|
|
Virchows Arch, 2002 Nov, 441(5), 475 - 80 Epub 2002 Apr 13. Molecular cytogenetic mapping of recurrent chromosomal breakpoints in tenosynovial giant cell tumors; Nilsson M et al.; Tenosynovial giant cell tumor (TGCT) is the most common benign tumor of synovium and tendon sheath . Cytogenetic data indicate that 1p11-13 is the region most frequently involved in structural rearrangements . With the aim of eventually identifying the genes associated with TGCT development, we have investigated 1p11-13 breakpoints using fluorescence in situ hybridization (FISH) analysis, with a panel of yeast artificial chromosome (YAC) probes covering 1p11-21 . Twenty-six tumors were analyzed by G-banding, and 24 of these showed a breakpoint in 1p11-13 . The cytogenetic findings add to previous observations that, among a variety of translocations involving 1p11-13, chromosome 2 is the most common translocation partner, with a breakpoint in 2q35-37 . This aberration was found in eight cases . Other recurrent translocation partners, found in two or three cases, were 5q22-31, 11q11-12, and 8q21-22 . Material from 21 tumors was available for FISH analysis, which revealed that the breakpoints clustered to one region spanned by two YAC probes, 914F6 and 885F12 located in 1p13.2, in 18 cases . Bacterial artificial chromosome probes were used to map the recurrent breakpoint on chromosome 2 . In four of seven cases there was a breakpoint within the sequence covered by probe 260J21, where the RDC1 gene is located, a gene reported to fuse with HMGIC in lipomas with a 2;12 translocation. Nat Cell Biol, 2002 Dec, 4(12), 986 - 92 Bicaudal-D regulates COPI-independent Golgi-ER transport by recruiting the dynein-dynactin motor complex; Matanis T et al.; The small GTPase Rab6a is involved in the regulation of membrane traffic from the Golgi apparatus towards the endoplasmic reticulum (ER) in a coat complex coatomer protein I (COPI)-independent pathway . Here, we used a yeast two-hybrid approach to identify binding partners of Rab6a . In particular, we identified the dynein-dynactin-binding protein Bicaudal-D1 (BICD1), one of the two mammalian homologues of Drosophila Bicaudal-D . BICD1 and BICD2 colocalize with Rab6a on the trans-Golgi network (TGN) and on cytoplasmic vesicles, and associate with Golgi membranes in a Rab6-dependent manner . Overexpression of BICD1 enhances the recruitment of dynein-dynactin to Rab6a-containing vesicles . Conversely, overexpression of the carboxy-terminal domain of BICD, which can interact with Rab6a but not with cytoplasmic dynein, inhibits microtubule minus-end-directed movement of green fluorescent protein (GFP)-Rab6a vesicles and induces an accumulation of Rab6a and COPI-independent ER cargo in peripheral structures . These data suggest that coordinated action between Rab6a, BICD and the dynein-dynactin complex controls COPI-independent Golgi-ER transport. Proc Natl Acad Sci U S A, 2002 Dec 24, 99(26), 17167 - 72 Epub 2002 Nov 21. NOSTRIN: a protein modulating nitric oxide release and subcellular distribution of endothelial nitric oxide synthase; Zimmermann K et al.; Activity and localization of endothelial nitric oxide synthase (eNOS) is regulated in a remarkably complex fashion, yet the complex molecular machinery mastering stimulus-induced eNOS translocation and trafficking is poorly understood . In a search by the yeast two-hybrid system using the eNOS oxygenase domain as bait, we have identified a previously uncharacterized eNOS-interacting protein, dubbed NOSTRIN (for eNOS traffic inducer) . NOSTRIN contains a single polypeptide chain of 506-aa residues of 58 kDa with an N-terminal cdc15 domain and a C-terminal SH3 domain . NOSTRIN mRNA is abundant in highly vascularized tissues such as placenta, kidney, lung, and heart, and NOSTRIN protein is expressed in vascular endothelial cells . Coimmunoprecipitation experiments demonstrated the eNOS-NOSTRIN interaction in vitro and in vivo, and NOSTRIN's SH3 domain was essential and sufficient for eNOS binding . NOSTRIN colocalized extensively with eNOS at the plasma membrane of confluent human umbilical venous endothelial cells and in punctate cytosolic structures of CHO-eNOS cells . NOSTRIN overexpression induced a profound redistribution of eNOS from the plasma membrane to vesicle-like structures matching the NOSTRIN pattern and at the same time led to a significant inhibition of NO release . We conclude that NOSTRIN contributes to the intricate protein network controlling activity, trafficking, and targeting of eNOS. J Biol Chem, 2003 Jan 24, 278(4), 2661 - 8 Epub 2002 Nov 21. ADP-ribosylation factor 4 small GTPase mediates epidermal growth factor receptor-dependent phospholipase D2 activation; Kim SW et al.; The epidermal growth factor receptor (EGFR) plays a critical role in the development, proliferation, and differentiation of cells of epithelial and mesenchymal origin . These EGFR-dependent cellular processes are mediated by a repertoire of intracellular signaling pathways triggered by the activation of the EGFR cytoplasmic domain, which originates from ligand binding of its extracellular domain . To understand the molecular mechanisms by which the intracellular domain of EGFR transmits mitogenic messages to the downstream signaling pathways, we used the cytoplasmic region of EGFR as bait in yeast two-hybrid screening . We found that ADP-ribosylation factor 4 (ARF4) interacts with the intracellular part of EGFR and mediates the EGF-dependent cellular activation of phospholipase D2 (PLD2) but does not mediate the activation of PLD1 . In addition, ARF4-mediated PLD2 activation leads to dramatic activation of the transcription factor activator protein 1 (AP-1), and, importantly, ARF4 activity is required for EGF-induced activation of cellular AP-1 . Our findings indicate that ARF4 is a critical molecule that directly regulates cellular PLD2 activity and that this ARF4-mediated PLD2 activation stimulates AP-1-dependent transcription in the EGF-induced cellular response. J Biol Chem, 2003 Feb 7, 278(6), 3742 - 50 Epub 2002 Nov 22. Mouse mu opioid receptor distal promoter transcriptional regulation by SOX proteins; Hwang CK et al.; We have identified transcription factors that bind to specific sequences in 5'-distal promoter regulatory sequences of the mouse mu opioid receptor (mor) promoter using the yeast one-hybrid system . The sequence between -746 and -707 in mor distal promoter was used as the bait because it acts as a functional promoter element and binds several DNA-binding proteins . From an adult mouse brain cDNA library, five cDNA clones encoding three Sox gene family (Sry like high mobility group (HMG) box gene) transcriptional factors, mSOX18, mSOX21, and mSOX6, were isolated . Electrophoretic mobility shift assays confirmed the presence of a binding site for SOX proteins in the -731/-725 region . Additionally, we have also established that the flanking regions outside the core Sox-binding site play an essential role in high affinity binding . DNase I footprint analysis indicates that proteins from mouse brain interact with the Sox-binding site within the mor distal promoter . Finally, we demonstrated that overexpression of mSOX18 and/or mSOX21 was able to up-regulate mouse mor distal promoter activity in mor-expressing neuronal cells (NMB) . These data indicate that SOX proteins might contribute to the transcriptional activity of the mor gene and suggest that mu opioid receptor could mediate some of the developmental processes in which SOX proteins are included. J Biol Chem, 2003 Feb 14, 278(7), 5062 - 71 Epub 2002 Nov 20. The p34cdc2-related cyclin-dependent kinase 11 interacts with the p47 subunit of eukaryotic initiation factor 3 during apoptosis; Shi J et al.; Cyclin-dependent kinase 11 (CDK11; also named PITSLRE) is part of the large family of p34(cdc2)-related kinases whose functions appear to be linked with cell cycle progression, tumorigenesis, and apoptotic signaling . However, substrates of CDK11 during apoptosis have not been identified . We used a yeast two-hybrid screening strategy and identified eukaryotic initiation factor 3 p47 protein (eIF3 p47) as an interacting partner of caspase-processed C-terminal kinase domain of CDK11 (CDK11(p46)) . We demonstrate that the eIF3 p47 can interact with CDK11 in vitro and in vivo, and the interaction can be strengthened by stimulation of apoptosis . EIF3 p47 contains a Mov34/JAB domain and appears to interact with CDK11(p46) through this motif . We show in vitro that the caspase-processed CDK11(p46) can phosphorylate eIF3 p47 at a specific serine residue (Ser(46)) and that eIF3 p47 is phosphorylated in vivo during apoptosis . Purified recombinant CDK11(p46) inhibited translation of a reporter gene in vitro in a dose-dependent manner . In contrast, a kinase-defective mutant CDK11(p46M) did not inhibit translation of the reporter gene . Stable expression of CDK11(p46) in vivo inhibited the synthesis of a transfected luciferase reporter protein and overall cellular protein synthesis . These data provide insight into the cellular function of CDK11 during apoptosis. Endocrinology, 2002 Dec, 143(12), 4665 - 72 Molecular evolution of adrenarche: structural and functional analysis of p450c17 from four primate species; Arlt W et al.; Adrenarche is the prepubertal onset of increased adrenal secretion of 19-carbon steroids, especially dehydroepiandrosterone (DHEA) . However, while human beings and chimpanzees exhibit adrenarche, other primates such as the baboon and rhesus monkey do not, and the adrenals of most other mammals produce little or no DHEA . Thus, the acquisition of adrenarche is a very recent evolutionary event . DHEA is produced from pregnenolone by the successive 17alpha-hydroxylase and 17,20 lyase activities of a single enzyme, P450c17 . To ascertain whether sequence differences in P450c17 contribute to adrenarche, we cloned the rhesus monkey cDNA from adrenal tissue and cloned the chimpanzee and baboon cDNAs from genomic DNA using an exon-trapping strategy . Using microsomes from yeast transformed with rhesus, baboon, chimp, or human P450c17, we measured the Michaelis constant and maximum velocity for the 17alpha-hydroxylase and 17,20 lyase activities . The human and chimp enzymes differ at only two amino acids and baboon and rhesus P450c17 only at a single residue; the human/chimp enzyme differed from the baboon/rhesus enzyme by 25-27 residues (95% identity) . Surprisingly, the greatest difference in enzymatic activities was a marked increase in 17alpha-hydroxylase activity of P450c17 in the baboon, which differs from rhesus only at residue 255 {arginine (Arg) in baboon, histine (His) in rhesus} . Residue 255 is also Arg in human and chimp . Wild-type human P450c17 and its Arg255His mutant had similar 17alpha-hydroxylase activities, but the Arg255Ala mutant had decreased 17alpha-hydroxylase activity . These data establish that Arg255 is important for 17alpha-hydroxylase activity and show that the evolution of adrenarche in higher primates is not determined by variations in the sequence of P450c17. Eur J Med Chem, 2002 Oct, 37(10), 783 - 91 Preparation and anticoagulant activity of the phosphosulfomannan PI-88; Yu G et al.; A yeast-derived phosphomannan mixture was chemically sulfonated and the composition and structure of the product mixture was studied . This phosphosulfomannan mixture, PI-88, is currently under clinical evaluation as an anti-cancer agent . Analysis using capillary electrophoresis demonstrated that PI-88 was a multi-component mixture . Gel permeation chromatography provided four fractions of PI-88 that contained components which differed in size from disaccharide to hexasaccharide, and by degree of sulfation . These fractions were characterised by spectroscopic and chromatographic methods and the structure of PI-88 is that expected based on the structure of the phosphomannan starting material . The anticoagulant activity of these fractions was evaluated and the structural requirements for activity are described. Biochem Biophys Res Commun, 2002 Dec 6, 299(3), 366 - 72 Physical interaction between hepatitis C virus NS4B protein and CREB-RP/ATF6beta; Tong WY et al.; By using a yeast two-hybrid assay, cyclic AMP-response-element-binding protein-related protein (CREB-RP), also called activating transcription factor 6beta (ATF6beta), was identified as a cellular protein that interacts with the NS4B protein of hepatitis C virus . An N-terminal half of NS4B and a central portion of CREB-RP/ATF6beta containing the basic leucine zipper (bZIP) domain were involved in the interaction . The interaction between NS4B and CREB-RP/ATF6beta was demonstrated also in mammalian cells by co-immunoprecipitation and confocal microscopic analyses using specific antibodies . The bZIP domain of ATF6alpha, which shares high sequence similarity with CREB-RP/ATF6beta, was also shown to interact with NS4B in yeast although the interaction was weaker than that between NS4B and CREB-RP/ATF6beta . CREB-RP/ATF6beta and ATF6alpha are known as endoplasmic reticulum (ER) stress-induced transcription factors . Collectively, our results imply the possibility that NS4B modulates certain cellular responses upon ER stress through the physical interaction with CREB-RP/ATF6beta and ATF6alpha. Curr Biol, 2002 Nov 19, 12(22), 1952 - 8 Integrating interactome, phenome, and transcriptome mapping data for the C . elegans germline; Walhout AJ et al.; By integrating functional genomic and proteomic mapping approaches, biological hypotheses should be formulated with increasing levels of confidence . For example, yeast interactome and transcriptome data can be correlated in biologically meaningful ways . Here, we combine interactome mapping data generated for a multicellular organism with data from both large-scale phenotypic analysis ("phenome mapping") and transcriptome profiling . First, we generated a