Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us


Infect Immun, 1982 Jun, 36(3), 1013 - 8
Blastogenic responses of lymphocytes from mice immunized by sublethal infection with yeast cells of Histoplasma capsulatum; Tewari RP et al.; Blastogenic responses of spleen cells to histoplasmin and ribosomal antigens and to the mitogens concanavalin A . phytohemagglutinin, and lipopolysaccharide were studied in normal and immunized mice (10(5) live yeast cells of Histoplasma capsulatum given by the subcutaneous route) . Cells (10(6) per well) were cultured with and without antigens and mitogens in microtiter plates with RPMI 1640-5% heat-inactivated normal mouse serum for 72 h at 37 degrees C . Cells were harvested after a 16- to 18-h pulse with 1 microCi of {3H}thymidine (6.7 Ci/mol), and thymidine incorporation was measured by scintillation counting . The initial blastogenic response to concanavalin A (54 X 10(3) cpm) was suppressed (P less than 0.001) from 4 to 14 days post-immunization and returned to control levels on day 21 . The response to phytohemagglutinin was suppressed up to 21 days . Lipopolysaccharide responses, however, were affected to a lesser degree . Blastogenic responses to histoplasmin and H . capsulatum ribosomes were similar on day 0 in normal and immune lymphocytes, but by day 4 cells from immunized mice were more responsive (P less than 0.01) . The maximum response to H . capsulatum antigens was detected on day 42 and was 9- to 16-fold higher than in controls . These results demonstrate in vitro responses of primed lymphocytes on exposure to H . capsulatum antigens and suppressed responses to mitogens during early stages of the immune response.

J Inorg Biochem, 1982 Jun, 16(3), 201 - 13
Role of magnesium cations in the yeast orotate phosphoribosyltransferase catalyzed reaction . Mechanism of the inhibition by Cu++ and Ni++ ions; Dodin G et al.; The magnesium chelate of the N(3)H tautomer of orotate, L3Mg, is the true substrate in the biosynthesis of orotidine 5'-monophosphate (OMP) catalyzed by yeast orotate phosphoribosyltransferase (OPRTase, E.C . 2.4.210) with a Michaelis constant KmL3Mg equal to 12(2) muM . It is postulated that Mg++ cations activate the transport of orotate to the active site by neutralizing the orotate charges; the ligand N(3)H is then exchanged between the incoming cation and the cation bound to the enzyme, thus ensuring the stabilization of the appropriate isomeric structure of orotate . This scheme, together with kinetic and thermodynamic data on orotate complexation by Mg++ and Ca++, accounts for the role of Ca++ cations that neither activate nor inhibit OMP synthesis . Cu++ and Ni++ inhibiting properties arise from the formation of inert complexes of orotate . Ni++ complexes have a poor affinity for the protein, whereas Cu++ complexes have a Michaelis constant similar to that of the L3Mg active species . The inertness of these complexes is tentatively understood in terms of low phosphoribosyl transfer rates as postulated from the kinetic study of the protonation of the complexes in water.

Biosci Rep, 1982 Jun, 2(6), 419 - 26
Does more than one mitochondrially synthesized protein in yeast have larger precursors?
Ashraf J, Jayaraman J.
Yeast cells undergoing derepression (the phase of mitochondriogenesis) were exposed to {14C}formate in the presence of cycloheximide, the cytosolic protein synthesis inhibitor, and of 1,10-phenanthroline, a metallo-protease inhibitor . Extensive labelling was obtained under such conditions . Incubation of these labelled products with mitochondrial lysates released small peptides (mol . wt . 500-1000) . These results indicate that mitochondria probably synthesize some of the proteins in the precursor form and they are processed by a specific matrix-located protease before proper integration.

Proc Natl Acad Sci U S A, 1982 Jun, 79(11), 3493 - 7
Construction of a yeast actin gene intron deletion mutant that is defective in splicing and leads to the accumulation of precursor RNA in transformed yeast cells; Gallwitz D; The actin gene in yeast Saccharomyces cerevisiae is interrupted by a 309-base-pair intron within the protein-coding region . By using nuclease BAL-31, several intron deletion mutants were constructed to define sequences at the 5' splice junction that are required for RNA splicing . Extensive parts of the intron can be removed without affecting correct splicing . One mutant gene from which the invariant thymidine residue in the second intron position was deleted led to the accumulation of large amounts of unspliced actin mRNA when introduced into yeast cells through a recombinant high-copy-number plasmid . No evidence for the usage of alternative splice sites was obtained.

Proc Natl Acad Sci U S A, 1982 Jun, 79(11), 3428 - 32
Protein complexes from active replicative fractions associate in vitro with the replication origins of yeast 2-micrometers DNA plasmid; Jazwinski SM et al.; In a search for a replication complex, the activity that replicates the 2-micrometers yeast DNA plasmid in vitro was isolated in a high molecular weight form (Mr approximately 2 X 10(6) by gel filtration and rate-zonal sedimentation from extracts prepared from cells of the budding yeast Saccharomyces . When obtained from cells in late logarithmic cultures this material or "complex" was labile compared to that from early logarithmic cultures, and it did not survive as a complex after ammonium sulfate precipitation . This suggests that, as cultures approach stationary phase and cells cease growth, the association of its protein constituents may be altered . A chimera of 2-micrometers DNA inserted into the plasmid pBR322 was used to test for binding of components of the complex . After a brief incubation of the chimera in vitro with the high molecular weight material containing replicating activity, a protein "knob" was found associated with the 2-micrometers DNA as shown by electron microscopy . This association was not random but was limited to two positions on the plasmid . In the same series of experiments, the in vitro origins of 2-micrometers plasmid replication were also mapped . Two origins were found, consistent in position with those that have been identified in vivo . Molecules utilizing both origins simultaneously in vitro were not observed, and replication in vitro was bidirectional . The location of the origins corresponded to the positions at which the protein knobs associated with 2-micrometers DNA . This and the fact that no replicative intermediates with associated complexes were detected raises the possibility that a specific protein complex may be involved in initiation of DNA replication.

Chem Phys Lipids, 1982 Jun, 30(4), 297 - 308
Changes in the plasma membrane of yeast observed by spin label electron spin resonance and caused by photodynamic attack; Collins JM et al.; Spin label electron spin resonance (ESR) was used to characterize the response of lipid regions of the plasma membrane of yeast to photodynamic attack . Following photodynamic attack, the structure of these lipid regions changed resulting in the disappearance of an apparent order-disorder phase transition as well as impeding the diffusion of the steric acid based spin label 12NS into and across the plasma membrane . We propose that singlet molecular oxygen reacting with unsaturated carbon bonds in the fatty acyl chains of lipid surrounding channel proteins leads to an increase in the order of the lipid array and/or a change in the channel protein's conformation and is the cause of the lethal effect of externally sensitized photodynamic action.

Cell, 1982 Jun, 29(2), 573 - 84
Genetic properties of chromosomally integrated 2 mu plasmid DNA in yeast; Falco SC et al.; We obtained strains of yeast with large segments of 2 mu plasmid DNA integrated at several chromosomal locations by selecting genetically for recombination between a chromosomal sequence carried on a 2 mu-circle-containing hybrid plasmid and a homologous sequence on the chromosome . In all diploids examined, the presence of 2 mu circle sequences causes a marked instability of the chromosome into which the 2 mu DNA is inserted . Although in some cases the loss of genetic markers is due to physical loss of the entire chromosome, in most cases the loss of markers appears to be due to a mitotic homozygotization of markers: the allelic information from the homologous chromosome replaces the information distal to the integrated 2 mu DNA . The instability caused by integrated 2 mu DNA sequences requires the activity of the specialized site-specific recombination system encoded by the 2 mu plasmid . We propose that the presence of integrated 2 mu DNA allows efficient integration of additional copies of the intact 2 mu plasmid by the action of the plasmid-coded special recombination system . Unequal sister-strand exchanges within the inverted repetition would result in the formation of dicentric chromosomes whose breakage during mitosis might begin a cycle analogous to the breakage-fusion-bridge cycle described many years ago in maize.

Biokhimiia, 1982 Jun, 47(6), 1039 - 45
{Some features of methylpyrophosphate hydrolysis by yeast inorganic pyrophosphatase}; Mel'nik MS et al.; The interaction of yeast inorganic pyrophosphatase with methylpyrophosphate was studied . In the presence of Mg2+ the rate of hydrolysis of the methylpyrophosphate-Zn2+ complex by the enzyme was shown to decrease . This was accompanied by competition of Zn2+ and Mg2+ for one site of Me2+ binding on the enzyme . The kinetics of combined hydrolysis of zinc methylpyrophosphate and zinc pyrophosphate were studied . It was found that both substrates are hydrolyzed at the same active site of the enzyme . Free methylpyrophosphate when bound to a specific phosphorylation site on the enzyme surface accelerated magnesium pyrophosphate hydrolysis . Some kinetic parameters of this hydrolysis were determined.

Mol Cell Biochem, 1982 May 28, 45(1), 41 - 8
Formation of lipid-linked sugars in mycelial and yeast-like forms of Mucor rouxii; Bernard EA et al.; Cell wall fragments from both yeast-like and mycelial forms of the dimorphic fungus Mucor rouxii were used as enzymatic preparations to study the synthesis and role of prenyl-phospho-sugars in these systems . In the presence of GDP {14C} mannose two main products were formed . One of them was characterized as dolichol-monophosphate beta-mannose on the following basis: solubility in organic solvents, behaviour upon paper chromatography, DEAE cellulose column chromatography, mild acid hydrolysis, alkali treatment, catalytic reduction and phenol degradation . The other product was identified as a glycoprotein containing a single mannose unit linked to a serine or threonine residue . It was degraded with pronase and by mild NaOH-NaBH4 treatment all the radioactivity was released as free mannitol . When UDP {14C} glucose was employed as sugar donor two butanol soluble components were isolated . One of them (25%) was characterized as dolichol-monophosphate-beta-glucose on the basis of the same criteria as described above . The other one (75%) was neutral and was not studied in detail . Mycelial enzymes were about 40 times more active in the synthesis of the dolichol derivatives . In addition, large amounts of glycogen were detected . The role that both dolichol derivatives might play in glycoprotein biosynthesis is discussed.

J Biol Chem, 1982 May 25, 257(10), 5800 - 8
The biogenesis and regulation of yeast mitochondria RNA polymerase; Lustig A et al.; Yeast mitochondrial RNA polymerase is a nuclear-coded protein of approximately 90,000 daltons comprised of two 45,000-dalton subunits of pI 6.9 to 7.0 . To investigate the nature of the initial translation product of the RNA polymerase, we have analyzed those products of a cell-free translation system directed by yeast RNA that are immunoreactive with antibodies to the 45,000-dalton peptide of polymerase . A precursor of one or more of the subunits of the polymerase, 2,000 daltons later than the mature product, has been characterized using immunoreaction, immunocompetition, and peptide digestion . The role of transcription of the polymerase gene in catabolite repression of mitochondrial development has been investigated by analyzing the changes in cell-free synthesis of the RNA polymerase precursor during glucose and raffinose growth . The results indicate an increase in precursor synthesis and probably in the corresponding transcript abundance during glucose derepression . In contrast, the precursor is present at high levels until stationary phase during raffinose growth . These data indicate the involvement of increased transcription of the polymerase gene in the process of derepression.

Nucleic Acids Res, 1982 May 25, 10(10), 3195 - 209
In vitro transcription by purified yeast RNA polymerase II . Coarse promoter mapping on homologous cloned genes; Carnevali F et al.; Clones of the yeast Tyl element and 2 microns plasmid have been selectively transcribed in vitro by partially or completely purified yeast RNA polymerase II . Electrophoretic analysis of whole and restricted ternary transcription complexes allows the localization of the in vitro actively transcribed regions of the analyzed genes . The DNA regions that actively promote in vitro transcription correspond to the nucleotide sequence that in the Tyl element encompasses the in vivo transcription initiation sites and that in the 2 micrometer plasmid encompasses the starting codons of two oppositely oriented potential protein coding frames . The transcription assay that we describe herein may be applied to analyze rapidly the in vitro transcription of clones genes, to localize transcription initiation sites on supercoiled templates and to evaluate the differential in vitro promoter strength in RNA polymerase II served genes . Data obtained with RNA polymerase II at two different stages of purification are presented in parallel . Studies with a completely purified enzyme should certainly be preferred although the use of a partially purified RNA polymerase II may be convenient and may reveal factors which affect specificity.

Nucleic Acids Res, 1982 May 25, 10(10), 3133 - 48
Molecular cloning and analysis of yeast gene for cycloheximide resistance and ribosomal protein L29; Fried HM et al.; A cosmid clone bank of yeast DNA has been used to isolate the cycloheximide resistance gene cyh2 of Saccharomyces cerevisiae . A cosmid carrying this gene was identified by cross hybridization to another cloned gene, tsm437 . The two genes, which are tightly linked genetically are both present on a 31 kb segment of cloned DNA . The cyh2 gene encodes ribosomal protein L29, a component of the large subunit . Blot hybridization analysis reveals that this gene is present as a single copy in the yeast genome, unlike many other yeast ribosomal protein genes which appear to be duplicated . The cyh2 gene also appears to contain an intervening sequence, a characteristic common to most yeast ribosomal protein genes that have been cloned.

J Biol Chem, 1982 May 25, 257(10), 5866 - 72
Yeast DNA topoisomerase II . An ATP-dependent type II topoisomerase that catalyzes the catenation, decatenation, unknotting, and relaxation of double-stranded DNA rings; Goto T et al.; An activity from the yeast Saccharomyces cerevisiae, initially noted for its catalysis of aggregation of covalently closed double-stranded DNA rings in the presence of ATP, has been identified as a type II DNA topoisomerase and is designated yeast DNA topoisomerase II . The formation of the DNA aggregate, which has been shown to be a network of DNA rings that are topologically interlocked, requires the presence of a yeast DNA-binding protein in addition to the topoisomerase . In the absence of the binding protein, yeast DNA topoisomerase II catalyzes decatenation and unknotting of duplex DNA rings and the relaxation of negatively or positively supercoiled DNA . All reactions are ATP-dependent and require Mg(II) . Similar to other eukaryotic and phage T4-type II DNA topoisomerases, the yeast enzyme does not catalyze DNA supercoiling under the assay conditions employed . The activity is not sensitive to the gyrase inhibitor nalidixic acid, oxolinic acid, or novobiocin . Coumermycin inhibits the activity, however, at a concentration as low as 5 microgram/ml.

Biochem J, 1982 May 1, 203(2), 523 - 5
The binding of glucose to yeast hexokinase monomers is independent of ionic strength; Mayes EL et al.; Hoggett & Kellett {Eur . J . Biochem . 66, 65-77 (1976)} have reported that the binding of glucose to the monomer of hexokinase PII isoenzyme is independent of ionic strength, in contrast to the subsequent claim of Feldman & Kramp {Biochemistry 17, 1541-1547 (1978)} that the binding is strongly dependent on ionic strength . Since measurements with native hexokinase P forms are complicated by the fact that the enzyme exists in a monomer-dimer association-dissociation equilibrium, we have now studied the binding of glucose to the proteolytically-modified S forms which are monomeric . At pH 8.5, the affinity of glucose for both SI and SII monomers is independent of salt concentration over the range of KCl concentrations 0-1.0 mol . dm-3 and is in good agreement with that of the corresponding P forms in both low and high salt . These observations confirm that the binding of glucose to hexokinase P monomers is independent of ionic strength and that the affinity of glucose for the hexokinase PII monomer is about an order of magnitude greater than that for the dimer.

Clin Exp Immunol, 1982 May, 48(2), 411 - 6
Yeast opsonization in newborn infants and its relationship to parental atopy; Richardson VF et al.; Sera from 30 of 303 (9.9%) unselected term newborn infants were deficient in their ability to opsonize heat-killed baker's yeasts, an incidence which is almost double that seen in adults . Genetic influence is important in some since the mothers of 10 infants with defective opsonization showed the same defect, but it was not related to the sex or race of the infant or to the atopic state of the parents . In others the defect could be due to a functional maturation delay of the complement system, but not to inhibitory factors in neonatal serum since correction of opsonization was achieved with subopsonizing amounts of normal sera . Significantly more infants had sera with high opsonizing capacity (greater than 80% yeasts phagocytosed) when compared with adults; perhaps antibody independent immune mechanisms like this are important in the newborn . This study shows that a common specific immunodeficiency which may predispose to severe infection or atopy can be identified at birth.

Cell, 1982 May, 29(1), 235 - 44
Nucleotide sequence comparisons and functional analysis of yeast centromere DNAs; Fitzgerald-Hayes M et al.; We determined the nucleotide sequence of DNA segments containing functional centromeres (CEN3 and CEN11) isolated from yeast chromosomes III and XI . The two centromere regions differ in primary nucleotide sequence, but contain structural features in common . Both centromere regions contain an extremely A + T-rich core segment 87-88 bp in length, flanked by two short sequences (14 bp and 11 bp) that are identical in both DNAs . These elements plus one additional 10 bp region of perfect homology are positioned in an almost identical spatial arrangement within the two centromere regions . Significant homologies are also observed among the sequences flanking the high A + T region and various satellite DNA sequences from higher eucaryotes, although no repeated sequences occur near the yeast centromeres . Centromere activity in vivo is maintained on relatively small DNA fragments (627 bp for CEN3 and 858 bp for CEN11), as assayed by mitotic stabilization of autonomously replicating ars plasmids in yeast.

Biochimie, 1982 May, 64(5), 357 - 62
Formation of a catalytically active complex between tRNAAsp and aspartyl-tRNA synthetase from yeast in high concentrations of ammonium sulphate; Giege R et al.; The interactions of yeast tRNAAsp with cognate aspartyl-tRNA synthetase have been studied in high concentrations of either sodium chloride or ammonium sulphate by fluorescence titration and small-angle neutron scattering . In solutions containing more than 1M NaCl no complex is formed and enzymatic activity is abolished . In strong contrast, however, the physical measurements showed the formation of a two-to-one tRNA-enzyme complex, with high affinity, in 1.6 M (NH4)2SO4 . Aminoacylation assays under the same salt conditions showed the enzymatic fixation of aspartic acid to tRNAAsp to occur at an appreciable rate . The present study emphasizes that the effects of salts on protein-nucleic acid interactions do not depend only on ionic strength but also on the nature of the salt . This study has allowed a rational approach to the crystallisation of a functional tRNAAsp-aspartyl-tRNA synthetase complex (Giege, Lorber, Ebel, Thierry and Moras (1980) C.R . Acad . Sci . Paris, serie D, 291, 393-396).

J Clin Microbiol, 1982 May, 15(5), 949 - 50
Peptone-yeast autolysate-fetal bovine serum 10, a simple, inexpensive liquid medium for cultivation of Leishmania spp; Palomino JC; A simple liquid medium for the cultivation of Leishmania parasites is described . Leishmania brasiliensis and Leishmania peruviana cultured in this medium reached cell densities greater than 10(7) promastigotes per ml within 7 days . This medium compares very favorably with the more complex media used to cultivate Leishmania spp . and other hemoflagellates.

J Bacteriol, 1982 May, 150(2), 963 - 5
Oxygen-induced genetic changes in dry yeast cells; Hieda K; Cells of Saccharomyces cerevisiae were dried in vacuum, exposed to oxygen, nitrogen, air, and water vapor, and rehydrated with degassed medium without exposure to air . Drying per se caused few genetic changes, but the exposure of dry cells to oxygen increased the frequency of adenine-requiring colonies.

Biokhimiia, 1982 May, 47(5), 864 - 8
{Different accessibility to RNase T1 of 5S- and 5.8S-rRNA in 60S subunits and 80S ribosomes of yeast}; Man'kin AS et al.; The accessibility of RNase T1 hydrolysis of small rRNAs in 60S subunits and 80S yeast cytoplasmic ribosomes was studied . It was shown that in 60S subunit 5S and 5.8S rRNAs are hydrolyzed by RNase T1, whereas in 80S ribosome no hydrolysis occurs . The participation of small rRNAs in the association of ribosomal subunits is discussed.

