|
|
J Antibiot (Tokyo), 1991 Oct, 44(10), 1088 - 95 Localization of cephalosporinase in Enterobacter cloacae by immunocytochemical examination; Ishii Y et al.; Enterobacter cloacae NUH10 was isolated at Nagasaki University Hospital in 1987 . E . cloacae NUH10 is a mutant strain which produces high levels of cephalosporinase . E . cloacae ATCC 23355 is known to be sensitive to so-called third generation cephems and produces an inducible cephalosporinase . The polyclonal antibody to cephalosporinase extracted from E . cloacae NUH10 was utilized in post-embedding immunogold labeling in order to localize this protein in E . cloacae ATCC 23355 and E . cloacae NUH10 . Immunocytochemical localization of the cephalosporinase in both strains was observed with and without incubation with an inducer . Cephalosporinase was detected in both the cytoplasm and periplasmic space of E . cloacae ATCC 23355 and E . cloacae NUH10 incubated in medium including cefoxitin as an inducer . In the case of incubation without the inducer, a small quantity of cephalosporinase was located in the periplasmic space in either strain of bacteria . Western blot analysis showed that cephalosporinase was predominantly localized in the periplasmic space rather than in the cytoplasmic space. J Clin Microbiol, 1991 Oct, 29(10), 2300 - 4 Enterosistem 18-R: description and comparative evaluation with conventional methods for identification of members of the family Enterobacteriaceae; Piccolomini R et al.; The efficiency and accuracy of Enterosistem 18-R (Liofilchem s.r.l., Roseto degli Abruzzi, Teramo, Italy) were compared with those of conventional biochemical methods to identify 360 members (38 species) of the family Enterobacteriaceae . Overall, 329 strains (91.3%) were correctly identified (percentage of identification, greater than or equal to 90.0), with 37 (11.2%) requiring additional tests for complete identification . For 11 isolates (3.1%), Enterosistem 18-R gave only genus identifications, and for 14 (3.9%), the strains did not correspond to any key in the codebook and could not be identified by the manufacturer's computer service . Only six isolates (1.7%) were misidentified . The new system accurately identified common and several newly described isolates of the family Enterobacteriaceae, such as Enterobacter gergoviae, Providencia rustigianii, Serratia odorifera, and Serratia rubidaea . The system is highly reproducible, simple to perform, easy to handle, and inexpensive . With adjustments in supplementary code numbers for some strains, Enterosistem 18-R is a suitable alternative for identification of members of the Enterobacteriaceae in clinical laboratories. Radiat Res, 1991 Oct, 128(1), 100 - 3 Quinolone therapy in the prevention of mortality after irradiation; Brook I et al.; The effect of oral therapy with three quinolones (ofloxacin, ciprofloxacin, and pefloxacin) in the prevention of postirradiation bacteremia and mortality was tested in B6D2F1 mice given 9.5 Gy 60Co gamma radiation . Only 8 of 60 (13%) untreated mice survived for 30 days, compared to 47 of 60 (78%) mice treated with ofloxacin, 44 of 60 (74%) mice treated with ciprofloxacin, and 42 of 60 (70%) mice treated with pefloxacin (P less than 0.05) . The organisms recovered from the mice were Streptococcus spp . and Enterobacteriaceae . More Enterobacteriaceae were recovered from the livers of untreated animals than from the mice treated with the quinolones . However, no reduction in the number of Streptococcus spp . was noted in the animals given quinolones when compared to controls . This study shows that quinolones prolonged survival and decreased systemic spread of Enterobacteriaceae up to 30 days after exposure of mice to lethal irradiation. Mayo Clin Proc, 1991 Oct, 66(10), 1064 - 73 Cephalosporin antimicrobial agents and related compounds; Gustaferro CA et al.; Cephalosporins are broad-spectrum antimicrobial agents that are often used empirically to treat suspected bacterial infections and also to treat culture-proven infections due to selected gram-positive and gram-negative microorganisms . Cephalosporins differ widely in their spectrum of activity, susceptibility to beta-lactamases, serum half-life, and penetration of the central nervous system . In general, the first-generation and second-generation agents are most active against staphylococci and streptococci, and the third-generation agents are most active against the Enterobacteriaceae and Pseudomonas . As a group, cephalosporins have a favorable profile of toxicity in comparison with other antimicrobial agents . The development of bacterial resistance has affected all steps of the cephalosporin mechanism of action, including production of beta-lactamases, alterations in penicillin-binding proteins, and modification of the cell wall . New cephalosporins are among the most expensive pharmaceutical agents in use today . Maintaining expertise in the choice and use of these agents will remain a challenge to physicians as additional investigational cephalosporins continue to be developed and introduced into clinical practice. Mayo Clin Proc, 1991 Oct, 66(10), 1047 - 63 The penicillins; Wright AJ et al.; The penicillin family of antibiotics remains an important part of our antimicrobial armamentarium . In general, these agents have bactericidal activity, excellent distribution throughout the body, low toxicity, and efficacy against infections caused by susceptible bacteria . The initial introduction of aqueous penicillin G for treatment of streptococcal and staphylococcal infections was an important pharmacologic landmark . The emergence of penicillinase-producing Staphylococcus aureus prompted the development of the penicillinase-resistant penicillins (for example, methicillin, oxacillin, and nafcillin), in which an acyl side chain prevented disruption of the beta-lactam {corrected} ring . Subsequently, the aminopenicillins (such as ampicillin and amoxicillin) were developed because of the need for gram-negative antimicrobial activity . Their spectrum included Escherichia coli, Proteus mirabilis, Shigella Salmonella, Listeria, Haemophilus, and Neisseria . The search for a penicillin with additional antimicrobial activity against the Enterobacteriaceae and Pseudomonas aeruginosa led to the development of the carboxypenicillins (carbenicillin, ticarcillin, and temocillin) and the ureidopenicillins (mezlocillin, azlocillin, piperacillin, and apalcillin) . Finally, the combination of a beta-lactamase inhibitor (clavulanic acid or sulbactam) and an aminopenicillin or ticarcillin has further extended their antibacterial spectra . The development of an ideal penicillin that is rapidly bactericidal, nonsensitizing, nontoxic, bioavailable, resistant to beta-lactamase, and without inoculum effect and that has a high affinity for penicillin-binding proteins remains the goal. J Bacteriol, 1991 Oct, 173(19), 6303 - 6 Occurrence of 2-keto-3-deoxy-D-manno-octonic acid in lipopolysaccharides isolated from Vibrio parahaemolyticus; Han TJ et al.; The occurrence of 2-keto-3-deoxy-D-manno-octonic acid (KDO) in lipopolysaccharides (LPS) of Vibrio parahaemolyticus was demonstrated for the first time by gas chromatography-mass spectrometry after dephosphorylation, reduction, and methylation . KDO was virtually completely phosphorylated, since no KDO was detected by either gas chromatography or thiobarbituric acid assay before dephosphorylation . The level of KDO in all six strains of V . parahaemolyticus investigated ranged from 0.37 to 0.69%, which was considerably lower than that in enterobacterial LPS. J Bacteriol, 1991 Oct, 173(19), 6265 - 9 Structural and functional relationships between Pasteurella multocida and enterobacterial adenylate cyclases; Mock M et al.; The Pasteurella multocida adenylate cyclase gene has been cloned and expressed in Escherichia coli . The primary structure of the protein (838 amino acids) deduced from the corresponding nucleotide sequence was compared with that of E . coli . The two enzymes have similar molecular sizes and, based on sequence conservation at the protein level, are likely to be organized in two functional domains: the amino-terminal catalytic domain and the carboxy-terminal regulatory domain . It was shown that P . multocida adenylate cyclase synthesizes increased levels of cyclic AMP in E . coli strains deficient in the catabolite gene activator protein compared with wild-type strains . This increase does not occur in strains deficient in both the catabolite gene activator protein and enzyme III-glucose, indicating that a protein similar to E . coli enzyme III-glucose is involved in the regulation of P . multocida adenylate cyclase . It also indicates that the underlying process leading to enterobacterial adenylate cyclase activation has been conserved through evolution. Clin Chem, 1991 Oct, 37(10 Pt 1), 1734 - 6 Enzymatic method for measuring ethylene glycol with a centrifugal analyzer; Standefer J et al.; We describe a semiautomated, enzymatic method of analysis for ethylene glycol in plasma . Glycerol dehydrogenase (EC 1.1.1.6) from Enterobacter aerogenes, which has high specificity for ethylene glycol, is mixed with 3 microL of specimen in a centrifugal analyzer . NAD+ is added to initiate the reaction, and 450 s after an initial 90-s delay, the absorbance at 340 nm is measured . Monthly calibration with a five-point calibration curve is sufficient to provide between-day precision (CV) of 2% to 5% . The detection limit is 0.3 mmol/L with a CV of 10% . There is no significant interference from ethanol, methanol, isopropanol, acetone, lactate, or glycerol. Rev Med Chil, 1991 Oct, 119(10), 1115 - 22 {Infections in systemic lupus erythematosus}; Massardo L et al.; In this review of 159 pts with systemic lupus erythematosus (SLE) followed for 18 years, 78 pts had major infections (20/100 pt-years) . Patients with infection had a higher incidence of proteinuria, central nervous system involvement, the use of methylprednisolone boluses and mortality rate . Infection was independent of the amount of steroids and immunosuppressor drugs used . Microorganisms were isolated in 77% of the cases, gram negative enterobacteria were the most common isolates . 30% of the pts had pulmonary infection; and 84% of the infections happened during steroid therapy . Immunosuppression was associated to repeated infections . The 19 pts with fatal infections had a higher frequency of pneumonia and septicemia, and received high doses of steroids (> or = 40 mg) . No relation to immunosuppression was found in this group . In 26% opportunistic microorganisms were isolated in association to the use of high doses of steroids . Even if survival of SLE has improved in the last 40 years, infections are still an important cause of mortality, most of them related to aggressive steroid therapy. Med Trop (Mars), 1991 Oct-Dec, 51(4), 429 - 33 {Neonatal bacterial infections in the tropical zone}; Cisse MF et al.; One thousand and ten miscellaneous samples collected from infected newborns, were tested at the bacteriology laboratory of A . Royer Children's Hospital from 1983 to 1991 . These samples included 471 blood cultures, 114 pus of various origins, 410 cerebrospinal fluids and 15 urines . One bacteria or bacterial soluble antigens were detected in 294 samples (29.2%) . Positivity percentage was 29.2% for septicemia, 68.4% for suppurations, 17.8% for meningitidis and 33.3% for urinary tract infections . Altogether, we isolated 156 enterobacteria (53%), 14 Gram negative bacilli (4.7%) and 124 cocci (42.1%) among them 19 streptococci (A, B, C) and 25 pneumococci . Three major species were identified: S . aureus (25.8%), Klebsiella spp (19.7%) and Escherichia coli (14.6%) . The most efficient antibiotics against all strains were AKN, CTX, CRO and GEN. Rev Invest Clin, 1991 Oct-Dec, 43(4), 318 - 22 {In vitro comparison of ciprofloxacin with other antibiotics against multiresistant gram-negative bacilli}; Soto Hernandez JL et al.; In 2784 specimens submitted to the Clinical Microbiology Laboratory of the Instituto Nacional de Neurologia from May 1989 to January 1990, 140 (5.0%) had gram negative bacilli (GNB) resistant to five or more antibiotics . One hundred different isolates recovered from urine, tracheal aspirates, blood, cerebrospinal fluid, surgical wound infections and other sites were studied . Pseudomonas spp, Enterobacter spp, Klebsiella pneumoniae and Escherichia coli accounted for 86% of the total . Disk diffusion susceptibility tests with the NCCLS method revealed 59 to 67% of isolates susceptible to amikacin, ciprofloxacin and ceftazidime . Sixteen to 30% were inhibited by piperacillin, cefoperazone and cefotaxime . Less than 10% were susceptible to carbenicillin, tobramycin, gentamicin, cephalothin and ampicillin . Minimum inhibitory concentrations (MIC) to amikacin and ciprofloxacin were determined by broth macrotube dilution in Mueller-Hinton broth supplemented with Ca and Mg ions with a 5 x 10(5) cfu/mL inocula . MIC of 16 ug/mL or less for amikacin was found in 39% of the isolates; MIC 50 was 32 ug/mL and MIC 90 greater than 64 ug/mL . Ciprofloxacin had MIC 50 of 1 ug/mL and an MIC 90 greater than 4 ug/mL . Higher MICs to ciprofloxacin were seen in Pseudomonas spp. J Biochem (Tokyo), 1991 Oct, 110(4), 614 - 21 Novel plasmid vectors for gene cloning in Pseudomonas; Itoh N et al.; Novel host-vector systems have been developed for gene cloning in the metabolically versatile bacterial genus Pseudomonas . We found that a new Pseudomonas strain, Pseudomonas flavida IF-4, isolated from soil, carried two small cryptic plasmids, named pNI10 and pNI20 . They were multi-copy, but not self-transmissible, and the genome size was 3.7 kb for pNI10 and 2.9 kb for pNI20 . Several types of cloning vectors containing a kanamycin or streptomycin resistance (Kmr or Smr) gene were constructed from pNI10 and pNI20 . These plasmid vectors were efficiently transformed into several strains of Pseudomonas at a frequency up to 4 x 10(5) transformants per 1 microgram plasmid DNA by the usual competent cell method . The vectors derived from pNI10 replicated not only in Pseudomonas but also in some other Gram-negative enteric bacteria such as Escherichia coli, Enterobacter aerogenes, and Proteus mirabilis. J Antimicrob Chemother, 1991 Oct, 