two-hybrid interactome map of the Caenorhabditis elegans germline by using 600 transcripts enriched in this tissue . We compared this map to a phenome map of the germline obtained by RNA interference (RNAi) and to a transcriptome map obtained by clustering worm genes across 553 expression profiling experiments . In this dataset, we find that essential proteins have a tendency to interact with each other, that pairs of genes encoding interacting proteins tend to exhibit similar expression profiles, and that, for approximately 24% of germline interactions, both partners show overlapping embryonic lethal or high incidence of males RNAi phenotypes and similar expression profiles . We propose that these interactions are most likely to be relevant to germline biology . Similar integration of interactome, phenome, and transcriptome data should be possible for other biological processes in the nematode and for other organisms, including humans. Plant J, 2002 Nov, 32(4), 561 - 72 The plant disease resistance gene Asc-1 prevents disruption of sphingolipid metabolism during AAL-toxin-induced programmed cell death; Spassieva SD et al.; The nectrotrophic fungus Alternaria alternata f.sp . lycopersici infects tomato plants of the genotype asc/asc by utilizing a host-selective toxin, AAL-toxin, that kills the host cells by inducing programmed cell death . Asc-1 is homologous to genes found in most eukaryotes from yeast to humans, suggesting a conserved function . A yeast strain with deletions in the homologous genes LAG1 and LAC1 was functionally complemented by Asc-1, indicating that Asc-1 functions in an analogous manner to the yeast homologues . Examination of the yeast sphingolipids, which are almost absent in the lag1Deltalac1Delta mutant, showed that Asc-1 was able to restore the synthesis of sphingolipids . We therefore examined the biosynthesis of sphingolipids in tomato by labeling leaf discs with l-{3-3H}serine . In the absence of AAL-toxin, there was no detectable difference in sphingolipid labeling between leaf discs from Asc/Asc or asc/asc leaves . In the presence of pathologically significant concentrations of AAL-toxin however, asc/asc leaf discs showed severely reduced labeling of sphingolipids and increased label in dihydrosphingosine (DHS) and 3-ketodihydrosphingosine (3-KDHS) . Leaf discs from Asc/Asc leaves responded to AAL-toxin treatment by incorporating label into different sphingolipid species . The effects of AAL-toxin on asc/asc leaflets could be partially blocked by the simultaneous application of AAL-toxin and myriocin . Leaf discs simultaneously treated with AAL-toxin and myriocin showed no incorporation of label into sphingolipids or long-chain bases as expected . These results indicate that the presence of Asc-1 is able to relieve an AAL-toxin-induced block on sphingolipid synthesis that would otherwise lead to programmed cell death. Biochem J, 2003 Mar 15, 370(Pt 3), 979 - 86 Identification of a non-canonical E-box motif as a regulatory element in the proximal promoter region of the apolipoprotein E gene; Salero E et al.; We have used the yeast one-hybrid system to identify transcription factors with binding capability to specific sequences in proximal regions of the apolipoprotein E gene ( APOE ) promoter . The sequence between -113 and -80 nt, which contains regulatory elements in various cell types, was used as a bait to screen a human brain cDNA library . Four cDNA clones that encoded portions of the human upstream-stimulatory-factor (USF) transcription factor were isolated . Electrophoretic-mobility-shift assays ('EMSAs') using nuclear extracts from various human cell lines as well as from rat brain and liver revealed the formation of two DNA-protein complexes within the sequence CACCTCGTGAC (region -101/-91 of the APOE promoter) that show similarity to the E-box element . The retarded complexes contained USF1, as deduced from competition and supershift assays . Functional experiments using different APOE promoter-luciferase reporter constructs transiently transfected into U87, HepG2 or HeLa cell lines showed that mutations that precluded the formation of complexes decreased the basal activity of the promoter by about 50% . Overexpression of USF1 in U87 glioblastoma cells led to an increased activity of the promoter that was partially mediated by the atypical E-box . The stimulatory effect of USF1 was cell-type specific, as it was not observed in hepatoma HepG2 cells . Similarly, overexpression of a USF1 dominant-negative mutant decreased the basal activity of the promoter in glioblastoma, but not in hepatoma, cells . These data indicated that USF, and probably other related transcription factors, might be involved in the basal transcriptional machinery of APOE by binding to a non-canonical E-box motif within the proximal promoter. Biochem J, 2003 Mar 1, 370(Pt 2), 719 - 27 SDP1 is a peroxisome-proliferator-activated receptor gamma 2 co-activator that binds through its SCAN domain; Babb R et al.; Peroxisome-proliferator-activated receptors (PPARs), members of the nuclear hormone receptor superfamily, play an important role in the regulation of lipid metabolism and energy homoeostasis . In a yeast two-hybrid experiment using the zinc-finger transcription factor ZNF202 as bait, we previously identified the SCAN-domain-containing protein SDP1 . SDP1 shares a high degree of amino acid sequence identity with PGC-2, a previously identified PPAR gamma 2 co-activator from the mouse . Here we show that SDP1 and PGC-2 interact with PPAR gamma 2 through their SCAN domains, even though PPAR gamma 2 does not contain a SCAN domain . Similar to PGC-2, SDP1 enhanced PPAR gamma 2-dependent gene transcription in transiently transfected cells but did not alter the affinity of PPAR gamma 2 for agonists . Although the SCAN domain was necessary for binding to PPAR gamma 2, it was not sufficient for co-activation in cells, suggesting that other features of SDP1 are responsible for transcriptional co-activation . The ability of SDP1 to interact with two different transcription factors that regulate genes involved in lipid metabolism, ZNF202 and PPAR gamma 2, suggests that SDP1 may be an important co-regulator of such genes. Oncogene, 2002 Nov 21, 21(53), 8173 - 7 Expression of hpttg proto-oncogene in lymphoid neoplasias; Saez C et al.; Pituitary tumor-transforming gene (pttg) is a distinct proto-oncogene which is expressed in certain normal tissues with high proliferation rate and in a variety of tumors . PTTG is the vertebrate analog of yeast securins Pds1 and Cut2 with a key role in the regulation of sister chromatid separation during mitosis . Impairment of PTTG regulated functions is expected to lead to chromosomal instability and aneuploidy . Human pttg (hpttg) is abundantly expressed in Jurkat T lymphoblastic lymphoma cells but not in normal peripheral blood leukocytes . To obtain additional data on the potential role of hpttg in lymphomagenesis we selected 150 cases of lymphoid tumors for the assessment of hpttg expression in tumor tissues . Immunohistochemical studies on formalin-fixed, paraffin-embedded tissues revealed hPTTG in 38.8% of B-cell lymphomas, 70.2% of T-cell lymphomas, and 73.1% of Hodgkin's lymphomas . Among B-cell lymphomas, the most frequently immunostained tumors were plasma cell tumors, diffuse large cell lymphomas, and follicle center cell lymphomas . In Hodgkin's disease, immunoreactivity was mainly noted in Reed-Sternberg cells . In conclusion, the frequent overexpression of hpttg in many histological subtypes of lymphoma suggests the involvement of this proto-oncogene in lymphomagenesis. Med Sci Monit, 2002 Nov, 8(11), BR431 - 8 Development of a simple screening system for endocrine disruptors; Sugawara T et al.; BACKGROUND: An endocrine disruptor is a synthetic chemical, which causes adverse effects in an organism, or its progeny, after causing perturbations in the endocrine system . It is important to know which synthetic chemicals have endocrine-disrupting action . However, an increasing number of synthetic chemicals are being produced by modern synthetic chemistry, and the examination of endocrine disruptor potential has not yet caught up with the advances in synthetic chemistry . In this study, we have developed such a screening system for detecting synthetic chemicals with estrogen-like effects . MATERIAL/METHODS: The system was based on the yeast one-hybrid system . Both HIS3 and lacZ reporter genes connected to three tandem copies of the estrogen response element were prepared . Gal4-estrogen receptor is a fusion protein made from the activation domain (AD) of the yeast GAL4 transactivator gene and then incorporated into a plasmid, which was transfected into the YM4271 yeast cell strain . The estrogen effect was judged by this developed screening system . RESULTS: A dual reporter assay-system was established by transfection of the both HIS3 and lacZ reporter genes into the yeast cells . This screening system enabled the detection of as little as 10-12 mol of beta-estradiol . CONCLUSIONS: These results show that this newly developed dual assay is useful for the screening of endocrine-disruptors that have estrogen-like action. J Biol Chem, 2003 Feb 7, 278(6), 3521 - 6 Epub 2002 Nov 19. A novel active DNA topoisomerase I in Leishmania donovani; Villa H et al.; A common feature shared by type I DNA topoisomerases is the presence of a "serine, lysine, X, X, tyrosine" motif as conventional enzyme active site . Preliminary data have shown that Leishmania donovani DNA topoisomerase I gene (LdTOP1A) lacked this conserved motif, giving rise to different theories about the reconstitution of an active DNA topoisomerase I in this parasite . We, herein, describe the molecular cloning of a new DNA topoisomerase I gene from L . donovani (LdTOP1B) containing the highly conserved serine, lysine, X, X, tyrosine motif . DNA topoisomerase I activity was detected only when both genes (LdTOP1A and LdTOP1B) were co-expressed in a yeast expression system, suggesting the existence of a dimeric DNA topoisomerase I in Leishmania parasites. J Biol Chem, 2003 Feb 7, 278(6), 3985 - 91 Epub 2002 Nov 19. The hydrophilic domain of small ankyrin-1 interacts with the two N-terminal immunoglobulin domains of titin; Kontrogianni-Konstantopoulos A et al.; Little is known about the mechanisms that organize the internal membrane systems in eukaryotic cells . We are addressing this question in striated muscle, which contains two novel systems of internal membranes, the transverse tubules and the sarcoplasmic reticulum (SR) . Small ankyrin-1 (sAnk1) is an approximately 17-kDa transmembrane protein of the SR that concentrates around the Z-disks and M-lines of each sarcomere . We used the yeast two-hybrid assay to determine whether sAnk1 interacts with titin, a giant myofibrillar protein that organizes the sarcomere . We found that the hydrophilic cytoplasmic domain of sAnk1 interacted with the two most N-terminal Ig domains of titin, ZIg1 and ZIg2, which are present at the Z-line in situ . Both ZIg1 and ZIg2 were required for binding activity . sAnk1 did not interact with other sequences of titin that span the Z-disk or with Ig domains of titin near the M-line . Titin ZIg1/2 also bound T-cap/telethonin, a 19-kDa protein of the Z-line . We show that titin ZIg1/2 could form a three-way complex with sAnk1 and T-cap . Our results indicate that titin ZIg1/2 can bind sAnk1 in muscle homogenates and suggest a role for these proteins in organizing the SR around the contractile apparatus at the Z-line. J Biol Chem, 2003 Feb 7, 278(6), 4048 - 56 Epub 2002 Nov 19. Protein 4.1N is required for translocation of inositol 1,4,5-trisphosphate receptor type 1 to the basolateral membrane domain in polarized Madin-Darby canine kidney cells; Zhang S et al.; Protein 4.1N was identified as a binding molecule for the C-terminal cytoplasmic tail of inositol 1,4,5-trisphosphate receptor type 1 (IP(3)R1) using a yeast two-hybrid system . 4.1N and IP(3)R1 associate in both subconfluent and confluent Madin-Darby canine kidney (MDCK) cells, a well studied tight polarized epithelial cell line . In subconfluent MDCK cells, 4.1N is distributed in the cytoplasm and the nucleus; IP(3)R1 is localized in the cytoplasm . In confluent MDCK cells, both 4.1N and IP(3)R1 are predominantly translocated to the basolateral membrane domain, whereas 4.1R, the prototypical homologue of 4.1N, is localized at the tight junctions (Mattagajasingh, S . N., Huang, S . C., Hartenstein, J . S., and Benz, E . J., Jr . (2000) J . Biol . Chem . 