Nucleic Acids Res, 2004 Oct 11, 32(18), 5379 - 91 Print 2004. A high resolution protein interaction map of the yeast Mediator complex; Guglielmi B et al.; Mediator is a large, modular protein complex remotely conserved from yeast to man that conveys regulatory signals from DNA-binding transcription factors to RNA polymerase II . In Saccharomyces cerevisiae, Mediator is thought to be composed of 24 subunits organized in four sub-complexes, termed the head, middle, tail and Cdk8 (Srb8-11) modules . In this work, we have used screening and pair-wise two-hybrid approaches to investigate protein-protein contacts between budding yeast Mediator subunits . The derived interaction map includes the delineation of numerous interaction domains between Mediator subunits, frequently corresponding to segments that have been conserved in evolution, as well as novel connections between the Cdk8 (Srb8-11) and head modules, the head and middle modules, and the middle and tail modules . The two-hybrid analysis, together with co-immunoprecipitation studies and gel filtration experiments revealed that Med31 (Soh1) is associated with the yeast Mediator that therefore comprises 25 subunits . Finally, analysis of the protein interaction network within the Drosophila Mediator middle module indicated that the structural organization of the Mediator complex is conserved from yeast to metazoans . The resulting interaction map provides a framework for delineating Mediator structure-function and investigating how Mediator function is regulated. Adv Biophys, 2004, 38(Complete), 215 - 232 Molecular mechanism of vde-initiated intein homing in yeast nuclear genome; Fukuda T et al.; In Saccharomyces cerevisiae, VMAI intein encodes a homing endonuclease termed VDE which is produced by an autocatalytic protein splicing reaction . VDE introduces a DSB at its recognition sequence on intein-minus allele, resulting in the lateral transfer of VMAI intein . In this review, we summarize a decade of in vitro study on VDE and describe our recent study on the in vivo behavior of both VDE and host proteins involved in intein mobility . Meiotic DSBs caused by VDE are repaired in the similar pathway to that working in meiotic recombination induced by Spollp-mediated DSBs . Meiosis-specific DNA cleavage and homing is shown to be guaranteed by the two distinct mechanisms, the subcellular localization of VDE and a requirement of premeiotic DNA replication . Based on these lines of evidence, we present the whole picture of molecular mechanism of VDEinitiated homing in yeast cells. Exp Cell Res, 2004 Nov 1, 300(2), 345 - 53 Starvation for an essential amino acid induces apoptosis and oxidative stress in yeast; Eisler H et al.; Protracted starvation of auxotrophic Saccharomyces cerevisiae strains for an essential amino acid is commonly used to allow investigation of adaptive mutation mechanisms during starvation-induced cell cycle arrest . Under these conditions, the majority of cells dies during the first 6 days . We investigated starving cells for markers of programmed cell death and for the production of reactive oxygen species (ROS) . We observed that protracted starvation for lysine or histidine resulted in an increasing number of cells exhibiting DNA fragmentation and chromatin condensation, thus an apoptotic phenotype . Not only respiration-competent cells but also respiratory deficient rho0 cells were able to undergo programmed cell death . In addition the starving cells rapidly exhibited indicators of oxidative stress, independently of their respiratory competence . These results indicate that starvation for an essential amino acid results in severe cell stress, which may finally be the trigger of programmed cell death. Biochem Biophys Res Commun, 2004 Nov 12, 324(2), 686 - 91 Enhancement of pheromone response by RGS9 and Gbeta5 in yeast; Ajit SK et al.; The G-protein gamma-subunit-like (GGL) domain present within a subfamily of RGS proteins binds specifically to Gbeta5 . This interaction and resulting biological effect impacts the standard model of heterotrimeric G-protein signaling . It has been hypothesized that the RGS/Gbeta5 may potentially substitute for Gbetagamma in the heterotrimeric complex . Saccharomyces cerevisiae pheromone responsive mating signaling pathway is primarily driven by Gbetagamma . We evaluated GGL containing RGS9 and RGS7 for functional complementation in a RGS (sst2Delta) knockout yeast strain . The potential of Gbeta5 to augment the function of these RGS proteins was also evaluated . While Gbeta5 had no effect on RGS7, coexpression of Gbeta5 with RGS9 enhanced cell cycle arrest, suggesting that under certain conditions, RGS9 and Gbeta5 may possibly function as betagamma dimer . Furthermore, we demonstrate that Gbeta5 can complement a ste4Delta, the yeast beta-subunit, thus providing the first evidence of functional complementation of a mammalian Gbeta. FEBS Lett, 2004 Oct 8, 576(1-2), 161 - 4 Mouse acetylcholinesterase interacts in yeast with the extracellular matrix component laminin-1beta; Paraoanu LE et al.; Acetylcholinesterase (AChE) is likely to have roles other than the hydrolysis of acetylcholine, e.g., related to developmental processes like neurite outgrowth, differentiation and adhesion . Here, we investigated whether AChE can function as a heterophilic cell adhesion molecule and searched for proteins interacting with it . Using the yeast two-hybrid method and a mouse brain cDNA library, we have identified an interaction between a partial cDNA encoding the globular domain IV of laminin chain beta1 and the amino acids 240-503 of mouse AChE . Biochemical co-immunoprecipitation assays confirmed the genetic results . We suggest that AChE, by interacting with laminin-1, is able to exert changes in adhesion signaling pathways . Annu Rev Cell Dev Biol, 2004, 20, 559 - 91 Mechanisms of polarized growth and organelle segregation in yeast; Pruyne D et al.; Cell polarity, as reflected by polarized growth and organelle segregation during cell division in yeast, appears to follow a simple hierarchy . On the basis of physical cues from previous cell cycles or stochastic processes, yeast cells select a site for bud emergence that also defines the axis of cell division . Once polarity is established, rho protein-based signal pathways set up a polarized cytoskeleton by activating localized formins to nucleate and assemble polarized actin cables . These serve as tracks for the transport of secretory vesicles, the segregation of the trans Golgi network, the vacuole, peroxisomes, endoplasmic reticulum, mRNAs for cell fate determination, and microtubules that orient the nucleus in preparation for mitosis, all by myosin-Vs encoded by the MYO2 and MYO4 genes . Most of the proteins participating in these processes in yeast are conserved throughout the kingdoms of life, so the emerging models are likely to be generally applicable . Indeed, several parallels to cellular organization in animals are evident. Annu Rev Cell Dev Biol, 2004, 20, 1 - 28 The budding yeast spindle pole body: structure, duplication, and function; Jaspersen SL et al.; Nucleation of microtubules by eukaryotic microtubule organizing centers (MTOCs) is required for a variety of functions, including chromosome segregation during mitosis and meiosis, cytokinesis, fertilization, cellular morphogenesis, cell motility, and intracellular trafficking . Analysis of MTOCs from different organisms shows that the structure of these organelles is widely varied even though they all share the function of microtubule nucleation . Despite their morphological diversity, many components and regulators of MTOCs, as well as principles in their assembly, seem to be conserved . This review focuses on one of the best-characterized MTOCs, the budding yeast spindle pole body (SPB) . We review what is known about its structure, protein composition, duplication, regulation, and functions . In addition, we discuss how studies of the yeast SPB have aided investigation of other MTOCs, most notably the centrosome of animal cells. Yi Chuan Xue Bao, 2004 Jul, 31(7), 668 - 74 {The Elp4 subunit of human Elongator complex partially complements the growth defects of yeast ELP4 deletion strain}; Li F et al.; In this study, we performed in vivo experiments to determine the function of human Elongator subunit Elp4 by using a yeast complementary system . Our results indicated that though human ELP4 was not able to complement the growth defects of the ELP4 deletion mutant strain to high concentration salt, it partially reduced the sensitivity of mutant strain to caffeine, high temperature and 6-AU . Gene expression analysis indicated that human ELP4 partially resumed the slow activation of the PHO5 gene caused by the deletion of yELP4 under the low phosphate concentration . Meanwhile, under the condition of heat shock treatment, hELP4 increased the expression level of SSA3 gene . All these data demonstrated that human ELP4 can partially complement the growth defects and restore the slow activation of certain genes of the yELP4 deletion strain . These results indicate that human Elp4 subunit has similar functions to that of the yeast. Cell Biochem Funct . 2004 Oct 7; {Epub ahead of print} A novel link between a Rab GTPase and Rvs proteins: the yeast amphiphysin homologues; Talarek N et al.; The BAR proteins are a well-conserved family of proteins including Rvsp in yeast, amphiphysins and Bin proteins in mammals . In yeast, as in mammals, BAR proteins are known to be implicated in vesicular traffic . The Gyp5p (Ypl249p) and Ymr192p proteins interact in two-hybrid tests with both Rvs161p and Rvs167p . Gyp5p is a Ypt/Rab-specific GAP and Ymr192p is highly similar to Gyp5p . To specify the interaction between Rvsp and Gyp5p, we used two-hybrid tests to determine the domains necessary for these interactions . The specific SH3 domain of Rvs167p interacted with the N-terminal domain of Gyp5p . Moreover, Gyp5p could form a homodimer . Fus2 protein is a specific partner of Rvs161p in two-hybrid tests . To characterize the functional relationships between these five proteins, we have studied cellular phenotypes in single, double and triple mutant strains for which rvs mutants present defects, such as polarity, cell fusion and meiosis . Phenotypic analysis showed that Gyp5p, Ymr192p and Fus2p were involved in bipolar budding pattern and in meiosis . Specific epistasis or suppressive phenomena were found between the five mutations . Finally, The Gyp5p-GFP fusion protein was localized at the bud tip during apical growth and at the mother-bud neck during cytokinesis . Moreover, Rvs167p and Rvs161p were shown to be essential for the correct localization of Gyp5p . Altogether, these data support the hypothesis that both Rvsp proteins act in vesicular traffic through physical and functional interactions with Ypt/Rab regulators . Copyright (c) 2004 John Wiley & Sons, Ltd. Lab Chip, 2004 Oct, 4(5), 488 - 94 Epub 2004 Sep 14. Microfluidic biosensing systems . Part II . Monitoring the dynamic production of glucose and ethanol from microchip-immobilised yeast cells using enzymatic chemiluminescent micro-biosensors; Davidsson R et al.; A microfluidic flow injection (microFIA) system was employed for handling and monitoring of cell-released products from living cells immobilised on silicon microchips . The dynamic release of glucose and ethanol produced from sucrose by immobilised Saccharomyces cerevisiae cells was determined using microchip biosensors (micro-biosensors) with either co-immobilised glucose oxidase-horseradish peroxidase (GOX-HRP), or alcohol oxidase-horseradish peroxidase (AOX-HRP), catalysing a series of reactions ending up with chemiluminescence (CL) generated from HRP-catalysed oxidation of luminol in presence of p-iodophenol (PIP) . The yeast cells were attached by first treating them with polyethylenimine (PEI) followed by adsorption to the microchip surface . The cell loss during assaying was evaluated qualitatively using scanning electron microscopy (SEM), showing that no cells were lost after 35 min liquid handling of the cell chip at 10 microl min(-1) . The enzymes were immobilised on microchips via PEI-treatment followed by glutaraldehyde (GA) activation . The GOX-HRP micro-biosensors could be used during five days without any noticeable decrease in response, while the AOX-HRP micro-biosensors showed continuously decreasing activity, but could still be used employing calibration correction . The glucose and ethanol released from the immobilised yeast chips were quantitatively monitored, by varying the incubation time with sucrose, showing the possibilities and advantages of using a microfluidic system set-up for cell-based assays. Biol Proced Online, 2004, 6, 209 - 219 Epub 2004 Oct 01. Using the cre-lox recombination system to assess functional impairment caused by amino acid substitutions in yeast proteins; Shirley RL et al.; A method was developed to assess the functional significance of a sequence motif in yeast Upf3p, a protein required for nonsense-mediated mRNA decay (NMD) . The motif lies at the edge of the Upf3p-Upf2p interaction domain, but at the same time resembles the canonical leucine-rich nuclear export sequence (NES) found in proteins that bind Crm1p exportin . To test the function of the putative NES, site-directed mutations that cause substitutions of conserved NES-A residues were first selected to identify hypermorphic alleles . Next, a portable Crm1p-binding NES from HIV-1 Rev protein that functions in yeast was fused en masse to the C-terminus of variant Upf3 proteins