Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us


Int J Syst Evol Microbiol, 2005 Jan, 55(Pt 1), 335 - 9
Photobacterium lipolyticum sp . nov., a bacterium with lipolytic activity isolated from the Yellow Sea in Korea; Yoon JH et al.; A Gram-negative, motile, non-spore-forming, pleomorphic and lipolytic bacterial strain, M37(T), was isolated from an intertidal sediment of the Yellow Sea in Korea . This organism grew optimally at 25-28 degrees C and in the presence of 1-2 % NaCl . It did not grow without NaCl or in the presence of more than 6 % NaCl . Strain M37(T) was characterized chemotaxonomically by having Q-8 as the predominant respiratory lipoquinone and C(16 : 1)omega7c and/or iso-C(15 : 0) 2-OH and C(16 : 0) as the major fatty acids . The DNA G+C content was 47 mol% . Phylogenetic analyses based on 16S rRNA gene sequences placed strain M37(T) within the clade comprising Photobacterium species, forming a coherent cluster with the type strains of Photobacterium profundum and Photobacterium indicum (16S rRNA gene similarity levels of 97.5-98.0 %) . The mean DNA-DNA relatedness levels between strain M37(T) and P . profundum JCM 10084(T) and P . indicum DSM 5151(T) were in the range 12-15 % . Similarities between 16S rRNA gene sequences of strain M37(T) and those of the type strains of the other Photobacterium species ranged from 93.9 % (with Photobacterium fischeri) to 96.2 % (with Photobacterium phosphoreum) . On the basis of phenotypic properties and phylogenetic and genomic distinctiveness, strain M37(T) (=KCTC 10562BP(T)=DSM 16190(T)) should be placed in the genus Photobacterium as a novel species, for which the name Photobacterium lipolyticum sp . nov . is proposed.

J Huazhong Univ Sci Technolog Med Sci, 2004, 24(5), 507 - 9
Dark variants of luminous bacteria whole cell bioluminescent optical fiber sensor to genotoxicants; Sun Y et al.; A stable dark variant separated from photobacterium phosphoreum (A2) was fixed in agar-gel membrane and immobilized onto an exposed end of a fiber-optic linked with bioluminometer . The variant could emit a luminescent signal in the presence of genotoxic agents, such as Mitomycin C (MC) . The performance of this whole-cell optical fiber sensor system was examined as a function of several parameters, including gel probe thickness, bacterial cell density, and diameter of the fiber-optic core and working temperature . An optimal response to a model genotoxicant, Mitomycin C, was achieved with agar-bacterial gel membrane: the thickness of gel membrane was about 5 mm; the cell density of bacteria in gel membrane was about 2.0 x 10(7)/ml; the diameter of fiber-optic core was 5.0 mm; the working temperature was 25 degrees C . Under these optimized conditions, the response time was less than 10 h to Mitomycin C, with a lower detection threshold of 0.1 mg/L.

Biochem Biophys Res Commun, 2005 Jan 21, 326(3), 539 - 47
Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum; Lin JW et al.; The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified . Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No . AY787792) from P . phosphoreum has been determined, and the encoded beta-lactamase is deduced . The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35) . There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21) . The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found . The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions . Functional analysis elicits that R&R({ampC}) does function to lead to the gene expression . Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P({I})-promoter should be the promoter response for the gene expression . Analysis of the R&R({ampC}) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA . It implies that P . phosphoreum ampC gene could be under-regulated by the specific two-component regulator.

Dis Aquat Organ, 2004 Oct 21, 61(1-2), 33 - 9
Characterization of the 23S and 5S rRNA genes and 23S-5S intergenic spacer region (ITS-2) of Photobacterium damselae; Osorio CR et al.; The 23S ribosomal RNA (rRNA) gene has been sequenced in strains of the fish pathogens Photobacterium damselae subsp . damselae (ATCC 33539) and subsp . piscicida (ATCC 29690), showing that 3 nucleotide positions are clearly different between subspecies . In addition, the 5S rRNA gene plus the intergenic spacer region between the 23S and 5S rRNA genes (ITS-2) were amplified, cloned and sequenced for the 2 reference strains as well as the field isolates RG91 (subsp . damselae) and DI21 (subsp . piscicida) . A 100% similarity was found for the consensus 5S rRNA gene sequence in the 2 subspecies, although some microheterogeneity was detected as inter-cistronic variability within the same chromosome . Sequence analysis of the spacer region between the 23S and 5S rRNA genes revealed 2 conserved and 3 variable nucleotide sequence blocks, and 4 different modular organizations were found . The ITS-2 spacer region exhibited both inter-subspecies and intercistronic polymorphism, with a mosaic-like structure . The EMBL accession numbers for the 23S, 5S and ITS-2 sequences are: P . damselae subsp . piscicida 5S gene (AJ274379), P . damselae subsp . damselae 23S gene (Y18520), subsp . piscicida 23S gene (Y17901), P . damselae subsp . piscicida ITS-2 (AJ250695, AJ250696), P . damselae subsp . damselae ITS-2 (AJ250697, AJ250698).

Int J Syst Evol Microbiol, 2004 Nov, 54(Pt 6), 2113 - 6
Transfer of Hyphomicrobium indicum to the genus Photobacterium as Photobacterium indicum comb . nov; Xie CH et al.; Hyphomicrobium indicum Johnson and Weisrock 1969 lacks true budding and hyphal branching, and some phenotypic characteristics are in contrast to other true hyphomicrobia . The major quinone system (ubiquinone Q-8), the G+C content of the DNA (40 mol%) and the cellular fatty acid composition (16 : 0, 16 : 1 and 18 : 1 as the major components, and 12 : 0 3-OH and 14 : 0 3-OH as the hydroxy fatty acids) of H . indicum are different from the genus Hyphomicrobium, but similar to the genus Photobacterium . Like the marine bacteria Photobacterium, H . indicum can be tolerant of sea water, while Hyphomicrobium cannot . Phylogenetic analyses of 16S rRNA and gyrB gene sequences revealed that H . indicum is most closely related to the genus Photobacterium of the gamma-Proteobacteria . Based on the phylogenetic, phenotypic and chemotaxonomic evidence, the results indicate that H . indicum should be transferred to the genus Photobacterium, and the name Photobacterium indicum comb . nov . (type strain, NBRC 14233(T)=ATCC 19614(T)) is proposed.

J Appl Toxicol, 2004 Sep-Oct, 24(5), 349 - 53
Toxicity detection from EILATox-Oregon Workshop samples by using kinetic photobacteria measurement: the Flash method; Hakkila K et al.; The Flash test, which can be used to measure the toxicity from clear, turbid and coloured samples with identical protocol, was used in the EILATox-Oregon Workshop . During the workshop, 17 synthetic samples and three environmental samples were tested . In the Flash method the photobacteria Vibrio fischeri are initially dispensed on top of the sample and the light output of the bioluminescence reaction is recorded at a rate of several readings per second . The change in the light production was measured at two points: 30 s and 30 min after exposure at room temperature . Toxicity calculations were done by using either the peak height of the sample or the peak height of the control sample (maximum signal at 0-2 s) . When the peak height of the sample is used as a reference, the colour and turbidity effect of solid particles are taken into account throughout the whole measurement period . In the EILATox-Oregon Workshop toxicity was seen in samples 1 (chlordimeform), 4 (phosdrin), 5 (HgCl(2)), 6 (sodium arsenite), 8 (metham sodium), 12 (p-chlorophenol), 14 (sodium selenite) and 17 (MNNG) . Only samples 1, 4 and 12 showed different ec(50) values between different calculations of toxicity . The ec(50) values were calculated and compared with the ec(50) values of Microtox derived from the literature . The Flash test will not replace the standardized photobacteria test, but is the advanced version of it and is needed when the sample matrix is complex and when speed and low costs are required . Copyright (c) 2004 John Wiley & Sons, Ltd.

Yakugaku Zasshi, 2004 Oct, 124(10), 699 - 703
{Effect of glucose on luciferase expression in Photobacterium leiognathi}; Watanabe T et al.; Photobacterium leiognathi cultured in marine broth emits a luminescence that is temporarily enhanced and then extinguished by glucose . Glucose reduces the luciferase level and the expression of lux ABG mRNA in P . leiognathi . The amount of ATP in P . leiognathi is temporarily increased and then declines to the normal level . These results indicate that the extinguishing by glucose in P . leiognathi is induced by the interruption of the translation of luciferase.

J Microbiol, 2004 Sep, 42(3), 194 - 9
Coregulation of lux genes and riboflavin genes in bioluminescent bacteria of Photobacterium phosphoreum; Sung ND et al.; Investigation of the expression of the riboflavin (rib) genes, which are found immediately downstream of luxG in the lux operon in Photobacterium phosphoreum, provides more information relevant to the evolution of bioluminescence, as well as to the regulation of supply of flavin substrate for bacterial bioluminescence reactions . In order to answer the question of whether or not the transcriptions of lux and rib genes are integrated, a transcriptional termination assay was performed with P . phosphoreum DNA, containing the possible stem-loop structures, located in the intergenic region of luxF and luxE (OmegaA), of luxG and ribE (OmegaB), and downstream of ribA (OmegaC) . The expression of the CAT (Chloramphenicol Acetyl Transferase) reporter gene was remarkably decreased upon the insertion of the stem-loop structure (OmegaC) into the strong lux promoter and the reporter gene . However, the insertion of the structure (OmegaB) into the intergenic region of the lux and the rib genes caused no significant change in expression from the CAT gene . In addition, the single stranded DNA in the same region was protected by the P . phosphoreum mRNA from the S1 nuclease protection assay . These results suggest that lux genes and rib genes are part of the same operon in P . phosphoreum .

Fish Shellfish Immunol, 2005 Jan, 18(1), 31 - 8
Influence of vaccination on the nitric oxide response of gilthead seabream following infection with Photobacterium damselae subsp . piscicida; Acosta F et al.; The nitric oxide (NO) response of vaccinated and non-vaccinated juvenile gilthead seabream was studied in vivo and the NO response of isolated kidney macrophages of fish was studied in vitro . Fish were vaccinated with formalin-killed Photobacterium damselae subsp . piscicida (Pdp) with or without Freund's incomplete adjuvant (FIA) and control fish received phosphate buffered saline (PBS) . Thirty days later, fish were injected with a sublethal dose of Pdp and 3 fish/group were bled at time periods thereafter and serum nitrite and citrulline levels were determined as a measure of the NO response . All infected groups showed an increase in NO metabolites from 6h to 27 days, with peak levels at 24 h . However, the response in bacterin-vaccinated fish was significantly higher than in the non-vaccinated group and the bacterin plus FIA resulted in a further significant enhancement . Similarly enhanced NO responses were produced in vitro by isolated macrophages obtained from vaccinated compared with non-vaccinated fish 30 days after vaccination following infection, with the response in macrophages from fish vaccinated with the bacterin plus FIA being significantly higher than those from fish vaccinated with the bacterin alone . Thus, vaccination resulted in an enhanced NO response to infection with Pdp in vivo and in vitro . Furthermore, the level of protection of fish to experimental challenge with virulent Pdp correlated with the level of the NO responses in the different groups.

Int J Syst Evol Microbiol, 2004 Sep, 54(Pt 5), 1773 - 88
Phylogenetic relationships among marine Alteromonas-like proteobacteria: emended description of the family Alteromonadaceae and proposal of Pseudoalteromonadaceae fam . nov., Colwelliaceae fam . nov., Shewanellaceae fam . nov., Moritellaceae fam . nov., Ferrimonadaceae fam . nov., Idiomarinaceae fam . nov . and Psychromonadaceae fam . nov; Ivanova EP et al.; The phylogenetic relationships among marine Alteromonas-like bacteria of the genera Alteromonas, Pseudoalteromonas, Glaciecola, Thalassomonas, Colwellia, Idiomarina, Oceanimonas, Oceanisphaera, Shewanella, Moritella, Ferrimonas, Psychromonas and several other genera of the 'Gammaproteobacteria' were studied . Results of 16S rRNA gene sequence analyses revealed that some members of these genera formed several coherent groups at the family level . Characteristic signature oligonucleotides for studied taxa were defined . Signature positions are divided into three classes: (i) single compensatory mutations, (ii) double compensatory mutations and (iii) mutations affecting nucleotides not paired in the secondary structure . The 16S rRNA gene sequence similarity level within genera was 93 % or above . This value can be a useful additional criterion for genus discrimination . On the basis of this work and previous polyphasic taxonomic studies, the circumscription of the family Alteromonadaceae is limited to the genera Alteromonas and Glaciecola and the creation is proposed of the families Pseudoalteromonadaceae fam . nov . to accommodate bacteria of the genera Pseudoalteromonas and Algicola gen . nov . (formerly Pseudoalteromonas bacteriolytica) and Colwelliaceae fam . nov . to accommodate bacteria of the genera Colwellia and Thalassomonas . Bacteria of the genera Oceanimonas and Oceanisphaera formed a robust cluster and shared common signature oligonucleotides . Because of deep branching and lack of association with any other genus, the following families are proposed that include single genera: Idiomarinaceae fam . nov., Psychromonadaceae fam . nov., Moritellaceae fam . nov., Ferrimonadaceae fam . nov . and Shewanellaceae fam . nov . Finally, this study also revealed that {Hyphomicrobium} indicum should be reclassified as Photobacterium indicum comb . nov.