275, 30573-30585), and other endoplasmic reticulum marker proteins are still present in the cytoplasm . Moreover, the 4.1N-binding region of IP(3)R1 is necessary and sufficient for the localization of IP(3)R1 at the basolateral membrane domain . A fragment of the IP(3)R1-binding region of 4.1N blocks the localization of co-expressed IP(3)R1 at the basolateral membrane domain . These data indicate that 4.1N is required for IP(3)R1 translocation to the basolateral membrane domain in polarized MDCK cells. Comp Biochem Physiol A Mol Integr Physiol, 2002 Nov, 133(3), 667 - 76 Unusual organic osmolytes in deep-sea animals: adaptations to hydrostatic pressure and other perturbants; Yancey PH et al.; Shallow-living marine invertebrates use free amino acids as cellular osmolytes, while most teleosts use almost no organic osmolytes . Recently we found unusual osmolyte compositions in deep-sea animals . Trimethylamine N-oxide (TMAO) increases with depth in muscles of some teleosts, skates, and crustaceans (up to 300 mmol/kg at 2900 m) . Other deep-sea animals had high levels of (1) . scyllo-inositol in echinoderms, gastropods, and polychaetes, (2) . that polyol plus beta-alanine and betaine in octopods, (3) . hypotaurine, N-methyltaurine, and unidentified methylamines in vestimentiferans from hydrothermal vents and cold seeps, and (4) . a depth-correlated serine-phosphate osmolyte in vesicomyid clams from trench seeps . We hypothesize that some of these solutes counteract effects of hydrostatic pressure . With lactate dehydrogenase, actin, and pyruvate kinase, 250 mM TMAO (but not glycine) protected both ligand binding and protein stability against pressure . To test TMAO in living cells, we grew yeast under pressure . After 1 h at 71 MPa, 3.5 h at 71 MPa, and 17 h at 30 MPa, 150 mM TMAO generally doubled the number of cells that formed colonies . Sulfur-based osmolytes which are not correlated with depth, such as hypotaurine and thiotaurine, are probably involved in sulfide metabolism and detoxification . Thus deep-sea osmolytes may have at least two other roles beyond acting as simple compatible osmotica. Food Addit Contam, 2002 Oct, 19(10), 990 - 5 Bioavailability of selenium in the defatted dark muscle of tuna; Yoshida M et al.; The content and bioavailability of selenium (Se) in the dark muscle of tuna (DMT) were studied . Fluorometric analysis showed that DMT contained 2.0-4.7 microg x g(-1) Se . A large part of Se of the DMT was recovered in the dry powder of the defatted fraction prepared by successive treatment with acetone and n-hexane/ethanol . On trypsin digestion of the defatted DMT, release of Se paralleled that of nitrogen and about 70% of Se was released within 4 h . Male weanling ddY mice were fed a Torula yeast-based Se-deficient diet (basal diet) for 3 weeks, and then fed the basal diet or a diet supplemented with a 0.05-0.25 microg x g(-1) Se as either sodium selenite or the defatted DMT for a further 1 week . Se contents and GSHPx activities in the liver increased gradually with increases in the amount of supplemented Se . No differences were observed between selenite and defatted DMT in the effect on Se content . At low Se levels, the effect of Se in the defatted DMT on the liver GSHPx activities was inferior to that of selenite, but at a high Se level, Se in the defatted DMT showed a greater effect . The bioavailability of Se in the defatted DMT, as assessed by slope ratio analysis using selenite as the reference Se, was 87% for the liver Se content and 168% for the GSHPx activity . The results indicate that the defatted DMT contains high levels of Se in a nutritionally available form. DNA Cell Biol, 2002 Oct, 21(10), 727 - 35 Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome; Majumdar M et al.; The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans . Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3 . Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans . This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers . Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns . The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search . Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used . In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence . These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA . We have also identified similar HABP1 pseudogenes in the rat and mouse genome . The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15 . In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence . All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames . Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene. J Urol, 2002 Dec, 168(6), 2645 - 9 Increased expression of the acid sphingomyelinase-like protein ASML3a in bladder tumors; Wright KO et al.; PURPOSE: The function of the tumor suppressor gene DBCCR1 (deleted in bladder cancer chromosome region 1) is unknown despite data supporting an important role for DBCCR1 in bladder tumorigenesis . DBCCR1 has not yet been placed in a protein family or functional pathway . Protein-protein interactions are crucial for almost every aspect of cellular function . We hypothesized that the discovery of DBCCR1 protein binding partners would yield important clues for solving the mystery of DBCCR1 function . MATERIALS AND METHODS: We used the yeast 2-hybrid system to screen an adult human bladder cDNA library for DBCCR1 interacting proteins . RESULTS: In the screen ASML3a (acid sphingomyelinase-like phosphodiesterase 3a) was identified as a novel DBCCR1 binding partner . Transient transfection of bladder tumor cell lines showed that DBCCR1 over expression in human bladder tumor cells results in the up-regulation of ASML3a RNA and protein expression . ASML3a protein was also differentially expressed in 8 of 12 bladder tumors relative to corresponding normal urothelial tissue . CONCLUSIONS: It appears that DBCCR1 and ASML3a are involved in the process of bladder tumorigenesis . Their interaction may provide clues to discern their functions. Development, 2003 Jan, 130(1), 185 - 95 Six3 and Six6 activity is modulated by members of the groucho family; Lopez-Rios J et al.; Six3 and Six6 are two genes required for the specification and proliferation of the eye field in vertebrate embryos, suggesting that they might be the functional counterparts of the Drosophila gene sine oculis (so) . Phylogenetic and functional analysis have however challenged this idea, raising the possibility that the molecular network in which Six3 and Six6 act may be different from that described for SO . To address this, we have performed yeast two-hybrid screens, using either Six3 or Six6 as a bait . In this paper, we report the results of the latter screen that led to the identification of TLE1 (a transcriptional repressor of the groucho family) and AES (a potential dominant negative form of TLE proteins) as cofactors for both SIX6 and SIX3 . Biochemical and mutational analysis shows that the Six domain of both SIX3 and SIX6 strongly interact with the QD domain of TLE1 and AES, but that SIX3 also interacts with TLE proteins via the WDR domain . Tle1 and Aes are expressed in the developing eye of medaka fish (Oryzias latipes) embryos, overlapping with the distribution of both Six3 and Six6 . Gain-of-function studies in medaka show a clear synergistic activity between SIX3/SIX6 and TLE1, which, on its own, can expand the eye field . Conversely, AES alone decreases the eye size and abrogates the phenotypic consequences of SIX3/6 over-expression . These data indicate that both Tle1 and Aes participate in the molecular network that control eye development and are consistent with the view that both Six3 and Six6 act in combination with either Tle1 and/or Aes. Exp Cell Res, 2002 Nov 15, 281(1), 28 - 38 HL60 cells halted in G1 or S phase differentiate normally; Brown G et al.; Differentiating agents regulate the proliferation and myeloid maturation of HL60 cells by mechanisms that are at least partly independent (Drayson et al., (2001), Exp . Cell Res . 266, 126-134) . We have investigated whether halting HL60 cells in G1 or S phase influences their commitment to or maturation along the neutrophil and monocyte pathways . Early G1 and S phase cells were isolated separately by elutriation . Quinidine was used to block the cell cycle progression of G1 cells and aphidicolin to greatly retard the progression of S phase cells . Neutrophilic (in response to all-trans-retinoic acid) or monocytic (to 1 alpha,25-dihydroxyvitamin D(3)) differentiation were assessed by induction of CD11b, M-CSF receptor and CD14 expression, acquisition of granulocyte-colony stimulating factor responsiveness, capacities to phagocytose yeast and reduce nitroblue tetrazolium, and down-regulation of CD30 and transferrin receptor expression . The cell-cycle-blocked cells differentiated at normal rates, mostly without incorporating bromodeoxyuridine . These observations establish: (a) that neither transit through the cell cycle nor a cell's position in the cell cycle substantially influences execution of the neutrophilic and monocytic differentiation programs by HL60 cells; and (b) that individual HL60 cells are genuinely bipotent. Neuron, 2002 Nov 14, 36(4), 611 - 22 A Drosophila homolog of cyclase-associated proteins collaborates with the Abl tyrosine kinase to control midline axon pathfinding; Wills Z et al.; We demonstrate that Drosophila capulet (capt), a homolog of the adenylyl cyclase-associated protein that binds and regulates actin in yeast, associates with Abl in Drosophila cells, suggesting a functional relationship in vivo . We find a robust and specific genetic interaction between capt and Abl at the midline choice point where the growth cone repellent Slit functions to restrict axon crossing . Genetic interactions between capt and slit support a model where Capt and Abl collaborate as part of the repellent response . Further support for this model is provided by genetic interactions that both capt and Abl display with multiple members of the Roundabout receptor family . These studies identify Capulet as part of an emerging pathway linking guidance signals to regulation of cytoskeletal dynamics and suggest that the Abl pathway mediates signals downstream of multiple Roundabout receptors. Z Naturforsch {C}, 2002 Sep-Oct, 57(9-10), 858 - 62 Mutant Hansenula polymorpha strain with constitutive alcohol oxidase and peroxisome biosynthesis; Hristozova T et al.; A mutant of the methylotrophic yeast Hansenula polymorpha with constitutive alcohol oxidase (AOX) and peroxisome biosynthesis was obtained after UV treatment followed by cell plating on a medium containing methanol and 2-deoxy-D-glucose (DOG) . DOG-resistant colonies of mutants were insensitive to catabolic repression by glucose and methanol . A selection procedure is described that allows the isolation of a mutant exhibiting a constitutive phenotype of AOX involved in methanol utilization . Furthermore, additional features of the constitutive presence of peroxisomes are demonstrated . 562 DOG-resistant colonies were tested, 24 of them demonstrating constitutive AOX formation . Based on quantitative analysis, one of the strains--DOG-13 was selected and its growth, biochemical and ultrastructural characteristics were examined . Its specific enzyme activity when cultivated on a yeast nitrogen base + 1% glucose (YNB + 1% Glucose) was found to reach 145 nmol x min(-1) x mg(-1) protein (compared to zero of the parent strain) after he 20th hour of cultivation . This was confirmed by fine-structure analysis, showing typical peroxisomes, which number and size increased with the enzyme activity . This study demonstrates a constitutive AOX and peroxisome biosynthesis by the mutant strain H . polymorpha DOG-13 obtained. Genetica, 2002 Aug, 115(3), 269 - 72 Cytogenetic mapping of five YAC clones to human chromosome region 2q31 --> q32.1 in relation to the FRA2G common fragile site; Pelliccia F et al.; In this work, five YAC clones have been mapped by fluorescent in situ hybridization (FISH) to human chromosome region 2q31 --> q32.1 and ordered in relation to each other and to the FRA2G common fragile site . YAC clones that span the fragile site have been identified . Moreover a deleted HOXD 13 gene has been identified on the 942D2 YAC. Cytogenet Genome Res, 2002, 97(1-2), 43 - 50 Multicolor chromosome banding (MCB) with YAC/BAC-based probes and region-specific microdissection DNA libraries; Liehr T et al.; Multicolor chromosome banding (MCB) allows the delineation of chromosomal regions with a resolution of a few megabasepairs, i.e., slightly below the size of most visible chromosome bands . Based on the hybridization of overlapping region-specific probe libraries, chromosomal subregions are hybridized with probes that fluoresce in distinct wavelength intervals, so they can be assigned predefined pseudo-colors during the digital imaging and visualization process . The present study demonstrates how MCB patterns can be produced by region-specific microdissection derived (mcd) libraries as well as collections of yeast or bacterial artificial chromosomes (YACs and BACs, respectively) . We compared the efficiency of an mcd library based approach with the hybridization of collections of locus-specific probes (LSP) for fluorescent banding of three rather differently sized human chromosomes, i.e., chromosomes 2, 13, and 22 . The LSP sets were comprised of 107 probes specific for chromosome 2, 82 probes for chromosome 13, and 31 probes for chromosome 22 . The results demonstrated a more homogeneous coverage of chromosomes and thus, more desirable banding patterns using the microdissection library-based MCB . This may be related to the observation that chromosomes are difficult to cover completely with YAC and/or BAC clones as single-color fluorescence in situ hybridization (FISH) experiments showed . Mcd libraries, on the other hand, provide high complexity probes that work well as region-specific paints, but do not readily allow positioning of breakpoints on genetic or physical maps as required for the positional cloning of genes . Thus, combinations of mcd libraries and locus-specific large insert DNA probes appear to be the most efficient tools for high-resolution cytogenetic analyses . Cytogenet Genome Res, 2002, 97(1-2), 13 - 9 Characterization of supernumerary rings and giant marker chromosomes in well-differentiated lipomatous tumors by a combination of G-banding, CGH, M-FISH, and chromosome- and locus-specific FISH; Micci F et al.; Supernumerary ring chromosomes and/or giant marker chromosomes are often seen in soft-tissue tumors of low-grade or borderline malignancy, such as well-differentiated liposarcomas or atypical lipomas . Classic cytogenetic banding techniques have proved insufficient to identify the genomic composition and structure of such rings and markers, but fluorescent in situ hybridization (FISH) studies have shown that they consist mainly of amplified material from chromosome 12, more specifically from bands 12q13-->q15 . We have used the new FISH-based screening techniques comparative genomic hybridization (CGH) and multicolor-FISH (M-FISH) in combination with G-banding and analysis by chromosome- and locus-specific fluorescent in