using loxP sites recognized by bacterial cre-recombinase . Finally, variant Upf3-Rev proteins that were functional in NMD were selected and examined for the types of amino acid substitutions present in NES-A . The mutational analysis revealed that amino acid substitutions in the Upf3 NES impair both nuclear export and the Upf2p-Upf3p interaction, both of which are required for Upf3p to function in NMD . The method described in this report could be modified for the genetic analysis of a variety of portable protein domains. Biol Proced Online, 2004, 6, 204 - 208 Epub 2004 Oct 01. Peptide substrate identification for yeast Hsp40 Ydj1 by screening the phage display library; Li J et al.; We have identified a peptide substrate for molecular chaperone Hsp40 Ydj1 by utilizing the combination of phage display library screening and isothemol titration calirimetry (ITC) . The initial peptide substrate screening for Hsp40 Ydj1 has been carried out by utilizing a 7-mer phage display library . The peptide sequences from the bio-panning were synthesized and object to the direct affinity measurement for Hsp40 Ydj1 by isothemol titration calirimetry studies . The peptide which has the measurable affinity with Ydj1 shows enriched hydrophobic residues in the middle of the substrate fragment . The peptide substrate specificity for molecular chaperone Hsp40 has been analyzed. EMBO Rep, 2004 Nov, 5(11), 1096 - 101 Iron-induced oligomerization of yeast frataxin homologue Yfh1 is dispensable in vivo; Aloria K et al.; The neurodegenerative disease Friedreich's ataxia is caused by reduced levels of frataxin, a mitochondrial matrix protein . The in vivo role of frataxin is under debate . Frataxin, as well as its yeast homologue Yfh1, binds multiple iron atoms as an oligomer and has been proposed to function as a crucial iron-storage protein . We identified a mutant Yfh1 defective in iron-induced oligomerization . This mutant protein was able to replace functionally wild-type Yfh1, even when expressed at low levels, when mitochondrial iron levels were high and in mutant strains having deletions of genes that had synthetic growth defects with a YFH1 deletion . The ability of an oligomerization-deficient Yfh1 to function in vivo suggests that oligomerization, and thus oligomerization-induced iron storage, is not a critical function of Yfh1 . Rather, the capacity of this oligomerization-deficient mutant to interact with the Isu protein suggests a more direct role of Yfh1 in iron-sulphur cluster biogenesis. Plant Cell, 2004 Nov, 16(11), 2940 - 53 Epub 2004 Oct 07. A mechanism related to the yeast transcriptional regulator Paf1c is required for expression of the Arabidopsis FLC/MAF MADS box gene family; Oh S et al.; The Arabidopsis thaliana VERNALIZATION INDEPENDENCE (VIP) gene class has multiple functions in development, including repression of flowering through activation of the MADSbox gene FLC . Epigenetic silencing of FLC plays a substantial role in the promotion of flowering through cold (vernalization) . To better understand how VIP genes influence development, we undertook a genetic and molecular study of the previously uncharacterized VIP5 and VIP6 genes . We found that loss of function of these genes also resulted in downregulation of other members of the FLC/MAF gene family, including the photoperiodic pathway regulator MAF1/FLM . We cloned VIP5 and VIP6 through mapping and transcriptional profiling . Both proteins are closely related to distinct components of budding yeast Paf1C, a transcription factor that assists in establishment and maintenance of transcription-promotive chromatin modifications such as ubiquitination of H2B by Bre1/Rad6 and methylation of histone H3 lysine-4 by the trithorax-related histone methylase Set1 . Genetic analysis and coimmunoprecipitation experiments suggest that VIP5 and VIP6 function in the same mechanism as the previously described VIP3 and VIP4 . Our findings suggest that an evolutionarily conserved transcriptional mechanism plays an essential role in the maintenance of gene expression in higher eukaryotes and has a central function in flowering. J Biol Chem, 2004 Dec 31, 279(53), 55520 - 30 Epub 2004 Oct 07. Chromatin domain boundaries delimited by a histone-binding protein in yeast; Ferrari S et al.; When located next to chromosomal elements such as telomeres, genes can be subjected to epigenetic silencing . In yeast, this is mediated by the propagation of the SIR proteins from telomeres toward more centromeric regions . Particular transcription factors can protect downstream genes from silencing when tethered between the gene and the telomere, and they may thus act as chromatin domain boundaries . Here we have studied one such transcription factor, CTF-1, that binds directly histone H3 . A deletion mutagenesis localized the barrier activity to the CTF-1 histone-binding domain . A saturating point mutagenesis of this domain identified several amino acid substitutions that similarly inhibited the boundary and histone binding activities . Chromatin immunoprecipitation experiments indicated that the barrier protein efficiently prevents the spreading of SIR proteins, and that it separates domains of hypoacetylated and hyperacetylated histones . Together, these results suggest a mechanism by which proteins such as CTF-1 may interact directly with histone H3 to prevent the propagation of a silent chromatin structure, thereby defining boundaries of permissive and silent chromatin domains. Biotechniques, 2004 Sep, 37(3), 383 - 8 Development of a universal gap repair vector for yeast-based screening of knockout rodents; Chen KS et al.; Recently, we reported the production of the first knockout rats by combining N-ethyl-N-nitrosourea (ENU)-induced mutagenesis with a yeast-based truncation screening method . To make this new knockout technology more applicable for other laboratories and for high-throughput applications, we have developed a universal gap repair vector that is ready for use in screening for gene knockouts without additional engineering . The universal gap repair vector was validated for its application in both cDNA- and genomic DNA-based yeast truncation mutation assays . Breast cancer genes Brca1, Brca2, and Adenomatosis polyposis coli (Apc) genes from N2 rats of Brca1 and Brca2 knockouts and (Atm x ApcMin/+)F1 mice were examined, respectively . The results indicate that the universal gap repair vector we developed, using randomly selected codons as a universal cassette, is equally efficient at identifying truncation mutations as are those gap repair vectors designed specifically for Brca1 and Brca2 . The availability of a universal gap repair vector should facilitate the broader screening of knockouts of most genes of many species using the combined approach of ENU-induced mutagenesis and yeast truncation assay. Eukaryot Cell, 2004 Oct, 3(5), 1261 - 71 PP2A phosphatase activity is required for stress and Tor kinase regulation of yeast stress response factor Msn2p; Santhanam A et al.; In response to stress and nutrient starvation, the Saccharomyces cerevisiae transcription factor Msn2p accumulates in the nucleus and activates expression of a broad array of genes . Here, we analyze the role of the Tor (target of rapamycin) signaling pathway in mediating these responses . Inactivation of the Tor pathway component Tap42p using tap42(Ts) alleles causes a sustained nuclear localization similar to that after the addition of the Tor kinase inhibitor rapamycin . Effects of Tap42p inactivation and rapamycin addition could be suppressed by deletion of TIP41, which encodes a Tap42p-interacting protein . These results support the notion that rapamycin affects Msn2p by inactivating Tap42p function . Tap42p interacts with the catalytic subunit of PP2A (protein phosphatase 2A) and PP2A-like phosphatases . Deletion of either the catalytic or regulatory subunit that forms the PP2A phosphatase complex prevents nuclear accumulation of Msn2p in the tap42(Ts) strain and in wild-type strains treated with rapamycin . These results suggest that Tap42p is an inhibitor of PP2A phosphatase, which in turn inhibits nuclear export of Msn2p . Interestingly, PP2A function is also required for nuclear accumulation of Msn2p in response to stresses, such as heat and osmotic shock, as well as nitrogen (but not glucose) starvation . Thus, PP2A and the Tor kinase pathway transduce stress and nitrogen starvation signals to Msn2p . Finally, Msn2p localization is unaffected by conditional loss of 14-3-3 protein function, ruling out the possibility that 14-3-3 proteins act as a scaffold to sequester Msn2p in the cytoplasm. Microbiology, 2004 Oct, 150(Pt 10), 3289 - 304 Differential roles of PDK1- and PDK2-phosphorylation sites in the yeast AGC kinases Ypk1, Pkc1 and Sch9; Roelants FM et al.; Saccharomyces cerevisiae Pkh1 and Pkh2 (orthologues of mammalian protein kinase, PDK1) are functionally redundant . These kinases activate three AGC family kinases involved in the maintenance of cell wall integrity: Ypk1 and Ypk2, two closely related, functionally redundant enzymes (orthologues of mammalian protein kinase SGK), and Pkc1 (orthologue of mammalian protein kinase PRK2) . Pkh1 and Pkh2 activate Ypk1, Ypk2 and Pkc1 by phosphorylating a Thr in a conserved sequence motif (PDK1 site) within the activation loop of these proteins . A fourth protein kinase involved in growth control and stress response, Sch9 (orthologue of mammalian protein kinase c-Akt/PKB), also carries the conserved activation loop motif . Like other AGC family kinases, Ypk1, Ypk2, Pkc1 and Sch9 also carry a second conserved sequence motif situated in a region C-terminal to the catalytic domain, called the hydrophobic motif (PDK2 site) . Currently, there is still controversy surrounding the identity of the enzyme responsible for phosphorylating this second site and the necessity for phosphorylation at this site for in vivo function . Here, genetic and biochemical methods have been used to investigate the physiological consequences of phosphorylation at the PDK1 and PDK2 sites of Ypk1, Pkc1 and Sch9 . It was found that phosphorylation at the PDK1 site in the activation loop is indispensable for the essential functions of all three kinases in vivo, whereas phosphorylation at the PDK2 motif plays a non-essential and much more subtle role in modulating the ability of these kinases to regulate the downstream processes in which they participate. Microbiology, 2004 Oct, 150(Pt 10), 3219 - 28 The ER-Golgi v-SNARE Bet1p is required for cross-linking alpha-agglutinin to the cell wall in yeast; Kipnis P et al.; In Saccharomyces cerevisiae, glycosylphosphatidylinositol (GPI)-anchored cell wall mannoproteins, including alpha-agglutinin, are secreted to the cell surface through vesicular transport pathways . At the cell surface the GPI anchors are cleaved within the glycan, then transglycosylated to form a covalent cross-link to 1,6-beta-glucan . Among mutants that were temperature-sensitive for growth and for ability to cross-link the mannoprotein alpha-agglutinin to the cell wall, one strain was complemented by BET1, which encodes an ER-Golgi v-SNARE . Temperature-sensitive mutations in BET1 caused aberrations in cell wall structure, including excretion of alpha-agglutinin into the medium, sensitivity to lysis with Zymolyase and hypersensitivity to Calcofluor White . At restrictive temperatures, bet1 mutations block secretion of invertase and other proteins, but alpha-agglutinin was excreted into the extracellular medium . In wild-type parental or bet1 cells, secretion of alpha-agglutinin also continued after protein synthesis was blocked with cycloheximide . This secretion was due to continued export of a significant amount of alpha-agglutinin from compartments distal to the BET1-dependent secretion step . Thus, in bet1 cells the ER-Golgi block allowed secretion to continue, but prevented cell wall incorporation of the alpha-agglutinin . Therefore, a mutation early in the secretion pathway caused aberrant cell wall synthesis by preventing localization of key components required in wall cross-links. Microbiology, 2004 Oct, 150(Pt 10), 3209 - 18 Yeast Kre1p is GPI-anchored and involved in both cell wall assembly and architecture; Breinig F et al.; Kre1p is a cell surface O-glycoprotein involved in a late stage of 1,6-beta-glucan formation in the yeast Saccharomyces cerevisiae . Disruption of KRE1 leads to a 40 % reduction in the overall 1,6-beta-glucan content of the cell wall . This paper shows that in a yeast Deltakre1 null mutant, neither an N-terminal-truncated Kre1p nor Kre1p variants lacking a C-terminal glycosylphospatidylinositol (GPI) attachment site are capable of achieving normal function in glucan assembly, while full-length Kre1p completely complements a Deltakre1 null mutation and restores cell wall 1,6-beta-glucan content up to wild-type level . In a yeast gpi1 mutant, a green-fluorescent-protein-tagged Kre1p derivative is secreted into the medium, indicating an at least transient GPI-anchoring stage of Kre1p during its processing within the yeast secretory pathway . In contrast to the severe defect in cell wall beta-d-glucan, the amount of cell wall mannoproteins is not significantly decreased in a Deltakre1 disruptant, as could be confirmed in competition assays by investigating toxin binding to isolated cell wall mannoproteins . Since the yeast Deltakre1 mutant differed in its sensitivity to zygocin and K28, two killer viral protein toxins that use different cell wall mannoprotein populations as a primary toxin receptor, it can be concluded that