Cell, 1982 May, 29(1), 245 - 55
Cloning yeast telomeres on linear plasmid vectors; Szostak JW et al.; We have constructed a linear yeast plasmid by joining fragments from the termini of Tetrahymena ribosomal DNA to a yeast vector . Structural features of the terminus region of the Tetrahymena rDNA plasmid maintained in the yeast linear plasmid include a set of specifically placed single-strand interruptions within the cluster of hexanucleotide (C4A2) repeat units . An artificially constructed hairpin terminus was unable to stabilize a linear plasmid in yeast . The fact that yeast can recognize and use DNA ends from the distantly related organism Tetrahymena suggests that the structural features required for telomere replication and resolution have been highly conserved in evolution . The linear plasmid was used as a vector to clone chromosomal telomeres from yeast . One Tetrahymena end was removed by restriction digestion, and yeast fragments that could function as an end on a linear plasmid were selected . Restriction mapping and hybridization analysis demonstrated that these fragments were yeast telomeres, and suggested that all yeast chromosomes might have a common telomere sequence . Yeast telomeres appear to be similar in structure to the rDNA of Tetrahymena, in which specific nicks or gaps are present within a simple repeated sequence near the terminus of the DNA.

Cell, 1982 May, 29(1), 227 - 34
Recombination within the yeast plasmid 2mu circle is site-specific; Broach JR et al.; The multicopy yeast plasmid, 2mu circle, encodes a specialized recombination system . It contains two regions, each 599 bp in length, that are precise inverted repeats of each other and between which recombination occurs readily . In addition, this recombination requires the product of a 2mu circle gene, designated FLP . By examining the products of FLP-mediated recombination of plasmids containing single insertions within one of the repeated regions, we show that this recombination occurs only at a specific site within the repeat . This result was confirmed from analysis of the ability of plasmids containing various deletions within one of the repeated regions to serve as substrates for FLP-mediated recombination . These experiments limit the recombination site to a sequence of less than 65 bp . In addition, by mutational analysis of the recombination potential of a hybrid plasmid containing the entire 2mu circle genome, we have shown that FLP is only the 2mu circle gene necessary for this site-specific recombination . Finally, we describe a sensitive assay for recombination between the repeated sequences of 2mu circle; using it, we demonstrate that even in the absence of FLP gene product, recombination between the repeats occurs at a low but detectable level during meiosis.

Proc Natl Acad Sci U S A, 1982 May, 79(9), 2874 - 7
Phosphorylation of the regulatory subunit of yeast cAMP-dependent protein kinase; Sy J et al.; In vitro phosphorylation of the regulatory subunit of yeast cAMP-dependent protein kinase was studied . The cAMP-binding regulatory subunit (R subunit) can be multiply phosphorylated . Three distinct phosphorylation sites were inferred from the different ATP concentrations required for phosphorylation and from the presence of two discrete mobility shifts in NaDodSO4/polyacrylamide gel electrophoresis of the R subunit on phosphorylation . Limited tryptic digestion of the phosphorylated R subunit showed that a Mr 37,000 cAMP-binding peptide contained one of the phosphorylation sites and that a separate Mr 12,000 peptide contained another phosphorylation site . The yeast R subunit is therefore similar to the type II R subunit of mammalian origin, although it has a larger Mr (64,000 vs . 58,000) and is multiply phosphorylated . In vivo, both phosphorylated and unphosphorylated forms of the R subunit were found in cells grown in lactate or to stationary phase in 1.5% glucose, while cells grown in 5% glucose contained the unphosphorylated form.

Biophys Chem, 1982 May, 15(2), 169 - 76
Interaction of yeast 3-phosphoglycerate kinase with negatively charged carriers; Roustan C et al.; The aim of this study was to investigate the possibility of an interaction of yeast 3-phosphoglycerate kinase with negatively charged carriers such as polyanionic agents or a polarized electrode . Various polyanions were found to promote enzyme aggregation as judged by ultracentrifugation measurements and chemical modification . The data obtained suggest that these interactions are mediated through the N-terminal domain of the protein . However, the most striking property of 3-phosphoglycerate kinase described here is concerned with its significant dipolar moment as evidenced by electrocapillary measurements, which allows an orientation of the macromolecule in an electric field . Further, the enzyme could be absorbed by a negatively charged surface, first by hydrophobic links and then oriented perpendicularly to the surface . Therefore, the intrinsic properties of yeast 3-phosphoglycerate kinase agree with the formation of an enzyme-membrane complex and afford the ability for a specific orientation of the molecule at the lipid bilayer surface or in the cytoplasm.

Biokhimiia, 1982 May, 47(5), 740 - 5
{Calorimetric assay of yeast inorganic pyrophosphatase interaction with magnesium and phosphate ions}; Vorob'eva NN et al.; The thermodynamic characteristics for the specific binding of one or two Mg2+ by the yeast inorganic pyrophosphatase and for the enzyme interaction with phosphate were determined . Saturation of the first binding site with Mg2+ causes structural rearrangements in the enzyme molecule without changing the temperature of protein denaturation . On the contrast, saturation of the second binding site results in stabilization of the system, i . e . a considerable fall in the entropy and a rise in the temperature of denaturation . Phosphorylation of the enzyme carboxylic group by inorganic phosphate requires saturation of the first binding site with Mg2+ and is not accompanied by changes in the enthalpy of the system . The pyrophosphate synthesis in the presence of the enzyme saturated with Mg2+ in both binding sites is associated with changes in the enthalpy and, possibly, in the entropy of the system.

Biochim Biophys Acta, 1982 Apr 26, 697(1), 78 - 82
Stabilization of the tertiary structure of yeast phenylalanine tRNA by {Co(NH3)6}3+ . X-ray evidence for hydrogen bonding to pairs of guanine bases in the major groove; Hingerty BE et al.; The sites of three {Co(NH3)6}3+ ions bound to the phenylalanine tRNA of yeast have been determined by X-ray diffraction analysis . {Co(NH3)6}3+ binds to purine-purine sequences in yeast tRNA Phe . It is different from the binding fo Co2+, which binds to the base and phosphate of residue G15 . There are no direct metal-nucleotide bonds, although hydrogen bonding of the coordinated ammines to double-helical guanylguanosine sequences in the major groove and to phosphate oxygen in neighboring polynucleotide strands increases the stability of the structure . Hydrogen-bonding appears to be via cis ammine ligands to N(7) and O(6) positions of adjacent purine bases.

Proc R Soc Lond B Biol Sci, 1982 Apr 22, 215(1198), 19 - 44
The amino acid sequence of yeast phosphoglycerate mutase; Fothergill LA et al.; The complete amino acid sequence of yeast phosphoglycerate mutase comprising 241 residues has been determined . The sequence was deduced from the two cyanogen bromide fragments, and from the peptides derived from these fragments after digestion by a number of proteolytic enzymes . Determination of this sequence now allows a detailed interpretation of the existing high-resolution X-ray crystallographic structure . A comparison of the sequence reported here with the sequences of peptides from phosphoglycerate mutases from other species, and with the sequence of erythrocyte diphosphoglycerate mutase, indicates that these enzymes have a high degree of structural homology . Autolysis of phosphoglycerate mutase by yeast extracts leads to the complete loss of mutase activity, and the formation of electrophoretically distinguishable forms (R . Sasaki, E . Sugimoto & H . Chiba, Archs Biochem . Biophys . 115, 53-61 (1966)) . It is apparent from the amino acid sequence that these changes are due to the loss of an 8-12 residue peptide from the C-terminus.

Experientia, 1982 Apr 15, 38(4), 427 - 9
Reactivation of yeast glucose-6-phosphate dehydrogenase denaturated by saturated fatty acids; Tortora P et al.; Activity of yeast glucose-6-phosphate dehydrogenase, inactivated by treatment with saturated fatty acids, can be partially restored by incubation in a medium of suitable ionic composition . The effectiveness of ions in the reactivation process is inversely related to their 'chaotropic' properties . Time-dependence of reactivation extent suggests a 2-step mechanism of enzyme inactivation and the existence of an intermediate form that aggregates through a 2nd-order reaction, producing irreversibly inactive enzyme.

Biochim Biophys Acta, 1982 Apr 13, 715(2), 143 - 50
Purification and properties of a transketolase responsible for formaldehyde fixation in a methanol-utilizing yeast, candida boidinii (Kloeckera sp.) No . 2201; Kato N et al.; Dihydroxyacetone synthase, present in methanol-grown Candida boidinii (Kloeckera sp.) No . 2201, catalyzes the transfer of the glycolaldehyde group from xylulose 5-phosphate to formaldehyde to form glyceraldehyde 3-phosphate and dihydroxyacetone . This enzyme was purified to electrophoretic homogeneity and found to be a new type of transketolase . The molecular weight of the enzyme was estimated to be 190,000 by gel filtration . The enzyme appeared to be composed of four identical subunits (Mr, 55,000) . Thiamin pyrophosphate and Mg2+ were required for the activity . The optimum pH was found to be 7.0 . With xylulose 5-phosphate as the ketol-donor, aliphatic aldehydes (C1-C7), glycolaldehyde and glyceraldehyde were better acceptors than ribose 5-phosphate . The kinetic data were consistent with a ping-pong bi-bi mechanism . The Km values obtained were as follows: xylulose 5-phosphate, 1.0 mM; formaldehyde, 0.43 mM; glyceraldehyde 3-phosphate, 0.42 mM; and dihydroxyacetone, 0.52 mM.

J Biol Chem, 1982 Apr 10, 257(7), 4001 - 6
Spontaneous spatiotemporal organization in yeast extracts; Jacobsen H et al.; Stirred cytoplasmic extracts of the yeast Saccharomyces uvarum can, on addition of trehalose, display oscillations in the metabolite concentrations . Unstirred extracts may also develop spatiotemporal structures expressed in the metabolite concentrations . In this paper we present evidence of the existence of such patterns . The latter were recorded using the optical absorption of NADH in an annular cuvette, which was rotated in a photometer . Regularly spaced wavelike spatiotemporal standing waves were observed . At certain fixed points the NADH concentration appeared to remain constant . Such phenomena may improve our understanding of biochemical morphogenesis.

Nucleic Acids Res, 1982 Apr 10, 10(7), 2439 - 51
Induced hydrolytic activity of yeast phenylalanyl-tRNA synthetase by tRNAPhe-CC; Kuhn W et al.; "Induced hydrolysis" a new hydrolytic activity, was found by measuring AMP-production during aminoacylation of tRNAPhe-CCA by yeast phenylalanyl-tRNA synthetase in the presence of tRNAPhe-CC under conditions of low ionic strength at pH 8.5 . Experiments using the elongation factor Tu . GTP provide evidence that transfer of phenylalanine to the tRNAPhe-CCA is followed by rapid hydrolysis in the presence of tRNAPhe-CC . A simple mechanism shows good agreement with the experimental data.

Nucleic Acids Res, 1982 Apr 10, 10(7), 2419 - 37
Carbodiimide modification analysis of aminoacylated yeast phenylalanine tRNA: evidence for change in the apex region; Fritzinger DC et al.; The G- and U-specific reagent, carbodiimide was used to probe the solution structure of aminoacylated yeast phenylalanine tRNA . Both quantitative and qualitative changes in modification were observed when the modification patterns of tRNA-CCA(3'OH), tRNA-CCA(3'NH2) and phe-tRNA-CCA(3'NH2) were compared . Five nucleotides were modified in all cases, D16 and G20 in the D-loop, U33 and Gm34 in the anticodon loop and U47, in the region of the extra arm . Small changes occurred in the D-loop with incorporation of the adenosine analogue manifest as new, low levels of modification of G22 (D-stem) and a loss of sensitivity to Mg+2 in modification of D16 . Aminoacylation resulted in new modification of G19, modification of a residue in the T psi CG sequence, and a 2.5-fold increase in modification of G22 . Taken together the results show that aminoacylation causes increased exposure of bases in the apex region of the L-shaped molecule where the D- and psi-loops are joined . The effects observed could occur as a consequence of stable or dynamic changes in conformation.

Nucleic Acids Res, 1982 Apr 10, 10(7), 2199 - 207
Binding of rat ribosomal proteins to yeast 5.8S ribosomal ribonucleic acid; Lee JC et al.; 5.8 S RNA-protein complexes were prepared using purified yeast 5.8 S RNA and proteins from the large ribosomal subunit of rat liver . Formation of such hybrid complexes, as measured by Millipore filtration, was dependent on protein concentration . Binding of proteins to the RNA could approach saturation . Such complexes were isolated from sucrose density gradient centrifugation and shown to contain proteins L6, L8, L19, L35 and L35a . These proteins were identified by their molecular weights on polyacrylamide gels containing dodecylsulfate and their mobilities on two dimensional polyacrylamide gels.

Gene, 1982 Apr, 18(1), 29 - 37
Ribosomal protein genes of yeast contain intervening sequences; Bollen GH et al.; From a colony bank of HindIII-generated yeast DNA fragments we have isolated a number of recombinant DNAs carrying genes for ribosomal proteins (e.g., S10, S16A, S20, S24, S31, S33, L16, L25 and L34) of the yeast Saccharomyces carlsbergensis . By electron microscopic analysis of the R-loops formed between various DNA fragments and yeast mRNA, we could locate the ribosomal protein genes on the physical maps of the cloned DNA fragments . The R-loop structures observed indicate that a number of the ribosomal protein genes contain an intervening sequence.

Biokhimiia, 1982 Apr, 47(4), 546 - 51
{Kinetics of NAD-dependent formate dehydrogenase from the methanol-utilizing yeast Candida methylica}; Zaks AM et al.; A kinetic analysis of the mechanism of action of NAD-dependent formate dehydrogenase (EC 1.2.1.2) from the methanol-utilizing yeast Candida methylica has been carried out . The dependence of the initial reaction rate on substrate concentrations and the inhibition by the reaction products and substrate analogs were investigated . The data obtained suggest that the kinetics of the formate dehydrogenase action are consistent with the formation of a ternary enzyme--substrate complex . NAD is the first substrate and NADH is the last product of the reaction, respectively.

Mol Cell Biol, 1982 Apr, 2(4), 346 - 54
Yeast killer plasmid mutations affecting toxin secretion and activity and toxin immunity function; Bussey H et al.; M double-stranded RNA (MdsRNA) plasmid mutants were obtained by mutagenesis and screening of a diploid killer culture partially heat cured of the plasmid, so that a high proportion of the cells could be expected to have only on M plasmid . Mutants with neutral (nonkiller {K-}, immune {R+}) or suicide (killer {K+}, sensitive {R-} phenotypes were examined . All mutants became K- R- sensitives on heat curing of the MdsRNA plasmid, and showed cytoplasmic inheritance by random spore analysis . In some cases, M plasmid mutations were indicated by altered mobility of the MdsRNA by agarose gel electrophoresis or by altered size of in vitro translation products from denatured dsRNA . Neutral mutants were of two types: nonsecretors of the toxin protein or secretors of an inactive toxin . Of three neutral nonsecretors examined, one (NLP-1), probably a nonsense mutation, made a smaller protoxin precursor in vitro and in vivo, and two made full-size protoxin molecules . The in vivo protoxin of 43,000 molecular weight was unstable in the wild type and kinetically showed a precursor-product relationship to the processed, secreted 11,000-molecular-weight toxin . In one nonsecretor (N1), the protoxin appeared more stable in a pulse-chase experiment, and could be altered in a recognition site required for protein processing.

Gene, 1982 Apr, 18(1), 47 - 59
The nucleotide sequence of the HIS4 region of yeast; Donahue TF et al.; We have determined the nucleotide sequence of the yeast HIS4 gene and its 5' and 3' flanking sequences . The protein chain has a calculated Mr-value of 87 935 . Th 5' end of the HIS4 transcript maps at a position 63 bp upstream from the site of initiation of protein synthesis . The 3' end of the HIS4 transcript maps at a position approx . 118 bp after the UAG termination codon . There is no evidence for intervening sequences within the transcription unit . Functional sub-regions within the HIS4 coding frame have been identified by determining the sequence changes for various his4 mutations.

Mutat Res, 1982 Apr, 104(1-3), 79 - 86
The use of a yeast strain with a temperature-sensitive DNA ligase to estimate DNA repair after exposure to mutagens; Tippins RS et al.; The yeast strain cdc9 which possesses a temperature-sensitive DNA ligase, was used to estimate DNA repair after mutagen exposure . Following low UV fluences, single-strand breaks in DNA were detected after an incubation at the restrictive temperature but were absent at the permissive temperature . These DNA breaks were shown to be equal to the number of pyrimidine dimers induced in DNA as measured by the presence of UV-endonuclease sensitive sites . Similarly, after exposure to the chemical mutagen 4-chloromethyl-biphenyl (4CMB) single-strand breaks accumulated at the restrictive temperature . Hence the technique described should be applicable for the estimation of the early steps of repair of a wide range of different types of DNA damage induced in yeast by exposure to either physical or chemical mutagens.

Eur J Biochem, 1982 Apr 1, 123(2), 267 - 74
Affinity labelling of yeast phenylalanyl-tRNA synthetase with a 3'-oxidised tRNAPhe . Isolation and sequence of the labelled peptide; Renaud M et al.; Yeast phenylalanyl-tRNA synthetase was specifically labelled with a 3'-oxidised tRNAPhe . Stoichiometric inactivation was achieved with the incorporation of 2 mol oxidised tRNA Phe/mol enzyme which corresponds exactly to the stoichiometry of tRNA binding . The labelled peptide has been isolated using a quick chromatographic procedure which can be applied to any covalent complex formed between a tRNA and an aminoacyl tRNA synthetase . The isolated peptide (18 amino acids) was found to encompass the unique cysteine sequence of the smaller beta subunit of the enzyme.

J Clin Microbiol, 1982 Apr, 15(4), 723 - 4
Aniline blue-containing buffered charcoal-yeast extract medium for presumptive identification of Legionella species; Holmes RL; By utilizing buffered charcoal-yeast extract medium containing 0.01% aniline blue in conjunction with a long-wave UV light, the differentiation of five species of Legionella was facilitated . L . pneumophila, when grown on this medium, did not absorb the aniline blue dye; however, L . micdadei, L . dumoffii, L . bozemanii, and L . gormanii absorbed the dye in varying amounts and produced colonies of various shades of blue.

J Cell Biol, 1982 Apr, 93(1), 217 - 22
Ultrastructural organization of yeast chromatin; Rattner JB et al.; The ultrastructural organization of yeast chromatin was examined in Miller spread preparations of samples prepared from spheroplasts or isolated nuclei of Saccharomyces cerevisiae . Micrographs from preparations dispersed in 1 mM Tris (pH 7.2) illustrate that the basic chromatin fiber in yeast exists in two ultrastructurally distinct conformations . The majority (up to 95%) of the chromatin displays a beaded nucleosomal organization, although adjacent nucleosomes are separated by internucleosomal linkers of variable lengths . Ribonucleoprotein (RNP) fibrils are only occasionally associated with chromatin displaying the conformation . The remaining 5-10% of the chromatin appears to be devoid of discrete nucleosomes and has a smooth contour with a fiber diameter of 30-40 A . Transcriptional units, including putative ribosomal precursor RNA genes, defined by the presence of nascent RNP fibrils are restricted to chromatin displaying this smooth morphology . Chromatin released from nuclei in the presence of 5 mM Mg++ displays higher-order chromatin fibers, 200-300 A in diameter, these fibers appear to be arranged in a manner than reflects the two forms of the basic chromatin fiber.

Arch Tierernahr, 1982 Apr, 32(4), 267 - 75
{Carcinogenicity test in long-term bioassay of Fermosin-yeast grown on petroleum hydrocarbons}; Schramm T et al.; To test "fermosinR'-yeast grown on petroleum hydrocarbons for carcinogenic potency the product was fed chronically at a dietary level of 15% to male and female rats (Wistar) . Animals of the control group received the Institute's stock diet, similar to the yeast diet but without "fermosinR' . Feeding of "fermosinR'-diet did not affect the incidence nor the latency period nor the type of tumors compared with the control rats . Studies in mice (XVII) included two separate experiments . In the first one the dorsal skin of the animals was painted by extracts from yeast twice weekly and treated with the co-carcinogenic agent croton oil once a week . In the second experiment the mice were painted by extracts from pork of animals feed with "fermosinR' . The results obtained in rats and in mice did not reveal any evidence for carcinogenic potency of "fermosinR'-yeast.