situ probes to examine in detail the karyotypic characteristics of 22 lipomatous tumors, most of them classified histologically as well-differentiated liposarcomas, selected because they had been shown to harbor rings and/or marker chromosomes . M-FISH, in contrast to G- banding, was found to be informative with regard to the chromosomal origin of the rings and other markers present, whereas CGH and hybridizations with locus-specific probes helped identify which subchromosomal regions were involved . We found that chromosome bands 12q15-->q21 were always gained, with 12q15-->q21 being amplified (i.e., a green-to-red ratio >2 by CGH) in 14 of 22 tumors . In three tumors, two distinct but close amplicons in 12q could be identified, corresponding to bands 12q13-->q15 and 12q21 . The genomic segment 1q21-->q23 was gained in 12 cases, reaching the level of amplification in seven . Bands 6q24 and 7p15, whose pathogenetic involvement in liposarcomas has not been reported previously, were gained in three cases each . In addition, the rings and giant markers often contained interspersed sequences from several other chromosomes that did not give an equally clear impression of being nonrandomly involved . Biochem Biophys Res Commun, 2002 Nov 29, 299(2), 241 - 6 Cloning, expression, and genomic organization of mouse mp29 gene; Chang MS et al.; Human p29 has been demonstrated in the yeast two-hybrid method and in vitro GST pull-down assay to associate with GCIP, a cyclin D interacting protein . In this study, we describe the cloning and genomic structure of the mouse homologue, mp29 . The overall mouse mp29 amino acid sequence is highly identical (91%) to human p29 . Polyclonal antibody against mp29 was raised and the subcellular localization of mp29 was identified to be in the nucleus . Genomic clones containing mp29 gene were isolated and this gene was divided into seven exons spanning 9kb of genomic DNA . The transcription initiation site of mp29 gene was determined to be 94bp upstream of the translation initiation codon and the first 140bp proximal TATA-less promoter region is required to activate minimal transcription of mouse mp29 gene in mammalian cells. J Neurochem, 2002 Dec, 83(5), 1164 - 71 Interaction between GABAA receptor subunit intracellular loops: implications for higher order complex formation; Nymann-Andersen J et al.; The majority of fast inhibitory neurotransmission in the CNS is mediated by the GABA type-A (GABAA) receptor, a ligand-gated chloride channel . Of the approximately 20 different subunits composing the hetero-pentameric GABAA receptor, the gamma2 subunit in particular seems to be important in several aspects of GABAA receptor function, including clustering of the receptor at synapses . In this study, we report that the intracellular loop of the gamma2 subunit interacts with itself as well as with gamma1, gamma3 and beta1-3 subunits, but not with the alpha subunits . We further show that gamma2 subunits interact with photolabeled pentameric GABAA receptors composed of alpha1, beta2/3 and gamma2 subunits, and calculate the dissociation constant to be in the micromolar range . By using deletion constructs of the gamma2 subunit in a yeast two-hybrid assay, we identified a 23-amino acid motif that mediates self-association, residues 389-411 . We confirmed this interaction motif by inhibiting the interaction in a glutathione-S-transferase pull-down assay by adding a corresponding gamma2-derived peptide . Using similar approaches, we identified the interaction motif in the gamma2 subunit mediating interaction with the beta2 subunit as a 47-amino acid motif that includes the gamma2 self-interacting motif . The identified gamma2 self-association motif is identical to the interaction motif reported between GABAA receptor and GABAA receptor-associated protein (GABARAP) . We propose a model for GABAA receptor clustering based on GABARAP and GABAA receptor subunit-subunit interaction. Mol Plant Microbe Interact, 2002 Oct, 15(10), 1050 - 7 Multiple domains within the Cauliflower mosaic virus gene VI product interact with the full-length protein; Li Y et al.; The Cauliflower mosaic virus (CaMV) gene VI product (P6) is a multifunctional protein essential for viral propagation . It is likely that at least some of these functions require P6 self-association . The work described here was performed to confirm that P6 self-associates and to identify domains involved in this interaction . Yeast two-hybrid analyses indicated that full-length P6 self-associates and that this interaction is specific . Additional analyses indicated that at least four independent domains bind to full-length P6 . When a central domain (termed domain D3) was removed, these interactions were abolished . However, this deleted P6 was able to bind to the full-length wild-type protein and to isolated domain D3 . Viruses lacking domain D3 were incapable of producing a systemic infection . Isolated domain D3 was capable of binding to at least two of the other domains but was unable to self-associate . This suggests that domain D3 facilitates P6 self-association by binding to the other domains but not itself . The presence of multiple domains involved in P6 self-association may help explain the ability of this protein to form the intracellular inclusions characteristic of caulimoviruses. Biol Chem, 2002 Jul-Aug, 383(7-8), 1215 - 21 Role of the prosegment of Fasciola hepatica cathepsin L1 in folding of the catalytic domain; Cappetta M et al.; The N-terminal propeptides of cysteine proteinases play regulatory roles in the folding and stability of their catalytic domains, as well as being potent and highly specific inhibitors of their parental mature enzymes . Cysteine proteinases play a major role in the biology of the parasitic trematode Fasciola hepatica; in particular, this organism secretes significant amounts of cathepsin L enzymes . The isolated propeptide of F . hepatica cathepsin L1 functioned as a chaperone for the mature enzyme in renaturation experiments . A double point mutation (N701/F721) within the GxNxFxD motif of the propeptide affected its conformation and markedly decreased its affinity for the mature enzyme . When this mutation was introduced into preprocathepsin L1 expressed in yeast, the secretion of active enzyme dropped dramatically . However, significant enzyme activity was recovered from the culture supernatants after denaturation and renaturation in the presence of native propeptide . Thus, the variant prosegment gave rise to an enzyme with altered conformation, which could be refolded to the active form with the assistance of the native propeptide. Biol Chem, 2002 Jul-Aug, 383(7-8), 1059 - 66 Discovery of chemokine substrates for matrix metalloproteinases by exosite scanning: a new tool for degradomics; Overall CM et al.; Increasingly it is being recognized that matrix metalloproteinases (MMPs) are important processing enzymes that regulate cellular behaviour and immune cell function by selective proteolysis of cell surface receptors and adhesion molecules, cytokines and growth factors . These functions will likely prove to be as important in vivo as the proposed roles of MMPs in pathological matrix degradation . To screen for new protease substrates we have reported a novel 'exosite scanning' strategy that utilizes protease substrate-binding exosite domains as yeast two-hybrid baits . We discovered that the chemokine monocyte chemoattractant protein-3 (MCP-3) binds the hemopexin C domain of gelatinase A (MMP-2) leading to its efficient cleavage, converting an agonist to a potent receptor antagonist . We have now found that other MMPs cleave MCP-1, MCP-2, MCP-3, MCP-4, SDF-lalpha and SDF-1beta indicating that the intersection between the chemokine and MMP families is broad with important implications for the control of inflammatory and immune processes . Use of engineered substrates with altered exosite binding affinities further revealed the power of exosites in dictating proteolytic specificity - either directing cleavage of non-preferred sites or in other cases virtually eliminating proteolysis of readily accessible scissile bonds . Hence, bioinformatic searches for protease substrates based on scissile bond preference will only reveal a subset of substrates unless the influence of exosites is considered. Mol Pharmacol, 2002 Dec, 62(6), 1332 - 8 Mss4 gene is up-regulated in rat brain after chronic treatment with antidepressant and down-regulated when rats are anhedonic; Andriamampandry C et al.; Differential display reverse transcription-polymerase chain reaction was used to identify mRNAs that are differentially expressed in the brain of rats treated chronically with the reference tricyclic antidepressant, imipramine, in comparison with control rats . The gene encoding for a mutation suppressor for Sec4-8 yeast (Mss4) transcript is overexpressed in the amygdala of treated rats after 3 weeks of daily administration . This overexpression is also found in the hippocampus of rats treated chronically with either tianeptine or fluoxetine . Mss4 protein has the properties of a guanine nucleotide exchange factor, interacting with several members of the Rab family implicated in Ca(2+)-dependent exocytosis of neurotransmitters . Mss4 was also overexpressed in other brain structures as judged by in situ hybridization . The kinetics of the up-regulation of Mss4 gene expression measured by Northern blot during the imipramine, tianeptine, or fluoxetine treatments are consistent with an antidepressant effect that occurs after 3 weeks . In rats in which anhedonia was induced by chronic mild stress during 3 weeks, Mss4 transcripts were specifically down-regulated in hippocampus and amygdala compared with control rats . It is proposed that Mss4 protein, which stimulates exocytosis in vivo, participates in the potentiation of the activity of neurotransmitter pathways implicated in the action of several antidepressants and constitutes one of the common functional molecules induced after chronic antidepressant treatment. J Biol Chem, 2003 Feb 14, 278(7), 5399 - 409 Epub 2002 Nov 14. Identification and cloning of a novel family of coiled-coil domain proteins that interact with O-GlcNAc transferase; Iyer SP et al.; The abundant and dynamic post-translational modification of nuclear and cytosolic proteins by beta-O-linked N-acetylglucosamine (O-GlcNAc) is catalyzed by O-GlcNAc transferase (OGT) . Here we used the yeast two-hybrid approach to identify and isolate GABA(A) receptor-associated protein, GRIF-1 (Beck, M., Brickley, K., Wilkinson, H . L., Sharma, S., Smith, M., Chazot, P . L., Pollard, S., and Stephenson, F . A . (2002) J . Biol . Chem . 277, 30079-30090), and its novel homolog, OIP106 (KIAA1042), as novel OGT-interacting proteins . The proteins are highly similar to each other but are encoded by two separate genes . Both GRIF-1 and OIP106 contain coiled-coil domains and interact with the tetratricopeptide repeats of OGT . GRIF-1 and OIP106 are modified by O-GlcNAc and therefore are substrates for OGT . However, unlike another high affinity protein substrate, such as nucleoporin p62, OIP106 and GRIF-1 co-immunoprecipitate with OGT, exhibiting stable in vitro and in vivo associations . Whereas GRIF-1 has been reported to be expressed only in excitable tissue, OIP106 is expressed in all human cell lines that were examined . Confocal and electron microscopy show that OIP106 localizes to nuclear punctae in HeLa cells and co-localizes with RNA polymerase II . Co-immunoprecipitation experiments confirm the presence of an in vivo RNA polymerase II-OIP106-OGT complex, suggesting that OIP106 may target OGT to transcriptional complexes for glycosylation of transcriptional proteins, such as RNA polymerase II, and transcription factors . Similarly, GRIF-1 may serve to target OGT to GABA(A) receptor complexes for mediating GABA signaling cascades. FEBS Lett, 2002 Nov 20, 531(3), 529 - 37 N-terminal PDZ-binding domain in Kv1 potassium channels; Eldstrom J et al.; We have investigated the interactions of prototypical PDZ domains with both the C- and N-termini of Kv1.5 and other Kv channels . A combination of in vitro binding and yeast two-hybrid assays unexpectedly showed that PDZ domains derived from PSD95 bind both the C- and N-termini of the channels with comparable avidity . From doubly transfected HEK293 cells, Kv1.5 was found to co-immunoprecipitate with the PDZ protein, irrespective of the presence of the canonical C-terminal PDZ-binding motif in Kv1.5 . Imaging analysis of the same HEK cell lines demonstrated that co-localization of Kv1.5 with PSD95 at the cell surface is similarly independent of the canonical PDZ-binding motif . Deletion analysis localized the N-terminal PDZ-binding site in Kv1.5 to the T1 region of the channel . Co-expression of PSD95 with Kv1.5 N- and C-terminal deletions in HEK cells had contrasting effects on the magnitudes of the potassium currents across the membranes of these cells . These findings may have important implications for the regulation of channel expression and function by PDZ proteins like PSD95. FEBS Lett, 2002 Nov 20, 531(3), 494 - 8 Stimulation of IKK-gamma oligomerization by the human T-cell leukemia virus oncoprotein Tax; Huang GJ et al.; Human T-cell leukemia virus type 1 oncoprotein Tax activates NF-kappaB through direct binding to IKK-gamma, the regulatory component of the IkappaB kinase complex . Mechanisms by which IKK-gamma adapts the Tax signal to the IkappaB kinase are poorly understood . Here we demonstrate that IKK-gamma forms homodimer and homotrimer both in vitro and in yeast or mammalian cells through a C-terminal domain comprising amino acids 251-419 . In contrast, Tax protein targets a central region of IKK-gamma, which consists of amino acids 201-250 . Interestingly, Tax stimulates the oligomerization of IKK-gamma, likely through direct binding . Taken together, our