28(4), 577 - 80 Ceftibuten versus cefaclor for the treatment of bronchitis; Chirurgi VA et al.; Ceftibuten is an oral third generation cephalosporin with potent antimicrobial activity against Enterobacteriaceae, beta-lactamase positive Haemophilus influenzae, Moraxella catarrhalis, Neisseria meningitidis, Neisseria gonorrheae, penicillin-susceptible pneumococci, and beta-hemolytic streptococci . To study the efficacy and safety of ceftibuten for treatment of bronchitis, 58 patients were randomized to therapy with either ceftibuten 400 mg once a day or cefaclor 250 mg every 8 h at a ratio of two to one . Of 45 clinically evaluable patients, 28 (87.5%) of the 32 ceftibuten patients and 12 (92.3%) of the 13 cefaclor patients were clinically improved or cured . Of 33 microbiologically evaluable patients, 21 (87.5%) of the 24 ceftibuten patients and eight (80%) of the ten cefaclor patients were cured . Of 56 patients evaluable for adverse effects, three (7.9%) of the 38 ceftibuten patients and one (5.6%) of the 18 cefaclor patients had adverse reactions . In this small study, once-daily ceftibuten appeared as safe and as effective as cefaclor for the treatment of bronchitis. J Antimicrob Chemother, 1991 Oct, 28(4), 499 - 504 Imipenem resistance associated with the loss of a 40 kDa outer membrane protein in Enterobacter aerogenes; Chow JW et al.; An imipenem-resistant strain, Enterobacter aerogenes EA-Z, was isolated from a blood culture . Outer membrane protein (OMP) profiles indicated the loss of a 40 kDa OMP, decreased expression of 42 and 44 kDa OMPs, and increased expression of a 50 kDa OMP in strain EA-Z when compared with imipenem-susceptible clinical isolates of E . aerogenes . The OMP profile of EA-Z was similar to that of strain EA-SI16, an imipenem-resistant E . aerogenes second-step mutant selected on imipenem-containing media . A single-step imipenem-resistant mutant, EA-SI8, had lost expression of only the 40 kDa OMP . No new beta-lactamase could be detected by isoelectric focusing, and no increase in imipenem hydrolysis was seen when EA-Z was compared with imipenem-sensitive controls, even in the presence of added zinc . These data suggest that the 40 kDa OMP of E . aerogenes might be required for the normal diffusion of imipenem across the outer membrane. Antimicrob Agents Chemother, 1991 Oct, 35(10), 2057 - 64 Comparative study of pharmacokinetics and serum bactericidal activity of ceftizoxime and cefotaxime; Vallee F et al.; Single 2-g intravenous doses of ceftizoxime (CZX) and cefotaxime (CTX) were given over 30 min to 10 adult volunteers in a crossover manner on two separate occasions . Concentrations of CZX, CTX, and the primary metabolite of CTX, desacetylcefotaxime (dCTX), in serum, suction-induced-blister fluid, and urine were determined by high-pressure liquid chromatography . Pharmacokinetic parameters were estimated by using an extended least-squares modeling program (MKMODEL) . CZX exhibited a half-life in serum (2.05 h) longer than that of CTX (1.43 h) but comparable to that of dCTX (2.02 h) . The percentage of penetration in blister fluid, estimated by area under the curve ratios, was significantly higher for CZX (164.4%) than for CTX (60.8%) . Serum bactericidal activity, determined for volunteer samples at 1, 6, 8, and 12 h after patients were dosed, against clinical isolates of the Bacteroides fragilis group, Enterobacter cloacae, Escherichia coli, Klebsiella pneumoniae, and Morganella morganii were significantly higher for CZX than those for CTX against members of the family Enterobacteriaceae at all times . Serum bactericidal titers against B . fragilis were also higher for CZX than for CTX at 1 h postinfusion . Neither CZX nor CTX exhibited any bactericidal activity at any other time against the B . fragilis group . In conclusion, the serum bactericidal activity of CZX was greater and more-prolonged than that of CTX against tested strains in spite of the in vitro synergistic contribution of dCTX to CTX, equal serum elimination half-lives of dCTX and CZX, and similar antibacterial activity and similar instability under microbiological testing for CZX and CTX. Mol Gen Mikrobiol Virusol, 1991 Oct, (10), 16 - 9 {Design of a species-specific DNA probe based on the pFra plasmid of the plague pathogen}; Shishkina OG et al.; The recombinant plasmid pBS1 carrying a 2 kb SalGI fragment of Yersinia pestis pFra plasmid was constructed by insertion of the fragment into a vector plasmid pBR327 . SalGI-BspRI 400 bp subfragment was recloned into a pBR322 vector plasmid . Open reading frame was found in the fragment by DNA sequencing technique . The subfragment designated F1-probe permits one to identify specifically the Yersinia pestis strains harbouring pFra plasmid, thus, differing them from closely related Yersiniea and other representatives of Enterobacteriaceae family. Int J Food Microbiol, 1991 Oct, 14(1), 59 - 66 Temperature in agar plates and its influence on the results of quantitative microbiological food analyses; Peterz ME; The numbers of colony forming units (cfu) of some strains of Enterobacteriaceae growing in Violet Red bile agar at 44 degrees C can vary considerably depending on incubation conditions and location of an individual agar plate in a stack . The reason is that the heating-up rates of the agar in plates incubated at elevated temperatures are slower if the incubators do not have an air circulator and/or if the plates are located in the centre of a stack . Variability in agar temperatures among different plates after 24 h of incubation at 44 degrees C was higher if plates were placed in an incubator with an air circulator than in an incubator without one . This effect could be avoided if the plates were incubated enclosed in a plastic bag. Eur J Clin Microbiol Infect Dis, 1991 Oct, 10(10), 843 - 6 Lack of emergence of significant resistance in vitro and in vivo to the new azalide antibiotic azithromycin; Retsema JA et al.; In vitro experiments were performed in which 6 to 12 strains of Staphylococcus aureus, Streptococcus pyogenes, Haemophilus influenzae and Enterobacteriaceae were passaged nine times in sub-lethal concentrations of azithromycin or control antibiotics . Streptococcus pyogenes and Staphylococcus aureus quickly became resistant to rifampin as the MIC90 increased from 0.1 to greater than 50 micrograms/ml for both species . The MIC90 of azithromycin, erythromycin, amoxicillin and cefaclor increased by three dilutions for Staphylococcus aureus . The MIC values of azithromycin for Streptococcus pyogenes, Haemophilus influenzae and Enterobacteriaceae strains did not change significantly . However, for Haemophilus influenzae and the Enterobacteriaceae strains, the MIC values of erythromycin and oral cephalosporins increased four-fold . In the in vivo experiments, mice infected with Staphylococcus aureus or Escherichia coli contaminated sutures were administered azithromycin for three days, and on day 6 viable bacterial cells were recovered from the infection site . The sustained tissue concentrations of azithromycin indicated that the organisms would have been continuously exposed to azithromycin at the site of infection . Colonies isolated from azithromycin-treated and non-treated mice were cultured and their susceptibility to azithromycin compared . The azithromycin MIC values for Staphylococcus aureus cultures from treated and non-treated animals were identical . The azithromycin MICs for Escherichia coli recovered from treated animals were on average, less than one dilution higher than for control cultures . Emergence of significant resistance to azithromycin in the laboratory was not observed with the pathogens tested. Antimicrob Agents Chemother, 1991 Oct, 35(10), 2155 - 8 Increased resistance to multiple drugs by introduction of the Enterobacter cloacae romA gene into OmpF porin-deficient mutants of Escherichia coli K-12; Komatsu T et al.; Introduction of the romA gene cloned from Enterobacter cloacae into Escherichia coli K-12 resulted in almost complete inhibition of OmpF expression and a concomitant increase in resistance to quinolones, beta-lactams, chloramphenicol, and tetracyclines . In addition, the romA gene reduced the susceptibility to these multiple drugs even in the OmpF porin-deficient mutants of E . coli K-12 . Results indicate the presence of romA-sensitive penetration pathway(s) for these multiple drugs other than the OmpF porin in E . coli. Am J Med, 1991 Sep 16, 91(3B), 72S - 75S Major trends in the microbial etiology of nosocomial infection; Schaberg DR et al.; To determine trends in the microbial etiology of nosocomial infections in the 1980s, surveillance data on the microbiology of documented nosocomial infection reported to the National Nosocomial Infections Surveillance System and from the University of Michigan Hospital were analyzed . Antimicrobial susceptibility data on selected pathogens from both sources were also reviewed . Overall, Escherichia coli decreased from 23% of infections in 1980 to 16% in 1986-1989, Klebsiella pneumoniae dropped from 7% to 5%, whereas coagulase negative staphylococci increased from 4% to 9% and Candida albicans increased from 2% to 5% . Staphylococcus aureus, Pseudomonas aeruginosa, Enterobacter species and enterococci had minor increases, but antimicrobial resistant strains for these pathogens as well as coagulase-negative staphylococci were seen more frequently . In contrast to the 1970s, major shifts in the etiology of nosocomial infection have occurred in the decade of the 1980s . Taken as a whole, the shifts are away from more easily treated pathogens toward more resistant pathogens with fewer options for therapy . These shifts underscore the continued need for prevention and control to accompany new developments in therapy. Am J Med, 1991 Sep 16, 91(3B), 82S - 85S Mechanisms and implications of glycopeptide resistance in enterococci; Derlot E et al.; Glycopeptide resistance is recent in enterococci and its expression is inducible by glycopeptides . Two phenotypes can be distinguished: (a) resistance to high levels of vancomycin and teicoplanin, and (b) resistance to low levels of vancomycin only . There is no cross-resistance between glycopeptides, glycolipodepsipeptides (ramoplanin), and lipopeptides (daptomycin) . The determinants conferring low-level resistance are nontransferable and presumably chromosomal . High-level resistance is plasmid-mediated and the plasmids range from 34 to 40 kb, are self-transferable, and encode various resistance combinations . All plasmids share the same glycopeptide resistance determinant, which is distinct from that conferring low-level resistance . Induction of resistance is associated with induction of about a 40 kDa protein . We have determined the sequence of the vanA gene encoding one such resistance protein designated VANA . Amino acid sequence similarity was detected between VANA and D-Ala: D-Ala ligases from Enterobacteriaceae . Complementation analysis in Escherichia coli indicated that VANA possesses D-Ala: D-Ala ligase activity and is therefore related to enzymes that catalyze synthesis of glycopeptide target, i.e., terminal D-Ala-D-Ala of peptidoglycan precursors . The contribution of VANA to synthesis of peptidoglycan in the presence of glycopeptides is unknown: VANA could bind to D-Ala-D-Ala, preventing the binding of the drugs; could modify the target of the drug; and could be a ligase with novel specificity. Biochem J, 1991 Sep 15, 278 ( Pt 3), 801 - 7 The importance of the negative charge of beta-lactam compounds in the interactions with active-site serine DD-peptidases and beta-lactamases; Varetto L et al.; The interaction between various penicillins and cephalosporins the carboxylate group of which at C-3 or C-4 had been esterified or amidated and different penicillin-recognizing enzymes was studied . In general, our findings reinforced the common assumption that an anionic group at that position is necessary for the effective acylation of these enzymes . However, the relative activities of the modified beta-lactams as inactivators of the Streptomyces R61 DD-peptidase or as substrates of the Bacillus licheniformis, Streptomyces albus G and Enterobacter cloacae beta-lactamases did not fit a general scheme in which the intrinsic electronic and geometric properties of the beta-lactam compounds would be sufficient to explain their substrate or inactivator properties towards the various types of enzymes investigated. J Immunol, 1991 Sep 15, 147(6), 1899 - 904 Binding sites for endotoxins (lipopolysaccharides) on human monocytes; Couturier C et al.; The nature of the binding sites for LPS on human monocytes was investigated using {3H} labeled intact LPS from Neisseria meningitidis and from Salmonella minnesota R7, and the {3H} labeled purified inner core region (PS-OMe) of S.m . R7 LPS . In the presence of serum, intact LPS from enterobacterial and nonenterobacterial strains bound to monocytes in a dose-dependent, saturable, and displaceable fashion . N.m . LPS and LPS from the enterobacterial strain of Escherichia coli 0111-B4 bound to the same sites on monocytes as assessed in competitive binding experiments . Specific binding of intact LPS to monocytes occurred through the CD14 molecule as shown by the ability of mAb and of F(ab')2 fragments of mAb directed against specific epitopes of CD14 to inhibit the binding of {3H}-LPS to cells and by the lack of binding of intact LPS to CD14-deficient cells from patients with paroxysmal nocturnal hemoglobinuria . Specific binding of LPS to monocytes was not mediated by the CD11/CD18 complex because mAb to the alpha and beta chains of the Leu-CAM molecules did not alter the binding of LPS to cells and because LPS did not inhibit the binding of labeled mAb to monocytes . {3H}-PS-OMe also bound in a dose-dependent and displaceable fashion to monocytes involving an unidentified, non-CD14, binding site on the cells . Binding of LPS to monocytes also involved nonsaturable binding sites for hydrophobic structures of LPS as evidenced in binding experiments performed in the absence of serum . These observations indicate that intact LPS may interact with the monocyte membrane in at least three ways including serum-dependent binding to CD14 and to a lectin-like receptor, and serum-independent hydrophobic