by prion or other unknown pathogenic components through cultivation in the presence of bovine serum . There is thus a growing need for other host cells in which the recombinant glycoproteins can be produced . Recently, we successfully developed a mutant yeast strain engineered in a glycosylation system . The sugar chain produced in the mutant yeast is not immunogenic to the human immuno-surveillance system . In the present study, we selected fibroblast growth factor (FGF) as a model glycoprotein and assessed the bioactivity of FGF produced in yeast in terms of its proliferating activity and tissue distribution in mammalian cells and in the whole body . Structural changes in the sugar chains of FGFs derived from mutant yeast, as compared with those from mammalian cells, did not affect the proliferating activity remarkably . However, the tissue distribution in the mouse differed significantly; a high-mannose type sugar chain was the major determinant of the specific distribution of FGF to the kidney . The mechanism of this phenomenon is still unclear, but our observations suggest that recombinant glycoproteins derived from mutant yeasts producing high-mannose type sugar chains would be applicable for tissue-targeting therapy. Exp Gerontol, 2004 Jul, 39(7), 999 - 1009 Suppressor analysis points to the subtle role of the LAG1 ceramide synthase gene in determining yeast longevity; Jiang JC et al.; Individual yeast cells display a finite replicative capacity . LAG1 was identified as a gene that is differentially expressed during the yeast replicative life span and was shown to play a role in determining yeast longevity . This gene is not essential, but simultaneous deletion of LAG1 and its close homologue LAC1 is lethal . Lag1p and Lac1p have been found to be an essential component of ceramide synthase . In this study, multicopy suppressors of the lethality of a lag1delta lac1delta double mutant were isolated to help clarify the role of LAG1 in yeast longevity . The two multicopy suppressors YBR183w (YPC1) and YPL087w (YDC1) encode ceramidases unrelated to Lag1p and Lac1p, which were previously found to support the reverse reaction of ceramide synthesis . Multiple copies of YPC1 were much more efficient than YDC1 in rescuing cell growth . They were also much more effective in rescuing the life span of a lag1delta lac1delta double mutant, sustaining a life span approaching that obtained by the restoration of LAG1 expression . Neither deletion of LAC1 nor overexpression of YPC1 had a detectable effect on wild-type life span . However, the overexpression of LAG1 had a bimodal effect on longevity, with moderate expression resulting in increased longevity and with higher expression curtailing life span . These results suggest that subtle changes in ceramide/sphingolipid metabolism are important in determining yeast longevity . They also indicate that Lag1p plays a special role in this relationship . Homologues of Lag1p have been identified in higher eukaryotes, including human, raising the possibility that ceramide and other sphingolipid metabolites play a wider role in biological aging. Plant Physiol, 2004 Jul, 135(3), 1630 - 41 Epub 2004 Jul 02. Tomato phospholipid hydroperoxide glutathione peroxidase inhibits cell death induced by Bax and oxidative stresses in yeast and plants; Chen S et al.; Using a conditional life or death screen in yeast, we have isolated a tomato (Lycopersicon esculentum) gene encoding a phospholipid hydroperoxide glutathione peroxidase (LePHGPx) . The protein displayed reduced glutathione-dependent phospholipid hydroperoxide peroxidase activity, but differs from counterpart mammalian enzymes that instead contain an active seleno-Cys . LePHGPx functioned as a cytoprotector in yeast (Saccharomyces cerevisiae), preventing Bax, hydrogen peroxide, and heat stress induced cell death, while also delaying yeast senescence . When tobacco (Nicotiana tabacum) leaves were exposed to lethal levels of salt and heat stress, features associated with mammalian apoptosis were observed . Importantly, transient expression of LePHGPx protected tobacco leaves from salt and heat stress and suppressed the apoptotic-like features . As has been reported, conditional expression of Bax was lethal in tobacco, resulting in tissue collapse and membrane permeability to Evans blue . When LePHGPx was coexpressed with Bax, little cell death and no vital staining were observed . Moreover, stable expression of LePHGPx in tobacco conferred protection against the fungal phytopathogen Botrytis cinerea . Taken together, our data indicated that LePHGPx can protect plant tissue from a variety of stresses . Moreover, functional screens in yeast are a viable tool for the identification of plant genes that regulate cell death. Plant Physiol, 2004 Jul, 135(3), 1480 - 90 Epub 2004 Jul 02. The putative Arabidopsis homolog of yeast vps52p is required for pollen tube elongation, localizes to Golgi, and might be involved in vesicle trafficking; Lobstein E et al.; The screening of the Versailles collection of Arabidopsis T-DNA transformants allowed us to identify several male gametophytic mutants, including poky pollen tube (pok) . The pok mutant, which could only be isolated as a hemizygous line, exhibits very short pollen tubes, explaining the male-specific transmission defect observed in this line . We show that the POK gene is duplicated in the Arabidopsis genome and that the predicted POK protein sequence is highly conserved from lower to higher eukaryotes . The putative POK homolog in yeast (Saccharomyces cerevisiae), referred to as Vps52p/SAC2, has been shown to be located at the late Golgi and to function in a complex with other proteins, Vps53p, Vps54p, and Vps51p . This complex is involved in retrograde trafficking of vesicles between the early endosomal compartment and the trans-Golgi network . We present the expression patterns of the POK gene and its duplicate P2 in Arabidopsis, and of the putative Arabidopsis homologs of VPS53 and VPS54 of yeast . We show that a POK::GFP fusion protein localizes to Golgi in plant cells, supporting the possibility of a conserved function for Vps52p and POK proteins . These results, together with the expression pattern of the POK::GUS fusion and the lack of plants homozygous for the pok mutation, suggest a more general role for POK in polar growth beyond the pollen tube elongation process. J Theor Biol, 2004 Aug 7, 229(3), 327 - 38 Mathematical modeling of regulatory mechanisms in yeast colony development; Walther T et al.; In the present study, yeast colony development serves as a model system to study growth of fungal populations with negligible nutrient and signal transport within the mycelium . Mathematical simulations address the question whether colony development is governed by diffusional limitation of nutrients . A hybrid one-dimensional cellular automaton model was developed that describes growth of discrete cells based upon microscopic interaction rules in a continuous field of nutrient and messenger . The model is scaled for the geometry of the experimental setup, cell size, growth- and substrate uptake rates . Therefore, calculated cell density profiles and nutrient distributions can be compared to experimental results and the model assumptions can be verified . In the physiologically relevant parameter range, simulations show an exponentially declining cell density along the median axis of the colonies in case of a diffusion limited growth scenario . These results are in good agreement with cell density profiles obtained in cultivations of the yeast Candida boidinii with glucose as the limiting carbon source but stand in contrast to the constant cell density profile estimated for Yarrowia lipolytica grown under the same conditions . While from the comparison of experimental results and simulations a diffusion limited growth mechanism is proposed for glucose limited C . boidinii colonies, this hypothesis is rejected for the growth of Y . lipolytica . As an alternative, a quorum sensing model was developed that can explain the evolution of constant cell density profiles based on the effect of a not further characterized unstable or volatile messenger. Anal Bioanal Chem, 2004 Aug, 379(7-8), 1068 - 75 Epub 2004 Jul 01. Coupling gravitational and flow field-flow fractionation, and size-distribution analysis of whole yeast cells; Sanz R et al.; This work continues the project on field-flow fractionation characterisation of whole wine-making yeast cells reported in previous papers . When yeast cells are fractionated by gravitational field-flow fractionation and cell sizing of the collected fractions is achieved by the electrosensing zone technique (Coulter counter), it is shown that yeast cell retention depends on differences between physical indexes of yeast cells other than size . Scanning electron microscopy on collected fractions actually shows co-elution of yeast cells of different size and shape . Otherwise, the observed agreement between the particle size distribution analysis obtained by means of the Coulter counter and by flow field-flow fractionation, which employs a second mobile phase flow as applied field instead of Earth's gravity, indicates that yeast cell density can play a major role in the gravitational field-flow fractionation retention