findings suggest a new model of Tax activation of NF-kappaB, in which Tax interacts with IKK-gamma to stimulate its oligomerization. Dev Biol, 2002 Nov 15, 251(2), 333 - 47 The GLH proteins, Caenorhabditis elegans P granule components, associate with CSN-5 and KGB-1, proteins necessary for fertility, and with ZYX-1, a predicted cytoskeletal protein; Smith P et al.; The GLH proteins belong to a family of four germline RNA helicases in Caenorhabditis elegans . These putative ATP-dependent enzymes localize to the P granules, which are nonmembranous complexes of protein and RNA exclusively found in the cytoplasm of all C . elegans germ cells and germ cell precursors . To determine what proteins the GLHs bind, C . elegans cDNA libraries were screened by the yeast two-hybrid method, using GLHs as bait . Three interacting proteins, CSN-5, KGB-1, and ZYX-1, were identified and further characterized . GST pull-down assays independently established that these proteins bind GLHs . CSN-5 is closely related to the subunit 5 protein of COP9 signalosomes, conserved multiprotein complexes of plants and animals . RNA interference (RNAi) with csn-5 results in sterile worms with small gonads and no oocytes, a defect essentially identical to that produced by RNAi with a combination of glh-1 and glh-4 . KGB-1 is a putative JNK MAP kinase that GLHs bind . A kgb-1 deletion strain has a temperature-sensitive, sterile phenotype characterized by the absence of mature oocytes and the presence of trapped, immature oocytes that have undergone endoreplication . ZYX-1 is a LIM domain protein most like vertebrate Zyxin, a cytoskeletal adaptor protein . In C . elegans, while zyx-1 appears to be a single copy gene, neither RNAi depletion nor a zyx-1 deletion strain results in an obvious phenotype . These three conserved proteins are the first members in each of their families reported to associate with germline helicases . Similar to the loss of GLH-1 and GLH-4, loss of either CSN-5 or KGB-1 causes oogenesis to cease, but does not affect the initial assembly of P granules. Dev Biol, 2002 Nov 15, 251(2), 294 - 306 Syntaxin 5 is required for cytokinesis and spermatid differentiation in Drosophila; Xu H et al.; Syntaxin 5 is a Golgi-localized SNARE protein that has been shown to be required for ER-Golgi traffic in yeast and Golgi reassembly following cell division in mammalian cells . Here, we describe the characterization of the Drosophila ortholog of syntaxin 5, dSyx5, and show that, like its mammalian and yeast counterparts, the protein is localized to the Drosophila Golgi and binds to alpha-SNAP . Null mutations in dSyx5 are larval lethal and demonstrate impaired transport of a GFP-tagged membrane protein . A hypomorphic allele of dSyx5 caused by insertion of an EP element results in impenetrant lethality, and escaping adult flies are male sterile . The male sterility results both from failure of germ cells to complete cytokinesis and from defects in spermatid elongation and maturation . Ectopic expression of dSyx5 from the EP element can rescue the cytokinesis defect, but high levels of expression are required to restore maturation and fertility . Together, these results show that dSyx5 is required for the proper function of the Golgi apparatus and that an efficiently functioning Golgi apparatus is required for the steps leading to the completion of cytokinesis and formation of mature sperm. Curr Eye Res, 2002 May, 24(5), 392 - 6 Protein Phosphatase 1 binds strongly to the retinoblastoma protein but not to p107 or p130 in vitro and in vivo; Dunaief JL et al.; PURPOSE: To identify and characterize retinoblastoma protein (pRb) binding proteins that may influence retinoblast proliferation and retinal pigment epithelial cell survival . METHODS: The yeast two-hybrid system was used to screen a bovine retinal cDNA library and to characterize positive clones . DNA sequencing and site-directed mutagenesis were used for further analysis . Co-immunoprecipitation experiments were used to confirm the results of the two-hybrid system in vivo . RESULTS: In the two-hybrid system, Protein Phosphatase 1alpha1 (PP1alpha1) binds the retinoblastoma protein . Unlike several other pRb binding proteins, PP1alpha1 binds only weakly to the Rb family member p107, and does not demonstrate detectable binding to p130 . Confirming the two-hybrid results, endogenous PP1 in a human retinal pigment epithelial (RPE) cell line co-immunoprecipitates with endogenous pRb but not p107 or p130 . Site directed mutagenesis of two pRb binding motifs in PP1alpha1 from LXSXE to LXCXE leads to slight increases in its two-hybrid interaction with pRb but does not alter its binding preference for pRb over the other family members . The complete sequence of bovine PP1alpha1 is reported . CONCLUSIONS: The strong two-hybrid interaction between PP1alpha1 and pRb, but not p107 or p130, suggests that the phosphorylation status of members of the pRb family may be regulated by different phosphatases, contributing to fine control of cell cycle progression . Conversely, PP1 activity may be specifically regulated by pRb and not p107 or p130 . Mutagenesis studies suggest that PP1alpha1's LXSXE motif is not responsible for its binding preference for pRb over p107 and p130 . Disruption of the PP1-pRb interaction may influence retinoblastoma tumorigenesis as well as RPE cell proliferation and survival. Science, 2003 Jan 3, 299(5603), 112 - 4 Epub 2002 Nov 14. Modulation of ATP-dependent chromatin-remodeling complexes by inositol polyphosphates; Shen X et al.; Eukaryotes use adenosine triphosphate (ATP)-dependent chromatin-remodeling complexes to regulate gene expression . Here, we show that inositol polyphosphates can modulate the activities of several chromatin-remodeling complexes in vitro . Inositol hexakisphosphate (IP6) inhibits nucleosome mobilization by NURF, ISW2, and INO80 complexes . In contrast, nucleosome mobilization by the yeast SWI/SNF complex is stimulated by inositol tetrakisphosphate (IP4) and inositol pentakisphosphate (IP5) . We demonstrate that mutations in genes encoding inositol polyphosphate kinases that produce IP4, IP5, and IP6 impair transcription in vivo . These results provide a link between inositol polyphosphates, chromatin remodeling, and gene expression. Curr Opin Genet Dev, 2002 Dec, 12(6), 711 - 8 Conflict begets complexity: the evolution of centromeres; Malik HS et al.; Centromeres mediate the faithful segregation of eukaryotic chromosomes . Yet they display a remarkable range in size and complexity across eukaryotes, from approximately 125 bp in budding yeast to megabases of repetitive satellites in human chromosomes . Mapping the fine-scale structure of complex centromeres has proven to be daunting, but recent studies have provided a first glimpse into this unexplored bastion of our genomes and the evolutionary pressures that shape it . Evolutionary studies of proteins that bind centromeric DNA suggest genetic conflict as the underlying basis of centromere complexity, drawing interesting parallels with the myriad selfish elements that employ centromeric activity for their own survival. Curr Opin Genet Dev, 2002 Dec, 12(6), 695 - 700 The evolution of developmental regulatory pathways; Gibson G et al.; Evolutionary analysis of the content of developmental regulatory pathways has been advanced by the publication of pairs of complete genome sequences from representative taxonomic groups . Annotation of the fission yeast, rice, and mouse genomes confirms that most regulatory families are shared among eukaryotes but also shows that certain gene families have restricted distributions . Theoretical advances in the past few years include development of the theory of scale-free networks, which provides a new framework in which to consider the connectivity and evolution of regulatory systems, and introduction of algorithms that use comparative data to enhance detection of transcriptional regulatory motifs. Int Immunopharmacol, 2002 Oct, 2(11), 1599 - 602 Effect of antipyretics on polymorphonuclear leukocyte functions in children; Gurer US et al.; The aim of this study was to investigate whether fever and antipyretic drugs had an adverse effect on human polymorphonuclear leukocyte (PMN) functions (phagocytic and intracellular killing activity) . Twenty febrile children with an axillary temperature of 39-40 degrees C and 20 healthy children without fever were included . Polymorphonuclear leukocytes were isolated . The effects of in vitro addition of antipyretic drugs (acetaminophen, metamizole sodium, nimesulid and ibuprofen) on PMN functions were tested . Phagocytic activity was assayed by the ingestion of yeast cells by PMNs and intracellular killing activity by the ingestion of yeast cells (stained blue) killed by PMNs . PMNs derived from febrile children exhibited better phagocytic activity when ibuprofen was added . In contrast, phagocytic activity was enhanced when acetaminophen, metamizole sodium or nimesulid was added in children without fever . Intracellular killing activity was enhanced when ibuprofen or metamizole sodium was added in children without fever . We conclude the antipyretic drugs at safely achievable concentrations do not suppress PMN function in vitro. J Mol Microbiol Biotechnol, 2002 Nov, 4(6), 551 - 4 Approaches to library screening; Campbell TN et al.; Fuelled by the drive to complete the Human Genome Project, many laboratories have developed new methods of screening clone libraries . From PCR-based strategies to pooling schemes and increased automation, the tedious task of library screening has become less labour-intensive and more cost-efficient . Currently, two main screening methods dominate: hybridization and polymerase chain reaction (PCR) . In the following article, we present a brief overview of hybridization and PCR-based screening of yeast and bacterial libraries . Multi-faceted approaches combining different techniques, as well as less frequently employed methods such as fingerprinting are also described. Cancer Biol Ther, 2002 Jul-Aug, 1(4), 428 - 32 The pro-oncoprotein EWS (Ewing's Sarcoma protein) interacts with the Brn-3a POU transcription factor and inhibits its ability to activate transcription; Thomas GR et al.; The Brn-3a POU family transcription factor is able to induce the expression of a number of neuronally-expressed genes as well as to enhance neuronal differentiation and inhibit apoptosis . Many of these effects are mediated by the C-terminal POU domain of Brn-3a which acts both as a DNA binding domain and a transcriptional activation domain . To identify the mechanisms by which this domain acts, we carried out a yeast two hybrid assay to identify proteins which interact with it . We show that both full length Brn-3a and the isolated POU domain interact with the EWS transcription factor and its oncogenic derivative EWS-Fli1 . Moreover, EWS can block Brn-3a-mediated activation of the Bcl-x promoter whereas this effect is lost in EWS-Fli1 . The significance of this novel interaction is discussed in terms of the manner in which Brn-3a regulates its target promoters and the mechanism of oncogenic transformation by EWS-Fli1. Cancer Biol Ther, 2002 Jul-Aug, 1(4), 370 - 4 Selenomethionine inhibits growth and suppresses cyclooxygenase-2 (COX-2) protein expression in human colon cancer cell lines; Baines A et al.; Currently, selenium (in the form of high selenium containing yeast or selenomethionine) is being evaluated for anticancer effects against both human colon polyp recurrence and human prostate cancer, respectively . Chemical speciation analysis of the high selenium containing yeast indicates that selenomethionine (SeMet) is a major constituent of selenized yeast . We tested the hypothesis that SeMet might affect colon cancer cell growth by mechanisms involving cyclooxygenases (COX) . The growth of all four-colon cancer cell lines tested was inhibited by selenomethionine . Furthermore, selenomethionine decreased COX-2 protein and PGE2 levels in HCA-7 cells . Selenomethionine suppressed COX-2 RNA levels in HCA-7 cells which could account for decreased COX-2 protein levels . Finally, the addition of PGE2 protected cells from the antiproliferative effects of selenomethionine in a concentration dependent manner . Selenomethionine might regulate COX-2 at the transcriptional level . These data suggests that Se-Met-induced cell growth inhibition may be, in part, mediated by COX-2 dependent mechanisms . The results of this study support the use of selenium agents in colon cancer chemoprevention trials. J Cell Sci, 2002 Dec 15, 115(Pt 24), 4925 - 36 Subcellular targeting of metabolic enzymes to titin in heart muscle may be mediated by DRAL/FHL-2; Lange S et al.; During sarcomere contraction skeletal and cardiac muscle cells consume large amounts of energy . To satisfy this demand, metabolic enzymes are associated with distinct regions of the sarcomeres in the I-band and in the M-band, where they help to maintain high local concentrations of ATP . To date, the mechanism by which metabolic enzymes are coupled to the sarcomere has not been elucidated . Here, we show that the four and a half LIM-only protein DRAL/FHL-2 mediates targeting of the metabolic enzymes creatine kinase, adenylate kinase and phosphofructokinase by interaction with the elastic filament protein titin in cardiomyocytes . Using yeast two-hybrid assays, colocalisation experiments, co-immunoprecipitation and protein pull-down assays, we show that DRAL/FHL-2 is bound to two distinct sites on titin . One binding site is situated in the N2B region, a cardiac-specific insertion in the I-band part of titin, and the other is located in the is2 region of M-band titin . We also show that DRAL/FHL-2 binds to the metabolic enzymes creatine kinase, adenylate kinase and phosphofructokinase and might target these enzymes to the N2B and is2 regions in titin . We propose that