Agrobacterium

J Bacteriol, 1988 Dec, 170(12), 5822 - 9
Glycine betaine allows enhanced induction of the Agrobacterium tumefaciens vir genes by acetosyringone at low pH; Vernade D et al.; We established growth conditions for efficient induction of the vir genes of Agrobacterium tumefaciens by acetosyringone . Optimal induction was attained at a pH below 5.2 in an AB minimal medium-derived high-osmotic-strength medium containing glycine betaine . This natural osmoprotectant accelerated the adaptation of the bacteria to these conditions . We established the kinetics of induction for virB, virD, virE, and virG by using lacZ fusions, and we found that the virB mutant strain could not adapt to this low-pH medium unless 1 mM CaCl2 was added . This pH control of vir gene expression was shown to act at the level of expression of virG, which was the limiting factor . This improved vir induction at a low pH correlated with an increase in a set of proteins which was analyzed by two-dimensional gel electrophoresis . The fact that high inducibility corresponded to a reduced growth rate and the demonstration that a set of proteins was associated with the inducible state suggest that vir gene induction is linked to the adaptation of the cells to an unfavorable environment . Hence, vir gene expression in A . tumefaciens is probably dependent upon a machinery which is specific to an adaptive response; the implications for plant transformation are discussed.

Mol Gen Mikrobiol Virusol, 1988 Dec, (12), 11 - 6
{Deletional and insertional analysis of the antitumorigenicity of the plasmid R388 in Agrobacterium tumefaciens}; Mashkovskaia GV et al.; The study of the plasmid R388 deletional derivatives has shown the antitumorigenicity determinant of the plasmid to be contained by the tra-operon . Transposon Tn5 has been used for selection of a number of insertional mutants having lost the antitumorigenic properties . The difference in the locations of Tn5 inserts was found, all of the latter being localized within the tra-operon . The data obtained suggest the locus of the plasmid R388 responsible for its antitumorigenic properties to be located in the region of tra-genes distally to the rep-region.

Can J Microbiol, 1988 Dec, 34(12), 1354 - 7
Mobilization and transfer of Azospirillum lipoferum plasmid by the Tn5-Mob transposon into a plasmid-free Agrobacterium tumefaciens strain; Bally R et al.; Azospirillum lipoferum 4B harbors five cryptic plasmids . Several suicide plasmids were used to transfer Tn5-Mob to A . lipoferum 4B . Tn5-Mob insertion mutations of this strain could be obtained at frequencies of 10(-8)-10(-7) per recipient cell . One hundred Tn5-Mob A . lipoferum 4B mutants were used in bacterial matings with a plasmid-free Agrobacterium tumefaciens recipient strain . This is the first report of mobilization, transfer, and replication of an Azospirillum plasmid in Agrobacterium tumefaciens . One transconjugant was found which had lost an indigenous plasmid.

Nucleic Acids Res, 1988 Nov 25, 16(22), 10765 - 82
Specialized binary vector for plant transformation: expression of the Arabidopsis thaliana AHAS gene in Nicotiana tabacum; Olszewski NE et al.; We constructed a cosmid vector, pOCA18, designed for transferring plant genomic libraries from Agrobacterium tumefaciens to plants . Clones from a genomic library of Arabidopsis thaliana DNA in pOCA 18 were propagated stably in both Escherichia coli and A . tumefaciens . Clones from the pOCA18 A . thaliana library were used to construct transgenic Nicotiana tabacum plants; the DNA inserts were transferred intact in 10 out of 16 transgenic N . tabacum plants examined but were partially deleted in six others . Transgenic N . tabacum plants constructed with a mutant A . thaliana acetohydroxy acid synthase gene (from the pOCA18 library) that encodes an enzyme resistant to the herbicide chlorsulfuron were resistant to chlorsulfuron . A statistical analysis indicated that if the A . thaliana library contains 10(7) members and if 10(7) A . tumefaciens transconjugants containing the library were used to transform plant cells, then 2 x 10(4) transformed plant cells must be generated to have a 95% probability of constructing a transgenic plant carrying a specific DNA sequence from the A . thaliana library.

Nucleic Acids Res, 1988 Nov 11, 16(21), 10225 - 36
Bidirectional transfer from a 24 bp border repeat of Agrobacterium tumefaciens; van Haaren MJ et al.; T-region transfer from wild-type Agrobacterium strains is thought to be an orientated process, starting at the right border repeat and terminating at the left border repeat of the T-region . Here we demonstrate that a right border repeat in the inverted orientation relative to the onc-genes can also mediate transfer of the T-region to the plant cell, although with lower efficiency as a border repeat in the native orientation . Transfer mediated by an inverted right border repeat is stimulated by the presence of the T-region transfer enhancer . Similar single stranded molecules, comprising the bottom strand of the T-DNA, were isolated from acetosyringone induced bacteria, irrespective of the orientation of the right border . These findings show that border repeats work bidirectionally to some extent.

Proc Natl Acad Sci U S A, 1988 Nov, 85(22), 8558 - 62
Role of the overdrive sequence in T-DNA border cleavage in Agrobacterium; Toro N et al.; The T-DNA of the Ti plasmid of Agrobacterium is flanked by 25-base-pair imperfect direct repeats that are required in cis for transfer to the genome of the plant host . Another sequence, designated overdrive, is located adjacent to the right-border repeats and functions in cis to enhance tumor formation . We have examined the effect of the overdrive sequence on the early steps in T-DNA processing . We report here that overdrive greatly enhances cleavage by the site-specific endonuclease in Agrobacterium, perhaps by directing the endonuclease to the adjacent border sequences . We also show by a gel mobility-shift assay that overdrive affinity-purified proteins from acetosyringone-induced Agrobacterium cells interact with T-DNA border and overdrive sequences . Further, we show that in vivo the virC operon enhances cleavage at the T-DNA borders, most likely by interaction between the VirC1 protein and the overdrive sequence.

J Bacteriol, 1988 Nov, 170(11), 5236 - 40
Purification and properties of the gamma-butyrobetaine-binding protein from an Agrobacterium sp; Nobile S et al.; A binding protein for gamma-butyrobetaine was purified from osmotic shock fluid of an Agrobacterium sp . It was a monomeric protein with an apparent molecular weight of 52,000 or 53,000 as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and gel filtration, respectively . The isoelectric point was 4.3, as determined by isoelectric focusing . Amino acid analysis of the protein showed that Asx and Glx were predominant components and that the protein contained no cysteine . The dissociation constant of this protein for gamma-butyrobetaine was found to be 0.7 microM by equilibrium dialysis . Attempts to sequence the amino-terminal end with the Edman method failed, suggesting that this region of the protein is blocked.

Appl Environ Microbiol, 1988 Nov, 54(11), 2859 - 61
Role of sublethal injury in decline of bacterial populations in lake water; Gurijala KR et al.; Following their addition to lake water, the populations of Escherichia coli and of antibiotic-resistant strains of Pseudomonas fluorescens, Agrobacterium tumefaciens, Micrococcus flavus, Rhizobium meliloti, and Klebsiella pneumoniae declined rapidly, as determined by counting on media containing antibacterial compounds . The estimates of population sizes were occasionally higher if procedures were used that permitted possible resuscitation of injured cells . No resuscitation procedure yielded consistently higher estimates of populations of surviving cells than the use of selective media alone . The patterns of survival of the test bacteria in lake water amended with eucaryotic inhibitors were essentially the same whether a resuscitation procedure was used or not, and the patterns of survival in sterile lake water or buffer were the same whether counts were made on selective media or on media without antibacterial agents . On the basis of the methods used to show sublethal injury caused by stress, we suggest that such injury to the test bacteria is not a significant factor involved in their decline in lake water.

Gene, 1988 Oct 15, 70(1), 25 - 37
Nucleotide sequence of the phosphinothricin N-acetyltransferase gene from Streptomyces viridochromogenes Tü494 and its expression in Nicotiana tabacum; Wohlleben W et al.; The phosphinothricin (Pt) N-acetyltransferase gene (pat) of Streptomyces viridochromogenes Tu494 is located on a 0.8-kb BglII fragment {Strauch et al., Gene 63 (1988) 65-74} . By sequencing a 1.3-kb BglII-SstII fragment, an open reading frame representing the pat gene was found . It encodes a polypeptide of 183 amino acids with an Mr of 20,621 . The base composition of the pat gene is typical for Streptomyces {70.1 mol% (G + C) in total and 93.5 mol% (G + C) in the third position} . Translation of pat is initiated by a GTG codon which was identified by frameshift mutations in Escherichia coli as well as in Streptomyces lividans . Significant homology of the pat gene was found to the bialaphos-resistance gene (bar) of Streptomyces hygroscopicus {Thompson et al., EMBO J . 9 (1987) 2519-2523} . However, variations were detected in the 5'-noncoding region of the two resistance genes which may reflect differences in regulation . Since Pt is a potent herbicide, the pat gene was modified and introduced into Nicotiana tabacum by Agrobacterium-mediated leaf-disc transformation . The GTG start codon of pat was replaced by ATG . Subsequently the modified pat-coding region was fused to the 35S promoter of the cauliflower mosaic virus . Transgenic plants could directly be selected on Pt-containing medium.

Nucleic Acids Res, 1988 Oct 11, 16(19), 9267 - 83
Influence of flanking sequences on variability in expression levels of an introduced gene in transgenic tobacco plants; Dean C et al.; The petunia rbcS gene SSU301 was introduced into tobacco using Agrobacterium tumefaciens-mediated transformation . The time at which rbcS expression was maximal after transfer of the tobacco plants to the greenhouse was determined . The expression level of the SSU301 gene varied up to 9 fold between individual tobacco plants which had been standardized physiologically as much as possible . The presence of adjacent pUC plasmid sequences did not affect the expression of the SSU301 gene . In an attempt to reduce the between-transformant variability in expression, the SSU301 gene was introduced into tobacco surrounded by 10kb of 5' and 13 kb of 3' DNA sequences which normally flank SSU301 in petunia . The longer flanking regions did not reduce the between-transformant variability of SSU301 gene expression.

Biochimie, 1988 Oct, 70(10), 1411 - 6
Evidence for a role of a vicinal dithiol in the transport of gamma-butyrobetaine in Agrobacterium sp; Nobile S et al.; An Agrobacterium sp . isolated from soil is able to use gamma-butyrobetaine as its sole source of carbon and nitrogen . The involvement of thiol groups for active transport of gamma-butyrobetaine was investigated by use of the thiol alkylating reagent N-ethylmaleimide (NEM) and the dithiol specific reagent phenylarsine oxide (PAO) . Both reagents strongly inhibited gamma-butyrobetaine uptake, but also induced the release of the accumulated substrate, suggesting that the transport system either contains a dithiol-dependent protein or that a small thiol-containing molecule is implicated in the uptake phenomenon.

J Mol Biol, 1988 Sep 20, 203(2), 373 - 84
vir-induced recombination in Agrobacterium . Physical characterization of precise and imprecise T-circle formation; Timmerman B et al.; Induction of Ti plasmid virulence (vir) gene expression during the early stages of plant cell transformation by Agrobacterium tumefaciens initiates the generation of several T-DNA-associated molecular events: (1) site-specific nicks at T-DNA border sequences (border nicks); (2) free, unipolar, linear, single-stranded T-DNA copies (T-strands); and (3) double-stranded, circular T-DNA molecules (T-circles) . The first two T-DNA products have been detected in A . tumefaciens, while T-circles have only been detected following Escherichia coli transformation or transduction . The relationship between the three events has not been evaluated since the genesis of T-circles in A . tumefaciens has not been clarified . Evidence is presented here that T-circles are not an artefact of E . coli transformation, but are present as free, double-stranded molecules in A . tumefaciens resulting from site-specific reciprocal recombination between the left and right 25-base-pair border sequences that flank the T-DNA . Furthermore, the frequency of T-circle formation correlates with the frequency of formation of its reciprocal product, the Ti plasmid deleted in the T-DNA region . Several types of recombinant T-DNA circles arise after activation of vir gene expression, a major class representing precise site-specific recombination between both T-DNA borders, and a minor class representing recombination events either utilizing only one T-DNA border sequence and other Ti plasmid sequences, or utilizing only Ti plasmid sequences (i.e . no T-DNA borders) . Nucleotide sequence analyses show that when one (nicked) border recombines with other Ti plasmid sequences, a small stretch (16 to 17 base-pairs) of local homology suffices to allow crossing over.

J Bacteriol, 1988 Sep, 170(9), 4181 - 7
Ti plasmid-specified chemotaxis of Agrobacterium tumefaciens C58C1 toward vir-inducing phenolic compounds and soluble factors from monocotyledonous and dicotyledonous plants; Ashby AM et al.; Twelve phenolic compounds with related structures were analyzed for their ability to act as chemoattractants for Agrobacterium tumefaciens C58C1 and as inducers of the Ti plasmid virulence operons . The results divided the phenolic compounds into three groups: compounds that act as strong vir inducers and are chemoattractants for A . tumefaciens C58C1 harboring the nopaline Ti plasmid pDUB1003 delta 31, but not the isogenic cured strain; compounds that are at best weak vir inducers and are weak chemoattractants for Ti plasmid-harboring and cured A . tumefaciens C58C1; and compounds that are vir noninducers and are also nonattractants . A strong correlation between vir-inducing ability and Ti plasmid requirement for chemotaxis is thus established . In addition, chemical structure rules for vir induction and chemotaxis are outlined . Positive chemotaxis toward root and shoot homogenates from monocotyledonous and dicotyledonous plants was observed . At low extract concentrations, chemotaxis was enhanced by the presence of Ti plasmid . The chemoattractants do not derive from intact cell walls . Lack of attraction is not responsible for the apparent block to monocot transformation by A . tumefaciens.

J Bacteriol, 1988 Sep, 170(9), 4047 - 54
Transcriptional regulation of the virA and virG genes of Agrobacterium tumefaciens; Winans SC et al.; We have used transcriptional and translational fusions between various vir gene promoters and the lacZ gene to study the regulation of vir genes . Like other vir promoters, the virA promoter was induced by acetosyringone in a virA virG-dependent fashion . In addition to being induced by acetosyringone, the virG promoter was partially induced by acidic growth conditions and by starvation for inorganic phosphate . These two conditions appeared to act synergistically . The response to low pH and to phosphate starvation occurred in the absence of the Ti plasmid and must therefore have been mediated by chromosomal genes . Two transposon-generated mutations were obtained which attenuated induction by low pH . One of these transposons was cloned along with flanking DNA; the flanking DNA was sequenced (858 base pairs total), and the predicted amino acid sequence showed homology with a family of proteins including the Rhizobium leguminosarum nodI gene, many of whose members bind ATP and have been implicated in active transport systems . These results are discussed as possible explanations for previous observations that the induction of the octopine vir regulon (i) occurs only in acidic media and (ii) shows hyperbolic kinetics after a long lag phase.

Nucleic Acids Res, 1988 Aug 11, 16(15), 7647 - 61
Right-hand border regions of octopine T-DNA are recognized by RNA polymerase of Agrobacterium as well as by VirD1 and VirD2 proteins; Niwa Y et al.; The T-DNA of octopine Ti plasmid of Agrobacterium tumefaciens contains TL- and TR-DNA regions each bounded by 25 base-pair-repeats (designated A, B, C and D from left to right) . Short DNA segments containing the borders B, C and D were found to function as promoter when placed in the rightward orientation upstream of promoter-less lacZ . Promoter consensus sequence of Agrobacterium were found within these border repeats and in their adjacent regions . The expression of lacZ was low when the segments contained the overdrive, a sequence known to enhance T-DNA transfer . Simultaneous overproduction of VirD1 and D2 proteins, endonuclease acting on the border repeats, interfered with the promoter functions of the border segments . In spite of their activity under these conditions, the border regions do not seem to be involved in the gene expression, because they are not followed by appropriate open reading frames . We propose that RNA polymerase of Agrobacterium competes with VirD products for T-DNA borders and thereby affects the transfer of T-DNA.

J Bacteriol, 1988 Aug, 170(8), 3782 - 5
Recognition of individual strains of fast-growing rhizobia by using profiles of membrane proteins and lipopolysaccharides; de Maagd R et al.; Membrane protein and lipopolysaccharide profiles of Rhizobium leguminosarum (biovars viciae, trifolii, and phaseoli), R . meliloti, and Agrobacterium tumefaciens strains were analyzed and compared by sodium dodecyl sulfate-polyacrylamide gel electrophoresis . Differences in one or both profiles allowed us to distinguish all 18 R . leguminosarum strains tested in this study from each other.

J Bacteriol, 1988 Aug, 170(8), 3367 - 74
Association of the virD2 protein with the 5' end of T strands in Agrobacterium tumefaciens; Young C et al.; The soil bacterium Agrobacterium tumefaciens can incite tumors in many dicotyledonous plants by transferring a portion (T-DNA) of its Ti plasmid into susceptible plant cells . The T-DNA is flanked by border sequences that serve as recognition sites for specific cleavage by an endonuclease that comprises two virD-encoded proteins (VirD1 and VirD2) . After cleavage, both double-stranded, nicked T-DNA molecules and single-stranded T-DNA molecules (T strands) were present . We have determined that a protein is tightly associated with, and probably covalently attached to, the 5' end of the T strands . Analysis of deletion derivatives in Escherichia coli, immunoprecipitation, and a procedure combining immunoblot and nucleic acid hybridization data identified this protein as the gene product of virD2.

Mol Gen Genet, 1988 Aug, 213(2-3), 229 - 37
Organization and characterization of the virCD genes from Agrobacterium rhizogenes; Hirayama T et al.; We have precisely localized virulent (vir) genes of the hairy root-inducing plasmid pRiA4b on the basis of sequence similarity with the tumor-inducing plasmid pTiA6NC, and shown that the overall organizations of vir genes in both plasmids are fairly analogous, although sizes and spacer lengths in some genes differ from each other . Among the vir genes thus mapped, the virC and virD loci were characterized in detail . Transposon insertions in virD led to loss of tumorigenicity on Kalanchoe stems and carrot discs, and one within virC exhibited an attenuated pathogenicity . The avirulent phenotype of the virD2 strain among these mutants was due to the lack of ability to recombine T-DNA border repeats in Agrobacterium cells . The nucleotide sequence of most parts of the virCD loci were similar in both plasmids . The virCD genes of these two plasmids, therefore, seem comparable both functionally and structurally . Phylogeny of pRi and pTi has also been discussed from the sequence data.

J Bacteriol, 1988 Aug, 170(8), 3523 - 30
The ndvA gene product of Rhizobium meliloti is required for beta-(1----2)glucan production and has homology to the ATP-binding export protein HlyB; Stanfield SW et al.; The ndvA locus of Rhizobium meliloti is homologous to and can substitute for the chvA locus of Agrobacterium tumefaciens . We have previously shown that an ndvA mutant exhibited reduced motility and formed small, white, empty nodules on alfalfa roots . Here we show that this ndvA mutant is defective in the production of the cyclic extracellular polysaccharide beta-(1----2)glucan, even though a 235,000-dalton protein intermediate, known to be involved in the synthesis of this molecule, is present and active in vitro . The DNA sequence of the ndvA locus revealed a single large open reading frame encoding a 67,100-dalton protein that was homologous to a number of bacterial ATP-binding transport proteins . The greatest degree of relatedness was seen with Escherichia coli HlyB, a protein involved in the export of hemolysin, and with the mdr gene product of mammalian cells, which is also homologous to HlyB and thought to be involved in export . Based on the overall symbiotic phenotype of ndvA mutants, the extensive homology between NdvA and HlyB, the fact that ndvA mutants retained an active 235,000-dalton membrane intermediate, and the absence of extracellular beta-(1----2)glucan, we propose that NdvA is involved in export of beta-(1----2)glucan from the cell and that this process is fundamentally important for normal alfalfa nodule development.

J Bacteriol, 1988 Jul, 170(7), 3164 - 9
Chemotaxis of Rhizobium meliloti to the plant flavone luteolin requires functional nodulation genes; Caetano-Anolles G et al.; Luteolin is a phenolic compound from plants that acts as a potent and specific inducer of nodABC gene expression in Rhizobium meliloti . We have found that R . meliloti RCR2011 exhibits positive chemotaxis towards luteolin . A maximum chemotactic response was observed at 10(-8) M . Two closely related flavonoids, naringenin and apigenin, were not chemoattractants . The presence of naringenin but not apigenin abolished chemotaxis of R . meliloti towards luteolin . A large deletion in the nif-nod region of the symbiotic megaplasmid eliminated all chemotactic response to luteolin but did not affect general chemotaxis, as indicated by swarm size on semisoft agar plates and chemotaxis towards proline in capillary tubes . Transposon Tn5 mutations in nodD, nodA, or nodC selectively abolished the chemotactic response of R . meliloti to luteolin . Agrobacterium tumefaciens GMI9050, a derivative of the C58 wild type lacking a Ti plasmid, responded chemotactically to 10(-8) M luteolin . The introduction of a 290-kilobase nif-nod-containing sequence of DNA from R . meliloti into A . tumefaciens GMI9050 enabled the recipient to respond to luteolin at concentrations peaking at 10(-6) M as well as at concentrations peaking at 10(-8) M . The response of A . tumefaciens GMI9050 to luteolin was also abolished by the presence of naringenin.

J Bacteriol, 1988 Jul, 170(7), 3170 - 6
Minimal region necessary for autonomous replication of pTAR; Gallie DR et al.; The native 44-kilobase-pair plasmid pTAR, discovered in a grapevine strain of Agrobacterium tumefaciens, contains a single origin of DNA replication confined to a 1.0-kilobase-pair region of the macromolecule . This region (ori) confers functions sufficient for replication in Agrobacterium and Rhizobium species but not in Pseudomonas solanacearum, Pseudomonas glumae, Pseudomonas syringae pv . savastanoi, Xanthomonas campestris pv . campestris, and Escherichia coli . ori contains a repA gene that encodes a 28,000-dalton protein required for replication . Nucleotide sequencing of repA and its promoter region revealed four 8-base-pair palindromic repeats upstream of the repA coding region . Deletion of these repeats alters repA expression and plasmid copy number . Downstream of repA are three additional repeats in a region essential for replication . A locus responsible for plasmid partitioning (parA) and a putative second locus regulating plasmid copy number are part of the origin region and are required for stable plasmid maintenance.

Mol Plant Microbe Interact, 1988 Jul-Aug, 1(6), 235 - 42
Inducible expression of cytokinin biosynthesis in Agrobacterium tumefaciens by plant phenolics; Powell GK et al.; Nopaline strains of Agrobacterium tumefaciens contain a gene, tzs, that encodes a cytokinin biosynthetic prenyl transferase . The gene is located adjacent to the Ti plasmid virulence region and is constitutively expressed at low levels . As a result, bacteria containing tzs secrete low levels of zeatin into the medium . We find zeatin secretion to be induced more than 100-fold by acetosyringone, one of a number of naturally occurring phenolics produced by plants in response to wounding . Induction was very sensitive to the pH of the medium (optimum pH 5.5) and was due to massive overexpression of tzs-encoded cytokinin prenyl transferase activity . The relative ability of members of a set of phenols to induce tzs expression was examined and found to be parallel to that reported for activation of other virulence genes . A series of molecular cloning experiments established that virA and virG, two genes known to be essential to the virulence induction process, were necessary and sufficient for phenolic-induced tzs expression . Sequences present in the promoter region of tzs were found to be similar to those present in genes regulated by bacterial two-component positive regulatory systems.

EMBO J, 1988 Jul, 7(7), 1929 - 36
Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia; Castresana C et al.; We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia . These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation . Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene . Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression . These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT- . We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light . We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter . Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels . Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter . This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression.

Mol Gen Genet, 1988 Jul, 213(1), 50 - 5
Construction of a Tn5 derivative encoding bioluminescence and its introduction in Pseudomonas, Agrobacterium and Rhizobium; Boivin R et al.; A simple method based upon the use of a Tn5 derivative, Tn5-Lux, has been devised for the introduction and stable expression of the character of bioluminescence in a variety of gram-negative bacteria . In Tn5-Lux, the luxAB genes of Vibrio harveyi encoding luciferase are inserted on a SalI--BglII fragment between the kanamycin resistance (Kmr) gene and the right insertion sequence . The transposon derivative was placed on a transposition suicide vehicle by in situ recombination with the Tn5 suicide vector pGS9, to yield pDB30 . Mating between Escherichia coli WA803 (pDB30) and a strain from our laboratory, Pseudomonas sp . RB100C, gave a Kmr transfer frequency of 10(-6) per recipient, a value 10 times lower than that obtained with the original suicide vehicle pGS9 . Tn5-Lux was also introduced by insertion mutagenesis in other strains of gram-negative soil bacteria . The bioluminescence marker was expressed in the presence of n-decanal, and was monitored as chemiluminescence in a liquid scintillation counter . The recorded light intensities were fairly comparable among the strains, and ranged between 0.2 to 1.8 x 10(6) cpm for a cell density of 10(3) colony forming units/ml . Nodules initiated by bioluminescent strains of Rhizobium leguminosarum on two different hosts were compared for intensity of the bioluminescence they produced.

J Bacteriol, 1988 Jul, 170(7), 2939 - 46
Opine utilization by Agrobacterium spp.: octopine-type Ti plasmids encode two pathways for mannopinic acid degradation; Dessaux Y et al.; Octopine-type strains of Agrobacterium tumefaciens degrade the opine mannopinic acid through a specific pathway which involves cleavage of the molecule at the C--N bond between the amino acid and the sugar moieties . Mannose was identified as a product of the reaction . This pathway was inducible by mannopinic and agropinic acids, but not by mannopine or agropine, the two other mannityl opines . The transport system for this pathway appeared to be specific for mannopinic acid . A second, nonspecific pathway for mannopinic acid degradation was also identified . This involved some of the catabolic functions associated with the metabolism of mannopine and agropine . This second pathway was inducible by mannopine and agropine but not by mannopinic or agropinic acids . The transport system for this pathway appeared to have a broad specificity . Transposon Tn5 insertion mutants affected in the specific catabolic pathway were isolated and analyzed . These mutants continued to catabolize mannopine and agropine . Both mapped to a region of the Ti plasmid previously shown to be associated with the catabolism of mannopinic acid . Restriction enzyme analysis of the Ti plasmid from strain 89.10, an octopine strain that is naturally unable to utilize mannopinic acid, showed a deletion in this same region encoding the specific mannopinic acid degradation pathway . Analysis of recombinant clones showed that the second, nonspecific pathway was encoded in a region of the Ti plasmid associated with mannopine and agropine catabolism . This region shared no structural overlap with the segment of the plasmid encoding the specific mannopinic acid degradative pathway.

Gene, 1988 Jun 15, 66(1), 19 - 29
Escherichia coli lacZ gene as a biochemical and histochemical marker in plant cells; Matsumoto S et al.; Several lacZ chimeric genes were constructed by fusing the truncated lacZ sequence of Escherichia coli to N-terminal sequences of few other genes . Promoters used to direct expression of the chimeric genes were the promoter for 35S RNA of cauliflower mosaic virus (P35S) as well as those of the small subunit gene of ribulose bisphosphate carboxylase and the octopine synthase gene . These constructs were introduced into tobacco cells using a Ti plasmid of Agrobacterium tumefaciens, and beta-galactosidase activity in uncloned and cloned calli derived from the crown galls were examined . The results showed that the P35S-linked lacZ chimeric gene is expressed very efficiently . When slices of the crown gall carrying this chimeric gene were placed on plates containing indicator XGal, localized areas of the outgrowth turned deep blue, whereas no such areas were found in the crown gall having promoter-less lacZ . Calli from galls containing this construct expressed beta-galactosidase activity at an eight-fold higher level (approx . 7000 units/mg protein) than the endogenous activity (approx . 900 units/mg protein) . Some of the calli displayed over 20-fold higher activity . Actively growing mini calli expressing activity higher than 4000 units/mg protein dyed deep blue on XGal agar medium such that they were distinguishable from calli having no lacZ . Half of the uncloned P35S-lacZ transformant calli showed activity higher than this level . These results indicate that the lacZ gene linked to a strong promoter such as P35S is useful as a biochemical and histochemical marker gene in plant cells.

Genes Dev, 1988 Jun, 2(6), 677 - 87
Expression of nodule-specific genes in alfalfa root nodules blocked at an early stage of development; Dickstein R et al.; To help dissect the molecular basis of the Rhizobium-legume symbiosis, we used in vitro translation and Northern blot analysis of nodule RNA to examine alfalfa-specific genes (nodulins) expressed in two types of developmentally defective root nodules elicited by Rhizobium meliloti . Fix- nodules were elicited by R . meliloti nif mutants; these nodules were invaded by rhizobia and contained differentiated bacteroids . 'Empty' nodules were elicited by R . meliloti exo and ndv mutants and by Agrobacterium tumefaciens strains carrying the R . meliloti nod genes; these nodules contained a nodule meristem but lacked infection threads, intracellular bacteria, and bacteroids . Fix- nodules contained a spectrum of nodulins similar to wild-type nodules . In contrast, only two nodulins, Nms-30 and a nodulin homologous to ENOD2 of soybean, were detected in empty nodules . Although R . meliloti ndv and exo mutants elicited nodules with the same defective phenotype, ndv and exo mutants (except for exoC mutants) had distinct biochemical phenotypes . R . meliloti ndvA and ndvB mutants were deficient in cyclic glucan production but not the acidic exopolysaccharide; the converse was true for exoA, exoB, and exoF mutants . exoC mutants were defective in both exopolysaccharide and cyclic glucan biosynthesis . Our results support the model that the R . meliloti nod genes produce a signal that results in nodule meristem induction . Both the exopolysaccharide and cyclic glucan, however, appear to act at the next step in the developmental process and are involved in the production of a signal (or structure) that allows infection thread formation and invasion of the nodule.

Genes Dev, 1988 Jun, 2(6), 688 - 97
rolA locus of the Ri plasmid directs developmental abnormalities in transgenic tobacco plants; Sinkar VP et al.; Plants containing the left T-DNA (TL) of Agrobacterium rhizogenes show a variety of developmental abnormalities that include severely wrinkled leaves, loss of apical dominance, reduced geotropism of roots, reduced internode distances, and floral hyperstyly . The TL-DNA also affects the morphology of tumor tissue at the site of inoculation on Kalanchoe diagremontiana leaves . Single mutations at four loci of the TL-DNA (rolA, rolB, rolC, and rolD) are known to affect tumor morphology on K . diagremontiana leaves . We regenerated plants from tissues transformed with TL-DNA containing mutations in each of the rol loci in order to determine which of the rol loci, if any, control the abnormal plant phenotype . Only plants regenerated after infection with bacteria containing a mutation in rolA locus showed loss of the wrinkled leaf phenotype . The rolA locus was cloned into the plant transformation vector pGA472 and introduced alone into plants . Transgenic plants containing rolA displayed the abnormal phenotype . These results indicate that rolA is the primary determinant of the severely wrinkled phenotype of Ri plasmid transgenic plants . Other rol loci may influence the degree of developmental abnormalities.

J Bacteriol, 1988 Jun, 170(6), 2659 - 67
The Agrobacterium tumefaciens virE2 gene product is a single-stranded-DNA-binding protein that associates with T-DNA; Christie PJ et al.; Agrobacterium tumefaciens transfers T-DNA into the plant genome by a process mediated by Ti plasmid-encoded vir genes . Cleavage at T-DNA border sequences by the VirD endonuclease generates linear, single-stranded T-DNA molecules . In the work described in this report, we used electrophoretic mobility shift assays to show that the purified virE2 gene product binds to single-stranded DNA . VirE2 protein associates with T-DNA as shown by immunoprecipitation studies with VirE2-specific antiserum . The VirE2 protein was detected primarily in the cytoplasm, but also in the inner and outer membrane and periplasmic fractions . Virulence of a virE2 mutant was restored by mixed infection with strains carrying an intact vir region, but not with virA, virB, virD, virE, or virG mutants or chvA, chvB, or exoC mutants . We propose that the VirE2 protein is involved in the processing of T-DNA and in T-strand protection during transfer to the plant cell.

Nucleic Acids Res, 1988 May 25, 16(10), 4621 - 36
Analysis of the complete nucleotide sequence of the Agrobacterium tumefaciens virB operon; Thompson DV et al.; The complete nucleotide sequence of the virB locus, from the octopine Ti plasmid of Agrobacterium tumefaciens strain 15955, has been determined . In the large virB-operon (9600 nucleotides) we have identified eleven open reading frames, designated virB1 to virB11 . From DNA sequence analysis it is proposed that nearly all VirB products, i.e . VirB1 to VirB9, are secreted or membrane associated proteins . Interestingly, both a membrane protein (VirB4) and a potential cytoplasmic protein (VirB11) contain the consensus amino acid sequence of ATP-binding proteins . In view of the conjugative T-DNA transfer model, the VirB proteins are suggested to act at the bacterial surface and there play an important role in directing T-DNA transfer to plant cells.