interactions. Antimicrob Agents Chemother, 1991 Sep, 35(9), 1840 - 8 Genetic analyses of sulfonamide resistance and its dissemination in gram-negative bacteria illustrate new aspects of R plasmid evolution; Radstrom P et al.; In contrast to what has been observed for many other antibiotic resistance mechanisms, there are only two known genes encoding plasmid-borne sulfonamide resistance . Both genes, sulI and sulII, encode a drug-resistant dihydropteroate synthase enzyme . In members of the family Enterobacteriaceae isolated from several worldwide sources, plasmid-mediated resistance to sulfonamides could be identified by colony hybridization as being encoded by sulI, sulII, or both . The sulI gene was in all cases found to be located in the newly defined, mobile genetic element, recently named an integron, which has been shown to contain a site-specific recombination system for the integration of various antibiotic resistance genes . The sulII gene was almost exclusively found as part of a variable resistance region on small, nonconjugative plasmids . Colony hybridization to an intragenic probe, restriction enzyme digestion, and nucleotide sequence analysis of small plasmids indicated that the sulII gene and contiguous sequences represent an independently occurring region disseminated in the bacterial population . The sulII resistance region was bordered by direct repeats, which in some plasmids were totally or partially deleted . The prevalence of sulI and sulII could thus be accounted for by their stable integration in transposons and in plasmids that are widely disseminated among gram-negative bacteria. DICP, 1991 Sep, 25(9), 972 - 7 Overview of synergy with reference to double beta-lactam combinations; Hopefl AW; Combination antimicrobial therapy is used to expand the bacterial coverage over a single agent, to prevent the emergence of resistant organisms, to decrease toxicity by allowing lower doses of both agents, or for synergy . Synergy is one of the most common of these reasons, especially in serious infections . The introduction of new broad-spectrum beta-lactam antimicrobials has led to their combination in the treatment of seriously ill patients . Whereas a combination of an aminoglycoside and a beta-lactam antimicrobial is frequently synergistic, much less is known about synergy between combinations of beta-lactams . In vitro testing shows most combinations of two beta-lactams to be indifferent or additive in their effects; rarely does synergy occur . Antagonism can sometimes be seen, particularly with combinations involving cefoxitin or imipenem, especially if the treated organism is Enterobacter or Pseudomonas . Results of clinical trials comparing double beta-lactam (DBL) therapy with aminoglycoside/beta-lactam combinations show no difference in clinical response rates . Highly active DBL combinations may substitute for standard aminoglycoside-containing regimens in certain situations, even though they are not reliably synergistic . However, in the treatment of seriously ill patients such combinations may be less desirable. Urologe A, 1991 Sep, 30(5), 306 - 9 {Problems of infection in polymer implants}; Jansen B et al.; Infections associated with indwelling devices have become a major problem in modern medicine . Coagulase-negative staphylococci and to a lesser extent Staphylococcus aureus, enterobacteriaceae und fungi are the predominant causative organisms in the etiology of these infections . The general features of the pathogenesis of foreign body infections are discussed, as are the clinical picture and therapy . Special emphasis is given to the occurrence of polymer-associated infections in urological devices such as penile prostheses and to their prevention and therapy. Mutat Res, 1991 Sep-Oct, 250(1-2), 211 - 21 Widespread adaptive response against environmental methylating agents in microorganisms; Sedgwick B et al.; Many bacterial species have adaptive responses which protect against the toxicity and mutagenicity of methylating agents . Induced 3-methyladenine-DNA glycosylase and O6-methylguanine-DNA methyltransferase activities increase the cellular capacity of E . coli, B . subtilis, and M . luteus to repair toxic and mutagenic methylated base derivatives in DNA . The DNA methyltransferase or Ada protein of E . coli regulates the response and is converted into a strong transcriptional activator by self-methylation on repair of a methylphosphotriester in DNA . The multiple functions of the E . coli Ada protein (39 kDa) are split between two proteins, AdaA (24 kDa) and AdaB (20 kDa), in B . subtilis . Proteins (39 kDa) recognised by anti-Ada antibodies are efficiently induced in several enterobacterial species and correlate with increased DNA methyltransferase activities . In contrast, an "Ada-related" protein is only weakly induced in Salmonella typhimurium and no increase in DNA repair activity is detectable . The existence of adaptive responses in diverged bacterial species suggests the frequent occurrence of methylating agents in the environment . Several direct-acting methylating agents which are known to arise in the environment have been shown to induce the response . These include abundantly occurring methyl chloride, the antibiotic streptozotocin, the precursors of the known labile inducers N-methyl-N'-nitrosourea and N-methyl-N'-nitro-N-nitrosoguanidine and as shown in this paper, methyl radicals which may arise by the irradiation or oxidation of methyl compounds. Nippon Geka Gakkai Zasshi, 1991 Sep, 92(9), 1276 - 9 {Factors relating to postoperative infections in cancer patients}; Sakamoto Y et al.; Some factors relating to the increasing prevalence of postoperative infections after gastroenterological surgery were investigated from the standpoint of both patients profile and isolated bacteria . Data were collected from 542 cancer patients comprising 39 with esophagus cancer, 229 with gastric cancer, 149 with hepato-biliary tract and pancreatic cancer and 125 with colon cancer . Respiratory infections after operations were most frequently caused by aging, disturbance of glucose tolerance and respiratory dysfunction, whereas with intraabdominal abscess the major factors were disturbance of glucose tolerance, hepatic dysfunction and respiratory dysfunction in this order . Two factors in the management of patients during operation were singled out as mainly contributing to infection: these were prolonged operative time as in the case of esophagus cancer or hepato-biliary tract and pancreatic cancer, and massive intraoperative bleeding as in hepato-biliary tract, pancreatic and gastric cancer . As isolated bacteria, the most frequent clinical isolates were MRSA, Enterococcus, P . aeruginosa and Enterobacter, and it is noteworthy that all of these were strongly resistant to all antimicrobial agents . The greater emphasis on prevention control of postoperative infections, therefore, should be focussed on aging, preoperative risk factors, surgical stress and the kinds of antimicrobial agents administered. Oral Surg Oral Med Oral Pathol, 1991 Sep, 72(3), 300 - 8 Multivariate study of enterobacteria and Pseudomonas in saliva of patients with acute leukemia; Wahlin YB et al.; The effect of antibacterial treatment on the prevalence of gram-negative rods (enterobacteria and Pseudomonas) in the mouths of patients with leukemia was studied . Of the patients' salivary samples, 45% contained gram-negative rods compared with 12% in a control group of healthy persons . The antibacterial resistance patterns of gram-negative rods from healthy persons were different from those of the hospitalized patients . No relationship was found between the amount of antibacterial treatment and presence of gram-negative rods . The gram-negative rods recovered from individual patients were usually not resistant to the antibacterial agents given to the patients in question . Only a few patients harbored the same clone of a gram-negative rod for a lengthy period . The resistance patterns of these clones of gram-negative rods were similar to those of gram-negative rods that were transient in the mouth . It was concluded that resistance to antibacterial agents is not a factor of major importance for the capacity of the gram-negative rods to become established in the mouths of hospitalized patients with leukemia. Infect Immun, 1991 Sep, 59(9), 3346 - 9 Comparative immunochemistry of lipopolysaccharides from Branhamella catarrhalis strains; Fomsgaard JS et al.; Lipopolysaccharides (LPS) were extracted and purified from the type strain and from a clinical isolate of Branhamella catarrhalis . Chemical analysis revealed the presence of glucose, galactose, and glucosamine in different molar proportions in the LPS from these two isolates, whereas there was no difference between the two isolates in the ratios of ketodeoxyoctonate, phosphate, and the fatty acids C12, 3-OH-C12, and 3-OH-C11 present . Heptose or 3-OH-C14 was not detectable in either preparation . LPS from both strains appeared semirough according to sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis, presenting a core polysaccharide plus one repeating unit . Immunoblotting, passive hemolysis, and hemolysis inhibition assays using anti-LPS antibodies from immunized rabbits demonstrated cross-reactivity between the LPS preparations; however, antigenic dissimilarities were also found, suggesting that more than one serotype may exist . The lipid A isolated from the two LPS was serologically identical and exhibited cross-reactivity with lipid A of members of the family Enterobacteriaceae . The B . catarrhalis LPS were biologically active, causing lethality in D-galactosamine-sensitized C57/BL6 mice and inducing Limulus amoebocyte lysate gelation. Mol Gen Genet, 1991 Sep, 229(1), 155 - 60 Structural and functional analysis of the rcsA gene from Erwinia stewartii; Poetter K et al.; RcsA is a positive regulator of genes for extracellular polysaccharide biosynthesis in the Enterobacteriaceae . The nucleotide sequence of the rcsA gene from Erwinia stewartii was determined and compared to rcsA sequences from E . amylovora, Escherichia coli, and Klebsiella pneumoniae . Three highly conserved regions of the gene were identified . The C-terminal end of the open reading frame (ORF) shared significant amino acid homology to the LuxR class of bacterial activator proteins . Insertion and deletion mutagenesis of the 5' non-coding region indicated that maximal expression of rcsA was dependent upon cis-acting regulatory sequences located more than 300 bp upstream of the translational start site. Chest, 1991 Sep, 100(3), 628 - 30 The differential effect of cigarette smoke on the growth of bacteria found in humans; Ertel A et al.; The effect of cigarette smoke on growth of those species of bacteria that are considered common potential human pathogens was examined in vitro . Smoke from both mentholated and nonmentholated cigarettes inhibited the growth of Gram-positive cocci to a greater degree than that of Gram-negative rods . Staphylococcus aureus, Streptococcus pneumoniae, and a variety of other streptococci were inhibited at a smoke solution dilution of 1:8 . Enteric bacteria such as Klebsiella, Enterobacter, and Pseudomonas were not affected by a 1:1 dilution of the solution . As with the Gram-positive cocci, the Neisseria species and Branhamella were also inhibited at a dilution of 1:8 . Culture results of the mouth of 15 smokers and 15 nonsmokers showed that the smokers have a propensity to develop heavy Gram-negative bacterial colonization. J Bacteriol, 1991 Sep, 173(18), 5604 - 11 Mutagenic DNA repair in enterobacteria; Sedgwick SG et al.; Sixteen species of enterobacteria have been screened for mutagenic DNA repair activity . In Escherichia coli, mutagenic DNA repair is encoded by the umuDC operon . Synthesis of UmuD and UmuC proteins is induced as part of the SOS response to DNA damage, and after induction, the UmuD protein undergoes an autocatalytic cleavage to produce the carboxy-terminal UmuD' fragment needed for induced mutagenesis . The presence of a similar system in other species was examined by using a combined approach of inducible-mutagenesis assays, cross-reactivity to E . coli UmuD and UmuD' antibodies to test for induction and cleavage of UmuD-like proteins, and hybridization with E . coli and Salmonella typhimurium umu DNA probes to map umu-like genes . The results indicate a more widespread distribution of mutagenic DNA repair in other species than was previously thought . They also show that umu loci can be more complex in other species than in E . coli . Differences in UV-induced mutability of more than 200-fold were seen between different species of enteric bacteria and even between multiple natural isolates of E . coli, and yet some of the species which display a poorly mutable phenotype still have umu-like genes and proteins . It is suggested that umDC genes can be curtailed in their mutagenic activities but that they may still participate in some other, unknown process which provides the continued stimulus for their retention. J Bacteriol, 1991 Sep, 173(17), 5371 - 84 Rhizobium lipopolysaccharide modulates infection thread development in white clover root hairs; Dazzo FB et al.; The interaction between Rhizobium lipopolysaccharide (LPS) and white clover roots was examined . The Limulus lysate assay indicated that Rhizobium leguminosarum bv . trifolii (hereafter called R . trifolii) released LPS into the external root environment of slide cultures . Immunofluorescence and immunoelectron microscopy showed that purified LPS from R . trifolii 0403 bound rapidly to root hair tips and infiltrated across the root hair wall . Infection thread formation in root hairs was promoted by preinoculation treatment of roots with R . trifolii LPS at a low dose (up to 5 micrograms per plant) but inhibited at a higher dose . This biological activity of LPS was restricted to the region of the root present at the time of exposure to LPS, higher with LPS from cells in the early stationary phase than in the mid-exponential phase, incubation time dependent, incapable of reversing inhibition of infection by NO3- or NH4+, and conserved among serologically distinct LPSs from several wild-type R . trifolii strains (0403, 2S-2, and ANU843) . In contrast, infections were not