DRAL/FHL-2 acts as a specific adaptor protein to couple metabolic enzymes to sites of high energy consumption in the cardiac sarcomere. Neurosci Lett, 2002 Dec 6, 334(1), 49 - 52 Discovery of a protein sequence in the N-terminal region of the human neuronal alpha7 nicotinic acetylcholine receptor involved in homomeric interactions; Chio CL et al.; The neuronal nicotinic acetylcholine receptor subunit, alpha7, can form homopentameric receptor/ion channel complexes . Potential contributions of its N-terminal region to homomeric interactions were investigated, in comparison with the corresponding region of an analogous heteromeric subunit, alpha3 . Recombinant chimeras were prepared upon engineering the N-terminal alpha7 (M1-V224) or alpha3 (M1-S232) sequence into the background of another homomeric mouse 5-hydroxytryptamine3 (5-HT)(3) receptor . The alpha7/5-HT(3) chimera, when expressed heterologously in a human epithelial cell line, SH-EP1, robustly expressed alpha-bungarotoxin binding sites as homooligomers while the alpha3/5-HT(3) did not produce epibatidine (non-selective ligand) binding sites, and did not interfere the alpha7/5-HT3 phenotype, upon co-expression . Yeast two hybrid assays with the N-terminal regions showed positive responses between alpha7:alpha7, but not between alpha7:alpha3 and alpha3:alpha3 . Similar assays with the alpha7 N-terminal region and its five smaller fragments (G23-N46, D47-N90, V91-N133, S134-M182and Q183-V224) revealed that the G23-N46 sequence is involved in homomeric interactions . Replacement of the corresponding region of the alpha3/5-HT(3) chimera with the alpha7 G23-N46 sequence conferred a dominant negative role on the chimera, by abolishing the alpha7/5-HT(3) phenotype . These results support the view that the G23-N46 portion of the alpha7 N-terminal region may contribute to receptor homooligomerizations . Dev Cell, 2002 Nov, 3(5), 697 - 710 GLD-3, a bicaudal-C homolog that inhibits FBF to control germline sex determination in C . elegans; Eckmann CR et al.; The FBF RNA binding proteins control multiple aspects of C . elegans germline development, including sex determination . FBF promotes the oocyte fate at the expense of spermatogenesis by binding a regulatory element in the fem-3 3'UTR and repressing this sex-determining gene . Here we report the discovery of GLD-3, a Bicaudal-C homolog and cytoplasmic protein that physically interacts with FBF . Using RNAi and a gld-3 deletion mutant, we show that GLD-3 promotes the sperm fate, a sex determination effect opposite to that of FBF . By epistasis analysis, GLD-3 acts upstream of FBF, and, in a yeast three-hybrid assay, GLD-3 interferes specifically with FBF binding to the fem-3 3'UTR . We propose that GLD-3 binds FBF and thereby inhibits its repression of target mRNAs. Analyst, 2002 Oct, 127(10), 1392 - 6 A sensitive and selective assay of nucleic acids by measuring enhanced total internal reflected resonance light scattering signals deriving from the evanescent field at the water/tetrachloromethane interfacet; Lu W et al.; A total internal reflected resonance light scattering (TIR-RLS) technique, the coupling of resonance light scattering (RLS) technique with total internal reflected light at the interface of two immiscible liquids, where the steep change of the refractive indexes occurs to result in an evanescent field, is proposed with the characteristics of separation and enrichment properties of analytes and direct use of oil-soluble reagents free from surfactants . At pH 8.69 and ion strength 0.008, ternary amphiphilic species formed by the interaction of nucleic acids, including calf thymus DNA (ctDNA), fish sperm DNA (fsDNA), and yeast RNA (yRNA), with Eu(III) in the presence of oil-soluble trioctylphosphine oxide (TOPO), are adsorbed to the water/tetrachloromethane (H20/CCl4) interface, giving rise to significantly enhanced TIR-RLS signals . It has been found that the enhanced TIR-RLS intensity at 348.0 nm is proportional to the concentration of thermally denatured ctDNA, fsDNA and yRNA in the range 0.002-2.5 microg ml(-1), 0.002-2.5 microg ml(-1) and 0.003-2.0 microg ml(-1), respectively and their limits of determination (3sigma) are 0.16 ng ml(-1), 0.19 ng ml(-1) and 0.28 ng ml(-1), correspondingly . Complicated artificial samples with highly interfering backgrounds were determined satisfactorily. Mol Biol Cell, 2002 Nov, 13(11), 4001 - 12 Transforming growth factor-beta receptors interact with AP2 by direct binding to beta2 subunit; Yao D et al.; Transforming growth factor-beta (TGF-beta) superfamily members regulate a wide range of biological processes by binding to two transmembrane serine/threonine kinase receptors, type I and type II . We have previously shown that the internalization of these receptors is inhibited by K(+) depletion, cytosol acidification, or hypertonic medium, suggesting the involvement of clathrin-coated pits . However, the involvement of the clathrin-associated adaptor complex AP2 and the identity of the AP2 subunit that binds the receptors were not known . Herein, we have studied these issues by combining studies on intact cells with in vitro assays . Using fluorescence photobleaching recovery to measure the lateral mobility of the receptors on live cells (untreated or treated to alter their coated pit structure), we demonstrated that their mobility is restricted by interactions with coated pits . These interactions were transient and mediated through the receptors' cytoplasmic tails . To measure direct binding of the receptors to specific AP2 subunits, we used yeast two-hybrid screens and in vitro biochemical assays . In contrast to most other plasma membrane receptors that bind to AP2 via the mu2 subunit, AP2/TGF-beta receptor binding was mediated by a direct interaction between the beta2-adaptin N-terminal trunk domain and the cytoplasmic tails of the receptors; no binding was observed to the mu2, alpha, or sigma2 subunits of AP2 or to mu1 of AP1 . The data uniquely demonstrate both in vivo and in vitro the ability of beta2-adaptin to directly couple TGF-beta receptors to AP2 and to clathrin-coated pits, providing the first in vivo evidence for interactions of a transmembrane receptor with beta2-adaptin. J Biol Chem, 2003 Jan 31, 278(5), 2799 - 806 Epub 2002 Nov 11. Receptor-ligand interaction between vitellogenin receptor (VtgR) and vitellogenin (Vtg), implications on low density lipoprotein receptor and apolipoprotein B/E . The first three ligand-binding repeats of VtgR interact with the amino-terminal region of Vtg; Li A et al.; The vitellogenin receptor (VtgR) belongs to the low density lipoprotein receptor (LDLR) gene family . It mediates the uptake of vitellogenin (Vtg) in oocyte development of oviparous animals . In this study, we cloned and characterized two forms of Oreochromis aureus VtgR . Northern analysis showed that VtgR was specifically expressed in ovarian tissues . However, reverse transcription-PCR indicates that either there are trace levels of expression of VtgR or a homolog of LDLR exists in nonovarian tissues . The VtgR is highly homologous to the very low density lipoprotein receptor . To better understand the mechanism by which similar structural modules in the ligand-binding domain bind different ligands, we used the yeast two-hybrid system to screen for the minimal interaction motifs in Vtg and VtgR . The amino-terminal region of the lipovitellin I domain of Vtg interacts with the ligand-binding domain of VtgR . The first three ligand-binding repeats of the receptor were found to be essential for ligand binding . Computational analysis of the binding sequence indicates that Vtg has a similar receptor-binding region to apolipoprotein (apo) E and apoB . Site-directed mutagenesis of this region indicates electrostatic interaction between Vtg and its receptor . Sequence analysis suggests the coevolution of receptor-ligand pairs for the LDLR/apo superfamily and suggests that the mode of binding of LDLR/very low density lipoprotein receptor to apoB and apoE is inherited from the electrostatic attraction of VtgR and Vtg. J Biol Chem, 2003 Jan 17, 278(3), 1915 - 23 Epub 2002 Nov 11. Syntrophin gamma 2 regulates SCN5A gating by a PDZ domain-mediated interaction; Ou Y et al.; SCN5A encodes the alpha subunit of the cardiac muscle and intestinal smooth muscle mechanosensitive Na(+) channel . Mechanosensitivity in the intestine requires an intact cytoskeleton . We report, using laser capture microdissection, single cell PCR, and immunohistochemistry, that syntrophins, scaffolding proteins, were expressed in human intestinal smooth muscle cells . The distribution of syntrophin gamma 2 was similar to that of SCN5A . Yeast two-hybrid and glutathione S-transferase pull-down experiments show that SCN5A and syntrophin gamma 2 co-express and that the PDZ domain of syntrophin gamma 2 directly interacts with the C terminus of SCN5A . In native cells, disruption of the C terminus-syntrophin gamma 2 PDZ domain interaction using peptides directed against either region result in loss of mechanosensitivity . Co-transfection of syntrophin gamma 2 with SCN5A in HEK293 cells markedly shifts the activation kinetics of SCN5A and reduces the availability of Na(+) current . We propose that syntrophin gamma 2 is an essential Na(+) channel-interacting protein required for the full expression of the Na(+) current and that the SCN5A-syntrophin gamma 2 interaction determines mechanosensitivity and current availability. Virology, 2002 Oct 10, 302(1), 106 - 22 The conserved process of TCR/CD3 complex down-modulation by SIV Nef is mediated by the central core, not endocytic motifs; Schaefer TM et al.; The Nef protein of Simian immunodeficiency virus (SIV) associates with multiple T lymphocyte signaling proteins, including the T cell receptor (TCR) zeta chain . We demonstrate here that these interactions are conserved and highly specific . Nefs derived from genetically diverse strains of SIV (SIV(mac)239, SIV(smm)PBj, and SIV(smm)DeltaB670) all interacted with TCR zeta on two separate domains, referred to as SIV Nef interaction domains (SNIDs), as examined in both yeast two-hybrid and glutathione-S-transferase (GST) fusion protein pull-down assays . Multiple HIV-1 Nefs were examined and none interacted with TCR zeta . In contrast, HIV-2(UC1) Nef, similar to SIV Nef, interacted with TCR zeta on two domains, although only the SIV Nefs potently reduced cell-surface expression of the TCR/CD3 complex in T cells . In addition, we examined the abilities of SIV, HIV-2, and HIV-1 Nefs to interact with the cytoplasmic domains of other signaling molecules including CD3epsilon, CD3gamma, and FcepsilonRIgamma, which also contain YxxL motifs, and determined that SIV and HIV-2 Nefs interacted only with TCR zeta, whereas HIV-1 Nef did not interact with any signal-transducing cytoplasmic domain examined . Last, to gain further insight into the mechanism by which Nef down-modulates the TCR/CD3 complex, we mutated or deleted regions on Nef involved in endocytosis, localization of Nef to the plasma membrane, interaction with cellular kinases, or that were conserved among multiple strains of SIV . Mutation of the myristoylation site and a conserved region surrounding a putative PKC phosphorylation site were the only mutations that abrogated Nef-mediated down-modulation of the TCR/CD3 complex . These findings demonstrate there is a spectrum of associations between SIV, HIV-2, and HIV-1 Nefs, and the TCR/CD3 complex, and suggest that down-modulation of the TCR/CD3 complex occurs via association with subsets of cellular proteins that are different from those involved in CD4 and CD28 down-modulation. Insect Biochem Mol Biol, 2002 Dec, 32(12), 1731 - 40 Biochemical and molecular characterizaton of house cricket (Acheta domesticus, Orthoptera: Gryllidae) Delta9 desaturase; Riddervold MH et al.; Studies of insect fatty acyl-CoA desaturases have heretofore concentrated on the Diptera and Lepidoptera . We report here the isolation and characterization of a fatty acyl-CoA Delta9 desaturase from the house cricket, Acheta domesticus (Orthoptera) . Two desaturase cDNAs were isolated from a library, one of which contained two intron sequences . The clones were identical in their respective coding regions, but had divergent 5' and 3' untranslated regions . The cDNAs encode a 359 amino acid desaturase enzyme that could rescue a fatty acyl-CoA desaturase auxotrophic phenotype when expressed in yeast . Biochemical analysis of lipids from transformed yeast cells confirmed that the enzyme is a Delta9 desaturase with activity on both palmitic and stearic acid substrates . Southern blotting indicated multiple Delta9 desaturase genes within the genome . A single message that was up-regulated in fed insects vs . starved insects was observed on northern blots, indicating transcriptional regulation in response to diet. Structure (Camb), 2002 Nov, 10(11), 1533 - 40 Crystal structure of the human supernatant protein factor; Stocker A et al.; Supernatant protein factor (SPF) promotes the epoxidation of squalene catalyzed by microsomes . Several studies suggest its in vivo role in the cholesterol biosynthetic pathway by a yet unknown mechanism . SPF belongs to a family of lipid binding proteins called CRAL_TRIO, which include yeast phosphatidylinositol transfer protein Sec14 and tocopherol transfer protein TTP . The crystal structure of human SPF at a resolution of 1.9 A reveals a two domain topology . The N-terminal 275 residues form a Sec14-like domain, while the C-terminal 115 residues consist of an eight-stranded jelly-roll barrel similar to that found in many viral protein structures . The ligand binding cavity has a peculiar horseshoe-like shape . Contrary to the Sec14 crystal structure, the lipid-exchange loop is in a closed conformation, suggesting a mechanism for lipid exchange. J Biol Chem, 2003 Jan 24, 278(4), 2469 - 78 