Mol Microbiol, 1988 May, 2(3), 413 - 7
virA and virG are the Ti-plasmid functions required for chemotaxis of Agrobacterium tumefaciens towards acetosyringone; Shaw CH et al.; Octopine and nopaline Ti-plasmids confer upon Agrobacterium tumefaciens C58C1 the ability to respond chemotactically to the vir-inducing phenolic wound exudate, acetosyringone . A . tumefaciens C58C1 containing Ti-plasmids with Tn5 insertions in virB, C, D or E exhibited marked chemotaxis towards acetosyringone . However, Ti-plasmids with mutations in virA or virG were unable to confer the responsive phenotype . Of the cosmid clones pVK219 (virAB) pVK221 (virBGC) pVK225 (virGCDE) and pVK257 (virABGC) mobilized to cured A . tumefaciens C58C1, only pVK257 bestowed acetosyringone chemotaxis . virA and virG are thus required for chemotaxis of A . tumefaciens towards acetosyringone . This suggests a multifunctional role for virA and virG: at low concentrations of acetosyringone they mediate chemotaxis and at higher concentrations they effect vir-induction.

J Bacteriol, 1988 May, 170(5), 2395 - 400
Scanning electron microscope studies of Agrobacterium tumefaciens attachment to Zea mays, Gladiolus sp., and Triticum aestivum; Graves AE et al.; Scanning electron microscope studies demonstrated that cells of Agrobacterium tumefaciens strains attach to cells on the cut surfaces of corn and wheat seedlings and to gladiolus disks . Bacterial cells attached to these monocots in the same manner as they attached to the dicots tested . Of the strains tested, A66 and T37 covered more of the cut surfaces of these monocots in a nonrandom fashion than did cells of other isolates . These bacteria attached to cells of intact monocotyledonous plants and had the greatest affinity for tissues located within the vascular bundles . They attached in large numbers to cells in these areas in all three monocots tested.

Infect Immun, 1988 May, 56(5), 1101 - 6
Characterization of Brucella polysaccharide B; Bundle DR et al.; Polysaccharide B was extracted from Brucella melitensis 16M and from a rough strain of Brucella abortus 45/20 by autoclaving or trichloroacetic acid extraction of whole cells and by a new method involving mild leaching of cells . The material obtained by either of the established procedures was contaminated by O polysaccharide . The new leaching protocol eliminated this impurity and provided a pure glucan, which was regarded as polysaccharide B . This polysaccharide was found by high-performance liquid chromatography separations, chemical composition, methylation, and two-dimensional homo- and heteronuclear magnetic resonance experiments to be a family of nonreducing cyclic 1,2-linked polymers of beta-D-glucopyranosyl residues . The degree of polymerization varied between 17 and 24 . Polysaccharide B was essentially identical to cyclic D-glucans produced by Rhizobia, Agrobacteria, and other bacterial species . Pure polysaccharide B did not precipitate with Brucella anti-A or anti-M serum and did not inhibit the serological reaction of Brucella A or M antigen with either bovine or murine monoclonal Brucella anti-A or anti-M serum . Previously described serological reactions of polysaccharide B preparations with Brucella anti-A and anti-M sera are related in this study to the presence in crude extracts of contaminants with the antigenic properties of Brucella lipopolysaccharide O polysaccharides.

Plasmid, 1988 May, 19(3), 189 - 202
Map location on Agrobacterium root-inducing plasmids of homologies with the virulence region of tumor-inducing plasmids; Birot AM et al.; Southern-type hybridizations were carried out in order to identify sequence homologies with the pTi vir loci, on an agropine-type plasmid (pRiHRI) and a mannopine-type plasmid (pRi8196) of Agrobacterium rhizogenes . The localization of the sequences hybridizing with subcloned fragments containing vir A, B, G, C, and D from pTiAch5 indicated a similar linear organization of the pTi vir loci and their homologies on pRiHRI and pRi8196, though no homology was detected on both pRi with a 1.1-kb internal fragment of virD . No homology was detected either with the vir E locus on pRiHRI vir region, nor with the virF locus on both pRi vir regions . As on nopaline pTiC58, fragments bearing the homologies with virC and virG are closer together on both pRi than on octopine pTiAch5 . A preliminary functional map of the pRiHRI vir region is deduced from this study.

Mol Microbiol, 1988 May, 2(3), 385 - 92
Regulation of the virC and virD promoters of pTiC58 by the ros chromosomal mutation of Agrobacterium tumefaciens; Tait RC et al.; The virC and virD operons of the virulence region of the Ti plasmid are highly regulated, requiring a transcriptional regulator that is encoded by virG and is activated by the product of virA and plant phenolics such as acetosyringone . Full expression of virC and virD of octopine and nopaline Ti plasmids is also obtained by a mutation in the ros gene of the Agrobacterium tumefaciens chromosome . S1-nuclease analysis, in vitro transcription, and DNase I protection experiments with A . tumefaciens RNA polymerase revealed virD promoters tandemly arranged, both of which are functional in the Ros mutant, while only one is functional in the presence of acetosyringone . A third (overlapping) promoter appears to be responsible for transcription of virC . Expression of virC and virD appears to be modulated by factors within the bacterium by means of a mechanism that is independent of factors produced during infection of the host plant.

Proc Natl Acad Sci U S A, 1988 May, 85(9), 2909 - 13
Agrobacterium tumefaciens virE operon encodes a single-stranded DNA-binding protein; Das A; The virulence (vir) genes of Agrobacterium tumefaciens Ti plasmid are essential for transformation of plant cells . Overproduction of a virE-encoded gene product in Escherichia coli was achieved by construction of an operon fusion with the E . coli tryptophan (trp) operon . The virE2 gene product in E . coli partitioned into the insoluble membrane fraction . The protein was solubilized by treatment with 4 M urea at 0 degree C . DNA-protein binding experiments showed that a strong single-stranded (ss) DNA-binding activity was present in protein fractions containing the virE2 gene product . The binding was highly specific with little or no binding observed with either double-stranded DNA or ssRNA . No significant binding to Ti plasmid DNA sequences was observed . Protein blotting studies indicated that the ssDNA-binding activity was associated with the 68-kDa virE2 polypeptide.

J Biol Chem, 1988 Apr 25, 263(12), 5804 - 14
Characterization of the virB operon from an Agrobacterium tumefaciens Ti plasmid; Ward JE et al.; The virulence genes of the Agrobacterium tumefaciens Ti plasmid are grouped into six transcription units and direct the transfer of T-DNA into plant cells . We report here the nucleotide sequence of the largest vir operon, virB, from the Ti plasmid pTiA6NC . This operon contains 11 open reading frames, 7 of which show evidence of translational coupling . trpE::virB gene fusions were used to confirm the reading frames of genes virB2, 4, 5, 6, 7, 8, 10, and 11 . In addition, the native gene products of virB6 and virB9 were identified using maxicell and in vitro transcription-translation techniques, and the VirB9 protein was found to be proteolytically processed . The codon usage of the predicted virB genes is very similar to the other pTiA6 vir genes and is much less biased than Escherichia coli . Since many of the virB gene products have secretion signals common to exported bacterial proteins, it is likely that they will be membrane-associated . We propose that the VirB proteins are involved in the formation of a transmembrane structure which mediates the passage of the transferred T-DNA molecule through the bacterial and plant cell membranes.

Nucleic Acids Res, 1988 Apr 25, 16(8), 3127 - 40
Selective recovery of foreign gene transcripts as virus-like particles in TMV-infected transgenic tobaccos; Sleat DE et al.; A short origin-of-assembly sequence (OAS) located in the 30kDa movement protein gene, about 1.0kb from the 3'-end of the common strain of tobacco mosaic virus (TMV) RNA, nucleates encapsidation of the 6395-nucleotide-long genome by TMV coat protein in vitro, and presumably also in vivo . Single-stranded RNAs containing a foreign reporter gene sequence and the TMV OAS at their 5' - and 3' -ends, respectively, can be synthesized in vitro from recombinant SP6-transcription plasmids and will assemble spontaneously in vitro to form TMV-like 'pseudovirus' particles . In this paper, we show that foreign gene transcripts derived from the nuclear DNA of plants transformed by Agrobacterium tumefaciens, and which contain the TMV OAS, can be assembled into stable 'pseudovirus' particles in vivo during a systemic infection by TMV (helper) . This is the first report of structural complementation between a heritable function bestowed on a transgenic plant and an infecting virus . As a route to protect, accumulate and recover a specific mRNA in vivo, in transgenic plant cells, this novel approach may find wider applications in developmental plant molecular biology.

Eur J Biochem, 1988 Apr 5, 173(1), 123 - 30
Ornithine cyclodeaminase from Ti plasmid C58: DNA sequence, enzyme properties and regulation of activity by arginine; Sans N et al.; Nopaline, an abundant opine in plant cells transformed with nopaline-type Ti plasmids, is catabolized in Agrobacterium by three Ti-plasmid-coded steps via arginine and ornithine to proline . The last enzyme, ornithine cyclodeaminase (OCD), converts ornithine directly into proline with release of ammonia . We describe the DNA sequence of the ocd gene from Ti plasmid C58, antiserum against an OCD fusion protein overexpressed in Escherichia coli, induction and identification of the gene product in Agrobacterium and enzymatic properties of the protein . The DNA sequence suggests a soluble protein with a stretch of some homology with ornithine carbamoyltransferases from other bacteria . OCD activity is subject to substrate inhibition, is stimulated by NAD+ (presumably acting as a catalytic cofactor) and is regulated by L-arginine which has pronounced effects on the optima for pH and temperature and on the Km for ornithine . The regulation of OCD activity by L-arginine is discussed as part of the mechanisms which integrate the pathway of Ti-plasmid-coded opine utilization with general metabolism in Agrobacterium.

Proc Natl Acad Sci U S A, 1988 Apr, 85(8), 2553 - 7
Structure of the octopine synthase upstream activator sequence; Leisner SM et al.; We have identified a transcriptional activating element within the 5' flanking sequence of the Agrobacterium tumefaciens octopine synthase (ocs) gene that is necessary for ocs expression in transformed tobacco calli . This element is located between 333 and 116 base pairs upstream from the transcription initiation site and functions independent of orientation when placed upstream of the ocs gene . It does not function in either orientation when placed downstream of the gene, nor can it activate its promoter when separated by a distance of 608 base pairs . Deletion analysis indicates that sequences essential for activator function are localized between 222 and 177 base pairs upstream of the transcription initiation site . Another region, located between 333 and 249 base pairs upstream of the transcription initiation site, does not as a monomer activate the ocs promoter, but it can as a dimer.

Virology, 1988 Apr, 163(2), 572 - 8
Expression of alfalfa mosaic virus cDNA1 and 2 in transgenic tobacco plants; van Dun CM et al.; Chimeric genes composed of DNA complementary to alfalfa mosaic virus (AIMV) RNAs 1 or 2, the CaMV 35 S promoter, and the nos polyadenylation signal were transferred to the genome of Nicotiana tabacum cv . Samsun NN by means of the Agrobacterium tumefaciens transformation system . Transformants contained intact copies of the viral genes and accumulated transcripts of approximately the size predicted from the cloning procedure . Using antisera raised against synthetic peptides corresponding to the C-terminal parts of AIMV P1 and P2, it was not possible to detect viral translation products in the transformants . However, transgenic protoplasts containing cDNA1 were able to complement an infection by the AIMV nucleoproteins containing RNAs 2 and 3, indicating that biologically active P1 accumulates in these protoplasts . Upon inoculation with AIMV strains 425 or YSMV, the cDNA1- and cDNA2-transformed plants became infected to a level similar to that of nontransformed or vector-transformed control plants.

Mol Gen Genet, 1988 Apr, 212(1), 182 - 90
Relative strengths of the 35S cauliflower mosaic virus, 1', 2', and nopaline synthase promoters in transformed tobacco sugarbeet and oilseed rape callus tissue; Harpster MH et al.; The 35S promoter of cauliflower mosaic virus and promoters from the nopaline synthase, 1' and 2' genes of Agrobacterium tumefaciens T-DNA were fused to the bacterial octopine synthase and chitinase gene coding regions . These chimaeric gene constructions were introduced into tobacco, sugarbeet and oilseed rape cells and their relative levels of expression measured by primer extension analysis of RNA isolated from pooled populations of stably transformed calli . In tobacco callus, the 35S promoter provided the highest levels of gene expression, followed by the 2', 1' and nopaline synthase promoters . While the ranking of these promoters is conserved in sugarbeet and oilseed rape callus, there is between-species variation in the relative strength of these promoters . In all three species, transcription initiation is conserved for each of the chimaeric gene constructions . Additional constructions in which the 5' untranslated leader of a petunia chlorophyll a/b binding protein gene is substituted for DNA downstream of the 35S transcription start site demonstrates that heterologous 5' leader sequences can be utilized to augment steady-state levels of reporter gene expression.

J Bacteriol, 1988 Apr, 170(4), 1759 - 67
Characterization and mapping of the agrocinopine-agrocin 84 locus on the nopaline Ti plasmid pTiC58; Hayman GT et al.; Overlapping segments of pTiC58 inserted into cosmid vectors were used to characterize the agrocinopine-agrocin 84 locus from the nopaline/agrocinopine A and B Agrobacterium tumefaciens strain C58 . All of the clones conferring agrocin 84 sensitivity on agrobacteria also conferred uptake of agrocin 84 and agrocinopines A and B . Transposon Tn3-HoHo1 insertion mutations of one such clone were generated that simultaneously abolished agrocin 84 sensitivity and transport of agrocinopines A and B and agrocin 84 . Such insertions were found to cluster within a 4.4-kilobase region . Analysis of beta-galactosidase activity in these insertion mutants suggested a single transcriptional unit regulated at the transcriptional level by agrocinopines A and B . The smallest DNA fragment subcloned from the region to confer all three activities was 8.5 kilobases long . This subclone was still properly regulated, indicating that the regulatory gene is closely linked to the locus . The data are consistent with a single operon encoding catabolism of agrocinopines A and B and conferring sensitivity to agrocin 84 . Based on these results, we support the locus name acc, for agrocinopine catabolism.

J Bacteriol, 1988 Apr, 170(4), 1523 - 32
Virulence genes, borders, and overdrive generate single-stranded T-DNA molecules from the A6 Ti plasmid of Agrobacterium tumefaciens; Veluthambi K et al.; Agrobacterium tumefaciens transfers the T-DNA portion of its Ti plasmid to the nuclear genome of plant cells . Upon cocultivation of A . tumefaciens A348 with regenerating tobacco leaf protoplasts, six distinct single-stranded T-DNA molecules (T strands) were generated in addition to double-stranded T-DNA border cleavages which we have previously reported (K . Veluthambi, R.K . Jayaswal, and S.B . Gelvin, Proc . Natl . Acad . Sci . USA 84:1881-1885, 1987) . The T region of an octopine-type Ti plasmid has four border repeats delimiting three T-DNA regions defined as T left (TL), T center (TC), and T right (TR) . The six T strands generated upon induction corresponded to the TL, TC, TR, TL + TC, TC + TR, and TL + TC + TR regions, suggesting that the initiation and termination of T-strand synthesis can occur at each of the four borders . Most TL + TC + TR T-strand molecules corresponded to the top T-DNA strand, whereas the other five T strands corresponded to the bottom T-DNA strand . Generation of T strands required the virA, virG, and virD operons . Extra copies of vir genes, harbored on cosmids within derivatives of A . tumefaciens A348, enhanced production of T strands . The presence of right and left border repeats in their native orientation is important for the generation of full-length T strands . When a right border repeat was placed in the opposite orientation, single-stranded T-DNA molecules that corresponded to the top strand were generated . Deletion of overdrive, a sequence that flanks right border repeats and functions as a T-DNA transmission enhancer, reduced the level of T-strand generation . Induction of A . tumefaciens cells by regenerating tobacco protoplasts increased the copy number of the Ti plasmid relative to the bacterial chromosome.

J Bacteriol, 1988 Apr, 170(4), 1430 - 7
Genetic analysis of the virE operon of the Agrobacterium Ti plasmid pTiA6; McBride KE et al.; The virE operon of the Agrobacterium tumefaciens Ti plasmid pTiA6 encodes at least one trans-acting protein involved in the expression of virulence . Two open reading frames designated virE1 and virE2 code for polypeptides of 7 and 60 kilodaltons (kDa), respectively, that can be visualized after expression in Escherichia coli minicells . To determine which virE sequences are required for virulence, a strain deleted for the entire locus {strain KE1(pTiA6 delta E)} was constructed and tested for the ability to be complemented by subclones with and without site-directed mutations in the virE operon . One subclone containing only virE1 and virE2 as well as upstream promoter sequences was sufficient to restore full virulence on the host plant Kalanchoe daigremontiana . However, some other virulence locus representing a host range determinant appeared to be deleted from strain KE1(pTiA6 delta E), since virE1 and virE2 were not sufficient to fully restore virulence on wounded tomato plants . virE operon constructs with specific lesions in either virE1 or virE2 were impaired for complementation of pTiA6 delta E . Several mutations specific for the promoter-proximal virE1 locus appeared to have a polar effect on expression of the virE2-encoded 60-kDa protein . However, virE2::lacZ fusion constructs suggest that this effect is not at the level of transcription or translation . Collectively, these data indicate that both the 7- and the 60-kDa polypeptides are virulence determinants for the Ti plasmid pTiA6 and suggest that the 60-kDa protein may be less stable in the absence of the 7-kDa protein.

Genetika, 1988 Mar, 24(3), 436 - 42
{Transfer of hybrid plasmids pRP1.2::MINI-Mu into Agrobacterium and Rhizobium cells}; Piruzian ES et al.; The study is devoted to determination of bacteriophage Mu genome regions responsible for transfer limitation and instability of the plasmids in cells of strains of practically important microorganisms . With this aim in view, we determined the frequency of transfer into Agrobacterium tumefaciens and Rhizobium meliloti cells of plasmids with mini-Mu phages carrying previously constructed deletions of various lengths . Sharp decrease has been noted in the frequency of transfer into A . tumefaciens strain PG2592 of all the plasmids used, as compared with the initial plasmid pRP1.2 with no dependence on the availability of mini-Mu killing functions . This gives evidence that deletions in the mini-Mu utilized do not include the sites affected by the recipient' restriction system . As regards R . meliloti L5-30-M27, it appeared that the transfer of pRM30 plasmid carrying mini-Mu 5 with conserved killing functions (the ability for autonomous transposition) is of the same frequency as the transfer of pRP1.2 . In this mini-Mu, the region between the extreme HpAI sites in the right end is missing, this region being probably responsible for such low frequency of transfer into Rhizobium cells of Mu-containing plasmid.

Microbiol Sci, 1988 Mar, 5(3), 92 - 5
Use of Agrobacterium radiobacter in agricultural ecosystems; Moore LW; Agrobacterium tumefaciens is a soil inhabitant that infects many dicotyledonous plants, causing crown gall disease . The success of Agrobacterium radiobacter K84 to control this disease in agroecosystems throughout the world has been impressive . This review describes the attributes of K84, its mechanism of control, its failures, and other alternative biocontrol agents.

Mol Plant Microbe Interact, 1988 Mar, 1(3), 121 - 7
Identification of the product of an Agrobacterium tumefaciens chromosomal virulence gene; Zorreguieta A et al.; The chvB operon of Agrobacterium tumefaciens is required for bacterial attachment to plant cells and for efficient crown gall tumor formation . As defined by the virulence phenotypes of mutants with transposon insertions mapping in the region, the operon was previously mapped to a 5-kilobase (kb) stretch of chromosomal DNA . We report here that the operon is actually about 8.5 kb long and that it contains a 7-kb gene coding for a large membrane protein involved in the synthesis of cyclic beta-1,2-glucan . Mutants with transposon insertions within the 5-kb phenotypically defined operon do not synthesize this functional protein, do not synthesize beta-1,2-glucan, and do not form tumors . However, mutants with insertions that map up to 3.5 kb downstream of the phenotypically defined operon synthesize truncated proteins that are active in beta-1,2-glucan synthesis . These mutants form tumors . The truncated proteins correspond closely in size with the map positions of the insertions, suggesting that the insertions truncate the proteins by translational termination . A plasmid that contains only the phenotypically defined chvB operon also codes for a truncated protein . A fusion product between the protein and beta-galactosidase carried on a Tn3-HoHo1 insertion was observed in one mutant . Partial trypsin digestion of wild-type inner membranes generated truncated proteins that were active in beta-1,2-glucan synthesis, demonstrating that a large portion of the protein is not required for beta-1,2-glucan synthesis . The correlation between beta-1,2-glucan synthesis by the truncated proteins and tumorigenesis strongly implicates the polysaccharide product of this protein in tumor formation.

Plasmid, 1988 Mar, 19(2), 75 - 83
Homology mapping of T-DNA regions on three Agrobacterium rhizogenes Ri plasmids by electron microscope heteroduplex studies; Brevet J et al.; Recombinant plasmids carrying segments of the Agrobacterium rhizogenes T-DNA regions of the three Ri plasmids 1855 (TL-DNA only), 8196, and 2659 were used for establishing homology maps by electron microscope examination of heteroduplexes . Plasmid DNA was linearized by digestion with suitable restriction endonucleases in order to generate large T-DNA segments . Heteroduplexes were prepared in 50% formamide and spread under standard conditions . Measurements of double and single strands allowed the drawing of homology maps . The three T-DNAs share mainly two homologous sequences of respectively about 2.5 and 1.5 kb, bracketing a largely nonhomologous central part which is about 5.5 kb long . The T-DNAs from pRi1855 and pRi2659 appear to be more related to each other than to that of pRi8196 . With reference to the published nucleotide sequence of the TL-DNA of pRiA4 (probably identical to that of pRi1855), ORFs 8 and 14 seem to be the most conserved sequences of the three T-DNAs . The significance of these conserved sequences is unclear since the genetic loci involved in rhizogenicity of agropine strains identified previously are located in nonhomologous regions.

J Bacteriol, 1988 Mar, 170(3), 1408 - 11
Mapping of Agrobacterium tumefaciens chromosomal genes affecting cellulose synthesis and bacterial attachment to host cells; Robertson JL et al.; Six chromosomal transposon mutations in Agrobacterium tumefaciens which result in an inability to synthesize cellulose fibrils were mapped to the vicinity of trp-2 and met-6 . Mutations which result in an inability to attach to plant cells, attC43 and attC69, also mapped in this region, as did one Tn5 mutation which caused overproduction of cellulose . Another cellulose overproduction mutation mapped at a distance and was closely linked to ilv-13 . The results suggest that there is a region of the A . tumefaciens chromosome located near met-6 which is concerned with the interaction of the bacterium with the host cell surface.

J Ethnopharmacol, 1988 Feb-Mar, 22(2), 143 - 72
Studies on the pharmacological activity of Amazonian Euphorbiaceae; Macrae WD et al.; Plant material from 34 Amazonian species of the family Euphorbiaceae were collected and extracts prepared . Sixteen of these species have a documented use as a medicinal agent . The extracts were tested for their ability to inhibit the growth of the bacteria, Escherichia coli and Staphylococcus aureus; the yeasts, Saccharomyces cerevisiae and Candida albicans; the dermatophytic fungi, Microsporum canis, Microsporum fulvum, Microsporum gypseum and Trichophyton gallinae; the viruses, Sindbis virus and murine cytomegalovirus; and tumours induced on potato discs by Agrobacterium tumefaciens . They were also examined for their toxicity to brine shrimp, Artemia salina . The results are discussed with respect to ethnobotanical information available for some of the species.

J Gen Microbiol, 1988 Feb, 134 ( Pt 2), 413 - 24
Transfer of the Ti plasmid from Agrobacterium tumefaciens into Escherichia coli cells; Sprinzl M et al.; We have screened strains of Agrobacterium tumefaciens for spontaneous mutants showing constitutive transfer of the nopaline Ti plasmid pTiC58 during conjugation . The Ti plasmid derivatives obtained could be transferred not only to A . tumefaciens but also to E . coli cells . The Ti plasmid cannot survive as a freely replicating plasmid in E . coli, but it can occasionally integrate into the E . coli chromosome . However, insertion in tandem of plasmids carrying fd replication origins (pfd plasmids) into the T-DNA provides an indicator for all transfer events into E . coli cells, providing fd gene 2 protein is present in these cells . This viral protein causes the excision of one copy of the pfd plasmid and allows its propagation in the host cell . By using this specially designed Ti plasmid, which was also made constitutive in transfer functions, we found plasmid exchange among A . tumefaciens strains and between A . tumefaciens and E . coli cells to be equally efficient . A Ti plasmid with repressed transfer functions was transferred to E . coli with a rate similar to the low frequency at which it was transferred to A . tumefaciens . The expression of transfer functions of plasmid RP4 either in A . tumefaciens or in E . coli did not increase the transfer of the Ti plasmid into E . coli cells, nor did the addition of acetosyringone, an inducer of T-DNA transfer to plant cells . The results show that A . tumefaciens can transfer the Ti plasmid to E . coli with the same efficiency as within its own species . Conjugational transmission of extrachromosomal DNA like the narrow-host-range Ti plasmid may often not only occur among partners allowing propagation of the plasmid, but also on a 'try-all' basis including hosts which do not replicate the transferred DNA.

J Bacteriol, 1988 Feb, 170(2), 790 - 5
Expression of an Agrobacterium Ti plasmid gene involved in cytokinin biosynthesis is regulated by virulence loci and induced by plant phenolic compounds; John MC et al.; The nopaline-type Ti plasmid T37 of Agrobacterium tumefaciens carries two distinct genes that encode enzymes involved in cytokinin biosynthesis . In this report, we show that the level of expression of one of these genes was increased dramatically by culture conditions that increased the expression of Ti plasmid virulence genes, including coculture with plant cells or treatment with acetosyringone, a plant phenolic compound . When this nopaline-type Ti plasmid gene was introduced into Agrobacterium strains containing an octopine-type Ti plasmid, similar induction of expression by culture conditions was observed, and analysis of virulence region mutants demonstrated that this induction was under the control of the virA and virG regulatory loci . We further show that induction was strongly pH dependent in octopine strains but, under the conditions examined, pH independent in nopaline strains.

Biochem Biophys Res Commun, 1988 Jan 29, 150(2), 640 - 7
Seed-transmissible expression of mammalian metallothionein in transgenic tobacco; Maiti IB et al.; A binary plasmid was constructed to contain the mouse metallothionein c-DNA, the constitutive 35S promoter from cauliflower mosaic virus, the polyadenylation signal from the pea rbcS-E9 gene and several selectable markers . The plasmid was transferred to Agrobacterium tumefaciens and the leaf disc method was used to transform tobacco . Callus and shoots were regenerated in the presence of kanamycin and transformed plants were obtained . Southern, Northern and Western blot analysis demonstrated integration and expression of the metallothionein gene in transformed callus and transgenic plants . The gene is transmitted to and expressed in seed derived progeny as a dominant Mendelian trait.

Virology, 1988 Jan, 162(1), 248 - 50
Agrobacterium-mediated infectivity of cloned digitaria streak virus DNA; Donson J et al.; A monomeric clone of double-stranded DNA synthesized in vitro DNA of the geminivirus Digitaria streak (DSV) was subcloned as a tandem dimeric unit into a binary vector of Agrobacterium tumefaciens, creating a plasmid pDS2 . Inoculation of digitaria sanguinalis with A . tumefaciens carrying pDS2 resulted in viral infection . The symptoms, virus particles, and DNA forms obtained were indistinguishable from those of a natural DSV infection of D . sanguinalis . Inoculations have also induced infections in Zea mays and Avena sativa . The sequence of the Agrobacterium-mediated infectious clone of DSV has been determined.

Gene, 1988, 62(2), 237 - 47
A bacteriophage T4 expression cassette that functions efficiently in a wide range of gram-negative bacteria; Frey J et al.; We have constructed a derivative of the broad-host-range vector RSF1010 . This plasmid, p alpha omega, contains an expression cassette derived from bacteriophage T4 gene 32, into which we have inserted the coding sequence for the xylE enzyme (C2,3O) of the TOL plasmid pWWO . The composite plasmid, p alpha xylE omega, was transferred by conjugal mobilisation into a variety of Gram-negative bacteria (Agrobacter, Paracoccus, Erwinia, Pseudomonas, Rhizobium and Xanthomonas) . High levels of C2,3O activity were found in almost all of the extracts . Polyacrylamide gel electrophoresis of these extracts revealed a prominent protein band at 35 kDa whose identity as the C2,3O gene product was confirmed by immunoblotting . We have mapped the 5' ends of the gene 32/xylE hybrid transcripts . In all of the Gram-negative bacteria, the proximal P2 promoter is the most efficient promoter in the cassette . In most of the strains a weaker and more distal promoter activity (Pl) was also detected . In both uninfected and phage-infected Escherichia coli cells, the transcript produced from this promoter is processed at a specific site upstream from the gene 32 start codon . The same processing occurred in all the bacterial species examined . The decay of the hybrid xylE transcript has been analyzed in E . coli and Erwinia, and in both strains this mRNA was among the most stable.

Folia Microbiol (Praha), 1988, 33(4), 255 - 60
Role of iron in the enhancement by Agrobacterium tumefaciens infection in mice; Mitra A et al.; Microorganisms require iron for their growth and usually compete with their host for available iron from the system . Iron supplementation to host causes an increase of available iron both to host and to potential microbial invaders and favours the latter more than the former as the bacteria release siderophores which are responsible for iron transport mechanism . In view of this observation a study was done to deal with the distribution of storage and injected iron given as an overload within a physiological pool, taking mice as the host, with a correlation to its utilization by Agrobacterium tumefaciens and with bacterial growth and multiplication . The results obtained help in understanding the host--parasite relationships, regarding bacterial virulence and infection and the growth-promoting effect of iron, as iron promoted the development and progression of serum-exposed A . tumefaciens in mice.

Gene, 1988, 63(1), 41 - 52
Mini-Mulac transposons with broad-host-range origins of conjugal transfer and replication designed for gene regulation studies in Rhizobiaceae; Ratet P et al.; Novel mini-Mu derivatives were constructed, carrying a truncated lacZYA operon fused to the terminal 117 bp of the Mu S-end, for the isolation of translational lac fusions by mini-Mu-mediated insertion mutagenesis . Different selectable markers (chloramphenicol resistance; gentamycin resistance) were introduced to allow selection for mini-Mu insertions in different replicons and bacterial strains . A mini-Mulac derivative carrying the site for conjugal transfer of plasmid RP4 (oriT) and the origin of replication of the Agrobacterium rhizogenes Ri plasmid (oriRiHRI) was constructed to enable one-step lac-fusion mutagenesis of cloned (plasmid-borne) regions in Escherichia coli and efficient conjugal transfer of gene fusions to to a variety of Gram-negative bacteria . The conjugation frequency, stability and copy number of replicons carrying mini-Mulac derivatives with oriT and oriRiHRI in members of the Rhizobiaceae such as Rhizobium meliloti, Azorhizobium caulinodans ORS571 and Agrobacterium tumefaciens C58 was examined.

J Bacteriol, 1988 Jan, 170(1), 301 - 7
Structure and transcription analysis of the gene encoding a cellobiase from Agrobacterium sp . strain ATCC 21400; Wakarchuk WW et al.; The DNA sequence was determined for the cloned Agrobacterium sp . strain ATCC 21400 beta-glucosidase gene, abg . High-resolution nuclease S1 protection studies were used to map the abg mRNA 5' and 3' termini . A putative abg promoter was identified whose sequence shows similarities to the consensus promoter of Escherichia coli and with the nif promoter regions of Klebsiella . The abg coding sequence was 1,374 nucleotides long . The molecular weight of the enzyme, based on the predicted amino acid sequence, was 51,000 . The observed Mr was 50,000 to 52,000 . A region of deduced protein sequence was homologous to a region from two other beta-glucosidase sequences . This region of homology contained a putative active site by analogy with the active site of hen egg white lysozyme.

EMBO J, 1987 Dec 20, 6(13), 3881 - 9
Studies on the introduction and mobility of the maize Activator element in Arabidopsis thaliana and Daucus carota; Van Sluys MA et al.; We have co-transformed carrot (Daucus carota) and Arabidopsis thaliana with an Agrobacterium tumefaciens non-tumorigenic T-DNA carrying the maize transposable element Activator (Ac) and an Agrobacterium rhizogenes Ri T-DNA . We present evidence that the Ac element transposes in transformed root or root-derived callus cultures of both species . We show that fertile plants can be regenerated from transformed, root-derived callus cultures of Arabidopsis, demonstrating the utility of the Ri plasmid for introducing the maize Ac element into plants . We also present evidence that Ac elements that excise from the transforming T-DNA early after transformation continue to be mobile in carrot root cultures.

J Bacteriol, 1987 Dec, 169(12), 5835 - 7
Agrobacterium tumefaciens virulence locus pscA is related to the Rhizobium meliloti exoC locus; Marks JR et al.; Agrobacterium tumefaciens and Rhizobium meliloti carry related genetic loci which have important roles in virulence and symbiosis . Previously, it was shown that two virulence loci of A . tumefaciens, chvA and chvB, are related to two R . meliloti symbiosis loci, ndvA and ndvB, respectively (T . Dylan, L . Ielpi, S . Stanfield, L . Kashyap, C . Douglas, M . Yanofsky, E . Nester, D . R . Helinski, and G . Ditta, Proc . Natl . Acad . Sci . USA 83:4403-4407, 1986) . Here we show that these two phytobacteria possess additional related virulence/symbiosis genes . Results of genetic complementation and DNA hybridization experiments indicate that the pscA virulence locus of A . tumefaciens is structurally and functionally related to the exoC symbiosis locus of R . meliloti . Thus, A . tumefaciens and R . meliloti bear at least three related genetic loci that have crucial roles in establishing the interactions that each bacterium has with its respective host plants.