Genetics, 1982 Apr, 100(4), 565 - 77
Determination of the order of gene function in the yeast nuclear division pathway using cs and ts mutants; Moir D et al.; Cold-sensitive (cs) and heat-sensitive (ts) conditional-lethal mutations that affect specifically the cell division cycle of budding yeast (Saccharomyces cerevisiae) were used to determine the order of gene function . Reciprocal temperature-shift experiments using cs-ts double mutants revealed a detailed order of function among genes whose execution points and mutant phenotypes are very similar . The data suggest that the nuclear branch of the overall cell-cycle pathway itself contains at least one branch.

Genetics, 1982 Apr, 100(4), 547 - 63
Cold-sensitive cell-division-cycle mutants of yeast: isolation, properties, and pseudoreversion studies; Moir D et al.; We isolated 18 independent recessive cold-sensitive cell-division-cycle (cdc) mutants of Saccharomyces cerevisiae, in nine complementation groups . Terminal phenotypes exhibited include medial nuclear division, cytokinesis, and a previously undescribed terminal phenotype consisting of cells with a single small bud and an undivided nucleus . Four of the cold-sensitive mutants proved to be alleles of CDC11, while the remaining mutants defined at least six new cell-division-cycle genes: CDC44, CDC45, CDC48, CDC49, CDC50 and CDC51.--Spontaneous revertants from cold-sensitivity of four of the medial nuclear division cs cdc mutants were screened for simultaneous acquisition of a temperature-sensitive phenotype . The temperature-sensitive revertants of four different cs cdc mutants carried single new mutations, called Sup/Ts to denote their dual phenotype: suppression of the cold-sensitivity and concomitant conditional lethality at 37 degrees . Many of the Sup/Ts mutations exhibited a cell-division-cycle terminal phenotype at the high temperature, and they defined two new cdc genes (CDC46 and CDC47) . Two cold-sensitive medial nuclear division cdc mutants representing two different cdc genes were suppressed by different Sup/Ts alleles of another gene which also bears a medial nuclear division function (CDC46) . In addition, the cold-sensitive medial nuclear division cdc mutant csH80 was suppressed by a Sup/Ts mutation yielding an unbudded terminal phenotype with an undivided nucleus at the high temperature . This mutation was an allele of CDC32 . These results suggest a pattern of interaction among cdc gene products and indicate that cdc gene proteins might act in the cell cycle as complex specific functional assemblies.

Proc Natl Acad Sci U S A, 1982 Apr, 79(7), 2355 - 9
Isolation and characterization of yeast mutants deficient in adenylate cyclase and cAMP-dependent protein kinase; Matsumoto K et al.; Mutants of Saccharomyces cerevisiae that require cAMP for growth have been isolated . Some of the mutants isolated were deficient in adenylate cyclase activity and mapped at a locus, cyr1, located near the centromere of chromosome X . Growth of cells carrying the cyr1 mutation was arrested at the G1 phase of the yeast cell cycle in the absence of cAMP . The cyr1 mutation was suppressed by a secondary mutation designated bcy1 . The bcy1 mutation bypassed the need for cAMP for growth . The bcy1 mutants had extremely low levels of cAMP-binding protein and cAMP-dependent protein kinase but produced a high level of cAMP-independent protein kinase . The results indicate that cAMP is an essential factor for yeast cells to proceed through the cell cycle via the activation of protein kinase.

J Biol Chem, 1982 Mar 25, 257(6), 3203 - 10
Temperature-sensitive yeast mutants deficient in asparagine-linked glycosylation; Huffaker TC et al.; A {3H}mannose suicide selection has been used to isolate mutants in yeast which contain temperature-sensitive defects in asparagine-linked glycosylation . The surviving cells were screened at the nonpermissive temperature for a decreased ability to incorporate {3H}mannose and for defects in glycosylation of the secreted protein invertase . One of these mutants (alg1-1) has been characterized and found to be blocked in the assembly of the lipid-linked oligosaccharide precursor . The alg1-1 cells synthesize mannosyl compounds at 60% of the wild type level at the nonpermissive temperature and 105% of the wild type level at the permissive temperature . In vivo labeling experiments have demonstrated that alg1-1 cells are able to synthesize GlcNAc2-lipid but are unable to synthesize any mannose-containing oligosaccharide-lipids . This result was confirmed by in vitro labeling of yeast membranes . When incubated with UDP-{3H}GlcNAc, alg1-1 membranes synthesized GlcNAc2-lipid but failed to elongate it when GDP-Man was added . The alg1-1 membranes also failed to elongate exogenous GlcNAc2-lipid but were able to convert Man1GlcNAc2-lipid to Man5-Glc-NAc2-lipid in the presence of GDP-Man . These results indicate that the alg1-1 mutant is blocked specifically in the addition of the first mannose residue to the lipid-linked oligosaccharide precursor.

J Biol Chem, 1982 Mar 25, 257(6), 2822 - 8
AMP deaminase reaction as a control system of glycolysis in yeast . Activation of phosphofructokinase and pyruvate kinase by the AMP deaminase-ammonia system; Yoshino M et al.; The role of AMP deaminase (EC 3.5.4.6) reaction in the stimulation of the regulatory enzymes of glycolysis was investigated using permeabilized yeast cells . 1) The addition of polyamine activated AMP deaminase in situ, resulting in the subsequent increase in ammonium production, which can stimulate the activity of 6-phosphofructokinase (EC 2.7.1.11) and pyruvate kinase (EC 2.7.1.40) . 2) Zn2+ inhibited AMP deaminase activity, followed by a decrease in ammonium ion concentration which reduced the activity of phosphofructokinase . 3) Polyamine and Zn2+ did not activate or inhibit directly the activity of phosphofructokinase and pyruvate kinase . 4) A simple Michaelis-Menten relationship was observed between the various levels of ammonium ion and of fructose 1,6-biphosphate formed in situ, indicating that phosphofructokinase activity or glycolytic flux was dependent upon the level of ammonium produced through the action of AMP deaminase . 5) The increase in Pi concentration resulted in the decreased magnitude of activation by NH4+ and marked stimulation by Pi itself of phosphofructokinase, and further reduced the production of NH4+ through the inhibition of AMP deaminase, suggesting that phosphofructokinase activity may not be regulated by the level of NH4+ but by Pi concentration under conditions of increased Pi levels . The AMP deaminase-ammonium system shows a regulatory function in glycolysis of yeast cells in the presence of physiological Pi levels, whereas glycolysis may be principally controlled by Pi level under the conditions of elevated Pi concentration . Polyamines may play a part in the stimulation of glycolysis through the elevated level of ammonium ion under the conditions of increased ATP utilization during cell proliferation, and can participate in the catabolic processes as well as anabolic processes through the stimulation of the AMP deaminase-ammonium system.

Mol Cell Biochem, 1982 Mar 19, 43(2), 89 - 95
Calculation of half-lives of proteins in vivo . Heterogeneity in the rate of degradation of yeast proteins; Gancedo JM et al.; A method is given for the calculation of half-lives of proteins in vivo from the measurement of the decrease of radioactivity in pulse-labelled proteins with time . This method could be particularly useful for the study of the degradation of proteins in cells that have a low growth rate . The method applied to growing yeast indicates that there are two major classes of protein . The class with low turnover constitutes the bulk of yeast protein and has a half-life of 160 h in a medium with glucose or galactose and of 50 h in a medium with ethanol . The class of proteins with high turnover (half-life between 0.8 and 2.4 hours) represents from 1% of total protein in yeast growing on glucose to 7% in yeast growing on ethanol . It is shown that some proteins which are depressed during growth on ethanol or induced during growth on galactose are particularly susceptible to degradation in a medium which contains glucose . It is proposed that protein degradation is regulated by a coarse control at the level of protease activity and a fine control on the susceptibility of individual proteins to proteases.

Biochemistry, 1982 Mar 16, 21(6), 1295 - 302
Substrate synergism and the kinetic mechanism of yeast hexokinase; Viola RE et al.; Michaelis constants for MgATP with yeast hexokinase vary from 28 microM with D-mannose to above 4 mM for the slow ATPase reaction, with the different values reflecting the degree of synergism in binding of MgATP and the sugar substrate . The best substrates show the greatest synergism, but the correlation is not exact . Similar synergistic binding between MgADP or its methylene analogue and phosphorylated sugars is seen . Product inhibiton of MgADP vs . MgATP and vice versa appears noncompetitive at low levels of variable substrate but becomes competitive at high levels . These patterns show that MgATP can combine with E-glucose-6-P (Ki = 4 mM) and MgADP with E-glucose (Ki = 1.6 mM) . Isotope partitioning studies with glucose or glucose-6-P have determined the rates of release of these substrates from binary and ternary complexes and, together with reverse isotope exchange studies and the product inhibition studies mentioned above, have shown that the kinetic mechanism is a somewhat random one in which dissociation of sugars from productive ternary complexes is very slow, but release from nonproductive ternary complexes occurs at rates similar to those from binary enzyme-sugar complexes . D-Arabinose-5-P has a Km of 4.6 mM and a Vmax 5% that for glucose-6-P, confirming that the high Km for D-arabinose in the forward direction is caused by the low proportion in the furanose form . The dissociation constant of MgADP in the absence of sugars was determined from the Ki of 5.8 mM for MgADP as a competitive inhibitor vs . MgATP of the slow ATPase reaction.

Nucleic Acids Res, 1982 Mar 11, 10(5), 1661 - 78
Separation and sequence of the 3' termini of M double-stranded RNA from killer yeast; Thiele DJ et al.; Four subspecies of M double-stranded RNA from a killer strain of Saccharomyces cerevisiae were isolated . Each subspecies were susceptible to heat cleavage, presumably at an internal 190 base pair A,U-rich region, generating two discrete fragments corresponding to each side of the A, U-rich region . Enzymatic and chemical RNA sequence analysis defined the 3'-terminal 175 bases for the larger fragment (M-1) and 231 bases for the smaller fragment (M-2) . All four subspecies of M have identical size and 3'-terminal sequences . Potential translation initiation codons are present on the corresponding 5' termini of both fragments, and a possible 18S ribosomal RNA binding site is also present on the 5' terminus of M-1 . Stem and loop structures for the 5' and 3' termini of M-1 may function as recognition sites for replication, transcription, and translation.

Nucleic Acids Res, 1982 Mar 11, 10(5), 1625 - 33
Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast; Sor F et al.; The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene . In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences . The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3') . We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast . When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA . Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae . The 5' and 3' terminal structures of all these sequences are highly constant.

Biochemistry, 1982 Mar 2, 21(5), 855 - 61
Enzymatic replacement of the anticodon of yeast phenylalanine transfer ribonucleic acid; Bruce AG et al.; An efficient procedure for the replacement of the anticodon and the adjacent hypermodified nucleotide (residues 34-37) of yeast tRNAPhe with any desired oligoribonucleotide sequence has been developed . The four residues are removed by chemical cleavage at Y-37 and partial ribonuclease A digestion at U-33 . An oligonucleotide is inserted in three steps by using T4 RNA ligase and T4 polynucleotide kinase . When different oligonucleotides are inserted, both the size of the loop and the sequence of nucleotides in the anticodon region of this tRNA can be varied . The ability of the different anticodon loop substituted tRNAs to be aminoacylated by yeast phenylalanyl-tRNA synthetase is dependent upon the sequence of the oligonucleotide inserted . This suggests that there is an important interaction between the anticodon region of yeast tRNAPhe and its synthetase.

Mikrobiologiia, 1982 Mar-Apr, 51(2), 220 - 3
{Action of ozone on the membrane-dependent functions of Candida utilis yeast cells}; Konev SV et al.; The action of ozone on the structural-functional state of plasmic membranes was studied with Candida utilis cells . The damage of the membranes resulting in disorders of permeability barriers for nucleotides was not identical to damages which made the cells stained with methylene blue . The curve for the damage of membrane integrity (staining with methylene blue) coincided with the curve for the survival of C . utilis cells; therefore, the bacterial action of ozone consists mainly in damaging the surface cell structures.

Biochem J, 1982 Mar 1, 201(3), 473 - 9
The molecular composition of the volutin granule of yeast; Jacobson L et al.; The volutin granule was isolated from yeast by disruption of freeze-dried cells in an organic solvent and density-gradient-gradient centrifugation . The granule is composed of two types of macromolecule, a linear-chain polyphosphate and four basic proteins, of molecular weights ranging from 10 000 to 20 000 . In the dissolved granule these macromolecules are in a complex that is uniform by hydrodynamic criteria (s20,w = 22.3 S) . The polyphosphate separated from this complex gives a single 31P n.m.r . resonance and in the analytical ultracentrifuge behaves as a monodisperse solute of molecular weight 245 000 +/- 1000 . In the 31P n.m.r . spectrum of yeast used for its isolation, this polyphosphate accounts for 14% of total cell polyphosphate.

Scand J Immunol, 1982 Mar, 15(3), 297 - 304
The cytotoxic effect of mouse macrophages stimulated in vitro by a beta-1,3-D-glucan from yeast cell walls; Bogwald J et al.; Macrophages stimulated by an insoluble beta-1,3-D-glucan from yeast cell walls were able to destroy tumour cells as measured by the release of radioactive label from prelabelled 14C-thymidine cells . Target cells were B-16 melanoma, P-815 mastocytoma, and the L-929 cell line . A significant target cell killing by macrophages stimulated by glucan was observed after 72-96 h . The cytolysis of L-929 cells was investigated in some detail . No stable soluble cytolytic factor appeared to be released into the medium during the stimulation of macrophages by glucan, since cell-free spent medium had no cytotoxic effect on L-929 cells . The densities of the macrophage monolayers were critical for an effective target cell killing; dense cultures showed more cytotoxicity than less dense cultures . The kinetics of the development of macrophage-mediated cytotoxicity suggests a minimum stimulation period of 4 days for maximal cytolysis.

Cell, 1982 Mar, 28(3), 551 - 61
Directionality of yeast mating-type interconversion; Klar AJ et al.; The mating-type a and alpha alleles of the yeast Saccharomyces cerevisiae interconvert by a transposition-substitution reaction where replicas of the silent mating loci, at HML and HMR, are transmitted to the expressed mating-type locus (MAT) . HML is on the left arm and HMR on the right arm, while MAT is in the middle of chromosome III . Cells with the genotype HML alpha HMRa switch mating type efficiently at a frequency of about 86% . Since well over 50% of the cells switch, it is thought that switches do not occur randomly, but are directed to occur to the opposite mating-type allele . In contrast, we report that strains possessing the reverse HMLa HMR alpha arrangement switch (phenotype) inefficiently at a maximum of about 6% . The basis for this apparent reduced frequency of switching is that these strains preferentially yield futile homologous MAT locus switches--that is, MATa to MATa and MAT alpha to MAT alpha--and consequently, most of these events are undetected . We used genetically marked HM loci to demonstrate that alpha cells preferentially choose HMR as donor and a cells preferentially choose HML as donor, irrespective of the genetic content of the silent loci . Because of this feature, HML alpha HMRa strains generate predominantly heterologous while HMLa HMR alpha strains produce predominantly homologous MAT switches . The control for directionality of switching therefore is not at the level of transposing heterologous mating-type information, but only at the level of choosing HML versus HMR as the donor . In strains where the preferred donor locus is deleted, the inefficient donor becomes capable of donating efficiently . Thus the preference seems to be mediated by competition between the HM loci for donating information to MAT.

Proc Natl Acad Sci U S A, 1982 Mar, 79(5), 1484 - 7
The two yeast histone H2A genes encode similar protein subtypes; Choe J et al.; The sequences of the two histones H2A genes in the yeast Saccharomyces cerevisiae have been determined . These genes encode two histone H2A subtypes which are 131 amino acids in length but differ at 2 amino acid positions: an Ala leads to Thr and a Thr leads to Ala change at positions 124 and 125 . Thus, the two histone H2A subtypes have identical amino acid compositions . The coding regions of the two H2A genes are homologous at 369 of 393 bases (94%), with all but 2 of the 24 changes being silent . There is only 30% homology in the 5' flanking sequences of the two H2A genes . Like other eukaryotic histone genes, the yeast H2A genes are not interrupted by intervening sequences . When the yeast H2A histones are compared to those from other eukaryotes, there is at least 80% homology in amino acid sequence.

Mutat Res, 1982 Mar, 93(1), 83 - 100
The oxygen effect in haploid and diploid yeast strains of different sensitivities; Mock G et al.; The extent of the oxygen effect for cell survival was studied in diploid and haploid wild-type yeast and in mutants belonging to the rad2, rad6 and rad50 epistatic group . In haploids, reduced oxygen enhancement ratios were found in rad52, rad6 and rad18 . The latter two also showed some influence of the mating type . In diploids the oxygen effect was decreased in rad2, rad52 and rad18.

Chem Biol Interact, 1982 Mar 1, 39(1), 1 - 15
Toxicity, interstrand cross-links and DNA fragmentation induced by 'activated' cyclophosphamide in yeast: comparative studies on 4-hydroperoxy-cyclophosphamide, its monofunctional analogon, acrolein, phosphoramide mustard, and nor-nitrogen mustard; Fleer R et al.; Activated cyclophosphamide (CP) is known to achieve its cytotoxic and alkylating capacity upon spontaneous hydrolytic breakdown of the oxazaphosphorine ring structure . Treatment of yeast cells with the chemically activated form of CP (4-hydroperoxy-CP, 4-OOH-CP) and with several potentially toxic cleavage products revealed that cytotoxicity is closely linked to the formation of DNA interstrand cross-links and to DNA fragmentation . While this holds true for 4-OOH-CP and its bifunctional alkylating breakdown products, phosphoramide mustard (PM) and nor-nitrogen mustard (NNM), equimolar concentrations of acrolein and the monofunctional analogon of activated CP were inactive . NNM, the ultimate cleavage product within the successive degradation of the oxazaphosphorine structure was five times more toxic than 4-OOH-CP, whereas the cytotoxic action of PM was only slightly enhanced . The high cytotoxicity of NNM was matched by its ability to induce DNA interstrand cross-links: at concentrations and treatment times producing equal cell killing, 4-OOH-CP and NNM produced the same extent of cross-linking and DNA fragmentation . Biochemical potency of NNM is in contrast to data found with the NBP colorimetric assay which suggest that NNM loses its alkylating activity at neutral pH . 4-OOH-CP and PM are much more stable than predicted from half-life measurements performed via the NBP colorimetric assay: they retain a considerable fraction of their cytotoxic and cross-linking activity in spite of a 12-h preincubation at pH 7 and 36 degrees C.

Genetics, 1982 Mar, 100(3), 387 - 412
A new mapping method employing a meiotic rec-mutant of yeast; Klapholz S et al.; A rapid new mapping method has been developed for localizing a dominant or recessive mutation to a particular chromosome of yeast . The procedure utilizes the ability of strains homozygous for the spo11-1 mutation to undergo chromosome segregation without appreciable recombination during sporulation . The level of sporulation in spo11-1/spo11-1 diploids is reduced and asci are often immature or abnormal in appearance; spore viability is less than 1% . The first step of the mapping procedure is the construction of a haploid spo11-1 strain carrying a recessive drug-resistance marker and the unmapped mutation(s) . This strain is crossed to a set of three spo11-1 mapping tester strains containing, among them, a recessive marker on each chromosome . The resulting spo11-1/spo11-1 diploids are sporulated and plated on drug-containing medium . Viable meiotic products that express the drug-resistance marker due to chromosome haploidization are selectively recovered . These meiotic products are haploid for most, but generally not all, chromosomes . The level of disomy for individual chromosomes averages 19% . Each of the recessive chromosomal markers is expressed in approximately a third of the drug-resistant segregants . Ninety-eight percent of these segregants show no evidence of intergenic recombination . Thus, two markers located on the same chromosome, but on different homologs, are virtually never expressed in the same drug-resistant clone . The utility of this mapping procedure is demonstrated by confirming the chromosomal location of seven known markers, as well as by the assignment of a previously unmapped mutation, spo12-1, to chromosome VIII . In addition, the analysis of the products of spo11-1 meiosis indicates that several markers previously assigned to either chromosome XIV or chromosome XVII are actually on the same chromosome.