in a yeast Deltakre1 background, mannoproteins do not differ significantly in total amount from a Kre1+ wild-type but rather in their expression and distribution at the cell surface . Taken together, these data favour and suggest a structural, rather than enzymic, function of Kre1p in yeast cell wall assembly. Mol Cell, 2004 Oct 8, 16(1), 139 - 46 Delivery of yeast telomerase to a DNA break depends on the recruitment functions of Cdc13 and Est1; Bianchi A et al.; The yeast single-strand TG-repeat telomere binding protein Cdc13 and the telomerase accessory protein Est1 play essential roles in chromosome end replication . To determine whether a proposed Cdc13-Est1 interaction recruits telomerase (Est2), we used a simplified system in which telomere formation was monitored at an HO-induced DNA double-strand break (DSB) . Tethering of either Cdc13 or Est1 adjacent to a DSB promoted telomere formation, and tethering of Est1, even in the absence of a DSB, resulted in the recruitment of Est2 . Est1 association with a DSB containing an adjacent short TG-repeat sequence depended on the Cdc13-Est1 interaction affected by cdc13-2 and est1-60 mutations, whereas Cdc13 association did not . Similarly, Est2 binding to the DSB also required the Cdc13-Est1 interaction, but not synthesis of new TG repeats at the break site . These data demonstrate a critical role for Est1 in recruiting telomerase to its site of action, in cooperation with the telomere binding protein Cdc13. Macromol Biosci, 2004 Jul 14, 4(7), 674 - 9 Concanavalin a immobilized affinity adsorbents for reversible use in yeast invertase adsorption; Yavuz H et al.; Concanavalin A (Con A) immobilized poly(2-hydroxyethyl methacrylate) (PHEMA) beads were investigated for specific adsorption of yeast invertase from aqueous solutions . PHEMA beads were prepared by a suspension polymerization technique with an average size of 150-200 microm, and activated by epichlorohydrin . Con A was then immobilized by covalent binding onto these beads . The maximum Con A immobilization was found to be 10 mg/g . The invertase-loading capability of the PHEMA/Con A beads was 107 mg/g . The maximum invertase adsorption capacity on the PHEMA/Con A adsorbents was observed at pH 5.0 . The values of the Michaelis constant K(m) of invertase were significantly larger upon adsorption, indicating decreased affinity by the enzyme for its substrate, whereas V(max) was smaller for the adsorbed invertase . Adsorption improved the pH stability of the enzyme as well as its temperature stability . Thermal stability was found to increase with adsorption . The adsorbed enzyme activity was found to be quite stable in repeated experiments.Storage stability of adsorbed invertase. Glycoconj J, 2004, 21(1-2), 75 - 8 Expression of human glycosyltransferase genes in yeast as a tool for enzymatic synthesis of sugar chain; Shimma Y et al.; We planned the production of human glycosyltransferases in yeast for the enzymatic synthesis of various sugar chains . More than 160 genes encoding various glycosyltransferases were prepared as N-terminal transmembrane region truncated forms by PCR and were inserted into the entry vector of Invitrogen Ltd's Gateway system . About fifty glycosyltransferases were chosen for the synthesis of human type oligosaccharides, and expressed as two different forms in yeast . One is a soluble form, which is secreted into the culture medium by methylotrophic yeast, and the other is an immobilized form, which is displayed at the budding yeast cell wall as a fusion protein with Pir protein . To date, in both systems, some sialyltranferases and fucosyltransferases have been produced as active forms, indicating the potential usefulness of these systems for the enzymatic synthesis of various types of human sugar chains attached to proteins and lipids. Cytogenet Genome Res, 2004, 107(3-4), 180 - 90 A role for the MutL homologue MLH2 in controlling heteroduplex formation and in regulating between two different crossover pathways in budding yeast; Abdullah MF et al.; BACKGROUND AND AIMS: Mismatch repair proteins play important roles during meiotic recombination in the budding yeast Saccharomyces cerevisiae and most eukaryotic organisms studied to date . To study the functions of the mismatch repair protein Mlh2p in meiosis, we constructed mlh2Delta strains and measured rates of crossing over, gene conversion, post-meiotic segregation and spore viability . We also analysed mlh1Delta, mlh3Delta, msh4Delta, msh5Delta, exo1Delta and mus81Delta mutant strains singularly and in various combinations . RESULTS: Loss of MLH2 resulted in a small but significant decrease in spore viability and a significant increase in gene conversion frequencies but had no apparent effect on crossing over . Deletion of MLH2 in mlh3Delta, msh4Delta or msh5Delta strains resulted in significant proportion of the "lost" crossovers found in single deletion strains being regained in some genetic intervals . We and others propose that there are at least two pathways to generate crossovers in yeast (Ross-Macdonald and Roeder, 1994; Zalevsky et al., 1999; Khazanehdari and Borts, 2000; Novak et al., 2001; de los Santos et al., 2003) . Most recombination intermediates are processed by the "major", Msh4-dependent pathway, which requires the activity of Mlh1p/Mlh3p/Msh4p/Msh5p as well as a number of other proteins . The minor pathway(s) utilizes Mms4p/Mus81p . We suggest that the absence of Mlh2p allows some crossovers from the MSH4 pathway to traverse the MUS81-dependent pathway . Genome Res, 2004 Oct, 14(10A), 1975 - 86 Large-scale mutagenesis of the yeast genome using a Tn7-derived multipurpose transposon; Kumar A et al.; We present here an unbiased and extremely versatile insertional library of yeast genomic DNA generated by in vitro mutagenesis with a multipurpose element derived from the bacterial transposon Tn7 . This mini-Tn7 element has been engineered such that a single insertion can be used to generate a lacZ fusion, gene disruption, and epitope-tagged gene product . Using this transposon, we generated a plasmid-based library of approximately 300,000 mutant alleles; by high-throughput screening in yeast, we identified and sequenced 9032 insertions affecting 2613 genes (45% of the genome) . From analysis of 7176 insertions, we found little bias in Tn7 target-site selection in vitro . In contrast, we also sequenced 10,174 Tn3 insertions and found a markedly stronger preference for an AT-rich 5-base pair target sequence . We further screened 1327 insertion alleles in yeast for hypersensitivity to the chemotherapeutic cisplatin . Fifty-one genes were identified, including four functionally uncharacterized genes and 25 genes involved in DNA repair, replication, transcription, and chromatin structure . In total, the collection reported here constitutes the largest plasmid-based set of sequenced yeast mutant alleles to date and, as such, should be singularly useful for gene and genome-wide functional analysis. Proc Natl Acad Sci U S A, 2004 Oct 12, 101(41), 14841 - 6 Epub 2004 Oct 01. Effects of the U1C L13 mutation and temperature regulation of yeast commitment complex formation; Du H et al.; The U1 small nuclear ribonucleoprotein particle U1C protein has a zinc finger-like structure (C2H2 motif) at its N terminus, which is conserved from yeast to humans . Mutations of amino acid L13 within this domain rescue the essential function of the helicase protein Prp28p . Prp28p has been implicated in unwinding the 5' splice site (5'ss)-U1 small nuclear RNA (snRNA) base-pairing, to allow replacement of U1 snRNA with U6 snRNA during spliceosome assembly . The L13 phenotype has therefore been interpreted to indicate that WT U1C contributes to 5'ss-U1 snRNA stabilization by binding to the RNA duplex . We show here that an L13 mutant extract cannot form stable base-pairing at room temperature but is permissive for U1-5'ss base-pairing at low temperature . This phenotype is similar to that of a U1C-depleted extract, indicating that the U1C L13 mutation is a strong loss-of-function mutation . The two mutant extracts are unlike a WT extract, which undergoes stable pairing at room temperature but little or no pairing at low temperature . Taken together with previous results and the failure to observe a direct interaction of U1C with the U1-5'ss duplex, the data suggest that U1C contributes indirectly to stable U1-5'ss base-pairing under permissive conditions . A model is proposed to account for the L13 results. J Biol Chem, 2004 Dec 17, 279(51), 53584 - 92 Epub 2004 Oct 01. Yeast cox17 solution structure and Copper(I) binding; Abajian C et al.; Cox17 is a 69-residue cysteine-rich, copper-binding protein that has been implicated in the delivery of copper to the Cu(A) and Cu(B) centers of cytochrome c oxidase via the copper-binding proteins Sco1 and Cox11, respectively . According to isothermal titration calorimetry experiments, fully reduced Cox17 binds one Cu(I) ion with a K(a) of (6.15 +/- 5.83) x 10(6) M(-1) . The solution structures of both apo and Cu(I)-loaded Cox17 reveal two alpha helices preceded by an extensive, unstructured N-terminal region . This region is reminiscent of intrinsically unfolded proteins . The two structures are very similar overall with residues in the copper-binding region becoming more ordered in Cu(I)-loaded Cox17 . Based on the NMR data, the Cu(I) ion has been modeled as two-coordinate with ligation by conserved residues Cys(23) and Cys(26) . This site is similar to those observed for the Atx1 family of copper chaperones and is consistent with reported mutagenesis studies . A number of conserved, positively charged residues may interact with complementary surfaces on Sco1 and Cox11, facilitating docking and copper transfer . Taken together, these data suggest that Cox17 is not only well suited to a copper chaperone function but is specifically designed to interact with two different target proteins. J Biol Chem, 2004 Dec 3, 279(49), 51042 - 8 Epub 2004 Dec 3. Specificity of prion assembly in vivo . {PSI+} and {PIN+} form separate structures in yeast; Bagriantsev S et al.; The yeast prions {PSI+} and {PIN+} are self-propagating amyloid aggregates of the Gln/Asn-rich proteins Sup35p and Rnq1p, respectively . Like the mammalian PrP prion "strains," {PSI+} and {PIN+} exist in different conformations called variants . Here, {PSI+} and {PIN+} variants were used to model in vivo interactions between co-existing heterologous amyloid aggregates . Two levels of structural organization, like those previously described for {PSI+}, were demonstrated for {PIN+} . In cells with both {PSI+} and {PIN+} the two prions formed separate structures at both levels . Also, the destabilization of {PSI+} by certain {PIN+} variants was shown not to involve alterations in the {PSI+} prion size . Finally, when two variants of the same prion that have aggregates with distinct biochemical characteristics were combined in a single cell, only one aggregate type was propagated . These studies demonstrate the intracellular organization of yeast prions and provide insight into the principles of in vivo amyloid assembly. Arch Biochem Biophys, 2004 Nov 1, 431(1), 9 - 15 Identification of three phosphorylation sites in the alpha7 subunit of the yeast 20S proteasome in vivo using mass spectrometry; Iwafune Y et al.; The 26S proteasome complex, which consists of a 20S proteasome and a pair of 19S regulatory particles, plays important roles in the degradation of ubiquitinated proteins in eukaryotic cells . The alpha7 subunit of the budding yeast 20S proteasome is a major phosphorylatable subunit; serine residue(s) in its C-terminal region are phosphorylated in vitro by CKII . However, the exact in vivo phosphorylation sites have not been identified . In this study, using electrospray ionization quadrupole time-of-flight mass spectrometry analysis, we detected a mixture of singly, doubly, and triply phosphorylated C-terminal peptides isolated from a His-tagged construct of the alpha7 subunit by nickel-immobilized metal affinity chromatography . In addition, we identified three phosphorylation sites in the C-terminal region using MS/MS analysis and site-directed mutagenesis: Ser258, Ser263, and Ser264 residues . The MS/MS analysis of singly phosphorylated peptides showed that phosphorylation at these sites did not occur successively. Genome Biol . 2004;5(10):243 . Epub 2004 Sep 30. Global nucleosome distribution and the regulation of transcription in yeast; Ercan S et al.; Recent studies show that active regulatory regions of the yeast genome have a lower density of nucleosomes than other regions, and that there is an inverse correlation between nucleosome density and the transcription rate of a gene . This may be the result of transcription factors displacing nucleosomes. Genome Biol . 