Microbiol Mol Biol Rev, 2004 Sep, 68(3), 403 - 31, table of contents
Biodiversity of vibrios; Thompson FL et al.; Vibrios are ubiquitous and abundant in the aquatic environment . A high abundance of vibrios is also detected in tissues and/or organs of various marine algae and animals, e.g., abalones, bivalves, corals, fish, shrimp, sponges, squid, and zooplankton . Vibrios harbour a wealth of diverse genomes as revealed by different genomic techniques including amplified fragment length polymorphism, multilocus sequence typing, repetetive extragenic palindrome PCR, ribotyping, and whole-genome sequencing . The 74 species of this group are distributed among four different families, i.e., Enterovibrionaceae, Photobacteriaceae, Salinivibrionaceae, and Vibrionaceae . Two new genera, i.e., Enterovibrio norvegicus and Grimontia hollisae, and 20 novel species, i.e., Enterovibrio coralii, Photobacterium eurosenbergii, V . brasiliensis, V . chagasii, V . coralliillyticus, V . crassostreae, V . fortis, V . gallicus, V . hepatarius, V . hispanicus, V . kanaloaei, V . neonatus, V . neptunius, V . pomeroyi, V . pacinii, V . rotiferianus, V . superstes, V . tasmaniensis, V . ezurae, and V . xuii, have been described in the last few years . Comparative genome analyses have already revealed a variety of genomic events, including mutations, chromosomal rearrangements, loss of genes by decay or deletion, and gene acquisitions through duplication or horizontal transfer (e.g., in the acquisition of bacteriophages, pathogenicity islands, and super-integrons), that are probably important driving forces in the evolution and speciation of vibrios . Whole-genome sequencing and comparative genomics through the application of, e.g., microarrays will facilitate the investigation of the gene repertoire at the species level . Based on such new genomic information, the taxonomy and the species concept for vibrios will be reviewed in the next years.

Biochem J, 2005 Jan 15, 385(Pt 2), 575 - 80
Random mutagenesis of bacterial luciferase: critical role of Glu175 in the control of luminescence decay; Hosseinkhani S et al.; Bacterial luciferases (LuxAB) can be readily classed as slow or fast decay luciferases based on their rates of luminescence decay in a single turnover assay . Luciferases from Vibrio harveyi and Xenorhabdus (Photorhabdus) luminescens have slow decay rates, and those from the Photobacterium genus, such as Photobacterium fisheri, P . phosphoreum and P . leiognathi, have rapid decay rates . By substitution of a 67-amino-acid stretch of P . phosphoreum LuxA in the central region of the LuxA subunit, the 'slow' X . luminescens luciferase was converted into a chimaeric luciferase with a significantly more rapid decay rate {Valkova, Szittner and Meighen (1999) Biochemistry 38, 13820-13828} . To understand better the role of specific residues in the classification of luciferases as slow and fast decay, we have conducted random mutagenesis on this region . One of the mutants generated by a single mutation on LuxA at position 175 {E175G (Glu175-->Gly)} resulted in the 'slow decay' X . luminescens luciferase being converted into a luciferase with a significantly more rapid decay rate . These results indicate the importance of Glu175 in LuxA as a critical residue for differentiating between 'slow' and 'fast' luciferases and show that this distinction is primarily due to differences in aldehyde affinity and in the decomposition of the luciferase-flavin-oxygen intermediate.

Fish Shellfish Immunol, 2004 Nov, 17(5), 411 - 35
Maternal transfer of humoral specific and non-specific immune parameters to sea bream (Sparus aurata) larvae; Hanif A et al.; Immunisation of sea bream (Sparus aurata L.) broodstock with a novel vaccine mixture of Photobacterium damsela subsp . piscicida SK7 (Phdp) was performed during the period of egg development and the changes in specific and non-specific humoral immune parameters were measured . Total immunoglobulin level, specific antibody titre, anti-protease activity and lysozyme activity were significantly higher in immunised parents compared to the control . After spawning significantly higher anti-protease activity, lysozyme activity and total immunoglobulin level were detected in the eggs from immunised parents . Specific antibody titres against Phdp were only detected in the eggs from the immunised parents . The larvae from immunised parents also expressed significantly higher levels of specific and non-specific humoral immune parameters compared to the controls . A small amount of total immunoglobulin was detected in larvae decreasing gradually until day 8 post-hatching and then an increase was measured in larvae from immunised parents, whereas no immunoglobulin was detected at days 4, 6 and 8 in larvae from non-immunised parents . The specific antibody titre against Phdp was detected only in larvae from immunised broodstock until day 14 post-hatching . The higher humoral immune parameters in eggs and larvae from immunised parents in comparison to eggs and larvae from non-immunised parents, suggest transfer of maternal specific and non-specific immune factors.

Acta Crystallogr D Biol Crystallogr, 1996 Jan, 52(Pt 1), 77 - 86
Structure of flavoprotein FP(390) from a luminescent bacterium Photobacterium phosphoreum refined at 2.7 A resolution; Kita A; The three-dimensional structure of a flavoprotein, FP(390), from a luminescent bacterium, Photobacterium phosphoreum, solved by the molecular-replacement method, was refined to an R factor of 24.0% for 17 433 independent reflections, from 6.0 to 2.7 A resolution, collected by synchrotron radiation . The asymmetric unit of the crystal (space group P4(3)22, a = b = 76.8 and c = 242 A) contains two monomer molecules related by a non-crystallographic twofold axis to form a dimer . There are two Q-flavin {flavin mononucleotide (FMN) with myristic acid} molecules in FP(390) monomer . One of them is located at the interface of dimer which is bound to both monomer and the another is at the molecular surface . The electron density of myristic acids of Q-flavins at the dimer interface in both monomer are weak and unclear, showing the possibility that the Q-flavins bound in this site are not a single species but a mixture of two components, 6-(3"-myristic acid)-FMN and 6-(4"- myristic acid)-FMN.

Appl Environ Microbiol, 2004 Aug, 70(8), 5010 - 8
Explorative multivariate analyses of 16S rRNA gene data from microbial communities in modified-atmosphere-packed salmon and coalfish; Rudi K et al.; Modified-atmosphere packaging (MAP) of foods in combination with low-temperature storage extends product shelf life by limiting microbial growth . We investigated the microbial biodiversity of MAP salmon and coalfish by using an explorative approach and analyzing both the total amounts of bacteria and the microbial group composition (both aerobic and anaerobic bacteria) . Real-time PCR analyses revealed a surprisingly large difference in the microbial loads for the different fish samples . The microbial composition was determined by examining partial 16S rRNA gene sequences from 180 bacterial isolates, as well as by performing terminal restriction fragment length polymorphism analysis and cloning 92 sequences from PCR products of DNA directly retrieved from the fish matrix . Twenty different bacterial groups were identified . Partial least-squares (PLS) regression was used to relate the major groups of bacteria identified to the fish matrix and storage time . A strong association of coalfish with Photobacterium phosphoreum was observed . Brochothrix spp . and Carnobacterium spp., on the other hand, were associated with salmon . These bacteria dominated the fish matrixes after a storage period . Twelve Carnobacterium isolates were identified as either Carnobacterium piscicola (five isolates) or Carnobacterium divergens (seven isolates), while the eight Brochothrix isolates were identified as Brochothrix thermosphacta by full-length 16S rRNA gene sequencing . Principal-component analyses and PLS analysis of the growth characteristics (with 49 different substrates) showed that C . piscicola had distinct substrate requirements, while the requirements of B . thermosphacta and C . piscicola were quite divergent . In conclusion, our explorative multivariate approach gave a picture of the total microbial biodiversity in MAP fish that was more comprehensive than the picture that could be obtained previously . Such information is crucial in controlled food production when, for example, the hazard analysis of critical control points principle is used.

Mol Biol (Mosk), 2004 May-Jun, 38(3), 507 - 14
{The effect of Clp proteins on DnaK-dependent refolding of bacterial luciferases}; Zavil'gel'skii GB et al.; A study was made of the refolding of bacterial luciferases of Vibrio fischeri, V . harveyi, Photobacterium phosphoreum, and Photorhabdus luminescens . By reaction rate, luciferases were divided into two groups . The reaction rate constants of fast luciferases of V . fischeri and Ph . phosphoreum were about tenfold higher than those of slow luciferases of Ph . luminescens and V . harveyi . The order of increasing luciferase thermostability was Ph . phosphoreum, V . fischeri, V . harveyi, and Ph . luminescens . The refolding of thermoinactivated luciferases completely depended on the active DnaK-DnaJ-GrpE chaperone system . Thermolabile fast luciferases of V . fischeri and Ph . phosphoreum showed highly efficient rapid refolding . Slower and less efficient refolding was characteristic of thermostable slow luciferases of V . harveyi and Ph . luminescens . Chaperones of the Clp family were tested for effect on the efficiency of DnaK-dependent refolding of bacterial luciferases in Escherichia coli cells . The rate and extent of refolding were considerably lower in the clpB mutant than in wild-type cells . In E . coli cells with mutant clpA, clpP, of clpX showed a substantially lower luciferase refolding after heat shock.

Environ Monit Assess, 2004 Jul, 95(1-3), 287 - 94
Comparative toxicological evaluation of untreated and treated tannery effluent with Nostoc muscorum L . (algal assay) and microtox bioassay; Chandra R et al.; The relative sensitivity of tannery effluent before and after treatment was compared by employing Nostoc muscorum and microtox assay in laboratory . The effect on chlorophyll, protein and biomass content of Nostoc muscorum was studied with the luminescent property inhibition of Photobacterium phosphorium and compared with algal bioassay . The results of microtox assay after 5, 15 and 30 min of exposure were compared with data obtained from algal bioassay . It was observed that the luminescent property of Photobacterium phosphorium in microtox assay as well as the chlorophyll content of Nostoc muscorum in algal assay were the most sensitive parameters in toxicity evaluation of tannery effluent . The microtox assay produced notably comparable EC50 values with that of algal bioassay . The microtox assay of toxicity showed that EC50 (%) in 30 min was 3.19 and 63.49 for untreated and treated tannery effluent, respectively while in algal bioassay the EC50 for chlorophyll was in between 0-2.5% and 100%, respectively, in untreated and treated effluent . More than 60% reduction of toxicity was noted in treated tannery effluent in both test system.

Clin Infect Dis, 2004 May 15, 38(10), e100 - 1 Epub 2004 Apr 23.
Fatal infection of the hand due to Photobacterium damsela: a case report; Asato J et al.; We report a case of fatal acute renal failure due to Photobacterium damsela infection of the hand . Although the patient received intensive medical care and surgical treatment, he died 8 h after arrival at the hospital . This is the first case of P . damsela sepsis proven by blood culture in Japan.

Int J Syst Evol Microbiol, 2004 May, 54(Pt 3), 919 - 24
Use of recA as an alternative phylogenetic marker in the family Vibrionaceae; Thompson CC et al.; This study analysed the usefulness of recA gene sequences as an alternative phylogenetic and/or identification marker for vibrios . The recA sequences suggest that the genus Vibrio is polyphyletic . The high heterogeneity observed within vibrios was congruent with former polyphasic taxonomic studies on this group . Photobacterium species clustered together and apparently nested within vibrios, while Grimontia hollisae was apart from other vibrios . Within the vibrios, Vibrio cholerae and Vibrio mimicus clustered apart from the other genus members . Vibrio harveyi- and Vibrio splendidus-related species formed compact separated groups . On the other hand, species related to Vibrio tubiashii appeared scattered in the phylogenetic tree . The pairs Vibrio coralliilyticus and Vibrio neptunius, Vibrio nereis and Vibrio xuii and V . tubiashii and Vibrio brasiliensis clustered completely apart from each other . There was a correlation of 0.58 between recA and 16S rDNA pairwise similarities . Strains of the same species have at least 94 % recA sequence similarity . recA gene sequences are much more discriminatory than 16S rDNA . For 16S rDNA similarity values above 98 % there was a wide range of recA similarities, from 83 to 99 %.