Cell, 1982 Mar, 28(3), 563 - 73
DNA sequence required for efficient transcription termination in yeast; Zaret KS et al.; The cyc1-512 mutation is a 38 base pair deletion in the 3' nontranslated region of the CYC1 locus in the yeast Saccharomyces cerevisiae . The deletion occurred between two 7 bp directly repeated sequences . The cyc1-512 mutant produces approximately 10% of the normal amount of the CYC1 gene product, iso-1-cytochrome c, and produces 5%--10% of the normal steady-state amount of CYC1 mRNA . Most of the mRNAs in cyc1-512 are longer at their 3' ends by up to 1000 nucleotides, suggesting that the 38 bp deletion in cyc1-512 prevents proper transcription termination . The improper transcription termination is shown to cause converging transcription between CYC1 and an adjacent gene . The fact that all of the aberrantly sized mRNAs in cyc1-512 are polyadenylated leads us to suggest that polyadenylation may be coupled to transcription termination in yeast . We have uncovered a consensus sequence between the region deleted in cyc1-512 and the 3' nontranslated regions of some but not all yeast genes, and discuss the possible role of this sequence in transcription termination.

Proc Natl Acad Sci U S A, 1982 Mar, 79(5), 1583 - 7
Suppressor of yeast mitochondrial ochre mutations that maps in or near the 15S ribosomal RNA gene of mtDNA; Fox TD et al.; A polypeptide chain-terminating mutation in the yeast mitochondrial oxi 1 gene has been shown to be an ochre (TAA) mutation by DNA sequence analysis . Mitochondrially inherited revertants of this mutation include two types: In the first, the ochre codon has been changed to a sense codon by further mutation in the oxi 1 gene while, in the second, the ochre codon is still present, indicating the occurrence of an extrageneic ochre suppressor mutation . This mitochondrial ochre suppressor, termed MSU1, has been "cloned" in rho- strains of yeast and tested against other oxi 1 mutations . Several additional mutations are also suppressible, and those examined so far are also ochre mutations . MSU1 does not suppress known frameshift or missense mutations at oxi 1 . Isoelectric focusing of the gene product (cytochrome oxidase subunit II) from a suppressed-mutant strain indicates that suppression does not involve insertion of charged amino acids . Physical mapping of the mtDNA retained in the MSU1-carrying rho- clones localizes the suppressor mutation to the gene coding the 15S rRNA or a site not more than 300 base pairs from it . No known tRNA genes occur this close to the 15S rRNA gene, and mtDNA from a suppressor-carrying rho- does not hybridize detectably to mitochondrial tRNAs . These results suggest that MSU1 may be an alteration in the 15S rRNA.

J Biol Chem, 1982 Feb 25, 257(4), 1902 - 5
Interaction between yeast beta-(1 goes to 3)glucan synthetase and activating phosphorylated compounds . A kinetic study; Notario V et al.; Yeast beta-(1 goes to 3)glucan synthetase is stimulated by ATP or GTP . The structural requirements for the activation were investigated by testing several phosphorylated compounds . The simplest substance with stimulatory ability was inorganic pyrophosphate . Addition of a nucleoside, as in GDP, decreased the concentration required for half-maximal stimulation; a third phosphate group, as in GTP, further enhanced the stimulatory capacity . On the other hand, esterification of the terminal phosphate of GTP with a nucleoside or a methyl group led to a total loss of activating ability: dinucleoside triphosphates and the gamma-phosphate methyl ester of GTP acted as competitive antagonists of the activators . alpha,beta- and beta,gamma-imino and -methylene derivatives of both ATP and GTP stimulated the enzymatic activity, suggesting that activation can occur without covalent transfer either of the terminal phosphate or pyrophosphate, or of the nucleotidyl residue . The stimulatory effect of the beta,gamma-imino derivatives of ATP and GTP was not additive . The inhibition constants obtained with gamma-phosphate esters of GTP were the same for either one of the two imino analogs . It is concluded that adenosine and guanosine derivatives bind to the same domain of the enzyme . It is also postulated that activators may interact with the enzyme or with a regulatory protein at two locations, a binding site for the nucleoside moiety and a "functional" site for the pyrophosphate residue.

Mycopathologia, 1982 Feb 19, 77(2), 69 - 73
Cysteine-independent and cysteine-requiring yeast-strains of Histoplasma capsulatum; Jacobson ES et al.; Recently we described a strain of Histoplasma capsulatum, designated H-35, which is able to grow as yeast on a minimal medium consisting of inorganic salts, glucose and a trace of biotin . Using this strain as a prototrophic wild type we sought auxotrophic mutants . Mutagenized yeast-cells were starved for inorganic sulfate in sulfur-free minimal medium . Sulfate was then added, and growing prototrophic cells were killed by addition of amphotericin B . After 24 hours non-growing auxotrophs were 'rescued' by removal of amphotericin and addition of yeast extract . This 'mutant enrichment' cycle was repeated two additional times, after which the cells were plated on blood agar and 800 yeast-colonies were picked . Seventeen of these yeast-strains required cysteine for growth, as compared with strain H-35, which grew as yeast on minimal medium.

Nucleic Acids Res, 1982 Feb 11, 10(3), 1093 - 6
Isolation and structure of a yeast initiator tRNAmet gene; Venegas A et al.; Sixteen bacterial clones containing yeast initiator tRNAmet genes have been isolated . The size of the BamHI fragments encoding these genes ranges from 4,000 to 23,000 base pairs . The nucleotide sequence of one member of this group has been determined . It has no intervening sequences.

J Biol Chem, 1982 Feb 10, 257(3), 1149 - 55
Studies of the kinetic mechanism of hypoxanthine-guanine phosphoribosyltransferase from yeast; Ali LZ et al.; An assay procedure, utilizing high pressure liquid chromatography, has been designed which allows both reactions catalyzed by hypoxanthine-guanine phosphoribosyltransferase to be monitored simultaneously . Using this procedure and the theories described by Huang (Huang, C . V . (1979) Methods . Enzymol . 63, 486-500) for alternate substrate kinetic analysis, we have determined that purified hypoxanthine-guanine phosphoribosyltransferase from yeast catalyzes the formations of both IMP and GMP through the use of an Ordered Bi Bi kinetic mechanism, and that guanine is highly preferred over hypoxanthine as substrate in the forward reaction . This proposed kinetic mechanism has been confirmed using flow dialysis experiments in which a binary enzyme-5-phosphoribosyl-alpha-1-pyrophosphate complex was characterized but where enzymic complexes, with either guanine or hypoxanthine, were not detected . Also consistent with this kinetic mechanism was our observation that an exchange of label between {14C}guanine or {14C}hypoxanthine and their respective nucleotides (GMP and IMP) was not catalyzed by hypoxanthine-guanine phosphoribosyltransferase . However, a significant exchange of label between {32P}pyrophosphate and 5-phosphoribosyl-alpha-1-pyrophosphate is observed upon incubation with this enzyme, suggesting that hypoxanthine-guanine phosphoribosyltransferase may exist, in part, as a phosphoribosyl-enzyme complex in the presence of 5-phosphoribosyl-alpha-1-pyrophosphate.

Genetics, 1982 Feb, 100(2), 159 - 74
{HOK}, a new yeast non-Mendelian trait, enables a replication-defective killer plasmid to be maintained; Wickner RB et al.; The K1 killer plasmid, {KIL-k1}, of Saccharomyces cerevisiae is a 1.25 x 10(6) dalton linear double-stranded RNA plasmid coding for a protein toxin and immunity to that toxin . The {KIL-sd1} plasmid is a replication-defective mutant of {KIL-k1} that depends on one of the recessive chromosomal superkiller (ski-) mutations for its maintenance (Toh-e and Wickner 1979) . This report concerns a means by which {KIL-sd1} can be stably maintained in a SKI+ host . Strains carrying a plasmid we call {HOK} (helper of killer) stably maintain {KIL-sd1} . {HOK} segregates 4 {HOK}:0 in meiotic crosses and is efficiently transferred by cytoplasmic mixing (heterokaryon formation) . {HOK} depends for its maintenance on the products of PET18, MAK3, and MAK10, three chromosomal genes needed to maintain {KIL-k1}, but is independent of 10 other MAK genes and of MKT1 . {HOK} is not mitochondrial DNA and is unaffected by agents which convert psi+ strains to psi- . {HOK} is also distinct from the previously described plasmids {URE3}, 20S RNA, 2 mu DNA, and {EXL} . Strains lacking {HOK} consistently have a four-fold lower copy number of L double-stranded RNA than strains carrying {HOK}.

Can J Biochem, 1982 Feb, 60(2), 100 - 7
pH dependence of free and immobilized yeast alcohol dehydrogenase kinetics; Mazid MA et al.; A study was made of the influence of pH on the reaction between NAD and ethanol, catalyzed by yeast alcohol dehydrogenase, both in free solution and attached to the inner surface of a nylon tube . A new least-squares analysis of the results has been devised; it is simpler to apply and is more realistic than those previously employed . Analysis of the results for the free enzyme indicated that the free enzyme has two active ionizing groups having pK values of about 6.6 and 8.8 . These pK values undergo only small changes when the enzyme is bound to NAD and when it is bound to both NAD and ethanol . With the immobilized enzyme and saturating concentrations of ethanol the rates went through a maximum as the pH was varied from 6.5 to 10.0 . With saturating concentrations of NAD there was a steady increase in rate, with no falling off at pH 10 . Immobilization generally brought about an increase in the pK values . These increases are attributed partly to a residual negative surface charge which attracts the leaving H+ ions . They are also attributed partly to the formation in the reaction of H+ ions, which cause the local pH to be lower than that in the bulk solution . This effect is more important with saturating NAD ions, since the buffer anions will then be less mobile and less able to mediate the movement of protons.

Biochimie, 1982 Feb, 64(2), 113 - 26
The hierarchical approach to the DNA stability problem . II . Some applications and speculations with yeast mitochondrial DNA as an example; Michel F et al.; As discussed in the preceding article {1} hierarchical analysis of DNA sequences should make it possible to treat complex unfolding (and refolding) processes involving both equilibrium and non-equilibrium subtransitions . Hence a variety of actual experimental situations may be analyzed . This is demonstrated with the help of a 1950 bp yeast mitochondrial DNA sequence encompassing part of the 21S ribosomal RNA gene: excellent fit of complex denaturation and renaturation profiles is achieved with only two adjustable parameters . The advantage of dealing with objectively defined stability units is also apparent when stability profiles are compared to known functional maps: striking correlations may be brought out and their possible significance is briefly discussed.

Proc Natl Acad Sci U S A, 1982 Feb, 79(3), 786 - 9
Localization of genes for the double-stranded RNA killer virus of yeast; Welsh JD et al.; The M double-stranded RNA (ds RNA) genome segment of the cytoplasmically inherited killer virus of yeast codes for two polypeptides when denatured and translated in vitro: a previously known 32,000-dalton peptide and a newly discovered 19,000-dalton peptide (NaDodSO4/polyacrylamide gel electrophoresis) . An internal 190-base-pair region of the ds RNA is selectively degraded by S1 nuclease treatment at 65 degrees C, resulting in two ds RNA fragments which contain the termini of the original ds RNA . The larger fragment codes for the 32,000-dalton polypeptide and the smaller fragment codes for the 19,000-dalton polypeptide . Thus, the two gene products of M are encoded by distinct regions of this ds RNA.

Jpn J Exp Med, 1982 Feb, 52(1), 1 - 7
Direct activation of human adherent cells by yeast cell wall in vitro; Mashiba H et al.; Adherent cells from human peripheral blood could be activated by cocultivation with yeast cell wall for 3 days and the acid phosphatase activity of these cells was elevated . Lymphocyte response to phytohemagglutinin (PHA) was reduced in the presence of yeast cell wall ranging from 0.1 microgram/ml to 1000 micrograms/ml . When the activated adherent cells were added to non-adherent cells or the cells from lymphoid cell line (HD-10), derived from Hodgkin's disease, DNA synthesis of these target cells was suppressed . The supernatants from the activated adherent cells were also inhibitory to the proliferation of the cell line . It is suggested that this in vitro system is useful in investigating the mechanisms of macrophage activation and the roles of macrophages in immune responses.

Biokhimiia, 1982 Feb, 47(2), 323 - 8
{Methylpyrophosphate, the simplext organic substrate of yeast inorganic phyrophosphatase}; Mel'nik MS et al.; The interaction between yeast inorganic pyrophosphatase and the simplest organic substrate, methylpyrophosphate, was studied . Methylpyrophosphate hydrolysis occurred most intensively in the presence of Zn2+ less intensively in the presence of CO2+ and Mn2+ and did not occur at all in the presence of Mg2+ . The complex convertible into reaction products contains two Zn2+ and one molecule of zinc methylpyrophosphate per one active center . The activator metal ions are linked with pyrophosphatase consecutively; each of the two enzyme forms produced can bind to the substrate . The values of the maximal velocity and the constants of the substrate binding to the pyrophosphatase were calculated.

Nucleic Acids Res, 1982 Jan 22, 10(2), 513 - 24
Evidence for ribosomes involved in splicing of yeast mitochondrial transcripts; Schmelzer C et al.; We have investigated the processing of transcripts of the split gene COB in yeast mitochondrial DNA from cells whose mitochondrial translation was blocked by chloramphenicol for several generations of cell growth . First analysis of transcripts by electrophoresis and RNA/DNA-hybridization clearly showed that cell growth in the presence of CAP leads to an inhibition of processing yielding an increasing amount of splicing intermediates of the COB transcript and decreasing amounts of the 18S mRNA coding for apocytochrome b . This observation is in accordance with the now widely favoured idea that mitochondrial proteins are involved in splicing of COB transcripts and that their reduction should hamper processing and - therefore - lead to an accumulation of pre-mRNAs . However, further information obtained by pulse-labeling of pre-mRNA in vivo in the presence of CAP for various times shows that even 30 minutes after addition of CAP a reduction of the processing rate is obtained . Based on these findings we conclude that maturation of mtRNAs is not only dependent on mitochondrial proteins, but also on a more direct interaction of the translation machinery and RNA processing whose nature is so far unknown.

Biochemistry, 1982 Jan 19, 21(2), 309 - 16
Regulation of the nuclear-coded peptides of yeast cytochrome c oxidase; Lustig A et al.; We have analyzed the catabolite regulation of cytochrome oxidase by assaying changes in the synthesis of precursors of the nuclear-coded peptides (IV--VII) of cytochrome c oxidase in an in vitro reticulocyte cell-free system programmed with RNA isolated from cells grown in either glucose or raffinose . As a first step, we have characterized antibodies which bind to the precursors of subunits V and VI . Initial translation products for subunits IV and VII have also been tentatively identified by utilizing these antibodies . The messenger RNAs coding for the precursors of the nuclear-coded subunits fall in the expected size range of 8--15 S . Catabolite repression of the nuclear-coded oxidase peptides appears to be regulated by the abundance of their messenger RNAs . Translation of messenger RNA isolated from yeast cells grown on glucose indicates a coordinate and uniform increase in precursor synthesis during glucose derepression . In contrast, when RNA isolated from raffinose (derepressed) grown cells is used to direct cell-free translation, precursor abundance is high throughout growth, although the synthesis of some of the species changes in a complex pattern of ratio and abundance . These data indicate that the abundance of the messengers for the nuclear-coded precursors is regulated in a fashion dependent on the physiologic state of the cell.

J Biol Chem, 1982 Jan 10, 257(1), 39 - 41
Overproduction and control of the LEU2 gene product, beta-isopropylmalate dehydrogenase, in transformed yeast strains; Hsu YP et al.; Two transformed yeast strains, 21D/pYT14-LEU2 and AH22/CV9-2, were found to produce beta-isopropylmalate dehydrogenase to such an extent that the enzyme constitutes 2 and 1%, respectively, of the total extractable protein . This is 30 and 15 times, respectively, above wild type level . beta-Isopropylmalate dehydrogenase was purified from strain 21D/pYT14-LEU2 to a purity of about 95% in essentially three steps . Strain 21D/pYT14-LEU2 carries the LEU2 gene on a vector that also contains the yeast 2-micrometers plasmid and therefore replicates autonomously, whereas strain AH22/CV9-2 carries multiple copies of the LEU2 gene integrated at its normal chromosomal location . Despite the different genetic arrangements, regulation of LEU2 gene expression by leucine and leucine plus threonine was normal . Immunotitration showed that the decrease in specific activity caused by leucine and threonine corresponded to a decrease in immunoreactive material.

J Am Coll Nutr, 1982, 1(3), 263 - 74
Effect of high-chromium brewer's yeast on human serum lipids; Elwood JC et al.; A group of 11 normolipidemic and a group of 16 hyperlipidemic adult subjects were given orally 20 gm daily of a high-chromium brewer's yeast (2.4 micrograms Cr+++/gm, ie, 48 micrograms Cr+++ daily) for 8 weeks . A significant decrease in total cholesterol in both groups of subjects was observed (24-26 mg/dl) . High density lipoprotein cholesterol (HDL-C) was significantly increased (5-6 mg/dl) in normo- and hyperlipidemic subjects by brewer's yeast supplementation . However, following supplementation, the triglyceride blood levels were not changed in either the normo- or hyperlipidemic group . When the multiple complex risk factor (total cholesterol/HDL-C) was calculated, 84% of all subjects receiving brewer's yeast showed a decrease in this ratio, and the mean decrease in this ratio in all subjects was significant at P less than 0.01 . A second group of 19 normolipidemic, predominantly male, adult subjects was given orally 10 gm of a high-chromium brewer's yeast (2.4 micrograms/gm, ie, 24 micrograms Cr+++ daily) for 8 weeks . The total circulating serum cholesterol was significantly decreased by a modest amount in this group after supplementation . The HDL-C levels were significantly increased (4 mg/dl) . The total cholesterol/HDL ratio was decreased in 79% of the subjects, and the mean TC/HDL-C decrease of the entire group was significant at P less than 0.01.

J Immunopharmacol, 1982-83, 4(4), 265 - 78
Inhibition of yeast phagocytosis by dexamethasone in macrophage cultures: reversibility of the effect and enhanced suppression in cultures of stimulated macrophages; Grasso RJ et al.; This investigation was initiated to characterize further the ability of 1 microM dexamethasone to suppress the ingestion of heat-killed Saccharomyces cerevisiae particles in cultures of murine resident peritoneal macrophages . Time course studies revealed that the inhibitory response required the continual presence of the steroid in the culture medium . In addition, increased inhibitory responses occurred after dexamethasone was supplied to previously untreated cultures of resident macrophages that became stimulated by differentiating in vitro . These findings indicate that glucocorticoids act directly on macrophages to decrease their phagocytic capacity, which in vivo would reduce host resistance.

Prog Clin Biol Res, 1982, 102 Pt C, 65 - 74
Structure and function of yeast acid phosphatase; Mildner P et al.; A pronounced heterogeneity of purified acid phosphatase has been observed . The size heterogeneity which was demonstrated by electrophoretic methods is in agreement with the finding that the enzyme preparation contains families of molecules differing in the carbohydrate content (38% - 70%) . The charge heterogeneity was shown by isoelectric focusing indicating the existence of several slightly different protein chains in the enzyme preparation . It was found that the enzyme is a dimer with a mean molecular weight of 252000 Daltons . There are 16 N-glycosidically linked carbohydrate chains, differing in size from 15-150 mannose units, and a very small amount of O-glycosidically linked mannose . Properties of acid phosphatase deglycosilated by treatment with beta-endo-N-acetylglucosaminidase, were compared with the native enzyme and it was found that the carbohydrate chains do not play a direct role in the catalytic activity of the enzyme, but stabilize the tridimensional structure of the molecule . A drastic increase of sensitivity of the deglycosilated enzyme against proteolysis was found.

Z Allg Mikrobiol, 1982, 22(7), 503 - 5
The temperature profile of growth, death and yield of the starch-converting yeast Lipomyces kononenkoae; Spencer-Martins I et al.; A strain of Lipomyces kononenkoae earlier proposed for industrial starch bioconversion was found to have a dissociative temperature profile . The Arrhenius plot of sustained exponential growth displayed a single branch between the optimum (32-33 degrees C) and the maximum (about 35 degrees C) temperature for growth while the extrapolated Arrhenius plots of growth and thermal death intersected at a biologically non-significant value . The yield of L . kononenkoae on glucose did not decrease at supraoptimal temperatures while the associative yeast Saccharomyces cerevisiae suffered yield decreases above the optimum temperature for growth with increasing temperature.