increased by preinoculation treatment of roots with LPSs from R . leguminosarum bv . viciae strain 300, R . meliloti 102F28, or members of the family Enterobacteriaceae . Most infection threads developed successfully in root hairs pretreated with R . trifolii LPS, whereas many infections aborted near their origins and accumulated brown deposits if pretreated with LPS from R . meliloti 102F28 . LPS from R . leguminosarum 300 also caused most infection threads to abort . Other specific responses of root hairs to infection-stimulating LPS from R . trifolii included acceleration of cytoplasmic streaming and production of novel proteins . Combined gas chromatography-mass spectroscopy and proton nuclear magnetic resonance analyses indicated that biologically active LPS from R . trifolii 0403 in the early stationary phase had less fucose but more 2-O-methylfucose, quinovosamine, 3,6-dideoxy-3-(methylamino)galactose, and noncarbohydrate substituents (O-methyl, N-methyl, and acetyl groups) on glycosyl components than did inactive LPS in the mid-exponential phase . We conclude that LPS-root hair interactions trigger metabolic events that have a significant impact on successful development of infection threads in this Rhizobium-legume symbiosis. Mol Microbiol, 1991 Sep, 5(9), 2203 - 16 Characterization of kdgR, a gene of Erwinia chrysanthemi that regulates pectin degradation; Reverchon S et al.; Erwinia chrysanthemi is a phytopathogenic enterobacterium able to degrade the pectic fraction of plant cell walls . The kdgR negative regulatory gene controls all the genes involved in pectin catabolism, including the pel genes encoding pectate lyases . The E . chrysanthemi kdgR regulatory gene was subcloned in Escherichia coli where it was shown to be functional, since it repressed the expression of a pelE::uidA fusion . The nucleotide sequence of kdgR contained an open reading frame of 918bp preceded by classical transcriptional initiation signals . KdgR shows similarity to two other regulatory proteins, namely GylR, encoding an activator protein of the glycerol operon in Streptomyces coelicolor, and IclR, encoding a repressor of the acetate operon in Salmonella typhimurium and in Escherichia coli . Previously, comparison of regulatory regions of several genes controlled by kdgR revealed the existence of a conserved region which was proposed as a KdgR-binding site . The 25 bp oligonucleotide AAAAAAGAAACATTGTTTCATTTGT corresponding to this consensus was substituted to the lac operator, at the beginning of transcription of the lacZ gene . This construct functioned as an operator for binding of the KdgR protein in vivo. J Pharm Sci, 1991 Sep, 80(9), 861 - 7 An evaluation of the antibacterial activities of combinations of sulfonamides, trimethoprim, dibromopropamidine, and silver nitrate compared with their uptakes by selected bacteria; Richards RM et al.; Modifications of antibacterial activity have been demonstrated using combinations of two antibacterials from trimethoprim, sulfonamides (sulfadiazine, sulfamerazine, and silver sulfadiazine), silver nitrate, and dibromopropamidine isethionate, either formulated in a cream base or dissolved in peptone water . The creams were evaluated using the agar cup diffusion method in isosensitest agar . The peptone water solutions provided fractional inhibitory concentrations for combinations of the antibacterial substances . The test organisms were Pseudomonas aeruginosa, Enterobacter cloacae, and Staphylococcus aureus . Bacterial uptakes of antibacterial combinations, determined by either an HPLC assay method or an atomic absorption method, combined with dry cell weight determinations, indicated that enhancement of activity of the antibacterial combinations against P . aeruginosa (two strains) and E . cloacae were related to marked increases in the bacterial uptake of the chemical agents . Decreases in activity were related to decreased uptake of either dibromopropamidine and/or silver ions . The effect of the trimethoprim and the sulfonamides was shown to depend on their effect on bacterial folate synthesis . It is suggested that partial blockade of the folate synthetic pathway leads to an effect on cell permeability which results in increased uptake of antibacterials . Dibromopropamidine isethionate also has an effect on cell permeability which produces an increased bacterial uptake of a second antibacterial present in the medium . These findings provide further explanation of how subinhibitory concentrations of trimethoprim and sulfonamide combinations are synergistic against a wide range of bacteria even when certain bacteria are resistant to either member of the combination. Biochem Int, 1991 Sep, 25(2), 271 - 9 Carbon-phosphorus bond cleavage activity in cell-free extracts of Enterobacter aerogenes ATCC 15038 and Pseudomonas sp . 4ASW; McMullan G et al.; Carbon-phosphorus bond cleavage activity was investigated in cell-free extracts of Enterobacter aerogenes ATCC 15038 (IFO 12010) and Pseudomonas sp . 4ASW, strains known to utilize a range of phosphonates as sole phosphorus source . In vitro phosphonatase activity was detected in extracts of both organisms; however extensive analysis failed to detect any organic product from phosphonates other than phosphonoacetal dehyde . Non-specific liberation of phosphate was observed in Pseudomonas sp . 4ASW, associated with a single fraction of FPLC-purified extract, and is believed to result from the activity of cellular phosphatases. Antibiot Khimioter, 1991 Sep, 36(9), 7 - 9 {Drug resistance of opportunistic enterobacteria isolated from various sources}; Chernevskaia OM et al.; Resistance of 159 strains of opportunistic enterobacteria to 9 antibacterial drugs was studied . The strains were isolated from man and cattle . It was shown that the overwhelming majority of the isolates (93 per cent) were polyresistant irrespective of the genus . There was a high frequency of the strains resistant to the widely used antibiotics such as chloramphenicol (73 per cent), ampicillin (73.6 per cent) and rifampicin (95.6 per cent) and sulfanilamides (99.3 per cent) . Gentamicin and nalidixic acid proved to be the most active against the cultures: 11.9 and 10 per cent of the resistant strains, respectively . The strains of enterobacteria isolated from different sources had a sensitivity to the antibiotics . Multiple antibiotic resistance to at least 5 drugs, variability of the spectra and high resistance were more characteristic of the isolates from the animals . The necessity of a rational use of antibacterial drugs in veterinary is indicated. Kansenshogaku Zasshi, 1991 Sep, 65(9), 1205 - 10 {Hafnia alvei septicemia with shock and DIC in an adult with postoperative lung cancer}; Masaki H et al.; In Japan, we experienced the first case of Hafnia alvei septicemia with shock and disseminated intravascular coagulation (DIC) in an adult with postoperative lung cancer . A 63 year-old male, who had been followed up in our department since 1987, was admitted to our hospital with the complaints of fever, hemoptysis and dyspnea on June 25, 1989 . After admission, he was treated with sulbactam/cefoperazone 4 g/day intravenously for suspicion of respiratory-tract infection . After antibiotic administration, the fever subsided and the general condition became almost good . The patient experienced fever again after the antibiotic was stopped . For this reason subsequent Clavulanic acid/Amoxicillin, Flomoxef, and Ceftazidime was administered, but was not effective . Therefore septicemia was suspected and blood culture was done . The bacteria isolated from blood culture was identified as Hafnia alvei . Hafnia alvei is a gram-negative organism belonging to the Enterobacteriaceae family and quite rare pathogen in human. Zh Mikrobiol Epidemiol Immunobiol, 1991 Sep, (9), 13 - 6 {The cultural properties and virulence of Yersinia}; Smirnov IV et al.; Study of the cultivation properties of 82 enterobacterial strains has revealed that the colonies of virulent Y . enterocolitica (serovars O3, O9) and Y . pseudotuberculosis (serovar I) are temperature-sensitive . This sign, closely connected with the presence and expression of the virulence plasmid with a molecular weight of 44-48 MD, is not characteristic of other strains . Virulent Yersinia grown in nutrient agar for 48 hours at 37 degrees C form colonies which are smaller in diameter than those formed during cultivation at 26 degrees C (with the significance of differences t greater than or equal to 4), their diameter at 37 degrees C not exceeding 1.0 mm . The test for the determination of the temperature-sensitive morphology of Yersinia colonies, along with the tests for other virulence markers, is probably suitable for the detection of the causative agents of yersiniosis or pseudotuberculosis. Rev Infect Dis, 1991 Sep-Oct, 13 Suppl 10, S858 - 68 Prophylaxis in otolaryngologic surgery and neurosurgery: a critical review; Shapiro M; In an assessment of prospective, controlled studies of antimicrobial prophylaxis against infections following otolaryngologic surgery and neurosurgery, the English-language literature on this topic was reviewed . Rates of infection following clean otolaryngologic operations are the same for patients receiving prophylaxis and those receiving placebo . For patients with head and neck cancer, rates of postoperative infection without antibiotic prophylaxis in clean surgery are less than 1%, and prophylaxis is not indicated; in contrast, in clean-contaminated procedures (infection rate, 18%-87%), prophylaxis is highly protective, although several studies have shown no advantage to its prolongation beyond 24 hours . For the latter operations, drugs with adequate activity against oral anaerobes are essential, whereas the need for coverage against Enterobacteriaceae is doubtful . In clean and clean-contaminated neurosurgical procedures, the rate of protective efficacy of prophylaxis ranges between 63% and 76% . For shunt operations the available evidence favors prophylaxis, but the wide range of infections reported mandates a large-scale multicenter trial to decide the issue. Plasmid, 1991 Sep, 26(2), 141 - 6 Bacteriophages for incompatibility group H plasmids: morphological and growth characteristics; Maher D et al.; Two independently isolated temperature-sensitive bacteriophage that are specific for enterobacterial hosts harboring HI and HII plasmids were characterized to determine if any identifiable differences existed between them . The traits examined included adsorption pattern of phage to H pili, bacteriophage size, sensitivity to chloroform, RNA strandedness, reaction with F-specific antiphage serum, virion protein pattern, temperature range of lytic ability, and plaque morphology . No differences between the phages were observed for any of the features analyzed . Ecological questions on the origin and maintenance of temperature-sensitive phages are discussed. Mol Gen Mikrobiol Virusol, 1991 Sep, (9), 9 - 13 {Characteristics of the R-plasmid pM3 (IncP-9) of a broad circle of hosts}; Titok MA et al.; A new broad host range plasmid pM3 (IncP-9) was found in a facultative methylotrophic bacteria Pseudomonas putida and described . The pM3 plasmid is characterized by thermo-instability in Enterobacteriaceae family of bacteria at 36 degrees C or higher temperatures . It is also unable to be inherited as an autonomous element in the obligate methylotrophic bacteria Methylobacillus M75 . The peculiarities of plasmid inheritance make possible to use it as a tool for genetic research, for instance, to construct the donor strains in Methylobacillus M75 able to mobilize the chromosomal genes for conjugational transfer in isogenic systems of crosses. Mol Microbiol, 1991 Sep, 5(9), 2223 - 31 Molecular cloning and expression in Escherichia coli K-12 of the rfb gene cluster determining the O antigen of an E . coli O111 strain; Bastin DA et al.; The O antigen of Escherichia coli O111 is identical in structure to that of Salmonella enterica serovar adelaide . Another O-antigen structure, similar to that of E . coli O111 and S . enterica serovar adelaide is found in both E . coli O55 and S . enterica serovar greenside . Both O-antigen structures contain colitose, a 3,6 dideoxyhexose found only rarely in the Enterobacteriaceae . The O-antigen structure is determined by genes generally located in the rfb gene cluster . We cloned the rfb gene cluster from an E . coli O111 strain (M92), and the clone expressed O antigen in both E . coli K-12 and a K-12 strain deleted for rfb . Lipopolysaccharide analysis showed that the O antigen produced by strains containing the cloned DNA is polymerized . The chain length of O antigen was affected by a region outside of rfb but linked to it and present on some of the plasmids containing rfb . The rfb region of M92 was analysed and compared, by DNA hybridization, with that of strains with related O antigens . The possible evolution of the rfb genes in these O antigen groups is discussed. J Clin Microbiol, 1991 Sep, 29(9), 1795 - 800 Fimbrial types among respiratory isolates belonging to the family Enterobacteriaceae; Hornick DB et al.; Bacterial attachment is believed to be an early step in gram-negative nosocomial pneumonia . The frequency of fimbria-associated adhesins among respiratory pathogens has not been studied in detail . In this study isolates belonging to the family Enterobacteriaceae, prospectively obtained from intensive care unit patients who were suspected of having nosocomial pneumonia, were examined for fimbria-associated adhesins . Type 3, P, type 1, and other fimbrial phenotypes were identified by specific hemagglutination and electron microscopy . The Klebsiella type 3 fimbrial phenotype was further characterized by using a monoclonal antibody . Also, both type 3 and Escherichia coli P fimbrial genotypes were detected by using DNA colony blot assays . The frequencies of genera or species isolated were as follows: Enterobacter (38.6%), Klebsiella (26.8%), Serratia (17.7%), E . coli (13%), and Proteus (5.2%) . Isolates of Klebsiella oxytoca, K . pneumoniae, and Enterobacter cloacae most commonly possessed the type 3 fimbrial phenotype and genotype . The phenotype and genotype for E . coli P fimbriae (46.2 and 50%, respectively), a known pathogenic determinant in the urinary