Fish Shellfish Immunol, 2004 Feb, 16(2), 107 - 16
The effect of growth medium salinity of Photobacterium damselae subsp . piscicida on the immune response of hybrid bass (Morone saxatilis x M . chrysops); Nitzan S et al.; Photobacterium damselae subsp . piscicida (P . damselae) was grown on various media and the effect of media salinity on certain immune responses of hybrid bass was studied . In Israel, pasteurellosis outbreaks have not been reported at water salinities below 1.38 per thousand . During vaccination experiments the salinity of the medium on which P . damselae is grown, was shown to affect stimulation of the immune system . No correlation was found between antibody response and protection . Bacterial envelopes separated by electrophoresis and subjected to western blot analysis revealed an antibody response against some protein bands . Band sequencing was performed to identify the protein stimulating the immune response . Sequence identity of 80% was seen in 10-amino-acid overlap of the 36-kDa band with a specific gene of alkalophilic Bacillus firmus . A preparation of P . damselae grown in a 2.5% NaCl medium at 25 degrees C is the most effective vaccine against pasteurellosis, providing hybrid bass with quite good protection.

Environ Technol, 2004 Feb, 25(2), 173 - 84
Ion trap LC/MS characterisation of toxic polar organic pollutants in colour photographic wastewaters and monitoring of their chemical degradation; Lunar L et al.; Liquid chromatography/electrospray ionisation-ion trap mass spectrometry (LC/ESI-ITMS) with positive mode of operation was successfully applied to the characterisation of aromatic amines and chelating agents in colour photographic wastewaters . In addition to residual ingredients, monomers and dimers of sulphonated aromatic amines were the main toxic polar organic pollutants found . Oxidation of wastewater components by the Fenton-like reagent (Fe3+ + H2O2) was investigated by continuously pumping a solution of hydrogen peroxide . Iron concentration, present in the wastewater as ferric carboxylate complexes, was typically above 1 g l(-1), and therefore addition of Fe3+ was not necessary for treatment . Operating variables like reagent feeding concentration and flowrate, temperature and pH were studied . The overall chemical oxygen demand (COD) removal reached 90% after 7.5 h of treatment when the dosage of hydrogen peroxide was 230 g per litre of effluent, the pH was about 4 and the temperature was 60 degrees C . The absence of toxics in the treated effluents was confirmed by the Photobacterium phosphoreum luminescence reduction test . Monitoring of the chemical degradation of aromatic amines and chelating agents by LC/ESI-ITMS proved that the Fenton's like reagent was effective in degrading them . Propylenediamine tetraacetic acid (PDTA) was found to be the more recalcitrant compound, however about 97% of degradation was achieved after 7.5 hours of treatment.

Fish Shellfish Immunol, 2004 May, 16(5), 581 - 8
Activation of the nitric oxide response in gilthead seabream after experimental infection with Photobacterium damselae subsp . piscicida; Acosta F et al.; Inoculation of small gilthead seabream (Sparus aurata) (30-75 g body weight) with a sublethal dose of different Photobacterium damselae subsp . piscicida (Pdp) strains (DI-21 and 94/99) induced an increase in serum concentrations of stable nitric oxide (NO) metabolites lasting from 6 h to six days post-infection, with a peak at 24 h . In contrast, no such response was detected in larger fish (150-600 g) . Since the virulence of Pdp correlates with the presence of a polysaccharide capsular layer which can be induced by growing the bacteria in medium supplemented with 1% glucose (C+ forms), the effect of the presence of an enhanced capsular layer on the NO response in small fish was also evaluated . Although, all bacteria induced a similar rapid (6 h) and sustained (up to six days) NO response, serum concentrations of nitrites and citrulline were significantly increased in fish infected with the Pdp strains grown in glucose-supplemented medium . When the NO response of fish infected with the C+ form of Pdp was blocked by prior injection of the inhibitor L-NAME, the LD(50) was reduced by over 10-fold and the mean time to death was also markedly reduced . Considering that (i) pasteurellosis only affects gilthead seabream with body weights below 100 g; (ii) capsulated Pdp are more resistant to the bactericidal action of NO and peroxynitrites than non-capsulated strains; and (iii) blocking the NO response of the fish results in greater susceptibility to Pdp, it seems reasonable to propose that the sustained NO response reported in this study represents a relevant protective mechanism of juvenile gilthead seabream against pasteurellosis.

Dis Aquat Organ, 2004 Mar 10, 58(2-3), 151 - 6
Identification and characterisation of the fur genes in Photobacterium damselae ssp . piscicida and ssp . damselae; Juiz-Rio S et al.; The gene encoding the ferric uptake regulator protein (fur gene) of the fish pathogenic bacterium Photobacterium damselae ssp . piscicida Strain D121 was partially amplified using degenerate oligonucleotides . Complete sequencing of the fur gene and neighbouring DNA was accomplished by primer walking . An open reading frame of 447 bp, coding for a protein of 148 amino acids, and with high homology to previously described Fur proteins, was identified . The fur gene of P . damselae ssp . damselae ATCC 35083 was subsequently amplified by PCR with specific primers and its sequence determined, showing a 99.3% similarity to the P . damselae ssp . piscicida fur gene . The P . damselae fur gene was able to complement the fur mutation of Escherichia coli Strain H1681 in an iron-dependent fashion.

Environ Toxicol, 2004 Jun, 19(3), 161 - 78
Chemical speciation and toxicity of metals assessed by three bioluminescence-based assays using marine organisms; Deheyn DD et al.; Metal toxicity is a function of the biology of the target organism and the chemical speciation of the metal . The toxicity of 11 metals was assessed with three cell-based bioassays based on marine organisms: the bacterium Photobacterium phosphoreum of the Microtox bioassay, an environmental strain of P . phosphoreum, and photocytes isolated from the brittlestar Ophiopsila californica . Metal speciation was calculated for three commonly used media: NaCl-based Microtox bioassay medium, artificial seawater glycerol, and artificial seawater . Decreased bioluminescence was considered a proxy for cell toxicity . In all three assays the elements Cd and Hg exhibited similar speciation as well as similar toxicity profiles . The element Cu was toxic in all three assays despite different metal speciation for the P . phosphoreum bioassay . The element Ag was toxic to both bacterial strains but not to photocytes despite a similar chemical speciation for all three assays . In general, the Microtox bioassay was sensitive to all metals (except Pb), whereas the photocytes were the least sensitive to the metals . The heightened response of the Microtox bioassay probably resulted from a combination of the limited complexing power of the medium and the greater sensitivity of the bacterial strain .

Biosens Bioelectron, 2004 Jun 15, 19(11), 1457 - 63
Continuous culture of photobacterium; Pooley DT et al.; The design and performance characteristics of a small volume (20 ml) continuous culture device for the cultivation of luminous bacteria are described . This simply constructed device can be used to supply luminescent bacteria with constant properties for either laboratory use or the assay of environmental pollutants . Furthermore, bacteria can be deployed to make sensitive (<1 nM) oxygen measurements . The culture device may be configured, alone or in combination, as a chemostat, turbidostat or a "bioluminostat" where bacterial bioluminescence becomes the controlling variable . Over extended periods (>1 week) it was possible to maintain steady-state luminescence within 5% of a pre-set value, although occasionally a non-bioluminescent "mutant" became dominant; in this case light emission was irreversibly lost . A secondary chamber provided additional flexibility and easy manipulation of the cultivated bacteria for testing . The continuous culture system is also suitable for the growth of recombinant microorganisms that either constitutively express luciferase, or do so in response to stress promoter activity . The non-standard control methodologies reported may have important research and industrial applications, for example in providing immediate process control or as an inferential method to optimize biomass: product yield ratios.

Environ Pollut, 1990, 65(4), 323 - 32
Mutatox test: a new test for monitoring environmental genotoxic agents; Kwan KK et al.; In this study, Yamaska River water and Milli-Q water and organically extracted sediment extracts were used to evaluate the sensitivity of a new genotoxicity screening test, the Mutatox test . Also in this study, the samples were tested for acute and chronic toxicity using the following screening test procedures: Microtox, Daphnia magna, Ceriodaphnia reticulata and ATP-TOX Systems . The Mutatox test is based on the use of a dark mutant strain of Photobacterium phosphoreum and is sensitive to chemicals which are (1) DNA damaging agents (2) DNA intercalating agents, (3) DNA synthesis inhibitors and (4) direct mutagens . In this study, the Mutatox test was found to be a simple-to-perform sensitive procedure which added greater scope to the battery of tests approach . Preliminary indications are that this procedure may prove to be one of the more responsive and valuable tests in the 'battery of tests' approach to environmental screening.

J Clin Microbiol, 2004 Apr, 42(4), 1414 - 9
Simultaneous detection of marine fish pathogens by using multiplex PCR and a DNA microarray; Gonzalez SF et al.; We coupled multiplex PCR and a DNA microarray to construct an assay suitable for the simultaneous detection of five important marine fish pathogens (Vibrio vulnificus, Listonella anguillarum, Photobacterium damselae subsp . damselae, Aeromonas salmonicida subsp . salmonicida, and Vibrio parahaemolyticus) . The array was composed of nine short oligonucleotide probes (25-mer) complementary to seven chromosomal loci (cyt, rpoN, gyrB, toxR, ureC, dly, and vapA) and two plasmid-borne loci (fatA and A.sal) . Nine primer sets were designed to amplify short fragments of these loci (100 to 177 bp) in a multiplex PCR . PCR products were subsequently labeled by nick translation and hybridized to the microarray . All strains of the five target species (n = 1 to 21) hybridized to at least one species-specific probe . Assay sensitivities ranged from 100% for seven probes to 83 and 67% for the two remaining probes . Multiplex PCR did not produce any nonspecific amplification products when tested against 23 related species of bacteria (n = 40 strains; 100% specificity) . Using purified genomic DNA, we were able to detect PCR products with < 20 fg of genomic DNA per reaction (equivalent to four or five cells), and the array was at least fourfold more sensitive than agarose gel electrophoresis for detecting PCR products . In addition, our method allowed the tentative identification of virulent strains of L . anguillarum serotype O1 based on the presence of the fatA gene (67% sensitivity and 100% specificity) . This assay is a sensitive and specific tool for the simultaneous detection of multiple pathogenic bacteria that cause disease in fish and humans.

Arch Microbiol, 2004 May, 181(5), 352 - 61 Epub 2004 Mar 19.
Phylogenetic analysis of the lux operon distinguishes two evolutionarily distinct clades of Photobacterium leiognathi; Ast JC et al.; The luminous marine bacterium Photobacterium mandapamensis was synonymized several years ago with Photobacterium leiognathi based on a high degree of phenotypic and genetic similarity . To test the possibility that P . leiognathi as now formulated, however, actually contains two distinct bacterial groups reflecting the earlier identification of P . mandapamensis and P . leiognathi as separate species, we compared P . leiognathi strains isolated from light-organ symbiosis with leiognathid fishes (i.e., ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1) with strains from seawater originally described as P . mandapamensis and later synonymized as P . leiognathi (i.e., ATCC 27561(T) and ATCC 33981) and certain strains initially identified as P . leiognathi (i.e., PL-721, PL-741, 554) . Analysis of the 16S rRNA and gyrB genes did not resolve distinct clades, affirming a close relationship among these strains . However, strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 were found to bear a luxF gene in the lux operon ( luxABFE), whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 lack this gene ( luxABE) . Phylogenetic analysis of the luxAB(F)E region confirmed this distinction . Furthermore, ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 all produced a higher level of luminescence on high-salt medium, as previously described for PL-721, whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 all produced a higher level of luminescence on low-salt medium, a characteristic of P . leiognathi from leiognathid fish light organs . These results demonstrate that P . leiognathi contains two evolutionarily and phenotypically distinct clades, P . leiognathi subsp . leiognathi (strains ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1), and P . leiognathi subsp . mandapamensis (strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554).

Arch Environ Contam Toxicol, 2004 Jan, 46(1), 1 - 7
Development of a fragment constant method for estimating the mixture toxicity; Lin Z et al.; Based on Group Contribution Theory, a fragment constant model to estimate mixture toxicity is proposed in this paper . The toxicity (EC50M) of 58 mixtures is determined using Photobacterium phosphoreum . Analysis of these EC50M and the mole fraction of the individual chemical fragments (Br, Cl, NO2, OH, NH2) helps work out the fragment toxicity contribution (deltaTi) to EC50M . Thus, a linear regression equation is established between the toxicity contribution deltaTi and the fragment constants of Hansch f(i), and this equation is so significant that it helps provide an approach for calculating EC50M.