Z Allg Mikrobiol, 1982, 22(7), 477 - 86
{Polysaccharide structure of cell wall preparations from the food protein yeast Candida spec . H}; Nuske J et al.; More than 27% of the cell wall are unstably bound components: Proteophosphomannan as a main polysaccharide of the cell wall, mannose and manno-oligosides which are bound to peptides or phosphate . 19% are glycosidically linked with a phosphate bridge or O-glycosidically (Ser/Thr) linked with the protein which is covalently bound to the cell wall . Besides mannose and glucose, manno-oligosides and gluco-oligosides are involved in this linkage . A preparation consisting of glucan and chitin remains after careful degradation . It contains (1,2)-, (1,3)- and (1,6)- linked glucose, (1, 2, 3)-, (1, 2, 6)- or (1, 3, 6)-glucose-branchpoints and (1,4)-linked N-acetylglucosamine.

Folia Microbiol (Praha), 1982, 27(4), 242 - 4
Long-term preservation of yeast cultures in liquid nitrogen; Hubalek Z et al.; Nineteen strains of taxonomically diverse yeast species tested survived freezing and subsequent five-year storage in liquid nitrogen at - 196 degrees C, using a medium M 2 composed of malt extract, yeast extract, peptone, calf serum and dimethyl sulfoxide . Viability of the yeast cultures after long-term storage ranged from 5 to 97% (average 62%) compared with the viability of the cultures prior to freezing . The use of liquid nitrogen refrigeration for preserving yeast cultures is strongly advocated.

Z Allg Mikrobiol, 1982, 22(1), 29 - 40
{Mannan localization with concanavalin A in conjunction with electron microscopy and chemical analysis of differently prepared cell walls of the food protein yeast Candida spec . H}; Fischer W et al.; Regions of different electron densities after concanavalin A-peroxidase-reaction have been observed in cell walls of intact cells as well as in isolated cell walls: In the peripheral region of intact cell walls two mannan layers appear . Treating isolated cell wall with pronase, NaOH, ethylendiamine or citrate buffer, respectively, we find on A binding spots in the inner cell wall regions which appear electron transparent in the untreated cell walls . Apparently the mannan component of the inner cell wall regions is masked by proteins . In correspondence with chemical analysis our results cannot confirm the existence of inner cell wall regions which are free of mannan.

Z Naturforsch {C}, 1982 Jan-Feb, 37(1-2), 102 - 6
Immobilization of yeast cells by radiation-induced polymerization; Fujimura T et al.; Radiation-induced polymerization method was applied to the immobolization of yeast cells . The effects of irradiation, cooling and monomer, which are necessary for polymerization, were recovered completely bu subsequent aerobic incubation of yeast cells . The ethanol productive in immobilized yeast cells increased with the increase of aerobic incubation period . The growth of yeast cells in immobilized yeast cell was indicated . The maximum ethanol productivity in immobilized yeast cell system was around three times as much as that in free yeast cell system.

Z Allg Mikrobiol, 1982, 22(3), 175 - 83
{Use of dielectrophoresis for the preparative separation of thermotolerant yeast cells}; Krause G et al.; Dielectrophoresis as a new method for preparative separation of cells is being presented . This method responds to differences in the polarization of cells, which correlate with a number of complex physiological properties of cells . It is shown that yeast cells of different thermotolerant properties can be differentiated by dielectrophoresis . Moreover, the application of this method permitted to separate cells with a high selectivity, which produce more biomass at a temperature of 40 degrees C than the initial population . Investigations on the ability of cells to survive in an inhomogeneous a.c . field have shown that the number of dead cells at frequencies of 10(5) cps and 10(6) cps and at field strengths (on the surface of the central electrode) below 2.4 X 10(5) V/m is small . This fact should be considered when picking out suitable separation conditions.

Mol Gen Genet, 1982, 185(3), 506 - 9
Cell cycle inhibition of yeast spheroplasts; Murakami S et al.; Osmotically stabilized yeast spheroplasts are capable of extensive DNA synthesis . Although the rate of DNA synthesis in spheroplasts is approximately one-third that of intact cells, the relative amounts of nuclear and mitochondrial DNA synthesized by spheroplasts is very similar to the relative amounts synthesized by intact cells . Furthermore, nuclear but not mitochondrial DNA synthesis is inhibited in MATa spheroplasts by the application of the yeast mating pheromone, alpha-factor . Similarly, DNA synthesis is reversibly temperature-sensitive in spheroplasts created from cdc7 and cdc8 mutant cells.

Genetics, 1982 Jan, 100(1), 19 - 33
Regulatory mutations of inositol biosynthesis in yeast: isolation of inositol-excreting mutants; Greenberg ML et al.; The enzyme inositol-1-phosphate synthase (I-1-P synthase), product of the INO1 locus, catalyzes the synthesis of inositol-1-phosphate from the substrate glucose-6-phosphate . The activity of this enzyme is dramatically repressed in the presence of inositol . By selecting for mutants which overproduce and excrete inositol, we have identified mutants constitutive for inositol-1-phosphate synthase as well as a mutation in phospholipid biosynthesis . Genetic analysis of the mutants indicates that at least three loci (designated OPI1, OPI2 and OPI4) direct inositol-mediated repression of I-1-P synthase . Mutants of these loci synthesize I-1-P synthase constitutively . Three loci are unlinked to each other and to INO1, the structural gene for the enzyme . A mutant of a fourth locus, OPI3, does not synthesize I-1-P synthase constitutively, despite its inositol excretion phenotype . This mutant is preliminarily identified as having a defect in phospholipid synthesis.

Mol Gen Genet, 1982, 185(2), 367 - 8
Pentose phosphate pathway mutants of yeast; Lobo Z et al.; A glucose-negative mutant of Saccharomyces cerevisiae lacking 6-phosphogluconate dehydrogenase, the second enzyme of the pentose phosphate pathway, has been obtained by inositol starvation . Suppression of this mutant for growth on glucose takes place by the loss of glucose 6-phosphate dehydrogenase . A lesion in the latter enzyme alone leaves growth practically unaffected . The mutations define the respective structural genes.

Comp Biochem Physiol B, 1982, 71(4), 577 - 82
Comparative studies on the kinetic parameters and product analyses of chicken and rat liver and yeast fatty acid synthetase; Aprahamian SA et al.; 1 . Comparative kinetics and product analyses of chicken and rat liver and yeast fatty acid synthetase . 2 . Vmax's for the three enzymes studied decrease with increasing primer chain-length, while Km's (except for yeast) increases . 3 . Palmitate is the main product (approximately 90%) of the rat synthetase whereas palmitate (60%) and stearate (40%) are the products of chicken and yeast enzymes . Increasing the primary chain length does not alter palmitate synthesis by rat and chicken enzymes but increases stearate synthesis by the yeast synthetase . 4 . The three synthetases could not synthesize fatty acids in the absence of primer acetyl-CoA suggesting that malonyl-CoA decarboxylase is not a component.

Cell, 1982 Jan, 28(1), 145 - 54
Two differentially regulated mRNAs with different 5' ends encode secreted with intracellular forms of yeast invertase; Carlson M et al.; The SUC2 gene of yeast (Saccharomyces) encodes two forms of invertase: a secreted, glycosylated form, the synthesis of which is regulated by glucose repression, and an intracellular, nonglycosylated enzyme that is produced constitutively . The SUC2 gene has been cloned and shown to encode two RNAs (1.8 and 1.9 kb) that differ at their 5' ends . The stable level of the larger RNA is regulated by glucose; the level of the smaller RNA is not . A correspondence between the presence of the 1.9 kb RNA and the secreted invertase, and between the 1.8 kb RNA and the intracellular invertase, was observed in glucose-repressed and -derepressed wild-type cells . In addition, cells carrying a mutation at the SNF1 locus fail to derepress synthesis of the secreted invertase and also fail to produce stable 1.9 kb RNA during growth in low glucose . Glucose regulation of invertase synthesis thus is exerted, at least in part, at the RNA level . A naturally silent allele (suc2 degrees) of the SUC2 locus that does not direct the synthesis of active invertase was found to produce both the 1.8 and 1.9 kb RNAs under normal regulation by glucose . A model is proposed to account for the synthesis and regulation of the two forms of invertase: the larger, regulated mRNA contains the initiation codon for the signal sequence required for synthesis of the secreted, glycosylated form of invertase; the smaller, constitutively transcribed mRNA begins within the coding region of the signal sequence, resulting in synthesis of the intracellular enzyme.

Basic Life Sci, 1982, 19, 305 - 29
Functional mutants of yeast alcohol dehydrogenase; Wills C et al.; Selection of petite strains of yeast (that is, strains unable to respire aerobically) on media containing allyl alcohol will result in enrichment for mutants at the ADC1 locus . This locus codes for the constitutive alcohol dehydrogenase, ADH-I, which is primarily responsible for the production of ethanol in yeast . The mutant enzymes are functional, and confer resistance to allyl alcohol on the cell by shifting the NAD-NADH balance in the direction of NADH . These mutants exhibit altered Km's for cofactor, substrate, or both, and often have altered Vmax's . In this paper, the methodology for obtaining these mutants and for determining the amino acid substitutions responsible for these changes is presented . Several new mutants have been at least approximately localized, and one, DB-AA3-N15, has been shown to be due to the substitution of an arginine for a tryptophan at position 54 . This substitution would be expected, by analogy with the known tertiary structure of the horse liver alcohol dehydrogenase, to decrease the hydrophobic environment of the active site pocket . The substitution has a pronounced effect on the Km for ethanol, but far less on that for acetaldehyde . The current status of investigation of other classes of functional mutants of this enzyme, and the potential both for selection of useful variants of this molecule and for an increase understanding of its function are discussed.

Mutat Res, 1982 Jan-Feb, 100(1-4), 145 - 51
The effects of BC, 4CMB and 4HMB upon the induction of mitotic gene conversion in yeast; Parry JM; Both BC and 4CMB but not 4HMB were shown to be capable of inducing mitotic gene conversion in exponential phase cultures of the JDI strain of the yeast Saccharomyces cerevisiae . The results obtained indicate that in terms of the relative frequency of genetic events per lethal event 4CMB was more active than BC in this test system.

Mutat Res, 1982 Jan-Feb, 100(1-4), 113 - 7
A comparison of the response to 4CMB, 4HMB and BC of 5 yeast strains differing in their radiosensitivities; North TA et al.; The test compounds 4CMB, 4HMB and BC were assayed for their genotoxicity using stationary phase cultures of 5 yeast strains which differ in their mutagen sensitivity . It was found that 4HMB produced no differences in survival between the 5 strains whereas 4CMB and BC caused more lethality in the triple red strain than the other 4 strains . The results indicate that both BC and 4CMB are capable of inducing DNA damage which results in cell lethality in the repair-deficient triple mutant.

J Membr Biol, 1982, 64(3), 175 - 9
Anilinonaphthalene sulfonate fluorescence and amino acid transport in yeast; Slavik J et al.; Fluorescence of 1-anilinonaphthalene-8-sulfonate in yeast membranes appears to be caused predominantly by binding to lipids (ANS protein:ANS lipid approximately 1 : 20) as indicated by the fluorescence lifetime, degree of polarization, and excitation spectra . It was insensitive to short-circuiting the membrane potential . Fluorescence intensity increased as cells (especially after pretreatment with energy donors such as glucose) were exposed to some amono acids, in particular, aspartic and glutamic acids . The character of fluorescence shifted to that of protein-bound ANS, suggesting an exposure of new protein sites accessible to the probe . This shift could be prevented by inhibitors of energy transduction as well as of transport . The K1/2 of the shift was at 2.5 mM aspartic acid.

Mol Gen Genet, 1982, 188(2), 179 - 83
Development of the genetic map of the yeast Saccharomycopsis lipolytica; Ogrydziak D et al.; Tetrad and random spore analyses have been used to further develop the genetic map of Saccharomycopsis lipolytica . Mutations in 23 new nuclear genes have been isolated . Eight genes have been located on linkage fragment 1, 4 on fragment 2, 2 on fragment 5 and 3 on fragment 6 . Linkage fragments 3 and 4 have been shown to be linked, and this fragment now contains 12 markers . A tentative map of the linkage fragments 1 and 3 is presented (Fig . 1) . Markers exhibiting possible centromere linkage have been identified . Interference estimates suggest that there is little interference in S . lipolytica.

Peptides, 1982 Jan-Feb, 3(1), 31 - 5
Relationship of yeast-injection induced changes in brain met-enkephalin and analgesia; Chipkin RE et al.; Subplantar injection of Brewer's yeast induces a hyperalgesia that is associated with an increase in the level of striatal Met-enkephalin (ME); there was no change in the hypothalamus of periaqueductal gray . To test the relationship between striatal ME and analgesia, naloxone (10, 3, 0.5 mg/kg, SC) or thiorphan (100 micrograms, ICV) were administered . Neither drug caused a potentiation or a reduction in the hypersensitivity . These data suggest that an increase in striatal does not result in altered pain sensitivity in this model.

Folia Microbiol (Praha), 1982, 27(5), 350 - 3
Immunological changes after long-term feeding of germfree piglets with protein isolates and yeast cell walls from Candida utilis as food additives; Fencl Z et al.; Germfree piglets were fed a diet supplemented with cell walls and a protein isolate from Candida utilis for 54 days . Besides morphological signs of activation of the lymphoid tissue which occurred primarily in the intestine of piglets which had been fed yeast cell walls, even an increased serum immunoglobulin level could be detected . In sera and intestinal content of piglets fed both with cell walls and isolated protein, specific antibodies capable of agglutinating yeasts were present . Even though a limited number of experimental animals was employed it can be concluded that the yeast material added to the diet elicited an immune response.

EMBO J, 1982, 1(12), 1635 - 40
Sequence and structure of yeast phosphoglycerate kinase; Watson HC et al.; The structure of yeast phosphoglycerate kinase has been determined with data obtained from amino acid sequence, nucleotide sequence, and X-ray crystallographic studies . The substrate binding sites, as deduced from electron density maps, are compatible with known substrate specificity and the stereochemical requirements for the enzymic reaction . A carboxyl-imidazole interaction appears to be involved in controlling the transition between the open and closed forms of the enzyme.

Physiol Chem Phys, 1982, 14(4), 315 - 22
Isolation of yeast nuclei . Evidence of chromatin-associated proteolytic activity; Ruggieri S et al.; Purified yeast nuclei contain proteolytic activities which are associated with chromatin . pH optimum is in the range 8.0--8.5 . Partial purification reveals the presence of three fractions corresponding to different molecular weights . Boiled chromatin supernatants are able to inhibit proteolytic activity . The inhibition effect of various compounds is also described . The purity of the chromatin preparation seems to rule out artifacts due to contamination.

Chromosoma, 1982, 87(1), 125 - 32
The ultrastructural meiotic phenotype of the radiation sensitive mutant rad 6-1 in yeast; Kundu SC et al.; An ultrastructural analysis of three yeast rad 6-1/rad 6-1 diploids on sporulation medium for 0, 6, 10, and 24 h shows that arrest occurs at meiotic prophase . Two strains, CL 139 and PU 6, fail to complete chromosome synapsis based on the continued presence of single chromosomal cores in arrested nuclei . A clone derived from CL 139, however, showed complete pairing as evident from the presence of 17 synaptonemal complexes . All three strains underwent spindle pole body duplication but the poles failed to form a proper metaphase I spindle . A revertant Rad 6+ isolated from CL 139 showed normal chromosome behaviour and normal kinetic functions . It is concluded that the absence of meiotic recombination in some Rad 6- strains may result from asynapsis, but that in other strains (e.g., CL 139s) recombination fails in spite of complete synapsis . In all cases the lack of sporulation is adequately explained by failure of the kinetic apparatus to form a metaphase I spindle.

Acta Biochim Pol, 1982, 29(1-2), 159 - 73
Replication of the 2-micrometer DNA plasmid of yeast; Jazwinski SM; The 2-micrometer DNA plasmid of yeast provides an useful probe for the analysis of the factors involved in the initiation of chromosomal DNA replication in the cell division cycle . Cell-free extracts prepared from growing yeast cells stimulate DNA replication directed by this plasmid . The plasmid replicating activity is subject to control in the yeast cell cycle . The 2-micrometer DNA plasmid can be isolated from logarithmically-growing cells in association with yeast folded chromosomes . The interaction of the plasmid with structures in the cell corresponding to the folded chromosome appears dynamic and cell cycle-dependent . Thus, not only the induction and activity of the proteins involved in replication, but also the intracellular locus of a replicon may be important factors in the control of initiation of DNA replication.

Mol Gen Genet, 1982, 188(1), 121 - 7
Nucleic acid metabolism in yeast VI . Utilisation of exogenous dAMP; Fath WW et al.; It is shown that mutants of Saccharomyces cerevisiae able to efficiently utilise exogenous dTMP can also utilise exogenous dAMP . Under extracellular conditions permissive for dTMP uptake label stemming from offered {8-3H}dAMP is incorporated preferentially into alkali-resistant, high molecular weight material (putative DNA); only about 30% of high molecular weight cell-bound dAMP label was found to be sensitive towards mild alkali hydrolysis . This putative RNA label can be minimised to practically zero when greater than or equal to mM Ade is employed in a dAMP labelling assay . Exogenous dAMP at much greater than 10 microM was found to be cytostatic similarly to much greater than microM dTMP and similarly to inhibit effectively import of exogenous Pi . We conclude from our results that there exists a yeast cytoplasmic membrane permease able to import dAMP . A model of this hypothetical permease system is presented.

Mol Gen Genet, 1982, 188(1), 115 - 20
Nucleic acid metabolism in yeast, V . Excretion of thymidylate; Fath WW et al.; It is shown that highly efficient utilisers of exogenous dTMP of the yeast Saccharomyces cerevisiae are able to excrete the nucleotide with similar efficiency . Strains Pi-repressible in acid phosphatase/nucleotidase excrete dTMP at extracellular high Pi; strains constitutive for this enzymic activity excrete dThd . Excretion of thymidylate and dThd, unlike uptake of exogenous dTMP, seems to be unaffected by the extracellular pH, by the extracellular presence of dTMP, and to be rather independent of the extracellular presence of a metabolisable carbohydrate such as D(+)-glucose . A model of the yeast dTMP-incorporation principle (TIP) is presented suggesting that it is also responsible for export of endogenous thymidylate.

Mol Gen Genet, 1982, 186(4), 467 - 74
Effect of halogenated pyrimidine 5'-mononucleotides on dTMP-permeable yeast strains and the isolation and characterization of resistant mutants; Bisson LF et al.; Unlike wild-type Saccharomyces cerevisiae, yeast cells carrying the tup 7 mutation are able to take up exogenously-supplied dTMP . The tup 7 mutant was also found to be dramatically sensitive to growth inhibition by FdUMP and BrdUMP . The exclusive mode of action of FdUMP in such strains was shown to be inhibition of thymidylate synthetase . Spontaneously-arising derivatives resistant to FdUMP and BrdUMP were isolated from the tup7 strain . Genetically, these mutations were recessive and defined three complementation groups (fdr1, fdr2, and bdr2), unlinked to the tup7 locus and to each other . No resistance mutations were obtained which mapped at the structural gene for thymidylate synthetase . Biochemical analysis of cells carrying these mutations showed that in the case of fdr2 and bdr2, in addition to an inability to transport dTMP, acid and alkaline phosphatase levels were affected, indicating that phosphatase expression and 5'-mononucleotide permeability are coordinately controlled . In contrast, the fdr1 mutation and a previously identified suppressor of dTMP-permeability, sot1, affected only 5'-mononucleotide uptake and may define components of the permease responsible for dTMP entry.

Prep Biochem, 1982, 12(2), 175 - 95
Preparation of phosphatidyl{2-3H}inositol from yeast grown in medium containing myo{2-3H}inositol; Graff G et al.; Phosphatidyl{2-3H}inositol was prepared from Saccharomyces cerevisiae (YSC-2), grown in synthetic medium containing myo{2-3H}inositol . Over 44 microCi (or 81%) of the radiolabeled inositol was taken up by the organism, with 34 microCi incorporated into phosphatidylinositol . Upon purification by silicic acid pressure liquid chromatography (MPLC), a final yield of 24 to 26 microCi of phosphatidyl{2-3H}inositol with a specific radioactivity of 40 X 10(3) dpm/nmole was obtained . The purified phosphatidyl{2-3H}inositol was found to be a suitable for phospholipase C from human platelets.