tract, were detected more frequently than expected . In addition, a previously unspecified hemagglutinin that was specific for porcine erythrocytes was almost uniformly expressed among isolates of Enterobacter aerogenes . Finally, the expression of the type 1 fimbrial phenotype was widely detected among the isolates tested but notably absent among K . oxytoca and Proteus mirabilis isolates . The frequency of the various fimbrial types identified suggests a role for these bacterial organelles in adherence to respiratory epithelia. J Hosp Infect, 1991 Sep, 19(1), 33 - 40 Analysis of plasmid pattern in paediatric intensive care unit outbreaks of nosocomial infection due to Enterobacter cloacae; Wang CC et al.; Sequential outbreaks of nosocomial infection due to multiply-resistant Enterobacter cloacae occurred in September 1987, and between December 1988 and January 1989, in a paediatric intensive care unit . A total of eight neonates were affected and most had received ventilatory support . Initially, we were unable to determine whether the two outbreaks were caused by the same strain of E . cloacae . After applying plasmid profile analysis to identify epidemic strains, we established that the strain from the first outbreak was different from the second outbreak strain, as each had its own plasmid pattern . During the second outbreak, an environmental bacteriological survey was carried out . We found that the distilled water containers were contaminated with E . cloacae which had the same plasmid profile . After changing the distilled water containers and by reinforcement of aseptic techniques, the nosocomial outbreak was terminated. J Hosp Infect, 1991 Sep, 19 Suppl C, 43 - 58 Protecting neutropenic patients from bowel-derived organisms; Warren RE; Prevention of infection from bowel-derived organisms in neutropenic patients requires both the appropriate use of chemoprophylaxis and close attention to the prevention of cross-colonization or cross-infection with resistant Enterobacteriaceae and pseudomonads . Control of common-source infection and control of Gram-positive infection are also important . The objectives of chemoprophylaxis should be considered and their efficacy regularly assessed . Non-absorbable antibiotics may have an important place in minimizing selection of resistant strains, but absorbed agents such as cotrimoxazole (trimethoprim/sulphamethoxazole) and 4-quinolones offer advantages over these and nalidixic acid as prophylactic agents . Ciprofloxacin prophylaxis is probably more effective at reducing Gram-negative bacteraemia than co-trimoxazole but overall mortality may be higher . Further confirmation and investigation of the reasons for this are needed . Protocols of rational antibiotic prophylaxis and treatment involving these agents can be modified to cover only the Gram-negative superinfections that are likely. Diagn Microbiol Infect Dis, 1991 Sep-Oct, 14(5), 389 - 401 Antimicrobial activity evaluations of two new quinolones, PD127391 (CI-960 and AM-1091) and PD131628; Barrett MS et al.; The in vitro activities of PD127391 and the new fluorinated-4-quinolone, PD131628, were compared with each other and with five similar fluoroquinolones (ciprofloxacin, enoxacin, fleroxacin, norfloxacin, and ofloxacin) . A total of 844 isolates mainly from recent clinical bacteremias and additional stock strains with well-characterized resistance mechanisms were tested . PD127391 had slightly more activity than PD131628 (90% minimum inhibitory concentration (MIC90)} 0.008-0.12) against the Enterobacteriaceae, but both were two- to fourfold more potent than ciprofloxacin . PD131628 activity was equal to or greater than PD127391 when tested against Pseudomonas aeruginosa . PD127391 showed greatest activity against Bacteroides fragilis group strains (MIC90, 2 micrograms/ml) when compared with PD131628 (MIC90 greater than 8 micrograms/ml) . Both PD127391 (MIC90s, 0.015-1.0 micrograms/ml) and PD131628 (MIC90s, 0.03 - greater than 8 micrograms/ml) were more active than ciprofloxacin against Gram-positive organisms . Altering the medium pH, adding divalent cations (magnesium), and increasing the inoculum concentration to 10(6) colony-forming units per spot adversely effected the activity of both PD127391 and PD131628 . Resistance selection and mutational rates to resistance were identical to previously studied drugs in their class. Ned Tijdschr Geneeskd, 1991 Aug 10, 135(32), 1437 - 41 {The relationship between predisposing factors in liver abscesses and the causative bacteria}; Lim TT et al.; In order to assess the correlation between bacteria isolated from liver abscesses and factors predisposing to liver abscesses, a retrospective study of clinical and bacteriological data on 21 patients with 27 episodes of pyogenic abscesses was carried out at the University Medical Centre, Amsterdam . Out of 27 episodes, 15 (55%) were associated with biliary or pancreatic disease; in seven of these 15 episodes more than one microorganism was cultured . Enterobacteriaceae were isolated in 13 (85%) of 15 episodes . Anaerobic bacteria were recovered only when operations in the pancreatico-biliary area had been performed previously . Seven episodes (26%) were related to extrahepatic disease; anaerobic bacteria (Bacteroides and Fusobacterium spp.) were isolated in five of these seven episodes . Streptococcus milleri seemed especially prominent, since this bacterium was cultured in six of seven episodes . Enterobacteriaceae were not involved in these seven episodes . Other factors predisposing to liver abscesses (15%) were diabetes mellitus n = 2), paraproteinaemia (n = I), and metastatic carcinoid (n = I) . Blood cultures were positive in 65% of 23 episodes, but 40% of the positive cultures contained a smaller number of bacterial species than could be cultured from the abscess itself . Bacteria isolated from liver abscesses are related to the underlying predisposing condition . For diagnosis of the underlying condition and antibiotic therapy, puncture and bacteriologic examination of the abscess is essential. Am J Med, 1991 Aug 8, 91(2A), 125S - 131S Incidence of pneumonia in mechanically ventilated patients treated with sucralfate or cimetidine as prophylaxis for stress bleeding: bacterial colonization of the stomach; Kappstein I et al.; Retrograde colonization of the oropharynx from the stomach by microaspiration of gastric fluid is a recently recognized phenomenon associated with increased gastric pH that may result in pneumonia during ventilation therapy . In a prospective study we investigated 104 mechanically ventilated patients in the intensive care unit who were receiving sucralfate (n = 49) or cimetidine (n = 55) for stress ulcer prophylaxis . The incidence of pneumonia was 45.5% (25 patients) in the cimetidine group and 26.5% (13 patients) in the sucralfate group (95% confidence interval 0.98 to 6.97; odds ratio 2.61; p = 0.0549) . Mortality rates were 18.4% (9 patients) in the sucralfate group versus 25.5% (14 patients) in the cimetidine group (p = 0.48) . The mean pH values of gastric aspirates were significantly lower in patients treated with sucralfate than in patients receiving cimetidine (p = 0.044) . The number of colony-forming units of Enterobacteriaceae in gastric aspirates was also significantly lower in the sucralfate group (p = 0.0037). Obstet Gynecol, 1991 Aug, 78(2), 245 - 8 Intrapartum bacteriuria and postpartum endometritis; Monif GR; Ten gravidas with bacteriuria in the immediate antepartum period subsequently delivered vaginally and did not receive antibiotic therapy . Four of these women developed postpartum endometritis and in three of them, the same Enterobacteriaceae recovered from the urine was present in the endometrial cultures . Of the 1233 study subjects whose screening urine cultures were negative and who delivered vaginally, 27 (2.2%) developed endometritis . Intrapartum bacteriuria was significantly associated with postpartum endometritis in women delivering vaginally (P less than .001) . Monitoring for asymptomatic bacteriuria and eradicating it in pregnancy should diminish the occurrence of endometritis and possible endomyometritis in the postpartum period. Zh Mikrobiol Epidemiol Immunobiol, 1991 Aug, (8), 15 - 7 {The modelling of the translocation of the intestinal microflora in conventional animals}; Almagambetov KKh et al.; To study the mechanisms of the translocation of enteric microflora and to develop the corresponding prophylactic measures, experimental models are necessary . In this connection two methods of simulating translocation are proposed . One of these methods is reproduced in animals resuscitated from the state of apparent death caused by acute venous blood loss and the other method, in animals with acute renal insufficiency induced by the ligation of the middle part of both ureters . During the period from the first hours to two weeks after the state of apparent death enterobacteria penetrate into mesenteric lymph nodes and occasionally into the liver, spleen and blood . On day 3 after the ligation of the ureters enterobacteria can be isolated from the above-mentioned organs and the blood, while the kidneys remain sterile . The models are reproducible, exhibit adequate clinical manifestations of these terminal states, and permit the detailed investigation of the translocation mechanisms. Semin Arthritis Rheum, 1991 Aug, 21(1), 40 - 6 Plant thorn synovitis: an uncommon cause of monoarthritis; Olenginski TP et al.; Plant thorn synovitis (PTS) is an uncommon cause of monoarthritis . Seven cases of PTS were identified at our institution from January 1979 to July 1990, six of whom were men . Mean age was 27 years (range, 7 to 56 years) . Symptoms included pain, swelling, and stiffness . Synovitis was present on examination along with decreased range of motion of affected joints in all patients . Roentgenograms were unremarkable in five patients, but disclosed demineralization in two others . Initial conservative treatment with nonsteroidal antiinflammatory drugs (NSAIDs), antibiotics, or splinting was usually unsuccessful; surgery was necessary in six patients . Findings included marked inflammatory synovial reactions with evidence of retained thorn in all patients . One patient had a positive operative wound culture (Enterobacter agglomerans) without evidence of osteomyelitis . All patients improved after surgery without sequelae . Despite a history suggesting thorn injury in many cases, diagnosis was often delayed; mean time to diagnosis was 10 weeks (range, 2 weeks to 9 months) . PTS must be included in the differential diagnosis of monoarthritis . Histologically, PTS can mimic sarcoidosis, tuberculosis, or fungal infection . Optimal treatment of PTS is arthrotomy, foreign body removal, and extensive synovectomy. Antimicrob Agents Chemother, 1991 Aug, 35(8), 1685 - 7 Ofloxacin and penicillin G combination therapy in prevention of bacterial translocation and animal mortality after irradiation; Brook I et al.; The efficacies of 40 mg of ofloxacin per kg/day given orally and 250 mg of penicillin per kg/day given intramuscularly, alone or in combination, were evaluated in the prevention of mortality of C3H/HeN female mice given 8.2 Gy of 60Co radiation . Mortalities were 51 of 60 mice (85%) in the control group, 46 of 60 mice (77%) among those treated with penicillin, 32 of 60 mice (53%) among those treated with ofloxacin (P less than 0.05), and 5 of 60 mice (8%) among those treated with ofloxacin and penicillin (P less than 0.001) . The organisms recovered from the livers of control mice were members of the family Enterobacteriaceae and Streptococcus spp . A reduction in the number of the Enterobacteriaceae was noted only in ofloxacin-treated mice, and a reduction in the number of Streptococcus spp . was noted only in the penicillin-treated mice . Reductions in the numbers of both groups of organisms were noted only in the animals treated with both agents . This study shows the advantage of the combination of ofloxacin and penicillin in the prevention of bacterial translocation and animal mortality after irradiation. Antimicrob Agents Chemother, 1991 Aug, 35(8), 1576 - 81 Translocation of antibiotic resistance determinants including an extended-spectrum beta-lactamase between conjugative plasmids of Klebsiella pneumoniae and Escherichia coli; Sirot D et al.; The extended-spectrum beta-lactamase CAZ-7, derived from TEMs, was produced by two different strains of the family Enterobacteriaceae, Klebsiella pneumoniae and Escherichia coli, isolated from the same patient . Both isolates were resistant to amikacin . In addition, the K . pneumoniae strain was TEM-1 producing and resistant to gentamicin . An E . coli HB101 transconjugant obtained from K . pneumoniae, selected on ceftazidime, showed that CAZ-7 and amikacin resistance were encoded by an 85-kb Inc7 or M plasmid, while an E . coli HB101 transconjugant obtained from E . coli under the same conditions showed that CAZ-7 and amikacin resistance were encoded by a greater than 150-kb Inc6 or C plasmid . Two other E . coli HB101 transconjugants obtained from K . pneumoniae, selected on gentamicin or chloramphenicol, showed that TEM-1 and gentamicin resistance could be encoded either by a greater than 150-kb Inc6 or C plasmid or by an 85-kb Inc7 or M plasmid . It was hypothesized that the genes for beta-lactam and aminoglycoside resistances were located on translocatable sequences . EcoRI digestion and hybridizations obtained with blatem, aacA4, and IS15 probes demonstrated that the CAZ-7 gene, amikacin resistance gene, and IS15 element were clustered on an approximately 20-kb fragment common to 85- and greater than 150-kb plasmids . E . coli HB101 transconjugants from K . pneumoniae and E . coli isolates were used to obtain translocations of CAZ-7 and amikacin resistance and of TEM-1 and gentamicin resistance between the 85- and greater than 150-kb plasmids . This study shows a typical example of in vivo gene dissemination involving transposable elements which translocate multiresistance genes, including an extended-spectrum beta-lactamase. J Mol Evol, 1991 Aug, 33(2), 125 - 32 Counterselection of GATC sequences in enterobacteriophages by the components of the methyl-directed mismatch repair system; Deschavanne P et al.; Weak to severe deficit of GATC sequences in the DNA of enterobacteriophages appears to be correlated with their undermethylation during growth in dam+ (GATC ade-methylase) bacteria . This observation is corroborated by the sequence analysis showing no evidence for site-specific mutagenicity of 6meAde . The MutH protein of the methyl-directed mismatch repair system recognizes and cleaves the undermethylated GATC sequences in the course of mismatch repair . To enquire whether the MutH function of the methyl-directed mismatch repair system participates in counterselection of GATC sequences in enterobacteriophages, we have studied the yield of bacteriophage phi X174 containing either 0, 1, or 2 GATC sequences, in wild type, dam, and mut (H, L, S, U) Escherichia coli . Following transfection with unmethylated DNA containing two GATC sequences, a net decrease in the yield of infective particles was observed in all bacterial mutH+ dam- strains, whereas no detectable decrease was observed in bacteria infected by DNA without GATC sequence . This effect of the MutH function is maximum in wild type and mutL and mutS bacteria whereas the effect is not significant in mutU bacteria, suggesting an interaction of the helicase II with the MutH protein . However, in dam+ bacteria, the presence of GATC sequences leads to an increased yield of infective particles . The effect of GATC sequence and its Dam methylation system on phage yield in mutH- bacteria reveals that methylated GATC sequences are advantageous to the phage.