mechanism of yeast cells, in which flow field-flow fractionation retention is independent of particle density . Flow field-flow fractionation is then coupled off-line to gravitational field-flow fractionation for more accurate characterisation of the doubly-fractionated cells . Coupling gravitational and flow field-flow fractionation eventually furnishes more information on the multipolydispersity indexes of yeast cells, in particular on their shape and density polydispersity. Genome Res, 2004 Jul, 14(7), 1310 - 4 Evolution and topology in the yeast protein interaction network; Wuchty S; The integrity of the yeast protein-protein interaction network is maintained by a few highly connected proteins, or hubs, which hold the numerous less-connected proteins together . The structural importance and the increased essentiality of these proteins suggest that they are likely to be conserved in evolution, implying a strong relationship between the number of interactions and their evolutionary distance to its orthologs in other organisms . The existence of this coherence was recently reported to strongly depend on the quality of the protein interaction and orthologs data . Here, we introduce a novel method, the evolutionary excess retention (ER), allowing us to uncover a robust and strong correlation between the conservation, essentiality, and connectivity of a yeast protein . We conclude that the relevance of the hubs for the network integrity is simultaneously reflected by a considerable probability of simultaneously being evolutionarily conserved and essential, an observation that does not have an equivalent for nonessential proteins . Providing a thorough assessment of the impact noisy and incomplete data have on our findings, we conclude that our results are largely insensitive to the quality of the utilized data . Environ Toxicol Chem, 2004 Jul, 23(7), 1743 - 50 Competition effects for copper between soil, soil solution, and yeast in a bioassay for Folsomia candida Willem; van der Zee SE et al.; We investigated the accumulation of copper (Cu) by the springtail Folsomia candida Willem, if exposed to Cu-contaminated sandy soil with yeast as a food source . Commonly, the dissolved and the easily desorbed Cu fractions are assumed to be available for uptake, and as both fractions depend on pH, a pH dependency of copper uptake and accumulation is expected . In recent studies with springtails this dependency was not observed . To explain this, we show that both the adsorption of copper by yeast and by soil is indeed pH dependent; however, these dependencies differ . Addition of yeast as a food source to copper-contaminated soil leads to competition for copper by yeast and soil that suppresses the pH dependency of copper adsorption by yeast . This may cause a pH dependency not to be observed in copper accumulation by springtails if they predominantly feed on yeast in bioassays . We conclude that the addition of artificial food sources in bioassays may affect the cause-effect relationships that are investigated . A combination of (soil) chemical experimentation and modeling and ecotoxicological studies may help in identifying such bias and, therefore, with interpreting bioassays. Adv Exp Med Biol, 2004, 547, 91 - 105 Yeast signal transduction: regulation and interface with cell biology; Sprague GF et al.; We examined the morphogenetic transitions that yeast cells undergo in response to extracellular cues, and determined that multiple mechanisms control specificity of signal transduction pathway signaling and the attendant physiological response that ensues . This article describes the approaches that we used to determine these mechanisms . Our findings indicate that scaffolding proteins, which organize signal transduction pathways, are an especially powerful means to achieve specificity . We do not yet know how general this mechanism is . Our studies have also started to reveal ways in which a protein, Ste20, first identified as a participant in signal transduction pathways, may also connect to the basic cell biology machinery . Synthetic lethal genetic analysis has suggested that the polarisome and a new ubiquitin-like system may be targets of Ste20. Mol Microbiol, 2004 Jul, 53(2), 687 - 96 Translation termination factors function outside of translation: yeast eRF1 interacts with myosin light chain, Mlc1p, to effect cytokinesis; Valouev IA et al.; The translation termination factor eRF1 recognizes stop codons at the A site of the ribosome and induces peptidyl-tRNA hydrolysis at the peptidyl transferase centre . Recent data show that, besides translation, yeast eRF1 is also involved in cell cycle