Proc Natl Acad Sci U S A, 1987 Dec, 84(24), 9006 - 10
Mobilization of T-DNA from Agrobacterium to plant cells involves a protein that binds single-stranded DNA; Gietl C et al.; Crude protein extracts of induced and uninduced octopine wild-type strain of Agrobacterium tumefaciens, as well as several mutants of the virulence loci virA, -B, -G, -C, -D, and -E, were probed with single- and double-stranded synthetic oligodeoxynucleotides of different sequence and length in an electrophoretic retardation assay . Four complexes involving sequence-nonspecific, single-stranded-DNA-binding proteins were recognized . One inducible complex is determined by the virE locus, two Ti-plasmid-dependent complexes are constitutively expressed, and a fourth one is controlled by chromosomal genes . The protein-DNA complexes were characterized by sucrose density gradient centrifugation and by determination of the length of single-stranded DNA required for their formation . It is hypothesized that the single-stranded-DNA-binding proteins are involved in the production of T-DNA intermediates or have a carrier or protective function during T-DNA transfer.

J Bacteriol, 1987 Dec, 169(12), 5782 - 8
Reiterated DNA sequences in Rhizobium and Agrobacterium spp; Flores M et al.; Repeated DNA sequences are a general characteristic of eucaryotic genomes . Although several examples of DNA reiteration have been found in procaryotic organisms, only in the case of the archaebacteria Halobacterium halobium and Halobacterium volcanii {C . Sapienza and W . F . Doolittle, Nature (London) 295:384-389, 1982}, has DNA reiteration been reported as a common genomic feature . The genomes of two Rhizobium phaseoli strains, one Rhizobium meliloti strain, and one Agrobacterium tumefaciens strain were analyzed for the presence of repetitive DNA . Rhizobium and Agrobacterium spp . are closely related soil bacteria that interact with plants and that belong to the taxonomical family Rhizobiaceae . Rhizobium species establish a nitrogen-fixing symbiosis in the roots of legumes, whereas Agrobacterium species is a pathogen in different plants . The four strains revealed a large number of repeated DNA sequences . The family size was usually small, from 2 to 5 elements, but some presented more than 10 elements . Rhizobium and Agrobacterium spp . contain large plasmids in addition to the chromosomes . Analysis of the two Rhizobium strains indicated that DNA reiteration is not confined to the chromosome or to some plasmids but is a property of the whole genome.

Nucleic Acids Res, 1987 Nov 11, 15(21), 8983 - 97
Overdrive is a T-region transfer enhancer which stimulates T-strand production in Agrobacterium tumefaciens; van Haaren MJ et al.; Introduction of a left or right synthetic border repeat together with the overdrive sequence in an octopine Ti-plasmid deletion mutant, lacking the right border, resulted in the complete restoration of the oncogenicity of the mutant strain . However introduction of a border repeat without the overdrive, only restored oncogenicity partially . The overdrive sequence turned out to be able to stimulate the synthetic border mediated T-region transfer, independent of its orientation and position relative to the border repeat . Furthermore the distance between border repeat and overdrive could be enlarged, without a loss of overdrive activity . Here we enlarged the distance between the two sequences up to 6714bp . These results were confirmed by estimating the amount of single stranded T-DNA molecules from induced agrobacteria, containing the various border constructs.

J Bacteriol, 1987 Nov, 169(11), 5336 - 8
Chemotaxis to plant phenolic inducers of virulence genes is constitutively expressed in the absence of the Ti plasmid in Agrobacterium tumefaciens; Parke D et al.; The virulence (vir) genes are required in the early stages of plant tumor formation and are located together on the tumor-inducing (Ti) plasmid in Agrobacterium tumefaciens . Five of the vir genes are expressed inducibly in response to the following monocyclic phenolic compounds: acetosyringone, catechol, gallate, beta-resorcylate, protocatechuate, p-hydroxybenzoate, and vanillin . Of these compounds, only the latter six, excluding vanillin {corrected} served as chemoattractants and only the latter three served as growth substrates for A . tumefaciens A348 . Strain A136, isogenic except for lack of the Ti plasmid, demonstrated chemotactic behavior and nutritional capabilities similar to those of strain A348 . The chemotactic response to the vir gene inducers was expressed constitutively.

J Bacteriol, 1987 Nov, 169(11), 5113 - 8
Dual control of Agrobacterium tumefaciens Ti plasmid virulence genes; Close TJ et al.; The virulence genes of nopaline (pTiC58) and octopine (pTiA6NC) Ti plasmids are similarly affected by the Agrobacterium tumefaciens ros mutation . Of six vir region complementation groups (virA, virB, virG, virC, virD, and virE) examined by using fusions to reporter genes, the promoters of only two (virC and virD) responded to the ros mutation . For each promoter that was affected by ros, the level of expression of its associated genes was substantially elevated in the mutant . This increase was not influenced by Ti plasmid-encoded factors, and the mutation did not interfere with the induction of pTiC58 vir genes by phenolic compounds via the VirA/VirG regulatory control mechanism . The effects of the ros mutation and acetosyringone were cumulative for all vir promoters examined . The pleiotropic characteristics of the ros mutant include the complete absence of the major acidic capsular polysaccharide.

Mol Microbiol, 1987 Nov, 1(3), 309 - 16
Nucleotide sequence of the virG locus of the Agrobacterium tumefaciens plasmid pTiC58; Powell BS et al.; The nucleotide sequence of the virG locus of the nopaline type plasmid pTiC58 of Agrobacterium tumefaciens has been determined . It contains an open reading frame (ORF) of 759 nucleotides and has 77% homology to the virG sequences of octopine type plasmids . Differences between the sequences of the two types of Ti plasmids in the region of virG are located predominantly outside the ORF . The amino acid sequences inferred from the two virG genes show 80% homology to each other and each shows the same moderate homologies to amino acid sequences derived from genes in a family of two-component regulatory systems . Specific differences in nucleotide and amino acid sequences as well as a structure-function model for the gene product are discussed.

Can J Microbiol, 1987 Nov, 33(11), 949 - 54
A study of predominant aerobic microflora of black bears (Ursus americanus) and grizzly bears (Ursus arctos) in northwestern Alberta; Goatcher LJ et al.; Swab specimens were obtained from nasal, rectal, and preputial or vaginal areas of 37 grizzly and 17 black bears, captured during May to June of 1981 to 1983, to determine the types and frequency of predominant aerobic microflora . Bacterial genera most frequently isolated from bears were Escherichia, Citrobacter, Hafnia, Proteus, Staphylococcus, and Streptococcus species, comprising about 65% of the isolates . Erwinia, Xanthomonas, Agrobacterium, Rhizobium, and Gluconobacter/Acetobacter were also isolated but at lower frequencies (less than 5%) . Comparison of bacterial generic composition using similarity quotient values showed no appreciable differences between grizzly and black bear flora . Also, no outstanding differences in bacterial generic composition were observed among grizzly bear samples; however, differences were noted among black bear samples . Fungal genera most commonly encountered included Cryptococcus, Rhodotorula, Cladosporium, Penicillium, Sporobolomyces, and Candida . In general, the microflora of both bear types were marked by generic diversity and random distribution . The majority of microorganisms isolated from the plant samples in the study area were also found in bear samples . This observation and the presence of certain water and soil bacteria in samples from bears suggest that the predominant microflora of both grizzly and black bears were transient and probably influenced by their foraging habits and surrounding environments.

J Bacteriol, 1987 Nov, 169(11), 5101 - 12
Regulation of the vir genes of Agrobacterium tumefaciens plasmid pTiC58; Rogowsky PM et al.; The virulence (vir) region of pTiC58 was screened for promoter activities by using gene fusions to a promoterless lux operon in the broad-host-range vector pUCD615 . Active vir fragments contained the strongly acetosyringone-inducible promoters of virB, virC, virD, and virE and the weakly inducible promoters of virA and virG . Identical induction patterns were obtained with freshly sliced carrot disks, suggesting that an inducer is released after plant tissue is wounded . Optimal conditions for vir gene induction were pH 5.7 for 50 microM acetosyringone or sinapic acid . The induction of virB and virE by acetosyringone was strictly dependent on intact virA and virG loci . An increase in the copy number of virG resulted in a proportional, acetosyringone-independent increase in vir gene expression, and a further increase occurred only if an inducing compound and virA were present.

J Bacteriol, 1987 Nov, 169(11), 5035 - 45
Double-stranded cleavage of T-DNA and generation of single-stranded T-DNA molecules in Escherichia coli by a virD-encoded border-specific endonuclease from Agrobacterium tumefaciens; Jayaswal RK et al.; The virD locus of Agrobacterium tumefaciens Ti plasmid pTiA6 was sequenced . Computer analysis of the sequence indicated five possible open reading frames (ORFs) within this locus . Two additional ORFs were identified distal to this locus . However, only two polypeptides of apparent molecular masses 16 and 56 kilodaltons, the products of ORFs 1 and 2, were detected in Escherichia coli, both in vivo and in an in vitro coupled transcription-translation system . The virD locus was cloned in expression vector pKK223.3 under control of a tac promoter and introduced into an E . coli strain harboring mini-Ti plasmid pAL1050 . When induced with isopropyl-beta-D-thiogalactopyranoside, the virD gene products exhibited double-stranded T-DNA border-specific endonuclease activity . Deletion analysis demonstrated that this activity is encoded within the 5'-proximal 1.7-kilobase-pair portion of the virD locus that carries ORF 1 and most of ORF 2 . Neither ORF 1 nor ORF 2 independently showed endonuclease activity; complementation studies indicated that the products of ORFs 1 and 2 together have this activity . The expression of this 1.7-kilobase-pair region of the virD locus caused double-stranded cleavage of the T-DNA at or near the borders and generated single-stranded T-DNA molecules with approximately equal frequencies in E . coli.

Nucleic Acids Res, 1987 Oct 26, 15(20), 8283 - 92
Effects of mutations in the TATA box region of the Agrobacterium T-cyt gene on its transcription in plant tissues; de Pater BS et al.; We have generated mutations in the promoter region of the octopine type cytokinin gene of Agrobacterium tumefaciens, and studied their effects on mRNA formation in different plant species . The promoter region of this gene contains several putative TATA boxes . Phenotypic expression and Northern blot hybridization showed that TATA boxes are essential for expression, but that one TATA box leads to wild-type transcript levels . Analysis of the 5' ends of T-cyt transcripts by primer extension using RNA from T-cyt gene transformed tobacco shoots revealed two major cap site clusters and one minor cap site . TATA box consensus sequences can be found approximately 30 bp upstream from each cap site cluster . Deletion of a TATA box results in loss of the corresponding cap sites . An insertion of 7 bp between the right TATA box and corresponding cap sites results in a shift of the position of the cap sites, so that the original distance of TATA box to cap sites is conserved as much as possible.

Nucleic Acids Res, 1987 Oct 26, 15(20), 8267 - 81
Plant expression signals of the Agrobacterium T-cyt gene; de Pater BS et al.; Within the 5' and 3' non-coding regions of the T-cyt gene from the octopine T-DNA of Agrobacterium tumefaciens sequences required for expression of this gene in plant cells were identified by deletion mutagenesis . The results show that 184 bp of the 5' non-coding region and 270 bp of the 3' non-coding region are sufficient for wild-type expression . Within the 5' non-coding region two essential expression signals were identified: (1.) an activator element located between -185 and -129 with respect to the ATG start codon and (2.) one out of two TATA boxes . Deletions of the activator element or the two TATA boxes resulted in nonfunctional genes . Deletion of the upstream TATA box and both putative CAAT boxes did not significantly affect expression . Within the 3' non-coding region, the polyadenylation box most distal to the stop codon was not essential for expression, but sequences more upstream, including a second polyadenylation box were found to be required for wild-type expression.

J Mol Biol, 1987 Oct 20, 197(4), 635 - 45
Characterization of Agrobacterium tumefaciens virulence proteins induced by the plant factor acetosyringone; Engstrom P et al.; The Ti plasmid virulence (vir) loci encode functions essential for the transfer of the T-DNA element from Agrobacterium tumefaciens to plant cells . The expression of these loci is specifically signaled by plant phenolics such as acetosyringone . Here, we characterize the protein products that are induced in Agrobacterium grown in the presence of acetosyringone . More than 10 to 15 proteins are induced in strains harboring different Ti plasmids . Two general classes of acetosyringone-induced proteins are observed, encoded either within or outside the vir region . Synthesis of both classes of proteins requires acetosyringone and the products of the vir regulatory genes A and G . Those proteins encoded outside the vir region define a novel category of proteins, the virulence-related proteins, which are both chromosomally and Ti plasmid-encoded . The molecular weight and subcellular localization of several pTiA6 vir-induced proteins are identified . The most abundant induced protein has a molecular weight of 65,000, and is the single product of the virE locus; this protein distributes into both cell envelope and soluble fractions . Three proteins with molecular weights of approximately 33,000, 80,000 and 25,000 fractionate with the cell envelope and are encoded by genes within the 5' half of the virB locus . The envelope localization of the virB proteins suggests that they play a role in directing T-DNA transfer events that occur at the bacterial surface.

Acta Pathol Microbiol Immunol Scand {B}, 1987 Oct, 95(5), 323 - 4
Septicemia with Agrobacterium species from a permanent vena cephalica catheter . A case report; Ekelund B et al.; A case of Agrobacterium septicemia is reported in a 47-year-old woman with disseminated adenomcarcinoma mammae and a permanent vena cephalica catheter.

DNA, 1987 Oct, 6(5), 473 - 81
Physical analysis of PB2, a temperate bacteriophage of Agrobacterium tumefaciens; Sollitti P et al.; We have constructed a detailed physical map of PB2, a temperate bacteriophage of Agrobacterium tumefaciens . The restriction endonucleases Bam HI (3 sites), Eco RI (22 sites), Hind III (19 sites), Hpa I (5 sites), Xba I (1 site), and Xho I (1 site) were used to elucidate the map of infectious PB2 DNA . The map was generated by reciprocal sequential digestions and analysis of partial digestion products of isolated restriction fragments . We have determined the genome size as 66.35 +/- 1.71 kb . The potential of PB2 as a phage-based shuttle vector for the A . tumefaciens-plant transformation system is discussed.

J Bacteriol, 1987 Oct, 169(10), 4417 - 25
Genes responsible for the supervirulence phenotype of Agrobacterium tumefaciens A281; Jin SG et al.; Agrobacterium tumefaciens A281 induces large, rapidly appearing tumors on a variety of plants and has a wider host range than other strains of A . tumefaciens . By using Tn3HoHo1 transposon mutagenesis and complementation analysis, a 2.5-kilobase DNA fragment which is responsible for the supervirulence phenotype was identified in the virulence (vir) region of the Ti plasmid . This fragment contains the virG locus, as well as the 3' end of the virB operon . A clone of this fragment conferred the supervirulence phenotype on A348, a nonsupervirulent strain . The increased virulence was correlated with an increased expression of vir genes, which could be achieved by introducing an extra copy of the transcriptional activator virG or the supervirulence region for maximum virulence . The virulence of the supervirulent strain A281 could be increased even further if the entire virB operon was added in addition to the virG operon . A plasmid, pToK47, containing virB and virG increased the virulence of all A . tumefaciens strains into which the plasmid was introduced . These data suggest that a highly virulent binary vector system can be constructed which might prove especially useful in the transformation of certain higher plants.

Nucleic Acids Res, 1987 Sep 25, 15(18), 7503 - 17
Molecular characterization of the virD operon from Agrobacterium tumefaciens; Porter SG et al.; The Agrobacterium tumefaciens Ti plasmid virulence (vir) region contains at least six transcriptional units required for the efficient transfer of T-DNA to the plant genome (virA, B, C, D, E, and G) . We have reported that two proteins encoded by the 5'portion of the virD operon are required for a site-specific endonuclease activity that nicks the direct repeats which flank the T-DNA . We have presented the nucleotide sequence for this portion of the operon . The nucleotide sequence of the remainder of the virD operon essential for virulence has now been determined . Two additional open reading frames encode proteins of 21.3 and 75.8 kilodaltons (kd) . Translational fusions between virD2, virD3, and virD4 proteins and trpE produced fusion proteins of the size predicted from the nucleotide sequence data . We have used antisera directed against the trpE-virD2 fusion protein to detect both native virD2 protein and a virD2-lacZ fusion protein in crude extracts from Agrobacterium.

J Bacteriol, 1987 Sep, 169(9), 4242 - 8
Cytokinin production by Agrobacterium and Pseudomonas spp; Akiyoshi DE et al.; The production of cytokinins by plant-associated bacteria was examined by radioimmunoassay . Strains producing trans-zeatin were identified in the genera Agrobacterium and Pseudomonas . Agrobacterium tumefaciens strains containing nopaline tumor-inducing plasmids, A . tumefaciens Lippia isolates, and Agrobacterium rhizogenes strains produced trans-zeatin in culture at 0.5 to 44 micrograms/liter . Pseudomonas solanacearum and Pseudomonas syringae pv . savastanoi produced trans-zeatin at levels of up to 1 mg/liter . In vitro cytokinin biosynthetic activity was measured for representative strains and was found to correlate with trans-zeatin production . The genetic locus for trans-zeatin secretion (tzs) was cloned from four strains: A . tumefaciens T37, A . rhizogenes A4, P . solanacearum K60, and P . syringae pv . savastanoi 1006 . Southern blot analysis showed substantial homology of the Agrobacterium tzs genes to each other but not to the two Pseudomonas genes.

Plasmid, 1987 Sep, 18(2), 156 - 63
Incompatibility between a Rhizobium Sym plasmid and a Ri plasmid of Agrobacterium; O'Connell MP et al.; The symbiotic plasmid of Rhizobium trifolii G1008 was mobilized to other Rhizobium strains and to Agrobacterium using Tn5-Mob, a transposon that confers on a host replicon the ability to be mobilized in trans by RP4 . Incompatibility was observed between pSymG1008 and the hairy-root-inducing plasmid pRi1855 . Agarose gel electrophoresis revealed that pRi1855 was eliminated as an autonomous element in the presence of pSymG1008 and its absence was correlated with loss of the ability to induce hairy root disease . This indicates a close ancestral relationship between a Rhizobium symbiotic plasmid and a plant pathogenic plasmid of Agrobacterium . pSymG1008 and pRi1855 can be assigned to the IncRh-3 incompatibility group . Furthermore, pSymG1008 was mobilized at low frequency to R . phaseoli 51E and the transconjugants isolated had lost the indigenous Sym plasmid and the ability to nodulate beans.

J Bacteriol, 1987 Sep, 169(9), 4184 - 9
Genetic analysis of agrocin 84 production and immunity in Agrobacterium spp; Ryder MH et al.; Mutations affecting agrocin production on the 48-kilobase (kb) plasmid, pAgK84, can be complemented in trans with cloned portions of the plasmid . Five complementation groups ranging in minimum size from 1.2 to 5.6 kb were identified within a 14-kb segment . Plasmid pAgK84-encoded immunity to agrocin 84 was located to two separate regions of the plasmid . Either region alone was sufficient to protect sensitive strains, and both loci mapped to the agrocin 84 biosynthesis region . One region is located within complementation group I, while the other forms a part of complementation group IV . Production of agrocin 84 was unaffected by nopaline, agrocinopine A, acetosyringone, or low or high levels of ferric iron . Agrocin 84 production was greatly suppressed when the strain also contained a Ti plasmid nutritionally or mutationally derepressed for agrocinopine A catabolism . RNA dot-blot analysis indicated that decreased agrocin 84 production by such strains was not due to transcriptional repression of agrocin 84 biosynthetic loci . In strains also harboring pAtK84b, the opine catabolic plasmid of Agrobacterium radiobacter K84, induction of the agrocinopine A catabolic locus of this plasmid had no such effect on agrocin 84 production.

Eur J Biochem, 1987 Aug 17, 167(1), 81 - 7
The Noc region of Ti plasmid C58 codes for arginase and ornithine cyclodeaminase; Sans N et al.; Plant tumors induced by Agrobacterium tumefaciens synthesize a group of substances (opines) which can serve as sole source of carbon and nitrogen for the bacteria . We investigate Ti-plasmid-coded genes and enzymes involved in catabolism of the opine N2-(1,3-dicarboxypropyl)-L-arginine (nopaline) with a novel approach: expression and mapping of protein-coding regions in Escherichia coli minicells, followed by identification of enzyme functions in the heterologous E . coli background . The results show that a specific part of the nopaline catabolism (Noc) region of Ti plasmid C58 is packed with closely spaced protein-coding regions which can be expressed into polypeptides of distinct sizes in E . coli . We identify and map three enzyme activities: nopaline oxidase, arginase and ornithine cyclodeaminase, an unusual protein converting ornithine directly into proline . Nopaline oxidase requires two different Noc-gene-encoded proteins for function and the latter two enzymes are new discoveries in the Noc region . These three enzyme activities together constitute a catabolic pathway leading from nopaline through arginine and ornithine to proline.

J Biol Chem, 1987 Aug 5, 262(22), 10601 - 7
Structure of a polysaccharide containing galactose and galacturonic acid from Rhizobium meliloti . Characterization and partial purification of a 2-O-methyltransferase; Coira JA et al.; The teichuronic acid type polysaccharide found in Rhizobium meliloti which is associated with sensitivity to phage 16B and is formed in the inner membranes from UDP-galactose and UDP-galacturonic acid (Ugalde, R . A., Coira, J . A., and Brill, W . J . (1986) J . Bacteriol . 168, 270-275) has been studied further . Results of acid hydrolysis, periodate oxidation, and borohydride reduction show that this polysaccharide contains the repetitive unit -galacturonosyl(1-3)galactosyl(1-4-) . A soluble enzyme was found to catalyze the transfer of methyl groups from S-adenosylmethionine to position 2 of the galacturonosyl residue . The enzyme requires Mn2+ or Mg2+, its pH optimum is 8.2, and the apparent Km for S-adenosylmethionine is 2.7 microM . The teichuronic acid type polysaccharide bound to a trichloroacetic acid-insoluble cell residue is a substrate for the methyltransferase; however, the polysaccharide released from the trichloroacetic acid-insoluble portion by mild acid treatment is no longer methylated . Other soluble galacturonic acid-containing polysaccharides were not used as substrates . The methyltransferase and the polysaccharide acceptor are both found in R . meliloti strain 102F51 . Spontaneously arising mutants resistant to phage 16B do not form teichuronic acid but are transferase-positive . Other strains of R . meliloti as well as Agrobacterium tumefaciens and Escherichia coli cells do not form teichuronate and have no transferase.

Biochim Biophys Acta, 1987 Jul 10, 901(1), 112 - 8
Cyclic glucans produced by Agrobacterium tumefaciens are substituted with sn-1-phosphoglycerol residues; Miller KJ et al.; In a previous study (Miller, K.J., Kennedy, E.P . and Reinhold, V.N . (1986) Science 231, 48-51) it was reported that the biosynthesis of periplasmic cyclic beta-1,2-glucans by Agrobacterium tumefaciens is strictly osmoregulated in a pattern closely similar to that found for the membrane-derived oligosaccharides of Escherichia coli (Kennedy, E.P . (1982) Proc . Natl . Acad . Sci . USA 79, 1092-1095) . In addition to the well-characterized neutral cyclic glucan, the periplasmic glucans were found to contain an anionic component not previously reported . Biosynthesis of the anionic component is osmotically regulated in a manner indistinguishable from that of the neutral cyclic beta-1,2-glucan . We now find that the anionic component consists of cyclic beta-1,2-glucans substituted with one or more sn-1-phosphoglycerol residues . The presence of sn-1-phosphoglycerol residues represents an additional, striking similarity to the membrane-derived oligosaccharides of E . coli.

J Bacteriol, 1987 Jul, 169(7), 3209 - 16
Identification of a new virulence locus in Agrobacterium tumefaciens that affects polysaccharide composition and plant cell attachment; Thomashow MF et al.; We have identified a new virulence locus in Agrobacterium tumefaciens . Strains carrying Tn5 inserts at this locus could not incite tumors on Kalanchoe daigremontiana, Nicotiana rustica, tobacco, or sunflower and had severely attenuated virulence on carrot disks . We termed the locus pscA, because the mutants that defined the locus were initially isolated as having an altered polysaccharide composition; they were nonfluorescent on media containing Leucophor or Calcofluor, indicating a defect in the production of cellulose fibrils . Further analysis showed that the pscA mutants produced little, if any, of the four species of exopolysaccharide synthesized by the wild-type strain . DNA hybridization analysis and genetic complementation experiments indicated that the pscA locus is not encoded by the Ti plasmid and that it is distinct from the previously described chromosomal virulence loci chvA and chvB . However, like chvA and chvB mutants, the inability of the pscA mutants to form tumors is apparently due to a defect in plant cell attachment . Whereas we could demonstrate binding of the wild-type strain to tobacco suspension cells, attachment of the pscA mutants was drastically reduced or completely absent.

J Bacteriol, 1987 Jul, 169(7), 3094 - 8
Expression of Rhizobium meliloti nod genes in Rhizobium and Agrobacterium backgrounds; Yelton MM et al.; Rhizobium meliloti nod genes are required for the infection of alfalfa . Induction of the nodC gene depends on a chemical signal from alfalfa and on nodD gene expression . By using a nodC-lacZ fusion, we have shown that the induction of the R . meliloti nodC gene and the expression of nodD occur at almost normal levels in other Rhizobium backgrounds and in Agrobacterium tumefaciens, but not in Escherichia coli . Xanthomonas campestris, or Pseudomonas savastanoi . Our results suggest that bacterial genes in addition to nodDABC are required for nod gene response to plant cells . We have found that inducing activity is present in other plant species besides alfalfa . Acetosyringone, the A . tumefaciens vir gene inducer, does not induce nodC.

Mol Cell Biol, 1987 Jul, 7(7), 2552 - 7
Complementation of a threonine dehydratase-deficient Nicotiana plumbaginifolia mutant after Agrobacterium tumefaciens-mediated transfer of the Saccharomyces cerevisiae ILV1 gene; Colau D et al.; The Saccharomyces cerevisiae ILV1 gene, encoding threonine dehydratase (EC 4.2.1.16) was fused to the transferred DNA nopaline synthase promoter and the 3' noncoding region of the octopine synthase gene . It was introduced, by Agrobacterium tumefaciens-mediated gene transfer, into an isoleucine-requiring Nicotiana plumbaginifolia auxotroph deficient in threonine dehydratase . Functional complementation by the ILV1 gene product was demonstrated by the selection of several transformed lines on a medium without isoleucine and by the identification in these lines of the yeast threonine dehydratase activity . This is the first example illustrating the complementation of a plant auxotroph by transfection with a cloned gene.

Plasmid, 1987 Jul, 18(1), 84 - 8
Genetic analysis of the gentamicin resistance region of pPH1JI and incorporation into a wide host range cloning vehicle; Rubin RA; A region of the IncP plasmid pPH1JI encoding resistance to gentamicin, spectinomycin, and streptomycin was characterized by subcloning, deletion, and insertion mutagenesis . Approximate locations of these resistance determinants were established . A 1.6-kb HindIII-SphI segment of this region expresses gentamicin resistance (Gmr) in Escherichia coli when inserted into various plasmid vectors; this DNA segment encodes a polypeptide of 17.5 kDa . Incorporation of this fragment into an IncP cloning vehicle produced a Gmr wide host range vector, pRAR209, which confers levels of Gmr comparable to those expressed by pPH1JI in E . coli, Agrobacterium tumefaciens, and Rhizobium meliloti.

Plasmid, 1987 Jul, 18(1), 70 - 5
Physical map of the T-DNA region of Agrobacterium rhizogenes strain NCPPB2659; Combard A et al.; The T-DNA region of the plasmid responsible for hairy root in the Agrobacterium rhizogenes strain NCPPB2659 is identified and characterized by its physical map.

Appl Environ Microbiol, 1987 Jun, 53(6), 1338 - 43
Characterization of Agrobacterium tumefaciens strains isolated from grapevine tumors in China; Ma DQ et al.; Thirteen strains of Agrobacterium tumefaciens isolated from grapevine tumors in northern China were surveyed . These strains varied in their host range properties, although all were tumorigenic on grapevines . Twelve of these strains belonged to Agrobacterium sp . biotype 3, and 11 strains resulted in the synthesis of the opine octopine in tumor tissue . Interestingly, one strain resulted in accumulation of arginine, a previously unrecognized opine, in tumor tissue . Although DNA in most of these strains showed homology to the previously characterized transferred DNA and vir loci, some virulent strains showed little or no homology to these loci . Thus, some of these strains represent widely divergent examples of Agrobacterium sp . The DNA in most strains exhibited little or no homology to a wide-host-range virA locus but did show strong homology to a limited-host-range virA locus . This finding further supports the idea that Agrobacterium strains associated with grapevines may have a specific virA locus.

J Bacteriol, 1987 Jun, 169(6), 2828 - 34
Nitrogen-fixing nodules induced by Agrobacterium tumefaciens harboring Rhizobium phaseoli plasmids; Martinez E et al.; Rhizobium phaseoli CFN299 forms nitrogen-fixing nodules in Phaseolus vulgaris (bean) and in Leucaena esculenta . It has three plasmids of 185, 225, and 410 kilobases . The 410-kilobase plasmid contains the nitrogenase structural genes . We have transferred these plasmids to the plasmid-free strain Agrobacterium tumefaciens GMI9023 . Transconjugants containing different combinations of the R . phaseoli plasmids were obtained, and they were exhaustively purified before nodulation was assayed . Only transconjugants harboring the 410-kilobase plasmid nodulate P . vulgaris and L . esculenta . Nodules formed by all such transconjugants are able to reduce acetylene . Transconjugants containing the whole set of plasmids from CFN299 nodulate better and fix more nitrogen than the transconjugants carrying only the Sym plasmid . Microscopic analysis of nodules induced by A . tumefaciens transconjugants reveals infected cells and vascular bundles . None of the A . tumefaciens transconjugants, not even the one with the whole set of plasmids from CFN299, behaves in symbiosis like the original R . phaseoli strain; the transconjugants produce fewer nodules and have lower acetylene reduction (25% as compared to the original R . phaseoli strain) and more amyloplasts per nodule . More than 2,000 bacterial isolates from nodules of P . vulgaris and L . esculenta formed by the transconjugants were analyzed by different criteria . Not a single rhizobium could be detected . Our results show that R . phaseoli plasmids may be expressed in the A . tumefaciens background and direct the formation of effective, differentiated nodules.

J Bacteriol, 1987 Jun, 169(6), 2336 - 44
Molecular characterization of the virC genes of the Ti plasmid; Close TJ et al.; The virC (formerly bak) complementation group of the nopaline-type Ti plasmid pTiC58 encodes two proteins, VirC1 and VirC2 . According to the primary structure of the polypeptides predicted by the nucleotide sequence, VirC1 is composed of 231 amino acids with a total molecular mass of 25.5 kilodaltons, and VirC2 is composed of 202 amino acids with a molecular mass of 22.1 kilodaltons . The pTiC58 VirC1 and VirC2 polypeptides are equal in length to VirC1 and VirC2 of the octopine-type plasmid pTiA6NC . VirC1 proteins of pTiC58 and pTiA6NC are identical at 202 (87.4%) of the amino acid residues, and this homology is distributed fairly evenly throughout the protein . VirC2 identities occur at 142 residues (70.3%), but fall predominantly into two blocks of higher homology (84.6 and 78.5%) separated by a 41-residue segment of much lower homology (29.3%) . Mutations in virC resulted in attenuated virulence on all hosts tested, the severity of attenuation varying markedly depending on the type of plant inoculated . For example, the attenuation was more pronounced on Kalanchoe than on sunflower or jimson weed . Virulence was restored to normal on all hosts by in-trans complementation with corresponding nonmutant DNA fragments of pTiC58 or of the octopine-type plasmid pTi15955 . Two oligopeptides from within the predicted pTiC58 VirC1 polypeptide were synthesized and used to raise antibodies . These antibodies were used to detect the VirC1 product of both pTiC58 and pTi15955 . In both cases, virC was expressed constitutively in the Agrobacterium tumefaciens ros mutant . The homology between virC genes of octopine- and nopaline-type Ti plasmids thus includes a conservation of genetic regulatory control mechanisms as well as considerable conservation of the primary structure of the protein products.

Mol Gen Genet, 1987 Jun, 208(1-2), 301 - 8
Genetic analysis of mannityl opine catabolism in octopine-type Agrobacterium tumefaciens strain 15955; Dessaux Y et al.; The genetic organization of functions responsible for mannityl opine catabolism of the Ti plasmid of Agrobacterium tumefaciens strain 1,5955 was investigated . A partial HindIII digest of pTi1,5955 was cloned into a broad host range cosmid and the clones obtained were tested for ability to confer mannityl opine degradation upon Agrobacterium . Inserts containing genes for catabolism of mannopinic acid, mannopine, agropine, and agropinic acid were obtained, spanning a segment of 43 kb on the Ti plasmid . Two clones conferring upon Agrobacterium the ability to catabolize the mannityl opines were mobilized to several Rhizobium sp., to Pseudomonas putida and P . fluorescens and to Escherichia coli . The catabolic functions were phenotypically expressed in all Rhizobium sp . tested, and in P . fluorescens, but not in P . putida or in E . coli.