(ABSTRACT TRUNCATED AT 250 WORDS) Int J Food Microbiol, 1991 Aug, 13(4), 239 - 48 Quantification of microbial populations associated with the manufacture of vacuum-packaged, smoked vienna sausages; Dykes GA et al.; Sources of contamination of vacuum-packaged vienna sausages by spoilage microorganisms were examined in a meat-processing plant . Microbial numbers present in the environment, on working surfaces and workers' hands and aprons were quantified by plate counting on selective media . Product line samples were taken at critical control points in the manufacturing process and analysed before and after preliminary incubation of vacuum-packaged samples at 25 degrees C for 24 h . In all samples the numbers of aerobic bacteria, Enterobacteriaceae, lactic acid bacteria and yeasts were determined by standard procedures . Contamination of sausage surfaces by lactic acid bacteria occurred as a result of the manufacturing and handling processes . The environment and specifically packers' hands, as well as working surfaces contributed to microbiological contamination of various types after removal of the peel from individual sausages . The preliminary incubation procedure allowed detection of low numbers of spoilage microorganisms. J Bacteriol, 1991 Aug, 173(16), 5194 - 9 Initiator (DnaA) protein concentration as a function of growth rate in Escherichia coli and Salmonella typhimurium; Hansen FG et al.; The DnaA protein concentration was determined in five different Escherichia coli strains and in Salmonella typhimurium LT2 growing at different growth rates . The DnaA protein concentration was found to be invariant over a wide range of growth rates in the four E . coli K-12 strains and in S . typhimurium . In E . coli B/r the DnaA protein concentration was generally higher than in the K-12 strains, and it increased with decreasing growth rates . For all the strains, there appears to be a correlation between the DnaA protein concentration and the initiation mass . This supports the concept of the concentration of DnaA protein setting the initiation mass and, thus, that the DnaA protein is a key molecule in the regulation of initiation of chromosome replication in members of the family Enterobacteriaceae. Infect Immun, 1991 Aug, 59(8), 2719 - 26 Evidence for invasion of a human oral cell line by Actinobacillus actinomycetemcomitans; Meyer DH et al.; Actinobacillus actinomycetemcomitans, an oral bacterial species associated with periodontal disease, was found to invade human cell lines . Invasion was demonstrated by recovery of viable organisms from gentamicin-treated KB cell monolayers and by light and electron microscopy . Internalization occurred through a cytochalasin D-sensitive process . Invasion efficiencies of some A . actinomycetemcomitans strains were comparable to those of invasive members of the family Enterobacteriaceae . Differences in invasiveness were correlated with bacterial colonial morphology . Smooth variants invaded more proficiently than rough variants . A . actinomycetemcomitans can undergo a smooth-to-rough colonial morphology shift which results in the loss of invasiveness . Coordinated regulation of genes involved in the rough-to-smooth phenotypic transitions may play a role in the episodic nature of periodontal disease. Zhonghua Min Guo Wei Sheng Wu Ji Mian Yi Xue Za Zhi, 1991 Aug, 24(3), 272 - 80 Antibacterial activities of amoxicillin alone and in combination with clavulanic acid correlated with beta-lactamase production; Hsu LY et al.; Amoxicillin, a beta-lactam antibiotic, was tested for its effect in combination with clavulanic acid, a beta-lactamase inhibitor, against 9 species of bacteria isolated from clinical specimens . A total of 698 strains of bacteria were tested for beta-lactamase production by the rapid chromogenic cephalosporin method . Their susceptibilities to amoxicillin alone and in combination with clavulanic acid were tested by the agar dilution method . The percentage of beta-lactamase producing strains ranged from 46.6% in Proteus mirabilis to 100% in Klebsiella pneumoniac . In general, beta-lactamase nonproducers were more susceptible to amoxicillin than beta-lactamase producers . For beta-lactamase producers, clavulanic acid decreased the MICs of amoxicillin prominently in strains of Neisseria gonorrhoeae, Haemophilus influenzae, Escherichia coli, K . pneumoniae, P . mirabilis, Enterobacter cloacae and Bacteroides fragilis, when combining clavulanic acid with amoxicillin in the ratio of 1:2 . Their MIC50s, MIC90s and geometric means of MICs all decreased 4 folds or greater . For beta-lactamase non-producing strains, the MICs did not show significant differences by adding clavulanic acid in most species we tested, including methicillin-sensitive Staphylococcus aureus, N . gonorrhoeae, H . influenzae, Proteus vulgaris and E . cloacae. Curr Opin Dent, 1991 Aug, 1(4), 404 - 10 Bacterial infections of oral soft tissues; Holbrook WP; Bacterial infections of the oral soft tissues are not particularly common . When they occur, they can often be rapidly progressive and even fatal without prompt diagnosis, drainage, and antibiotic therapy . Most infections are caused by endogenous oral bacteria that have overcome the host immune system as a result of surgery or, more frequently, because of underlying defects in the innate or specific immune systems . The role of oral anaerobes in these infections is increasingly being realized, and empirical antibiotic therapy should always take account of the possibility of anaerobic involvement in any infection . More research is required into infected mucositis in patients with hematologic malignancies and the possible importance of enterobacteria in infections of the oral mucosa in debilitated patients . Surveillance cultures may help improve management of therapy. Arzneimittelforschung, 1991 Aug, 41(8), 831 - 8 {The effect of sulbactam on the in vitro activity of mezlocillin, piperacillin and cefotaxime}; Bauernfeind A et al.; The in vitro activity of mezlocillin (MZL, CAS 51481-65-3), piperacillin (PIP, CAS 61477-96-1) and cefotaxim (CTX, CAS 63527-52-6) alone and in combination with sulbactam (SBT; CAS 68373-14-8) against mezlocillin-resistant pathogens was determined in a multicenter study . A total of 870 strains were investigated (481 Enterobacteriaceae, 57 Pseudomonas aeruginos, 41 Acinetobaster spp., 194 Bacteroides fragilis, and 97 Staphylococcus spp.) . Determinations of MIC were performed according to DIN-guidelines (agar-dilution method for aerobes and microbroth-dilution method for anaerobes) . Sulbactam was added in fixed concentrations of 5 mg/l and 10 mg/l . In all sulbactam-combinations examined mean MIC as well as MIC50 and MIC90 were reduced compared to the respective values for the antibiotics alone . Consequently, percentages of susceptible strains increased significantly: i.e . for Enterobacteriaceae: MZL 1% vs . MZL + 10 mg/l SBT 53%; PIP 4% vs . PIP + 10 mg/l SBT 54%; CTX 52% vs . CTX + 10 mg/l SBT 68% . The effect of sulbactam was most pronounced in Bacteroides spp . with an increase in susceptible strains from 2% to 97% for MZL, from 6% to 95% for PIP and from 7% to 98% for CTX . The results indicate that by adding sulbactam the in vitro activity of mezlocillin, piperacillin and cefotaxim against resistant pathogens is augmented significantly . In addition, the spectrum of antibacterial activity is extended to anaerobic pathogens such as Bacteroides spp . The availability of sulbactam as a monosubstance for combination with various beta-lactam-antibiotics thus represents a useful improvement of therapeutic options in bacterial infections. J Chemother, 1991 Aug, 3(4), 209 - 25 Antibacterial activity of ceftibuten, a new oral third generation cephalosporin; Debbia EA et al.; Ceftibuten, a new oral third generation cephalosporin, was found to be the most active beta-lactam drug tested against members of the Enterobacteriaceae, inhibiting most strains at less than 4 micrograms/ml . All isolates of Branhamella catarrhalis, Haemophilus influenzae, and Neisseria spp . were highly susceptible to ceftibuten . Penicillin-sensitive pneumococci and pathogenic beta-hemolitic streptococci were also killed by ceftibuten . The antibacterial activity of this new drug, which results in rapid lysis of susceptible cells, was not significantly affected by serum, pH, inoculum size, media composition and growth conditions . Ceftibuten is characterized by a remarkable resistance to inactivation by most beta-lactamases synthetized by common gram-positive and gram-negative pathogens . The potent in vitro activity of ceftibuten in conjunction with its favorable pharmacokinetic profile render this new molecule an attractive candidate for the treatment of respiratory and urinary tract infections sustained by susceptible pathogens. J Antimicrob Chemother, 1991 Aug, 28(2), 239 - 48 The in-vitro activity of cefdinir (FK482), a new oral cephalosporin; Wise R et al.; The in-vitro activity of cefdinir (FK482), an orally absorbed aminothiazolyl cephalosporin, was compared with that of cefuroxime, cefixime, cephalexin, cefaclor and co-amoxiclav . Cefdinir was highly active against Staphylococcus aureus, inhibiting 90% of strains at 0.03 mg/L . The respiratory pathogens Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis were also susceptible (MIC90 less than or equal to 1 mg/L) . The common members of the Enterobacteriaceae were susceptible (MIC90 less than or equal to 1 mg/L), but those possessing chromosomal beta-lactamases were more resistant . Cefdinir appeared highly stable to the TEM-1 and SHV-1 beta-lactamases with only relatively minor degrees of hydrolysis being seen with TEM-3, -5 and -9. Mol Microbiol, 1991 Aug, 5(8), 1853 - 62 Cloning and expression of the rfe-rff gene cluster of Escherichia coli; Ohta M et al.; We have cloned a 13 kb Escherichia coli DNA fragment which complemented the rfe mutation to recover the biosynthesis of E . coli O9 polysaccharide . Using Tn5 insertion inactivation, the rfe gene was localized at the 1.5 kb HindIII-EcoRI region flanking the rho gene . We constructed an rfe-deficient E . coli K-12 mutant by site-directed inactivation using a DNA fragment of the cloned 1.5 kb rfe gene . This also confirmed the presence of the rfe gene in the 1.5 kb region . By simultaneous introduction of both the rfe plasmid and the plasmid of our previously cloned E . coli O9 rfb into this rfe mutant, we succeeded in achieving in vivo reconstitution of O9 polysaccharide biosynthesis . From sequence analysis of the rfe gene, a putative promoter followed by an open reading frame (ORF) was identified downstream of the rho gene . This ORF coincided with the position of the rfe gene determined by Tn5 analysis and site-directed mutagenesis . Furthermore, we identified the rff genes in the 10.5 kb DNA flanking the rfe gene . We recognized at least two functional domains on this cloned rff region . Region I complemented a newly found K-12 rff mutant, A238, to synthesize the enterobacterial common antigen (ECA) . Deletion of region II resulted in the synthesis of ECAs with shorter sugar chains . When the 10.5 kb rff genes of the plasmid were inactivated by either deletion or Tn5 insertion, the plasmid lost its ability to give rise to transformants of the rfe mutants. J Bacteriol, 1991 Aug, 173(15), 4578 - 86 Structure and function of a bacterial mRNA stabilizer: analysis of the 5' untranslated region of ompA mRNA; Chen LH et al.; The 5' untranslated region (UTR) of the Escherichia coli ompA transcript functions in vivo as a growth rate-regulated mRNA stabilizer . The secondary structure of this mRNA segment has been determined by a combination of three methods: phylogenetic analysis, in vitro probing with a structure-specific RNase, and methylation by dimethylsulfate in vivo and in vitro . These studies reveal that despite extensive sequence differences, the 5' UTRs of the ompA transcripts of E . coli, Serratia marcescens, and Enterobacter aerogenes can fold in a remarkably similar fashion . Furthermore, the Serratia and Enterobacter ompA 5' UTRs function as effective mRNA stabilizers in E . coli . Stabilization of mRNA by the Serratia ompA 5' UTR is growth rate dependent . These findings indicate that the features of the ompA 5' UTR responsible for its ability to stabilize mRNA in a growth rate-regulated manner are to be found among the structural similarities shared by these diverse evolutionary variants. J Antimicrob Chemother, 1991 Aug, 28(2), 185 - 98 Phenotypic characterization of quinolone-resistant mutants of Enterobacteriaceae selected from wild type, gyrA type and multiply-resistant (marA) type strains; Piddock LJ et al.; The NCTC type strains of Escherichia coli, Enterobacter cloacae, Serratia marcescens and Klebsiella pneumoniae were