2004;5(10):R76 . Epub 2004 Sep 15. A scale of functional divergence for yeast duplicated genes revealed from analysis of the protein-protein interaction network; Baudot A et al.; BACKGROUND: Studying the evolution of the function of duplicated genes usually implies an estimation of the extent of functional conservation/divergence between duplicates from comparison of actual sequences . This only reveals the possible molecular function of genes without taking into account their cellular function(s) . We took into consideration this latter dimension of gene function to approach the functional evolution of duplicated genes by analyzing the protein-protein interaction network in which their products are involved . For this, we derived a functional classification of the proteins using PRODISTIN, a bioinformatics method allowing comparison of protein function . Our work focused on the duplicated yeast genes, remnants of an ancient whole-genome duplication . RESULTS: Starting from 4,143 interactions, we analyzed 41 duplicated protein pairs with the PRODISTIN method . We showed that duplicated pairs behaved differently in the classification with respect to their interactors . The different observed behaviors allowed us to propose a functional scale of conservation/divergence for the duplicated genes, based on interaction data . By comparing our results to the functional information carried by GO annotations and sequence comparisons, we showed that the interaction network analysis reveals functional subtleties, which are not discernible by other means . Finally, we interpreted our results in terms of evolutionary scenarios . CONCLUSIONS: Our analysis might provide a new way to analyse the functional evolution of duplicated genes and constitutes the first attempt of protein function evolutionary comparisons based on protein-protein interactions. BMC Biochem . 2004 Oct 01;5(1):14. RNA integrity as a quality indicator during the first steps of RNP purifications : a comparison of yeast lysis methods; Lopez de Heredia M et al.; BACKGROUND: The completion of several genome-sequencing projects has increased our need to assign functions to newly identified genes . The presence of a specific protein domain has been used as the determinant for suggesting a function for these new genes . In the case of proteins that are predicted to interact with mRNA, most RNAs bound by these proteins are still unknown . In yeast, several protocols for the identification of protein-protein interactions in high-throughput analyses have been developed during the last years leading to an increased understanding of cellular proteomics . If any of these protocols or similar approaches shall be used for the identification of mRNA-protein complexes, the integrity of mRNA is a critical factor . RESULTS: We compared the effect of different lysis protocols on RNA integrity . We report dramatic differences in RNA stability depending on the method used for yeast cell lysis . Glass bead milling and French Press lead to degraded mRNAs even in the presence of RNase inhibitors . Thus, they are not suitable to purify intact mRNP complexes or to identify specific mRNAs bound to proteins . CONCLUSION: We suggest a novel protocol, grinding deep-frozen cells, for the preparation of protein extracts that contain intact RNAs, as lysis method for the purification of mRNA-protein complexes from yeast cells. Genes Cells, 2004 Oct, 9(10), 905 - 17 DNA topoisomerase II is required for the G0-to-S phase transition in Drosophila Schneider cells, but not in yeast; Hossain MS et al.; We previously reported that DNA topoisomerase II (topo II) is required for the G(0)-to-S phase transition in mammalian cells {Hossain et al . (2002) ICRF-193, a catalytic inhibitor of DNA topoisomerase II, inhibits re-entry into the cell division cycle from quiescent state in mammalian cells . Genes Cells 7, 285-294} . In this study, we examined whether the requirement for topo II is evolutionarily conserved in Drosophila and yeast . ICRF-193, a catalytic inhibitor of topo II, inhibited DNA synthesis in Drosophila Schneider cells released from the G(0) (stationary) phase, whereas the drug did not inhibit DNA synthesis in Schneider cells released from the M phase . Depletion of topo II mRNA by RNA-interference (RNAi) in G(0)-phase Schneider cells resulted in significant inhibition of DNA synthesis after release from G(0)-arrest . In the yeast topo II temperature-sensitive (ts) mutant, the initial cycle of DNA synthesis occurred at a restrictive temperature after release from starvation-induced G(0) phase and doubling of the DNA content in the cells was confirmed by both flow cytometry and fluorescence spectrophotometry . DNA synthesis in yeast cells after release from the G(0) phase was also observed in the presence of ICRF-193 . Doubling of the DNA content was observed during spore germination of topo II ts mutant yeast at a restrictive temperature as determined by fluorescence spectrophotometry . These results indicate that topo II is required for the G(0)-to-S phase transition in Drosophila Schneider cells, but not in yeast. J Biol Chem, 2004 Dec 10, 279(50), 52566 - 73 Epub 2004 Dec 10. Studies of the interaction of substituted mutants of BAX with yeast mitochondria reveal that the C-terminal hydrophobic alpha-helix is a second ART sequence and plays a role in the interaction with anti-apoptotic BCL-xL; Arokium H et al.; The role of the two ends of the pro-apoptotic protein BAX in its interaction with mitochondria was challenged by assaying substituted mutants in yeast cells for the ability to bind and insert into the mitochondrial membrane and to promote the release of cytochrome c . Mutations at the N-terminal end confirmed the inhibitory function of this zone, known as apoptotic regulation of targeting (ART) . On the other hand, mutations at the C-terminal end of the protein support the hypothesis that the hydrophobic helix alpha9 is not required for the insertion of BAX . In addition, three mutations (a T174D single substitution in the helix alpha9, a K189E/K190E double substitution at the end of the protein, and a P168A mutation in the loop before alpha9) exhibited a strong binding capacity, a strong insertion, as well as high ability to induce cytochrome c release . Considering the positions of these mutations and their potential effect on the movement of helix alpha9, we propose that the C-terminal end of the protein behaves like a second ART . Also, opposite to a mutation that changes the conformation of the N-terminal ART, the mutations in the C-terminal part of the protein impaired the inhibitory effect of anti-apoptotic BCL-xL over BAX insertion, suggesting that the conformation of the alpha9-helix plays a significant role in BAX/BCL-xL interaction. Mol Cell Biol, 2004 Oct, 24(20), 9221 - 38 Persistent activation by constitutive Ste7 promotes Kss1-mediated invasive growth but fails to support Fus3-dependent mating in yeast; Maleri S et al.; Mitogen-activated protein kinase kinase kinase-Ste11 (MAPKKK-Ste11), MAPKK-Ste7, and MAPK-Kss1 mediate pheromone-induced mating differentiation and nutrient-responsive invasive growth in Saccharomyces cerevisiae . The mating pathway also requires the scaffold-Ste5 and the additional MAPK-Fus3 . One contribution to specificity in this system is thought to come from stimulus-dependent recruitment of the MAPK cascade to upstream activators that are unique to one or the other pathway . To test this premise, we asked if stimulus-independent signaling by constitutive Ste7 would lead to a loss of biological specificity . Instead, we found that constitutive Ste7 promotes invasion without supporting mating responses . This specificity occurs because constitutive Ste7 activates Kss1, but not Fus3, in vivo and promotes filamentation gene expression while suppressing mating gene expression . Differences in the ability of constitutive Ste7 variants to bind the MAPKs and Ste5 account for the selective activation of Kss1 . These findings support the model that Fus3 activation in vivo requires binding to both Ste7 and the scaffold-Ste5 but that Kss1 activation is independent of Ste5 . This scaffold-independent activation of Kss1 by constitutive Ste7 and the existence of mechanisms for pathway-specific promoter discrimination impose a unique developmental fate independently of any distinguishing external stimuli. Mol Cell Biol, 2004 Oct, 24(20), 8823 - 33 Genome-wide analysis of the relationship between transcriptional regulation by Rpd3p and the histone H3 and H4 amino termini in budding yeast; Sabet N et al.; The histone amino termini have emerged as key targets for a variety of modifying enzymes that function as transcriptional coactivators and corepressors . However, an important question that has remained largely unexplored is the extent to which specific histone amino termini are required for the activating and repressive functions of these enzymes, Here we address this issue by focusing on the prototypical histone deacetylase, Rpd3p, in the budding yeast Saccharomyces cerevisiae . We show that targeting Rpd3p to a reporter gene in this yeast can partially repress transcription when either the histone H3 or the histone H4 amino terminus is deleted, indicating that the "tails" are individually dispensable for repression by Rpd3p . In contrast, we find that the effect of rpd3 gene disruption on global gene expression is considerably reduced in either a histone H3Delta1-28 (H3 lacking the amino-terminal 28 amino acids) or a histone H4(K5,8,12,16Q) (H4 with lysine residues 5, 8, 12, and 16 changed to glutamine residues) background compared to the wild-type background, indicating a requirement for one or both of these histone tails in Rpd3p-mediated regulation for many genes . These results suggest that acetylation of either the H3 or the H4 amino terminus could suffice to allow the activation of such genes . We also examine the relationship between H3 tails and H4 tails in global gene expression and find substantial overlap among the gene sets regulated by these histone tails . We also show that the effects on genome-wide expression of deleting the H3 or H4 amino terminus are similar but not identical to the effects of mutating the lysine residues in these same regions . These results indicate that the gene regulatory potential of the H3 and H4 amino termini is substantially but not entirely contained in these modifiable lysine residues. Mikrobiol Z, 2004 May-Jun, 66(3), 43 - 50 {Effect of chrome (VI) on growth physiology and sorptional capacity of yeast}; A novel yeast mutation et al.; Departamento de Genetica, Facultad de Biologia, Universidad de Sevilla, 41012, SpainWe isolated a novel rad52 mutation, rad52-L89F, which specifically impairs recombination in rad51Delta cells . rad52-L89F displays phenotypes similar to rad59Delta and encodes a mutant protein impaired in its ability to interact with Rad59 . These results support the idea that Rad59 acts in homologous recombination via physical interaction with Rad52. Genetics, 2004 Sep, 168(1), 547 - 51 Importance of the Sir3 N terminus and its acetylation for yeast transcriptional silencing; Wang X et al.; The N-terminal alanine residues of the silencing protein Sir3 and of Orc1 are acetylated by the NatA Nalpha-acetyltransferase . Mutations demonstrate that the N terminus of Sir3 is important for its function . Sir3 and, perhaps, also Orc1 are the NatA substrates whose lack of acetylation in ard1 and nat1 mutants explains the silencing defect of those mutants. Genetics, 2004 Sep, 168(1), 89 - 101 Increase in Ty1 cDNA recombination in yeast sir4 mutant strains at high temperature; Radford SJ et al.; Transposition of the Ty1 element of the yeast Saccharomyces cerevisiae is temperature sensitive . We have identified a null allele of the silent information regulator gene SIR4 as a host mutant that allows for transposition at high temperature . We show that the apparent increase in transposition activity in sir4 mutant strains at high temperature is dependent on the RAD52 gene and is thus likely resulting from an increase in Ty1 cDNA recombination, rather than in IN-mediated integration . General cellular recombination is not increased at high temperature, suggesting that the increase in recombination at high temperature in sir4 mutants is specific for Ty1 cDNA . Additionally, this high-temperature Ty1 recombination was found to be dependent on functional Sir2p and Sir3p . We speculate that the increase in recombination seen in sir4 mutants at high temperature may be due to changes in chromatin structure or Ty1 interactions with chromosomal structures resulting in higher recombination rates. Genetics, 2004 Sep, 168(1), 77 - 87 Abortive transposition by a group II intron in yeast mitochondria; Dickson L et al.; Group II intron homing in yeast mitochondria is initiated at active target sites by activities of intron-encoded ribonucleoprotein (RNP) particles, but is completed by competing recombination and repair mechanisms . Intron aI1 transposes in haploid cells at low frequency to target sites in mtDNA that resemble the exon 1-exon 2 (E1/E2) homing site . This study investigates a system in which aI1 can transpose in crosses (i.e., in trans) . Surprisingly, replacing an inefficient transposition site with an active E1/E2 site supports <1% transposition of aI1 . Instead, the ectopic site was mainly converted to the related sequence in donor mtDNA in a process we call "abortive transposition." Efficient abortive events depend on sequences in both E1 and E2, suggesting that most events result from cleavage of the target site by the intron RNP particles, gapping, and recombinational repair using homologous sequences in donor mtDNA . A donor strain that lacks RT activity carries out little abortive transposition, indicating that cDNA synthesis actually promotes abortive events . We also infer that some intermediates abort by ejecting the intron RNA from the DNA target by forward splicing . These experiments provide new insights to group II intron transposition and homing mechanisms in yeast mitochondria. Genetics, 2004 Sep, 168(1), 65 - 75 Heterochromatin spreading at yeast telomeres occurs in M phase; Martins-Taylor K et al.; Heterochromatin regulation of gene expression exhibits epigenetic inheritance, in which some feature of the structure is retained