Ann Inst Pasteur Microbiol, 1987 May-Jun, 138(3), 297 - 302
{Profiles of enzymatic activities of the genera Agrobacterium, Alcaligenes, Alteromonas, Flavobacterium and Pseudomonas}; Algorta G et al.; Profiles of enzymatic activities were studied using 19 chromogenic substrates for 22 species (211 strains) belonging to the genera Agrobacterium, Alcaligenes, Alteromonas, Flavobacterium and Pseudomonas . The observed patterns of reactions may be useful as an aid in identification of these species and for epidemiological studies.

J Bacteriol, 1987 May, 169(5), 2086 - 91
Common loci for Agrobacterium tumefaciens and Rhizobium meliloti exopolysaccharide synthesis and their roles in plant interactions; Cangelosi GA et al.; Mutants of Rhizobium meliloti have been isolated which are deficient in exopolysaccharide (EPS) production and effective nodulation of alfalfa (J . A . Leigh, E . R . Signer, and G . C . Walker, Proc . Natl . Acad . Sci . USA 82:6231-6235, 1985) . We isolated approximately 100 analogous EPS-deficient (Exo) mutants of the closely related plant pathogen Agrobacterium tumefaciens, including strains whose EPS deficiencies were specifically complemented by each of five cloned R . meliloti exo loci . We also cloned A . tumefaciens genes which complemented EPS defects in three of the R . meliloti Exo mutants . In two of these cases, symbiotic defects were also complemented . All of the A . tumefaciens Exo mutants formed normal crown gall tumors on four different plant hosts, except ExoC mutants, which were nontumorigenic and unable to attach to plant cells in vitro . Like their R . meliloti counterparts, A . tumefaciens Exo mutants were deficient in production of succinoglycan, the major acidic EPS species produced by both genera . A . tumefaciens ExoC mutants also produced extremely low levels of another major EPS, cyclic 1,2-beta-D-glucan . This deficiency has been noted previously in a different set of nontumorigenic, attachment-defective A . tumefaciens mutants.

Mol Gen Genet, 1987 May, 207(2-3), 233 - 41
Deletion analysis of the mannopine synthase gene promoter in sunflower crown gall tumors and Agrobacterium tumefaciens; DiRita VJ et al.; We have used deletion mutagenesis to analyze a TR-DNA promoter from the octopine-type Ti plasmid pTiB6806 . The promoter for the gene encoding mannopine synthase (mas) was cloned upstream of the bacterial kanamycin-resistance gene neomycin phosphotransferase II (NPT II) . Bal31 deletion mutagenesis was used to generate deletion derivatives of the mas/NPTII gene beginning 1353 bp upstream of the initiation of transcription and extending to 120 bp downstream from the mRNA start site . Deletions that left intact 318 bp upstream of transcription initiation had no detectable effect on the ability of tumors harboring the deletion to synthesize correctly initiated mRNA or to grow on the kanamycin analogue G418 . Deletion to-138 destroyed the ability of sunflower crown gall tumors to grow on G418 although low levels of the mas/NPTII transcript were detected in one tumor line . Deletions that left only 57 bp upstream of transcription initiation allowed neither growth on G418 nor detectable mas/NPTII synthesis, even though the CCAAT and TATAA homologies were intact . The mas promoter is functional in Agrobacterium tumefaciens and we present data concerning the effects of the Bal31 deletions on the growth of A . tumefaciens on kanamycin.

Nucleic Acids Res, 1987 Apr 24, 15(8), 3479 - 91
Organ-specific and dosage-dependent expression of a leaf/stem specific gene from potato after tagging and transfer into potato and tobacco plants; Stockhaus J et al.; ST-LS1, a single copy gene from potato displaying a leaf/stem specific gene expression, was tagged by an exon modification and introduced into both potato and tobacco cells using Agrobacterium vectors . After regeneration of whole plants, the expression of the tagged gene was analyzed with respect to its organ specificity and compared to the expression of the corresponding resident gene . The expression of the transferred gene in transgenic plants closely followed the expression of the resident gene . No marked influence of the plant species serving as host was observed . The level of expression of the introduced gene varied by a factor of at least 100 in independent transformants when normalized to the expression of the resident gene . Southern analysis performed on the transformed plants indicated a correlation between copy number of the introduced gene and its expression level . The activity of the tagged gene as well as of the resident gene was significantly inhibited by treatment of the transgenic plants with the herbicide norfluorazon, indicating that this gene activity is dependent on the presence of functional chloroplasts in the leaves.

EMBO J, 1987 Apr, 6(4), 857 - 63
Activation of Agrobacterium tumefaciens vir gene expression generates multiple single-stranded T-strand molecules from the pTiA6 T-region: requirement for 5' virD gene products; Stachel SE et al.; Agrobacterium tumefaciens transfers its Ti-plasmid T-DNA to plant cells . This process is initiated by plant-induced activation of the Ti-plasmid virulence loci, resulting in the generation of single stranded (ss) cleavages of the Ti-plasmid T-DNA border sequences (border nicks) and ss linear unipolar T-DNA molecules (T-strands) . A single T-strand is produced from the two-border T-region of the pGV3850 nopaline plasmid . In this paper the induced molecular events for the complex T-region of the pTiA6 octopine plasmid are analyzed . This T-region carries four T-DNA borders delimiting three T-DNA elements (TR, TC and TL) . Induction of pTiA6 generates cleavages independently at its border repeats, and six distinct T-strand species corresponding to TR, TR/TC, TR/TC/TL, TC, TC/TL and TL . These T-strand molecules are linear and correspond to the bottom strand of the pTiA6 T-region . Thus, borders can function for both initiation and termination of T-strand synthesis . We propose that the different pTiA6 T-strands are independently generated, and that the distribution of border nicks within the parental T-region determines which T-strand is produced . To identify genes involved in T-strand production, pTiA6 virulence (vir) and chromosomal virulence (chv) mutant strains were analyzed . VirA and VirG, the vir regulatory loci are required . Furthermore, the two 5' cistrons of virD are required for both border nicks and T-strands, suggesting that these genes encode the border endonuclease, and that T-strand production is dependent on border nicks . That no mutants are defective for T-strands alone suggests that functions encoded outside of vir and chv might mediate some of the later reactions of T-strand synthesis.

EMBO J, 1987 Apr, 6(4), 849 - 56
Characterization of the virA locus of Agrobacterium tumefaciens: a transcriptional regulator and host range determinant; Leroux B et al.; The virulence (vir) region of Agrobacterium tumefaciens mediates the transfer of a defined segment of plasmid DNA (the T-DNA) into the plant genome . The vir genes are specifically induced by molecules produced by wounded plant cells, and virA is required for this induction . We have determined the nucleotide sequence of virA loci from limited (pTiAg162) and wide (pTiA6) host range tumor-inducing (Ti) plasmids, each of which encodes a single protein of 92,000 daltons . Using antibody directed against the virA gene product, we have localized the VirA protein to the bacterial inner membrane . VirA is homologous to at least four bacterial proteins which play a role in the transcriptional regulation of diverse families of genes . Based on its role in vir gene induction, homology to transcriptional regulators and membrane localization, we propose that VirA acts as an environmental sensor of plant-derived inducer molecules and transmits this information to the level of vir gene expression . The pTiAg162 virA locus was shown to be ineffective at directing vir gene induction, suggesting that this may in part contribute to the narrow host range conferred by this plasmid.

J Bacteriol, 1987 Apr, 169(4), 1745 - 6
Agrobacterium tumefaciens-mediated transformation of the monocot genus Gladiolus: detection of expression of T-DNA-encoded genes; Graves AC et al.; Agrobacterium tumefaciens was capable of directing the transformation of Gladiolus sp., a monocot genus belonging to the family Iridaceae . Only strains capable of transferring T-DNA formed tumors, sections of which could be cultured in phytohormone-free media . Opine synthase activities were also observed in homogenates made from these tumors.

J Bacteriol, 1987 Apr, 169(4), 1529 - 36
Characterization of the virE locus of Agrobacterium tumefaciens plasmid pTiC58; Hirooka T et al.; The virE locus that is responsible for the efficiency of infection by Agrobacterium tumefaciens (T . Hirooka and C . Kado, J . Bacteriol . 168:237-243, 1986) is located next to the right boundary of the virulence (Vir) region of the nopaline plasmid pTiC58 . This locus is very similar to the virE locus of octopine type Ti plasmids on the basis of nucleotide and amino acid sequence comparisons as well as genetic complementation analyses . The nucleotide sequence of virE revealed three open reading frames, arranged as an operon, with a potential coding capacity for proteins of 9, 7.1, and 63.5 kilodaltons . The promoter region of virE was analyzed by using gene fusions to promoterless cat and lux genes . Two different promoters were detected, one which operates in A . tumefaciens and one which operates in Escherichia coli . virE is transcribed from left to right toward the T region . In A . tumefaciens, the expression of virE was induced by acetosyringone and required the presence of pTiC58.

Mol Gen Genet, 1987 Apr, 207(1), 171 - 5
High meiotic stability of a foreign gene introduced into tobacco by Agrobacterium-mediated transformation; Muller AJ et al.; Two lines of transgenic Nicotiana tabacum transformed to kanamycin resistance by means of a binary Agrobacterium vector containing a nos-npt gene were investigated over three generations . Southern hybridization and crossing analyses revealed that a single copy of T-DNA had integrated in each line and that the kanamycin resistance was regularly transmitted to the progeny as a monogenic dominant trait . Homozygous transgenic plants were fully fertile, morphologically normal and did not significantly differ from wild-type plants in the quantitative characters examined (plant height, flowering time) . The two lines showed very low, but significantly different levels of meiotic instability: kanamycin-sensitive plants occurred among backcross progeny from homozygous transgenic plants with frequencies of 6/45,000 and 25/45,000, respectively . The sensitive plants arose independently of each other and thus resulted from meiotic rather than mitotic events . These findings demonstrate for the first time that integrated foreign genes can be transmitted to progeny with the high degree of meiotic stability required for commercial varieties of crop plants . They emphasize the importance of non-homologous integration and of avoiding co-integration of inactive gene copies for achieving meiotically stable transformants.

Plasmid, 1987 Mar, 17(2), 137 - 48
Homology studies demonstrate colinear organization of the transferred regions of plasmids pRi 1855 and pRi 8196 from Agrobacterium rhizogenes; Combard A; Agrobacterium rhizogenes, a pathogenic bacterium determining for hairy-root tumors in plants, acts by insertion of a fragment (T-DNA) of its Ri plasmid into the plant nuclear DNA . Two A . rhizogenes strains, pRi 1855 and pRi 8196, responsible for similar disease symptoms, differ when compared at the structural level . However, some morphogenetic loci previously identified by insertion mutagenesis in either one of the two T-DNAs seem physiologically equivalent . The possibility that these morphogenetic loci are structurally similar was tested by cross-hybridization studies . Our data allow establishment of an unequivocal correspondence between the two T-DNA maps where apparently equivalent morphogenic loci occupy similar positions which suggests that the observed structural homologies also reflect physiological similarities between both T-DNAs.

Biochimie, 1987 Mar, 69(3), 231 - 7
Expression vectors based on the Agrobacterium rhizogenes Ri plasmid transformation system; Robaglia C et al.; This article describes several new expression vectors that capitalize on the ability of Agrobacterium rhizogenes to transfer DNA from its Ri plasmid to the plant nuclear genome . The intermediate vectors described include an expression cassette based on one of the three following promoters: the nopaline synthase promoter, or the cauliflower mosaic virus (CaMV) promoters responsible for transcription of either the 19S or 35S CaMV RNA . The termination and polyadenylation signals are either from the nopaline synthase gene or from CaMV . The expression micro-Ri plasmid described bears a selectable marker gene and an expression cassette cloned between the borders of the TL-region of the Ri plasmid of A . rhizogenes A4 . Different strategies for using these vectors to introduce chimeric genes into plants are described, and the advantages and disadvantages of the two types of vectors are discussed.

Mol Gen Genet, 1987 Mar, 206(3), 460 - 4
Klebsiella pneumoniae nif-lac fusions are expressed in Agrobacterium tumefaciens C58; Kanvinde L et al.; Plasmids containing hybrid genes, in which different Klebsiella pneumoniae nif (nitrogen-fixation) promoters were fused with the structural part of the Escherichia coli lac operon, were introduced into a double auxotrophic derivative of Agrobacterium tumefaciens C58 . A study of their expression in the new host was made simple by the inherent inability of A . tumefaciens C58 to produce beta-galactosidase unless provided with the wild-type lac operon of E . coli . As shown by quantitative measurements of the enzyme, all K . pneumoniae promoters were expressed well in A . tumefaciens C58, even under conditions known to repress them . It also has been shown that the activity of K . pneumoniae nif A is essential for the expression of nifHDK even when introduced into A . tumefaciens . After entering the new host the plasmids, the nif genes and the fusion alleles contained in them, remained stable . Possible mechanisms responsible for the constitutive behaviour of nif promoters in A . tumefaciens are discussed.

J Bacteriol, 1987 Mar, 169(3), 1046 - 55
Processing of the T-DNA of Agrobacterium tumefaciens generates border nicks and linear, single-stranded T-DNA; Albright LM et al.; Transfer and integration of a defined region (T-DNA) of the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens is essential for tumor formation . We used a physical assay to study structural changes induced in Agrobacterium T-DNA by cocultivation with plant cells . We show that nicks are introduced at unique, identical locations in each of the 24-base-pair imperfect direct repeats which flank the T-DNA and present evidence that a linear, single-stranded molecule is generated . We propose that these changes result from processing of the T-DNA for transfer and that they occur by a mechanism similar to DNA processing during conjugative DNA transfer between bacteria.

J Mol Biol, 1987 Feb 5, 193(3), 465 - 78
Agrobacterium tumefaciens pTAR parA promoter region involved in autoregulation, incompatibility and plasmid partitioning; Gallie DR et al.; The locus responsible for directing proper plasmid partitioning of Agrobacterium tumefaciens pTAR is contained within a 1259 base-pair region . Insertions or deletions within this locus can result in the loss of the plasmid's ability to partition properly . One protein product (parA), approximately 25,000 Mr, is expressed from the par locus in Escherichia coli and A . tumefaciens protein analysis systems in vitro . DNA sequence analysis of the locus revealed a single 23,500 Mr open reading frame, confirming the protein data . A 248 base-pair region immediately upstream from the 23,500 Mr open reading frame, containing an array of 12 seven-base-pair palindromic repeats each of which are separated by exactly ten base-pairs of A + T-rich (75%) sequence, not only serves to provide the promoter but is also involved in parA autoregulation . In addition, this region containing a set of 12 seven-base-pair palindromic repeats, is responsible for plasmid-associated incompatibility within Inc Ag-1 and also functions as the cis-acting recognition site at which parA interacts to bring about partitioning . Transcriptional analysis indicated that only the DNA strand responsible for parA is actively transcribed, and that active transcription of the opposite strand of par can inhibit the production of parA, resulting in plasmid destabilization . The presence of the par locus in a plasmid results in stable inheritance within a wide range of members of Rhizobiaceae . Segregation rates of par-defective derivatives can be influenced by the host.

J Bacteriol, 1987 Feb, 169(2), 880 - 4
A Rhizobium meliloti mutant that forms ineffective pseudonodules in alfalfa produces exopolysaccharide but fails to form beta-(1----2) glucan; Geremia RA et al.; A mutant of Rhizobium meliloti that elicited the formation of inactive nodules in alfalfa was found not to form beta-(1----2) glucan in vivo or in vitro . It was nonmotile because it lacks flagella . The 235-kilodalton protein which acts as an intermediate in beta-(1----2) glucan synthesis was undetectable in the mutant . These properties of the mutant are common to those of chvB mutants of Agrobacterium tumefaciens . Exopolysaccharide formation by the R . meliloti mutant was about double that by the wild type.

J Bacteriol, 1987 Feb, 169(2), 710 - 7
Bacterial carbon-phosphorus lyase: products, rates, and regulation of phosphonic and phosphinic acid metabolism; Wackett LP et al.; Carbon-phosphorus bond cleavage activity, found in bacteria that utilize alkyl- and phenylphosphonic acids, has not yet been obtained in a cell-free system . Given this constraint, a systematic examination of in vivo C-P lyase activity has been conducted to develop insight into the C-P cleavage reaction . Six bacterial strains were obtained by enrichment culture, identified, and characterized with respect to their phosphonic acid substrate specificity . One isolate, Agrobacterium radiobacter, was shown to cleave the carbon-phosphorus bond of a wide range of substrates, including fosfomycin, glyphosate, and dialkyl phosphinic acids . Furthermore, this organism processed vinyl-, propenyl-, and propynylphosphonic acids, a previously uninvestigated group, to ethylene, propene, and propyne, respectively . A determination of product stoichiometries revealed that both C-P bonds of dimethylphosphinic acid are cleaved quantitatively to methane and, furthermore, that the extent of C-P bond cleavage correlated linearly with the specific growth rate for a range of substrates . The broad substrate specificity of Agrobacterium C-P lyase and the comprehensive characterization of the in vivo activity make this an attractive system for further biochemical and mechanistic experiments . In addition, the failure to observe the activity in a group of gram-positive bacteria holds open the possibility that a periplasmic component may be required for in vivo expression of C-P lyase activity.

Anal Biochem, 1987 Feb 1, 160(2), 342 - 5
Detection of opines by colorimetric assay; Yang NS et al.; A colorimetric procedure for confirming the presence of arginine-derived opines (nopaline and octopine) in plant tissue extracts is described . Those materials are widely used as markers of plant cell transformation and tumorigenesis mediated by the tumor-inducing plasmids of Agrobacterium tumefaciens . Nopaline and octopine are generally detected, following resolution by paper electrophoresis, by observation of the uv-fluorescent products formed upon reaction with phenanthrenequinone . We found that a further heat treatment step, compatible with paper electrophoresis, results in rapid production of a red-purple pigment . Our colorimetric assay is sensitive to 1.25-micrograms quantities of opine and eliminates problems of background fluorescence encountered with crude plant extract in the usual assay.

Nucleic Acids Res, 1987 Jan 26, 15(2), 825 - 37
Characterization of the virE operon of the Agrobacterium Ti plasmid pTiA6; Winans SC et al.; The Agrobacterium tumefaciens Ti plasmid contains at least six transcriptional units (designated vir loci) which are essential for efficient crown gall tumorigenesis . Mutations in one of these loci, virE, result in a sharply attenuated virulence phenotype . In the present communication, we have analyzed the virE operon at the molecular level . This locus contains open reading frames coding for two hydrophilic proteins having molecular weights of approximately 7,000 daltons and 60,500 daltons . Using a maxicell strain of E . coli, we have visualized two proteins encoded by virE which correspond in size to these open reading frames . Analysis of codon usage of virE and seven other vir loci indicates that, in contrast to E . coli, all possible codons for a given amino acid are utilized at approximately the same frequency.

Gene, 1987, 55(1), 105 - 14
A new vector derived from Agrobacterium rhizogenes plasmids: a micro-Ri plasmid and its use to construct a mini-Ri plasmid; Vilaine F et al.; A new binary vector system has been constructed, based on agropine-type root-inducing plasmid (pRi) left transferred-region border sequences cloned in a plasmid containing the replication origin of another A . rhizogenes plasmid (pArA4a) . This micro-pRi has been used to introduce a chimeric kanamycin resistance gene into tobacco plants, vir functions being provided by either octopine or nopaline tumor-inducing plasmids deleted of their own transferred regions . In addition, we show that cloning of pRi EcoRI fragment 15, which contains three open reading frames (which may correspond to loci rolA, B and C), in the micro-Ri vector generates a mini-pRi capable of inducing the proliferation of transformed roots.

Gene, 1987, 53(2-3), 153 - 61
Promoter cassettes, antibiotic-resistance genes, and vectors for plant transformation; Rothstein SJ et al.; We have constructed a set of plant transformation vectors, promoter cassettes, and chimeric antibiotic-resistance genes for the transformation and expression of foreign genes in plants sensitive to Agrobacterium infection . The different vectors allow for either concurrent or consecutive selection for kanamycin and hygromycin resistance and have a number of unique restriction sites for the insertion of additional DNA . The promoter cassettes utilize the CaMV 19S and CaMV 35S promoters and are constructed to allow for the easy insertion of foreign genes . The cloned gene can then easily be inserted into the transformation vectors . We have utilized the promoter cassettes to express the hygromycin-resistance gene either from the CaMV 35S or the CaMV 19S promoters, with both chimeric resistance genes allowing for the selection of hygromycin-resistant tobacco plants.

Mol Gen Genet, 1987 Jan, 206(1), 174 - 7
The promoter proximal region in the virD locus of Agrobacterium tumefaciens is necessary for the plant-inducible circularization of T-DNA; Yamamoto A et al.; The formation of crown gall tumours involves the transfer of the T-DNA region of the Ti plasmid from Agrobacterium to plant cells and its subsequent integration into plant chromosomes . When agrobacteria are incubated with plant protoplasts or exudates of plants, the T-DNA region is circularized by recombination or cleavage and rejoining between the 25 bp terminal repeats; the formation of circular T-DNAs is thought to be one step in T-DNA transfer (Koukolikova-Nicola et al . 1985; Machida et al . 1986) . We previously showed that the virulence region of the Ti plasmid is required for T-DNA circularization . In the present paper, we examined the circularization event in agrobacteria harbouring octopine Ti plasmids with mutations in various loci of the virulence region . The results clearly demonstrate that the gene(s) encoded in the virD locus are necessary for T-DNA circularization . In particular, the gene(s) present in the region proximal to the virD promoter are essential . We propose that product(s) of this gene have recombinase or endonuclease activity which specifically recognizes the 25 bp terminal repeats of T-DNA.

Somat Cell Mol Genet, 1987 Jan, 13(1), 67 - 76
Expression of mouse dihydrofolate reductase gene confers methotrexate resistance in transgenic petunia plants; Eichholtz DA et al.; Transgenic petunia plants containing an altered (Leu22----Arg22) mouse dihydrofolate reductase gene fused to the cauliflower mosiac virus 35S (CaMV 35S) promoter and nopaline synthase (nos) polyadenylation site were obtained by transforming petunia leaf disks with an Agrobacterium tumefaciens strain carrying the chimeric gene . Transformants were directly selected for and rooted on medium containing 1 microM methotrexate (MTX) . The chimeric gene was present in the regenerated plants at one to three copies and produced the expected 950-nucleotide-long transcript based on Southern and Northern hybridization analyses, respectively . Leaf pieces from the regenerated transgenic plants were able to form callus when cultured on medium containing 1 microM MTX and were able to incorporate 32P into high-molecular-weight DNA in the presence of greater than 100 microM MTX, thus demonstrating that the chimeric mouse dhfr gene was fully functional and useful as a selectable marker in plant transformation experiments . To date, this is the first report of successful expression of a vertebrate gene in transformed plant cells.

Gene, 1987, 61(1), 1 - 11
Design and construction of a versatile system for the expression of foreign genes in plants; Schardl CL et al.; We have built a series of vectors to allow the constitutive or light-regulated expression of foreign genes in plants . These vectors carry expression cassettes consisting of either the cauliflower mosaic virus 35S promoter or the pea rbcS-E9 promoter, a multiple cloning site derived from M13um20, and the rbcS-E9 polyadenylation site . These cassettes have been incorporated into pBR322-based or RK2-based replicons to facilitate direct DNA uptake or Agrobacterium tumefaciens-mediated gene transfer . Their application for the expression of a bacterial gene is described.

Microbiol Sci, 1987 Jan, 4(1), 24 - 8
Agrobacterium rhizogenes as a vector for transforming higher plants; Tepfer M et al.; Agrobacterium rhizogenes is a natural vector for genetically transforming higher plants . A protocol is given for using this system to insert foreign genes into host plants . Improvements currently being developed in several laboratories are also discussed.

Plasmid, 1987 Jan, 17(1), 13 - 25
Physical characterization of Rhizobium meliloti megaplasmids; Burkardt B et al.; Intact megaplasmids of Rhizobium meliloti 2011 have been isolated and visualized by electron microscopy . The contour lengths of 64 megaplasmid molecules were determined . One definite class of molecules of 400 micron length and a range of larger molecules with lengths of up to 560 micron was observed . The contour lengths of the megaplasmids pRme2011a and pRme2011b were measured after isolation from plasmid-free Agrobacterium strains into which they had been individually transferred . Plasmid pRme2011a corresponds to the 400-micron class of megaplasmids while plasmid pRme2011b belongs to the 560-micron class . Preparatively isolated megaplasmids pRme2011a and b showed completely different restriction patterns . The pattern of total megaplasmid DNA from R . meliloti 2011 is composed of those from pRme2011a and b, suggesting that no more than two different megaplasmids exist . Because the length distributions of measured molecules were broad, R . meliloti 2011 megaplasmids seem to vary in length in vivo . Because only pRme2011a hybridized with a nifHD probe, this is the Sym plasmid . For R . meliloti strain MVII-1, which carries the megaplasmids pRmeMVII-1f and pRmeMVII-1g, pRmeMVII-1f was shown to be the Sym plasmid . Buoyant density determinations of R . meliloti 2011 and MVII-1 megaplasmids gave a value of 1.717 g/cm3 for pSym, which is that of Agrobacterium DNA . The buoyant density of the second megaplasmid was 1.721 g/cm3, corresponding to the density of the R . meliloti chromosome . As determined by reassociation kinetics, pRme2011a and b are unrelated . The degree of relatedness between strains MVII-1 and 2011 was 82%.

Folia Biol (Praha), 1987, 33(1), 40 - 9
Transfer of Drosophila melanogaster transponsable genetic element mdg-4 into plant cells; Karlovska L et al.; The copia-like element mdg-4, as a component of the Drosophila genomic fragment Dm111, was cloned into the vector pIB16 . The chimaeric plasmid pIB16 {Dm111} was used to transform tobacco cells as a cointegrate with pTiC58 (Agrobacterium tumefaciens), pTiC58::pIB16 {Dm111} . The growth properties of primary crown-gall tumours were followed, and the DNA of one Nicotiana tabacum transformant was further analysed . The DNA/DNA molecular hybridization of digests of genomic DNA with 32P-labelled pDm111 probe demonstrated full-length insertion of Dm111 into N . tabacum genome . We were not able to detect any common sequence with Dm111 in untransformed tobacco cells.

J Bacteriol, 1987 Jan, 169(1), 313 - 23
Characterization of nonattaching mutants of Agrobacterium tumefaciens; Matthysse AG; The first step in tumor formation by Agrobacterium tumefaciens is the site-specific binding of the bacteria to plant host cells . Transposon mutants of the bacteria which fail to attach to carrot suspension culture cells were isolated . These mutants showed no significant attachment to carrot cells with either microscopic or viable cell count assays of bacterial binding . The nonattaching mutants were all avirulent . When revertants of the mutants were obtained by enriching for bacteria which do bind to carrot cells, the bacteria were found to have regained the ability to bind to carrot cells and virulence simultaneously . These results suggest that the ability of the bacteria to bind to plant cells is required for virulence . Like the parent strain, all of the nonattaching mutants synthesized cellulose, but unlike the parent strain, they failed to aggregate carrot suspension culture cells . The transposon Tn5, which was used to obtain the mutants, was located on a 12-kilobase EcoRI fragment of the bacterial chromosomal DNA in all of the nonattaching mutants from strain C58 . That the mutant phenotype was due to the Tn5 insertion was shown by cloning the Tn5-containing DNA fragment from the mutant bacteria and using it to replace the wild-type fragment in the parent strain by marker exchange . The resulting bacteria had the same mutant phenotype as the original Tn5 mutants; they did not attach to carrot cells, they did not cause the aggregation of carrot cells, and they were avirulent . No difference was seen between the parent strain and the nonattaching mutants in hydrophobicity, motility, flagella, fimbriae, beta-2-glucan content, size of lipopolysaccharide, or ability of the lipopolysaccharide to inhibit bacterial attachment to tissue culture cells . Differences were seen between the parent strain and the nonattaching mutants in the polypeptides removed from the bacteria during the preparation of spheroplasts . Three of the mutants were lacking a polypeptide of about 34 kilodaltons (kDa) . One mutant was lacking the 34-kDa polypeptide and another polypeptide of about 38 kDa . The fifth mutant was lacking a polypeptide slightly smaller than the 34-kDa polypeptide missing in the other four mutants . These missing polypeptides all reappeared in the revertants of the mutants . Thus, bacterial binding to plant cells appears to require the presence of these polypeptides.

J Bacteriol, 1987 Jan, 169(1), 278 - 82
Biosynthesis and degradation of nodule-specific Rhizobium loti compounds in Lotus nodules; Scott DB et al.; Two nodule-specific Rhizobium loti compounds were identified in Lotus tenuis and Lotus pedunculatus nodules induced by strain NZP2037 . One, a silver nitrate-positive cation called rhizolotine, has been characterized as the riboside of a novel alpha-hydroxyimino acid containing a 1,4,5,6-tetrahydropyrimidine ring (G . J . Shaw, R . D . Wilson, G . A . Lane, L . D . Kennedy, D . B . Scott, and G . J . Gainsford, J . Chem . Soc . Chem . Commun., p . 180-181, 1986), and the other, yellow-1, stains yellow with ninhydrin . Both compounds were degraded by R . loti NZP2037 but not by strains of Rhizobium meliloti, Rhizobium trifolii, or Agrobacterium tumefaciens . Under the conditions tested neither compound was able to serve as a sole source of C or N for growth of R . loti NZP2037 . Rhizolotine and yellow-1 were found in nodules from a range of different legumes inoculated with NZP2037, suggesting that the Rhizobium and not the host plant determines their synthesis . Neither compound was found in nodulelike structures of L . pedunculatus induced by transposon Tn5-induced noninfectious (Inf-) mutants of NZP2037 or in similar structures induced by a transconjugant of NZP2037 containing the symbiotic (Sym) cointegrate plasmid pPN1 of R . trifolii . Both compounds were also absent in the ineffective nodules induced by the bacterial-release-negative (Bar-) mutant, strain PN239 . However, both compounds were present in nodules induced by the fixation-negative (Fix-) mutant PN235 and in Fix+ nodules formed by a plasmid-cured derivative of NZP2037 . These results would suggest that infection and bacterial release from the infection thread are necessary for nodule (symbiotic) synthesis of these compounds.

J Bacteriol, 1987 Jan, 169(1), 1 - 7
Analysis of cell division gene ftsZ (sulB) from gram-negative and gram-positive bacteria; Corton JC et al.; The ftsZ (sulB) gene of Escherichia coli codes for a 40,000-dalton protein that carries out a key step in the cell division pathway . The presence of an ftsZ gene protein in other bacterial species was examined by a combination of Southern blot and Western blot analyses . Southern blot analysis of genomic restriction digests revealed that many bacteria, including species from six members of the family Enterobacteriaceae and from Pseudomonas aeruginosa and Agrobacterium tumefaciens, contained sequences which hybridized with an E . coli ftsZ probe . Genomic DNA from more distantly related bacteria, including Bacillus subtilis, Branhamella catarrhalis, Micrococcus luteus, and Staphylococcus aureus, did not hybridize under minimally stringent conditions . Western blot analysis, with anti-E . coli FtsZ antiserum, revealed that all bacterial species examined contained a major immunoreactive band . Several of the Enterobacteriaceae were transformed with a multicopy plasmid encoding the E . coli ftsZ gene . These transformed strains, Shigella sonnei, Salmonella typhimurium, Klebsiella pneumoniae, and Enterobacter aerogenes, were shown to overproduce the FtsZ protein and to produce minicells . Analysis of {35S}methionine-labeled minicells revealed that the plasmid-encoded gene products were the major labeled species . This demonstrated that the E . coli ftsZ gene could function in other bacterial species to induce minicells and that these minicells could be used to analyze plasmid-endoced gene products.

Biochem Biophys Res Commun, 1986 Dec 30, 141(3), 1242 - 8
Expression of Agrobacterium tumefaciens T-DNA gene 7 in Xenopus laevis oocytes; McPherson JC et al.; The expression of Agrobacterium tumefaciens T-DNA gene 7 was investigated in Xenopus laevis oocytes . Cloned DNA injected into oocytes consisted of T-DNA sequences derived from octopine type Ti plasmid B6-806 and T-DNA attached to plant DNA sequences at the left junction in crown gall tumors . Transcription initiation sites observed in oocytes were similar to those for transcript 7 in crown gall tumors . Quantitative differences in transcription occurred depending on the flanking sequences of the injected clones indicating that sequences upstream of the TATA box of T-DNA gene 7 affect the quantitative expression of this gene in Xenopus oocytes.