exposed to 3, 5 and 10 x MIC of nalidixic acid, enoxacin, ciprofloxacin, PD 117596 and PD 127391 . From each strain a mutant with a high MIC of quinolones alone (gyrA) and a mutant with intermediate resistance to quinolones, some beta-lactams, chloramphenicol and tetracycline (multiply resistant, m-r) were selected on agar containing antibiotics . The gyrA mutants required a higher concentration of quinolone to inhibit DNA synthesis by 50% but quinolone uptake kinetics and outer membrane profile were the same as the wild type . The m-r mutants had similar DNA synthesis IC50 as the wild type, decreased quinolone uptake kinetics and had decreased expression of an OMP of approximately 40 kD . The gyrA and m-r mutants were then exposed to 3, 5 and 10 x MIC of the same quinolones and new mutants (F2) selected . The F2 mutants from the gyrA mutants displayed a further increase in quinolone MIC; the F2 mutants from the m-r mutants had several phenotypes: high quinolone MICs with cross resistance to other agents, high quinolone resistance alone, or intermediate quinolone resistance alone . Most F2 mutants had MICs above the recommended breakpoint concentrations for quinolones . The F2 mutants often had altered biochemical profiles (API 20E), however, only in the case of E . cloacae did this affect speciation with the strains being identified as Rhanella aquatalis. Antimicrob Agents Chemother, 1991 Aug, 35(8), 1605 - 11 Nosocomial spread of an amikacin resistance gene on both a mobilized, nonconjugative plasmid and a conjugative plasmid; Hopkins JD et al.; Resistance to amikacin among members of the family Enterobacteriaceae at a hospital in Venezuela rose from 2% in 1979 to 5% in 1984 and 10% in 1985 as amikacin usage rose 20-fold to exceed gentamicin usage . Resistance to gentamicin remained at 25 to 27% . We examined the plasmids from 21 isolates obtained in 1984 and 1985 . Nine of eleven in 1984 and three of ten in 1985 carried aacA and sul on a 3.8-kb BamHI fragment of pBWH300, a 10.4-kb nonconjugative plasmid that had been mobilized into strains of six species by at least two different coresident conjugative plasmids . Six 1985 isolates of two species carried these genes on a similar BamHI fragment of the 104-kb conjugative plasmid pBWH303 . One isolate in 1984 and one in 1985 carried the 69-kb conjugative plasmid pBWH301, which had aacA as the promoter-proximal gene of an operon that also encompassed the cat and aadB resistance genes . Another conjugative plasmid, pBWH302, was found in a single isolate . It carried a different aacA allele on the functional transposon Tn654, which appeared to be closely related to Tn1331, a transposon previously isolated in Argentina and Chile . Increased selection may thus have led to dissemination of an endemic aacA allele on two endemic plasmids, one spread by mobilization, with occasional intrusion of additional aacA alleles from outside. APMIS, 1991 Aug, 99(8), 703 - 10 Enhancement by a serum factor of the immunoaccessibility of an enterobacterial porin protein domain; Henriksen AZ et al.; Monoclonal antibody (MAb) generated against the domain Po I on the outer membrane (OM) porin (Po) protein of an Escherichia coli 055 strain showed weak binding by the OM in ELISA . Human serum and sera from different animal species enhanced the MAb binding in ELISA when the antibody was incubated together with serum or the OM was pretreated with serum . Human serum also enhanced the MAb binding when coats were prepared by using OMs from various cross-reacting bacteria . The ability of human serum to amplify the MAb binding by OMs was similar to that of lysostaphin . Amplification by serum was not observed when MAbs against three other enterobacterial OM proteins were tested . The amplifying serum factor was destroyed by heating (100 degrees C) and by mercaptoethanol . It appeared in fractions which corresponded to an apparent molecular weight of 75,000-80,000 after gel permeation, and, after ion-exchange chromatography, in fractions which contained a protein of 60 kD when analysed by SDS-PAGE . These data support the notion that the serum-induced enhancement of the anti-Po I MAb binding was due to a previously described serum amidase (N-acetylmuramyl-L-alanine amidase) which has peptidoglycan-degrading activity . The effects of the amplifying serum factor may influence the antibody levels which are measured when OMs from Gram-negative bacteria are used as antigen in a serodiagnostic test. Orv Hetil, 1991 Jul 21, 132(29), 1571 - 3 {Characteristics of nosocomial pneumonia}; Adam A et al.; 284 patients with pneumonia treated in non-invasive chest wards were analysed in a prospective study . Out of 284 cases 26 proved to be nosocomial pneumonias . Older age, chronic non specific lung diseases, malignancies, peptic ulcus, chronic alcoholism as risk factors for nosocomial pneumonia should be taken into consideration . The pathogen agent was clearly identified in four cases, meanwhile the pathogenity of the agents was suspected at seven patients . By distribution of all pathogens the widely known bacteria are responsible for nosocomial pneumonia were less than one third of cases (in three cases Staphylococcus aureus, in one-one case E . coli and Enterobacter) . The possible causes of their observation were analysed . Out of the 15 pathogens Gram-negative bacilli were found in six cases only . Authors suggest to use this observation at the rational choice of empiric treatment. FEMS Microbiol Lett, 1991 Jul 15, 66(1), 19 - 25 Construction by polymerase chain reaction and use of intragenic DNA probes for three main types of transferable beta-lactamases (TEM, SHV, CARB) {corrected}; Arlet G et al.; Intragenic DNA probes were synthesized by polymerase chain reaction using fragments of the genes of three major types of beta-lactamases (TEM, SHV, CARB) as templates . The TEM probe hybridized with the genes encoding TEM-1, TEM-2 and six extended-spectrum related enzymes (TEM-3 to TEM-7, TEM-2O) in colony hybridizations and Southern-blot analysis . The SHV probe hybridized with the genes for SHV-1, OHIO-1 and four derived extended-spectrum beta-lactamases (SHV-2, SHV-3, SHV-4 and SHV-5) . The CARB probe hybridized with the genes for PSE-1 (CARB-2), PSE-4 (CARB-1), CARB-3 and CARB-4 . None of the probes hybridized with genes for any of eight oxacillin-hydrolysing enzymes, PSE-2, OXA-1 to OXA-7, ROB-1 and chromosomal beta-lactamases of various Enterobacteriaceae (except Klebsiella pneumoniae) and Pseudomonas aeruginosa . Investigations of Escherichia coli clinical isolates using these probes indicate the presence of a novel type of extended-spectrum, transferable beta-lactamase. Rev Infect Dis, 1991 Jul-Aug, 13 Suppl 9, S733 - 6 Ticarcillin-clavulanate therapy for bacterial skin and soft tissue infections; File TM Jr et al.; Ticarcillin-clavulanate is active in vitro against the vast majority of pathogens involved in skin and soft tissue infections . A compilation of six controlled clinical trials of ticarcillin-clavulanate for treatment of skin infections showed a satisfactory clinical response in 175 (93%) of 189 cases . The bacteriologic response included eradication of Staphylococcus aureus, Enterococcus species, Enterobacteriaceae, and Pseudomonas aeruginosa in 88%, 75%, 88%, and 77% of cases, respectively . In addition, the records of 17 patients with diabetic foot infections who were treated with ticarcillin-clavulanate as monotherapy in controlled trials are reviewed . Eight of these infections were cured and eight were improved at the end of therapy . The available clinical data suggest that ticarcillin-clavulanate is effective antimicrobial therapy for skin infections. J Trauma, 1991 Jul, 31(7), 991 - 4; discussion 994-5 Autologous fibrin gel: bactericidal properties in contaminated hepatic injury; Dulchavsky SA et al.; Fibrin glue is an effective hemostatic agent in a variety of clinical situations; its utility is limited by potential transmission of viral infection . We studied the bactericidal properties of fibrin gel (FG) in a murine contaminated hepatic injury model and in vitro by agar plate culture method . Intra-abdominal abscess formation and adhesion rate were assessed following controlled liver injury in association with abdominal contamination with 10(7) Bacteroides fragilis and hepatorrhaphy (H, n = 15) or FG (n = 12) . Animals treated by hepatorrhaphy had a significantly greater intra-abdominal abscess rate (15/15 vs . 4/12, p less than 0.05) and adhesion rate (14/15 vs . 6/12, p less than 0.05) than animals treated with FG . Fibrin gel is bactericidal to Bacteroides fragilis, Enterobacter faecium, Escherichia coli, and Staphylococcus aureus but has no effect against Klebsiella pneumoniae or Pseudomonas aeruginosa; the plasma component appears active . Fibrin gel demonstrates significant improvement in adhesion formation and intra-abdominal abscess rate when compared with suture hepatorrhaphy . Fibrin gel appears protective in contaminated hepatic injury. Am J Med Sci, 1991 Jul, 302(1), 46 - 9 Aztreonam: a review of the first monobactam; Westley-Horton E et al.; Aztreonam represents the first synthetic monobactam marketed in the United States and is being viewed as a nontoxic alternative to the aminoglycosides . Advantages of aztreonam over the aminoglycosides include lack of ototoxicity and nephrotoxicity and better penetration into the CSF . Additional advantages include its use in penicillin and cephalosporin allergic patients . Disadvantages of aztreonam compared to the aminoglycosides include the cost of the drug (50 times more expensive than gentamicin), the lack of post antibiotic effect, resistance to P . aeruginosa, and lack of significant activity against Enterobacter cloacae and E . aerogenes . There are insufficient clinical trials to document the superiority of aztreonam over the "gold standard" therapy for gram-negative infections--the aminoglycosides . The restricted anti-microbial spectrum of aztreonam has been proposed as an advantage . Theoretically, this would permit targeting of a gram-negative pathogen with minimal disruption of the (largely anaerobic) intestinal flora . In fact, use of this drug has been associated with colonization of gram-positive organism, especially enterococci . Although aztreonam appears to be an excellent antibiotic, its use has been limited by its relatively high cost, narrow spectrum of activity, and the availability of numerous alternative agents. Respir Med, 1991 Jul, 85(4), 301 - 8 A double-blind comparison of the effects of cefaclor and amoxycillin on respiratory tract and oropharyngeal flora and clinical response in acute exacerbations of bronchitis; Trigg CJ et al.; Fifty-one patients admitted to hospital with severe exacerbations of chronic bronchitis entered a double-blind trial of treatment with cefaclor (500 mg tds) compared with amoxycillin (500 mg tds) for 7 days . Twenty-six patients received cefaclor and 25 amoxycillin . Sputum and throat swabs were collected on admission, after 7 days of therapy and at outpatient follow-up, 3 weeks after treatment had finished . Clinical status and spirometry were assessed on admission and at the third, seventh and 28th day . There was no significant difference between the two regimes for clinical outcome, spirometry or numbers of infecting pathogens . Opportunistic colonization with resistant Gram-negative organisms and Candida species was highly prevalent on admission (56%) in both groups, perhaps because of previous antibiotic administration and general debility of the majority of patients . The high prevalence of opportunistic colonizing organisms persisted at follow-up (48%) with a significant excess of new organisms (Enterobacter cloacae, Klebsiella species and Candida species) present in sputum in the amoxycillin-treated patients . Cefaclor may be less damaging to normal flora than amoxycillin with a consequently reduced risk of colonization and superinfection of the respiratory tract with resistant Gram-negative organisms and yeasts. Mol Microbiol, 1991 Jul, 5(7), 1669 - 79 In vitro activation of Escherichia coli prohaemolysin to the mature membrane-targeted toxin requires HlyC and a low molecular-weight cytosolic polypeptide; Hardie KR et al.; The c . 110 kDa haemolysin toxin secreted by Escherichia coli and other pathogenic Gram-negative bacteria is synthesized as the non-toxic precursor, prohaemolysin (proHlyA), which is unable to target mammalian cell membranes until activated intracellularly by an unknown mechanism dependent upon the coexpressed c . 20 kDa protein, HlyC . We have established in vitro post-translational activation of proHlyA in membrane-depleted cell extract fractions from E . coli recombinant strains containing (separately) the proHlyA and HlyC proteins . In vitro activation was calcium-independent and effective over a pH range of 6 to 9 and at temperatures from 42 degrees C to 4 degrees C . HlyC cell extract was also able to activate proHlyA which had been secreted out of cells containing the export proteins HlyB and HlyD . Fractionation of HlyC cell extracts by sucrose gradient centrifugation and molecular weight chromatography revealed activating fractions as having a molecular mass of 40 kDa, suggesting that the HlyC activator is present physiologically in a multimeric form . Cell extracts containing activation-competent HlyC and proHlyA were inactive following dialysis, but activity was restored by complementation with a cell extract lacking both proteins . HlyC and proHlyA proteins which were overproduced separately from recombinant expression plasmids were inactive following purification, but activity could again be restored with a Hly-negative cell extract . These experiments demonstrated that HlyC is not sufficient for activation; an additional cellular factor is required . The cellular factor was found in enterobacteria but not other bacteria or eukaryotic cells . It was cytosolic, protease-sensitive, and behaved as a c . 