and can reseed formation in new cells . To understand the cell-cycle events that influence heterochromatin assembly and maintenance in budding yeast, we have conducted two types of experiments . First we have examined the kinetics of heterochromatin spreading at telomeres . We have constructed a strain in which the efficient silencing of a telomere-linked URA3 gene depends on the inducible expression of the Sir3 silencing factor . Prior studies determined that S-phase passage was required for the establishment of silencing at the HM loci in yeast . We find that establishment of silencing in our strain occurs at a point coincident with mitosis and does not require S-phase passage . In addition, we find that passage through mitosis is sufficient to establish silencing at the HML locus in a strain bearing a conditional allele of SIR3 . Finally, we have also assessed the stability of yeast heterochromatin in the absence of the cis-acting elements required for its establishment . We show that silencing is stable through S phase in the absence of silencers and therefore possesses the ability to self-propagate through DNA replication . However, silencing is lost in the absence of silencers during progression through M phase . These experiments point to crucial events in mitosis influencing the assembly and persistence of heterochromatin. Nucleic Acids Res, 2004 Sep 27, 32(17), 5076 - 86 Print 2004. A yeast arginine specific tRNA is a remnant aspartate acceptor; Fender A et al.; High specificity in aminoacylation of transfer RNAs (tRNAs) with the help of their cognate aminoacyl-tRNA synthetases (aaRSs) is a guarantee for accurate genetic translation . Structural and mechanistic peculiarities between the different tRNA/aaRS couples, suggest that aminoacylation systems are unrelated . However, occurrence of tRNA mischarging by non-cognate aaRSs reflects the relationship between such systems . In Saccharomyces cerevisiae, functional links between arginylation and aspartylation systems have been reported . In particular, it was found that an in vitro transcribed tRNAAsp is a very efficient substrate for ArgRS . In this study, the relationship of arginine and aspartate systems is further explored, based on the discovery of a fourth isoacceptor in the yeast genome, tRNA4Arg . This tRNA has a sequence strikingly similar to that of tRNAAsp but distinct from those of the other three arginine isoacceptors . After transplantation of the full set of aspartate identity elements into the four arginine isoacceptors, tRNA4Arg gains the highest aspartylation efficiency . Moreover, it is possible to convert tRNA4Arg into an aspartate acceptor, as efficient as tRNAAsp, by only two point mutations, C38 and G73, despite the absence of the major anticodon aspartate identity elements . Thus, cryptic aspartate identity elements are embedded within tRNA4Arg . The latent aspartate acceptor capacity in a contemporary tRNAArg leads to the proposal of an evolutionary link between tRNA4Arg and tRNAAsp genes. J Virol, 2004 Oct, 78(20), 11016 - 29 Anti-Vpr activity of a yeast chaperone protein; Benko Z et al.; Human immunodeficiency virus type 1 (HIV-1) viral protein R (Vpr) exerts multiple effects on viral and host cellular activities during viral infection, including nuclear transport of the proviral integration complex, induction of cell cycle G(2) arrest, and cell death . In this report, we show that a fission yeast chaperone protein Hsp16 inhibits HIV-1 by suppressing these Vpr activities . This protein was identified through three independent genome-wide screens for multicopy suppressors of each of the three Vpr activities . Consistent with the properties of a heat shock protein, heat shock-induced elevation or overproduction of Hsp16 suppressed Vpr activities through direct protein-protein interaction . Even though Hsp16 shows a stronger suppressive effect on Vpr in fission yeast than in mammalian cells, similar effects were also observed in human cells when fission yeast hsp16 was expressed either in vpr-expressing cells or during HIV-1 infection, indicating a possible highly conserved Vpr suppressing activity . Furthermore, stable expression of hsp16 prior to HIV-1 infection inhibits viral replication in a Vpr-dependent manner . Together, these data suggest that Hsp16 inhibits HIV-1 by suppressing Vpr-specific activities . This finding could potentially provide a new approach to studying the contribution of Vpr to viral pathogenesis and to reducing Vpr-mediated detrimental effects in HIV-infected patients. Biochem Biophys Res Commun, 2004 Oct 29, 323(4), 1172 - 83 Isolation of a dinoflagellate mitotic cyclin by functional complementation in yeast; Bertomeu T et al.; Dinoflagellates are protists with permanently condensed chromosomes that lack histones and whose nuclear membrane remains intact during mitosis . These unusual nuclear characters have suggested that the typical cell cycle regulators might be slightly different than those in more typical eukaryotes . To test this, a cyclin has been isolated from the dinoflagellate Gonyaulax polyedra by functional complementation in cln123 mutant yeast . This GpCyc1 sequence contains two cyclin domains in its C-terminal region and a degradation box typical of mitotic cyclins . Similar to other dinoflagellate genes, GpCyc1 has a high copy number, with approximately 5000 copies found in the Gonyaulax genome . An antibody raised against the N-terminal region of the GpCYC1 reacts with a 68kDa protein on Western blots that is more abundant in cell cultures enriched for G2-phase cells than in those containing primarily G1-phase cells, indicating its cellular level follows a pattern expected for a mitotic cyclin . This is the first report of a cell cycle regulator cloned and sequenced from a dinoflagellate, and our results suggest control of the dinoflagellate cell cycle will be very similar to that of other organisms. Biochim Biophys Acta, 2004 Oct 5, 1680(1), 34 - 45 Proteasome inhibition alters the transcription of multiple yeast genes; Dembla-Rajpal N et al.; The 26S proteasome degrades denatured proteins and other proteins targeted for destruction by covalent modification . Here we show that impaired proteasome function influences the transcription of numerous yeast genes . Of 6144 genes present on the macroarray filters used in this study, approximately 5% showed measurable mRNA decreases and 2% showed mRNA increases following 30 min of proteasome inhibition . Northern blot hybridization shows that this response is time- and dose-dependent and occurs with either pharmacological or genetic impairment of the proteasome . A number of splicing factors possess the PEST motif found in certain proteasome substrates . However, mRNA levels drop with proteasome inhibition without obvious increases in intron-bearing pre-mRNA, indicating that splicing is not generally impaired when proteome activity is blocked . Chimeric gene constructs, nuclear run-on experiments, and transcriptional inhibition studies show that for members of three functional groups (i.e., ribosomal protein genes, histone genes, and heat shock protein genes) changes in mRNA levels occur largely by transcriptional modulation . In addition, these studies reveal a possible new means of modulating kinetochore levels through CEP3 expression . Together these data strongly support the view that proteasome activity plays a significant role in the regulation of eukaryotic gene expression. FEMS Microbiol Lett, 2004 Oct 1, 239(1), 171 - 9 Multiple ubiquitin-specific protease genes are involved in degradation of yeast tryptophan permease Tat2 at high pressure; Miura T et al.; When Saccharomyces cerevisiae cells are exposed to high hydrostatic pressure, tryptophan permease Tat2 is degraded in a manner dependent on Rsp5 ubiquitin ligase . Consequently, cell growth is arrested in tryptophan auxotrophic strains . Here we show that of 17 ubiquitin-specific protease genes (UBP), deletion of DOA4, UBP6 or UBP14 causes stabilization of Tat2 and hence the cells can grow at 25 MPa . These disruptant cells displayed marked sensitivity to the arginine analogue canavanine . Internal free ubiquitin decreased 2- to 5-fold upon UBP deletion, although overproduction of ubiquitin did not affect their high-pressure growth and canavanine sensitivity . These results suggest that multiple ubiquitin-specific proteases are involved in pressure-induced degradation of Tat2, rather than free ubiquitin depletion. Biochem Pharmacol, 2004 Nov 1, 68(9), 1807 - 14 Using yeast to screen for inhibitors of protein tyrosine phosphatase 1B; Montalibet J et al.; Inhibition of protein tyrosine phosphatase 1B (PTP1B) has been proposed as a novel therapy to treat type 2 diabetes and obesity . In order to identify novel PTP1B inhibitors, we have developed a robust screen in Saccharomyces cerevisiae where growth is dependent on PTP1B catalytic activity . This was based on the observation that overexpression of v-Src, a tyrosine kinase, in yeast leads to lethality through mitotic dysfunction and this lethality can be reversed by co-expression of PTP1B . The expression levels of v-Src and PTP1B were optimized to obtain a balance between robust growth and sensitivity to inhibitors . Screening was carried out in 96-well plates and growth of the liquid culture measured by absorbance at 600 nm . Initial characterization was performed using vanadate as well as some novel PTP1B inhibitors . Vanadate specifically inhibited PTP1B-dependent growth in a dose dependent manner with an EC50 of 0.92 +/- 0.07 mM . This simple yeast growth interference assay has the potential for use as a high throughput screen for PTP1B inhibitors in sample collections or crude mixtures. FEMS Yeast Res, 2004 Sep, 4(8), 849 - 56 Botryozyma mucatilis sp . nov., an anamorphic ascomycetous yeast associated with nematodes in poplar slime flux; Kerrigan J et al.; A new species of Botryozyma, Botryozyma mucatilis, was isolated from the surface of free-living nematodes, Panagrellus dubius, inhabiting slime flux from hybrid poplars, Populus deltoidesxtrichocarpa, in Oregon, USA . This species was discovered in relatively close proximity to the teleomorphic species Ascobotryozyma americana and Ascobotryozyma cognata, both collected from P . dubius nematodes inhabiting beetle galleries in Populus spp . and Populus and Salix spp., respectively . B . mucatilis is recognized as a distinct species based on molecular and morphological data . Sequence divergence in both the D1/D2 domain of the nuclear large-subunit rDNA and internal transcribed spacer region rDNA, low DNA reassociation values, notably different amplified fragment-length polymorphic fingerprints, and significantly longer cells all support the designation of a novel species. Yeast, 2004 Sep, 21(12), 983 - 9 Cell shape and growth of budding yeast cells in restrictive microenvironments; Suzuki M et al.; Effects of limited growth space on the cell morphology and cell growth are investigated by creating rigid outside environments . The cube-shaped holes big enough for a single cell of the budding yeast Saccharomyces cerevisiae were prepared with a focused ion-beam (FIB), commonly used for processing semiconductors . We demonstrated that the outline of the cells changes their ellipsoidal morphology into a cubic form when the daughter cells are grown in the holes, indicating that yeast cells change their shape in response to external limited space . The yeast cells grown in the microenvironments exhibit neither bud formation nor nuclear division . Although restricted growth caused by the physical barriers leads to the block of cell cycle progression in the wild-type cells, swe1Delta cells defective in the morphogenesis checkpoint become binucleate after being grown in the microenvironments . These results suggest that yeast cells under spatial restriction arrest cell cycle progression in a Swelp-dependent manner . Copyright (c) 2004 John Wiley & Sons, Ltd. Mol Genet Genomics, 2004 Sep, 272(2), 173 - 80 Epub 2004 Jul 29. Complete DNA sequence of the linear mitochondrial genome of the pathogenic yeast Candida parapsilosis; Nosek J et al.; The complete sequence of the mitochondrial DNA of the opportunistic yeast pathogen Candida parapsilosis was determined . The mitochondrial genome is represented by linear DNA molecules terminating with tandem repeats of a 738-bp unit . The number of repeats varies, thus generating a population of linear DNA molecules that are heterogeneous in size . The length of the shortest molecules is 30,922 bp, whereas the longer molecules have expanded terminal tandem arrays (nx738 bp) . The mitochondrial genome is highly compact, with less than 8% of the sequence corresponding to non-coding intergenic spacers . In silico analysis predicted genes encoding fourteen protein subunits of complexes of the respiratory chain and ATP synthase, rRNAs of the large and small subunits of the mitochondrial ribosome, and twenty-four transfer RNAs . These genes are organized into two transcription units . In addition, six intronic ORFs coding for homologues of RNA maturase, reverse transcriptase and DNA endonucleases were identified . In contrast to its overall molecular architecture, the coding sequences of the linear mitochondrial DNA of C . parapsilosis are highly similar to their counterparts in the circular mitochondrial genome of its close relative C . albicans . The complete sequence has implications for both mitochondrial DNA replication and the evolution of linear DNA genomes. Arch Virol, 2004 Dec, 149(12), 2349 - 64 Epub 2004 Dec. Yeast two-hybrid