Nucleic Acids Res, 1986 Dec 22, 14(24), 9933 - 42
Nucleotide sequence of the virulence gene virG of the Agrobacterium tumefaciens octopine Ti plasmid: significant homology between virG and the regulatory genes ompR, phoB and dye of E . coli; Melchers LS et al.; The entire nucleotide sequence of the virG locus, from the octopine Ti plasmid of Agrobacterium tumefaciens strain 15955, has been determined . The virG gene is 801 nucleotides in length and has one open reading frame which encodes a protein of Mr 29,995 . The virG gene is involved in the transcriptional activation of the Ti plasmid vir-loci, which occurs after induction by specific compounds present in plant exudate . Sequence analysis of the Agrobacterium virG protein showed significant homology with the Escherichia coli ompR, phoB and dye proteins, which are all positive regulatory genes for genes encoding envelope proteins . These results suggest that the virG gene encodes a positive regulatory protein which can activate vir gene expression.

J Bacteriol, 1986 Dec, 168(3), 1291 - 301
The hypervirulence of Agrobacterium tumefaciens A281 is encoded in a region of pTiBo542 outside of T-DNA; Hood EE et al.; We used a binary-vector strategy to study the hypervirulence of Agrobacterium tumefaciens A281, an L,L-succinamopine strain . Strain A281 is hypervirulent on several solanaceous plants . We constructed plasmids (pCS65 and pCS277) carrying either the transferred DNA (T-DNA) or the remainder of the tumor-inducing (Ti) plasmid (pEHA101) from this strain and tested each of these constructs in trans with complementary regions from heterologous Ti plasmids . Hypervirulence on tobacco could be reconstructed in a bipartite strain with the L,L-succinamopine T-DNA and the vir region on separate plasmids . pEHA101 was able to complement octopine T-DNA to hypervirulence on tobacco and tomato plants . Nopaline T-DNA was complemented better on tomato plants by pEHA101 than it was by its own nopaline vir region, but not to hypervirulence . L,L-Succinamopine T-DNA could not be complemented to hypervirulence on tobacco and tomato plants with either heterologous vir region . From these results we suggest that the hypervirulence of strain A281 is due to non-T-DNA sequences on the Ti plasmid.

J Bacteriol, 1986 Dec, 168(3), 1087 - 95
Molecular cloning and expression of Rhizobium fredii USDA 193 nodulation genes: extension of host range for nodulation; Ramakrishnan N et al.; DNA hybridization with the cloned nodulation region of Rhizobium meliloti as a probe revealed DNA homology with four HindIII fragments, 12.5, 6.8, 5.2, and 0.3 kilobases (kb) in size, of the symbiotic plasmid pRjaUSDA193 . Both hybridization and complementation studies suggest that the common nodulation genes nodABC and nodD of R . fredii USDA 193 are present on the 5.2-kb HindIII and 2.8-kb EcoRI fragments, respectively, of the Sym plasmid . Both fragments together could confer nodulation ability on soybeans when present in Sym plasmid-cured (Sym-) and wild-type (Sym+) Rhizobium strains or in a Ti plasmid-cured Agrobacterium tumefaciens strain . Furthermore, the 2.8-kb EcoRI fragment alone was able to form nodulelike structures on Glycine max L . cv . "Peking" (soybean) . Microscopic examination of these nodules revealed bacterial invasion of the cells, probably via root hair penetration . Bacterial strains harboring plasmids carrying the 5.2- and 2.8-kb nod fragments elicited root-hair-curling responses on infection . These data suggest that the genes responsible for host range determination and some of the early events of nodulation may be coded for by the 5.2-kb HindIII and 2.8-kb EcoRI fragments.

Mol Cell Biol, 1986 Dec, 6(12), 4486 - 92
Isolation of tobacco DNA segments with plant promoter activity; Herman LM et al.; We constructed a promoter probe vector, pGVL120, to isolate plant DNA segments with promoter activity in tobacco . Plant nuclear DNA Sau3A fragments were inserted in front of the npt-II sequence, and a mixture of recombinant plasmids was mobilized to Agrobacterium sp . and used to transform tobacco protoplasts . By kanamycin selection, transformed plant cell lines containing NPT-II T-DNAs were isolated . Eight of these cell lines were regenerated and analyzed for the levels of NPT-II activity in stem, root, midrib, and leaf . These levels demonstrated novel regulation patterns in each isolate . One cell line, T20, was analyzed in detail and found to contain four different T-DNAs . One of the recloned T-DNAs, T20-2, contains an insert of 401 base pairs in front of the NPT-II sequence, and by reintroducing this T-DNA into plant cells we could demonstrate that this insert provides a promoter sequence . The NPT-II enzyme activity under the control of the P20 promoter is especially high in stem and root, but low in leaf and callus, both in the originally isolated T20 plant and in independently isolated transformants with the T20-2 T-DNA.

DNA, 1986 Dec, 5(6), 473 - 82
Studies of the structure and functional organization of foreign DNA integrated into the genome of Nicotiana tabacum; Czernilofsky AP et al.; In transgenic plants obtained either by Agrobacterium tumefaciens-mediated transformation or by direct DNA transfer, the structure of integrated chimeric donor DNA remains stable during vegetative proliferation, during sexual transmission, and under various selection conditions . We correlate the level of expression of the introduced gene in independent transformants and their offspring with the particular arrangement and modification of their integrated DNAs . Genetic analysis of transgenic plants shows that the chimeric gene is transmitted in a Mendelian fashion to the F1 and F2 progeny as a single dominant trait . Deviations from the expected segregation pattern are discussed with respect to different levels of gene activity . We compare the gene activity in heterozygotes versus homozygotes, and show variation in activity between plants regenerated independently from the same transformed callus . Cotransformation studies with two physically unlinked and partly homologous plasmids carrying two different marker genes indicate that they are physically linked after integration into the host genome.

J Bacteriol, 1986 Dec, 168(3), 1283 - 90
T-DNA and opine synthetic loci in tumors incited by Agrobacterium tumefaciens A281 on soybean and alfalfa plants; Hood EE et al.; We report here the molecular characterization of transferred DNA (T-DNA) in leguminous tumors incited by Agrobacterium tumefaciens A281 harboring the tumor-inducing plasmid pTiBo542 . The T-DNA is composed of two regions named TL (left portion)-DNA and TR (right portion)-DNA, in accordance with the nomenclature for the octopine strains . TL-DNA is defined by several internal HindIII restriction fragments totaling 10.8 kilobase pairs (kbp) in uncloned soybean and alfalfa tumors . Alfalfa tumor DNA may contain one more HindIII fragment at the left end of TL-DNA than does soybean tumor DNA . TR-DNA has a 5.8-kbp BamHI-EcoRI internal fragment . All borders other than the left border of TL-DNA appear to be the same within the detection limits of Southern blot hybridization experiments . The two T-DNA regions are separated by 16 to 19 kbp of DNA not stably maintained in tumors . The distance from the left border of TL-DNA to the right border of TR-DNA is approximately 40 kbp . Loci for the mannityl opines are situated in TR-DNA, based on genetic and biochemical criteria.

Cell, 1986 Nov 7, 47(3), 471 - 7
The virD operon of Agrobacterium tumefaciens encodes a site-specific endonuclease; Yanofsky MF et al.; Tumor formation by Agrobacterium tumefaciens involves the transfer and integration of a defined segment (T-DNA) of tumor-inducing (Ti) plasmid DNA into the plant nuclear genome . A set of plasmid genes outside the T-DNA, the vir genes, are thought to mediate the transfer process . We report here that the virD operon encodes a site-specific endonuclease that cleaves at a unique site within each of the 24 bp direct repeats that flank the T-DNA . The endonuclease function was further localized to the 5' end of this operon by demonstrating that cleavage does not occur in virD mutant strains of Agrobacterium and that the 5' end of the virD operon is sufficient to direct cleavage in E . coli . Analysis of nucleotide sequence and protein data indicate that two proteins of 16.2 and 47.4 kd are involved.

J Bacteriol, 1986 Nov, 168(2), 780 - 4
Transport of gamma-butyrobetaine in an Agrobacterium species isolated from soil; Nobile S et al.; An Agrobacterium sp . isolated from soil by selective growth on gamma-butyrobetaine (gamma-trimethylaminobutyrate) as the sole source of both carbon and nitrogen has been shown to possess an inducible transport system for this growth substrate . This transport system has a Kt of 0.5 microM and a maximal velocity of 3.8 nmol/min per mg (dry weight) . The influx of gamma-butyrobetaine is optimal at pH 8.5 and operates against a concentration gradient . The transport system shows a high specificity for trimethylamine carboxylic acid molecules of defined chain length . gamma-Butyrobetaine uptake was significantly reduced in osmotically shocked cells and a gamma-butyrobetaine binding activity was detected in the crude shock fluid . This suggests a transport mechanism involving a periplasmic gamma-butyrobetaine binding protein.

Plasmid, 1986 Nov, 16(3), 222 - 4
A spontaneous insertion in the agrocin sensitivity region of the Ti-plasmid of Agrobacterium tumefaciens C58; Cooksey DA; A spontaneous agrocin-resistant mutant of Agrobacterium tumefaciens strain C58 was shown to have an insertion of 1.2 kb in the agrocin-sensitivity region of pTiC58 . The insertion was cloned from the Ti-plasmid, and a subclone containing only DNA internal to the insertion was used to probe the Ti-plasmid and chromosomal DNA of the wild-type strain C58 . The probe showed homology to chromosomal sequences but showed no homology to wild-type pTiC58 . Homology was also detected with chromosomal sequences of A . tumefaciens strains, B6, K24, and T37 . These results suggest that an indigenous insertion sequence of 1.2 kb transposed from the chromosome to the agrocin-sensitivity region of the Ti-plasmid in this spontaneous mutant of C58.

Genetika, 1986 Nov, 22(11), 2693 - 701
{Characteristics of derivatives of the plasmid RP4 in a broad range of hosts with altered properties of maintenance and inheritance}; Dobrovol'ski P et al.; Hydroxylamine-induced mutants of the plasmid pPD6 (8.4 kb) were isolated which are resistant to high doses of tetracycline . One of the plasmids studied--pPD21 is a multicopy mutant, another one, pPD12 is a dimeric form of the pPD6 plasmid . The pPD12 plasmid is very unstable, its derivative, pPD13 spontaneous mutant acquiring stability but not the ability to resolve DNA multimeric forms into monomeric forms . Multicopy bireplicon pPD619 plasmid was constructed by joining in vitro pPD6 and pUC19 plasmids . Removing the replicon pUC19 from the bireplicon plasmid gives a new low-copy plasmid pPD620 . All of the plasmids constructed were mobilized by the conjugative pRK2013 plasmid into the strains of Escherichia coli, Pseudomonas aeruginosa and Agrobacterium tumefaciens . The pPD6 plasmid and its derivatives can be used as cloning vectors.

J Bacteriol, 1986 Nov, 168(2), 607 - 12
Cloning and regulation of Erwinia herbicola pigment genes; Perry KL et al.; The genes coding for yellow pigment production in Erwinia herbicola Eho10 (ATCC 39368) were cloned and localized to a 12.4-kilobase (kb) chromosomal fragment . A 2.3-kb AvaI deletion in the cloned fragment resulted in the production of a pink-yellow pigment, a possible precursor of the yellow pigment . Production of yellow pigment in both E . herbicola Eho10 and pigmented Escherichia coli clones was inhibited by glucose . When the pigment genes were transformed into a cya (adenylate cyclase) E . coli mutant, no expression was observed unless exogenous cyclic AMP was provided, which suggests that cyclic AMP is involved in the regulation of pigment gene expression . In E . coli minicells, the 12.4-kb fragment specified the synthesis of at least seven polypeptides . The 2.3-kb AvaI deletion resulted in the loss of a 37K polypeptide and the appearance of a polypeptide of 40 kilodaltons (40K polypeptide) . The synthesis of the 37K polypeptide, which appears to be required for yellow pigment production, was not repressed by the presence of glucose in the culture medium, as was the synthesis of other polypeptides specified by the 12.4-kb fragment, suggesting that there are at least two types of gene regulation involved in yellow pigment synthesis . DNA hybridization studies indicated that different yellow pigment genes exist among different E . herbicola strains . None of six pigmented plant pathogenic bacteria examined, Agrobacterium tumefaciens C58, Cornyebacterium flaccumfaciens 1D2, Erwinia rubrifaciens 6D364, Pseudomonas syringae ATCC 19310, Xanthomonas campestris 25D11, and "Xanthomonas oryzae" 17D54, exhibited homology with the cloned pigment genes.

Proc Natl Acad Sci U S A, 1986 Nov, 83(21), 8278 - 82
A gene essential for Agrobacterium virulence is homologous to a family of positive regulatory loci; Winans SC et al.; The vir region of Agrobacterium tumefaciens spans at least six transcriptional loci required for crown gall tumorigenesis . The transcriptional induction of two of these vir loci in response to cocultivation with tobacco suspension cells was measured by using bacteria containing mutations in each of the six vir loci located on the Ti plasmid . Induction of these vir genes occurred only in bacteria that had functional copies of virA and virG . The nucleic acid sequence of a 1.25-kilobase clone encompassing virG contains one open reading frame capable of coding for a protein of about 30,000 daltons . The amino acid sequence of the predicted virG product is homologous to that of eight bacterial proteins, including that of the ompR gene of Escherichia coli . Most, although not all, of these proteins, like VirG, are positive regulatory elements.

Nucleic Acids Res, 1986 Oct 24, 14(20), 8073 - 90
A binary vector for transferring genomic libraries to plants; Simoens C et al.; The transformation of mutant plants with a complete recombinant library derived from wild-type DNA followed by assay of transformed plants for complementation of the mutant phenotype is a promising method for the isolation of plant genes . The small genome of Arabidopsis thaliana is a good candidate for attempting this so-called shotgun transformation . We present the properties of an A . thaliana genomic library cloned in a binary vector, pC22 . This vector, designed to introduce genomic libraries into plants, contains the oriV of the Ri plasmid pRiHR1 by which it replicates perfectly stably in Agrobacterium . Upon transfer of the library from E . coli to A . tumefaciens large differences in transfer efficiencies of individual recombinant clones were observed . There is a direct relation between transfer efficiency and stability of the recombinant clones both in E . coli and A . tumefaciens . The stability is independent of the insert size, but seems to be related to the nature of the insert DNA . The feasibility of shotgun transformation and problems of statistical sampling are discussed.

J Bacteriol, 1986 Oct, 168(1), 244 - 50
Molecular characterization of a host-range-determining locus from Agrobacterium tumefaciens; Yanofsky MF et al.; The virulence loci play an essential role in tumor formation by Agrobacterium tumefaciens . This study focused on the virC locus, which affects the host range Agrobacterium species . virC mutants display an attenuated or avirulent phenotype on certain host plants, but remain fully virulent on other plant hosts . The nucleotide sequence revealed that the virC locus of pTiA6NC is an operon consisting of two open reading frames . These two open reading frames, designated virC1 and virC2, encode protein products of 25,713 and 22,710 daltons, respectively, which were visualized by polyacrylamide gel electrophoresis . Only two nucleotides separated the stop codon for virC1 from the start codon for virC2, indicating that these genes may be translationally coupled.

Proc Natl Acad Sci U S A, 1986 Oct, 83(20), 7850 - 4
Two-component regulatory systems responsive to environmental stimuli share strongly conserved domains with the nitrogen assimilation regulatory genes ntrB and ntrC; Nixon BT et al.; We report that the ntrB and ntrC proteins of Bradyrhizobium sp . {Parasponia} strain RP501 share homology with other regulatory proteins . There is extensive conservation of C-terminal regions between products of RP501 ntrB; Klebsiella pneumoniae ntrB; Escherichia coli envZ, cpxA, and phoR; Agrobacterium tumefaciens virA; and, to a lesser extent, E . coli cheA . There is also extensive conservation of N-terminal regions between products of RP501 ntrC; K . pneumoniae ntrC; E . coli ompR, sfrA, phoB, cheY and cheB; Salmonella typhimurium cheB and cheY; Bacillus subtilis spoOA and spoOF; and A . tumefaciens virG . We propose that these regulatory genes comprise two-component regulatory systems that evolved from a common ancestral system that involved transduction of information about the status of the environment by one protein domain (the C-terminal regions conserved among ntrB, envZ, etc.) to a second one (the N-terminal region conserved among ntrC, ompR, etc.) . The ntrC-set protein then acts upon a specific responding mechanism, typically as a transcriptional activator but also as an effector of the maturation of outer membrane proteins or as a modulator of the direction of flagella rotation.

J Bacteriol, 1986 Oct, 168(1), 237 - 43
Location of the right boundary of the virulence region on Agrobacterium tumefaciens plasmid pTiC58 and a host-specifying gene next to the boundary; Hirooka T et al.; The right boundary of the virulence (Vir) region of the nopaline plasmid pTiC58 of Agrobacterium tumefaciens was determined by transposon insertion, cartridge emplacement, and deletion mutagenesis . Genetic complementation with mutant and wild-type alleles led to the identification of the virE locus at the right boundary, which was located about 6 kilobases from the left border of the segment of DNA that is transferred into the plant genome . virE is 2.0 kilobases long and encodes at least one protein of 69 kilodaltons . Various mutations in virE resulted in different truncated lengths of the 69-kilodalton protein . As this protein was increasingly truncated from the carboxy terminus, the host range of A . tumefaciens and the frequency of tumor formation diminished concomitantly . Thus, as one of its functions, the 69-kilodalton protein of virE is probably involved in some aspect of the host range specificity of A . tumefaciens and in infection efficiency.

Eur J Biochem, 1986 Sep 15, 159(3), 507 - 11
Control of a futile urea cycle by arginine feedback inhibition of ornithine carbamoyltransferase in Agrobacterium tumefaciens and Rhizobia; Vissers S et al.; In Agrobacterium tumefaciens and Rhizobia arginine can be used as the sole nitrogenous nutrient via degradation by an inducible arginase . These microorganisms were found to exhibit arginine inhibition of ornithine carbamoyltransferase activity . This inhibition is competitive with respect to ornithine (Km for ornithine = 0.8 mM; Ki for arginine = 0.05 mM) . This type of urea cycle regulation has not been observed among other microorganisms which degrade arginine via an arginase . The competitive pattern of this inhibition leads to its being inoperative in ornithine-grown cells, where the intracellular concentration of ornithine is high . In arginine-grown cells, however, the intracellular arginine and ornithine concentrations are compatible with inhibition and ornithine recycling appears to be effectively blocked in vivo.

Appl Environ Microbiol, 1986 Sep, 52(3), 597 - 8
Time required for tumor induction by Agrobacterium tumefaciens; Sykes LC et al.; Cellulose-minus mutants of Agrobacterium tumefaciens retain virulence but can be removed from wound sites by washing with water . Washing of Bryophyllum diagremontiana leaves inoculated with a cellulose-minus mutant was used to determine the minimum time the bacteria must be present for tumor induction . This time was 4 to 8 h.

J Bacteriol, 1986 Sep, 167(3), 947 - 51
Formation in Rhizobium and Agrobacterium spp . of a 235-kilodalton protein intermediate in beta-D(1-2) glucan synthesis; Zorreguieta A et al.; beta-D(1-2) Glucan was synthesized by Agrobacterium and Rhizobium spp . in vitro with enzymes from the internal membranes upon the addition of UDF glucose and Mg2+ or Mn2+ . An intermediate containing protein and beta-D(1-2) glucan was formed during the reaction . It could be precipitated with trichloroacetic acid or separated by polyacrylamide gel electrophoresis under denaturing conditions . After detection with Coomassie blue or a radioactive substrate, the intermediate appeared as a 235-kilodalton protein . The radioactivity could be chased with a nonradioactive substrate . All strains that formed beta-D(1-2) glucan in vitro formed the 235-kilodalton protein, whereas avirulent, beta-D(1-2) glucan-negative mutants did not synthesize it . Transposon insertions in the chvB locus of strains ME2 and ME116 did not alter the virulence of the strains . These strains were able to form beta-D(1-2) glucan in vitro and synthesize the 235-kilodalton protein.

J Bacteriol, 1986 Sep, 167(3), 881 - 7
Two gene clusters of Rhizobium meliloti code for early essential nodulation functions and a third influences nodulation efficiency; Putnoky P et al.; A pLAFR1 cosmid clone (pPP346) carrying the nodulation region of the symbiotic plasmid pRme41b was isolated from a gene library of Rhizobium meliloti 41 by direct complementation of a Nod- deletion mutant of R . meliloti . Agrobacterium tumefaciens and Rhizobium species containing pPP346 were able to form ineffective nodules on alfalfa . The 24-kilobase insert in pPP346 carries both the common nodulation genes and genes involved in host specificity of nodulation . It was shown that these two regions are essential and sufficient to determine the early events in nodulation . A new DNA region influencing the kinetics and efficiency of nodulation was also localized on the symbiotic megaplasmid at the right side of the nif genes.

J Gen Microbiol, 1986 Sep, 132 ( Pt 9), 2549 - 59
Agrobacterium Ti and Ri plasmids specify enzymic lactonization of mannopine to agropine; Dessaux Y et al.; A novel enzymic activity, responsible for the conversion of mannopine to agropine by lactonization, has been identified in Agrobacterium strains . This activity is encoded by octopine-type and agropine-type Ti or Ri plasmids, and is inducible by mannopine and agropine . In crude extracts it is stable for long periods and can be used for preparative synthesis of agropine from mannopine . The physiological role of this activity is not understood . However, it is probably involved in degradation of opines of the agropine family since it is always associated with agropine utilization in wild-type strains.

Plasmid, 1986 Sep, 16(2), 124 - 34
Restriction maps and homologies of the three plasmids of Agrobacterium rhizogenes strain A4; Jouanin L et al.; Agrobacterium rhizogenes strain A4 is a virulent agropine-type strain possessing three plasmids: plasmid a (pArA4a, 180 kb) is not necessary for plant transformation, plasmid b (250 kb) is the root-inducing plasmid (pRiA4), and plasmid c (pArA4c) is a cointegrate of pArA4a and pRiA4 . The total plasmid DNA (pArA4) of strain A4 was cloned in the cosmid pHSG262 and the library obtained was used to establish BamHI maps of the three plasmids . The plasmids a and Ri have an apparently identical region and a partly homologous region, and are different in the remaining regions including their origins of replication . Another agropine-type A . rhizogenes strain, HRI, bears only one plasmid, which is the Ri plasmid (pRiHRI) . pRiHRI and pRiA4 present the same restriction maps for a great part, but are different in a region of 48 kb; however, this region of pRiHRI is found unmodified in pArA4a and may have a role in the virulence of the bacteria . The comparison between the restriction maps of the plasmids of strain A4 leads us to propose that the recombination event leading to pArA4c formation occurs within the identical regions of pArA4a and pRiA4 . In addition, the comparison with the already established map of pRiHRI suggests that strain HRI could have been derived from a recombination event between the two homologous regions of pArA4c with subsequent loss of the smaller plasmid.

Nucleic Acids Res, 1986 Aug 26, 14(16), 6699 - 709
Nucleotide sequence of an insertion sequence (IS) element identified in the T-DNA region of a spontaneous variant of the Ti-plasmid pTiT37; Vanderleyden J et al.; We have identified and determined the nucleotide sequence of an IS element (IS136) of Agrobacterium tumefaciens . This is the first IS element isolated and sequenced from a nopaline type Ti-plasmid . Our IS element has 32/30 bp inverted repeats with 6 mismatches, is 1,313 bp long and generates 9 bp direct repeats upon integration . IS136 has 3 main open reading frames (ORF's) . Only ORF1 (159 codons) is preceded by sequences that are proposed to serve functional roles in transcriptional and translational initiation . No DNA sequence homology was found between IS136 and IS66, an IS element isolated from an octopine type Ti-plasmid.

J Bacteriol, 1986 Aug, 167(2), 732 - 4
Proline biosynthesis encoded by the noc and occ loci of Agrobacterium Ti plasmids; Farrand SK et al.; Octopine or nopaline Ti plasmids, or clones encoding their occ or noc loci, allowed proline auxotrophs of Agrobacterium tumefaciens to utilize the appropriate arginyl opine as a proline substitute . Arginine and ornithine substituted for proline only if the occ or noc loci were induced or made constitutive by mutation . These results support a report demonstrating a Ti plasmid-encoded activity in A . tumefaciens which cyclizes ornithine to proline.

Cell, 1986 Aug 1, 46(3), 325 - 33
virA and virG control the plant-induced activation of the T-DNA transfer process of A . tumefaciens; Stachel SE et al.; The Ti plasmid vir loci of Agrobacterium tumefaciens are transcriptionally activated in response to signal molecules produced by plant cells to initiate the T-DNA transfer process . We show that the pTiA6 vir loci are organized as a single regulon whose induction by plants is controlled by virA and virG . Mutations in virA result in attenuated induction . This locus is constitutively transcribed and noninducible . Mutations in virG eliminate vir induction . This locus is constitutively transcribed, plant-inducible, and self-regulated in a complex fashion, and it produces two distinct and differentially regulated transcripts . virA is proposed to encode a transport protein for the plant signal molecule, and virG a positive regulatory protein that together with the plant molecule activates vir expression.

J Bacteriol, 1986 Jul, 167(1), 387 - 8
Sustained ethylene production in Agrobacterium-transformed carrot disks caused by expression of the T-DNA tms gene products; Goodman TC et al.; Agrobacterium-infected carrot disks continually produced elevated levels of ethylene . Ethylene production was mediated by the elevated levels of auxin synthesized in transformed tissues.

EMBO J, 1986 Jul, 5(7), 1445 - 54
The genetic and transcriptional organization of the vir region of the A6 Ti plasmid of Agrobacterium tumefaciens; Stachel SE et al.; The genetic transformation of plant cells by Agrobacterium tumefaciens is mediated by the genes of the Ti plasmid vir region . To determine the genetic and transcriptional organization of the vir region of pTiA6, vir plasmid clones were saturated with insertion mutations of a Tn3-lacZ transposon . This element is both an insertion mutagen and a reporter for the expression of the sequences into which it has inserted . One hundred and twenty-four vir::Tn3-lac insertions were analyzed for their mutagenic effect on Agrobacterium virulence, and for their expression of beta-galactosidase activity, the lacZ gene product, in vegetative bacteria and in bacteria cocultivated with plant cells . These data in conjunction with genetic complementation results show that the pTiA6 vir region contains six distinct vir complementation groups: virA, virB, virC, virD, virE and virG . Mutations in these loci eliminate (virA, virB, virD and virG) or significantly restrict (virC and virE) the ability of Agrobacterium to transform plant cells . Each of the vir loci corresponds to a single vir transcription unit: virA is constitutively expressed and non-inducible; virB, virC, virD and virE are expressed only upon activation by plant cells; and virG is both constitutively expressed and plant-inducible . The two largest vir operons, virB and virD, are probably polycistronic . The pTiA6 vir region also contains plant-inducible loci (pin) which are non-essential for virulence.

J Bacteriol, 1986 Jul, 167(1), 66 - 72
Second symbiotic megaplasmid in Rhizobium meliloti carrying exopolysaccharide and thiamine synthesis genes; Finan TM et al.; Using physical and genetic data, we have demonstrated that Rhizobium meliloti SU47 has a symbiotic megaplasmid, pRmeSU47b, in addition to the previously described nod-nif megaplasmid pRmeSU47a . This plasmid includes four loci involved in exopolysaccharide (exo) synthesis as well as two loci involved in thiamine biosynthesis . Mutations at the exo loci have previously been shown to result in the formation of nodules which lack infection threads (Inf-) and fail to fix nitrogen (Fix-) . Thus, both megaplasmids contain genes involved in the formation of nitrogen-fixing root nodules . Mutations at two other exo loci were not located on either megaplasmid . To mobilize the megaplasmids, the oriT of plasmid RK2 was inserted into them . On alfalfa, Agrobacterium tumefaciens strains containing pRmeSU47a induced marked root hair curling with no infection threads and Fix- nodules, as reported by others . This plant phenotype was not observed to change with A . tumefaciens strains containing both pRmeSU47a and pRmeSU47b megaplasmids, and strains containing pRmeSU47b alone failed to curl root hairs or form nodules.

Proc Natl Acad Sci U S A, 1986 Jun, 83(11), 3895 - 9
The right border region of pTiT37 T-DNA is intrinsically more active than the left border region in promoting T-DNA transformation; Jen GC et al.; Deletions of border regions of T-DNA on Agrobacterium Ti plasmid or mini-T plasmid have shown the right border region of pTiT37 T-DNA to be more active than the left border region in promoting T-DNA transformation . In this study we examine the possibility that the apparent difference in activity of left and right border regions may be due to position or orientation differences between the left and right borders with respect to the transferred onc genes . We have constructed eight similar single-border mini-T plasmids that contain a left border segment or a right border segment of pTiT37 T-DNA at various positions with either orientation with respect to the onc genes . We assayed the plant tumor-inducing activity of these mini-T plasmids in Agrobacterium tumefaciens LBA4404 containing the virulence helper plasmid pAL4404 . Regardless of the position and orientation of the border-containing segment in the mini-T plasmid, mini-T plasmids with the right border segment were highly virulent, whereas those with the left border segment were only weakly so . These results indicate that the difference in transformational activity between the left and right border regions is intrinsic and not an effect of position or orientation with respect to the onc genes . The pattern of the mini-T plasmid sequences integrated into the plant genome suggests that T-DNA transformation involves the directional transfer of a linear intermediate bounded by the border repeats.

Cell, 1986 May 23, 45(4), 593 - 600
Tomato golden mosaic virus A component DNA replicates autonomously in transgenic plants; Rogers SG et al.; Phenotypically normal petunia plants carrying chromosomal inserts of either the tomato golden mosaic virus (TGMV) A or the B component DNA, as single or tandem inserts, were obtained using an Agrobacterium tumefaciens Ti plasmid-based transformation system . Southern hybridization analysis revealed that the tandem, direct-repeat A plants contained free single and double stranded A component DNAs . No free B component DNA was detected in plants carrying tandem repeats of the B component . Progeny of self-fertilized plants appeared normal . In contrast, one-quarter of the progeny from tandem A by tandem B plant crosses showed chlorotic lesions on their leaves similar to virus symptoms . The significance of these results and the use of this method for the study of virus functions involved in TGMV replication and symptom production are discussed.

Science, 1986 May 23, 232(4753), 983 - 5
Plant phenolic compounds induce expression of the Agrobacterium tumefaciens loci needed for virulence; Bolton GW et al.; The virulence loci of Agrobacterium tumefaciens are a set of linked transcriptional units that play an essential role in the early stages of plant tumorigenesis . These loci are induced upon cocultivation of the bacteria with plant cells . Seven phenolic compounds that are widely distributed among the angiosperm plants--catechol, gallic acid, pyrogallic acid, p-hydroxybenzoic acid, protocatechuic acid, beta-resorcylic acid, and vanillin--are able to induce the expression of the virulence loci . These phenolics in combination induce each transcriptional locus of the vir loci . Furthermore, this induction displays similar kinetics and genetic control to that observed during cocultivation of the bacteria with plant cells.

Science, 1986 May 9, 232(4751), 738 - 43
Delay of disease development in transgenic plants that express the tobacco mosaic virus coat protein gene; Abel PP et al.; A chimeric gene containing a cloned cDNA of the coat protein (CP) gene of tobacco mosaic virus (TMV) was introduced into tobacco cells on a Ti plasmid of Agrobacterium tumefaciens from which tumor inducing genes had been removed . Plants regenerated from transformed cells expressed TMV mRNA and CP as a nuclear trait . Seedlings from self-fertilized transgenic plants were inoculated with TMV and observed for development of disease symptoms . The seedlings that expressed the CP gene were delayed in symptom development and 10 to 60 percent of the transgenic plants failed to develop symptoms for the duration of the experiments . Increasing the concentration of TMV in the inoculum shortened the delay in appearance of symptoms . The results of these experiments indicate that plants can be genetically transformed for resistance to virus disease development.

Plasmid, 1986 May, 15(3), 245 - 7
Multiple mutations in the transferred regions of the Agrobacterium rhizogenes root-inducing plasmids; Estramareix C et al.; Agrobacterium rhizogenes induces root formation at the site of inoculation in plants and inserts fragments of its Ri plasmid into the plant nuclear DNA . The transferred region (T-DNA) of the Ri plasmid of the A . rhizogenes strain A4 is made of two fragments, namely TL and TR; the latter harbors a sequence homology with the tms loci (responsible for auxin synthesis) of A . tumefaciens . On Daucus carota slices, single insertion mutations on the TL region of A . rhizogenes do not confer a mutant phenotype while an insertion-deletion in the TR region do confer a Basatt phenotype . Six double mutants with a single insertion in the TL region and the same deletion-insertion of the TR region were constructed . Three of these double mutants were avirulent on D . carota which indicates that in A . rhizogenes A4 the TL and the TR regions cooperate to confer a full infectious phenotype.

J Bacteriol, 1986 May, 166(2), 491 - 9
Activity of T-DNA borders in plant cell transformation by mini-T plasmids; Jen GC et al.; By using a binary vector system, we examined the requirements for border sequences in T-DNA transformation of plant genomes . Mini-T plasmids consisting of small replicons with different extents of pTiT37 T-DNA were tested for plant tumor-inducing ability in Agrobacterium tumefaciens strain LBA4404 containing helper plasmid pAL4404 (which encodes virulence genes needed for T-DNA transfer) . Assays of these bacteria on carrot disks, Kalanchoe leaves, and SR1 Nicotiana tabacum plantlets showed that mini-T plasmid containing full length T-DNA including left and right borders was highly virulent, as were mini-T plasmids containing all onc (oncogenicity) genes and only the right border . In contrast, mini-T plasmids containing all onc genes and only the left border induced tumors only rarely, and a mini-T plasmid containing all onc genes but no T-DNA borders was completely avirulent . Southern hybridization analyses of tumor DNA showed that T-DNA border sequences delimited the extent of the two-border mini-T plasmid transferred and integrated into the plant genome . When only one T-DNA border was present, it formed one end of the transferred DNA, and the other end mapped in the vector sequences . The implications of these results for the mechanism of T-DNA transfer and integration are discussed.