Epub 2002 Nov 08. Complex formation by the human Rad51B and Rad51C DNA repair proteins and their activities in vitro; Lio YC et al.; The human Rad51 protein is essential for DNA repair by homologous recombination . In addition to Rad51 protein, five paralogs have been identified: Rad51B/Rad51L1, Rad51C/Rad51L2, Rad51D/Rad51L3, XRCC2, and XRCC3 . To further characterize a subset of these proteins, recombinant Rad51, Rad51B-(His)(6), and Rad51C proteins were individually expressed employing the baculovirus system, and each was purified from Sf9 insect cells . Evidence from nickel-nitrilotriacetic acid pull-down experiments demonstrates a highly stable Rad51B.Rad51C heterodimer, which interacts weakly with Rad51 . Rad51B and Rad51C proteins were found to bind single- and double-stranded DNA and to preferentially bind 3'-end-tailed double-stranded DNA . The ability to bind DNA was elevated with mixed Rad51 and Rad51C, as well as with mixed Rad51B and Rad51C, compared with that of the individual protein . In addition, both Rad51B and Rad51C exhibit DNA-stimulated ATPase activity . Rad51C displays an ATP-independent apparent DNA strand exchange activity, whereas Rad51B shows no such activity; this apparent strand exchange ability results actually from a duplex DNA destabilization capability of Rad51C . By analogy to the yeast Rad55 and Rad57, our results suggest that Rad51B and Rad51C function through interactions with the human Rad51 recombinase and play a crucial role in the homologous recombinational repair pathway. EMBO J, 2002 Nov 15, 21(22), 6072 - 82 Clathrin light and heavy chain interface: alpha-helix binding superhelix loops via critical tryptophans; Chen CY et al.; Clathrin light chain subunits (LCa and LCb) contribute to regulation of coated vesicle formation to sort proteins during receptor-mediated endocytosis and organelle biogenesis . LC binding to clathrin heavy chain (HC) was characterized by genetic and structural approaches . The core interactions were mapped to HC residues 1267-1522 (out of 1675) and LCb residues 90-157 (out of 228), using yeast two-hybrid assays . The C-termini of both subunits also displayed interactions extending beyond the core domains . Mutations to helix breakers within the LCb core disrupted HC association . Further suppressor mutagenesis uncovered compensatory mutations in HC (K1415E or K1326E) capable of rescuing the binding defects of LCb mutations W127R or W105R plus W138R, thereby pinpointing contacts between HC and LCb . Mutant HC K1415E also rescued loss of binding by LCa W130R, indicating that both LCs interact similarly with HC . Based on circular dichroism data, mapping and mutagenesis, LCa and LCb were represented as alpha-helices, aligned along the HC and, using molecular dynamics, a structural model of their interaction was generated with novel implications for LC control of clathrin assembly. J Biol Chem, 2003 Jan 17, 278(3), 1774 - 83 Epub 2002 Nov 07. The Armadillo family protein p0071 is a VE-cadherin- and desmoplakin-binding protein; Calkins CC et al.; p0071, a member of the armadillo protein family, localizes to both adherens junctions and desmosomes in epithelial cells and exhibits homology to the adherens junction protein p120 and the desmosomal protein plakophilin-1 . p0071 is also present at dermal microvascular endothelial intercellular junctions and colocalizes with VE-cadherin, an endothelium-specific cadherin that associates with both actin and intermediate filament networks . To define the role of p0071 in junction assembly, p0071 was tested for interactions with other components of the endothelial junctional complex . In transient expression assays, p0071 colocalized with and formed complexes with both VE-cadherin and desmoplakin . Deletion analysis using the yeast two-hybrid system revealed that the armadillo repeat domain of p0071 bound directly to VE-cadherin . Site-directed mutagenesis experiments demonstrated that p0071 and p120 bound to the same region on the cytoplasmic tail of VE-cadherin and that overexpression of p0071 could displace p120 from intercellular junctions . In contrast to VE-cadherin, desmoplakin was found to associate with the non-armadillo head domain of p0071 . Cotransfections and triple-label immunofluorescence analysis revealed that VE-cadherin colocalization with desmoplakin in transfected COS cells required p0071, suggesting that p0071 may couple VE-cadherin to desmoplakin . Based on previous findings that both VE-cadherin and desmoplakin play central roles in vasculogenesis, these new results suggest that p0071 may play an important role in endothelial junction assembly and in the morphogenic events associated with vascular remodeling. Mech Ageing Dev, 2002 Sep, 123(11), 1461 - 7 Lifespan in captive baboons is heritable; Martin LJ et al.; The effects of aging are evident in multiple organ systems, tissues, cell types, and molecules; all complex phenotypes affected by multiple shared and unique environmental factors and genes, which makes identifying the role of genetics in human aging difficult . Researchers have used yeast, nematodes, fruit flies, and mice to search for genes that influence the aging process . Given the phylogenetic distance and anatomic and physiologic dissimilarities of these organisms from humans, directly extrapolating these results to our species is problematic . However, nonhuman primates have a high degree of genetic, anatomic and physiologic similarity with humans and, thus, they may assist in the detection, characterization, and identification of genetic and environmental influences on human aging . Our goal is to demonstrate that effects of genes on variation in lifespan, a surrogate measure of aging, can be detected in a nonhuman primate species . Using variance component analysis, heritability of age at death was estimated to be 0.23+/-0.08 (P=0.0003) in 674 baboons from the Southwest Foundation for Biomedical Research (SFBR) . This research demonstrates that lifespan is under partial genetic control . Given these findings, we believe that the baboon has potential as a model of human aging. Proc Natl Acad Sci U S A, 2002 Nov 26, 99(24), 15806 - 11 Epub 2002 Nov 07. A chloroplast FKBP interacts with and affects the accumulation of Rieske subunit of cytochrome bf complex; Gupta R et al.; Immunophilins are intracellular receptors of the immunosuppressants cyclosporin A, FK506, and rapamycin . Although all immunophilins possess peptidyl-prolyl isomerase activity and are identified from a wide range of organisms, little is known about their cellular functions . We report the characterization and functional analysis of an FK506 and rapamycin-binding protein (AtFKBP13) from Arabidopsis . The AtFKBP13 protein is synthesized as a precursor that is imported into chloroplasts and processed to the mature form located in the thylakoid lumen, as shown by chloroplast import assays and Western blot analysis . Experiments show that AtFKBP13 is translocated across the thylakoid membrane by the DeltapH-dependent pathway . Yeast two-hybrid screening identified Rieske FeS protein, a subunit of the cytochrome bf complex in the photosynthetic electron transport chain, as an interacting partner for AtFKBP13 . Both yeast two-hybrid and in vitro protein-protein interaction assays showed that the precursor, but not the mature form, of AtFKBP13 interacted with Rieske protein, suggesting that interaction between the two proteins occurs along the import pathway . When AtFKBP13 expression was suppressed by RNA interference method, the level of Rieske protein was significantly increased in the transgenic plants. Bioinformatics, 2002 Nov, 18(11), 1486 - 93 A duplication growth model of gene expression networks; Bhan A et al.; MOTIVATION: There has been considerable interest in developing computational techniques for inferring genetic regulatory networks from whole-genome expression profiles . When expression time series data sets are available, dynamic models can, in principle, be used to infer correlative relationships between gene expression levels, which may be causal . However, because of the range of detectable expression levels and the current quality of the data, the predictive nature of such inferred, quantitative models is questionable . Network models derived from simple rate laws offer an intermediate level analysis, going beyond simple statistical analysis, but falling short of a fully quantitative description . This work shows how such network models can be constructed and describes the global properties of the networks derived from such a model . These global properties are statistically robust and provide insights into the design of the underlying network . RESULTS: Several whole-genome expression time series data sets from yeast microarray experiments were analyzed using a Markov-modeling method (Dewey and Galas, FUNC: Integr . Genomics, 1, 269-278, 2001) to infer an approximation to the underlying genetic network . We found that the global statistical properties of all the resulting networks are similar . The overall structure of these biological networks is distinctly different from that of other recently studied networks such as the Internet or social networks . These biological networks show hierarchical, hub-like structures that have some properties similar to a class of graphs known as small world graphs . Small world networks exhibit local cliquishness while exhibiting strong global connectivity . In addition to the small world properties, the biological networks show a power law or scale free distribution of connectivities . An inverse power law, N(k) approximately k(-3/2), for the number of vertices (genes) with k connections was observed for three different data sets from yeast . We propose network growth models based on gene duplication events . Simulations of these models yield networks with the same combination of global graphical properties that we inferred from the expression data. Eur J Biochem, 2002 Nov, 269(22), 5625 - 31 Restoring enzyme activity in nonfunctional low erucic acid Brassica napus fatty acid elongase 1 by a single amino acid substitution; Katavic V et al.; Genomic fatty acid elongation 1 (FAE1) clones from high erucic acid (HEA) Brassica napus, Brassica rapa and Brassica oleracea, and low erucic acid (LEA) B . napus cv . Westar, were amplified by PCR and expressed in yeast cells under the control of the strong galactose-inducible promoter . As expected, yeast cells expressing the FAE1 genes from HEA Brassica spp . synthesized very long chain monounsaturated fatty acids that are not normally found in yeast, while fatty acid profiles of yeast cells expressing the FAE1 gene from LEA B . napus were identical to control yeast samples . In agreement with published findings regarding different HEA and LEA B . napus cultivars, comparison of FAE1 protein sequences from HEA and LEA Brassicaceae revealed one crucial amino acid difference: the serine residue at position 282 of the HEA FAE1 sequences is substituted by phenylalanine in LEA B . napus cv . Westar . Using site directed mutagenesis, the phenylalanine 282 residue was substituted with a serine residue in the FAE1 polypeptide from B . napus cv . Westar, the mutated gene was expressed in yeast and GC analysis revealed the presence of very long chain monounsaturated fatty acids (VLCMFAs), indicating that the elongase activity was restored in the LEA FAE1 enzyme by the single amino acid substitution . Thus, for the first time, the low erucic acid trait in canola B . napus can be attributed to a single amino acid substitution which prevents the biosynthesis of the eicosenoic and erucic acids. Eur J Biochem, 2002 Nov, 269(22), 5608 - 16 Baboon cytochrome P450 17alpha-hydroxylase/17,20-lyase (CYP17); Swart AC et al.; Human cytochrome P450 17alpha-hydroxylase (CYP17) catalyses not only the 17alpha-hydroxlation of pregnenolone and progesterone and the C17,20-side chain cleavage (lyase) of 17alpha-hydroxypregnenolone, necessary for the biosynthesis of C21-glucocorticoids and C19-androgens, but also catalyses the 16alpha-hydroxylation of progesterone . In efforts to understand the complex enzymology of CYP17, structure/function relationships have been reported previously after expressing recombinant DNAs, encoding CYP17 from various species, in nonsteroidogenic mammalian or yeast cells . A major difference between species resides in the lyase activity towards the hydroxylated intermediates and in the fact that the secretion of C19-steroids take place, in some species, principally in the gonads . Because human and higher primate adrenals secrete steroids, CYP17 has been characterized in the Cape baboon, a species more closely related to humans, in an effort to gain a further understanding of the reactions catalysed by CYP17 . Baboon and human CYP17 cDNA share 96% homology . Baboon CYP17 has apparent Km and V values for pregnenolone and progesterone of 0.9 micro m and 0.4 nmol.h-1.mg protein-1 and 6.5 micro m and 3.9 nmol.h-1.mg protein-1, respectively . Baboon CYP17 had a significantly higher activity for progesterone hydroxylation relative to pregnenolone . No 16alpha-hydroxylase and no lyase activity for 17alpha-hydroxyprogesterone . Sequence analyses showed that there are 28 different amino acid residues between human and baboon CYP17, primarily in helices F and G and the F-G loop. Eur J Biochem, 2002 Nov, 269(22), 5406 - 13 Prediction of temporal gene expression . Metabolic opimization by re-distribution of enzyme activities; Klipp E et al.; A computational approach is used to analyse temporal gene expression in the context of metabolic regulation . It is based on the assumption that cells developed optimal adaptation strategies to changing environmental conditions . Time-dependent enzyme profiles are calculated which optimize the function of a metabolic pathway under the constraint of limited total enzyme amount . For