regulation . To clarify the mechanisms of non-translational functions of eRF1, we performed a genetic screen for its novel partner proteins . This screen revealed the gene for myosin light chain, Mlc1p, acting as a dosage suppressor of a temperature-sensitive mutation in the SUP45 gene encoding eRF1 . eRF1 and Mlc1p are able to interact with each other and, similarly to depletion of Mlc1p, mutations in the SUP45 gene may affect cytokinesis . Immunofluorescent staining performed to determine localization of Mlc1p has shown that the sup45 mutation, which arrests cytokinesis, redistributed Mlc1p, causing its disappearance from the bud tip and the bud neck . The data obtained demonstrate that yeast eRF1 has an important non-translational function effecting cytokinesis via interaction with Mlc1p. Mol Microbiol, 2004 Jul, 53(2), 381 - 9 Yeast genome sequencing: the power of comparative genomics; Piskur J et al.; For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology . Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions . Analysis of the novel sequence data has shown that the minimum number of genes from each species that need to be compared to produce a reliable phylogeny is about 20 . Yeast has also become an attractive model to study speciation in eukaryotes, especially to understand molecular mechanisms behind the establishment of reproductive isolation . Comparison of closely related species helps in gene annotation and to answer how many genes there really are within the genomes . Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because they are short and degenerate and occupy different positions . Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s) . In addition, the accumulating sequence data provide the background to use more yeast species in model studies, to combat pathogens and for efficient manipulation of industrial strains. Proc Natl Acad Sci U S A, 2004 Jul 6, 101(27), 10024 - 9 Epub 2004 Jun 28. Yeast telomerase RNA: a flexible scaffold for protein subunits; Zappulla DC et al.; In the yeast Saccharomyces cerevisiae, distinct regions of the 1.2-kb telomerase RNA (TLC1) bind to the catalytic subunit Est2p and to accessory proteins . In particular, a bulged stem structure binds the essential regulatory subunit Est1p . We now show that the Est1p-binding domain of the RNA can be moved to three distant locations with retention of telomerase function in vivo . We present the Est1p relocation experiment in the context of a working model for the secondary structure of the entire TLC1 RNA, based on thermodynamic considerations and comparative analysis of sequences from four species . The model for TLC1 has three long quasihelical arms that bind the Ku, Est1p, and Sm proteins . These arms emanate from a central catalytic core that contains the template and Est2p-binding region . Deletion mutagenesis provides evidence that the Sm arm exists in vivo and can be shortened by 42 predicted base pairs with retention of function; therefore, precise positioning of Sm proteins, like Est1p, is not required within telomerase . In the best-studied ribonucleoprotein enzyme, the ribosome, the RNAs have specific three-dimensional structures that orient the functional elements . In the case of yeast telomerase, we propose that the RNA serves a very different function, providing a flexible tether for the protein subunits. Mol Cell Biol, 2004 Jul, 24(14), 6476 - 87 Diazaborine treatment of yeast cells inhibits maturation of the 60S ribosomal subunit; Pertschy B et al.; Diazaborine treatment of yeast cells was shown previously to cause accumulation of aberrant, 3'-elongated mRNAs . Here we demonstrate that the drug inhibits maturation of rRNAs for the large ribosomal subunit . Pulse-chase analyses showed that the processing of the 27S pre-rRNA to consecutive species was blocked in the drug-treated wild-type strain . The steady-state level of the 7S pre-rRNA was clearly reduced after short-term treatment with the inhibitor . At the same time an increase of the 35S pre-rRNA was observed . Longer incubation with the inhibitor resulted in a decrease of the 27S precursor . Primer extension assays showed that an early step in 27S pre-rRNA processing is inhibited, which results in an accumulation of the 27SA2 pre-rRNA and a strong decrease of the 27SA3, 27SB1L, and 27SB1S precursors . The rRNA processing pattern observed after diazaborine treatment resembles that reported after depletion of the RNA binding protein Nop4p/Nop77p . This protein is essential for correct pre-27S rRNA processing . Using a green fluorescent protein-Nop4 fusion, we found that diazaborine treatment causes, within minutes, a