J Clin Microbiol, 2004 Mar, 42(3), 1370 - 2
Two cases of fatal necrotizing fasciitis caused by Photobacterium damsela in Japan; Yamane K et al.; We encountered two cases of fatal necrotizing fasciitis caused by Photobacterium damsela in Japan . Both cases occurred in fishermen who became sick after fishing . They developed multiple organ failure within 20 to 36 h from the onset of initial symptoms despite intensive chemotherapy and surgical treatments.

J Fish Dis, 2004 Jan, 27(1), 1 - 13
The effect of in vivo growth on the cellular and extracellular components of the marine bacterial pathogen Photobacterium damsela subsp . piscicida; Bakopoulos V et al.; Photobacterium damsela subsp . piscicida, the causative agent of fish pasteurellosis, was grown in vivo . Bacterial cells and extracellular products (ECPs) were analysed via electrophoresis and immunoblot analysis, using specific sea bass antisera . Growth in vivo induced the synthesis of unique bacterial cell proteins at > 206, 206, 21.3, 18, 7.6 and < 7.6 kDa . Sea bass serum raised against live bacterial cells of the pathogen and especially a sea bass serum raised against formalin-inactivated bacterial cells grown in a specific novel medium recognized the novel antigens at > 206 (associated with iron sequestration), 21.3, 7.6 and < 7.6 kDa, suggesting that the latter medium conserves the synthesis of natural bacterial cell proteins in vitro . In vivo growth of the pathogen induced the synthesis of more toxic ECPs in comparison with in vitro growth and an inverse correlation between total protein concentration in the ECPs and toxicity per unit of protein was observed . Substrate-polyacrylamide electrophoresis revealed the presence of in vivo synthesized ECPs of the pathogen (proteases) at 175, 132, < 79 and 48.3 kDa . Histological examination of tissues isolated from fish injected with these ECPs revealed inflammatory and necrotic lesions in the spleen, liver, head kidney, intestine and heart as soon as 48 h post-introduction of the ECPs.

Environ Microbiol, 2004 Feb, 6(2), 145 - 58
Genomic polymorphism in symbiotic populations of Photobacterium leiognathi; Dunlap PV et al.; Photobacterium leiognathi forms a bioluminescent symbiosis with leiognathid fishes, colonizing the internal light organ of the fish and providing its host with light used in bioluminescence displays . Strains symbiotic with different species of the fish exhibit substantial phenotypic differences in symbiosis and in culture, including differences in 2-D PAGE protein patterns and profiles of indigenous plasmids . To determine if such differences might reflect a genetically based symbiont-strain/host-species specificity, we profiled the genomes of P . leiognathi strains from leiognathid fishes using PFGE . Individual strains from 10 species of leiognathid fishes exhibited substantial genomic polymorphism, with no obvious similarity among strains; these strains were nonetheless identified as P . leiognathi by 16S rDNA sequence analysis . Profiling of multiple strains from individual host specimens revealed an oligoclonal structure to the symbiont populations; typically one or two genomotypes dominated each population . However, analysis of multiple strains from multiple specimens of the same host species, to determine if the same strain types consistently colonize a host species, demonstrated substantial heterogeneity, with the same genomotype only rarely observed among the symbiont populations of different specimens of the same host species . Colonization of the leiognathid light organ to initiate the symbiosis therefore is likely to be oliogoclonal, and specificity of the P . leiognathi/leiognathid fish symbiosis apparently is maintained at the bacterial species level rather than at the level of individual, genomotypically defined strain types.

Free Radic Biol Med, 2004 Jan 15, 36(2), 173 - 9
Collaborative effects of Photobacterium CuZn superoxide dismutase (SODs) and human AP endonuclease in DNA repair and SOD-deficient Escherichia coli under oxidative stress; Kim YG; The defenses against free radical damage include specialized repair enzymes that correct oxidative damage in DNA and detoxification systems such as superoxide dismutases (SODs) . These defenses may be coordinated genetically as global responses . We hypothesized that the expression of SOD and DNA repair genes would inhibit DNA damage under oxidative stress . Therefore, protection of Escherichia coli mutants deficient in SOD and DNA repair genes (sod-, xth-, and nfo-) was demonstrated by transforming the mutant strain with a plasmid pYK9 that encoded Photobacterium leiognathi CuZnSOD and human AP endonuclease . The results show that survival rates were increased in sod+ xth- nfo+ cells compared with sod- xth- ape-, sod- xth- ape-, and sod+ xth- ape- cells under oxidative stress generated with 0.1 mM paraquat or 3 mM H2O2 . The data suggest that, at the least, SOD and DNA repair enzymes may collaborate on protection and repair of damaged DNA . Additionally, both enzymes are required for protection against free radicals.

Dis Aquat Organ, 2003 Dec 3, 57(1-2), 51 - 8
Construction of a safe, stable, efficacious vaccine against Photobacterium damselae ssp . piscicida; Thune RL et al.; Vaccination with bacterial auxotrophs, particularly those with an interruption in the common pathway of aromatic amino-acid biosynthesis, known as the shikimate pathway, has been shown to be effective in the prevention of a variety of bacterial diseases . In order to evaluate this approach to vaccine development in the important marine pathogen Photobacterium damselae subsp . piscicida, the aroA gene of the shikimate pathway was identified from a P . damselae subsp . piscicida genomic library by complementation in an aroA mutant of Escherichia coli . The complementing plasmid was isolated and the nucleotide sequence of the P . damselae subsp . piscicida genomic insert was determined . Subsequent analysis of the DNA-sequence data demonstrated that the identified plasmid contained 3464 bp of P . damselae subsp . piscicida DNA, including the complete aroA gene . The sequence data was used to delete a 144 bp MscI fragment, and the kanamycin resistance gene (kan) from transposon Tn903 was ligated into the MscI site . This delta(aro)A::kan construct was sub-cloned into a suicide plasmid and transferred to a wild-type P . damselae subsp . piscicida by conjugation and allelic exchange . One selected mutant, LSU-P2, was confirmed phenotypically to require supplementation with aromatic metabolites for growth in minimal media, and was confirmed genotypically by PCR and DNA sequencing . Further, LSU-P2 was demonstrated to be avirulent in hybrid striped bass and to provide significant protection against disease following challenge with the wild-type strain.

Mikrobiol Z, 2003 Sep-Oct, 65(5), 8 - 12
{Antimicrobial activity of saponins from Hedera taurica C a r r.}; Mel'nichenko EG et al.; The antibacterial and antifungal action of saponins Sx1, taurozide H2, taurozide I and their effect on bioluminescent system of photobacteria Photobacterium phosphoreum (Cohn) Ford were investigated . Saponins H2 and I had no antimicrobial effect . Saponin Sx1 possessed antifungal activity in vitro with respect to Candida albicans, C . krusei, C . tropicalis . Saponin Sx1 is less toxic to P . phosphoreum than well-known antiseptics--chlorhexedin and miramistin.

Crit Care Med, 2004 Jan, 32(1), 278 - 81
Rapidly advancing necrotizing fasciitis caused by Photobacterium (Vibrio) damsela: a hyperaggressive variant; Goodell KH et al.; OBJECTIVE: To describe the first case of Vibrio damsela necrotizing fasciitis in New England, emphasizing the importance of very early operative intervention to achieve source control in this extremely aggressive infection . DESIGN: Case report . SETTING: Surgical intensive care unit at Tufts-New England Medical Center in Boston, MA . PATIENT: A 69-yr-old retired fisherman with rapidly progressive necrotizing fasciitis from Photobacterium (Vibrio) damsela infection and ensuing multiple-system organ failure . INTERVENTIONS: Surgical debridement, ventilator support, vasopressors, continuous veno-venous hemofiltration, and blood product transfusions . MEASUREMENTS AND MAIN RESULTS: Death . CONCLUSIONS: A high index of suspicion is necessary for the diagnosis of this specific pathogen and concordant infection . The willingness to surgically debride and amputate without hesitation at a very early point may be the only intervention capable of saving the lives of patients affected by Photobacterium (Vibrio) damsela.

Lasers Surg Med, 2003, 33(5), 311 - 9
The interaction of lipopolysaccharides with phenothiazine dyes; Usacheva MN et al.; BACKGROUND AND OBJECTIVES: The difference in the photobactericidal efficacy of methylene blue and toluidine blue against gram-negative bacteria may result from their primary reaction with lipopolysaccharides (LPS) of the outer bacterial membrane . The aim of the present study was to compare the reactivity of these dyes with LPS extracted from different gram-negative bacteria . STUDY DESIGN/MATERIALS AND METHODS: The interactions of methylene blue and toluidine blue with LPS from Escherichia coli (E . coli), Pseudomonas aeruginosa (P . aeruginosa), Klebsiella pneumoniae (K . pneumoniae), and Serratia marcescens (S . marcescens) were studied spectrophotometrically in 0.45% saline . The dyes were used at the concentration of 10 microM . The concentrations of LPS ranged from 5-100 microg/ml . RESULTS: Methylene blue and toluidine blue enter into a metachromatic reaction with the LPS resulting the in generation of dimers of methylene blue and higher aggregates of toluidine blue . The more significant hypochromic and hypsochromic effects in the reaction of the latter with LPS indicate a greater metachromatic efficacy of toluidine blue than methylene blue . The equilibrium constants of the metachromatic complex between toluidine blue and different LPS were calculated . The spectrophotometric titration of LPS with the dyes was used to estimate the equivalent weight of LPS . CONCLUSIONS: Toluidine blue interacts with LPS more significantly than methylene blue in vitro . This may be one of the main factors determining its greater photobactericidal efficacy against gram-negative bacteria .

J Clin Microbiol, 2003 Dec, 41(12), 5654 - 9
Accuracy of six commercially available systems for identification of members of the family vibrionaceae; O'Hara CM et al.; Six commercially available bacterial identification products were tested with Vibrio alginolyticus (12 strains), V . cholerae (30 strains), Photobacterium (Vibrio) damselae (10 strains), V . fluvialis (10 strains), V . furnissii (4 strains), V . hollisae (10 strains), V . metschnikovii (9 strains), V . mimicus (10 strains), V . parahaemolyticus (30 strains), and V . vulnificus (10 strains) to determine the accuracy of each system for identification . The products included API 20E, Crystal E/NF, MicroScan Neg ID2 and Rapid Neg ID3, and Vitek GNI+ and ID-GNB . Each product was tested only with those species that were listed in its database . Overall, the systems correctly identified 63.9, 80.9, 63.1, 73.6, 73.5, and 77.7% of the isolates to species level, respectively . Error rates ranged from 0.8% for the API 20E to 10.4% for the Rapid Neg ID3 . The API 20E gave "no identification" for 13.1% of the isolates, while the Neg ID2, GNI+, ID-GNB, and Crystal were unable to identify 1.8, 2.9, 5.0, and 6.9%, respectively . For V . cholerae, specifically, accuracy ranged from 50.0 to 96.7%, with the API 20E having the worst performance and Crystal having the best . V . fluvialis presented the biggest challenge for the API 20E and the GNI+, with probabilities averaging 10%, while V . mimicus was a major problem with the Crystal E/NF, which identified none of the strains correctly . With the Neg ID2, correct answers were often obtained only after a modified inoculation of the panel with a bacterial suspension prepared with 0.85% NaCl . Additional tests required for identification often included growth in the absence of NaCl, which is not readily available in most clinical laboratories . The only product to correctly identify at least 90% of V . cholerae strains was the Crystal E/NF, and only three of the six products, the API 20E and both of the Vitek cards, correctly identified more than 90% of the V . parahaemolyticus strains . Thus, extreme care must be taken in the interpretation of answers from these six commercially available systems for the identification of Vibrio species.

J Appl Microbiol, 2003, 95(6), 1375 - 80
Simple and rapid detection of Photobacterium damselae ssp . piscicida by a PCR technique and plating method; Rajan PR et al.; AIMS: To detect Photobacterium damselae ssp . piscicida using the PCR technique and plating method . METHODS AND RESULTS: Two strains of P . damselae ssp . piscicida were isolated from cultured cobia (Rachycentron canadum) at two different fish farms in Taiwan . A pair of primers was designed to detect the capsular polysaccharide gene of P . damselae ssp . piscicida by PCR . Reference strains of different genus and different clinical strains were used for this study . The expected product (410 bp) was obtained from both P . damselae ssp . piscicida and P . damselae ssp . damselae, and they were differentiated by culturing on thiosulphate citrate bile salts-sucrose agar (TCBS-1) . Photobacterium damselae ssp . damselae grew on TCBS-1 producing green colonies whereas P . damselae ssp . piscicida did not grow . CONCLUSIONS: The methods used are cost and labour effective when compared with the other methods and commercially available kits . SIGNIFICANCE AND IMPACT OF THE STUDY: This work provides an integrated set of methods to identify the species P . damselae and to differentiate P . damselae ssp . piscicida from P . damselae ssp . damselae.