J Cell Biol, 1986 Apr, 102(4), 1173 - 82
Identification of Rhizobium plasmid sequences involved in recognition of Psophocarpus, Vigna, and other legumes; Broughton WJ et al.; Symbiotic DNA sequences involved in nodulation by Rhizobium must include genes responsible for recognizing homologous hosts . We sought these genes by mobilizing the symbiotic plasmid of a broad host-range Rhizobium MPIK3030 (= NGR234) that can nodulate Glycine max, Psophocarpus tetragonolobus, Vigna unguiculata, etc., into two Nod- Rhizobium mutants as well as into Agrobacterium tumefaciens . Subsequently, cosmid clones of pMPIK3030a were mobilized into Nod+ Rhizobium that cannot nodulate the chosen hosts . Nodule development was monitored by examining the ultrastructure of nodules formed by the transconjugants . pMPIK3030a could complement Nod- and Nif- deletions in R . leguminosarum and R . meliloti as well as enable A . tumefaciens to nodulate . Three non-overlapping sets of cosmids were found that conferred upon a slow-growing Rhizobium species, as well as on R . loti and R . meliloti, the ability to nodulate Psophocarpus and Vigna, thus pointing to the existence of three sets of host-specificity genes . Recipients harboring these hsn regions had truly broadened host-range since they could nodulate both their original hosts as well as MPIK3030 hosts.

J Bacteriol, 1986 Apr, 166(1), 88 - 94
Physical and functional map of supervirulent Agrobacterium tumefaciens tumor-inducing plasmid pTiBo542; Komari T et al.; Agrobacterium tumefaciens strains carrying pTiBo542 induce large, fast-appearing tumors and have an unusually wide host range . A clone bank was made from this 250-kilobase plasmid in a wide-host-range vector, and restriction maps were determined for BamHI and SalI . The virulence genes, transferred DNA genes, plasmid incompatibility region, and a region that inhibits growth of certain A . tumefaciens strains were localized . The six virulence genes and two tms genes were highly homologous to the genes of pTiA6, but the tmr gene was not . Mutations in each of the six vir loci of pTiA6 were complemented by clones from the vir region of pTiBo542.

J Bacteriol, 1986 Apr, 166(1), 44 - 50
Arginine catabolism in Agrobacterium strains: role of the Ti plasmid; Dessaux Y et al.; We present a study of the enzymatic activities involved in the pathway for arginine catabolism by Agrobacterium tumefaciens . Nitrogen from arginine is recovered through the arginase-urease pathway; the genes for these two activities are probably chromosomally born . Arginase was found to be inducible during growth in the presence of arginine or ornithine . Urease was constitutively expressed . Ornithine, resulting from the action of arginase on arginine, could be used as a nitrogen source via transamination to delta 1-pyrroline-5-carboxylate and reduction of the latter compound to proline by a reductase (both enzymatic activities are probably chromosomally encoded) . Ornithine could also be used as a carbon source . Thus, we identified an ornithine cyclase activity that was responsible for direct conversion of ornithine to proline . This activity was found to be Ti plasmid encoded and inducible by growth in medium containing octopine or nopaline . The same activity was also chromosomally encoded in some Agrobacterium strains . In such strains, this activity was inducible during growth in arginine-containing medium.

Anal Biochem, 1986 Apr, 154(1), 305 - 10
Enhanced instrumental sensitivity and selectivity for aminopeptidase profiling; Coburn JT et al.; Laser-excited fluorimetry has been applied to the identification of bacteria and fungus . The instrumental sensitivity and selectivity of the aminopeptidase profiling method has been enhanced by the use of laser excitation in conjunction with improved spectral and temporal background rejection . The linear dynamic range for the aminopeptidase technique has been increased by achieving a reduced lower limit of detection of the fluorescent tag, beta-naphthylamine . Standard aminopeptidase methodology only provides a linear dynamic range of 1.5 orders of magnitude . The laser-based method expanded the range to three orders of magnitude allowing the inherent specificity of aminopeptidase enzymes within the pathogen to be observed . The enhanced linear dynamic range was observed in profiles of Agrobacterium tumefaciens rubi and Phytophthora megasperma var . sojae.

DNA, 1986 Apr, 5(2), 101 - 13
Fate of selectable marker DNA integrated into the genome of Nicotiana tabacum; Czernilofsky AP et al.; To compare the effects of different transformation methods on the integration behavior and structural stability of integrated foreign genes in plant cells, tobacco protoplasts were transformed with Escherichia coli plasmid pLGV2103neo DNA using the Ca phosphate DNA coprecipitation technique . Parallel transformations were done by cocultivation with Agrobacterium tumefaciens harboring the Ti plasmid derivatives pGV3850::2103neo or pGV3850::1103neo . A comparison of the fine structure of the integrated donor DNA obtained by direct gene transfer and by cocultivation indicates that the donor DNA in cells transformed by the former technique undergoes structural changes and concatemerizations, while the DNA integrated by the latter procedure is often unaltered . The cotransformed nopaline synthase gene, which is present in the donor Ti plasmid DNA, was inactivated in two out of nine cases . Once integrated, the arrays of selectable marker DNA appear to be structurally stable under different cell culture and selection conditions, as well as after genetic transmission.

Proc Natl Acad Sci U S A, 1986 Apr, 83(8), 2571 - 5
Analysis of Agrobacterium tumefaciens virulence mutants in leaf discs; Horsch RB et al.; The leaf disc transformation system provides a simple means to score expression of various T-DNA markers within days of infection by Agrobacterium tumefaciens as well as long-term selection for growth of transformed callus and shoots . In this report, we describe the application of this system to evaluation of marker transfer and integration in a comprehensive set of defined avirulent mutants of A . tumefaciens . We conclude that virC is not essential when the T-DNA is present on a binary vector . The most likely explanation for this is that the virC gene product is involved in generation of a T-DNA intermediate.

Nucleic Acids Res, 1986 Mar 25, 14(6), 2555 - 65
Nucleotide sequence and expression of a Pseudomonas savastanoi cytokinin biosynthetic gene: homology with Agrobacterium tumefaciens tmr and tzs loci; Powell GK et al.; The nucleotide sequence of a Pseudomonas trans-zeatin producing gene (ptz) from the pCK1 plasmid of Pseudomonas syringae pv . savastanoi strain 1006 has been determined . This gene confers upon E . coli the ability to synthesize and secrete several cytokinins including trans-zeatin, iso-pentenyladenine and their respective N9-ribosyl derivatives . Sequence analysis indicates an open reading frame encoding a protein of 234 amino acids with a molecular weight of 26,816 . Significant sequence homology is found between ptz and both the tzs and tmr genes from Agrobacterium tumefaciens . The results suggest a close relationship between the cytokinin biosynthetic pathways in P . savastanoi and A . tumefaciens.

J Mol Biol, 1986 Mar 20, 188(2), 129 - 45
Transformed cell clones as a tool to study T-DNA integration mediated by Agrobacterium tumefaciens; Van Lijsebettens M et al.; A large number of tobacco SR1 cell clones transformed by the wild-type Agrobacterium C58 have been analysed for the presence of screenable markers such as tumour morphology, opine synthesis and hormone dependence . Distinct phenotypic classes were observed depending upon whether the cell clones were isolated from primary tumours or were obtained via cocultivation of protoplasts . These classes of tobacco SR1-C58 transformants appear to arise from errors in the Ti plasmid (T-DNA) transfer and integration mechanism itself rather than from subsequent T-DNA rearrangements, since 900 subclones, obtained by recloning a wild-type SR1-C58-transformed cell clone, yielded no variation in the phenotypes . A detailed genomic T-DNA analysis showed the presence of characteristic, abnormally short T-DNAs in the teratoma-forming, Acs- class and also in the Nos- class . The abnormal right border in two Nos- clones ends close to a sequence that resembles the normal T-DNA terminus and lies adjacent to the nos promoter, suggesting that this sequence could have functioned as a recognition site directing these particular T-DNA transfers . On the basis of the phenotypic and genomic blotting data it is clear that the short T-DNAs are characteristic of the cocultivation method . Other phenomena causing phenotypic variation, such as the loss of the T-DNA, and the gradual repression of T-DNA gene expression by methylation, are the main causes of aberrations in primary tumours . Moreover, the physical data suggest that early in the transformation cycle of Agrobacterium a replication step of a preselected T-DNA occurs before integration into the plant genome.

Nucleic Acids Res, 1986 Feb 11, 14(3), 1355 - 64
Promoters of Agrobacterium tumefaciens Ti-plasmid virulence genes; Das A et al.; The DNA sequences of the promoter and 5' upstream regions of six Agrobacterium tumefaciens Ti-plasmid encoded virulence (vir) genes were determined . The transcription initiation sites were mapped by the S1 nuclease protection assay . In the -10 region, the vir promoters share a consensus sequence that is homologous to a DNA sequence found in the same region of E . coli promoters . In contrast, the -35 region sequences are variable . Several vir genes contain two common hexanucleotide sequences, 5'CGAGTA3' and 5'GCAATT3' . Translation initiation codons for all vir genes, except virG, are preceded by sequences homologous to the ribosome binding site sequences found in E . coli.

Science, 1986 Feb 7, 231(4738), 616 - 8
Molecular basis for the auxin-independent phenotype of crown gall tumor tissues; Thomashow MF et al.; The transfer of specific Ti (tumor-inducing) plasmid sequences, the T-DNA, from Agrobacterium tumefaciens to a wide range of plants results in the formation of crown gall tumors . These tissues differ from most plant cells in that they can be grown in vitro in the absence of added phytohormones . Here, data are presented that offer an explanation for the auxin-independent phenotype of crown gall tissues . It is shown that crude cell-free extracts prepared from three bacterial species harboring pTiA6 gene 1 could convert L-tryptophan to indole-3-acetamide; control extracts lacking gene 1 could not carry out the reaction . Other reports indicate that the pTiA6 gene 2 product can convert indole-3-acetamide to indole-3-acetic acid, a naturally occurring auxin of plants . It is concluded that the auxin-independent phenotype of crown gall tissue involves the introduction of Ti plasmid sequences encoding a two-step pathway for auxin synthesis.

Nature, 1986 Feb 27-Mar 5, 319(6056), 791 - 3
Stable transformation of maize after gene transfer by electroporation; Fromm ME et al.; The graminaceous monocots, including the economically important cereals, seem to be refractory to infection by Agrobacterium tumefaciens, a natural gene transfer system that has been successfully exploited for transferring foreign genes into higher plants . Therefore, direct transfer techniques that are potentially applicable to all plant species have been developed using a few dicot and monocot species as model systems . One of these techniques, electroporation, uses electrical pulses of high field strength to permeabilize cell membranes reversibly so as to facilitate the transfer of DNA into cells . Electroporation-mediated gene transfer has resulted in stably transformed animal cells and transient gene expression in monocot and dicot plant cells . Here we report that electroporation-mediated DNA transfer of a chimaeric gene encoding neomycin phosphotransferase results in stably transformed maize cells that are resistant to kanamycin.

J Biol Chem, 1986 Jan 5, 261(1), 108 - 21
Nucleotide sequence analysis of TL-DNA of Agrobacterium rhizogenes agropine type plasmid . Identification of open reading frames; Slightom JL et al.; We have determined the nucleotide sequence of the Ri TL-DNA region from an Agrobacterium rhizogenes agropine-type plasmid using subcloned regions from the essentially identical Ri TL-DNAs from strains A4 and HRI . This sequenced region of 21,126 base pairs (bp) contains the complete TL-DNA region of the Ri plasmid as determined by analysis of TL-DNA borders in the genome of infected, clonal, Convolvulus arvensis plants . The left and right borders of the TL-DNA are flanked by 25-bp sequences which match the 25-bp terminal sequences found near the borders of T-DNA regions of Agrobacterium tumefaciens Ti plasmids . Other DNA sequences similar to these 25-bp terminal sequences are found within the TL region, and some of these sequences appear to be associated with Ri TL-DNA structures found in transformed tobacco plants . The TL-DNA region contains 18 open reading frames, many of which have 5' and 3' regulatory elements similar to those found in eukaryotic genes . In many cases, CCAAT and TATA elements were found upstream from putative transcriptional initiation codons, and poly(A) addition (AATAAA) elements were observed in presumed 3'-noncoding regions . Comparison of Ri TL-DNA coding and noncoding sequence regions with T-DNA sequence regions from octopine type Ti plasmid pTi15955 reveals no extensive sequence homologies.

Science, 1986 Jan 3, 231(4733), 48 - 51
Osmotic adaptation by gram-negative bacteria: possible role for periplasmic oligosaccharides; Miller KJ et al.; The cyclic (1----2)-beta-D-glucans produced by species of Agrobacterium and Rhizobium resemble the membrane-derived oligosaccharides of Escherichia coli in their periplasmic localization, intermediate size, and (1----2)-beta-D-glucan backbones . The regulation of the biosynthesis of cyclic (1----2)-beta-D-glucan by Agrobacterium tumefaciens is now shown to parallel the osmotic regulation of membrane-derived oligosaccharide biosynthesis in Escherichia coli . This result suggests a general role for periplasmic oligosaccharides in the osmotic adaptation of Gram-negative bacteria as ecologically diverse as enteric and soil bacteria.

J Bacteriol, 1986 Jan, 165(1), 288 - 92
Enzymes of the beta-ketoadipate pathway are inducible in Rhizobium and Agrobacterium spp . and constitutive in Bradyrhizobium spp; Parke D et al.; Protocatechuate is a universal growth substrate for members of the family Rhizobiaceae, and these bacteria utilize the aromatic compound via the beta-ketoadipate pathway . This report describes transcriptional controls exercised by different subgroups of the Rhizobiaceae over five enzymes that catalyze consecutive reactions in the pathway: protocatechuate oxygenase (EC 1.13.11.3), beta-carboxy-cis,cis-muconate lactonizing enzyme (EC 5.5.1.2), gamma-carboxymuconolactone decarboxylase (EC 4.1.1.44), beta-ketoadipate enol-lactone hydrolase (EC 3.1.1.24), and beta-ketoadipate succinyl-coenzyme A transferase (EC 2.8.3.6) . All five enzymes were inducible in the fast-growing strains Agrobacterium rhizogenes, Agrobacterium tumefaciens, Rhizobium fredii, Rhizobium meliloti, Rhizobium leguminosarum, and Rhizobium trifolii . Specific activities in induced cells ranged from 5- to 100-fold greater than those found in uninduced cells . In contrast to the fast-growing strains and members of every other microbial taxon examined to date, the slow-growing Bradyrhizobium japonicum and cowpea Bradyrhizobium spp . constitutively expressed four of the five enzymes; protocatechuate oxygenase was the only inducible enzyme in this group . The slow-growing strains included different DNA homology groups, so it appears likely that constitutive expression of the four enzymes is a common trait in the bradyrhizobia . This property points to the importance of aromatic compounds and aromatic catabolites in the nutrition of these organisms.

Symp Soc Exp Biol, 1986, 40, 85 - 120
Transformation of the genomic expression of plant cells; Davey MR et al.; Agrobacterium-induced transformation of plant cells results from integration of T-DNA of the Ti or Ri plasmids into the genome of susceptible plants . Expression of T-DNA genes induces physiological changes in transformed cells which modify normal plant development to produce proliferations characteristic of crown gall and hairy root diseases . Understanding of the molecular basis of the transformation events associated with these examples of naturally occurring genetic engineering of plant cells, has stimulated efforts to construct vectors for transferring specific genes into plants . Vector construction has progressed from the use of wild-type Ti plasmids, giving phenotypically abnormal regenerated plants, to non-oncogenic plasmids . The range of vectors now available should enable useful foreign genes to be inserted into a range of dicotyledons and monocotyledons without impairing normal plant development.

Crit Rev Microbiol, 1986, 13(3), 281 - 307
Initial interactions of Agrobacterium tumefaciens with plant host cells; Matthysse AG; Infections of wounded dicotyledonous plants by Agrobacterium tumefaciens result in the formation of crown gall tumors . The initial step in tumor formation is the site-specific attachment of the bacteria to the host cells . The mechanism of recognition and attachment in this interaction has been studied in detail . Current information on the nature of the bacterial binding sites, the nature of the host receptors, the role of bacterial cellulose fibrils, and the genetics of bacterial attachment will be summarized, and a model for the attachment of Agrobacterium to host cells will be presented.

Folia Microbiol (Praha), 1986, 31(2), 86 - 93
Modification of T-DNA of nopaline Ti plasmid by intermediary vector and utilization of agrocin 84 sensitivity as simple criterion of conjugation transfer of modified Ti plasmid; Vlasak J et al.; The chloramphenicol resistance gene from pSa was introduced into T-DNA of pTi T37 of Agrobacterium tumefaciens by cointegration with intermediary plasmid based on pBR322 . The resulting intermediary vector was mobilized to A . tumefaciens T37 by conjugative plasmid pRK2 . The RK2 plasmid also forms contegrates with pTi due to the Tn3 transposon which was used for the mobilization of modified pTi into plasmid-less A . tumefaciens strain . Transconjugants were selected on the basis of their antibiotic resistance markers and tested for agrocin sensitivity as proof of Ti plasmid transfer . Agrocin sensitivity of tranconjugants together with chloramphenicol resistance was shown to be a sufficient and simple criterion of transfer of modified Ti plasmids . Agrobacterium strains with modified Ti plasmids showed decreased virulence in consequence of the presence of additional borderline sequence inside their T-DNA.

Gene, 1986, 45(3), 327 - 31
Integration of the delta-endotoxin gene of Bacillus thuringiensis into the chromosome of root-colonizing strains of pseudomonads using Tn5; Obukowicz MG et al.; The delta-endotoxin gene (tox) from Bacillus thuringiensis subsp . kurstaki HD-1 was cloned into Tn5 and the resulting Tn5-tox element transposed from a vector plasmid into the chromosome of six corn-root-colonizing strains of Pseudomonas fluorescens and Agrobacterium radiobacter . Chromosomal integration of the tox gene maximized stability and minimized the potential for horizontal transfer of the tox gene to other bacterial species . Expression of the tox gene was demonstrated by Western blot analysis and by toxicity against larvae of the tobacco hornworm (Manduca sexta) . The method described illustrates how a given gene can be stably integrated into the chromosome of diverse bacterial species.

Gene, 1986, 42(2), 185 - 92
Construction and uses of a new transposable element whose insertion is able to produce gene fusions with the neomycin-phosphotransferase-coding region of Tn903; Ratet P et al.; We describe the construction of a transposable element derived from the Mu phage that upon insertion is able to create a gene fusion between the region of Tn903 coding for neomycin phosphotransferase (NPT I), which confers resistance to aminoglycosides including kanamycin (KmR), neomycin and G418, and the control elements of the gene where the insertion occurs . A chloramphenicol (Cm) transacetylase gene (cat) that confers resistance to Cm is present in the transposon so that transposition events can be monitored even when no active fusions with the nptI coding region occur . The transposase gene is deleted and, therefore, this transposon is perfectly stable upon insertion . The properties of this new transposable element were studied by obtaining gene fusions between the Escherichia coli L-arabinose operon and 'nptI gene . In some of them the KmR phenotype is induced by arabinose . Insertions of this element in cloned fragments of the T-DNA region of Agrobacterium rhizogenes were also isolated . Some of them confer a KmR phenotype upon its E . coli carriers, which indicates that portions of the T-DNA are expressed in these cells.

Gene, 1986, 41(1), 47 - 57
Expression of a bean storage protein 'phaseolin minigene' in foreign plant tissues; Chee PP et al.; Using the phaseolin gene and its cDNA counterpart we constructed a mutant phaseolin gene lacking the five introns but retaining its natural 5' and 3' plant-regulatory sequences . This mutant phaseolin gene (minigene) was inserted into the Ti-plasmid of Agrobacterium tumefaciens strain 15955 which allowed its transfer and integration into the tobacco genome . Full-length and correctly initiated phaseolin mRNA was found among the poly(A)+RNA isolated from plant callus transformed with the minigene construction by using RNA-DNA hybridization and S1 nuclease mapping techniques . The presence of phaseolin polypeptides in soluble protein extracts from transformed tobacco tissues was confirmed by immunological methods . These results demonstrate that phaseolin gene introns and intron splicing are not a necessary requirement for biogenesis of stable phaseolin mRNA and that no alternative splice site was introduced by the removal of five introns.

J Mol Biol, 1985 Dec 5, 186(3), 557 - 64
Structure and expression of Ri T-DNA from Agrobacterium rhizogenes in Nicotiana tabacum . Organ and phenotypic specificity; Durand-Tardif M et al.; The incorporation of transferred DNA (T-DNA) from the Ri plasmid of Agrobacterium rhizogenes into the chromosomal DNA of higher plants is correlated with the appearance of a complex phenotype . The transformed genotype and phenotype undergo Mendelian inheritance . Through studies of Ri T-DNA content and transcription in Nicotiana tabacum, we have delineated a particular part of this foreign DNA as the likely source of the transformed phenotype . One inducible/repressible aspect of the transformed phenotype is termed T' and is correlated with the presence of a supplementary Ri T-DNA-encoded transcript . This transcript is found specifically in leaves, whereas most of the other T-DNA transcripts are more abundant in roots . The T' phenotype does not appear to be due to structural changes in the Ri T-DNA . It is inherited in a dominant Mendelian fashion . We propose that the T' phenotype is caused by heritable changes in the regulation of Ri T-DNA expression . We comment on the potential of this system as a model for studying eukaryotic gene expression.

Biochem J, 1985 Dec 1, 232(2), 431 - 4
N2-(1-carboxyethyl)methionine . A 'pseudo-opine' in octopine-type crown-gall tumours; Firmin JL et al.; A novel methionine-containing plasmid-determined compound, N2-(1-carboxyethyl)methionine (NCEM) has been identified in crown-gall tumours induced by octopine-type strains of Agrobacterium tumefaciens . NCEM is probably synthesized by octopine synthase . Cell-free preparations from octopine-type strains of A . tumefaciens can degrade NCEM; however, the bacterium cannot transport the compound into the cell, although these strains can take up and degrade the octopine family of opines.

J Bacteriol, 1985 Dec, 164(3), 1200 - 10
Identification of a Rhizobium meliloti pSym2011 region controlling the host specificity of root hair curling and nodulation; Truchet G et al.; In Rhizobium meliloti 2011 nodulation genes (nod) required to nodulate specifically alfalfa are located on a pSym megaplasmid . Nod- derivatives carrying large pSym deletions were isolated . By complementation of these strains with in vivo- and in vitro-constructed episomes containing pSym of sequences and introduction of these episomes into Agrobacterium tumefaciens, we show (i) that from a region of pSym of about 360 kilobases, genes required for specific alfalfa nodulation are clustered in a DNA fragment of less than 30 kilobases and (ii) that a nod region located between nifHDK and the common nod genes is absolutely required for alfalfa nodulation and controls the specificity of root hair curling and nodule organogenesis initiation.

J Gen Microbiol, 1985 Nov, 131 ( Pt 11), 2961 - 9
The use of pNJ5000 as an intermediate vector for the genetic manipulation of Agrobacterium Ti-plasmids; Hepburn AG et al.; The use of broad-host-range plasmids derived from RP4 as intermediate vectors for the transfer of narrow-host-range recombinant plasmids from Escherichia coli to Agrobacterium tumefaciens as a preliminary to marker exchange is described . Recombinant plasmids having a ColE1 type origin were linked to the RP4 derivative . Cointegrate formation appeared to take place by RecA-independent, homologous recombination within a short piece of DNA derived from the beta-lactamase gene of Tn1/Tn3 carried by both vector components, so that it never disrupted the recombinant portion of the construction . pNJ5000 provides an unstable intermediate vector for use in marker exchange experiments, while its stable relative pNJ1020 provides a carrier for use in binary vector systems.

J Clin Pathol, 1985 Nov, 38(11), 1293 - 9
"Agrobacterium yellow group" and Pseudomonas paucimobilis causing peritonitis in patients receiving continuous ambulatory peritoneal dialysis; Swann RA et al.; Five cases of peritonitis occurred during continuous ambulatory peritoneal dialysis in which unusual yellow pigmented Gram negative bacteria were isolated in pure culture . Four of these isolates were identified as the so called "Agrobacterium yellow group." The remaining isolate was identified as Pseudomonas paucimobilis, an organism closely related to the Agrobacterium yellow group.

J Bacteriol, 1985 Nov, 164(2), 774 - 81
Regulation of Ti plasmid virulence genes by a chromosomal locus of Agrobacterium tumefaciens; Close TJ et al.; We isolated a mutant strain of Agrobacterium tumefaciens, designated Ros, that has a pleiotropic phenotype which includes elevated levels of expression of certain genes in the virulence (Vir) region of tumor-inducing plasmid pTiC58 . This mutant and others were isolated by fusing the promoter of the Vir bak gene to a promoterless gene (cat) that encodes chloramphenicol acetyltransferase and then selecting for increased expression of cat in A . tumefaciens . The ros mutation is chromosomal in nature and is characterized by a more-than-300-fold increase in the level of expression of bak and a 12-fold increase in the level of expression of an adjacent divergent operon containing the hdv genes, which are involved in some aspect of host specificity . The Ros mutant is fully virulent and is typified by its unusual colony morphology; the colonies have rough surfaces, uneven edges, and a pit in the center at 24 degrees C and vary markedly in appearance from one growth temperature to another . The Ros mutant is not able to form colonies at 12 degrees C, a temperature at which the wild-type strain forms colonies in 14 days . The ros mutation occurs spontaneously with a frequency of 5 X 10(-8) . Genetic and biochemical evidence indicates that the product of the ros locus is a negative regulator of Ti plasmid genes and is related to undefined chromosomally encoded functions that are involved in the mutant phenotype.

J Bacteriol, 1985 Nov, 164(2), 723 - 30
New class of limited-host-range Agrobacterium mega-tumor-inducing plasmids lacking homology to the transferred DNA of a wide-host-range, tumor-inducing plasmid; Unger L et al.; Biotype 1 and 2 strains of Agrobacterium tumefaciens were isolated from crown gall tumors of Lippia canescens plants growing as ground cover in Arizona . The isolates were agrocin 84 sensitive, did not catabolize octopine, nopaline, agropine, or mannopine, and were limited in their tumorigenic host range . One biotype 2 strain, AB2/73, showed the most limited host range; it incited tumors only on Lippia strains, the cucurbit family of plants, and Nicotiana glauca . Megaplasmids were detected in the isolates by vertical agarose gel electrophoresis . The unusual host range, as well as sensitivity to agrocin 84, were plasmid specified since they were conjugally cotransferred with plasmids from donor strain AB2/73 . Correlation of deletions with concomitant loss of virulence and agrocin 84 sensitivity identified the megaplasmid pAtAB2/73d as the virulence element in strain AB2/73 . The estimated size of this tumor-inducing plasmid was 500 kilobases . Axenic growth of tumor tissue incited by strains carrying pAtAB2/73d was phytohormone independent . Although the limited-host-range megaplasmid pAtAB2/73d lacked any detectable homology to the phytohormone-biosynthetic genes in wide-host-range transferred DNA (tms-1, tms-2, tmr), it showed homology to the wide-host-range virB, virC, virD, and virG loci . Therefore, pAtAB2/73d represents a new class of tumor-inducing plasmids distinguished by its large size, the absence of determinants for the catabolism of several known opines, the presence of agrocin 84 sensitivity, and its lack of homology to wide-host-range transferred DNA contrasted with its conservation of sequences from the wise-host-range vir region.

Science, 1985 Nov 1, 230(4725), 556 - 8
A common origin of rickettsiae and certain plant pathogens; Weisburg WG et al.; On the basis of ribosomal RNA sequence comparisons, the rickettsia Rochalimaea quintana has been found to be a member of subgroup 2 of the alpha subdivision of the so-called purple bacteria, which is one of about ten major eubacterial divisions . Within subgroup alpha-2, R . quintana is specifically related to the agrobacteria and rhizobacteria, organisms that also have close associations with eukaryotic cells . This genealogical grouping of the rickettsiae with certain plant pathogens and intracellular symbionts suggests a possible evolution of the rickettsiae from plant-associated bacteria.

J Bacteriol, 1985 Nov, 164(2), 918 - 21
Positive selection procedure for entrapment of insertion sequence elements in gram-negative bacteria; Gay P et al.; We constructed the broad-host-range plasmid pUCD800 containing the sacB gene of Bacillus subtilis for use in the positive selection and isolation of insertion sequence (IS) elements in gram-negative bacteria . Cells containing pUCD800 do not grow on medium containing 5% sucrose unless the sacB gene is inactivated . By using pUCD800, we isolated a 1.4-kilobase putative IS element from Agrobacterium tumefaciens NT1RE by selection for growth on sucrose medium . This putative IS element appears to be unique to Agrobacterium strains.

Nucleic Acids Res, 1985 Oct 11, 13(19), 6981 - 98
Selection-expression plasmid vectors for use in genetic transformation of higher plants; Velten J et al.; Plasmid vectors containing both a selectable marker for plant transformation (kanamycin resistance) and a second, directly adjacent, divergent promoter for the transcription of inserted DNA fragments have been constructed . These vectors make use of a small (479 bp) dual-promoter DNA fragment, originally isolated from the T-DNA of Agrobacterium tumefaciens, fused to the neomycin phosphotransferase gene of Tn5 . Several unique restriction enzyme cleavage sites, as well as a polyadenylation signal sequence, have been introduced downstream of the open promoter, allowing simple insertional cloning of DNA fragments to be expressed in plants . To test the vectors, the coding region for the chloramphenicol acetyltransferase gene (CAT) from Tn9 was inserted, and the resulting plasmids introduced into tobacco cells . Transformed calli, selected only for Km resistance, contained, in every case tested, both NPTII and CAT activities.

J Clin Microbiol, 1985 Oct, 22(4), 683 - 5
Septicemia caused by Agrobacterium sp; Freney J et al.; Agrobacterium radiobacter biovar 2 was repeatedly grown from the blood of an elderly patient receiving artificial ventilation and broad-spectrum antibiotics . No source of the organism was found, but the septicemia ceased when cefotaxime was given . Sera from the patient showed a fourfold rise in antibody against the organism and higher titers than sera from all but 1 of 50 healthy blood donors . The organism did not contain the plasmid associated with plant oncogenicity . This case may be only the second in which Agrobacterium sp . has been clearly linked with human infection.

J Bacteriol, 1985 Oct, 164(1), 33 - 44
Molecular and genetic analysis of the transferred DNA regions of the root-inducing plasmid of Agrobacterium rhizogenes; White FF et al.; The T-DNA regions of the root-inducing (Ri) plasmid pRiA4b of Agrobacterium rhizogenes were characterized . Two regions, designated TL-DNA and TR-DNA, were found to be integrated and stably maintained in the plant genome . The TL-DNA spanned a 15- to 20-kilobase region of pRiA4b and was separated from the TR-DNA region by at least 15 kilobases of nonintegrated plasmid DNA . The TR-DNA region also spanned a 15- to 20-kilobase region of pRiA4b and included a region of homology to the tms morphogenic loci of the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens . Eighteen deletions and 95 transposon insertions were generated in the T-DNA regions and tested for alterations in virulence . Insertions into four loci in the TL-DNA affected the morphology of root formation of Kalanchoe diagremontiana leaves and stems, but had no visible effects on other host plants . Insertions into two loci (tms-1 and tms-2) in the TR-DNA eliminated virulence symptoms on all plants tested, with the exception of K . diagremontiana stems, where sparse root formation occurred . Complementation experiments with Ri and Ti plasmid T-DNA mutations indicate that the tms genes of the two plasmids serve similar functions and suggest a functional relationship between one or more genes of the TL-DNA and the cytokinin synthesis locus tmr of the Ti plasmid.

J Bacteriol, 1985 Oct, 164(1), 102 - 6
Role for 2-linked-beta-D-glucan in the virulence of Agrobacterium tumefaciens; Puvanesarajah V et al.; Phenol-water cell extracts of virulent Agrobacterium tumefaciens A348 and several avirulent mutants with a reduced ability to attach to plant surfaces were examined . A low-molecular-weight 2-linked-beta-D-glucan was identified in the cell wall extracts of the virulent wild-type strain . Analyses of phenol-water extracts and culture filtrates of four mutant strains showed that the mutants did not produce any 2-linked-beta-D-glucan . When these mutants were complemented, the ability to produce the glucan described above was restored . These results suggest that there is a role for 2-linked-beta-D-glucans in the attachment of A . tumefaciens to plant cells . One avirulent, attachment-defective mutant retained its ability to produce the low-molecular-weight glucan . This mutation, however, mapped to a different transcriptional unit than the mutants deficient in the glucan described above . Thus, it appears that 2-linked-beta-D-glucan is only one component that may be necessary for attachment of A . tumefaciens to plant cell surfaces.