10 kDa polypeptide in a number of assays including dialysis, sucrose gradient centrifugation, and gel filtration chromatography . Thus activation was possible in a defined in vitro reaction containing only purified proHlyA, HlyC, and the cellular factor . Kinetic studies in which the relative concentrations of the three components of proHlyA activation were varied suggested that neither HlyC nor the cellular factor acts as a conventional enzyme, with each participating in a finite number of activation events. Antimicrob Agents Chemother, 1991 Jul, 35(7), 1413 - 22 Correlation between in vitro and in vivo activity of antimicrobial agents against gram-negative bacilli in a murine infection model; Fantin B et al.; We studied the relationship between in vitro susceptibility tests (MICs, MBCs) and in vivo activity of tobramycin, pefloxacin, ceftazidime, and imipenem against 15 gram-negative bacilli from five different species in a murine thigh infection model . Complete dose-response curves were determined for each antimicrobial agent against each strain, and three parameters of in vivo activity were defined: maximal attainable antimicrobial effect (i.e., reduction in log10 CFU per thigh compared with untreated controls) at 24 h (Emax), total dose required to reach 50% of maximal effect (P50), and total dose required to achieve a bacteriostatic effect (static dose) . Pefloxacin demonstrated the greatest Emax (P less than 0.05) . Tobramycin was the most potent antimicrobial agent, as indicated by its having the lowest static dose/MIC ratio (P less than 0.002) . Log10 P50s and static doses correlated significantly with log10 MICs or MBCs for the 15 strains of each antibiotic (P less than 0.01) except imipenem (P greater than 0.50) . The greater potency of imipenem against the three Pseudomonas aeruginosa strains than against strains of the family Enterobacteriaceae (P less than 0.01) explained this lack of correlation . A longer duration of postantibiotic effect for imipenem against P . aeruginosa (P = 0.02) contributed to its increased potency against these strains . We conclude that in vitro susceptibility tests correlated well with in vivo activity in this animal model and that variations in potency among the four antimicrobial agents could be explained by differences in pharmacokinetics or pharmacodynamic activity. Rev Infect Dis, 1991 Jul-Aug, 13(4), 751 - 60 Role of antibodies and antibiotics in aerobic gram-negative septicemia: possible synergism between antimicrobial treatment and immunotherapy; Overbeek BP et al.; Recovery from gram-negative septicemia depends on the successful joint action of antibiotics and host defense mechanisms . The possible enhancement of host defense with either immunotherapy or antibiotic treatment has been the subject of numerous investigations . Because of the great similarity of core epitopes within different species of Enterobacteriaceae, most studies have focused on the development of cross-reactive and/or cross-protective antibodies to these common epitopes . The majority of strains that cause severe gram-negative septicemia, however, possess a complete O antigen (and often a K antigen) that may camouflage the common antigenic determinants . Antibodies to these common antigens therefore may be unable to recognize their targets . Subinhibitory concentrations of certain antibiotics have been shown to alter surface structures of Enterobacteriaceae to such an extent that the structures no longer camouflage underlying epitopes, allowing binding of cross-reactive or cross-protective antibodies to these epitopes . Thus antibiotics and antibodies may synergistically fight infection. Rev Infect Dis, 1991 Jul-Aug, 13(4), 613 - 9 Bacteremia in granulocytopenic patients in a tertiary-care general hospital; Ehni WF et al.; Episodes of bacteremia in granulocytopenic patients during 1985 and 1986 at a tertiary-care general hospital were reviewed to assess the adequacy of current empiric antimicrobial therapy . The major pathogens in these cases were Pseudomonas aeruginosa, Enterobacteriaceae organisms, and Staphylococcus epidermidis . This combination of pathogens differed from that found at the same facility from 1975 to 1977, when Staphylococcus aureus and streptococci predominated . When apparent, the sources of infection were predominantly venous catheters, the lower respiratory tract, and the urinary tract; most frequently there was no identifiable focus . S . epidermidis and streptococci were isolated more frequently during initial episodes of febrile bacteremia, and P . aeruginosa was isolated more often during subsequent episodes . If a narrow definition for therapeutic outcome is used, only 38% of episodes had a favorable response; response rates were no different with appropriate or inappropriate therapy . The low response rate may have been related to the use of data from the previous review to guide empiric therapy and to the subsequent inadequate treatment of infections caused by Pseudomonas and Enterobacter organisms . The overall mortality per total bacteremic episodes was 19%, and the primary factor associated with mortality was pneumonia (P less than .0001) . This study emphasizes the need for ongoing surveillance of local patterns of bacteremia to direct empiric therapy. Rev Infect Dis, 1991 Jul-Aug, 13(4), 550 - 8 Bacteremia caused by Enterobacter: 15 years of experience in a cancer hospital; Bodey GP et al.; A total of 296 episodes of bacteremia due to Enterobacter occurred in 281 patients with cancer between 1972 and 1986 . The majority of these episodes were caused by Enterobacter cloacae . Seventy-four percent of the patients developed their infection while in the hospital and 55% had received therapeutic antibiotics during the 10 days preceding the onset of the infection . Enterobacter bacteremia was associated with shock in 24% of the patients and with disseminated intravascular coagulation in only 3% . The overall rate of response to therapy was 79% and increased to 85% during the last 5-year period . Only five patients remained afebrile during their infection, but four of these five died . Only 37% of the patients with shock responded to therapy compared with 93% of the patients without shock . The rate of response to therapy was 86% among patients without pulmonary infection compared with only 53% among those with pulmonary infection . The response rate to therapy with a single antibiotic was 73% and that to therapy with two antibiotics was 85% . As single therapeutic agents aminoglycosides were less effective than beta-lactam agents. Infection, 1991 Jul-Aug, 19(4), 208 - 15 Swedish Study Group . A randomized multicenter trial to compare the influence of cefaclor and amoxycillin on the colonization resistance of the digestive tract in patients with lower respiratory tract infection; Septicemia caused by contaminated parenteral nutrition pouches: the refrigerator as an unusual cause; Hospital Hygienics Laboratory C.H.U . Cote de Nacre, Caen, FranceEleven patients in a hospital presented with septicemia caused by Enterobacter cloacae . The origin was the contamination of parenteral nutrition admixture from a resting place in the refrigerator of the parenteral mixture preparation room. Diagn Microbiol Infect Dis, 1991 Jul-Aug, 14(4), 319 - 30 In vitro antimicrobial activity of sparfloxacin (AT-4140, CI-978, PD 131501) compared with numerous other quinolone compounds; Jones RN et al.; Sparfloxacin (AT-4140, CI-978, PD 131501) was tested against over 800 recent bacteremic strains and compared with ciprofloxacin and six other fluoroquinolones . The 90% minimum inhibitory concentration (MIC90) ranges for the Enterobacteriaceae species were (a) sparfloxacin, 0.03-1 microgram/ml and (b) ciprofloxacin, 0.015-0.25 microgram/ml . Moraxella catarrhalis, Haemophilus influenzae, and Neisseria gonorrhoeae were very susceptible to sparfloxacin (MIC90s, 0.004- less than or equal to 0.03 microgram/ml) and the other comparison drugs . Staphylococcus aureas and other staphylococci were generally susceptible to the tested fluoroquinolones but very susceptible to sparfloxacin and WIN 57273 . All beta-hemolytic streptococci, enterococci, and pneumococci had sparfloxacin MICs of less than or equal to 1 microgram/ml . Sparfloxacin was quite active against anaerobic bacteria including Bacteroides fragilis gr . and Gram-positive strains (MIC90s, less than or equal to 2 micrograms/ml) . The most resistant enteric bacilli were among Serratia marcescens and the Proteae, especially the Providencia spp . (two- to eightfold higher MICs) . Pseudomonas aeruginosa strains were also susceptible to sparfloxacin (MIC90, 2 micrograms/ml) . Magnesium ions, CO2 incubation, and low pH had some adverse effect on sparfloxacin MICs, and resistance development was documented among current clinical isolates of staphylococci, pseudomonas, and some enteric species. Diagn Microbiol Infect Dis, 1991 Jul-Aug, 14(4), 361 - 4 Antimicrobial activity of cefpirome . An update compared to five third-generation cephalosporins against nearly 6000 recent clinical isolates from five medical centers; Jones RN et al.; Cefpirome, cefotaxime, ceftazidime, cefoperazone, ceftizoxime, and ceftriaxone were tested against approximately 6000 fresh clinical isolates from five medical centers . For 3031 strains of Enterobacteriaceae tested, cefpirome consistently had the lowest MIC50s and lowest percentage of resistant strains . Cefpirome was also the most active agent against the 2138 Gram-positive cocci tested; Staphylococcus haemolyticus was uniformly resistant to all agents tested . Against 791 nonenteric Gram-negative bacilli, the activity of cefpirome was most comparable to that of cefoperazone and slightly less active than ceftazidime . Among the current third-generation cephalosporins, cefotaxime and cefoperazone emerged as having better overall balanced activity . Ceftazidime displayed poorest coverage against Enterobacteriaceae and Gram-positive organisms . Ceftizoxime also provided compromised coverage of staphylococci and nonenteric Gram-negative bacilli . Cefpirome remains as active as originally described in 1984 and possesses a slightly wider spectrum of activity against contemporary aerobic pathogens compared to currently marketed third-generation cephalosporins. Diagn Microbiol Infect Dis, 1991 Jul-Aug, 14(4), 301 - 9 Antimicrobial activity of E-1040, a novel thiadiazolyl cephalosporin compared with other parenteral cephems; Jones RN et al.; E-1040, a new parenteral fourth-generation cephalosporin, was tested against greater than 600 bacteremic pathogens and compared with cefotaxime, ceftazidime, and cefpirome . E-1040 activity against Staphylococcus aureus was comparable (MIC90, 8 micrograms/ml) to ceftazidime, but inferior to cefotaxime (MIC90, 2 micrograms/ml) and cefpirome (MIC90, 0.5 microgram/ml) . beta-Hemolytic streptococci and most Gram-positive anaerobes were also susceptible to E-1040 . Some strains of coagulase-negative staphylococci, all oxacillin-resistant Staphylococcus spp., enterococci, and Bacteroides fragilis group strains were resistant to E-1040 (MIC90, greater than 64 micrograms/ml) . Comparative tests for E-1040 and the three other cephalosporins against pseudomonads and nonenteric Gram-negative bacilli showed E-1040 to be generally most active . The E-1040 MIC90 for Pseudomonas aeruginosa was 1 microgram/ml and for ceftazidime it was 4 micrograms/ml . Haemophilus influenzae, Moraxella catarrhalis, and Neisseria spp . has E-1040 MIC90s ranging from 0.12 to 2 micrograms/ml . Neisseria gonorrhoeae, strains resistant to penicillin, did not have markedly elevated E-1040 MICs compared with penicillin-susceptible strains . Enterobacteriaceae species had all MICs of less than or equal to 8 micrograms/ml for E-1040 and cefpirome, indicating activity against strains producing stably derepressed beta-lactamases . E-1040 appeared to be beta-lactamase stable, little influenced by testing systems or media, and was bactericidal . E-1040 seems to have promise as a parenteral beta-lactam for use on strains resistant to "third-generation" cephalosporins and other families of drugs such as aminoglycosides and fluoroquinolones. J Bacteriol, 1991 Jul, 173(14), 4310 - 7 Extracellular secretion of pectate lyase by the Erwinia chrysanthemi out pathway is dependent upon Sec-mediated export across the inner membrane; He SY et al.; The plant pathogenic enterobacterium Erwinia chrysanthemi EC16 secretes several extracellular, plant cell wall-degrading enzymes, including pectate lyase isozyme PelE . Secretion kinetics of 35S-labeled PelE indicated that the precursor of PelE was rapidly processed by the removal of the amino-terminal signal peptide and that the resulting mature PelE remained cell bound for less than 60 s before being secreted to the bacterial medium . PelE-PhoA (alkaline phosphatase) hybrid proteins generated in vivo by TnphoA insertions were mostly localized in the periplasm of E . chrysanthemi, and one hybrid protein was observed to be associated with the outer membrane of E . chrysanthemi in an out gene-dependent manner . A gene fusion resulting in the substitution of the beta-lactamase signal peptide for the first six amino acids of the PelE signal peptide did not prevent processing or secretion of PelE in E . chrysanthemi . When pelE was overexpressed, mature PelE protein accumulated in the periplasm rather than the cytoplasm in cells of E . chrysanthemi and Escherichia coli MC4100 (pCPP2006), which harbors a functional cluster of E . chrysanthemi out genes . Removal of the signal peptide from pre-PelE was SecA dependent in E . coli MM52 even in the presence of the out gene cluster . These data indicate that the extracellular secretion of pectic enzymes by E . chrysanthemi is an extension of the Sec-dependent pathway for general export of proteins across the bacterial inner membrane. Gac Med Mex, 1991 Jul-Aug, 127(4), 315 - 20 {The etiology of purulent meningoencephalitis in pediatrics . The therapeutic implications}; Games-Eternod J et al.; In order to know the etiology of purulent meningitis in infant and children, a retrospective study was done; 709 cases of a pediatric infectious disease service were analyzed . Diagnosis was established either by antigen detection (coagglutination) or bacterial culture . In 334/709 (48%) the bacterial agent was identifies . Haemophilus influenzae type b (70%), Streptococcus pneumoniae (14%), Enterobacteriaceae (8%) and Streptococcus sp (6.5%) were the most frequent . According to our results the epidemiologic pattern of purulent meningitis has not changed . A therapeutic approach is suggested. |