rapid redistribution of the protein from the nucleolus to the periphery of the nucleus, which provides a possible explanation for the effect of diazaborine on rRNA processing. Mol Cell Biol, 2004 Jul, 24(14), 6241 - 52 Identification of cis elements directing termination of yeast nonpolyadenylated snoRNA transcripts; Carroll KL et al.; RNA polymerase II (Pol II) termination is triggered by sequences present in the nascent transcript . Termination of pre-mRNA transcription is coupled to recognition of cis-acting sequences that direct cleavage and polyadenylation of the pre-mRNA . Termination of nonpolyadenylated {non-poly(A)} Pol II transcripts in Saccharomyces cerevisiae requires the RNA-binding proteins Nrd1 and Nab3 . We have used a mutational strategy to characterize non-poly(A) termination elements downstream of the SNR13 and SNR47 snoRNA genes . This approach detected two common RNA sequence motifs, GUA{AG} and UCUU . The first motif corresponds to the known Nrd1-binding site, which we have verified here by gel mobility shift assays . We also show that Nab3 protein binds specifically to RNA containing the UCUU motif . Taken together, our data suggest that Nrd1 and Nab3 binding sites play a significant role in defining non-poly(A) terminators . As is the case with poly(A) terminators, there is no strong consensus for non-poly(A) terminators, and the arrangement of Nrd1p and Nab3p binding sites varies considerably . In addition, the organization of these sequences is not strongly conserved among even closely related yeasts . This indicates a large degree of genetic variability . Despite this variability, we were able to use a computational model to show that the binding sites for Nrd1 and Nab3 can identify genes for which transcription termination is mediated by these proteins. FEBS Lett, 2004 Jul 2, 569(1-3), 301 - 6 Distinct regulatory mechanism of yeast GPX2 encoding phospholipid hydroperoxide glutathione peroxidase by oxidative stress and a calcineurin/Crz1-mediated Ca2+ signaling pathway; Tsuzi D et al.; The GPX2 gene encodes a homologue of mammalian phospholipid hydroperoxide glutathione peroxidase in Saccharomyces cerevisiae . Previously, we have reported that the oxidative stress-induced expression of GPX2 is strictly regulated by Yap1 and Skn7 transcription factors . Here, we found that the expression of GPX2 is induced by CaCl(2) in a calcineurin (CN)/Crz1-dependent manner, and the CN-dependent response element was specified in the GPX2 promoter . Neither Yap1 nor Skn7 was required for Ca(2+)-dependent induction of GPX2, therefore, distinct regulation for the oxidative stress response and Ca(2+) signal response for GPX2 exists in yeast cells. FEBS Lett, 2004 Jul 2, 569(1-3), 272 - 6 Sphingolipid C4 hydroxylation influences properties of yeast detergent-insoluble glycolipid-enriched membranes; Idkowiak-Baldys J et al.; Sphingoid base C4 hydroxylation is required for syringomycin E action on the yeast plasma membrane . Detergent-insoluble glycolipid-enriched membranes (DIGs) from a yeast strain lacking C4 hydroxylated sphingoid bases (sur2delta) are composed of linear membrane fragments instead of vesicular structures observed for wild-type DIGs, though they have similar lipid compositions and amounts of DIG marker proteins . Light-scattering bands collected from sur2delta after centrifugation of Triton X-100-treated cell lysates in continuous density gradients have lower buoyant densities than that of the wild-type . The results show that C4 hydroxylation influences the physical and structural properties of DIGs and suggest that syringomycin E interacts with lipid rafts. FEBS Lett, 2004 Jul 2, 569(1-3), 173 - 7 The selective utilization of substrates in vivo by the phosphatidylethanolamine and phosphatidylcholine biosynthetic enzymes Ept1p and Cpt1p in yeast; Boumann HA et al.; In yeast, the aminoalcohol phosphotransferases Ept1p and Cpt1p catalyze the final steps in the CDP-ethanolamine and CDP-choline routes leading to phosphatidylethanolamine (PE) and phosphatidylcholine (PC), respectively . To determine how these enzymes contribute to the molecular species profiles of PE and PC in vivo, wild-type, cpt1Delta, and ept1Delta cells were pulse labeled with deuterated ethanolamine and choline . Analysis of newly synthesized PE and PC using electrospray ionization tandem mass spectrometry revealed that PE and PC produced by Ept1p and Cpt1p have different species compositions, demonstrating that the enzymes consume distinct sets of diacylglycerol species in vivo . Using the characteristic phospholipid species profiles produced by Ept1p and Cpt1p as molecular fingerprints, it