Int J Food Sci Nutr, 2004 Feb, 55(1), 45 - 51
Nutritional composition and microflora of the fresh and fermented skate (Raja Kenojei) skins; Cho SH et al.; The proximate compositions of fresh and fermented skate skin were each 75.95% and 74.5% moisture, 22.7% and 21.8% protein, 0.5% and 0.7% lipid and 0.6% and 0.9% ash, respectively . The predominant minerals were potassium and phosphorus (i.e . 53.5 and 33.0 mg/100 g in fresh skin, and 10.46 and 10.51 mg/100 g in fermented skin, respectively) . Amino acid concentrations were lower in the fermented skin compared with the fresh skin . Histidine, glycine, alanine and glutamic acid were the major free amino acids in both skins . Palmitic acid (C16:0) was the major fatty acid in both fresh (16.68%) and fermented (20.38%) skate skin . Omega-3 polyunsaturated fatty acids were higher in fresh skin (22.17%) and fermented skin (24.54%) compared with omega-6 polyunsaturated fatty acids . The predominant microflora present in the both fresh and fermented skin were Photobacterium sp . and Vibrio sp . Total plate counts for the fresh and fermented skin were 2.4x10(4) CFU/g and 7.7x10(7) CFU/g, respectively.

J Basic Microbiol, 2003, 43(6), 499 - 507
Virulence of Photobacterium damselae subsp . piscicida in cultured cobia Rachycentron canadum; Liu PC et al.; An outbreak of serious mortality among the cultured cobia Rachycentron canadum (weighing 3 kg) characterized by the presence of whitish granulomatous deposits on the kidney, liver and spleen occurred in July of 2000 in Taiwan . A non-motile strain CP1 was isolated from kidney and/or liver on tryptic soy agar and/or brain heart infusion agar plates (both supplemented with 1% NaCl, w/v) . This strain was characterized and identified as Photobacterium damselae subsp . piscicida using biochemical characteristics and Bionor mono-Pp tests . The bacterium and its extracellular products (ECP) were lethal to the cobia (weighing 10 g) with LD50 values of 1.03 x 10(4) colony forming units and 1.26 microg protein/g fish body weight, respectively . All the moribund/dead fish exhibited darkness in color with no gross or internal leasions . However, the bacteria could be reisolated from kidney and liver after bacterial challenge . The present results reveal that Ph . damselae subsp . piscicida is the causative agent of fish photobacteriosis in the cobia and the bacterium isolated from sub-adult cobia (chronic form) is virulent to young cobia causing acute form of the disease.

Appl Environ Microbiol, 2003 Nov, 69(11), 6938 - 42
Isolation and identification of Photobacterium phosphoreum from an unexpected niche: migrating salmon; Budsberg KJ et al.; Six luminous bacteria were isolated from migrating salmon in the Yukon River, Alaska . All isolates were identified as Photobacterium phosphoreum . Previous studies suggest that P . phosphoreum is an exclusively marine bacterium, while our Alaskan isolates are from salmon which migrated up to 1,228 km from the marine environment.

Chem Res Toxicol, 2003 Oct, 16(10), 1365 - 71
Development of QSARs for predicting the joint effects between cyanogenic toxicants and aldehydes; Lin Z et al.; Quantitative structure-activity relationship (QSAR) approaches are proposed in this study to predict the joint effects of mixture toxicity . The initial investigation studies the joint effects between cyanogenic toxicants and aldehydes to Photobacterium phosphoreum . Joint effects are found to result from the formation of a carbanion intermediate produced through the chemical interactions between cyanogenic toxicants and aldehydes . Further research indicates that the formation of carbanion intermediate is highly correlated with not only the charge of the carbon atom in the -CHO of aldehydes but also the charge of the carbon atom (C) in the carbochain of cyanogenic toxicants . The charge of the carbon atom in the -CHO of aldehydes is quantified by using the Hammett constant (sigma(p)), and then, sigma(p)-based QSAR models are proposed to describe the relationships between the joint effects and the chemical structures of the aldehydes . By using the charge of carbon atom (C) in the carbochain of cyanogenic toxicants, another QSAR model is proposed to describe the relationship between the joint effects and the chemical structures of cyanogenic toxicants.

Comp Biochem Physiol C Toxicol Pharmacol, 2003 Sep, 136(1), 63 - 71
Purification and characterization of an antibacterial protein in the skin secretion of rockfish Sebastes schlegeli; Nagashima Y et al.; An antibacterial protein in the skin secretion of rockfish (Sebastes schlegeli) was purified by lectin affinity chromatography on Con A-Sepharose and gel filtration on TSKgel G3000SW . The antibacterial protein featured the high molecular mass and selective action against Gram-negative bacteria . The molecular mass of the protein was estimated to be approximately 150 kDa in gel filtration and approximately 75 kDa by SDS-PAGE, suggesting that it is dimeric . The antibacterial principle was an acidic glycoprotein with pI 4.5, 3.4% reducing sugar and 2.8% amino sugar . Its sugar chains had N-type (high mannose-type) oligosaccharide and sialic acid components . It inhibited strongly the growth of Aeromonas salmonicida, Photobacterium damselae and Shewanella putrefaciens with a minimum inhibitory concentration (MIC) of approximately 3 microg/ml, and moderately the growth of Vibrio parahaemolyticus and A . hydrophila with a MIC of 12.5 microg/ml and 25 microg/ml, respectively . The values of the minimum bactericidal concentration were almost equivalent to those of MIC . The potent sensitivity against virulent pathogens such as A . hydrophila, A . salmonicida and P . damselae may contribute considerably to the innate host defense mechanism to combat microbes on the mucosal surfaces of the rockfish.

Chemosphere, 2003 Dec, 53(8), 945 - 52
Three-dimensional quantitative structure-activity relationship study for phenylsulfonyl carboxylates using CoMFA and CoMSIA; Liu X et al.; From both the comparative molecular field analysis (CoMFA) and the comparative molecular similarity indices analysis (CoMSIA), the paper describes two three-dimensional quantitative structure-activity relationship (3D-QSAR) models for the acute toxicity logEC50 (15 min-EC50 in micromoll(-1)) of 56 phenylsulfonyl carboxylates on Photobacterium phosphoreum . Two models yield the leave-one-out cross-validated correlation coefficient q2 values of 0.823 and 0.713, and the conventional correlation coefficient r2 values of 0.958 and 0.933, respectively . The achievement of higher q2 and r2 values of CoMFA model indicates the significance of correlation of steric and electrostatic fields with biological activities . The key features in the CoMFA contour maps are critical to trace the important properties and gain insight into the toxic mechanism of tested compounds . The quality of CoMSIA model is slightly lower than that of CoMFA in terms of q2 and r2 values . Not requiring molecular superposition, CoMSIA is faster than CoMFA in data processing.

Adv Space Res, 2003, 31(6), 1513 - 24
The SOS-LUX-LAC-FLUORO-Toxicity-test on the International Space Station (ISS); Rabbow E et al.; In the 21st century, an increasing number of astronauts will visit the International Space Station (ISS) for prolonged times . Therefore it is of utmost importance to provide necessary basic knowledge concerning risks to their health and their ability to work on the station and during extravehicular activities (EVA) in free space . It is the aim of one experiment of the German project TRIPLE-LUX (to be flown on the ISS) to provide an estimation of health risk resulting from exposure of the astronauts to the radiation in space inside the station as well as during extravehicular activities on one hand, and of exposure of astronauts to unavoidable or as yet unknown ISS-environmental genotoxic substances on the other . The project will (i) provide increased knowledge of the biological action of space radiation and enzymatic repair of DNA damage, (ii) uncover cellular mechanisms of synergistic interaction of microgravity and space radiation and (iii) examine the space craft milieu with highly specific biosensors . For these investigations, the bacterial biosensor SOS-LUX-LAC-FLUORO-Toxicity-test will be used, combining the SOS-LUX-Test invented at DLR Germany (Patent) with the commercially available LAC-FLUORO-Test . The SOS-LUX-Test comprises genetically modified bacteria transformed with the pBR322-derived plasmid pPLS-1 . This plasmid carries the promoterless lux operon of Photobacterium leiognathi as a reporter element under control of the DNA-damage dependent SOS promoter of ColD as sensor element . This system reacts to radiation and other agents that induce DNA damages with a dose dependent measurable emission of bioluminescence of the transformed bacteria . The analogous LAC-FLUORO-Test has been developed for the detection of cellular responses to cytotoxins . It is based on the constitutive expression of green fluorescent protein (GFP) mediated by the bacterial protein expression vector pGFPuv (Clontech, Palo Alto, USA) . In response to cytotoxic agents, this system reacts with a dose-dependent reduction of GFP-fluorescence . Currently, a fully automated miniaturized hardware system for the bacterial set up, which includes measurements of luminescence and fluorescence or absorption and the image analysis based evaluation is under development . During the first mission of the SOS-LUX-LAC-FLUORO-Toxicity-Test on the ISS, a standardized, DNA-damaging radiation source still to be determined will be used as a genotoxic inducer . A panel of recombinant Salmonella typhimurium strains carrying either the SOS-LUX plasmid or the fluorescence-mediating lac-GFPuv plasmid will be used to determine in parallel on one microplate the genotoxic and the cytotoxic action of the applied radiation in combination with microgravity . Either in addition to or in place of the fluorometric measurements of the cytotoxic agents, photometric measurements will simultaneously monitor cell growth, giving additional data on survival of the cells . The obtained data will be available on line during the TRIPLE-LUX mission time . Though it is the main goal during the TRIPLE-LUX mission to measure the radiation effect in microgravity, the SOS-LUX-LAC-FLUORO-Toxicity-test in principle is also applicable as a biomonitor for the detection and measurement of genotoxic substances in air or in the (recycled) water system on the ISS or on earth in general . c2003 COSPAR . Published by Elsevier Science Ltd . All rights reserved.

J Chemother, 2003 Aug, 15(4), 329 - 34
Comparative antistreptococcal activity of photobactericidal agents; O'Neill J et al.; In order to establish a comparative order of efficacy among established photosensitising compounds currently under investigation, the in vitro photobactericidal activities of six commercially available photosensitisers were investigated at equal concentration against Streptococcus sanguis using a Helium Neon (HeNe) laser (632.8 nm) . Of the photosensitisers used, the four phenothiazinium compounds were efficient photobactericidal agents as was the protoporphyrin IX salt . However, the zinc phthalocyaninetetrasulfonate was less effective . Of the active agents, 1,9-dimethyl Methylene Blue (DMMB) was notable in achieving complete bacterial kill when used at a concentration of 40.85 microM in conjunction with a light energy dose of 21.8 J cm(-2), although there was inherent dark activity associated with this compound . Since each of the photosensitisers is well known to produce singlet oxygen, the relative activities exhibited are thought to be due to differences in bacterial cell uptake, which in turn are related to the physicochemical properties of the photosensitisers, in particular, to the combination of lipophilicity and ionic character.

J Fish Dis, 2003 Feb, 26(2), 77 - 90
Vaccination trials of sea bass, Dicentrarchus labrax (L.), against Photobacterium damsela subsp . piscicida, using novel vaccine mixtures; Bakopoulos V et al.; Bacterial cells of the marine fish pathogen Photobacterium damsela subsp . piscicida were grown in novel culture media . A mixture of whole cells and extracellular components was inactivated and used in bath, intraperitoneal (i.p.) and oral vaccination of sea bass, Dicentrarchus labrax, employing two sizes of fish . A commercial vaccine was used for comparative purposes . Control and immunized fish were either bath or intraperitoneally challenged 6 and 12 weeks post-vaccination . Small fish had significantly higher relative percentage survival with the novel vaccine mixture both at 6 and 12 weeks post-vaccination by bath, in comparison with the commercial vaccine . No protection was afforded at 6 or 12 weeks post-immunization by either vaccine after challenge via i.p . injection . Sea bass (1.5-2 g) intraperitoneally vaccinated with various adjuvanted vaccine mixtures were not protected against pasteurellosis . In contrast, larger sea bass (20 g) benefited from vaccination with the novel vaccine mixtures . Intraperitoneal challenge with the pathogen resulted in protection in both fish groups vaccinated with novel vaccine mixtures, whereas control fish suffered high mortalities (> 80%) . Orally vaccinated fish were immersion challenged with the pathogen . At 6 and 12 weeks post-vaccination the control fish had a high mortality and the fish vaccinated with the novel vaccine mixture achieved good protection.