systems confirm the membrane- association and oligomerization of BC1 but do not detect an interaction of the movement proteins BC1 and BV1 of Abutilon mosaic geminivirus; Frischmuth S et al.; Most of the plant begomoviruses use two proteins to transport their DNA from cell to cell, BV1 to shuttle it between nucleus and cytoplasm and BC1 to facilitate movement across plasmodesmata . In order to analyse their interaction for Abutilon mosaic geminivirus (AbMV) in yeast ( Saccharomyces cerevisiae), BC1 and BV1 genes were cloned into various plasmid vectors suitable for two-hybrid analysis . BC1 was fused to the binding domain (GBD) and BV1 to the activation domain (GAD) of the GAL4 transcription factor to check for interactions in the nucleus . Additionally, BC1 as well as BV1 were integrated into pMyr or pSos vectors to analyze protein binding at the plasma membrane using the CytoTraptrade mark system . Using freeze-fracture immuno-labelling (FreeFI), singly-expressed GBD:BC1 was localized at the plasma membrane although it was fused to a nuclear localization signal provided by the construct . GAD:BV1 was found in the nucleus of transformed cells as expected . Upon co-transformation of both constructs, cells grew poorly and exhibited symptoms of autolysis without any detectable level of GBD:BC1 or GAD:BV1, as revealed by FreeFI . In conclusion, both fusion proteins did not meet in the same compartment and appeared to be harmful to yeast if constitutively co-expressed . When expressed from pSos vector, BC1 induced the CytoTrap detection signal in the absence of pMyr indicating that BC1 protein alone is able to target the effector protein to the inner face of the plasma membrane . A mutated form of BC1 (DeltaBC1) lacking the previously identified membrane-binding domain was no longer able to auto-induce the CytoTrap signal cascade . Using DeltaBC1, an N-terminal, or a C-terminal third of BC1 revealed a homo-oligomerization of the C-terminal region of BC1 in two-hybrid analysis, but no interaction of BC1 with BV1. J Biol Chem, 2004 Dec 10, 279(50), 52319 - 23 Epub 2004 Dec 10. Hsp104 binds to yeast Sup35 prion fiber but needs other factor(s) to sever it; Inoue Y et al.; The interaction of Hsp104 with yeast prion fibers made of Sup35NM, a prion-inducing domain of Sup35, was tested . When fluorescently labeled Hsp104 was added to the preformed fibers, individual fibers were fluorescently decorated uniformly along the fiber length . However, the density of fluorescence differed from one fiber to another, indicating the presence of subspecies of Sup35NM fibers . The time course of fiber formation from monomer Sup35NM was delayed by Hsp104 . Hsp104-mediated fragmentation of fibers was tested using bead-tethered fibers . In contrast with the recent report (Shorter, J., and Lindquist, S . (2004) Science 304, 1793-1797), Hsp104 alone was unable to sever the fibers . Yeast cell lysate or the Hsp104-deficient cell lysate plus Hsp104 caused ATP-dependent, guanidine hydrochloride-sensitive fragmentation of the fibers . Thus, in our experimental setup, Hsp104 plus other factor(s) in the yeast cytosol are required for severing yeast prion fiber . The reason of discrepancy from the above report is unknown but is possibly caused by different conformational subspecies of prion fibers. Biochem J . 2004 Sep 24; Pt {Epub ahead of print} Specific interactions of PP2A and PP2A-like phosphatases with the yeast PTPA homologues, Ypa1 and Ypa2; Van Hoof C et al.; In order to elucidate the specific biological role of the yeast homologues of PTPA, Ypa1 and Ypa2, in the regulation of PP2A, we investigated the physical interaction of both Ypa proteins with the catalytic subunit of the different yeast PP2A-like phosphatases . Ypa1 interacts specifically with Pph3, Sit4 and Ppg1, whereas Ypa2 binds to Pph21 and Pph22 . The Ypa1 and Ypa2 proteins do not compete with Tap42 for binding to PP2A family members . The interaction of the Ypa proteins with the catalytic subunit of PP2A-like phosphatases is direct and independent of other regulatory subunits, implicating a specific function for the different PP2A-Ypa complexes . Strikingly, interaction of Ypa2 with yeast PP2A is promoted by the presence of Ypa1, suggesting a positive role of Ypa1 in the regulation of PP2A association with other interacting proteins . As in the mammalian system, all yeast PP2A-like enzymes associate as an inactive complex with yeast methylesterase, Yme . Ypa1 as well as Ypa2 can reactivate all these inactive complexes, except Pph22-Yme . Ypa1 is the most potent activator of PP2A activity, suggesting that there is no direct correlation between activation potential and binding capacity. Chaos, 2004 Sep, 14(3), 653 - 61 Bifurcation analysis of a model of the budding yeast cell cycle; Battogtokh D et al.; We study the bifurcations of a set of nine nonlinear ordinary differential equations that describe regulation of the cyclin-dependent kinase that triggers DNA synthesis and mitosis in the budding yeast, Saccharomyces cerevisiae . We show that Clb2-dependent kinase exhibits bistability (stable steady states of high or low kinase activity) . The transition from low to high Clb2-dependent kinase activity is driven by transient activation of Cln2-dependent kinase, and the reverse transition is driven by transient activation of the Clb2 degradation machinery . We show that a four-variable model retains the main features of the nine-variable model . In a three-variable model exhibiting birhythmicity (two stable oscillatory states), we explore possible effects of extrinsic fluctuations on cell cycle progression . J Cell Physiol, 2005 Jan, 202(1), 100 - 4 A novel role for Bsd2 in the resistance of yeast to adriamycin; Takahashi T et al.; In a search for undiscovered mechanisms of resistance to adriamycin, we screened a genomic library derived from Saccharomyces cerevisiae for genes related to adriamycin resistance . To our surprise, we found that overexpression of BSD2 rendered yeast cells resistant to adriamycin . Downregulation of the metal transporters Smf1 and Smf2 is the only activity of Bsd2 reported to date, and Bsd2 deficiency increases intracellular levels of Smf1 and Smf2 . SMF2-disrupted cells exhibited significantly greater resistance to adriamycin, whereas the resistance of SMF1-disrupted cells was only slightly improved . The sensitivity of the SMF1- and SMF2-disrupted yeast cell line overexpressing BSD2 was almost the same as that of the BSD2-overexpressing parental yeast cell . Thus the overexpression of BSD2 and the disruption of SMF1 and SMF2 might be involved in the same mechanism that confers resistance to adriamycin . Although both SMF1- and SMF2-disrupted cells were very sensitive to EGTA, overexpression of BSD2 had little or no effect on sensitivity to EGTA . However, a partial decrease in the intracellular level of FLAG-Smf2 was observed by overexpression of BSD2 . Thus, the resistance to adriamycin acquired by overexpression of BSD2 might be partially explained by down-regulation of Smf2, but in addition to Smf2, other as of yet unidentified targets of Bsd2 must also be responsible for the resistance . 2005 Wiley-Liss, Inc. Biotechnol Bioeng, 2004 Oct 5, 88(1), 84 - 93 Physicochemical surface properties of brewing yeast influencing their immobilization onto spent grains in a continuous reactor; Branyik T et al.; Immobilization of brewing yeast onto a cellulose-based carrier obtained from spent grains, a brewing byproduct, by acid/base treatment has been studied in a continuously operating bubble-column reactor . The aim of this work was to study the mechanisms of brewing yeast immobilization onto spent grain particles through the information on physicochemical surface properties of brewing yeast and spent grain particles . Three mechanisms of brewing yeast immobilization onto spent grains carrier were proposed: cell-carrier adhesion, cell-cell attachment, and cell adsorption (accumulation) inside natural shelters (carrier's surface roughness) . The possibility of stable cell-carrier adhesion regarding the free energy of interaction was proved and the relative importance of long-range forces (Derjaguin-Landau-Verwey-Overbeek theory) and interfacial free energies was discussed . As for the cell-cell attachment leading to a multilayer yeast immobilization, a physicochemical interaction through localized hydrophobic regions on cell surface was hypothesized . However, neither flocculation nor chain formation mechanism can be excluded so far . The adsorption of brewing yeast inside sufficiently large crevices (pores) was documented with photomicrographs . A positive effect of higher dilution rate and increased hydrophobicity of base-treated spent grains on the yeast immobilization rate has also been found. Nucleic Acids Res, 2004 Sep 23, 32(16), 4945 - 53 Print 2004. Identification and cloning of two putative subunits of DNA polymerase epsilon in fission yeast; Spiga MG et al.; DNA polymerase epsilon (Pol epsilon) is a multi-subunit enzyme required for the initiation of chromosomal DNA replication . Here, we report the cloning of two fission yeast genes, called dpb3+ and dpb4+ that encode proteins homologous to the two smallest subunits of Pol epsilon . Although Dpb4 is not required for cell viability, Deltadpb4 mutants are synthetically lethal with mutations in four genes required for DNA replication initiation, cdc20+ (encoding DNA Pol epsilon), cut5+ (homologous to DPB11/TopBP1), sna41+ (homologous to CDC45) and cdc21+ (encoding Mcm4, a component of the pre-replicative complex) . In contrast to Dpb4, Dpb3 is essential for cell cycle progression . A glutathione S-transferase pull-down assay indicates that Dpb3 physically interacts with both Dpb2 and Dpb4, suggesting that Dpb3 associates with other members of the Pol epsilon complex . Depletion of Dpb3 leads to an accumulation of cells in S phase consistent with Dpb3 having a role in DNA replication . In addition, many of the cells have a bi-nucleate or multinucleate phenotype, indicating that cell separation is also inhibited . Finally, we have examined in vivo localization of green fluorescent protein (GFP)-tagged Dpb3 and Dpb4 and found that both proteins are localized to the nucleus consistent with their proposed role in DNA replication . However, in the absence of Dpb3, GFP-Dpb4 appears to be more dispersed throughout the cell, suggesting that Dpb3 may be important in establishing or maintaining normal localization of Dpb4. Int J Syst Evol Microbiol, 2004 Sep, 54(Pt 5), 1877 - 82 Bullera cylindrica sp . nov., Bullera hubeiensis sp . nov . and Bullera nakasei sp . nov., ballistoconidium-forming yeast species from plant leaves; Wang QM et al.; Among yeasts isolated from plant leaves collected in different regions of China that form whitish or yellowish colonies and symmetrical ballistoconidia, four strains were shown to represent three novel Bullera species by conventional and molecular taxonomic characterization . The novel species are described as Bullera cylindrica sp . nov . (type strain CB 169T = AS 2.2308T = CBS 9744T), Bullera hubeiensis sp . nov . (type strain HX 19.3T = AS 2.2466T = CBS 9747T) and Bullera nakasei sp . nov . (type strain HX 15.5T = AS 2.2435T = CBS 9746T) . These three species, and another eight previously described Bullera species represented by Bullera mrakii, formed a strongly supported distinct clade among the hymenomycetous yeasts in each of the phylogenetic trees drawn from the 26S rDNA D1/D2 domain and the internal transcribed spacer region sequences. Int J Syst Evol Microbiol, 2004 Sep, 54(Pt 5), 1857 - 9 Candida bombiphila sp . nov., a new asexual yeast species in the Wickerhamiella clade; Brysch-Herzberg M et al.; Two yeast strains were isolated from a bumblebee and bumblebee honey . The strains were almost identical in their D1/D2 domain of the large-subunit rDNA and their physiological abilities . In both respects the strains resembled Wickerhamiella domercqiae . On the basis of these data, it is proposed that the strains represent a novel species with the name Candida bombiphila sp . nov . The type strain is CBS 9712T (= NRRL Y-27640T = MH268T). Immunol Lett, 2004 Sep, 95(2), 155 - 9 Identification of cyclophilin A as a CD99-binding protein by yeast two-hybrid screening; Kim HJ et al.; CD99 is a 32kDa surface glycoprotein, which is involved in the migration of leukocytes and the transport of ganglioside GM1 and transmembrane proteins . To identify signaling mechanisms triggered by CD99 engagement, a LexA-based yeast two-hybrid system was utilized to identify proteins interacting with the cytoplasmic domains of CD99 . In seven positive clones, we attempted to ascertain whether cyclophilin A (CypA) was involved in CD99-mediated signaling, since CypA had been implicated as a signaling regulator for kinases and phosphatases . The interaction between CD99 and CypA was confirmed by co-immunoprecipitation and confocal immunofluorescence studies . Interestingly, the amounts of CypA associated with CD99 increased upon CD99 engagement . We prepared an expression plasmid by inserting CypA cDNA into pEGFP, in order to visualize cellular CypA . In HeLa or HEK 293T cells transfected with the pEGFP-CypA plasmid, GFP-tagged CypA was diffusely present in the cytoplasm of untreated cells . However, CypA-GFP moved to the cell periphery and membrane blebbing, and became colocalized with CD99 upon CD99 engagement . These results suggest that CypA may be either a signaling mediator or a signaling regulator for CD99. Curr Microbiol, 2004 Oct, 49(4), 274 - 81 MAP kinase and