linear model pathways it is shown that wave-like enzyme profiles are optimal for a rapid substrate turnover . For the central metabolism of yeast cells enzyme profiles are calculated which ensure long-term homeostasis of key metabolites under conditions of a diauxic shift . These enzyme profiles are in close correlation with observed gene expression data . Our results demonstrate that optimality principles help to rationalize observed gene expression profiles. J Nutr, 2002 Nov, 132(11 Suppl), 3482S - 3489S Flavonoid effects relevant to cancer; Brownson DM et al.; Flavonoids, such as daidzein and genistein, present in dietary plants like soybean, have unique chemical properties with biological activity relevant to cancer . Many flavonoids and polyphenols, including resveratrol in red wine and epigallocatechin gallate in green tea, are known antioxidants . Some of these compounds have estrogenic (and antiestrogenic) activity and are commonly referred to as phytoestrogens . A yeast-based estrogen receptor (ER) reporter assay has been used to measure the ability of flavonoids to bind to ER and activate estrogen responsive genes . Recently, estrogenic compounds were also shown to trigger rapid, nongenomic effects . The molecular mechanisms, however, have not been completely detailed and little information exists regarding their relevance to cancer progression . As a preliminary step toward elucidating rapid phytoestrogen action on breast cancer cells, we investigated the effect of 17-beta estradiol (E2), genistein, daidzein and resveratrol on the activation status of signaling proteins that regulate cell survival and invasion, the cell properties underlying breast cancer progression . The effect of these estrogenic compounds on the activation, via phosphorylation, of Akt/protein kinase B (Akt) and focal adhesion kinase (FAK) were analyzed in ER-positive and -negative human breast cancer cell lines . E2, genistein and daidzein increased whereas resveratrol decreased both Akt and FAK phosphorylation in nonmetastatic ER-positive T47D cells . In metastatic ER-negative MDA-MB-231 cells, all estrogenic compounds tested increased Akt and FAK phosphorylation . The inhibitory action of resveratrol on cell survival and proliferation is ER dependent . Therefore, all estrogenic compounds tested, including resveratrol, may exert supplementary ER-independent nongenomic effects on cell survival and migration in breast cancer cells. J Nutr, 2002 Nov, 132(11), 3411 - 7 Choice feeding of selenium-deficient laying hens affects diet selection, selenium intake and body weight; Zuberbuehler CA et al.; Inadequate selenium (Se) supply often in combination with low vitamin E status causes deficiency symptoms in many species . It is likely that a vague discomfort or sickness is perceived before clear deficiency signs become apparent . We investigated whether Se-deficient hens reduce their Se deficit by selecting a diet containing more selenium when offered two diets with different Se concentrations . A Low-Se diet (0.07 mg Se/kg) was supplemented with Se-enriched yeast (Sel-Plex 50) to produce Medium-Se (0.20 mg Se/kg) and High-Se (1.50 mg Se/kg) diets . Each of two consecutive study parts (I and II) with the same hens and treatments began with a 6-wk baseline period (Medium-Se diet), subsequently followed a 9-wk depletion period (Low-Se diet or Medium-Se diet), then a 6-wk choice feeding period in which two diets with different Se concentrations (Low-Se and Medium-Se, Medium-Se and High-Se, or Low-Se and High-Se) were offered . A control group received the Medium-Se diet throughout the study . Daily Se intake, calculated from daily feed intake, followed similar patterns in both parts of the study, but Se-deficient hens preferred (P < 0.05) the High-Se diet to the Low-Se diet during the first 3 wk of choice feeding only in part I . We conclude that young Se-deficient laying hens reduce their Se deficit if they have a choice between a Low-Se and a High-Se diet by preferentially selecting the High-Se diet, possibly based on learned place preference and/or learned taste aversion to the Low-Se diet, presumably in response to discomfort due to Se-deficiency. Genome Res, 2002 Nov, 12(11), 1773 - 84 Protein-protein interactions between large proteins: two-hybrid screening using a functionally classified library composed of long cDNAs; Nakayama M et al.; Large proteins have multiple domains that are potentially capable of binding many kinds of partners . It is conceivable, therefore, that such proteins could function as an intricate framework of assembly protein complexes . To comprehensively study protein-protein interactions between large KIAA proteins, we have constructed a library composed of 1087 KIAA cDNA clones based on prior functional classifications done in silico . We were guided by two principles that raise the success rate for detecting interactions per tested combination: we avoided testing low-probability combinations, and reduced the number of potential false negatives that arise from the fact that large proteins cannot reliably be expressed in yeast . The latter was addressed by constructing a cDNA library comprised of random fragments encoding large proteins . Cytoplasmic domains of KIAA transmembrane proteins (>1000 amino acids) were used as bait for yeast two-hybrid screening . Our analyses reveal that several KIAA proteins bearing a transmembrane region have the capability of binding to other KIAA proteins containing domains (e.g., PDZ, SH3, rhoGEF, and spectrin) known to be localized to highly specialized submembranous sites, indicating that they participate in cellular junction formation, receptor or channel clustering, and intracellular signaling events . Our representative library should be a very useful resource for detecting previously unidentified interactions because it complements conventional expression libraries, which seldom contain large cDNAs. Insect Mol Biol, 2002 Dec, 11(6), 533 - 42 Isolation and molecular characterization of Musca domestica delta-9 desaturase sequences; Eigenheer AL et al.; We have isolated fatty acyl-CoA desaturase cDNA (Mdomd9) and genomic sequences from the housefly, Musca domestica . Two approximately 1.66 kb cDNAs were recovered . They had identical coding regions and 3' untranslated regions (UTRs), but differed in their 5' UTRs . The open reading frame encodes a 380 amino acid (aa) protein with 82% identity to Drosophila melanogaster desat1, and significant (> 50%) identity with other insect delta-9 desaturases . Functional analyses in a yeast expression system confirmed the cDNA encodes a delta9 desaturase . Northern analysis indicated two transcripts of 1.7 and 2.9 kb that hybridized specifically to the open reading frame . PCR amplification of genomic templates revealed three intron sites that are conserved among other insect species . Southern analysis of genomic DNA indicated at least two desaturase gene copies per haploid genome . There is a high degree of polymorphism, most of which appears to be due to variable intron sequences; curiously, individual flies had varying morphs of intron II and intron III . Together, the data suggest that there are more delta9 desaturase alleles within the population studied than there are loci within the genome, and support other studies suggesting that insect fatty acyl-CoA desaturases are a dynamically evolving gene family. J Neurochem, 2002 Nov, 83(4), 1013 - 7 ProSAP/Shank postsynaptic density proteins interact with insulin receptor tyrosine kinase substrate IRSp53; Bockmann J et al.; The ProSAP/Shank family of multidomain proteins of the postsynaptic density (PSD) can either directly or indirectly interact with NMDA-type and metabotropic glutamate receptors and the actin-based cytoskeleton . In a yeast two hybrid screen utilizing a proline-rich domain that is highly conserved among the ProSAP/Shank family members, we isolated several cDNA clones coding for the insulin receptor substrate IRSp53 . The specificity of this interaction was confirmed in transfected COS cells . Co-immunoprecipitation of IRSp53 and ProSAP2 solubilized from rat brain membranes indicates that the interaction occurs in vivo . The C-terminal SH3 domain of IRSp53 is responsible for the interaction with a novel proline-rich consensus sequence of ProSAP/Shank that was characterized by mutational analysis . IRSp53 is a substrate for the insulin receptor in the brain and acts downstream of small GTPases of the Rho family . Binding of Cdc42Hs to IRSp53 induces actin filament assembly, reorganization and filopodia outgrowth in neuronal cell lines . Our data suggest that IRSp53 can be recruited to the PSD via its ProSAP/Shank interaction and may contribute to the morphological reorganization of spines and synapses after insulin receptor and/or Cdc42Hs activation. J Neurochem, 2002 Nov, 83(4), 846 - 54 TorsinA and heat shock proteins act as molecular chaperones: suppression of alpha-synuclein aggregation; McLean PJ et al.; TorsinA, a protein with homology to yeast heat shock protein104, has previously been demonstrated to colocalize with alpha-synuclein in Lewy bodies, the pathological hallmark of Parkinson's disease . Heat shock proteins are a family of chaperones that are both constitutively expressed and induced by stressors, and that serve essential functions for protein refolding and/or degradation . Here, we demonstrate that, like torsinA, specific molecular chaperone heat shock proteins colocalize with alpha-synuclein in Lewy bodies . In addition, using a cellular model of alpha-synuclein aggregation, we demonstrate that torsinA and specific heat shock protein molecular chaperones colocalize with alpha-synuclein immunopositive inclusions . Further, overexpression of torsinA and specific heat shock proteins suppress alpha-synuclein aggregation in this cellular model, whereas mutant torsinA has no effect . These data suggest that torsinA has chaperone-like activity and that the disease-associated GAG deletion mutant has a loss-of-function phenotype . Moreover, these data support a role for chaperone proteins, including torsinA and heat shock proteins, in cellular responses to neurodegenerative inclusions. Acta Obstet Gynecol Scand, 2002 Nov, 81(11), 1047 - 52 Characterization of women with a history of recurrent vulvovaginal candidosis; Novikova N et al.; BACKGROUND: To characterize history, signs, and symptoms in women with a history of recurrent vulvovaginal candidosis (RVVC) and who had consulted with symptoms generally associated with the condition . METHODS: Eighty-three women with a history consistent with RVVC were interviewed regarding 32 parameters and 10 signs found at the clinical examination were noted . Candida cultures were made from the introitus and the posterior vaginal fornix . RESULTS: Only in a few of the 43 women with and the 40 without a positive yeast culture could any of the many etiological factors that have been associated with RVVC be traced . Only two factors differed between the groups, namely yogurt intake, which was reported by 28 (68%) and 38 (95%) women in these groups, respectively . Vaginal douching was performed by 10 (23%) women in the Candida-positive group and by 17 (42%) women in the Candida-negative group . Pruritis and burning occurred in 31 (72%) and 22 (51%) of culture-positive patients, which was less frequent than in the culture-negative group, i.e . reported by 19 (47%) and 9 (22%) patients, respectively (p = 0.022 and p = 0.007) . Edema (p = 0.026) of the vulva as well as erythema (p = 0.019) and edema (p = 0.008) of the vaginal mucosa, caseous discharge (p = 0.016), were found more often in the Candida culture-positive cases . CONCLUSIONS: History and results of clinical examination of patients with RVVC are not enough to distinguish those who are culture-positive from those who are culture-negative for Candida from the genital tract. Arch Microbiol, 2002 Dec, 178(6), 477 - 83 Epub 2002 Oct 15. Different effectors of dimorphism in Yarrowia lipolytica; Ruiz-Herrera J et al.; Yarrowia lipolytica is an ascomycete with biotechnological potential . In common media, the fungus grows as a mixture of yeast-like and short mycelial cells . The environmental factors that affect dimorphism in the wild-type strain, W29, and its auxotrophic derivative, PO1a, were analyzed . In both strains, pH was the most important factor regulating the dimorphic transition . Mycelium formation was maximal at pH near neutrality and decreased as pH was lowered to become almost null at pH 3 . Carbon and nitrogen sources, namely glucose and ammonium, were also important for mycelium formation; and their effect was antagonized by some alternative carbon and nitrogen sources . Citrate was an important positive effector of mycelium growth . Anaerobic stress induced formation of mycelial cells . The importance of the protein kinase A pathway was suggested by the inhibition of mycelium growth by cAMP . We propose that the interplay of these factors regulates the adaptation of the fungus, to better exploit its natural ecological niches. J Mol Biol, 2002 Nov 1, 323(4), 739 - 50 Structural effects of cofilin on longitudinal contacts in F-actin; Bobkov AA et al.; Structural effects of yeast cofilin on skeletal muscle and yeast actin were examined in solution . Cofilin binding to native actin was non-cooperative and saturated at a 1:1 molar ratio, with K(d)<or=0.05 microM for both CaATP-G-actin and F-actin . Cofilin binding enhanced the fluorescence of dansyl ethylenediamine (DED) attached to Gln41 on the DNase I binding loop of skeletal muscle F-actin and decreased the fluorescence of AEDANS at Cys41 on yeast Q41C/C374S mutant F-actin . However, cofilin had no effect on the spectral properties of DED or AEDANS on CaATP-G-actin . Fluorescence energy transfer (FRET) from tryptophan residues to DED at Gln41 on skeletal muscle actin and to AEDANS at Cys41 on |