EMBO J, 1982, 1(8), 987 - 94
Replication origins are associated with transcription initiation sequences in the mitochondrial genome of yeast; Baldacci G et al.; Mitochondrial transcripts have been investigated in a series of spontaneous petite mutants of Saccharomyces cerevisiae endowed with mitochondrial genomes formed by short repeat units containing no genes, but either: (a) one of the seven ori sequences, the canonical origins of DNA replication (ori+ mutants); or (b) partially deleted ori sequences, lacking GC-rich clusters A or C (ori- mutants); or (c) no canonical ori sequence, but only oris sequences, the surrogate origins of replication ( orio mutants) . The results indicate that some ori sequences play a role in transcription initiation, and that the presence of cluster C and, more specifically, of an AT-rich sequence next to it, are essential for transcription to take place . Hybridization experiments with separated DNA strands have identified the template strand used in transcription as the strand containing the oligopyrimidine stretch of cluster C . S1 degradation of RNA-DNA hybrids indicated that transcription initiates at a TATTACTTATATATTT sequence next to the oligopyrimidine stretch of cluster C and proceeds in the cluster C----cluster A direction . The relevance of these results for the transcription of the wild-type mitochondrial genome is discussed.

EMBO J, 1982, 1(6), 705 - 11
Surrogate origins of replication in the mitochondrial genomes of ori-zero petite mutants of yeast; Goursot R et al.; We have investigated the mitochondrial genome of eight ori-zero spontaneous petite mutants of Saccharomyces cerevisiae . The tandem repeat units of these genomes do not contain any of the seven canonical ori sequences of the wild-type genome . Instead, they contain one, or more, ori-S sequences . These 44-nucleotide long surrogate origins of replication are a subset of GC clusters characterized by a potential secondary fold with two sequences ATAG and GGAG , inserted in AT spacers, two AT base pairs just following them, a GC stem (broken in the middle, and, in most cases also near the base, by non-paired nucleotides), and a terminal loop . This structure is reminiscent of that of GC clusters A and B from canonical ori sequences and supports the view (Bernardi, 1982a ) that the GC clusters of the mitochondrial genome arose, by an expansion process, from the canonical ori sequences . Like the latter, ori-S sequences are present in both orientations, are located in intergenic regions, and can be used as excision sequences when tandemly oriented . Again as in the case of canonical ori sequences, the density of ori-S sequences on the repeat units of petite genomes are correlated with the replication efficiency of the latter, as assessed by the outcome of crosses with wild-type or petite tester strains.

EMBO J, 1982, 1(6), 675 - 80
Two yeast acid phosphatase structural genes are the result of a tandem duplication and show different degrees of homology in their promoter and coding sequences; Meyhack B et al.; We have cloned the structural genes for a regulated ( PHO5 ) and a constitutive ( PHO3 ) acid phosphatase from yeast by transformation and complementation of a yeast pho3 , pho5 double mutant . Both genes are located on a 5.1-kb BamHI fragment . The cloned genes were identified on the basis of genetic evidence and by hybrid selection of mRNA coupled with in vitro translation and immunoprecipitation . Subcloning of partial Sau3A digests and functional in vivo analysis by transformation together with DNA sequence analysis showed that the two genes are oriented in the order (5') PHO5 , PHO3 (3') . While the nucleotide sequences of the two coding regions are quite similar, the putative promoter regions show a lower degree of sequence homology . Partly divergent promoter sequences may explain the different regulation of the two genes.

EMBO J, 1982, 1(5), 529 - 34
A region of extreme instability in the mitochondrial genome of yeast; Marotta R et al.; About half of the spontaneous petite mutants produced by wild-type Saccharomyces cerevisiae strain B (as well as by several other strains) have the same defective mitochondrial genome . Its repeat unit is a segment, 2200 base pairs (bp) long, which derives from an excision between the origins of replication ori 2 and ori 7 of the wild-type genome, and contains a hybrid ori 2-ori 7 sequence . The spontaneous petites carrying this defective ori.h genome are supersuppressive , i.e., they very rapidly compete out the wild-type genome in crosses . The main reasons for the exceptional frequency of ori.h petites are an extremely high excision frequency, due to the extended homology between the two tandemly oriented ori sequences 265 bp long and the short distance separating them . Such an excision frequency is very strongly increased in petite genomes encompassing the ori 2-ori 7 region, because of their higher concentration in these ori sequences.

EMBO J, 1982, 1(10), 1245 - 50
Ty1 and delta elements occur adjacent to several tRNA genes in yeast; Eigel A et al.; A comparative analysis of a number of yeast DNA-pBR322 recombinant plasmids carrying repetitive sequence elements has revealed that Ty1 or delta elements occur in the vicinity of several tRNA genes . Four examples have been characterized in detail: three glutamate tRNA genes and a serine tRNA gene . The tRNAGlu3 genes occupy different chromosomal locations; two of these genes are found adjacent to Ty1 elements, and the third is found adjacent to an independent delta element . A delta unit is also found adjacent to a tRNASer2 gene . Next to one of the tRNAGlu3 genes, the delta element is joined to a truncated sigma element . Junctions between different delta units were characterized by the sequence analysis of two DNA segments that carry no tRNA genes.

EMBO J, 1982, 1(10), 1193 - 8
Probing yeast RNA polymerase A subunits with monospecific antibodies; Huet J et al.; Monoclonal antibodies were raised in mouse against native RNA polymerase A from Saccharomyces cerevisiae . After screening with the spot-immunodetection technique, 14 hybridomas were selected and the antibodies produced in mice . Their specificity, analyzed by blot-immunodetection, was found to be markedly biased towards a few RNA polymerase subunits: A135 , A49 , A43 , and A14.5 . A different monoclonal antibody directed against the largest subunit, A190 , was obtained by immunizing a mouse with RNA polymerase A dissociated into its subunits with SDS . Two antibodies, which probably recognized the same antigenic determinant on subunit A135 , inhibited in vitro RNA synthesis . Inhibition was prevented by preincubation of the enzyme with DNA, suggesting a role for the A135 subunit in template binding . The antibody directed against A14.5 interacted with the A14.5 kd subunit present in all three forms of the yeast nuclear RNA polymerases but did not interfere with RNA polymerase activity . These antibody probes will be useful to study subunit function in reconstituted transcription systems.

Acta Microbiol Pol, 1982, 31(3-4), 227 - 37
Light effects in yeast: relation between the respiratory deficiency and light sensitivity in yeast; Ulaszewski S et al.; Visible light of 5,000 lux intensity has been shown to photokill yeast cells at 12 degrees C . In the present report some of isogenic respiratory deficient mit- and nuclear mutants were compared for their sensitivity to light . No close correlation between the cytochromes spectra and light resistance was observed . Although, the nuclear and rho- mutants which lack cytochromes a + a3 and b are as a rule light resistant . Photokilling effect in yeast seems to be dependent both on the sufficiency of respiratory chain and on protein synthesis probably on cytoplasmic level.

Mol Gen Genet, 1982, 188(1), 96 - 102
The regulation of RNA synthesis in yeast . V . tRNA charging studies; Clare JJ et al.; The stringent control of RNA synthesis in the yeast Saccharomyces cerevisiae may be evoked either by starving for a required amino acid or by inhibiting protein synthesis . The response is non-coordinate in that the synthesis of ribosomal and messenger RNA is depressed whereas that of transfer RNA continues . If protein synthesis is blocked in starved cells then tRNA synthesis is stimulated . In this paper, the relationship between the level of tRNA charging and the transcriptional and translational state of the yeast cell has been examined . When cells are starved for an amino acid the corresponding tRNA species only becomes uncharged . This effect can be counteracted by the addition of protein synthesis inhibitors to the starved cells . In contrast, the same inhibitors provoked the discharge of tRNA in growing (non-starved) yeast . Similar results were obtained when protein synthesis was blocked using a temperature-sensitive mutant . These contrasting effects of translation inhibition on tRNA charging in starved and non-starved cells correlate with the changes that inhibition evoked in the transcriptional state of those cells . The data indicate that tRNA synthesis is under autoregulatory control and that tRNA charging may also play an important role in the regulation of rRNA synthesis.

J Immunol Methods, 1982, 50(1), 115 - 21
An enzyme immunoassay for yeast and mycelial phase-specific antibodies in histoplasmosis; Sharma A et al.; The enzyme-linked immunosorbent assay (ELISA) has been adapted to detect class-specific antibodies to yeast and mycelial phase (MP) antigens of Histoplasma capsulatum . Experimental histoplasmosis was produced in rhesus monkeys and humoral immune responses were measured by ELISA and complement-fixation (CF) tests . Antibodies to the yeast phase (YP) reached a peak after 7 weeks and gradually declined thereafter, while MP antibodies continued to increase even after 4 months . Comparison of the 2 tests showed a significant degree of correlation but ELISA was 10-20 times more sensitive than CF . The ELISA method permitted the analysis of low levels of antibodies at early stages of infection . Applications of the ELISA technique to the serodiagnosis of histoplasmosis employing the 2 phase-specific antigens are discussed.

Acta Biol Med Ger, 1982, 41(1), 23 - 30
{Interaction of terbium ions with inorganic pyrophosphatase from bakers' yeast: characterization of the binding sites}; Hansen G et al.; Terbium ions bind with a 2:1 stoichiometry per subunit to inorganic pyrophosphatase from bakers' yeast (EC 3.6.1.1) as measured by an increase of terbium fluorescence . The Tb3+ inhibition of the Mg2+ activated pyrophosphate hydrolysis is caused by a competitive binding at the substrate site of the active centre . The second Mg2+ binding site--the so-called "stabilization site"--is discussed as an additional binding site for Tb3+ . Thereby, Tb3+ causes also a stabilization of the enzyme against heat denaturation . The dissociation constants of the terbium-pyrophosphatase interaction are in the micromolar range.

Biosci Rep, 1982 Jan, 2(1), 55 - 62
Inhibition in vitro of yeast DNA polymerase I activity by beta-blockers; Presta M et al.; The activity of DNA polymerase I from Saccharomyces cerevisiae is inhibited, in a dose-dependent fashion, by the oncogenic beta-blocker 1-(2-nitro-3-methyl-phenoxy)-3-tert-butylamino-propan-2-ol (ZAMI 1305) and by the non-oncogenic beta-blockers 1-(2-nitro-5-methyl-phenoxy)-3-tert-butylamino-propan-2-ol (ZAMI 1327), atenolol, and propranolol, the latter having the highest inhibiting activity . The inhibition is due to an interaction of the beta-blockers with the free enzyme and with the enzyme-DNA complex . The degree of inhibition is directly related to the hydrophobicity of the aromatic moiety and to the length and hydrophilicity of the aliphatic chain of the inhibitor . No relation seems to exist between the in vitro inhibition of yeast DNA polymerase I by beta-blockers and their oncogenic activity.

Biochim Biophys Acta, 1981 Dec 28, 656(2), 220 - 7
Single-stranded DNA transcription by yeast RNA polymerase B; Nagamine Y et al.; Single-stranded DNA is not transcribed randomly by yeast RNA polymerase B . A denatured yeast DNA fragment, containing the gene for yeast alcohol dehydrogenase I, directs the transcription of defined RNA products visualized as discrete RNA . DNA hybrid bands following S1 nuclease treatment and agarose gel electrophoresis . Blocking the 3' end of the template by 3' deoxyadenosine did not change the band pattern but reduced the proportion of RNA covalently bound to the DNA from 20 to 4% . On the other hand, the band pattern was affected by the salt concentration, the nature of the divalent cation and the nucleoside triphosphate concentration . The four major RNA bands, found at low substrate concentration, hybridized to the same region of the template . This observation suggests the potential requirement for DNA destabilization in gene activation.

J Biol Chem, 1981 Dec 25, 256(24), 12780 - 7
Assembly of the mitochondrial membrane system . Analysis of the nucleotide sequence and transcripts in the oxi1 region of yeast mitochondrial DNA; Coruzzi G et al.; The region of yeast mitochondrial DNA between 10.7 and 17.9 map units has been characterized by restriction analysis and DNA sequencing . The DNA sequence was obtained from the partially overlapping genomes of the two rho- mutants DS200/A1 and DS302 . Two tRNA genes have been found in the sequence upstream of the oxi1 gene . The deduced secondary structures indicate that the genes code for the methionine (5'-CAU-3') and the asparagine (5'-GUU-3') tRNAs of yeast mitochondria . The region between 10.7 and 17.9 units contains two reading frames . One of these corresponds to the oxi1 gene previously shown to code for subunit 2 of cytochrome oxidase (Coruzzi, G., and Tzagoloff, A . (1979) J . Biol . Chem . 254, . 9324-9330; Fox, T . D . (1979) Proc . Natl . Acad . Sci . U.S.A . 76, 6534-6538) . The second reading frame can potentially code for a basic protein with 386 amino acid residues . It is not known at present if this putative gene is translated in vivo . Northern blots of wild type mitochondrial RNA were hybridized to single-stranded probes from the oxi1 gene and flanking regions . The results of these analyses indicate that the primary transcript of the oxi1 region is a high molecular weight RNA (larger than 3 kilobase pairs) which is processed in discrete steps to a mature 850-nucleotide messenger . The 5' leader of the messenger has been established to be 54 nucleotides long and to have a sequence identical with that of the genomic DNA immediately upstream of the oxi1 gene.

J Biol Chem, 1981 Dec 25, 256(24), 12958 - 61
Sequence of the yeast iso-1-cytochrome c mRNA; Boss JM et al.; The nucleotide sequence of the yeast iso-1-cytochrome c (CYC1) mRNA is presented . The mRNA was enriched by hybridization to cloned CYC1 DNA attached to a solid matrix: either nitrocellulose filters or diazobenzyloxymethyl cellulose powder . The sequence of the 5'-end of the mRNA was determined by the extension of a CYC1-specific dodecanucleotide primer; the sequence of the 3'-end was determined using a decanucleotide d(pT8-G-A) primer . The CYC1 mRNA begins 61 nucleotides 5' to the AUG initiation codon, extends through the coding sequence to 172 to 175 nucleotides 3' to the UAA termination codon, followed by the poly(A) tail . There are no intervening sequences . Some of the sequences that the CYC1 mRNA shares in common with other eukaryotic mRNAs are discussed.

Biochim Biophys Acta, 1981 Dec 21, 649(3), 529 - 32
Localization of polyphosphates at the outside of the yeast cell plasma membrane; Tijssen JP et al.; Under appropriate experimental conditions toluidine blue is bound to the yeast cell surface, without penetrating into the cells . Based on experimental observations it is highly probable that the dye is bound to polyphosphates, localized outside the plasma membrane . The probable localization of polyphosphates outside the plasma membrane is important in the context of the proposed involvement of polyphosphates in glucose transport in yeast.

Nucleic Acids Res, 1981 Dec 21, 9(24), 7073 - 83
Nuclear Overhauser effect study and assignment of D stem and reverse-Hoogsteen base pair proton resonances in yeast tRNAAsp; Roy S et al.; Nuclear Overhauser effects (NOEs) in yeast tRNAAsp were found for all four GU and G psi base pairs . NOEs of both reverse-Hoogsteen pairs were identified by comparison with a purine C8 deuterated sample . Several NOEs involving these resonances were also found which are clearly between single protons on adjacent base pairs . These interbase NOEs, combined with the assumption of reasonable similarity between the structure of yeast tRNAAsp and that of yeast tRNAPhe, lead to unambiguous assignment of many resonances including all the ring NH and C2 protons in the D stem . The stability of the stem at 28 degrees C, as recently deduced by Moras et al (Nature 288 669-674), from x-ray diffraction is confirmed . Assignments of the ring NH resonances of T54-A58 and of a G psi pair are made for the first time.

Biochim Biophys Acta, 1981 Dec 15, 662(2), 236 - 45
The effects of anions, substrates, metal ions and sulfhydryl reagents on the proteolytic susceptibility of yeast phosphoglycerate kinase; Wrobel JA et al.; With the aim of confirming our previous spectrophotometric binding studies ((1978) Eur . J . Biochem . 85, 345-350 and (1980) Eur . J . Biochem . 104, 249-254) and of ascertaining the full physiological significance of ion binding, we investigated the effects of ions and thiol reagents on the proteolysis of yeast phosphoglycerate kinase (ATP: 3-phospho-D-glycerate 1-phosphotransferase, EC 2.7.2.3) . The single non-essential thiol of the enzyme was modified with 5,5'-dithiobis(2-nitrobenzoic acid) or 2-chloromercuri-4-nitrophenol . Both modifications greatly increased the susceptibility of the kinase to inactivation by trypsin or yeast proteinase A, when compared with that of the native kinase . Electrophoresis in sodium dodecyl sulfate (SDS) revealed that limited proteolysis had occurred . The time courses for the proteolysis and loss of catalytic activity were followed and the active and inactive fragments identified . The molecular masses of the major proteolytic fragments differed with the two endopeptidases . Substrate and non-substrate anions in a concentration-dependent fashion, protected the native and mercurial-labelled kinase from inactivation by trypsin or yeast proteinase A . However, Zn2+, in a concentration-dependent fashion, increased the susceptibility of the native kinase to inactivation by each endopeptidase . The time courses for the inactivation and for the proteolysis allowed the active and inactive fragments to be identified . Zn2+ decreased the rate of inactivation of the mercurial-labelled kinase by proteinase A . The effects of these ions were detected at concentrations compatible with occupancy of an anion binding site and a low affinity Zn2+ binding site, both of which have been indicated from our previous binding studies.

Nucleic Acids Res, 1981 Dec 11, 9(23), 6369 - 77
RNA synthesis in isolated yeast mitochondria; Groot GS et al.; Isolated yeast mitochondria incorporate added UTP into RNA . Amongst the products formed are the two rRNAs, 4S RNA and several components presumed to be mRNAs . In omega+ strains (containing an intervening sequence in the 21S rRNA gene) besides mature 21S rRNA a transcript could be detected still containing nucleotide sequences transcribed from this intervening sequence . In omega- strains (not containing this intervening sequence) also a longer form of the 21S rRNA could be observed . These results suggest that isolated yeast mitochondria are capable of carrying out RNA synthesis and processing, including splicing.

Nucleic Acids Res, 1981 Dec 11, 9(23), 6379 - 90
Synthesis and processing of ribosomal RNA in isolated yeast mitochondria; Boerner P et al.; The synthesis and processing of the 15S and 21S rRNAs have been studied in isolated yeast mitochondria . When mitochondrial transcripts were labeled with {alpha-32p}UTP in an incubation mixture containing 50 microM ATP, the transcripts from the genes for the large and small ribosomal RNAs accumulated in the form of putative precursor molecules . The labeled pre-21S rRNA was converted to mature 21S rRNA during a chase period in the presence of 1 mM ATP . Thus, the maturation of 21S rRNA, a process which includes trimming at the 3' end and, in omega+ strains, the excision of a 1.1 kb intervening sequence, can occur in isolated mitochondria and appears to be dependent on ATP . In contrast, the maturation of 15S rRNA by the removal of approximately 80 nucleotides from the 5' end of a 15.5S transcript is severely restricted in isolated mitochondria, even in the presence of 2.5 mM ATP.

Nucleic Acids Res, 1981 Dec 11, 9(23), 6293 - 304
Biosynthesis and transport of yeast mitochondrial phenylalanyl-tRNA synthetase; Diatewa M et al.; The biosynthesis of yeast mitochondrial Phe-tRNA synthetase is studied in vivo . Antibodies against the enzyme are raised in rabbits . They precipitate two proteins in the post-ribosomal supernatant of the yeast cell homogenate . Immunoprecipitate analysis on SDS - gel electrophoresis shows that the two types of mitochondrial enzyme subunits with molecular weights of 57,000 and 72,000, respectively, are cytoplasmically synthesized as larger, individual precursors . Terminal extensions of the precursors prevent enzyme activity . Mitochondrial membranes linked protease(s) play(s) an active role in maturation.