cAMP signaling pathways modulate the pH-induced yeast-to-mycelium dimorphic transition in the corn smut fungus Ustilago maydis; Martinez-Espinoza AD et al.; Acid pH induces the yeast-to-mycelium transition in haploid cells of Ustilago maydis . We tested two signal transduction pathways known to be involved in dimorphism for roles in acid-induced filamentation . In wild-type cells intracellular cAMP levels were reduced under acid growth . A mutant defective in the regulatory subunit of PKA, ubc1, failed to respond to acid induction on solid medium, but in liquid medium showed a mycelial phenotype at acid pH . Mutants in the pheromone-responsive MAP kinase pathway lost the capacity to grow as mycelium at acid pH, while a mutant in the pheromone response-transcriptional regulator, prf1, behaved as wild-type . Filamentation by both ubc1 and prf1 mutants was inhibited by addition of cAMP . A putative MAP kinase cascade adaptor protein gene, ubc2, complemented a previously identified myc mutant strain defective in pH-induced myceliation . These results indicate that pH-dependent dimorphism is regulated by two known signaling pathways but that an effector for cAMP signaling alternative to Ubc1 is present in U . maydis and that Prf1 is not the sole downstream target of MAP kinase signaling. EMBO J, 2004 Oct 13, 23(20), 4040 - 50 Epub 2004 Sep 23. Targeting of Swi/Snf to the yeast GAL1 UAS G requires the Mediator, TAF IIs, and RNA polymerase II; Lemieux K et al.; The chromatin remodeling activity of the Swi/Snf complex is essential for the expression of several yeast genes . Previous studies have suggested that recruitment of Swi/Snf requires the action of transcriptional activators . However, reports in metazoans and in yeast have provided evidence of interactions between Swi/Snf and the RNA polymerase II holoenzyme/Mediator complex . Here we show that recruitment of Swi/Snf to the galactose-inducible gene GAL1 cannot be fully achieved without the integrity of the Mediator complex, TAF IIs, and RNA polymerase II . Moreover, artificial recruitment of Mediator is sufficient to tether both Swi/Snf and SAGA to the GAL1 UAS G . We further demonstrate that Swi/Snf recruitment at GAL1 does not require acetylation of chromatin by Gcn5 nor the presence of SAGA . Based on these results, we conclude that interactions between the Gal4 activator and Swi/Snf are not sufficient to recruit the latter to the GAL1 UAS G, since interactions with the Mediator, TAF IIs, and RNA polymerase II are also important. Mol Biol Cell, 2004 Dec, 15(12), 5551 - 64 Epub 2004 Dec. Requirements of fission yeast septins for complex formation, localization, and function; An H et al.; Septins are GTP binding proteins important for cytokinesis in many eukaryotes . The Schizosaccaromyces pombe genome sequence predicts orthologues of four of five Saccharomyces cerevisiae septins involved in cytokinesis and these are named Spns1-4p . That spns1-4 are not essential genes permitted the application of a combined genetic and proteomics approach to determine their functional relationships . Our findings indicate that Spns1-4p are present throughout interphase as a diffusely localized approximately 8.5S complex containing two copies of each septin linked together as a chain in the order Spn3p-Spn4p-Spn1p-Spn2p . Septin recruitment to the medial region of the cell is genetically separable from ring formation, and whereas it is normally restricted to mitosis, it can be promoted without activation of the mitotic cell cycle machinery . Coalescence into ring structures requires Spn1p and Spn4p associate with at least one other septin subunit and the expression of Mid2p that is normally restricted to mitosis . This study establishes the functional requirements for septin complex organization in vivo. Mol Biol Cell, 2004 Dec, 15(12), 5219 - 30 Epub 2004 Dec. Spindle pole body duplication in fission yeast occurs at the G1/S boundary but maturation is blocked until exit from S by an event downstream of cdc10+; Uzawa S et al.; The regulation and timing of spindle pole body (SPB) duplication and maturation in fission yeast was examined by transmission electron microscopy . When cells are arrested at G1 by nitrogen starvation, the SPB is unduplicated . On release from G1, the SPBs were duplicated after 1-2 h . In cells arrested at S by hydroxyurea, SPBs are duplicated but not mature . In G1 arrest/release experiments with cdc2.33 cells at the restrictive temperature, SPBs remained single, whereas in cells at the permissive temperature, SPBs were duplicated . In cdc10 mutant cells, the SPBs seem not only to be duplicated but also to undergo partial maturation, including invagination of the nuclear envelope underneath the SPB . There may be an S-phase-specific inhibitor of SPB maturation whose expression is under control of cdc10(+) . This model was examined by induction of overreplication of the genome by overexpression of rum1p or cdc18p . In cdc18p-overexpressing cells, the SPBs are duplicated but not mature, suggesting that cdc18p is one component of this feedback mechanism . In contrast, cells overexpressing rum1p have large, deformed SPBs accompanied by other features of maturation and duplication . We propose a feedback mechanism for maturation of the SPB that is coupled with exit from S to trigger morphological changes. J Biol Chem, 2004 Dec 10, 279(50), 51817 - 27 Epub 2004 Dec 10. Mitochondrial protein oxidation in yeast mutants lacking manganese-(MnSOD) or copper- and zinc-containing superoxide dismutase (CuZnSOD): evidence that MnSOD and CuZnSOD have both unique and overlapping functions in protecting mitochondrial proteins from oxidative damage; O'Brien KM et al.; Saccharomyces cerevisiae expresses two forms of superoxide dismutase (SOD): MnSOD, encoded by SOD2, which is located within the mitochondrial matrix, and CuZnSOD, encoded by SOD1, which is located in both the cytosol and the mitochondrial intermembrane space . Because two different SOD enzymes are located in the mitochondrion, we examined the relative roles of each in protecting mitochondria against oxidative stress . Using protein carbonylation as a measure of oxidative stress, we have found no correlation between overall levels of respiration and the level of oxidative mitochondrial protein damage in either wild type or sod mutant strains . Moreover, mitochondrial protein carbonylation levels in sod1, sod2, and sod1sod2 mutants are not elevated in cells harvested from mid-logarithmic and early stationary phases, suggesting that neither MnSOD nor CuZnSOD is required for protecting the majority of mitochondrial proteins from oxidative damage during these early phases of growth . During late stationary phase, mitochondrial protein carbonylation increases in all strains, particularly in sod1 and sod1sod2 mutants . By using matrix-assisted laser desorption ionization time-of-flight mass spectrometry, we have found that specific proteins become carbonylated in sod1 and sod2 mutants . We identified six mitochondrial protein spots representing five unique proteins that become carbonylated in a sod1 mutant and 19 mitochondrial protein spots representing 11 unique proteins that become carbonylated in a sod2 mutant . Although some of the same proteins are carbonylated in both mutants, other proteins are not . These findings indicate that MnSOD and CuZnSOD have both unique and overlapping functions in the mitochondrion. J Biol Chem, 2004 Dec 3, 279(49), 50764 - 72 Epub 2004 Dec 3. Taz1 binding to a fission yeast model telomere: formation of telomeric loops and higher order structures; Tomaska L et al.; Similar to its human homologues TRF1 and TRF2, fission yeast Taz1 protein is a component of telomeric chromatin regulating proper telomere maintenance . As mammalian TRF1 and TRF2 proteins have been shown to directly bind telomeric DNA to form protein arrays and looped structures, termed t-loops, the ability of Taz1p to act on fission yeast telomeric DNA in similar ways was examined using purified protein and model DNA templates . When incubated with Taz1p, model telomeres containing 3' single-stranded telomeric overhangs formed t-loops at a frequency approaching 13% . Termini with blunt ends and non-telomeric overhangs were deficient in t-loop formation . In addition, we observed arrays of multiple Taz1p molecules bound to the telomeric regions, resembling the pattern of TRF1 binding . The presence of t-loops larger than the telomeric tract, a high frequency of end-bound DNAs and a donut shape of the Taz1p complex suggest that Taz1p binds the 3' overhang then extrudes a loop that grows in size as the donut slides along the duplex DNA . Based on these in vitro results we discuss possible general implications for fission yeast telomere dynamics. Mol Biochem Parasitol, 2004 Oct, 137(2), 239 - 45 3' UTR signals necessary for expression of the Plasmodium gallinaceum ookinete protein, Pgs28, share similarities with those of yeast and plants; Cann H et al.; During metazoan development, 3' UTR signals mediate the time and place of gene expression . For protozoan Plasmodium parasites, the formation of ookinetes from gametes in the mosquito midgut is an analogous developmental process . Previous studies of the 3' UTR signals necessary for expression of Pgs28, the major surface protein of Plasmodium gallinaceum ookinetes, suggested that a 3' UTR T-rich region and DNA sequences containing an ATTAAA eukaryotic polyadenylation consensus motif were necessary for its expression . During metazoan development, U-rich elements may function in conjunction with eukaryotic polyadenylation consensus signals to mediate developmental protein expression . To define whether the putative Plasmodium elements were mediators of Pgs28 expression mutations of these nucleotide sequences were made in plasmid constructs . The effect of the mutations on Pgs28 expression was tested by the transient gene transfection of sexual stage P . gallinaceum parasites . These studies reveal that two different mutations of the ATTAAA motif, which alter gene expression in higher eukaryotes and yeast, do not alter the expression of Pgs28 . However, the U-rich element, adjacent nucleotides UUUACAAAAUUGUUUUAACU and downstream nucleotides UAUAUAAAA are able to mediate expression to varying degrees . The organization and overlapping function of these elements appears to more closely resemble that of yeasts or plants than those of metazoans. J Cell Biol, 2004 Sep 27, 166(7), 969 - 74 Epub 2004 Sep 20. An AIF orthologue regulates apoptosis in yeast; Wissing S et al.; Apoptosis-inducing factor (AIF), a key regulator of cell death, is essential for normal mammalian development and participates in pathological apoptosis . The proapoptotic nature of AIF and its mode of action are controversial . Here, we show that the yeast AIF homologue Ynr074cp controls yeast apoptosis . Similar to mammalian AIF, Ynr074cp is located in mitochondria and translocates to the nucleus of yeast cells in response to apoptotic stimuli . Purified Ynr074cp degrades yeast nuclei and plasmid DNA . YNR074C disruption rescues yeast cells from oxygen stress and delays age-induced apoptosis . Conversely, overexpression of Ynr074cp strongly stimulates apoptotic cell death induced by hydrogen peroxide and this effect is attenuated by disruption of cyclophilin A or the yeast caspase YCA1 . We conclude that Ynr074cp is a cell death effector in yeast and rename it AIF-1 (Aif1p, gene AIF1). Biochem Biophys Res Commun, 2004 Oct 22, 323(3), 789 - 95 Copper-dependent protein-protein interactions studied by yeast two-hybrid analysis; van Dongen EM et al.; An important step in copper homeostasis is delivery of copper to a specific P-type ATPase in the Golgi apparatus (Ccc2 in yeast, ATP7A and ATP7B in humans) by a small copper chaperone protein (Atx1 in yeast, ATOX1 in humans) . Atx1 and ATOX1 both contain an MXCXXC motif that is also present in Ccc2 (two motifs) and ATP7A/B (six motifs) . Protein-protein interactions probably require coordination of one Cu(I) by cysteines from both MXCXXC motifs . We applied yeast two-hybrid analysis to screen systematically all possible interactions between MXCXXC-containing domains in these proteins . We demonstrate that ATOX1 and Atx1 preferentially interact with domains 2 and 4 of ATP7B and that Atx1 interacts with both Ccc2 domains . All combinations show a remarkable bell-shaped dependency on copper concentration that is maximal just below normal copper levels . Our results suggest that yeast two-hybrid analysis can be used to study the intracellular copper status of a cell. Curr Biol, 2004 Sep 21, 14(18), R748 - 50 Mitotic spindle: laser microsurgery in yeast cells; Carvalho P et al.; Laser microsurgery has led to remarkable discoveries in a number of cell types . Two recent studies have shown that this classical technology can now be employed with small yeast cells . This advance will enable regional ablation to be combined with facile genetic manipulation in a eukaryotic cell. Curr Biol, 2004 Sep 21, 14(18), 1675 - 9 Activation of the Gal1 gene of yeast by pairs of 'non-classical' activators; Cheng JX et al.; Eukaryotic transcriptional activators work by recruiting to DNA the transcriptional machinery, including protein complexes required for chromatin modification, transcription initiation, and elongation . Which of these complexes must be directly recruited to trigger transcription? We test various "non-classical" transcription activators (comprising a component of the transcriptional machinery fused to a DNA binding domain) for their abilities to