was also shown that in vivo CDP-monomethylethanolamine is preferentially used as substrate by Ept1p, whereas CDP-dimethylethanolamine and CDP-propanolamine are converted by Cpt1p. Cell Mol Life Sci, 2004 Jul, 61(13), 1615 - 32 Targets of programmed destruction: a primer to regulatory proteolysis in yeast; Hilt W; Proteasome-mediated proteolysis of defined target proteins is an important regulatory mechanism, which contributes to control of various essential pathways and programs of the eukaryotic cell . Here, I describe basic principles and mechanisms of regulatory proteolysis as observed in a prominent model cell, the yeast Saccharomyces cerevisiae . Selective proteolysis is important for balancing of a cell's proteins . It is used to directly limit or neutralize enzymes in response to defined signals . Proteasome-mediated degradation is also crucial for the regulation of gene transcription . Elimination of transcription factors as well as mobilization of transcriptional activators by limited proteolysis is involved in negative and positive control of transcription . Moreover, recent data indicate that the proteasomal degradation system may be spatially linked to the transcription machinery . Selective proteolytic destruction of regulators and structural proteins is an essential regulatory mechanism ideally designed for the regulation and correct execution of unidirectional processes as are the cell division cycle or the program of apoptotic cell death . Here the proteasomal degradation system acts on various levels. Cell Mol Life Sci, 2004 Jul, 61(13), 1601 - 14 From lysosome to proteasome: the power of yeast in the dissection of proteinase function in cellular regulation and waste disposal; Wolf DH; The yeast Saccharomyces cerevisiae has turned out to be an invaluable tool in the molecular biological sciences for elucidating the housekeeping functions of eukaryotic cells . Due to its easy amenability to biochemical, genetic, molecular biological and cell biological experimentation, including genomics and proteomics, yeast has become one of the most frequently used eukaryotic model organisms . One of the fields where studies in yeast have a truly pacemaking character is cellular control by proteolysis . The function of vacuolar (lysosomal) proteolysis was elucidated . The in vivo role of ubiquitin and its relation to the proteasome was uncovered . This research led to an avalanche of studies in many different eukaryotic systems, including mammals, and provided us with surprising new insights in cellular control in health and disease. Biophys Chem, 2004 Jul 1, 110(1-2), 171 - 8 Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments; Stigter D; Brewer et al . (Biophys . J . 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p . They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption . This paper presents an improved interpretation . Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J . Mol . Biol . 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice . We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs . When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4 . The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant . The kinetics reported by Brewer et al . (Biophys . J . 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al . (Biophys . J . 85 (2003) 2519-2524). J Virol, 2004 Jul, 78(14), 7677 - 84 RNA sequences in the Moloney murine leukemia virus genome bound by the Gag precursor protein in the yeast three-hybrid system; Evans MJ et al.; Encapsidation of the Moloney murine leukemia virus (MMLV) genome is mediated through a specific interaction between the major viral structural protein, Gag, and an RNA packaging signal, Psi . Many studies have investigated this process in vivo, although the specific examination of the Gag-RNA interaction in this context is difficult due to the variety of other viral functions involved in virion assembly in vivo . The Saccharomyces cerevisiae three-hybrid assay was used to directly examine the interaction between MMLV Gag and Psi . In this system, MMLV RNA regions exhibiting high-affinity Gag binding were mapped . All Gag-binding regions were located 3' to the viral splice donor sequence of the viral RNA transcript . No single short RNA sequence within Psi supported strong Gag interaction . Instead, an RNA comprised of nearly the entire Psi region was necessary to demonstrate an appreciable Gag interaction in the yeast three-hybrid system . These finding support the notion that two stem-loops (C and D) are not sufficient to form a core MMLV encapsidation signal.
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||