J Biol Chem, 1981 Dec 10, 256(23), 11962 - 5
Synthesis and processing of in vitro and in vivo precursors of the vacuolar yeast enzyme carboxypeptidase Y; Muller M et al.; The biosynthesis of carboxypeptidase Y, which is located in the lysosome-like vacuole of Saccharomyces cerevisiae, has been studied in vitro in a cell-free translation system from wheat germ and in vivo in intact spheroplasts . When a wheat germ system was programmed with yeast RNA, a translation product was immunoprecipitated by anti-carboxypeptidase Y antibodies, which had a slightly smaller molecular weight (Mr = 59,000) on sodium dodecyl sulfate-polyacrylamide gel electrophoresis than the authentic glycoprotein (Mr = 60,000) . In the presence of dog pancreatic microsomal membranes, an additional cross-reacting translation product of Mr = 68,000 was formed, which in contrast to the 59,000-dalton form was not susceptible to digestion by externally added proteinases, suggesting its segregation within the microsomal vesicles . The observed increase in molecular weight may be consistent with a core glycosylation of the translocated protein . During a pulse-chase labeling of spheroplasts, the antibody initially precipitated a form of carboxypeptidase Y, which co-migrated on sodium dodecyl sulfate gels with the 68,000-dalton in vitro translation product . Following a chase of 60 min, this early labeled immunoreactive protein was completely converted into the authentic enzyme (Mr = 60,000) and is therefore coincident with the in vivo precursor of carboxypeptidase Y previously described (Hasilik, A., and Tanner, W . (1978) Eur . J . Biochem . 85, 599-608) . These data suggest that a vacuolar yeast enzyme is synthesized via a cotranslational segregation of its nascent polypeptide chain within the endoplasmic reticulum giving rise to a proenzyme, which is further processed in vivo into the vacuole-located mature enzyme.

Biokhimiia, 1981 Dec, 46(12), 2257 - 60
{Dihydroxyacetone synthase from the methanol-utilizing yeast Candida boidinii}; Bystrykh LV et al.; A procedure for purification of dihydroxyacetone synthase catalyzing the formation of dihydroxyacetone and glyceraldehyde 3-phosphate from formaldehyde and xylulose 5-phosphate has been developed . Using ion-exchangers with increasing affinity for dihydroxyacetone synthase, a homogenous preparation of the enzyme with specific activity of 2 u./mg has been obtained . The enzyme is made up of 2 subunits with m . w . of 76,000, contains thiamine pyrophosphate, requires Mg2+ for its activity and differs from yeast transketolase by substrate specificity and some other properties . The role of dihydroxyacetone synthase in metabolism of methanol-utilizing yeasts is discussed.

Antonie Van Leeuwenhoek, 1981 Dec, 47(5), 385 - 92
Influence of pH on the transition from yeast-like cells to chlamydospores in Aureobasidium pullulans; Bermejo JM et al.; When A . pullulans is grown on a glucose medium with a limiting nitrogen source and low buffer capacity, the yeast-like cells that are originally present undergo a transition to chlamydospores . The initial pH must be around 6 for the transition to take place under optimal conditions . On the above-mentioned medium pH decreases to values below 2 in the first two days; if this decrease is prevented, either by buffering the medium or by repeatedly adjusting the pH to its original value no chlamydospores form.

Mol Cell Biol, 1981 Dec, 1(12), 1120 - 4
Relation between the efficiency of homothallic switching of yeast mating type genes and the distribution of cell types; Davidow LS et al.; Homothallic switching of yeast mating type genes occurs as often as each cell division, so that a colony derived from a single haploid spore soon contains an equal number of MATa and MAT alpha cells . Cells of opposite mating types conjugate, and eventually the colony contains only nonmating MATa/MAT alpha diploids . Mutations that reduce the efficiency of homothallic MAT conversions yield colonies that still contain many haploid cells of the original spore mating type plus a few recently generated cells of the opposite mating type . These (a greater than alpha)- or (alpha greater than a)-mating colonies also contain some nonmating diploid cells . As an alternative to microscopic pedigree analysis to determine the frequency of mating type conversions in a variety of mutant homothallic strains, we analyzed the proportions of MATa, MAT alpha, and MATa/MAT alpha cells in a colony by examining the mating phenotypes of subclones . We developed a mathematical model that described the proportion of cell types in a slow-switching colony . This model predicted that the proportion of nonmating cells would continually increase with the size (age) of a colony derived from a single cell . This prediction was confirmed by determining the proportion of cell types in colonies of an HO swi1 strain that was grown for different numbers of cell divisions . Data from subcloning (a greater than alpha) and (alpha greater than a) colonies from a variety of slow-switching mutations and chromosomal rearrangements were used to calculate the frequency of MAT conversions in these strains.

Sabouraudia, 1981 Dec, 19(4), 287 - 94
Unusual response of a yeast to imidazole antifungals; Ball EH et al.; Thiamin was shown to relieve preferentially the toxicity of econazole for a yeast which showed an unusual response to imidazole drugs . The possible role of this vitamin in the response of the yeast to imidazoles is discussed . An investigation of the effect of a second exposure of yeasts to imidazole drugs showed that there is an increase in sensitivity when the cells are transferred directly to fresh medium containing the same concentrations of the drug, and a decrease in sensitivity following transfer via drug-free medium.

Eur J Biochem, 1981 Dec, 121(1), 47 - 52
Analysis of proteinase A function in yeast; Mechler B et al.; Yeast mutants lacking proteinase A were isolated . One of these mutants (Hb I) is characterized in detail . The mutation called pra1 segregates 2:2 in meiotic tetrads indicating a single gene mutation . No anti-(proteinase A) cross-reacting material can be detected . Diploids heterozygous for pra1 show gene dosage . Thus, it appears that PRA1 might be the structural gene for proteinase A . Results obtained with this mutant show that proteinase A is not a vital component of the vegetative cell cycle . The mutant exhibits normal mitotic growth under rich and poor growth conditions and shows normal mating . Enzymes subject to carbon catabolite inactivation and inactivation of NADP-dependent glutamate dehydrogenase, processes which were proposed to be of proteolytic nature, are not affected by the absence of proteinase A . However, protein degradation under sporulation conditions is about 30% reduced in proteinase A mutant cells . The differentiation process of sporulation is also disturbed leading to a 40% reduced sporulation frequency in mutant cells.

Eur J Cell Biol, 1981 Dec, 26(1), 129 - 35
Structure of intramembrane particles in proteoliposomes containing yeast mitochondrial ATPase; Lang RD et al.; Oligomycin-sensitive ATPase was isolated from yeast mitochondria and incorporated into phospholipid vesicles by cholate dialysis . The structure of the membranes was examined by freeze-fracture electron microscopy . Liposomes formed without the ATPase were small with diameters in the range 20 to 40 nm and they had smooth fracture faces . When the ATPase was introduced, larger vesicles formed (up to 500 nm in diameter) which bore intramembrane particles (IMPs) on their fracture faces . The IMP frequency was dependent on the ratio of protein to lipid used in the reconstitution . After unidirectional shadowing at an angle of 45 degrees, IMPs had a mean width of 12.7 nm and a mean shadow length of 5.9 nm . After rotary shadowing, the mean IMP diameter was 12.9 nm . When the amount of protein was higher than 1 mg/10 mg phospholipid in the initial incorporation mixture, the ATPase formed small hexagonal arrays in the liposome membranes . Computer-based image processing of such arrays showed that the IMPs had a centre-to-centre spacing of 13.7 nm . Calculations showed that each IMP may correspond to an oligomer of the ATPase.

Mol Cell Biol, 1981 Dec, 1(12), 1106 - 19
Transposition of yeast mating type genes from two translocations of the left arm of chromosome III; Haber JE et al.; In the yeast Saccharomyces cerevisiae, the HIS4C gene lies on the left arm of chromosome III . We analyzed two chromosomal rearrangements that have HIS4C translocated either to chromosome XII or to a new translocation chromosome . Using the cmt mutation that allows expression of the normally silent copies of mating type genes, we found that both of these translocations also carried HML alpha, more than 30 map units distal to HIS4C which normally lies on chromosome III . In the case of the translocation chromosome (designated T3), we also found an exchange event between HML alpha on the translocation chromosome and HMLa on chromosome III . In diploids containing two T3 chromosomes (one carrying HML alpha and the carrying HMLa), we found that HML was 32 centimorgans from HIS4C, which was 10 centimorgans from an unknown centromere . In homothallic strains carrying HMLa MATa HMRa on chromosome III, switching from MATa to MAT alpha could occur by using the HML alpha on the translocation as the sole donor of alpha information . Transposition from HML alpha on chromosome T3 was about 20 to 40% as efficient as transposition from intact chromosome III . In contrast, transposition from the HML alpha inserted into chromosome XII was reduced about 100-fold . This reduced efficiency did not appear to be caused by an alteration in the sequences immediately surrounding HML alpha in the translocation . The translocated HML alpha sequence was located in the same size (29-kilobase) SalI fragment as was found in chromosome III, and the same EcoRI, HindIII, and BglII restriction sites were also found . Furthermore, HML alpha was still under the control of the CMT gene, which maintains HML as a silent copy of mating type information . These results suggested that the position of the HML alpha sequence plays an important role in the efficiency of mating type switching.

J Bioenerg Biomembr, 1981 Dec, 13(5-6), 357 - 73
Orientation of complex III in the yeast mitochondrial membrane: labeling with {125I} diazobenzenesulfonate and functional studies with the decyl analogue of coenzyme Q as substrate; Beattie DS et al.; Mitochondria (or mitoplasts) and submitochondrial particles from yeast were treated with {125I} diazobenzenesulfonate to label selectively proteins exposed on the outer or inner surface of the inner mitochondrial membrane . Polyacrylamide gel analysis of the immunoprecipitates formed with antibodies against Complex III or cytochrome b revealed that the two core proteins and cytochrome b were labeled in both mitochondria and submitochondrial particles, suggesting that these proteins span the membrane . Cytochrome c1 and the iron sulfur protein were labeled in mitochondria but not in submitochondrial particles, suggesting that these proteins are exposed on the cytosolic side of the inner membrane . The steady-state reduction of cytochromes b and c1 was determined with succinate and the decyl analogue of coenzyme Q as substrates . Addition of the coenzyme Q analogue to mitochondria caused reduction of 15-30% of ;the total dithionite-reducible b and 100% of the cytochrome c1: Addition of the coenzyme Q analogue to submitochondrial particles led to the reduction of 70% of the total dithionite-reducible cytochrome b but insignificant amounts of cytochrome c1 . A model to explain the topography of Complex III in the inner membrane is proposed based on these results.

Cell, 1981 Dec, 27(2 Pt 1), 371 - 9
Deletion of the 3' half of the yeast tRNA-Leu3 gene does not abolish promotor function in vitro; Carrara G et al.; The promotor function of the 3' and 5' half tRNA sequences in the yeast tRNA-Leu3 gene has been studied by in vitro transcription in Xenopus laevis germinal vesicle (GV) extracts . Truncation of the DNA template within the tRNA intervening sequence by Hpa I abolishes transcription . However, separation of the tRNA gene halves by insertion of a 300 bp DNA fragment at the Hpa I site does not affect the promoter efficiency . Further, the complete sequence of the 3' half of the tRNA is not necessary for promoter function, because removal of the 3' half of the gene by cleavage with Pvu II, within the DNA inserted at the Hpa I site, does not inhibit transcription.

J Biol Chem, 1981 Nov 25, 256(22), 11917 - 22
Partial purification of cytosolic proteins which control yeast mitochondrial protein synthesis; Finzi E et al.; Protein synthesis in isolated yeast mitochondria incubated in the presence of GTP is stimulated 2-fold by addition of dialyzed postpolysomal supernatant (S-150) at the start of the incubation . Incubation of the yeast S-150 with 5'-nucleotidase had no effect on the stimulatory activity suggesting that the increased protein synthesis does not result from guanine nucleotides . A partial purification of the protein factors which stimulate mitochondrial protein synthesis has been accomplished by chromatography on Sephacryl S-200 . Stimulatory activity was eluted in two peaks, one in the 40,000 to 80,000 molecular weight range and a broad peak with a molecular weight of less than 10,000 . Stimulation of mitochondrial protein synthesis by the low molecular weight activator fraction was proportional to the concentration of protein added and abolished by trypsin treatment suggesting that the low molecular weight activator is a protein(s) . The rate of mitochondrial protein synthesis in the presence of activator, was linear for 40 min, while that in the presence of GTP was linear for only 20 min, suggesting that the activator and GTP stimulate protein synthesis by different mechanisms . Analysis of the products of the stimulated mitochondrial protein synthesis by gel electrophoresis revealed that the activator increased equally the labeling of all products . These results indicate that low molecular weight proteins present in the cytosol regulate mitochondrial protein synthesis.

J Biol Chem, 1981 Nov 10, 256(21), 11018 - 24
In vitro transcription of the yeast alcohol dehydrogenase I gene by homologous RNA polymerase B (II) . Selective initiation and discontinuous elongation on a supercoiled template; Lescure B et al.; A new in vitro approach is used to investigate the specificity of purified yeast RNA polymerase B (II) . The template is supercoiled, the transcription is primed by a dinucleotide, and the transcripts are analyzed by polyacrylamide gel electrophoresis after synthesis in the absence of one nucleoside triphosphate . Under these conditions, two recombinant plasmids carrying the gene or part of the gene for yeast alcohol dehydrogenase I direct the synthesis of a very limited number of oligonucleotides . Elongation of these prelabeled oligomers, using unlabeled substrates, occurs in a discontinuous way . A major transcript of 200 nucleotides accumulates transiently . Southern hybridization shows that it is initiated about 1,400 bases upstream from the origin of the yeast alcohol dehydrogenase I gene . A minor start was identified, by a modified runoff experiment, at position -35 from the AUG initiation codon . The location of this site is related to the presumptive in vivo transcription starts . The selectivity disappears when the template is a truncated DNA . Then, initiation occurs predominantly at nicks introduced by the restriction enzymes.

Mikrobiologiia, 1981 Nov-Dec, 50(6), 1084 - 7
{Effect of the pH of the medium on the growth and chemical composition of the methanol-assimilating yeast Candida boidinii}; Podgorskii VS; The yeast Candida boidinii T2A was grown in a medium with methanol or glucose as a sole source of carbon and energy, and the effect of the pH of the medium on the specific growth rate, the economic coefficient and the chemical composition of the yeast was investigated in a continuous chemostat process . The graphic presentation of the specific growth rate as a function of the pH is bell-shaped and, for all practical purposes, symmetric with respect to the ordinate of the optimal pH value . The maximal, specific rate of the yeast growth is 0.24 h-1 in the case of methanol and 0.38 h-1 in the case of glucose . The maximum in the curve is observed at pH 4.0 to 5.0 . The yeast grows within a wide range of pH without a change in the economic coefficient . At all the studied dilution rates for a continuous culture exceeding 0.06 h-1 and the pH from 2 to 8, the yield of yeast biomass remains almost at the same level (36-40%) . The results show a change in the chemical composition of the biomass depending on the pH of the medium and the rate of the yeast growth.

Mutat Res, 1981 Nov, 84(1), 37 - 47
Mutagenesis induced by mono- and bi-functional alkylating agents in yeast mutants sensitive to photo-addition of furocoumarins (pso); Cassier C et al.; The inactivation and the induction of forward and reverse mutations by a mono- and a bifunctional nitrogen mustard in 3 pso mutants of Saccharomyces cerevisiae, initially selected for their sensitivity to psoralen photo-addition, were compared with that of the wild-type . The pso1-1 mutant was very sensitive to both alkylating agents, and the mutagenicity was abolished . This correlates with the defect in the error-prone repair capacity for lesions induced by psoralen photo-addition and radiations already observed for this mutant . Therefore it appears that the PSO1+ gene product acts on a spectrum of DNA lesions . The pso2-1 mutant was highly sensitive to the lethal effect of the bifunctional nitrogen mustard and was only slightly sensitive to the monofunctional one . For both agents a reduction in induced mutagenesis was seen . The same was true for mono- and bifunctional psoralen derivatives . The pso2-1 mutant having the same sensitivity as the wild-type to UV and ionizing radiations, it is suggested that the PSO2+ gene product is predominantly necessary for the repair of cross-links irrespective of their molecular nature . In contrast with psoralen photo-induced inactivation the pso3-1 mutant had the same sensitivity as the wild-type to alkylating agents . However, a reduction in induced mutagenesis was seen in both cases . This response was modulated according to dose and type of mutation . Consequently, it appeared that the PSO3+ gene product acts specifically on psoralen photo-induced sub-lethal lesions and on a fraction of premutagenic lesions independently of their structure.

Cell, 1981 Nov, 27(1 Pt 2), 12 - 4
Splice points of the third intron in the yeast mitochondrial cytochrome b gene; Lazowska J et al.; We report the nucleotide sequences at the splicing junctions of intron 13 of the cytochrome b (box) "long" gene of the mitochondrion of Saccharomyces cerevisiae and compare them with the homologous sequences in Aspergillus nidulans . The two introns occupy exactly the same position and display an open reading frame in phase with the preceding exon at the 5' end and a blocked region at the 3' end.

Gene, 1981 Nov, 15(2-3), 157 - 66
Characterization of a yeast replication origin (ars2) and construction of stable minichromosomes containing cloned yeast centromere DNA (CEN3); Hsiao CL et al.; A yeast DNA sequence (ars2), capable of supporting autonomous replication of plasmids, in yeast, has been characterized . The ars2 replicator occurs about 7 kb from the ARG4 gene on yeast chromosome VIII . Plasmids containing ars2 and the ARG4 gene transform yeast arg4 mutants to ARG4+ with high frequency (about 103 transformants/micrograms DNA) and replicate autonomously in the transformed cells . The ars2 plasmids are mitotically unstable and are readily lost from yeast cultures when grown under nonselective conditions . The addition of a DNA segment containing functional yeast centromere (CEN3) and an ars2 plasmid effectively stabilizes the plasmid against both mitotic and meiotic loss . The ars2-CEN3 minichromosomes replicate autonomously in controlled copy number while segregating in a typical Mendelian pattern (2+ :2-) during meiosis . The requirement for a separate replicator sequence for stable mitotic and meiotic maintenance of centromere-containing minichromosomes is equally satisfied by the presence of either ars1 or ars2 . The centromere controls plasmid copy number to a low value (usually one) regardless of the type of replicator used.

Mutat Res, 1981 Nov, 91(6), 451 - 5
Nuclear mutants of yeast with reduced spontaneous mutability of the mitochondrial genome; Devin AB et al.; Nuclear mutations in yeast were obtained that reduced rates of spontaneous mutations in the mitochondrial genome . The symbol mmg (mutability of mitochondrial genome) is used to designate these mutations . 2 types of mmg mutation are described: semidominant and recessive ones . Each of the 4 mutations studied is located in a separate mmg locus suggesting that there are probably more than 4 mmg loci in the nuclear genome of a yeast cell.

Cell, 1981 Nov, 27(1 Pt 2), 25 - 35
In vitro mutation analysis of the mating-type locus in yeast; Tatchell K et al.; The mating-type locus (MAT) of Saccharomyces cerevisiae is a complex locus that codes for the regulators of cell type . Two unique messages are transcribed from each MAT allele . Using the in vitro mutagenesis technique whereby synthetic oligonucleotides containing restriction sites (linkers) were inserted into plasmids, we have constructed a series of mutations in cloned DNA containing either the MATa or MAT alpha locus . The new restriction site associated with each "linker" mutation has allowed the mutation to be mapped and sequenced . We have complemented genetically defined mutations (mata1, mat alpha 1 and mat alpha 2) with plasmids containing these in vitro mutations by yeast transformation, thereby mapping the genes onto the DNA sequence . MATa1 has been localized to the MATa unique region (Ya) from which the a1 message is transcribed . We find no function for the other MATa message by using our complementation assay . MAT alpha 1 maps to the MAT alpha unique (Y alpha) and adjacent (Z) region from which the alpha 1 message is transcribed . MAT alpha 2 maps to the other major message found in the common (X) region of the MAT alpha loci . Although most linker mutations that have a mutant phenotype appear to disrupt the translated portion of each gene, two mutations may disrupt transcription.