J Bacteriol, 1985 Oct, 164(1), 230 - 6
Natural relationship between bacteroides and flavobacteria; Weisburg WG et al.; Comparisons among 16S rRNA sequences from various eubacteria reveal a natural relationship between the bacteroides (represented by the Bacteroides fragilis sequence) and a phylogenetic unit that comprises the flavobacteria, cytophagae, flexibacteria, and others (represented by the Flavobacterium heparinum sequence) . Although the relationship is not a close one, it is, nevertheless, specific . rRNAs from these two organisms are not only closer to one another in overall sequence than they are to outgroup species (such as Bacillus subtilis, Escherichia coli, Desulfovibrio desulfuricans, and Agrobacterium tumefaciens), but they show common idiosyncrasies (i.e., derived characteristics) in both rRNA sequences and higher-order structures.

Ann Inst Pasteur Microbiol, 1985 Sep-Oct, 136B(2), 113 - 24
Heterologous hybridization of bacterial DNA to the endoglucanases A and B structural genes celA and celB of Clostridium thermocellum; Petre D et al.; DNA from various cellulolytic and non-cellulolytic bacteria was found to hybridize to Clostridium thermocellum NCIB10682 DNA fragments carrying the structural genes celA and celB which code for endoglucanases A and B . Homology to celA was detected in Agrobacterium rhizogenes, Azospirillum brasilense, Bacillus subtilis, Cellulomonas sp., Clostridium stercorarium, Erwinia chrysanthemi, Pseudomonas solanacearum and Streptomyces griseus . Homology to celB was detected only in B . subtilis, C . stercorarium and E . chrysanthemi . No homology to celA or celB was detected in Agrobacterium tumefaciens, Rhizobium japonicum, Rhizobium meliloti, Rhizobium ORS571 and Trichoderma reesei . Hybridization performed with the homologous strain NCIB10682 and with C . thermocellum LQRI suggested that the two strains were identical in terms of cel genes . In addition, it is likely that the C . thermocellum cel genes, whose number is presently estimated to be at least ten, do not belong to a gene family, since heterologous hybridization was observed only to a single small EcoRI or HindIII fragment homologous to celB.

Plasmid, 1985 Sep, 14(2), 171 - 5
Novel high- and low-copy stable cosmids for use in Agrobacterium and Rhizobium; Gallie DR et al.; Presented are a set of cosmids based on the unit copy Agrobacterium plasmid, pTAR, and the high-copy-number mutant plasmid, pUCD500, of pTiC58 . The addition of a par function derived from pTAR to the vectors allowed them to be stably maintained throughout the cell population in the absence of selective pressure . These vectors, designed for Agrobacterium and Rhizobium, also work in Escherichia coli . The vectors can be cotransferred to Rhizobiaceae from E . coli with the helper plasmid, pRK2013 . The pTiC58 origin containing vectors, pUCD1000 and pUCD1001 were found to be incompatible with a 250-kb plasmid harbored by R . meliloti RM102Z1 . RM102Z1(pUCD1000) was still capable of nodulating roots in alfalfa.

EMBO J, 1985 Sep, 4(9), 2159 - 65
A nuclear gene encoding the beta subunit of the mitochondrial ATP synthase in Nicotiana plumbaginifolia; Boutry M et al.; The beta subunit of the mitochondrial ATP synthase in Nicotiana plumbaginifolia is encoded by two nuclear genes, atp2-1 and atp2-2, which are both expressed . The complete nucleotide sequence of atp2-1 has been determined . It contains eight introns ranging from 88 to 1453 bp . The last intron contains a putative insertion element (Inp), of 812 bp bordered by 35-bp inverted repeats which share an 11-bp homology with Agrobacterium tumefaciens T-DNA borders . Sequences homologous to Inp are present in multiple copies in the N . plumbaginifolia and the N . tabacum genome but not in more distant species . The atp2-1 encoded polypeptide is highly homologous to beta subunits from other ATP synthases but it contains an extension at the N terminus which is probably involved in mitochondrial targeting . A sequence homology between exon 4 of atp2-1 and exon 1 of the human ras genes suggests a common ancestral origin for these exons.

Biochem Biophys Res Commun, 1985 Aug 30, 131(1), 152 - 9
Eight DNA insertion events of Agrobacterium tumefaciens Ti-plasmids in isogenic sunflower genomes are all distinct; Ursic D; We investigated whether the same or different T-DNA insertions occur every time Agrobacterium tumefaciens, the octopine type strain pTi 15955 strr, infects genetically identical sunflower plants . Eight newly established crown gall tissue culture lines were analyzed for their T-DNA content . Our data showed that all isogenic crown gall callus DNA produced distinct hybridization patterns . These eight patterns were also different from three standard lines included for comparison . In addition, all the tumor lines analyzed produced octopine, albeit in different quantities, and five produced agropine and mannopine . We concluded, that each A . tumefaciens crown gall tissue line derived from isogenic sunflower plants contained a distinct insertion pattern of T-DNA . Possible causes and reasons for this diversity will be discussed.

Nature, 1985 Aug 22-28, 316(6030), 750 - 2
Light-regulated and organ-specific expression of a wheat Cab gene in transgenic tobacco; Lamppa G et al.; Many of our most important crop plants are monocotyledons, including wheat, corn, rice and barley . No routine transformation system for monocotyledons has been reported, such as the Ti-mediated gene transfer system for dicotyledons facilitated by Agrobacterium tumefaciens . Indirect evidence suggests that Ti-plasmid DNA is transferred into and expressed in A . tumefaciens-infected wound tissues of plants from Liliaceae and Amaryllidaceae, but these observations have not been extended to monocotyledons of greatest agricultural importance . Regeneration of monocotyledons is usually blocked at the callus-stage, further complicating the possibility of exploring the regulated expression of their genes, and thus preventing identification of the regulatory domains of monocotyledonous genes in a homologous nuclear background . To circumvent these difficulties, we investigated whether monocotyledonous genes can be expressed and correctly regulated in dicotyledons . We have introduced a wheat gene (whAB1.6) encoding the major chlorophyll a/b binding protein (Cab) of the light-harvesting complex into the genomes of tobacco (Nicotiana tabacum SR1) and petunia (Petunia hybrida) via a Ti-DNA-mediated gene transfer system which allows the transformed cells to regenerate into whole plants . Here we report for the first time the light-regulated and organ-specific expression of a monocotyledonous gene in transgenic dicotyledonous plants.

Mol Gen Mikrobiol Virusol, 1985 Aug, (8), 35 - 8
{Effect of Agrobacterium tumefaciens (Smith and Town) . Conn . on the functional properties of human blood lymphocytes}; Slepukhina LV et al.; Agrobacterium tumefaciens has been shown to affect the proliferation of intact lymphocytes as well as lymphocytes stimulated by PHA action . Inoculation of bacteria into the cultures of intact lymphocytes and incubation during 72 h resulted in increased incorporation of {3H}-thymidine into the DNA of cultivated cells . The bacteria are capable of inhibition of lymphocytes proliferation stimulated by PHA.

Nucleic Acids Res, 1985 Jul 11, 13(13), 4777 - 88
Efficient octopine Ti plasmid-derived vectors for Agrobacterium-mediated gene transfer to plants; Deblaere R et al.; A two-component cloning system to transfer foreign DNA into plants was derived from the octopine Ti plasmid pTiB6S3 . pGV2260 is a non-oncogenic Ti plasmid from which the T-region is deleted and substituted by pBR322 . pGV831 is a streptomycin-resistant pBR325 derivative that contains a kanamycin resistance marker gene for plant cells and a site for cloning foreign genes between the 25-bp border sequences of the octopine T-region . Conjugative transfer of pGV831 derivatives to Agrobacterium and cointegration by homologous recombination between the pBR322 sequences present on pGV831 and pGV2260, can be obtained in a single step . Strains carrying the resulting cointegrated plasmids transfer and integrate T-DNA into the genome of tobacco protoplasts, and transformed tobacco calli are readily selected as resistant to kanamycin . Intact plants containing the entire DNA region between the T-DNA borders have been regenerated from such clones . In view of these properties we present pGV831 and its derivatives as vectors for efficient integration of foreign genes into plants.

J Bacteriol, 1985 Jul, 163(1), 341 - 8
Limited-host-range plasmid of Agrobacterium tumefaciens: molecular and genetic analyses of transferred DNA; Yanofsky M et al.; A tumor-inducing (Ti) plasmid from a strain of Agrobacterium tumefaciens that induces tumors on only a limited range of plants was characterized and compared with the Ti plasmids from strains that induce tumors on a wide range of plants . Whereas all wide-host-range Ti plasmids characterized to date contain closely linked oncogenic loci within a single transferred DNA (T-DNA) region, homology to these loci is divided into two widely separated T-DNA regions on the limited-host-range plasmid . These two plasmid regions, TA-DNA and TB-DNA, are separated by approximately 25 kilobases of DNA which is not maintained in the tumor . The TA-DNA region resembles a deleted form of the wide-host-range TL-DNA and contains a region homologous to the cytokinin biosynthetic gene . However, a region homologous to the two auxin biosynthetic loci of the wide-host-range plasmid mapped within the TB-DNA region . These latter genes play an important role in tumor formation because mutations in these loci result in a loss of virulence on Nicotiana plants . Furthermore, the TB-DNA region alone conferred tumorigenicity onto strains with an intact set of vir genes . Our results suggest that factors within both the T-DNA and the vir regions contribute to the expression of host range in Agrobacterium species . There was a tremendous variation among plants in susceptibility to tumor formation by various A . tumefaciens strains . This variation occurred not only among different plant species, but also among different varieties of plants within the same genus.

Proc Natl Acad Sci U S A, 1985 Jul, 82(13), 4443 - 7
Mitochondrial origins; Yang D et al.; The 16S ribosomal RNA sequences from Agrobacterium tumefaciens and Pseudomonas testosteroni have been determined to further delimit the origin of the endosymbiont that gave rise to the mitochondrion . These two prokaryotes represent the alpha and beta subdivisions, respectively, of the so-called purple bacteria . The endosymbiont that gave rise to the mitochondrion belonged to the alpha subdivision, a group that also contains the rhizobacteria, the agrobacteria, and the rickettsias--all prokaryotes that have developed intracellular or other close relationships with eukaryotic cells.

J Bacteriol, 1985 Jul, 163(1), 324 - 30
Extension of the host range of Escherichia coli vectors by incorporation of RSF1010 replication and mobilization functions; Priefer UB et al.; The broad-host-range vectors pSUP104, pSUP106, pSUP204, pSUP304, and pSUP404 are based on conventional Escherichia coli vectors (such as pBR325 and pACYC184) which have been modified to include the mobilization and broad-host-range replication functions of the IncQ plasmid RSF1010 . These vector plasmids now can be maintained in a wide range of bacterial genera including Rhizobium, Agrobacterium, and Pseudomonas . They are efficiently mobilized by RP4 and thus are of particular interest for bacteria refractory to transformation . They offer the selection markers and cloning sites characteristic of the basic E . coli vectors . Therefore, they can be applied and adapted to a variety of cloning strategies . However, the cloning of very large fragments (e.g., in cosmid hybrids of pSUP106) was found to affect the stability of the recombinant molecules in a Rec+ background . This instability was not observed with smaller inserts of about 5 kilobases.

Plasmid, 1985 Jul, 14(1), 47 - 52
Expression of a Rhizobium phaseoli Sym plasmid in R . trifolii and Agrobacterium tumefaciens: incompatibility with a R . trifolii Sym plasmid; Hooykaas PJ et al.; Identification of the Sym plasmid in Rhizobium phaseoli strain RCC3622 is described . Introduction of this plasmid into R . trifolii or Agrobacterium tumefaciens strains resulted in bacteria capable of forming characteristic spherical root nodules on beans . This Sym plasmid, designated pSym9, was characterized as 275 MDa and nonconjugative . pSym9 was incompatible with the R . trifolii Sym plasmid pSym5, and carries genes determining a melanin-like black pigment . A second plasmid of 135 MDa, pRph3622a, was also transferred from R . phaseoli to R . trifolii and A . tumefaciens . Transconjugants carrying this plasmid did not form root nodules on beans . In contrast to other Rhizobium plasmids, pRph3622a was unstable in A . tumefaciens.

Plasmid, 1985 Jul, 14(1), 17 - 27
lacZ gene fusions and insertion mutagenesis in the TL-region of Agrobacterium rhizogenes Ri plasmid; Plessis A et al.; Agrobacterium rhizogenes induces root formation and inserts a fragment of its plasmid into the genome of infected plants . A part of the transferred region (TL-region) of the Ri plasmid of A . rhizogenes strain A4 was cloned in pBR322 . Insertions of the Escherichia coli lacZ coding region into the hybrid plasmids were made in vivo using mini-Mu-duction . Two mini-Mus were used, one with the Mu A and B transposase genes (MudII1681) and the other without (MudII1734) . Two inserts which result in E . coli lacZ expression where shown to be located in the T-DNA region . This indicates that portions of the T-DNA are capable of expression in bacteria . When these two hybrid plasmids were transformed into Agrobacterium only the one harboring MudII1734 insert gave transformants which correspond to homologous recombination . These results indicate that gene fusion and insertion directed mutagenesis can be simultaneously obtained with this mini-Mu and could be used to study Agrobacterium gene expression.

J Bacteriol, 1985 Jun, 162(3), 1030 - 8
Analysis of transfer of tumor-inducing plasmids from Agrobacterium tumefaciens to Petunia protoplasts; Virts EL et al.; Petunia protoplasts were infected with the virulent Agrobacterium tumefaciens strain A348 or the avirulent strain A136 (lacking a Ti plasmid) . The infection process was stopped at various time intervals up to 24 h after inoculation, and the DNA from the plant cells was isolated . Southern blot analysis indicated that the DNA isolated from infected Petunia cells was not detectably contaminated by bacterial DNA from lysed Agrobacterium cells . Analysis of the DNA from the virulent infections suggested that the transferred DNA (T-DNA) may be transferred to the plant cell rapidly (within 2 to 6 h) after the bacteria bind to the cell wall and that the T-DNA may exist in a rearranged state which is stable over the time period investigated . Dot blot analysis indicated that regions far outside the T-DNA may be transferred to the plant cell . Most of the DNA transferred to the plant cell during the initial hours of infection is rapidly degraded.

J Nutr Sci Vitaminol (Tokyo), 1985 Jun, 31(3), 253 - 63
Biosynthesis of biotin-vitamers from unsaturated higher fatty acids by bacteria; Ohsugi M et al.; The biosynthesis of biotin-vitamers from unsaturated higher fatty acids by the resting cell system of bacteria was investigated . Biotin-vitamer formation from oleic, linoleic and linolenic acids was found in certain bacteria belonging to the genera Enterobacter, Agrobacterium, Bacillus, Escherichia and Micrococcus . The biotin-vitamers were identified as a mixture of 7,8-diaminopelargonic acid, desthiobiotin and biotin . Metabolites other than biotin-vitamers from those fatty acids were analyzed by gas-liquid chromatography and mass spectrometry . Linoleic, oleic, C-17 and C-15 saturated fatty acids were identified as the main metabolites of linolenic acid . The pathway of biosynthesis of pimelic acid from linolenic acid by a strain of Bacillus sphaericus AKU 0227 was also studied.

Arch Biochem Biophys, 1985 May 1, 238(2), 368 - 72
The enzymatic synthesis of beta 1-2 glucans; Zorreguieta A et al.; Incubation of labeled uridine diphosphate glucose with an enzyme preparation from Rhizobium meliloti or Agrobacterium tumefaciens leads to the formation of a glucan which appears to be identical to the beta 1-2 cyclic glucan described by several workers . This conclusion is based on the molecular size, the formation of sophorose and higher homologs by partial acid hydrolysis, the liberation of only glucose by total acid hydrolysis, and the release of only 3,4,6-tri-O-methylglucose after methylation and hydrolysis . A snail intestinal juice enzyme was found to break down the glucan and its partial hydrolysis products . A beta-glucosidase from sweet almonds degraded sophorose but not the intact glucan.

Proc Natl Acad Sci U S A, 1985 May, 82(9), 2669 - 73
Identification of pTiC58 plasmid-encoded proteins for virulence in Agrobacterium tumefaciens; Hagiya M et al.; Analyses were made of the host-dependent-variation (hdv) locus of the virulence (vir) region of the pTiC58 plasmid of Agrobacterium tumefaciens . The hdv locus is comprised of at least four genes that encode polypeptides of 13, 15, 29, and 28 kDa . Insertion of transposon Tn5 in the first gene abolishes the expression of all four genes in vitro and in vivo . Nucleotide sequence analysis of the hdv locus revealed four open reading frames tandemly arranged with spacer sequences having no promoter-like sequences and lacking the ability to bind A . tumefaciens RNA polymerase . These studies suggest that the hdv locus is comprised of at least four genes arranged in an operon in the vir region . The protein products of these genes are likely to function in some aspect of the host-range determination of A . tumefaciens.

Nucleic Acids Res, 1985 Apr 25, 13(8), 2773 - 88
Cloning and nucleotide sequence of the tzs gene from Agrobacterium tumefaciens strain T37; Akiyoshi DE et al.; The trans-zeatin secretion locus (tzs), from the nopaline Ti plasmid of Agrobacterium tumefaciens strain T37, was cloned and the nucleotide sequence determined . This gene is located in the virulence region of pTiT37 . The tzs gene is responsible for the secretion of trans-zeatin into bacterial culture medium and in addition has the cytokinin biosynthetic activity, dimethylallylpyrophosphate:AMP dimethylallyltransferase . Sequence analysis showed an open reading frame of 729 nucleotides, capable of encoding a protein of 27,545 daltons . A single new labelled protein of 27,200 daltons was detected in Escherichia coli maxicells expressing the cloned tzs gene . Significant sequence homology was observed between the tzs and the published tmr sequence from pTiT37.

EMBO J, 1985 Apr, 4(4), 891 - 8
A Tn3 lacZ transposon for the random generation of beta-galactosidase gene fusions: application to the analysis of gene expression in Agrobacterium; Stachel SE et al.; The construction and use of a Tn3-lac transposon, Tn3-HoHo1, is described . Tn3-HoHo1 can serve as a transposon mutagen and provides a new and useful system for the random generation of both transcriptional and translational lacZ gene fusions . In these fusions the production of beta-galactosidase, the lacZ gene product, is placed under the control of the gene into which Tn3-HoHo1 has inserted . The expression of the gene can thus be analyzed by monitoring beta-galactosidase activity . Tn3-HoHo1 carries a non-functional transposase gene; consequently, it can transpose only if transposase activity is supplied in trans, and is stable in the absence of this activity . A system for the insertion of Tn3-HoHo1 into sequences specifically contained within plasmids is described . The applicability of Tn3-HoHo1 was demonstrated studying three functional regions of the Agrobacterium tumefaciens A6 Ti plasmid . These regions code for octopine catabolism, virulence and plant tumor phenotype . The regulated expression of genes contained within each of these regions was analyzed in Agrobacterium employing Tn3-HoHo1 generated lac fusions.

Eur J Biochem, 1985 Mar 1, 147(2), 343 - 9
Characterization and primary structures of DNA-binding HU-type proteins from Rhizobiaceae; Khanaka H et al.; The DNA-binding HU-type proteins from several species of Rhizobiaceae including Rhizobium meliloti, two strains of Rhizobium leguminosarum with highly different phenotypic characters and Agrobacterium tumefaciens, were characterized and their amino acid sequences were determined . HU-type proteins isolated from R . leguminosarum L18 and A . tumefaciens are identical and show slight differences with the R . meliloti HU-type protein . On the other hand the R . leguminosarum L53 HU-type protein is quite different from the proteins cited above; several amino acid substitutions encountered in this protein result in significant changes in the folding of the polypeptide chain . The biochemical characteristics of these proteins are in good agreement with the respective position of these bacteria in the phylogeny determined by numerical taxonomy.

Plasmid, 1985 Mar, 13(2), 99 - 105
The development of plasmid-free strains of Agrobacterium tumefaciens by using incompatibility with a Rhizobium meliloti plasmid to eliminate pAtC58; Hynes MF et al.; Agrobacterium tumefaciens strains LBA275 and LBA290 were cured of their cryptic plasmid pAtC58 by the introduction of the Rhizobium meliloti plasmid pRme41a, which is incompatible with pAtC58 . pRme41a and pTiC58, the resident Ti plasmid of LBA275, were subsequently eliminated by growth at supraoptimal temperature (40 degrees C) . The resulting plasmid-free Agrobacterium strains, UBAPF1 and UBAPF2, have proved extremely useful for the study of Rhizobium plasmids . The loss of the cryptic plasmid pAtC58 has no effect on the tumor-forming ability of the Agrobacterium strains; when the Ti plasmid is present, normal tumors are formed on Kalanchoe daigremontiana.

J Bacteriol, 1985 Mar, 161(3), 1034 - 41
Analysis of Agrobacterium tumefaciens plasmid pTiC58 replication region with a novel high-copy-number derivative; Gallie DR et al.; The origin of replication, ori, of the nopaline tumor-inducing plasmid, pTiC58, mapped in a region that shares sequence homology with octopine plasmids pTiAch5 and pTiB6 . Within this region, the minimum amount of DNA necessary for maintaining autonomous replication was a 2.6-kilobase region, which also comprised the incompatibility function inc . pTiC58 derivatives containing inc were incompatible with Agrobacterium tumefaciens plasmids pTiC58, pTiD1439, pTiAch5, pTi15955, and pTiA5 and were compatible with A . rhizogenes plasmid pRi12 . Situated adjacent to the origin region was a 1.5-kilobase par segment involved in stable inheritance of pTiC58 under nonselective growth conditions . When par was present, plasmid maintenance approached that of the wild-type pTiC58 . Rapid loss from the cell population was observed for plasmids not containing this locus . Another 1.5-kilobase region, cop, positively regulated pTiC58 copy number, enabling certain pTiC58 derivatives to exist at a copy number up to 80 times higher than that of wild-type pTiC58 . Deletions within the cop locus resulted in reduced copy number . The ori/inc regions were flanked on either side by the par and cop loci.

Plasmid, 1985 Mar, 13(2), 129 - 38
Rhizobium meliloti carries two megaplasmids; Banfalvi Z et al.; In Rhizobium meliloti strain 41 the existence of a second megaplasmid (pRme41c) with a molecular weight similar to the sym megaplasmid pRme41b was demonstrated . Derivatives of the wild-type strain carrying pRme41b or pRme41c tagged with Tn5 allowed the examination of the transfer ability of both megaplasmids . The introduction of megaplasmids into the wild-type R . meliloti was not detected, probably because of the action of plasmid genes coding for entry exclusion of the same type of plasmid . However, transmissibility of both megaplasmids was observed in matings with Nod- or Fix- pRme41b deletion mutant recipients and with Agrobacterium tumefaciens at frequencies of 10(-6) - 10(-8) . Introduction of the megaplasmids into the R . meliloti recipients resulted in the loss of the same plasmid . On the other hand, pRme41b and pRme41c were compatible . From the extent of deletions in various Nod- and Fix- mutants a DNA region carrying genes probably involved in "surface exclusion" on pRme41b was located . This DNA region is about 50 kb distant from the nod genes and exhibits strong homology with a DNA segment of pRme41c . Symbiotic genes on pRme41c were not identified.

Plasmid, 1985 Mar, 13(2), 106 - 17
Tn5 insertions in the agrocin 84 plasmid: the conjugal nature of pAgK84 and the locations of determinants for transfer and agrocin 84 production; Farrand SK et al.; The kanamycin-resistance transposon Tn5 was randomly introduced into pAgK84, a 47.7-kb plasmid coding for agrocin 84 production in Agrobacterium . Using such marked plasmids, pAgK84 was found to be conjugal . It could be transferred to several Agrobacterium strains including those harboring octopine- or nopaline-type Ti plasmids . Its presence has no effect on Ti plasmid functions such as opine utilization and tumorigenicity, but it does confer agrocin 84 immunity upon previously sensitive strains . The plasmid could also be conjugally transferred to a Nod+ Fix+ strain of Rhizobium meliloti . The production of agrocin 84 is expressed in all Agrobacterium and Rhizobium transconjugants tested . The agrocin plasmid could not be introduced into restrictionless Escherichia coli or Pseudomonas aeruginosa recipients by conjugation or transformation . The sites of 92 independent Tn5 insertions were mapped on pAgK84 . These insertions are dispersed over the entire length of the plasmid . Analysis of the sites and effects of the Tn5 insertions has allowed us to construct a functional map of pAgK84 . Forty-three of these insertions, spanning a 20-kb segment of the plasmid, abolished or greatly reduced the production of agrocin 84 . The presence of two insertions within this segment having an effect on agrocin production suggests that at least three regions of the plasmid are involved in agrocin 84 biosynthesis . Fourteen of the Tn5 insertion derivatives are no longer conjugally transferable . These insertions all map to a single region of the plasmid and define about 3.5-kb as being associated with transfer functions.

J Bacteriol, 1985 Mar, 161(3), 850 - 60
Identification and genetic analysis of an Agrobacterium tumefaciens chromosomal virulence region; Douglas CJ et al.; A genetic analysis of Agrobacterium tumefaciens chromosomal functions required for virulence was undertaken . Large Tn5-containing cosmid clones were isolated from DNA of avirulent A . tumefaciens mutants having chromosomal Tn5 insertions and exhibiting defective attachment to plant cells . The clones from several different mutants each contained overlapping segments of a 30-kilobase A . tumefaciens chromosomal region, which were physically mapped . All chromosomal Tn5 insertions leading to the avirulent, attachment-defective phenotype were localized within an 11-kilobase portion of this chromosomal virulence region . Transposon Tn3::HoHo1 (Tn3 containing lacZ) was used to simultaneously mutagenize and create lac fusions within the virulence region . This analysis demonstrated the presence of two distinct chromosomal virulence loci, which were 1.5 and 5 kilobases long; transposon insertions into these loci led to avirulence and defective attachment . The beta-galactosidase activity associated with various Tn3::HoHo1-created lac fusions indicated that the loci are transcribed in opposite directions, and complementation studies suggested that each locus consists of a single transcriptional unit . A cosmid clone of the chromosomal virulence region containing a lac fusion in the extreme 3' portion of the 5-kilobase locus was used to demonstrate that expression of this region is dependent on the presence of sequences in the 5' portion of the locus, confirming its operon-like nature.

J Bacteriol, 1985 Feb, 161(2), 764 - 6
Specific attachment of Agrobacterium tumefaciens to bamboo cells in suspension cultures; Douglas C et al.; Agrobacterium tumefaciens was tested for its ability to attach to tissue culture cells of bamboo, a monocotyledonous plant . Phase-contrast microscopy and kinetic experiments with radiolabeled bacteria showed that attachment to bamboo cells was indistinguishable from attachment to cells of dicotyledonous plants . Bacterial mutants defective in attachment to dicotyledonous plants showed similar behavior with bamboo, and extensive washing of the bamboo cells had no effect on the number of bacteria which attached.

J Bacteriol, 1985 Feb, 161(2), 655 - 64
Genetic analysis of integration mediated by single T-DNA borders; Caplan AB et al.; Transformation of plant cells by the T-DNA of the Ti plasmid of Agrobacterium tumefaciens depends in part upon a sequence adjacent to the right T-DNA end . When this sequence is absent, the T-DNA is almost avirulent; when it is present, DNA between it and the left T-DNA border region becomes integrated in plants . To investigate further this process of DNA transfer and integration, we introduced the right border region and the nopaline synthase (nos) gene of plasmid pTiC58 into a variety of new positions around Ti plasmids . The border region functioned when separated from the remainder of the T-DNA by almost 50 kilobases . It also worked when placed outside of the T-DNA region where there were no known left-border sequences with which to interact . Indeed, the nos gene could be transferred to plants even when no other Ti plasmid sequences were present on the same plasmid . These results may indicate that the sequence requirements for the left borders are not as stringent as those for the right borders . In addition, mutants with an extra copy of the right border region within their T-DNA were found to transfer or integrate only parts of the bacterial T-DNA region . It is possible that abnormally placed T-DNA borders interfere with the normal process of DNA transfer, integration, or both.

Biochem Biophys Res Commun, 1985 Jan 16, 126(1), 352 - 7
An intermediate in cyclic beta 1-2 glucan biosynthesis; Zorreguieta A et al.; Incubation of UDP-{14C}Glc with the inner membranes of Agrobacterium tumefaciens leads to the formation of cyclic beta 1-2 glucan and trichloroacetic acid-insoluble compounds . The proteolysis products of the latter show a positive charge in acid and a negative charge in alkaline buffers . The cyclic beta 1-2 glucan and the trichloroacetic acid insoluble compounds yield the same products on partial acid hydrolysis . Addition of excess non-radioactive UDP-Glc to the reaction mixture nearly stops the formation of radioactive beta 1-2 glucan and leads to a rapid fall of radioactivity in the trichloroacetic acid precipitate . Alkaline treatment of the insoluble compounds under conditions of beta-elimination leads to the partial release of free saccharides (about 30%) . It is concluded that beta 1-2 glucan chains are built up joined to a protein and then released as free cyclic beta 1-2 glucan.

Plasmid, 1985 Jan, 13(1), 1 - 7
Localization of agropine-synthesizing functions in the TR region of the root-inducing plasmid of Agrobacterium rhizogenes 1855; De Paolis A et al.; The region of the Ri plasmid pRi 1855 that encodes agropine synthesis has been identified through its sequence homology with the equivalent genes of the octopine Ti plasmid pTi ACH5 . Interestingly the agropine genes lie outside the so-far identified T-DNA of pRi 1855, and are separated from this latter by a long sequence of non integrated plasmid DNA . The presence of this additional T-DNA (TRight DNA) in hairy roots was demonstrated by Southern blot analysis and by the presence of specific transcripts . The genes for agropine synthesis are arranged in the Ri plasmid in a reversed order as compared to their orientation in the Ti plasmid pTi ACH5.

J Bacteriol, 1985 Jan, 161(1), 223 - 30
Nodules are induced on alfalfa roots by Agrobacterium tumefaciens and Rhizobium trifolii containing small segments of the Rhizobium meliloti nodulation region; Hirsch AM et al.; Regions of the Rhizobium meliloti nodulation genes from the symbiotic plasmid were transferred to Agrobacterium tumefaciens and Rhizobium trifolii by conjugation . The A . tumefaciens and R . trifolii transconjugants were unable to elicit curling of alfalfa root hairs, but were able to induce nodule development at a low frequency . These were judged to be genuine nodules on the basis of cytological and developmental criteria . Like genuine alfalfa nodules, the nodules were initiated from divisions of the inner root cortical cells . They developed a distally positioned meristem and several peripheral vascular bundles . An endodermis separated the inner tissues of the nodule from the surrounding cortex . No infection threads were found to penetrate either root hairs or the nodule cells . Bacteria were found only in intercellular spaces . Thus, alfalfa nodules induced by A . tumefaciens and R . trifolii transconjugants carrying small nodulation clones of R . meliloti were completely devoid of intracellular bacteria . When these strains were inoculated onto white clover roots, small nodule-like protrusions developed that, when examined cytologically, were found to more closely resemble roots than nodules . Although the meristem was broadened and lacked a root cap, the protrusions had a central vascular bundle and other rootlike features . Our results suggest that morphogenesis of alfalfa root nodules can be uncoupled from infection thread formation . The genes encoded in the 8.7-kilobase nodulation fragment are sufficient in A . tumefaciens or R . trifolii backgrounds for nodule morphogenesis.

Exp Cell Biol, 1985, 53(6), 335 - 50
The in vitro effects of opines and other compounds on DNAs originating from bacteria, and from healthy and tumorous plant tissues; Le Goff L et al.; Purified total DNAs were isolated from oncogenic or nononcogenic Agrobacterium tumefaciens cells as well as from normal and crown gall tissues . Opines (octopine, nopaline, lysopine), plant hormone (auxin IAA) and some carcinogenic compounds were used in order to correlate their effects on in vitro strand separation and synthesis of DNAs with in vivo tumorous cell multiplication . Octopine (or nopaline) induced chain opening of DNAs originating from octopine (or nopaline)-metabolizing bacteria and from same bacteria strain-induced tumorous cells . This phenomenon was measured by the increase in DNA hyperchromicity which is concentration dependent . The tested compounds stimulated the in vitro synthesis of the same DNAs . Under the same conditions, in vitro strand separation and synthesis of healthy plant DNA was not (or only slightly) enhanced, except in the case of particular hormone-connected healthy cell DNA . IAA and carcinogens stimulated in vitro synthesis and induced in vitro strand separation (dose-dependent effect) of DNAs isolated from crown gall cells and inducing bacteria . Compared to healthy cell DNAs, these DNAs were thus susceptible to structurally very diversified molecules and in this way behave as do mammalian tissue DNAs . The opine and IAA actions observed here were specific for plant tissue DNA; cancerous human or animal tissue DNAs were insensitive . By their presence in the crown gall cells, opines possibly maintain destabilized areas (required for rapid growth and division) on tumor cell DNA . The cooperative actions of IAA and opines as well as small RNA and RNA fragments on gene activation, might explain the autonomy of plant tumor cells.