activate transcription of a chromosomally integrated reporter in yeast . Among these newly constructed fusion proteins, none efficiently activated transcription when working on its own . However, in several instances transcription was activated by a pair of such fusion proteins tethered to adjacent sites on DNA . In each of these cases, one fusion protein bore a component of the SAGA complex, and the other bore a component of the Mediator complex . Transcription was also activated by certain tripartite fusion proteins comprising a Mediator and a SAGA component fused to a DNA binding domain . The results are consistent with the finding that the classical activator Gal4, working at the GAL1 promoter, activates transcription by (at least in part) independently recruiting SAGA and Mediator. Langmuir, 2004 Sep 28, 20(20), 8812 - 6 Grabbing yeast iso-1-cytochrome c by Cys102: an effective approach for the assembly of functionally active metalloprotein carpets; Gerunda M et al.; We report an approach for immobilizing iso-1-cytochrome c from Saccharomyces cerevisiae on oxygen exposing surfaces derivatized with SH-terminated silanes . The SH moieties from silanes have been brought to react with the partially buried Cys102, forming an intermolecular disulfide bond which anchored covalently cytochrome c to the surface . The presence of a single cysteine residue on the protein surface imparted a well-defined orientation to the molecular edifice . Molecular constructs obtained with native cytochrome c and with a cysteine-depleted mutant (C102T) have been investigated by means of scanning force microscopy under liquid, which was performed to assay the quality of the molecular carpet, showing that the native protein formed a robust monolayer at the surface, whereas only a negligible amount of physisorbed molecules were detected in the case of a mutant . UV-vis absorption spectroscopy was performed to confirm that immobilization takes place via the Cys102 residue . Linear sweep voltammetric measurements showed retention of the redox activity of the covalently immobilized cytochrome c, confirming the viability of the proposed immobilization method for obtaining monolayers of redox active molecules. World J Gastroenterol, 2004 Oct 15, 10(20), 2989 - 93 Yeast expression and DNA immunization of hepatitis B virus S gene with second-loop deletion of alpha determinant region; Hu H et al.; AIM: Immune escape mutations of HBV often occur in the dominant epitope, the second-loop of the a determinant of hepatitis B surface antigen (HBsAg) . To let the hosts respond to the subdominant epitopes in HBsAg may be an effective way to decrease the prevalence of immune escape mutants . For this reason, a man-made clone of HBV S gene with the second-loop deletion was constructed . Its antigenicity was evaluated by yeast expression analysis and DNA immunization in mice . METHODS: HBV S gene with deleted second-loop, amino acids from 139 to 145, was generated using splicing by overlap extension . HBV deleted S gene was then cloned into the yeast expression vector pPIC9 and the mammalian expression vector pcDNA3 to generate pHB-SDY and pHB-SD, respectively . The complete S gene was cloned into the same vectors as controls . The deleted recombinant HBsAg expressed in yeasts was detected using Abbott IMx HBsAg test kits, enzyme-linked immunoadsorbent assay (ELISA) and immune dot blotting to evaluate its antigenicity in vitro . The anti-HBs responses to DNA immunization in BALB/c mice were detected using Abbott IMx AUSAB test kits to evaluate the antigenicity of that recombinant protein in vivo . RESULTS: Both deleted and complete HBsAg were successfully expressed in yeasts . They were intracellular expressions . The deleted HBsAg could not be detected by ELISA, in which the monoclonal anti-HBs against the alpha determinant was used, but could be detected by Abbott IMx and immune dot blotting, in which multiple monoclonal anti-HBs and polyclonal anti-HBs were used, respectively . The activity of the deleted HBsAg detected by Abbott IMx was much lower than that of complete HBsAg (the ratio of sample value/cut off value, 106+/-26.7 vs 1 814.4+/-776.3, P<0.01, t = 5.02) . The anti-HBs response of pHB-SD to DNA immunization was lower than that of complete HBV S gene vector pHB (the positive rate 2/10 vs 6/10, 4.56+/-3.52 mIU/mL vs 27.60+/-17.3 mIU/mL, P = 0.02, t = 2.7) . CONCLUSIONS: HBsAg with deleted second-loop of the alpha determinant still has antigenicity, and can also raise weak anti-HBs response in mice to DNA immunization, suggesting that it is possible to develop a subdominant vaccine for preventing infections of immune escape mutants of HBV. J Biol Chem, 2004 Nov 26, 279(48), 49780 - 6 Epub 2004 Nov 26. The contributions of protein disulfide isomerase and its homologues to oxidative protein folding in the yeast endoplasmic reticulum; Xiao R et al.; In vitro, protein disulfide isomerase (Pdi1p) introduces disulfides into proteins (oxidase activity) and provides quality control by catalyzing the rearrangement of incorrect disulfides (isomerase activity) . Protein disulfide isomerase (PDI) is an essential protein in Saccharomyces cerevisiae, but the contributions of the catalytic activities of PDI to oxidative protein folding in the endoplasmic reticulum (ER) are unclear . Using variants of Pdi1p with impaired oxidase or isomerase activity, we show that isomerase-deficient mutants of PDI support wild-type growth even in a strain in which all of the PDI homologues of the yeast ER have been deleted . Although the oxidase activity of PDI is sufficient for wild-type growth, pulse-chase experiments monitoring the maturation of carboxypeptidase Y reveal that oxidative folding is greatly compromised in mutants that are defective in isomerase activity . Pdi1p and one or more of its ER homologues (Mpd1p, Mpd2p, Eug1p, Eps1p) are required for efficient carboxypeptidase Y maturation . Consistent with its function as a disulfide isomerase in vivo, the active sites of Pdi1p are partially reduced (32 +/- 8%) in vivo . These results suggest that PDI and its ER homologues contribute both oxidase and isomerase activities to the yeast ER . The isomerase activity of PDI can be compromised without affecting growth and viability, implying that yeast proteins that are essential under laboratory conditions may not require efficient disulfide isomerization. J Biol Chem, 2004 Nov 26, 279(48), 49762 - 72 Epub 2004 Nov 26. Roles of O-mannosylation of aberrant proteins in reduction of the load for endoplasmic reticulum chaperones in yeast; Nakatsukasa K et al.; The protein quality control system in the endoplasmic reticulum (ER) ensures that only properly folded proteins are deployed throughout the cells . When nonnative proteins accumulate in the ER, the unfolded protein response is triggered to limit further accumulation of nonnative proteins and the ER is cleared of accumulated nonnative proteins by the ER-associated degradation (ERAD) . In the yeast ER, aberrant nonnative proteins are mainly directed for the ERAD, but a distinct fraction of them instead receive O-mannosylation . In order to test whether O-mannosylation might also be a mechanism to process aberrant proteins in the ER, here we analyzed the effect of O-mannosylation on two kinds of model aberrant proteins, a series of N-glycosylation site mutants of prepro-alpha-factor and a pro-region-deleted derivative of Rhizopus niveus aspartic proteinase-I (Deltapro) both in vitro and in vivo . O-Mannosylation increases solubilities of the aberrant proteins and renders them less dependent on the ER chaperone, BiP, for being soluble . The release from ER chaperones allows the aberrant proteins to exit out of the ER for the normal secretory pathway transport . When the gene for Pmt2p, responsible for the O-mannosylation of these aberrant proteins, and that for the ERAD were simultaneously deleted, the cell exhibited enhanced unfolded protein response . O-Mannosylation may therefore function as a fail-safe mechanism for the ERAD by solubilizing the aberrant proteins that overflowed from the ERAD pathway and reducing the load for ER chaperones. Peptides, 2004 Sep, 25(9), 1465 - 76 A walk-through of the yeast mating pheromone response pathway; Bardwell L; The intracellular signal transduction pathway by which the yeast Saccharomyces cerevisiae responds to the presence of peptide mating pheromone in its surroundings is one of the best understood signaling pathways in eukaryotes, yet continues to generate new surprises and insights . In this review, we take a brief walk down the pathway, focusing on how the signal is transmitted from the cell-surface receptor-coupled G protein, via a MAP kinase cascade, to the nucleus. Eur J Biochem, 2004 Oct, 271(19), 3897 - 904 Use of hydrostatic pressure to produce 'native' monomers of yeast enolase; Kornblatt MJ et al.; The effects of hydrostatic pressure on yeast enolase have been studied in the presence of 1 mm Mn(2+) . When compared with apo-enolase, and Mg-enolase, the Mn-enzyme differs from the others in three ways . Exposure to hydrostatic pressure does not inactivate the enzyme . If the experiments are performed in the presence of 1 mm Mg(2+), or with apo-enzyme, the enzyme is inactivated {Kornblatt, M.J., Lange R., Balny C . (1998) Eur . J . Biochem 251, 775-780} . The UV spectra of the high pressure forms of the Mg(2+)- and apo-forms of enolase are identical and distinct from the spectrum of the form obtained in the presence of 1 mm Mn(2+); this suggests that Mn(2+) remains bound to the high pressure form of enolase . With Mn-enolase, the various spectral changes do not occur in the same pressure range, indicating that multiple processes are occurring . Pressure experiments were performed as a function of {Mn(2+)} and {protein} . One of the changes in the UV spectra shows a dependence on protein concentration, indicating that enolase is dissociating into monomers . The small changes in the UV spectrum and the retention of activity lead to a model in which enolase, in the presence of high concentrations of Mn(2+), dissociates into native monomers; upon release of pressure, the enzyme is fully active . Although further spectral changes occur at higher pressures, there is no inactivation as long as Mn(2+) remains bound . We propose that the relatively small and polar nature of the subunit interface of yeast enolase, including the presence of several salt bridges, is responsible for the ability of hydrostatic pressure to dissociate this enzyme into monomers with a native-like structure. Anal Chem, 2004 Sep 1, 76(17), 5149 - 56 Determination of methionine and selenomethionine in yeast by species-specific isotope dilution GC/MS; Yang L et al.; A method for the simultaneous determination of methionine (Met) and selenomethionine (SeMet) in yeast using species-specific isotope dilution (ID) gas chromatography/mass spectrometry (GC/MS) is described . Samples were digested by refluxing for 16 h with 4 M methanesulfonic acid . Analytes were derivatized with methyl chloroformate and extracted into chloroform for GC/MS analysis . In addition to use of commercially available 13C-enriched Met and SeMet spikes for species specific ID analysis, a 74Se-enriched SeMet spike was also available for comparison of results . In selective ion monitoring mode, the intensities of ions at m/z 221, 222, 269, 270, and 263 were used to calculate the 221/222, 269/270, and 269/263 ion ratios for quantification of Met and SeMet . Concentrations of 5959 +/- 33 and 3404 +/- 12 microg g(-1) (one standard deviation, n = 6) with relative standard deviations of 0.55 and 0.36% for Met and SeMet, respectively, were obtained using 13C-enriched spikes . A concentration of 3417 +/- 8 microg g(-1) (one standard deviation, n = 6) was obtained using the 74Se-enriched SeMet spike . The concentration of SeMet measured in the yeast is equivalent to 66.43 +/- 0.24% of total Se and 30.31 +/- 0.11% of total Met is in the form of SeMet . Method detection limits (three times the standard deviation) of 3.4 and 1.0 microg g(-1) were estimated for Met and SeMet, respectively, based on a 0.25-g subsample of yeast with 1 mL of extract used for derivatization . A similar concentration of 5930 +/- 29 microg g(-1) (one standard deviation, n = 4) for Met and a lower concentration of 2787 +/- 49 microg g(-1) (one standard deviation, n = 4) for SeMet were obtained for this yeast sample using species-specific ID analysis based on GC/MS with 13C-enriched Met and SeMet spikes when a 2-h open microwave digestion approach using 8 M methanesulfonic acid was used. EMBO J, 2004 Sep 29, 23(19), 3825 - 35 Epub 2004 Sep 16. A chromodomain protein, Chp1, is required for the establishment of heterochromatin in fission yeast; Sadaie M et al.; The chromodomain is a conserved motif that functions in the epigenetic control of gene expression . Here, we report the functional characterization of a chromodomain protein, Chp1, in the heterochromatin assembly in fission yeast . We show that Chp1 is a structural component of three heterochromatic regions-centromeres, the mating-type region, and telomeres-and that its localization in these regions is dependent on the histone methyltransferase Clr4 . Although deletion of the chp1(+) gene causes centromere-specific decreases in Swi6 localization and histone H3-K9 methylation, we show that the role of Chp1 is not exclusive to the centromeres . We found that some methylation persists in native centromeric regions in the absence of Chp1, which is also true for the mating-type region and telomeres, and det