J Fish Dis, 2003 Jan, 26(1), 1 - 13
Investigation of media formulations promoting differential antigen expression by Photobacterium damsela ssp . piscicida and recognition by sea bass, Dicentrarchus labrax (L.), immune sera; Bakopoulos V et al.; Photobacterium damsela ssp . piscicida (Phdp) isolates were grown in various bacteriological media, in eukaryotic cell culture media and in the presence of fish cells (resembling some aspects of in vivo growth environments) . Bacterial cells, extracellular products (ECPs) and crude capsular polysaccharide were isolated and analysed by electrophoresis and Western blot using sea bass sera . Growth in bacteriological media conserved the synthesis of cell and extracellular components when these were compared with those prepared under near-in vivo growth conditions . In fact, synthesis of a larger range of cell components was induced after growth in bacteriological media . Certain media based on yeast extract and peptones from various sources and a specific salt formulation induced the synthesis of novel cell components at approximately 21.3 and 14 kDa . These antigens were recognized by sea bass sera collected after natural pasteurellosis outbreaks and other sea bass sera raised against live or inactivated Phdp cells . The ECPs of the pathogen were not good immunogens in their soluble form despite various treatments prior to immunization . The results are discussed with respect to vaccine development.

Fish Shellfish Immunol, 2003 Sep, 15(3), 241 - 8
Toxicity of nitric oxide and peroxynitrite to Photobacterium damselae subsp . piscicida; Acosta F et al.; Virulent strains of Photobacterium damselae subsp . piscicida (Pdp) were grown in media with or without glucose supplementation (to enhance polysaccharide capsule formation) and the bactericidal action of nitric oxide (NO) and peroxynitrites was evaluated in a cell-free assay . Treatment with the NO-donor S-nitroso-acetyl-penicillamine (SNAP) induced a dose-and time-dependent decrease in Pdp survival . This effect was greater for strains grown without glucose supplementation (C forms) than for their counterparts grown with glucose supplementation (C(+) forms) . Addition of superoxide anion (O2(-)) generating systems (Xanthine/Xanthine oxidase, glucose/glucose oxidase) to the culture media further enhanced the bactericidal effect of NO . A similar bactericidal effect, with the same pattern of sensitivity, was observed when C+ and C forms of the bacteria were treated with 3-morpholino-sydonimide hydrochloride (SIN-1), a compound which simultaneously generates NO and O2(-) . Addition of superoxide dismutase (SOD) or SOD plus catalase (CAT) did not fully reverse the toxic action of SIN-1 and the bactericidal effect was similar for both C and C(+) forms suggesting that while NO alone is sufficient to cause damage in all strains of the pathogen tested, growth in glucose supplemented medium enhanced protection to reactive oxygen intermediates rather than NO.

Appl Environ Microbiol, 2003 Jul, 69(7), 3932 - 7
Dominance of Vibrio fischeri in secreted mucus outside the light organ of Euprymna scolopes: the first site of symbiont specificity; Nyholm SV et al.; Previous studies of the Euprymna scolopes-Vibrio fischeri symbiosis have demonstrated that, during colonization, the hatchling host secretes mucus in which gram-negative environmental bacteria amass in dense aggregations outside the sites of infection . In this study, experiments with green fluorescent protein-labeled symbiotic and nonsymbiotic species of gram-negative bacteria were used to characterize the behavior of cells in the aggregates . When hatchling animals were exposed to 10(3) to 10(6) V . fischeri cells/ml added to natural seawater, which contains a mix of approximately 10(6) nonspecific bacterial cells/ml, V . fischeri cells were the principal bacterial cells present in the aggregations . Furthermore, when animals were exposed to equal cell numbers of V . fischeri (either a motile or a nonmotile strain) and either Vibrio parahaemolyticus or Photobacterium leiognathi, phylogenetically related gram-negative bacteria that also occur in the host's habitat, the symbiont cells were dominant in the aggregations . The presence of V . fischeri did not compromise the viability of these other species in the aggregations, and no significant growth of V . fischeri cells was detected . These findings suggested that dominance results from the ability of V . fischeri either to accumulate or to be retained more effectively within the mucus . Viability of the V . fischeri cells was required for both the formation of tight aggregates and their dominance in the mucus . Neither of the V . fischeri quorum-sensing compounds accumulated in the aggregations, which suggested that the effects of these small signal molecules are not critical to V . fischeri dominance . Taken together, these data provide evidence that the specificity of the squid-vibrio symbiosis begins early in the interaction, in the mucus where the symbionts aggregate outside of the light organ.

Fish Shellfish Immunol, 2003 Aug, 15(2), 129 - 44
Apoptosis of sea bass (Dicentrarchus labrax L.) neutrophils and macrophages induced by experimental infection with Photobacterium damselae subsp . piscicida; do Vale A et al.; The infection of sea bass (Dicentrarchus labrax L.) by intraperitoneal (i.p.) injection of the agent of fish pasteurellosis Photobacterium damselae subsp . piscicida resulted in the apoptosis of peritoneal neutrophils and macrophages . All the eight virulent and none of the two non-virulent strains tested exhibited apoptogenic activity . A secreted bacterial protein(s) is a likely candidate as the factor(s) responsible for this activity, since no apoptosis was induced by i.p . injected UV-killed virulent strains and the virulent culture supernatants exhibited a thermo-labile apoptogenic activity identical to that of live bacteria . The apoptotic process was characterized by the occurrence of DNA fragmentation detected by terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling (TUNEL) staining and DNA electrophoresis, and of typical ultrastructural alterations namely cell shrinkage, chromatin condensation, nuclear fragmentation and production of blebs with shedding of apoptotic bodies . In the apoptotic process induced by lethal doses of virulent bacteria or culture supernatants both peritoneal macrophages and neutrophils were extensively affected, the majority of these cells being apoptotic and reaching values around 10(7)per peritoneal cavity for each cell type at 24h post-injection . Moreover, the number of non-apoptotic macrophages was always below the initial number in the resting peritoneal cavity . Since macrophages are key cells in the elimination of both bacteria and apoptotic moribund cells and apoptotic bodies, the induction by Ph . damselae subsp . piscicida of simultaneous macrophage and neutrophil apoptosis results, on the one hand, in the destruction of the two phagocytic cell types involved in the restriction of multiplication of the bacteria and, on the other hand, in the uncontrolled progression of the apoptotic process towards secondary necrosis and eventual lysis of high numbers of moribund neutrophils and of neutrophilic apoptotic bodies, with the consequent extensive release of their highly cytotoxic components . Abundant apoptotic cells were also seen in sections of head-kidney from fish dying from experimental pasteurellosis . In contrast, no apoptosis was seen in vitro after the treatment with virulent culture supernatants of sea bass head-kidney macrophage cultures or after the treatment ex vivo of peritoneal exudate leukocytes with virulent bacteria or culture supernatants . The apoptotic process described here appears as a novel and very powerful microbial pathogenic strategy.

Chemosphere, 2003 Aug, 52(7), 1199 - 208
Quantification of joint effect for hydrogen bond and development of QSARs for predicting mixture toxicity; Lin Z et al.; A QSAR model is successfully proposed to predict the toxicity effect on Photobacterium phosphoreum by nonpolar-narcotic-chemical mixtures and/or polar-narcotic-chemical mixtures . For nonpolar-narcotic-chemical mixtures and polar-narcotic-chemical mixtures, their corresponding hydrophobicity-based QSAR models are derived from regression analysis . Comparison of these two QSAR models make us believe that it is the joint effect of hydrogen bond in polar-narcotic-chemical mixture that leads to the difference between these two models . Such joint effect of hydrogen bond can be quantified as AMH and BMH by using the different partition coefficients of mixtures in various organic phase/water systems . And the regression analysis results convinced us that the introduction of AMH does improve the quality of the QSAR model with r2=0.948, S.E.=0.166 and F=745.201 at P=0.000 for total 84 mixtures.

Proteins, 2003 Jun 1, 51(4), 607 - 15
Static and dynamic water molecules in Cu,Zn superoxide dismutase; Falconi M et al.; Understanding protein hydration is a crucial, and often underestimated issue, in unraveling protein function . Molecular dynamics (MD) computer simulation can provide a microscopic description of the water behavior . We have applied such a simulative approach to dimeric Photobacterium leiognathi Cu,Zn superoxide dismutase, comparing the water molecule sites determined using 1.0 ns MD simulation with those detected by X-ray crystallography . Of the water molecules detected by the two techniques, 20% fall at common sites . These are evenly distributed over the protein surface and located around crevices, which represent the preferred hydration sites . The water mean residence time, estimated by means of a survival probability function on a given protein hydration shell, is relatively short and increases for low accessibility sites constituted by polar atoms . Water molecules trapped in the dimeric protein intersubunit cavity, as identified in the crystal structure, display a trajectory mainly confined within the cavity . The simulation shows that these water molecules are characterized by relatively short residence times, because they continuously change from one site to another within the cavity, thus hinting at the absence of any relationship between spatial and temporal order for solvent molecules in proximity of protein surface .

Folia Microbiol (Praha), 2003, 48(1), 95 - 102
Standardized system for quantifying residual dirt on medical appliances cleansed in hospital washers--disinfectors: dirt detection by different methods; Sigler K et al.; An easy-to construct, easy-to-operate standardized system was developed for determining the residual biological contamination of surgical instruments, endoscopes and other medical appliances subjected to hospital cleansing and/or disinfection . It consists of standard-sized pieces of glass, metal or endoscope plastic--dirt carriers--either bare or enclosed in truncated Eppendorf caps to simulate hard-to-access conditions . The surface of the carriers is covered with model dirt simulating biological contamination and the carriers are then affixed to sturdy metal holders . Conventional model dirt were found to peel or flake off the carrier surface, lowering the precision of residual soil determination . A newly developed model dirt consisting of liver mash, lactose and sunflower oil and exhibiting low tendency to peel off surfaces was therefore used . The whole setup was subjected to chemical or enzymic cleansing programs at elevated temperature in hospital washer-disinfectors of two types, and the residual dirt after cleansing was determined by three methods . The method using toxicant-doped dirt that quenches the luminescence of an indicator bacterium Photobacterium phosphoreum gave satisfactory data under laboratory conditions but with hospital-washed samples it exhibited excessive fluctuations caused by bacterium--dirt interactions and by physical influences . Both other methods gave better results but displayed some process sensitivity . The luciferin-luciferase-based ATP bioluminescence assay sometimes gave low or even negative dirt level values and showed a low effect of reduced dirt accessibility on cleansing of metal carriers . The Bradford protein assay showed about equal cleansing efficiency for both easily and poorly accessible carriers after enzymic cleansing . Our system can be used for determining low levels of residual contamination of medical appliances after cleansing/disinfection and assessing the efficiency of commercial washer-disinfectors; its efficiency can be further increased by using a cleansing process-insensitive method for soil detection and quantification.

Dis Aquat Organ, 2003 Mar 17, 54(1), 35 - 41
Pharmacokinetics of flumequine and in vitro activity against bacterial pathogens of gilthead sea bream Sparus aurata; Rigos G et al.; The present study investigated the kinetic profile of flumequine (FLU) in gilthead sea bream Sparus aurata (170 g) held at 19 degrees C and evaluated its in vitro efficacy against important bacterial diseases in Mediterranean mariculture . Following a single intravascular injection (10 mg kg(-1) fish), the distribution half-life (t1/2alpha) and the half-life of the terminal phase of elimination (t1/2gamma) of the drug were 0.2 and 30 h respectively . Tissue penetration of FLU was low, since both the apparent distribution volume of the drug at steady-state (Vd(SS)) and the apparent volume of the central compartment (Vc) were small (0.57 and 0.15 l kg(-1)) . The mean residence time (MRT) was short (11 h) and the total clearance (CL(T)) of the drug was slow (0.05 l kg(-1) h(-1)) . Following oral administration (20 mg kg(-1)), the bioavailability (F %) of FLU was 29% and the maximum plasma concentration was 1.7 microg ml(-1) . The minimum inhibitory concentration (MIC) of the drug in distilled water supplemented with 2% NaCl against Vibrio anguillarum Serotype 1b, Photobacterium damsela ssp . piscicida, V . alginolyticus, V . damsela and V . fluvialis was 0.15, 0.3, 1.2, 0.019 and 0.15 microg ml(-1) respectively . The addition however of 10 mM Ca2+ and 55 mM Mg2+ to the medium resulted in an 8- to >120-fold reduction in FLU activity . The results indicate that FLU has an adequate kinetic profile in gilthead sea bream and that marine cations induce a significant impact on the activity of FLU, rendering its use against bacterial pathogens questionable.