Gene, 1985, 39(2-3), 141 - 6
Expression of the nopaline synthase gene in Escherichia coli; Gafni Y et al.; The Agrobacterium tumor-inducing (Ti) plasmid pTiT37 encodes nopaline synthase (NOS) gene (nos) with eukaryotic promoter elements that is expressed in transformed plant cells but not in the bacterial host . We have fused the nos gene to the Escherichia coli trp promoter, and observed synthesis of NOS in E . coli . The nopaline produced by this enzyme is excreted into the culture medium . NOS is enzymatically active at 30 degrees C but not 37 degrees C, as based on nopaline production . NOS protein is produced at both temperatures, based on production in minicells.

J Cell Sci Suppl, 1985, 2, 301 - 16
Surface components involved in bacterial pathogen-plant host recognition; Sequeira L; During their initial association with plant hosts, pathogenic bacteria interact with plant cell walls . The results of this interaction appear to determine whether bacterial multiplication will take place . With one group of bacterial plant pathogens (e.g . Agrobacterium tumefaciens), attachment to the host surface appears essential for pathogenesis . With another group (e.g . Pseudomonas solanacearum), only those strains that do not attach to the host cell wall are able to multiply in the intercellular spaces . Attachment of many incompatible strains to tobacco mesophyll cell walls leads to a rapid hypersensitive response (HR) and a drastic reduction in bacterial multiplication . Our working hypothesis is that these differences in host response to strains of P . solanacearum are the result of a recognition response in which surface components of both host and pathogen play important roles . Our approach is based on the use of spontaneous or transposon (Tn5)-generated mutants of strains K60 (virulent) and B1 (avirulent) that differ in surface components and in their ability to attach to host cells and to induce the HR . A study of the surface components of bacterial and tobacco cell walls has led to the tentative conclusion that bacterial lipopolysaccharide (LPS) and plant hydroxyproline-rich glycoproteins mediate initial attachment, apparently as a result of charge-charge interaction . This initial attachment is reversed by high salt concentrations during the first 15 min, but not thereafter . Firm attachment appears to depend on hydrophobic interactions mediated by bacterial pili . At the normal ionic strength of intercellular fluids, extracellular polysaccharide (EPS) appears to inhibit only the pili-mediated attachment . Several HR- mutants of strain B1 have been obtained by Tn5 insertion, but they remain avirulent on tobacco . We are examining the EPS, LPS and pili production, and the attachment characteristics of these strains.

Differentiation, 1985, 28(3), 200 - 4
Superoxide dismutase and peroxidase are coordinately regulated in differentiated and transformed tissues of Nicotiana tabacum; Bremner TA et al.; We used a series of normal and Agrobacterium-transformed, bacteria-free tobacco tissue cultures which differ in their levels of histodifferentiation to test the relationship of superoxide dismutase, peroxidase, and catalase to oncogenic transformation and differentiation . When compared with normal callus, tumor callus contained reduced levels of both superoxide dismutase and peroxidase, and a reduced number of isozymes of both enzymes . Teratomas characterized by limited but abnormal differentiation showed increases in superoxide-dismutase activity and isozymes, but levels of peroxidase activity lower than those found in normal callus despite an increase in the number of peroxidase isozymes . A similar disparity between low peroxidase activity and high isozyme number in the shoot suggests that there are increased levels of peroxidase inhibitors or of molecules which interfere with the spectrophotometric assay for peroxidase in more differentiated tissues . As judged by the number of isozymes of both superoxide dismutase and peroxidase in each tissue, the following conclusions are warranted: first, tobacco copper/zinc superoxide dismutases and peroxidases are encoded in several duplicated loci which are regulated independently . Second, transformation is associated with a decrease in both the specific activity and isozyme number of superoxide dismutase . Third, the partial release from the total inhibition of expression of differentiated function exhibited by teratoma is associated with an increase in both the activity and isozyme number of superoxide dismutase . Finally, the expression of superoxide dismutase and peroxidase isozymes appears to be coordinated during differentiation in a manner that is consistent with their role in an integrated mechanism for the removal of reduced oxygen species.

Nature, 1984 Dec 6-12, 312(5994), 564 - 6
Plant-inducible virulence promoter of the Agrobacterium tumefaciens Ti plasmid; Okker RJ et al.; Agrobacterium tumefaciens is the causative agent of crown gall, a plant tumour that can arise on most species of dicotyledonous plants . The tumour-inducing capacity of the bacterium requires the presence of a large plasmid, designated the Ti plasmid, which itself contains two regions essential for tumour formation-the T(umour)-region and the Vir(ulence)-region . The T-region is transferred to plant cells by an unknown mechanism, and becomes stably integrated into the plant genome . The Vir-region has been identified by transposon mutagenesis, but the DNA of this region has never been detected in tumour lines . However, trans-complementation of Vir mutants indicates that genes of the Vir-region are functional in the bacterium . Moreover, the Vir- and T-regions can be physically separated in A . tumefaciens without loss of tumour-inducing capacity . Seven loci, designated virA-F and virO (refs 17, 20-22), have been identified in the Vir-region of the octopine Ti plasmid, but their functions are unknown . As virC mutants in the octopine-type plasmid pTiB6 are invariably avirulent in tests on various plant species, this gene seems to be essential for virulence and we are studying it in detail . We report here that the promoter of virC shows no detectable activity in A . tumefaciens and Escherichia coli K-12 grown in standard medium, but that its activity is induced by a plant product.

Proc Natl Acad Sci U S A, 1984 Dec, 81(23), 7495 - 9
Nucleotide sequence of the insertion sequence found in the T-DNA region of mutant Ti plasmid pTiA66 and distribution of its homologues in octopine Ti plasmid; Machida Y et al.; The octopine tumor-inducing (Ti) plasmid pTiA66 has an insertion mutation in its T region (the DNA region incorporated into the plant genome) that results in the slow growth of crown gall tumors . These tumors exhibit hormonal autonomy different from that of the crown gall tumors caused by wild-type Ti plasmids . In the present study, the nucleotide sequences of both the DNA segment inserted into pTiA66 and its target site have been determined . The inserted segment is 2548 base pairs long and has 20-base-pair terminal inverted repeats . An 8-base-pair sequence at the target site is duplicated at both integration junctions . These structural features of the insert suggest that it is a bacterial insertion sequence (IS) element, which we have named IS66 . Blot-hybridization analyses using IS66 probes revealed that genomes of octopine Ti plasmids contain at least three sequences homologous to IS66: two homologues are located in the virulence region and one is located between the left-hand (TL-DNA) and right-hand (TR-DNA) portions of T-DNA . The chromosome of Agrobacterium tumefaciens A66 also contains two sequences highly homologous to IS66 . These results suggest that the mutant pTiA66 plasmid was generated by translocation of one of the sequences showing homology with IS66 into the T region . The fact that a sequence homologous to IS66 is present between TL-DNA and TR-DNA also suggests that the octopine T region was split into two portions, TL-DNA and TR-DNA, by translocation of IS66 or its relatives . Thus, IS66 may cause genetic and structural variations of the T region and the vir region of the octopine Ti plasmids.

Nucleic Acids Res, 1984 Nov 26, 12(22), 8711 - 21
Binary Agrobacterium vectors for plant transformation; Bevan M; A vector molecule for the efficient transformation of higher plants has been constructed with several features that make it efficient to use . It utilizes the trans acting functions of the vir region of a co-resident Ti plasmid in Agrobacterium tumefaciens to transfer sequences bordered by left and right T-DNA border sequences into the nuclear genome of plants . The T-region contains a dominant selectable marker gene that confers high levels of resistance to kanamycin, and a lac alpha-complementing region from M13mp19 that contains several unique restriction sites for the positive selection of inserted DNA.

Antibiotiki, 1984 Nov, 29(11), 803 - 6
{Growth rate of antibiotic-producing gram-negative bacteria on liquid nutrient media}; Oparina ON et al.; Glycerol-yeast medium No . 3 may be used as a seed medium in screening of antibiotic-producing strains among Acetobacter, Gluconobacter, Chromobacterium, Agrobacterium, and other genera . The medium is transparent . It provides visual instrumental control of the growth rate of the seed material and estimation of biomass augmentation . The period of the exponential phase growth of the strains tested on medium No . 3 was 2-8 hours . When no growth on medium No . 3 is observed media Nos . 1 and 2 can be used as alternative seed media.

Exp Cell Res, 1984 Nov, 155(1), 141 - 52
Phosphorylation of chromosomal proteins during the transition of a normal plant cell to a crown gall tumor cell; Schafer W et al.; The transition of a wounded plant cell to a crown gall tumor cell, which is induced by infection with virulent Agrobacterium tumefaciens cells, is accompanied by enhancement of chromatin-bound protein phosphokinase activity . Various protein kinases with different substrate specificity (viz . histone, phosvitin, casein phosphokinases) are distinctly more active in tumor cells . The phosphate is introduced into seryl and threonyl residues of proteins and is stable under standard assay conditions, thus indicating the absence of protein phosphatases . Acyl or histidyl phosphates are not involved . The properties of protein phosphokinases change during tumor induction, giving rise to kinases which are sensitive to spermine or spermidine . The pattern of chromatin proteins is tissue-specific and consequently different in wounded and tumorous plant cells, as is the phosphorylation pattern of these proteins.

J Bacteriol, 1984 Nov, 160(2), 564 - 8
Physical and functional map of an Agrobacterium tumefaciens tumor-inducing plasmid that confers a narrow host range; Knauf V et al.; Agrobacterium tumefaciens Ag162 induces crown gall disease on an unusually narrow range of host plants . The 231-kilobase Ti plasmid which has been shown to determine host range, was subcloned into the vector pVCK102 . By comparing overlaps of cloned insets, maps were constructed for the restriction endonucleases SalI, XhoI, EcoRI, and KpnI . Plasmid incompatibility, octopine catabolism, and at least six virulence genes were localized . Plasmid incompatibility between pTiAg162 and the wide host range plasmid pTiA6 consists of two components: mutual incompatibility and the apparent ability of pTiA6 to block RK2 replication if the pTiAg162 incompatibility locus is linked to the vector pVK102 . The octopine catabolism locus maps within the 30 kilobases of DNA separating the two T-DNA regions of pTiAg162 . Complementation of avirulent vir mutants of pTiA6 with clones of pTiAg162 DNA did not confer the host range of pTiAg162 but rather restored the wide host range of pTiA6 . One potentially important difference between pTiA6 and pTiAg162 is that pTiAg162 T-DNA regions are widely separated.

Proc Natl Acad Sci U S A, 1984 Oct, 81(19), 5994 - 8
T-DNA of Agrobacterium tumefaciens encodes an enzyme of cytokinin biosynthesis; Akiyoshi DE et al.; Phytohormone overproduction in crown gall tumors is due to the expression of several T-DNA genes . The data strongly suggest that the tmr gene (transcript 4) is responsible for cytokinin overproduction by encoding dimethylallyl-pyrophosphate:AMP dimethylallyltransferase (DMA transferase), an enzyme directly involved in cytokinin biosynthesis . Cell-free extracts of Escherichia coli strains containing the tmr gene from pTiA6NC had DMA transferase activity . No activity was present in the control strain containing only the plasmid vector . The cytokinins synthesized were isopentenyladenine, isopentenyladenosine, and isopentenyladenosine 5'-monophosphate . DMA transferase activity was also detected in cloned crown gall tumors incited by Agrobacterium tumefaciens wild-type A6NC and a tms mutant . Enzymatic activity in cell-free extracts of E . coli and tumors could be abolished by transposon insertion within the tmr gene.

J Bacteriol, 1984 Oct, 160(1), 327 - 32
Host range encoded by the Agrobacterium tumefaciens tumor-inducing plasmid pTiAg63 can be expanded by modification of its T-DNA oncogene complement; Buchholz WG et al.; Agrobacterium tumefaciens harboring pTiA6 incite unorganized tumors on Nicotiana rustica, sunflowers, carrots, and tomatoes, whereas isogenic strains of agrobacteria harboring pTiAg63 form "rooty" tumors on N . rustica and are essentially avirulent on sunflowers, carrots, and tomatoes . In this report we show that the different host range characteristics of these two plasmids were due, in part, to differences in the T-DNA oncogene complements of the plasmids . Specifically, we constructed derivatives of pTiAg63 that contained pTiA6 oncogenes 4, 6a, and 6b inserted into the TB-DNA region and found that agrobacteria harboring these plasmids could incite unorganized tumors on N . rustica, tomatoes, carrots, and the inbred sunflower line HA202R . Undefined host factors, however, also appeared to be involved in determining A . tumefaciens host range since three inbred sunflower lines, HA303B, HA89B, and HA290B, were susceptible to tumor formation by agrobacteria harboring pTiA6 but not by strains harboring pTiAg63 or the modified pTiAg63 plasmids.

J Bacteriol, 1984 Oct, 160(1), 319 - 26
Comparison of T-DNA oncogene complements of Agrobacterium tumefaciens tumor-inducing plasmids with limited and wide host ranges; Buchholz WG et al.; The T-DNA oncogene complements of the limited-host-range tumor-inducing plasmid pTiAg63 and the wide-host-range plasmid pTiA6 were compared . The resulting data indicate that pTiAg63 has DNA sequences related to most of the genes encoded by the oncogene region, the TL-DNA, of pTiA6 and that these sequences are divided between two T-DNA regions, the TA-DNA, which encoded sequences related to pTiA6 genes 4 (the cytokinin independence gene) and 6a, as well as to a pTiA6 TL-DNA fragment that encoded gene 6b and a portion of gene 3, and the TB-DNA, which encoded sequences related to genes 1 and 2 (the auxin independence genes) . Tumor tissues of Nicotiana rustica incited by Agrobacterium tumefaciens harboring either pTiA6 or pTiAg63 grew axenically in vitro on phytohormone-free medium . The morphologies of the tissues, however, differed; whereas those incited with pTiA6 grew as loose, friable, unorganized callus, the tumors incited by pTiAg63 grew as clumps of rootlike structures . Thus, the T-DNA oncogene complements of these plasmids were not equivalent . The results are discussed in relation to the A . tumefaciens host range.

Biochem Biophys Res Commun, 1984 Sep 17, 123(2), 458 - 62
Crown gall transformation of tobacco callus cells by cocultivation with Agrobacterium tumefaciens; Muller A et al.; Incubation of cells from squashed tobacco callus tissue with virulent Agrobacterium tumefaciens leads to the production of cells displaying a crown gall phenotype.

Cell, 1984 Sep, 38(2), 455 - 62
Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from agrobacterium to the plant genome; Wang K et al.; We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome . The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action . A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences . The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity . First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity . Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity . The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.

Infect Immun, 1984 Sep, 45(3), 631 - 6
Monoclonal antibodies specific for Escherichia coli J5 lipopolysaccharide: cross-reaction with other gram-negative bacterial species; Mutharia LM et al.; Four monoclonal antibodies against Escherichia coli J5 were studied . Each of these monoclonal antibodies reacted with purified lipopolysaccharides from E . coli J5, the deep rough mutant Salmonella minnesota Re595, Agrobacterium tumefaciens, and Pseudomonas aeruginosa PAO1 as well as with the purified lipid A of P . aeruginosa . Enzyme-linked immunosorbent assays using the outer membranes from a variety of gram-negative bacteria demonstrated that these lipid A-specific monoclonal antibodies interacted with between 84 and 97% of the gram-negative bacterial species tested . One of the monoclonal antibodies, 5E4, was shown to interact with 34 of the 35 outer membrane or lipopolysaccharide antigens tested . Immunoenzymatic staining of Western electrophoretic blots of separated P . aeruginosa outer membrane components was used to demonstrate that antibody 5E4 interacted with a similar fast-migrating band, corresponding to rough lipopolysaccharide, from all 17 serotype strains and all 14 clinical isolates of P . aeruginosa . Similarly, iodinated goat anti-mouse immunoglobulin was used to detect the binding of monoclonal antibody 8A1 to a fast-migrating band on Western electrophoretic blots of purified lipopolysaccharides from Klebsiella pneumoniae and both smooth and rough strains of E . coli, Salmonella typhimurium, and S . minnesota . These results suggest considerable conservation of single antigenic sites in the lipid A of gram-negative bacteria.

Plasmid, 1984 Sep, 12(2), 91 - 102
Restriction map of an agropine-type Ri plasmid and its homologies with Ti plasmids; Jouanin L; The Ri plasmid of an agropine-type Agrobacterium rhizogenes, strain HRI, was cloned in a cosmid and mapped with the restriction endonucleases BamHI, EcoRI, KpnI, SmaI, and XbaI . This plasmid is almost identical to pRi1855 and pRiA4b . A study by Southern hybridizations of the homologies with octopine pTiB6806 and nopaline pTiC58 makes it possible to propose the localization of certain functions on this plasmid, such as virulence, agropine catabolism, agropine synthesis, and the origin of replication.

Plasmid, 1984 Sep, 12(2), 111 - 8
Design and development of amplifiable broad-host-range cloning vectors: analysis of the vir region of Agrobacterium tumefaciens plasmid pTiC58; Close TJ et al.; The construction of a set of new plasmids that are suitable as general cloning vectors in Escherichia coli and Agrobacterium tumefaciens is described . Plasmid pUCD2 is amplifiable in E . coli, replicates in a wide range of gram-negative hosts and contains a number of useful restriction endonuclear cleavage sites and antibiotic resistance genes . This includes unique sites for KpnI, SacI, SacII, PstI, ClaI, SalI, EcoRV, and PvuII and the genes for resistance to kanamycin, tetracycline, ampicillin, and spectinomycin/streptomycin . Derivatives of pUCD2 include pUCD4, which has a unique XbaI site and the cosmid pUCD5, which also contains a unique EcoRI site . Two smaller plasmids pUCD9P and pUCD9X, contain many of the same unique sites as pUCD2 and pUCD4, but carry only the pBR322 replication origin and therefore do not display the extensive host-range of pSa . These plasmids were used to isolate and manipulate fragments of the A . tumefaciens pTiC58 plasmid in both E . coli and A . tumefaciens . Fragments from the virulence (vir) region of pTiC58 inserted immediately upstream of the spectinomycin resistance gene of pUCD2 resulted in spectinomycin resistance levels that varied greatly depending on the particular fragment and its orientation of insertion . Using this property we find that a major portion of the vir region of pTiC58 is transcribed in A . tumefaciens and E . coli from left to right toward the T region.

J Biol Chem, 1984 Aug 10, 259(15), 9704 - 10
Agrocinopine A, a tumor-inducing plasmid-coded enzyme product, is a phosphodiester of sucrose and L-arabinose; Ryder MH et al.; Opines are unusual compounds found specifically in plant crown gall tumors . Genes for their synthesis and catabolism reside in agrobacteria as tumor-inducing (Ti) plasmid DNA . Only a small Ti-plasmid segment (24 kilobase pairs), the T-DNA, is transferred to the plant cell where it commonly codes for enzymes involved in the biosynthesis of nitrogenous opines such as nopaline (N2-(1,3-D-dicarboxypropyl)-L-arginine) as well as the tumor phenotype . Ellis and Murphy, (Ellis, J.G., and Murphy, P.J . (1981) Mol . Gen . Genet . 181, 36-43) reported the existence of the phosphorylated opines, agrocinopines A and B in tumors containing nopaline . Pure agrocinopine A has now been isolated in a yield of 0.05-0.06 g/100 g, fresh weight, from such tumors . Physical, chemical, and biological data establish the structure of agrocinopine A as an unusual non-nitrogenous opine of sucrose and L-arabinose with a phosphodiester linkage from the 2-hydroxyl of the arabinose to the 4-hydroxyl of the fructose moiety in sucrose . Agrocinopine B is the corresponding phosphodiester, in which the glucose has been hydrolyzed from the sucrose portion of agrocinopine A . Borohydride reduction of the free L-arabinose anomeric carbon of agrocinopine A, to the corresponding arabinitol derivative eliminates the characteristic inhibition zone enhancement produced by both agrocinopines A and B in the agrocin 84 (a fraudulent adenine nucleotide) bioassay . Because of the limited number of genes in the T-DNA, a generalization is proposed, whereby all opines will be found to comprise two common plant cell constituents linked in an uncommon manner by the minimum number of enzymes.

Radioisotopes, 1984 Aug, 33(8), 543 - 6
Detection of tumor-inducing plasmid DNA sequence in Agrobacterium tumefaciens by DNA-DNA hybridization; Furukawa K et al.; Absence of plasmid DNA sequences in non-tumorigenic (crown gall tumor) strains of Agrobacterium tumefaciens was confirmed by DNA-DNA hybridization between purified tumor-inducing (Ti) plasmid DNAs isolated from the progenitor tumorigenic strains and 3H-labeled whole cell DNAs from tumorigenic strains and their non-tumorigenic derivatives . The genes controlling tumorigenicity in plant and utilizability of nopaline as their sole nitrogen source were confirmed to locate on Ti-plasmids.

Can J Microbiol, 1984 Aug, 30(8), 1030 - 7
Adsorption of tumorigenic Agrobacterium tumefaciens cells to susceptible potato tuber tissues; Pueppke SG et al.; Cells of tumorigenic Agrobacterium tumefaciens strain B6 were labeled with {35S}methionine and used to estimate bacterial adsorption to potato tuber discs . After 10 min at pH 7.2, about 5 X 10(5) bacteria adsorb to each 9.0-mm disc . Lengthening the incubation period to 90 min increases adsorption to about 11 X 10(5) bacteria per disc . Bacterial adsorption is reduced under both alkaline and acid pH conditions and increases 2.3-fold if the number of bacterial cells in the inoculum is doubled . Adsorption is increased if citrus pectin, polygalacturonic acid, or demethylated pectin is included in the inoculum; methylated polygalacturonic acid is inactive . The activity of citrus pectin is abolished, however, if the compound is applied to the discs as a pretreatment and then removed prior to inoculation . Lipopolysaccharide preparations from five of six A . tumefaciens strains have no effect on bacterial adsorption . The sixth preparation, from nontumorigenic strain NT-1, reduces adsorption by about 20%.

Biochem J, 1984 Aug 1, 221(3), 891 - 5
Enhanced 3-methoxytyramine levels in crown gall tumours and other undifferentiated plant tissues; Mitchell SD et al.; An amine, after dansylation, has been isolated from Nicotiana tabacum crown gall tumours for the first time and characterized as 4-hydroxy-3-methoxy-beta-phenylethylamine (3-methoxytyramine) . The compound cannot be detected in differentiated N . tabacum tissues but appears in the corresponding callus controls . Its concentration is further increased 5-42-fold when N . tabacum is transformed with all strains of Agrobacterium tumefaciens so far tested.

Proc Natl Acad Sci U S A, 1984 Aug, 81(16), 5071 - 5
Crown gall oncogenesis: evidence that a T-DNA gene from the Agrobacterium Ti plasmid pTiA6 encodes an enzyme that catalyzes synthesis of indoleacetic acid; Thomashow LS et al.; Stable incorporation of tumor-inducing (Ti) plasmid sequences, the T-DNA, into the genomes of dicotyledonous plants results in the formation of crown gall tumors . Previous genetic studies have suggested that the products of the genes encoding transcripts 1 and 2, which are encoded by the TL-DNA region of pTiA6, are responsible for inducing the auxin-independent phenotype of crown gall tissues . Here we report the construction of a plasmid, pMTlacT2, which directs the synthesis of the Mr 49,800 polypeptide encoded by the transcript 2 gene . Cell-free extracts prepared from Escherichia coli harboring this plasmid converted indoleacetamide to indoleacetic acid, the natural auxin of plants; extracts prepared from plasmidless strains of E . coli or strains harboring the cloning vehicle pBR322 did not carry out this reaction . We conclude that the transcript 2 gene of pTiA6 codes for an enzyme that participates in auxin biosynthesis, probably an indoleacetamide hydrolase.

Nature, 1984 Jul 12-18, 310(5973), 115 - 20
Light-inducible and chloroplast-associated expression of a chimaeric gene introduced into Nicotiana tabacum using a Ti plasmid vector; Herrera-Estrella L et al.; A chimaeric gene, consisting of the 5'-flanking region of a member of the Pisum sativum gene family encoding ribulose 1,5-bisphosphate carboxylase linked to the coding region of a bacterial chloramphenicol acetyltransferase gene, has been introduced into the genome of the plant Nicotiana tabacum using a Ti plasmid of Agrobacterium tumefaciens . The expression of the chimaeric gene is light-inducible in chloroplast-containing transformed tissue.

Biochemistry, 1984 Jul 3, 23(14), 3287 - 90
Structure and synthesis of histopine, a histidine derivative produced by crown gall tumors; Bates HA et al.; Histopine, an unusual amino acid derivative of histidine isolated from crown gall tumors of sunflowers (Helianthus annus) inoculated with Agrobacterium tumefaciens strain B6, was previously assigned the gross structure N-(1-carboxyethyl) histidine (2) . A diastereomeric mixture containing histopine (2a and 2b) was readily prepared by reductive alkylation of (S)-histidine (1) with pyruvic acid and sodium cyanoborohydride . The individual diastereomers were prepared by reaction of (S)-histidine with (R)- and (S)-2-bromopropionic acid . (R)-N-(1-Carboxyethyl)-(S)-histidine (2a) supports the growth of A . tumefaciens whereas (S)-N-(1-carboxyethyl)-(S)-histidine (2b) is inactive . Therefore, we assign structure 2a to histopine.

EMBO J, 1984 Jul, 3(7), 1525 - 31
Transcription of a zein gene introduced into sunflower using a Ti plasmid vector; Matzke MA et al.; A maize genomic clone containing a zein gene (Z4) was inserted into the T-region of the T37 Ti plasmid . Agrobacterium tumefaciens cells carrying this modified Ti plasmid were used to inoculate sunflower stemlets . Callus tissue active in nopaline synthesis was grown from a single transformed cell . DNA analysis of this tissue showed that the zein gene plus T-DNA was present in approximately 12 copies per diploid sunflower genome . A 1000 +/- 100 base RNA homologous to a zein probe could be isolated from the engineered sunflower tissue and the 5' end of this RNA was determined by S1 nuclease mapping . Two transcription start sites were detected . The positions of these transcription start sites and the ratio of the amounts of the two transcripts are identical for the Z4 gene in sunflower and in maize endosperm . Although the zein RNA isolated from the engineered sunflower tissue could be translated in a wheat germ system to yield an immuno-precipitable protein of the expected mol . wt., the presence of the zein protein in the sunflower tissue could not be demonstrated.

Cell, 1984 Jul, 37(3), 959 - 67
Transformation of several species of higher plants by Agrobacterium rhizogenes: sexual transmission of the transformed genotype and phenotype; Tepfer D; The T-DNA of the Ri plasmid from Agrobacterium rhizogenes is compatible with the regeneration of whole plants from genetically transformed roots and is transmitted through meiosis to the progeny of genetically transformed plants in carrot, tobacco, and morning glory (Convolvulus arvensis) . The presence of Ri T-DNA is correlated with a phenotype that in some respects is invariable from species to species and in other respects varies as a function of species, organ clone within species, or individual . The transformed phenotype concerns a variety of morphological and physiological traits, is dominantly inherited in tobacco, but does not in general appear to be deleterious . The Ri T-DNA may provide a molecular starting point for studying a number of basic phenomena in plant morphology and physiology.

Mol Biol Rep, 1984 Jul, 10(1), 49 - 55
Mapping of promoter-proximal regions by in vitro transcription of two Agrobacterium tumefaciens Ti-plasmids; Risuelo G et al.; Transcription initiation sites were mapped on both the octopine pTi Ach5 and the nopaline pTI C58 plasmids of Agrobacterium tumefaciens . Transcription ternary complexes were subjected to electrophoresis on agarose gels, prior and/or subsequent to restriction endonuclease digestion of the DNA template, evidenced by autoradiography and located on the restriction maps of the two tumor-inducing plasmids . A . tumefaciens RNA polymerase promptly recognizes and starts transcription on a few sequences which include the T-DNA.

J Bacteriol, 1984 Jul, 159(1), 1 - 8
Characterization of transposon Tn5-facilitated donor strains and development of a chromosomal linkage map for Agrobacterium tumefaciens; Pischl DL et al.; We have further characterized the transposon Tn5-facilitated chromosomal gene transfer system developed for Agrobacterium tumefaciens 15955 . Using a strain whose chromosome contained Tn5, we compared the chromosome-mobilizing ability of plasmid pDP37 (containing Tn5) with that of its parent plasmid R68.45 . For R68.45, we observed nonpolar transmission from multiple origins . For pDP37 we found polarized transmission from a single origin near ilv . When we examined the transmission gradients of a number of pDP37-containing donor strains each differing at the site of the chromosomal insertion we found just two classes . One set of donors transmitted markers with a gradient of Ilv+ greater than Rifr greater than His+ greater than Met+, whereas the second set transferred His+ greater than Rifr greater than Ilv+ greater than Met+ . Using representatives from each transmission class of donor strains, we conducted matings to measure the degree of linkage between pairs of adjacent donor markers . From this information we developed a map of the A . tumefaciens 15955 chromosome . Attempts to isolate R-prime plasmids or Hfr-like donors were unsuccessful.

Biochimie, 1984 Jul-Aug, 66(7-8), 547 - 56
Cloning and expression in Escherichia coli of the TL-DNA gene 4 of Agrobacterium tumefaciens under the control of the PR promoter of bacteriophage lambda; Sibold L et al.; A plasmid was constructed that directs expression of the TL-DNA gene 4 protein in E . coli . The different steps of the construction were as follows: i) a region of gene 4 encoding the amino-terminal portion of the protein was fused in frame to DNA encoding an enzymatically active carboxy-terminal fragment of beta-galactosidase . The hybrid gene was poorly expressed from the upstream lambda PL promoter carried by the vector . ii) in order to generate an efficient procaryotic ribosome binding site, a DNA fragment carrying the lambda PR promoter with the nearby Shine-Dalgarno (SD) sequence of gene cro was placed in front of the gene 4-lacZ fusion . A recombinant plasmid, termed pGV793, that expressed efficiently a fused protein 4-beta-galactosidase was identified among the Lac+ clones . DNA sequencing analysis showed that pGV793 carried a hybrid ribosome binding site composed of the cro SD sequence, a five bp sequence and the ATG codon of gene 4 . Plasmid pGV793 directed the synthesis of three polypeptides of molecular weight 132 Kd, 126 Kd and 122 Kd that carried beta-galactosidase antigenic determinants . The largest polypeptide had the expected size for the hybrid protein . The fusion proteins which accounted for about 0.5% of the total cellular proteins were purified by immunoadsorption using anti-beta-galactosidase antiserum . iii) the complete gene 4 coding sequence was reconstituted, with the lambda PR promoter in place . The resulting pGV822 plasmid expressed a polypeptide whose molecular weight 27 Kd corresponded to the expected size for the gene 4 product . The pI was about 7.

Biochem Biophys Res Commun, 1984 Jun 15, 121(2), 471 - 7
Comparative study of the DNA-binding HU-type proteins from slow growing and fast growing strains of Rhizobiaceae; Khanaka H et al.; The DNA-binding HU-type proteins have been isolated from two very different strains of Rhizobiaceae : Agrobacterium tumefaciens and Rhizobium japonicum . These proteins have been called HAt and HRj respectively . Their electrophoretic mobility on polyacrylamide gel, amino acid composition and crossed immunoreactivity have been compared to that of the homologous protein isolated from Rhizobium meliloti: the protein HRm . The proteins HAt and HRm show close similarities whereas the protein HRj differs markedly from the two others . The physico-chemical characteristics of the HU-type proteins from these Rhizobiaceae are in good agreement with the respective position of these bacteria in the taxonomy.

What Is Cell Biology?, What Is Environmental Microbiology?, What Is Anthrax?, What Is Biofilm?, What Is Biotechnology?, i, Bacteriology, o, Microorganism, r, Microbiology, c, Bacterium, i, Microbe, a, Antimicrobial, e, Antibiotics, c, Streptococci, i, Clostridia, s, Biofilms, r, Escherichia coli, o, Streptococci, i, Escherichia coli, o, Suspension cells, r, Campylobacter, o, Escherichia coli, c, Suspension cells, c, Bacteriophages, r, Microbiological, r, Citrobacter, r, Antimicrobials, a, Salmonella, e, Escherichia coli, a, S. cerevisiae, n, Microbiological, s, Bacillus subtilis

Scientific Publications - Work Done by Microbiology Reader Bioscreen C
Agricultural Microbiology Anaerobic Microbiology Antimicrobial Susceptibility Artificial Atmosphere Bioassay of Antibiotics Biofilm Microbiology Bioreactor Technology Biotechnology Cell Biology Clinical Microbiology Environmental Microbiology Experiments with Yeast	Fermentation Food Microbiology Functional Genomics Gene Technology Growth Media Development Growth Rate and Lag Time Industrial Microbiology Medical/Pharmaceutical Field Microbiological Assay Microbiological Research Microbiology of Cosmetics go to a specific theme...	Military Microbiology Molecular Microbiology Mutagenicity and Genotoxicity Oral Microbiology Patents Postantibiotic Studies Soil Microbiology Spore Microbiology Veterinary Microbiology Waste/Wastewater Treatment Water Microbiology Wine Microbiology

� 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com

Last modified: May 25, 2005