Arch Environ Contam Toxicol, 2003 Apr, 44(3), 332 - 5
The acute toxicity of gluconic acid, beta-alaninediacetic acid, diethylenetriaminepentakismethylenephosphonic acid, and nitrilotriacetic acid determined by Daphnia magna, Raphidocelis subcapitata, and Photobacterium phosphoreum; Sillanpaa M et al.; Acute toxicity of four relatively new chelating agents and their equimolar manganese and cadmium complexes was studied . The chelating agents studied were gluconic acid (GA), beta-alaninediacetic acid (ADA), diethylenetriaminepentakismethylenephosphonic acid (DTPMP), and nitrilotriacetic acid (NTA) . Three common bioassays, namely Daphnia magna, Raphidocelis subcapitata, and Photobacterium phosphoreum (Microtox bioassay) were applied . R . subcapitata proved the most sensitive to these compounds . With D . magna bioassay the LC(50) values were 600-900 mg/L with all other studied chelates and their Mn complexes, except Mn-GA, which yielded LC(50) value of 240 mg/L . The Cd-chelate complexes proved highly more toxic compared to Mn-chelate complexes or uncomplexed chelates exhibiting LC(50) values of 130-200 microg/L . However, Cd-DTPMP was an exception exhibiting LC(50) value of 2170 microg/L . That is to say, DTPMP proved the strongest chelating agent to reduce the Cd toxicity in the present study . The results from these bioassays were well in agreement to each other as well as with the results published elsewhere.

Luminescence, 2003 May-Jun, 18(3), 156 - 61
Interaction of aromatic compounds with Photobacterium leiognathi luciferase: fluorescence anisotropy study; Kudryasheva NS et al.; The time-resolved and steady-state fluorescence techniques were employed to elucidate possible interactions of four aromatic compounds (anthracene, POPOP, MSB and 1,4-naphthalendiol) with bacterial luciferase . Fluorescence spectra and fluorescence anisotropy decays of these compounds were studied in ethanol, water-ethanol solutions and in the presence of bacterial luciferase . Shifts of fluorescent spectra and differences in rotational correlation times are interpreted in terms of weak (hydrophobic) interactions of the molecules with the enzyme . These interactions suggest the feasibility of intermolecular energy transfer by an exchange resonance mechanism with a collision-interaction radius as a way of excitation of these compounds in the reaction catalysed by bacterial luciferase .

Water Res, 2003 May, 37(9), 2223 - 7
Use of partition coefficients to predict mixture toxicity; Lin Z et al.; By using the C(18)-Empore disks/water partition coefficient (K(MD)) to describe the toxicity of 50 mixed halogenated benzenes to Photobacterium phosphoreum, an approach is proposed in this study . Application of the approach to the 15 other related mixtures prove the predictive capability of this K(MD)-based approach, due to the consistency between the predicted toxicity and the observed ones with r(2)=0.929, SE=0.104, F=169.513 at P<0.001 . Further analysis of this approach finds that, for the mixtures, although the toxicity is highly correlated with their hydrophobicity, this correlation is free from the range difference of the hydrophobicity, the ratio or the number of the individual chemicals . These analysis results suggest that this K(MD)-based approach is able to predict the toxicity of mixture pollutants in wastewater.

J Huazhong Univ Sci Technolog Med Sci, 2002, 22(3), 180 - 2
Reversion mutation in dark variants of luminous bacteria and its application in gene toxicant monitoring; Guo J et al.; The luminous intensity of dark variant (S1) separated from photobacterium phosphoreum (A2) was 1/10,000 less than that of wild-type . Ethidium bromide (EB) (0.6 mg/L), Mytomycin C (MC, 0.05 mg/L), 2-amino fluorene (2-AF, 1.0 mg/L) all could strongly induce reversion mutation for S1 within 24 h and increase reversion ratio significantly . The results of experiments indicated that these revertants had stable genetic characteristic and the mutation may take place at gene levels . The mutagenesis to S1 caused by EB, MC and 2-AF was detected and it may be used as a new rapid, simple and sensitive method for gene toxicant monitoring.

Environ Toxicol Chem, 2003 Mar, 22(3), 466 - 72
Multiple computer-automated structure evaluation study of aquatic toxicity . III . Vibrio fischeri; Klopman G et al.; An acute toxicity model was constructed on the basis of 901 chemicals tested for toxicity against the luminescent bacteria Vibrio fischeri (formerly Photobacterium phosphoreum, the Microtox test) . The model was created using the Multiple Computer-Automated Structure Evaluation (M-CASE) program . The model can correctly predict acute toxicity for 92% of the compounds with an error averaging 0.55 log units per median effect concentration (EC50) . The main toxicophores, corresponding to polar and nonpolar narcosis, and other types of reactive chemicals were identified.

Cell Biochem Biophys, 2003, 37(3), 157 - 67
Patch-clamp experiments with porins extracted from a marine bacterium (Photobacterium profundum strain SS9) and reconstituted in liposomes; Macdonald AG et al.; The reconstitution of bacterial porins in liposome bilayers for patch-clamp recording is well established . However, the solutions used in the dehydration, rehydration, and osmotic swelling of the liposomes have been developed for porins from enteric bacteria . Porins from marine bacteria normally function in contact with seawater whose ionic composition and osmotic pressure would appear to be incompatible with the established methods . Here, we show that, contrary to expectation, an established reconstitution and patch-clamp method works well with porins, mainly OmpH and OmpL, extracted from the deep-sea marine bacterium Photobacterium profundum strain SS9 and that seawater can be introduced at a supplementary stage.

J Mol Biol, 2003 Mar 7, 326(5), 1351 - 60
Active-site copper and zinc ions modulate the quaternary structure of prokaryotic Cu,Zn superoxide dismutase; Cioni P et al.; The influence of the constitutive metal ions on the equilibrium properties of dimeric Photobacterium leiognathi Cu,Zn superoxide dismutase has been studied for the wild-type and for two mutant protein forms bearing a negative charge in the amino acid clusters at the dimer association interface . Depletion of copper and zinc dissociates the two mutant proteins into monomers, which reassemble toward the dimeric state upon addition of stoichiometric amounts of zinc . Pressure-dependent dissociation is observed for the copper-depleted wild-type and mutated enzymes, as monitored by the fluorescence shift of a unique tryptophan residue located at the subunit association interface . The spectral shift occurs slowly, reaching a plateau after 15-20 minutes, and is fully reversible . The recovery of the original fluorescence properties, after decompression, is fast (less than four minutes), suggesting that the isolated subunit has a relatively stable structure, and excluding the presence of stable intermediates during the dimer-monomer transition . The dimer dissociation process is still incomplete at 6.5 kbar for the copper-depleted wild-type and mutated enzymes, at variance with what is generally observed for oligomeric proteins that dissociate below 3 kbar . Measurement of the degree of dissociation, at two different protein concentrations, allows us to calculate the standard volume variation upon association, Delta V, and the dissociation constant K(d0), at atmospheric pressure, (25 ml/mol and 3 x 10(-7)M, respectively) . The holoprotein is fully dimeric even at 6.5 kbar, which allows us to evaluate a lower Delta G degrees limit of 11.5 kcal/mol, corresponding to a dissociation constant K(d0)<10(-9)M.

Curr Microbiol, 2003 Mar, 46(3), 184 - 9
Numerical taxonomy of Vibrionaceae isolated from cultured amberjack (Seriola dumerili) and surrounding water; Alcaide E; A numerical taxonomic study was performed on 148 isolates of Gram-negative, heterotrophic, facultative anaerobic bacteria isolated from amberjack (Seriola dumerili) and its surrounding culture water . The study included 30 type and reference strains belonging to genera Vibrio, Listonella, and Photobacterium . The strains were characterized by 109 morphological, biochemical, physiological, and nutritional tests . Cluster analysis of similarity matrices obtained with S(SM) and S(J) coefficients was carried out . UPGMA (unweighted pair group mathematical average) analysis defined 11 phena at S(SM) values > or = 86% . Nine phena were identified as Vibrio alginolyticus, V . fischeri, V . harveyi, V . carchariae, V . mediterranei, V . splendidus, V . furnissii, V . parahaemolyticus, and Photobacterium damselae subsp . damselae . The two latter comprised strains isolated from diseased fish.

J Environ Sci (China), 2002 Oct, 14(4), 552 - 7
Comparative study of four QSAR models of aromatic compounds to aquatic organisms; Yu RL et al.; Quantitative structure-activity relationships (QSARs) were developed for 43 aromatic compounds toxicity to Photobacterium phosphoreum and Daphnia magna based on four methods: octanol/water partition coefficient, linear solvation energy relationship, molecular connectivity index and group contribution . Through the evaluation of four QSAR methods, LSER was proved to be the best . And it applied to the widest range of chemicals with the greatest accuracy.

Extremophiles, 2002 Dec, 6(6), 507 - 14 Epub 2002 Sep 07.
Solute accumulation in the deep-sea bacterium Photobacterium profundum; Martin DD et al.; The identity and amounts of intracellular solutes in the deep-sea bacterium Photobacterium profundum strain SS9 were studied using nuclear magnetic resonance techniques . P . profundum strain SS9, a moderate piezophile which grows optimally at 20-30 MPa primarily accumulated glutamate and betaine, with lesser amounts of alanine, beta-hydroxybutyrate (beta-HB) and oligomers composed of the beta-HB units when grown at 0.1 MPa to early stationary phase . When grown at the optimal pressure, the cells preferentially increased intracellular concentrations of beta-HB and beta-HB oligomers, while the amino acid pools remained relatively constant . Since the organic solutes increased with increasing external NaCl in the medium, they are functioning as osmolytes . The beta-HB molecules represent a novel class of osmolytes, termed 'piezolytes,' whose cellular levels responded to hydrostatic pressure as well as osmotic pressure . Factors such as cell growth stage and temperature were also examined for their effect on the solute distribution in these cells.

Ecotoxicology, 2002 Oct, 11(5), 337 - 42
QSAR of ecotoxicological data on the basis of data-driven if-then-rules; Pudenz S et al.; A rather small data matrix of seven chemicals and 17 different ecotoxicological end points is examined by methods of Discrete Mathematics . Especially, the lattice theory and its variant, the Formal Concept Analysis may be an attractive tool to analyze Quantitative Structure Activity Relationships, when a numerical functional approach is not at hand . The central item is the so called concept, which is a pair of subsets: A subset of molecules and a subset of properties which correspond to each other . The concepts are partially ordered due to a subset relation . From this subset relation, if-then-rules are derived, which aim to relate the structure of molecules with their ecotoxicological properties . For example, the following chemical rule is found: Cl --> (2A,2C,2M) . That means, all substances considered here having a "-Cl" as structural code have a medium ecotoxicological effect on Daphnia magna, Orconectes immunisare (Crustacea) and on Photobacterium phosphoreum, at least within the training set.

Eur J Biochem, 2002 Dec, 269(23), 5851 - 60
Stimulated biosynthesis of flavins in Photobacterium phosphoreum IFO 13896 and the presence of complete rib operons in two species of luminous bacteria; Kasai S et al.; Photobacterium phosphoreum IFO 13896 emits light strongly when cultured in medium containing 3% NaCl, but only weakly in medium containing 1% NaCl . It is known that dim or dark mutants appear frequently and spontaneously from this parent strain . To confirm that riboflavin biosynthesis is stimulated when the lux operon is active, the amount of light emitted and flavins synthesized under strongly or weakly light emitting conditions was determined . In comparison with the parent strain cultured in 3% NaCl, the same strain cultured in 1% NaCl emitted 1/36 the light and produced 1/4 the flavins, while three dim or dark mutants, M1, M2 and M3 cultured in 3% NaCl, emitted almost no light, 1/58 the light and 1/10 the light and produced 1/8, 1/5 and 1/3 the amount of flavins, respectively . From these results, we deduced that the genes for riboflavin synthesis, rib genes, are organized in an operon in this strain . In P . phosphoreum NCMB 844, it has been reported that a rib gene cluster is present just downstream of the lux operon . However, among rib genes, the gene for pyrimidine deaminase/pyrimidine reductase, ribD, was not found in this cluster . Because a complete rib operon seems to be necessary for efficient regulation at the transcriptional level, we expected ribD to be present downstream of this cluster and sequenced this region, using SUGDAT, Sequencing Using Genomic DNA As a Template . We could not find this gene but found a gene for hybrid-cluster protein (prismane protein) . To find ribD in a different region, a partial ribD sequence was amplified and sequenced using a PCR-based method, and subsequently the genomic DNA was sequenced in both directions from this partial sequence using SUGDAT . Because ribC was found just downstream of ribD, we sequenced further downstream of ribC and confirmed that another complete set of rib genes, ribD, ribC, ribBA, and ribE, is present in P . phosphoreum . The presence of a complete rib operon in P . phosphoreum explains why this species can synthesize flavins at enhanced levels to sustain a strong light emission . Furthermore, we sequenced the rib operon in Vibrio fischeri, another representative luminous bacterium, in a manner similar to that described above, and confirmed that a complete operon is present also in this species . The organization of rib genes in an operon in the Proteobacteria gamma-subdivision is discussed.

Klin Lab Diagn, 2002 Apr, (4), 39 - 41
{Interaction of cationic surface-active antiseptics and serum albumin by the bacterial bioluminescence method}; Katsev AM et al.; Human serum albumin binding of cationic surface-active antiseptics was studied using a Photobacterium phosphoreum K3 strain isolated by the authors in the Black sea . Binding of cationic surface-active proteins to serum albumin led to disappearance of toxic and antibacterial characteristics of miramistine, ethonium, and decametoxin, but not chlorohexidine . The activity of chlorohexidine was reduced by 45-48% in the presence of albumin . Albumin binding capacity towards miramistine was 7.0-8.7%, towards ethonium 8.2-10%, and towards decametoxin 2.4-3%.

Appl Environ Microbiol, 2002 Nov, 68(11), 5498 - 507
Bacteria of the gamma-subclass Proteobacteria associated with zooplankton in Chesapeake Bay; Heidelberg JF et al.; The seasonal abundance of gamma-subclass Proteobacteria, Vibrio-Photobacterium, Vibrio cholerae-Vibrio mimicus, Vibrio cincinnatiensis, and Vibrio vulnificus in the Choptank River of Chesapeake Bay associated with zooplankton was monitored from April to December 1996 . Large (>202- microm) and small (64- to 202- microm) size classes of zooplankton were collected, and the bacteria associated with each of the zooplankton size classes were enumerated by fluorescent oligonucleotide direct count . Large populations of bacteria were found to be associated with both the large and small size classes of zooplankton . Also, the species of bacteria associated with the zooplankton showed seasonal abundance, with the largest numbers occurring in the early spring and again in the summer, when zooplankton total numbers were correspondingly large . Approximately 0.01 to 40.0% of the total water column bacteria were associated with zooplankton, with the percentage of the total water column bacteria population associated with zooplankton varying by season . A taxonomically diverse group of bacteria was associated with zooplankton, and a larger proportion was found in and on zooplankton during the cooler months of the year, with selected taxa comprising a larger percent of the Bacteria in the summer . V . cholerae-V . mimicus and V . vulnificus comprised the bulk of the large and small zooplankton-associated Vibrio-Photobacterium species . In contrast, V . cincinnatiensis accounted for less than 0.1 to 3% . It is concluded that water column and zooplankton bacterial populations vary independently with respect to species composition since no correlation was observed between taxa occurring with highest frequency in the water column and those in association with zooplankton.

Appl Environ Microbiol, 2002 Nov, 68(11), 5488 - 97
Seasonality of Chesapeake Bay bacterioplankton species; Heidelberg JF et al.; Bacteria, gamma-subclass of Proteobacteria, Vibrio-Photobacterium, Vibrio vulnificus, Vibrio cholerae-Vibrio mimicus, and Vibrio cincinnatiensis in water samples collected from the Choptank River in Chesapeake Bay from 15 April to 16 December 1996 were enumerated using a fluorescent oligonucleotide direct-counting (FODC) procedure . FODC results obtained using a Bacteria taxon-specific probe ranged from one-third the number of to the same number as that obtained by the acridine orange direct count (AODC) procedure . The abundance of individual taxa (per liter) ranged from 0.25 x 10(10) to 2.6 x 10(10) Bacteria, 0.32 x 10(8) to 3.1 x 10(8) gamma-Proteobacteria, 0.2 x 10(8) to 2.1 x 10(8) Vibrio-Photobacterium, 0.5 x 10(7) to 10 x 10(7) V . vulnificus, 0.2 x 10(6) to 6 x 10(6) V . cholerae-V . mimicus, and 0.5 x 10(5) to 8 x 10(5) V . cincinnatiensis . The occurrence of all taxa monitored in this study was higher in summer; however, these taxa made up a larger proportion of the Bacteria when the water temperature was low . Large fluctuations in species abundance as well as in percent composition of Vibrio-Photobacterium occurred from week to week, indicating that localized blooms of these taxa occur . The cross-Choptank River transect sample profile of V . vulnificus and V . cholerae-V . mimicus varied significantly in abundance, and trans-Choptank River transect samples revealed a patchy distribution.

Biochemistry (Mosc), 2002 Sep, 67(9), 986 - 92
Role of Hsp70 (DnaK-DnaJ-GrpE) and Hsp100 (ClpA and ClpB) chaperones in refolding and increased thermal stability of bacterial luciferases in Escherichia coli cells; Zavilgelsky GB et al.; The role of chaperones Hsp70 (DnaK-DnaJ-GrpE) and Hsp100 (ClpA-ClpB-ClpX) in refolding of thermoinactivated luciferase from the marine bacterium Photobacterium fischeri and the terrestrial bacterium Photorhabdus luminescens has been studied . These luciferases are homologous, but differ greatly in the rate of thermal inactivation and the rate constant for the luminescence reaction . It was shown that refolding of thermoinactivated luciferases is completely determined by the DnaK-DnaJ-GrpE system . However these luciferases markedly differ in the rate and degree of refolding . The degree of refolding of thermolabile "quick" Ph . fischeri luciferase reaches 80% of the initial level over several minutes, whereas renaturation of thermostable "slow" Ph . luminescens luciferase proceeds substantially slower (the degree of renaturation reaches only ~7-8% of the initial level over tens of minutes) . The measurement of the rate of thermal inactivation of luciferases in vivo in the cells of Escherichia coli wild strain and strains containing mutations in genes clpA, clpB, clpX showed that Ph . luminescens luciferase revealed reduced thermostability in mutant strain E . coli clpA- . It was shown that this effect was not connected with DnaK-dependent refolding . In the case of thermolabile Ph . fischeri luciferase, mutation in gene clpA has no effect on the shape of the curve of thermal inactivation . These data suggest that denatured Ph . luminescens luciferase has enhanced affinity with respect to chaperone ClpA in comparison with DnaK, whereas thermolabile Ph . fischeri luciferase is characterized by enhanced affinity with respect to chaperone DnaK . Denatured luciferase bound to ClpA does not aggregate and following refolding proceeds probably spontaneously and very quickly (over 1-2 min) . It is evident that the process under discussion requires ATP, since the addition of uncoupler of oxidative phosphorylation carbonyl cyanide 3-chlorophenylhydrazone results in a sharp decrease in thermal stability of luciferase to the level typical of the enzyme in vitro . The enhanced thermosensitivity of luciferases was observed also in E . coli containing mutations in gene clpB . However, this effect, which takes place for Ph . fischeri luciferase as well as for Ph . luminescens luciferase, is determined by DnaK-dependent refolding and probably connected with the ability of chaperone ClpB to provide disaggregation of the proteins, resulting in their interaction with chaperones of the Hsp70 family (DnaK-DnaJ-GrpE).

Fish Shellfish Immunol, 2002 Sep, 13(3), 183 - 98
The professional phagocytes of sea bass (Dicentrarchus labrax L.): cytochemical characterisation of neutrophils and macrophages in the normal and inflamed peritoneal cavity; do Vale A et al.; In order to identify the phagocytic cells of sea bass, the peritoneal leucocyte population of fish injected intraperitoneally with Photobacterium damselae subspecies piscicida was studied by light microscopy using cytocentrifuge preparations stained by the Antonow technique for peroxidase detection . Among the leucocytes present in the peritoneal exudate of the infected fish (macrophages, neutrophils, eosinophilic granular cells, lymphocytes and thrombocytes), macrophages and neutrophils were the only phagocytic cells . Neutrophils were easily distinguished from macrophages in Antonow stained preparations by the pattern of peroxidase positivity . Using ultrastructural cytochemistry, neutrophils were found to have abundant cytoplasmic granules positive for peroxidase and arylsulphatase and were negative for alpha-naphthyl butyrate (ANB) esterase . In contrast, ANB esterase activity was detected in macrophages . These leucocytes were typically negative for peroxidase, but ocasionally, some macrophages with peroxidase or arylsulphatase-positive vacuoles were observed . Both phagocytes had cytoplasmic granules positive for acid phosphatase . Glycogen particles were found in the cytoplasm of the two phagocytic cells, but they were much more abundant in neutrophils . Macrophages were much more abundant than neutrophils in the peritoneal cavity of non-injected sea bass but early after the intraperitoneal injection of bacteria, the number of neutrophils increased quickly and extensively . Higher numbers of intraperitoneally injected bacteria were found inside macrophages as compared to neutrophils because macrophages strongly predominated in the peritoneal population at the time of injection . However, when the bacteria were injected into peritoneal cavities with high numbers of neutrophils (attracted by a previous injection of 12% casein), the percentage of neutrophils with phagocytosed bacteria increased, approaching that of infected macrophages . Taken together, these results show that in sea bass, as in many other organisms, in addition to macrophages, neutrophils are important phagocytic cells, the relative participation of each of the two phagocytes in defense mechanisms against infection depending on the opportunity to encounter the invading infectious agents.

J Appl Microbiol, 2002, 93(4), 681 - 8
Amplified fragment length polymorphism (AFLP) and biochemical typing of Photobacterium damselae subsp . damselae; Botella S et al.; AIMS: The aim of the present study was to characterize subspecifically Photobacterium damselae subsp . damselae strains isolated from cultured Sparus aurata and Dicentrarchus labrax by means of phenotypic and molecular typing techniques (amplified fragment length polymorphism, AFLP) . METHODS AND RESULTS: Seventy-one strains of P . damselae subsp . damselae were isolated from 38 cultured fishes at different fish farms located on the Mediterranean coast near Valencia, Spain . Most fish studied were asymptomatic and some were recovered during infectious outbreaks . Phenotypic characterization revealed a considerable degree of variability within the subspecies, including some characters, such as production of urease, which are used to differentiate P . damselae subsp . damselae from P . damselae subsp . piscicida . Genetic characterization was conducted on a selection of 33 strains, including two reference strains . Dice coefficient (Sd) and the unweighted pair group method with average linkage (UPGMA) were used for numerical analysis of banding patterns . AFLP type was defined on the basis of 100% similarity in the dendrogram obtained, yielding 24 distinct AFLP profiles . At 70% similarity, 13 clusters were defined, thus confirming the great variability observed for the phenotypic traits . CONCLUSIONS: The AFLP variability shown by the isolates was high enough to discriminate between different strains which colonize the same fish . However, closely related AFLP types were usually derived from strains isolated at the same fish farm, indicating an epidemiological relationship . SIGNIFICANCE AND IMPACT OF THE STUDY: This study has confirmed that the AFLP technique allows discrimination of individual strains within P . damselae subsp . damselae for epidemiological studies, and that this subspecies exhibits greater variability than that described for subspecies piscicida.

Ying Yong Sheng Tai Xue Bao, 2002 Apr, 13(4), 471 - 5
{Toxicity effect of substituted benzenes in oilfield wastewater by molecular orbital method}; Ji G et al.; The quantum parameters of energy of highest occupied molecular orbital (EHOMO), energy of lowest unoccupied molecular orbital (ELUMO), energy of next highest occupied molecular orbital (ENHOMO), energy of next lowest unoccupied molecular orbital (ENLUMO), heat of molecular formation(delta H0f) and dipole moment (mu) of 55 substituted benzenes are calculated based on MOPAC software of molecular orbital AM1 method . The QSAR model of multiple descriptors was established by the above parameters and the parameters of first-order valence-corrected molecular connectivity index (1Xv), octanol-water partition coefficient (logP), observed 30 min-EC50 values of photobacteria . The QSAR model of 55 substituted benzenes was also established by two parameters of 1Xv and EHOMO . The toxicity mechanism of different substitutions was discussed . Results showed that the combination of quantum and physio-chemical parameters was very useful in predicting biological activity of substituted benzenes in oilfield wastewater . The quantum parameters were ideal parameters in describing the toxicity of organic compounds in oilfield wastewater.

Waste Manag, 2002, 22(6), 583 - 93
Ecotoxicological assessment of leachates from MSWI bottom ashes; Lapa N et al.; In this paper, chemical and ecotoxicological data of leachates from bottom ashes colle