Biochim Biophys Acta, 1981 Oct 27, 655(3), 390 - 5
A rapid isotope dilution procedure for estimating the relative proportion of mitochondrial DNA in yeast; Cottrell SF; A method is described for estimating rapidly the relative proportion of total DNA that is of mitochondrial origin in small quantities of the yeast, Saccharomyces cerevisiae . This procedure involves the mechanical disruption of cells followed by the addition of small amounts of radioactively labeled yeast nuclear and mitochondrial DNA to the lysate . Both labeled and unlabeled DNAs are then co-extracted from the mixture and separated into nuclear and mitochondrial DNA components by poly(L-lysine) Kieselguhr column chromatography . The resulting specific radioactivities of each species of DNA, when compared to the amount of labeled DNA initially added, or related to the relative proportion of unlabeled nuclear and mitochondrial DNA in the original cell sample . The isotope dilution procedure reported here is shown to be both reproducible and to reflect the true relative concentration of each species of DNA in this yeast.

Biochim Biophys Acta, 1981 Oct 27, 655(3), 323 - 8
Degradation of nucleic acids with ozone . II . Degradation of yeast RNA, yeast phenylalanine tRNA and tobacco mosaic virus RNA; Shinriki N et al.; The degradation of a mixture of four 5'-ribonucleotides (AMP, GMP, CMP and UMP), yeast RNA, yeast phenylalanine tRNA, and tobacco mosaic virus RNA (TMV-RNA) with ozone (concentration in inlet gas, 0.1-0.5 mg/l) was examined in a phosphate buffer (pH 6.9) . In the case of the mixture, GMP alone was degraded in the initial stage . In the ozonization of yeast RNA, the guanine moiety was less vulnerable to attack by ozone than in the case of free GMP, but it again degraded most rapidly among the four nucleotides . In the treatment of tRNA with ozone, the guanine moiety degraded first . When the numbers of degraded nucleotides reached 4.8 (remaining amino acid acceptor activity was 3.6%), the polyacrylamide gel electrophoresis of the ozonized tRNA gave a single band with the same mobility as that of the intact tRNA . It is evident that ozonolysis of tRNA proceeded without cleavage of the polynucleotide chain . In the case of TMV-RNA, the loss of the infectivity by ozone proceeded rapidly within 30 min and was followed by preferential degradation of the guanine moiety . The outstanding lability of the guanine moiety observed in each case is discussed in connection with the inactivation of tRNA and TMV-RNA.

Biochemistry, 1981 Oct 27, 20(22), 6384 - 91
Thermodynamics, kinetics, and mechanism in yeast inorganic pyrophosphatase catalysis of inorganic pyrophosphate: inorganic phosphate equilibration; Springs B et al.; We have developed two methods for quantitatively measuring inorganic pyrophosphate (PPi) in the presence of 10(3)--10(4) molar excesses of inorganic phosphate (Pi) and used them to measure the extent of enzyme-bound pyrophosphate (EPPi) formation in solutions of yeast inorganic pyrophosphatase and Pi . We have also measured the rate of enzyme-catalyzed H2O--phosphate oxygen exchange . We find both processes to have essentially identical dependence on Mg2+ and Pi concentrations, thus providing important confirmation for the recent proposal by Janson et al . (1979) that oxygen exchange proceeds via EPPi formation . Our results are consistent with a model in which three Mg2+ per active site are required for EPPi formation but inconsistent with a model requiring only two Mg2+ per active site and permit the formulation of an overall scheme for inorganic pyrophosphatase catalysis of PPi--Pi equilibration as well as the evaluation of equilibrium and rate constants in this scheme . The major results and conclusions of our work are the following: (a) the equilibrium constant for PPi (enzyme-bound) in equilibrium with 2Pi (enzyme-bound) is 4.8; (b) following PPi hydrolysis, the first released Pi contains an oxygen from solvent water; (c) the steps for PPi hydrolysis on the enzyme and for release of both product Pi's are all partially rate determining in overall enzyme-catalyzed PPi hydrolysis; (d) PPi formation on the enzyme is rate determining for H2O--Pi oxygen exchange; (e) PPi dissociation from the enzyme is very slow and is the rate-determining step in Pi--PPi exchange (Cohn, 1958; Janson et al., 1979) . This also accounts for the observation that the calculated dissociation constant for MgPPi complex binding to enzyme is considerably lower than the measured Km for enzyme-catalyzed MgPPi hydrolysis.

Biochemistry, 1981 Oct 13, 20(21), 6051 - 60
Divalent metal ion, inorganic phosphate, and inorganic phosphate analogue binding to yeast inorganic pyrophosphatase; Cooperman BS et al.; Four different techniques, equilibrium dialysis, protection of enzymatic activity against chemical inactivation, 31P relaxation rats, and water proton relaxation rates, are used to study divalent metal ion, inorganic phosphate, and inorganic phosphate analogue binding to yeast inorganic pyrophosphatase, EC 3.6.1.1 . A major new finding is that the binding of a third divalent metal ion per subunit, which has elsewhere been implicated as being necessary for enzymatic activity {Springs, B., Welsh, K . M., & Cooperman, B . S . (1981) Biochemistry (in press)}, only becomes evident in the presence of added inorganic phosphate and that, reciprocally, inorganic phosphate binding to both its high- and low-affinity sites on the enzyme is markedly enhanced in the presence of divalent metal ions, with Mn2+ causing an especially large increase in affinity . The results obtained allow evaluation of all of the relevant equilibrium constants for the binding of Mn2+ and inorganic phosphate or of Co2+ and inorganic phosphate to the enzyme and show that the high-affinity site has greater specificity for inorganic phosphate than the low-affinity site . In addition, they provide . The results obtained allow evaluation of all of the relevant equilibrium constants for the binding of Mn2+ and inorganic phosphate or of Co2+ and inorganic phosphate to the enzyme and show that the high-affinity site has greater specificity for inorganic phosphate than the low-affinity site . In addition, they provide . The results obtained allow evaluation of all of the relevant equilibrium constants for the binding of Mn2+ and inorganic phosphate or of Co2+ and inorganic phosphate to the enzyme and show that the high-affinity site has greater specificity for inorganic phosphate than the low-affinity site . In addition, they provide evidence against divalent metal ion inner sphere binding to phosphate for enzyme subunits having one or two divalent metal ions bound per subunit and evidence for a conformational change restricting active-site accessibility to solvent on the binding of a third divalent metal ion per subunit.

Biochim Biophys Acta, 1981 Oct 12, 677(2), 200 - 4
Effect of unsaturated fatty acids on the biosynthesis of glucose-repressed enzymes in yeast; Boll M et al.; In anaerobically glucose-grown yeast isocitrate lyase (EC 4.1.3.1.), and malate dehydrogenase (EC 1.1.1.37.) are repressed by glucose . 24 h cultures still contain 0.3--0.4% glucose in the medium, which is enough to completely repress these activities . Aeration of these cells, in buffer containing acetate, initiates the formation of the three enzymes . Within 16 h, the specific activities of these enzymes increase about 140, 120 and 70-fold, respectively . Glucose-6-phosphate dehydrogenase activity was not altered . When the yeast was grown anaerobically, but with a supplement of an unsaturated fatty acid in the medium, synthesis of the three enzymes was much faster and the specific activities after 16 h of derepression were considerably higher . A relationship exists between the number of double bonds in the unsaturated fatty acid molecule and its capability to stimulate enzyme synthesis: linolenic acid is more effective than linoleic acid, which, in turn, is much more effective than oleic acid . Increasing periods of aeration with glucose of anaerobically grown cells prior to derepression results in an increasing stimulation of enzyme synthesis on subsequent derepression . Anaerobic incubation of yeast in the presence of an unsaturated fatty acid in advance to derepression also increased the velocity of enzyme formation . It is suggested that during the aeration period with glucose and during anaerobic incubation with an unsaturated fatty acid a more active protein synthesizing apparatus was formed.

Nucleic Acids Res, 1981 Oct 10, 9(19), 4847 - 62
The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon . Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript; Veldman GM et al.; We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene . We mapped the pertinent processing sites, viz . the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA . At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast . At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene . These findings further support the suggestion put forward earlier (G.M . Veldman et al . (1980) Nucl . Acids Res . 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s) . We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence . We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA . We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA.

Nucleic Acids Res, 1981 Oct 10, 9(19), 5049 - 59
Yeast deRNA viral transcriptase pause products: identification of the transcript strand; Brennan VE et al.; ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae . The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L) . We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made . One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.

J Biol Chem, 1981 Oct 10, 256(19), 9774 - 7
A mutation in the tRNAAsp gene from yeast mitochondria . Effects on RNA and protein synthesis; Miller DL et al.; We have characterized a mutation that affects the tRNAAsp coded by yeast mitochondrial DNA . Comparison of the DNA sequences of the tRNAAsp gene from a wild type strain and the mutant demonstrates that the mutant differs by a C to U base change in position 72 of the tRNA . This mutation abolishes mitochondrial protein synthesis, presumably because the tRNAAsp made from this gene cannot be charged with aspartic acid (FAye, G., Bolotin-Fukuhara, M., and Fukuhara, H . (1976) in The Genetics and Biogenesis of Chloroplasts and Mitochondria (Bucher, C . T., Neupert, W., Sebalt, W., and Werner, S., eds) pp . 547-555, North Holland Publishing Co., Amsterdam) . It also reduces the amount of tRNAAsp transcripts in the mutant as compared to the wild type.

Infect Immun, 1981 Oct, 34(1), 6 - 10
Interactions between Histoplasma capsulatum and macrophages from normal and treated mice: comparison of the mycelial and yeast phases in alveolar and peritoneal macrophages; Kimberlin CL et al.; Interactions between macrophages (alveolar and peritoneal) from normal, vaccinated (with heat-killed yeast cells), and Mycobacterium bovis BCG-treated mice and the mycelial and yeast phases of Histoplasma capsulatum were observed . Phagocytosis of microconidia, small hyphal fragments, and yeast cells occurred 4 to 6 h after the infection of macrophage cultures . Conversion to the yeast phase began at 6 to 7 h and was complete after a 72-h incubation at 37 degrees C . Macrophages surrounded and adhered to macroconidia and large hyphal elements . More macrophages (65 to 68%) from BCG-treated mice contained fungi at 24 h than did macrophages from normal or vaccinated mice . Although there was no increase in the number of fungi in macrophages from vaccinated mice, only the macrophages from BCG-treated mice contained fewer fungi after 48 h of infection with the mycelial phase of H . capsulatum . Fungal growth was not inhibited in any of the macrophage cultures when infected with the yeast phase . The macrophages infected with yeast cells were destroyed after 48 to 72 h in the culture . Only BCG-treated macrophages survived infection with the mycelial phase, whereas macrophages from normal and vaccinated mice were destroyed by the infection.

Biochem J, 1981 Oct 1, 199(1), 227 - 33
The stereochemical course of yeast hexokinase-catalysed phosphoryl transfer by using adenosine 5'{gamma(S)-16O,17O,18O}triphosphate as substrate; Lowe G et al.; Adenosine 5'{gamma(S)-16O, 17O, 18O}triphosphate has been synthesized and used to determine the stereochemical course of phosphoryl transfer catalysed by yeast hexokinase . The chirality at phosphorus of the D-glucose 6-{16O,17O,18O}phosphate formed was analysed, after cyclization and methylation, by 31P n.m.r . spectroscopy . The phosphoryl transfer was found to occur with inversion of configuration, with a stereoselectivity in excess of 94% . The simplest interpretation of this result is that the phosphoryl group is transferred between substrates in the enzyme-substrate ternary complex by an 'in line' mechanism.

Arch Tierernahr, 1981 Oct, 31(10), 667 - 73
{Protein quality of dietary yeast ribonucleic acid in experiments using growing rats . 1 . Effect of ribonucleic acid on the body composition}; Greife HA et al.; In a feeding trial with growing rats the influence of dietary ribonucleic acid on the composition of body gain was investigated . To a control ration with casein + 50% DL-methionine as the sole protein source (1,64 N% in DM) ribonucleic acid (RNA) from yeast was supplemented at four levels ranging from 7,8% to 31,2% of diets nitrogen . The portion of daily feed and nitrogen intake derived from the basal diet was designed to be equal for all the animals . RNA was ingested in addition . Gain of body fresh and dry matter slightly increased with the dietary RNA-level, due to an increased deposition of body fat . Protein efficiency ratio as well as productive protein value decreased linearly with increasing N-intake . It may be concluded that RNA-N has slightly contributed to body mass gain but was not utilised for protein deposition.

Photochem Photobiol, 1981 Oct, 34(4), 521 - 4
Photodynamic action of hematoporphyrin on yeast cells--a kinetic approach; Ito T; By a technique which combines rapid mixing of cells and hematoporphyrin (HP) with a short duration of illumination, the photodynamic inactivation of yeast cells was investigated, particularly, in seeking for the information of the location of HP at the time of action . The fluence-survival curves obtained under the conditions where the reaction mixture was kept in the dark for 1 s, 60 s and even 35 min before illumination were indistinguishable from each other, indicating no interaction between cells and sensitizers took place in about 30 min in such a way that the photodynamic efficiency could be modified . It is unlikely tha HP acted intracellularly, since the protective effect of N-3 was observed at concentrations as low as 0.5 mM . Furthermore, the rate constant kp related to the protective effect of N-3 was estimated to be 1 x 10(8) M(-1)s(-1) under the assumption that (1) O2 was the active intermediate and had a lifetime of 12 microseconds under the present conditions . This value of kp is rather close to that of kq' the quenching rate constant of N-3 for (1)O2, of which the accepted value is 2 x 10(8) M(-1)s(-1) in the homogeneous aqueous system . This information, together with the absence of uptake of HP by cells and a well response of survival upon illumination to the D2O fraction of the reaction mixture, provide strong bases for the argument that direct interaction of HP with yeast cells is of minor importance in the photodynamic processes, and the photodynamic action is largely mediated by an intermediated ((1)O2) generated in bulk medium.

Eur J Biochem, 1981 Oct, 119(3), 625 - 32
Structure and reactivity relationship in glyceraldehyde-3-phosphate dehydrogenase . Dinitrophenylation of cysteine residues of yeast and rabbit muscle enzymes; Foucault G et al.; Dinitrophenylation of rabbit muscle and yeast glyceraldehyde-3-phosphate dehydrogenases modifies only SH groups . The rabbit muscle apoenzyme loses 75% of its original activity upon dinitrophenylation of two SH groups per tetramer whereas the yeast apoenzyme is totally inactivated under the same conditions . Dinitrophenylation of the active-site cysteine-149 of rabbit muscle and yeast holoenzymes results in an loss of activity corresponding to a 'half-of-the-sites' and a 'full-sites' reactivity, respectively . Determination of the sulphydryl content of the modified enzymes shows an unmasking of the cysteine residues of the dinitrophenylated rabbit muscle apoenzyme which is not observed for the yeast protein . However, conformational changes are revealed for both dinitrophenylated apoenzymes by differential absorption spectroscopy or by limited proteolysis . Sulphydryl group unmasking is not observed after modification of the cysteine residues of the rabbit muscle holoenzyme but it does occur when dinitrophenylation is performed in the presence of two moles NAD+/mole rabbit muscle enzyme . Although the apoenzyme is sensitive to an induced conformational change, our results favour symmetrical structures for both yeast apo and holo enzymes . The bis-dinitrophenylated rabbit muscle apoenzyme presents all the characteristics of an asymmetrical structure; however, it is not possible to deduce whether this symmetry is due to the chemical modification or whether it preexists in the native apoenzyme . The results of the dinitrophenylation of the rabbit holoenzyme, however, indicate that this enzyme possesses an asymmetrical structure.

Chem Biol Interact, 1981 Oct, 37(1-2), 141 - 54
Comparative study on the effects of cyclophosphamide on yeast in vitro and in the host-mediated assay: DNA damage and biological response; Ogorek B et al.; Cyclophosphamide (CP), whether applied in its chemically activated form as 4-hydroperoxy-cyclophosphamide (4-OOH-CP) in vitro or in the host-mediated assay (HMA) using rats, exhibits toxic and mutagenic effects on excision deficient yeast cells . The expression of these effects is examined during a prolonged postincubation in buffer and compared with the ability of activated CP to induce interstrand cross-links and DNA fragmentation . At comparable doses, we observed a close similarity of biological and biochemical effects in either test system.

Proc Natl Acad Sci U S A, 1981 Oct, 78(10), 5963 - 7
Yeast tRNA3Leu gene transcribed and spliced in a HeLa cell extract; Standring DN et al.; A cloned yeast tRNA3Leu gene containing a 33-base intervening sequence (IVS) is selectively transcribed by a soluble extract from HeLa cells . The 130-nucleotide tRNA3Leu precursor RNA formed is colinear with the gene and contains approximately 4 leader nucleotides and up to 9 trailer nucleotides . The IVS is accurately and efficiently removed by an endogenous HeLa excision-ligase activity to yield the spliced tRNA, the free IVS, and the half-tRNA intermediates . The splicing reaction occurs without prior 5' and 3' maturation of the precursor but, with this exception, this pattern of synthesis and subsequent maturation of the tRNA3Leu precursor conforms to the scheme for tRNA biosynthesis deduced for the xenopus system . Indeed, the two systems utilize similar or identical tRNA3Leu precursors . Our results stress the extraordinary conservation of tRNA biosynthesis in eukaryotes and demonstrate that a HeLa extract provides a useful system for investigating this process.

J Biochem (Tokyo), 1981 Oct, 90(4), 1159 - 65
Amino acid sequence of an intrinsic inhibitor of mitochondrial ATPase from yeast; Matsubara H et al.; The amino acid sequence of an intrinsic inhibitor of mitochondrial ATPase isolated from yeast was completed by using solid-phase sequencing and conventional procedures . The inhibitor was found to be composed of 63 amino acid residues, to lack tryptophan, cysteine, and tyrosine, and to have a molecular weight of about 7,383 . The inhibitor was characterized as a basic protein with 16 basic and 13 acidic amino acid residues, and several clusters of basic residues were noted . Some comments are made on the hydrophobic amino acids and the presence of repeated sequences.

J Biochem (Tokyo), 1981 Oct, 90(4), 1141 - 50
Properties of binding sites for adenine nucleotides on ATPase from yeast mitochondria; Hashimoto T et al.; High pressure column chromatography was applied to estimate the bound nucleotides on F1-ATPase . In this way, various species of adenine nucleotide in 0.1 to 0.3 mg of enzyme protein were well separated and estimated with a precision of about 10 nmol within 10 min . ATPase in submitochondrial particles contained 2 mol of ATP and 1 to 2 mol of ADP . The nucleotide content and binding nature of the enzyme varied at different stages of purification, but a total of four binding sites were found in enzyme preparations at all steps . Highly purified enzyme had two tight binding sites for ATP and two loose binding sites, one for ATP and one for ADP . The tight binding of ADP observed in submitochondrial particles was reconstituted by continuous supply of ATP and Mg2+ to the purified enzyme . Removal and rebinding of the nucleotides did not affect ATP-hydrolyzing activity but caused conformational changes of the enzyme, as demonstrated by measuring cold-lability and trypsin digestion . An analog of ATP, AMPP(NH)P, was found to bind to loose binding sites of the purified enzyme with 2 mol of tightly bound ATP, and to inhibit ATP-hydrolyzing activity competitively . The analog also bound to the tight sites under special conditions, protecting the enzyme against cold inactivation . During enzymatic hydrolysis of {3H}ATP, labeled ATP and ADP were both bound at the loose sites, but only slight amounts of these nucleotides were bound to the tight sites . From these results it is inferred that the loose sites are catalytic, while the tight sites are not.

J Gen Microbiol, 1981 Oct, 126(Pt 2), 253 - 9
Simultaneous assay of dihydroxyacetone synthase and transketolase in a methylotrophic yeast grown in continuous culture . A cautionary note; Lindley ND et al.; The methylotrophic yeast Candida boidinii CBS 5777 was grown in continuous culture under carbon limitation on glucose, glucose plus methanol, and methanol as carbon and energy sources . During adaptation from glucose to methanol there was a rapid rise in the specific activities of triokinase, fructose-1,6-bisphosphatase and dihydroxyacetone synthase, which are key enzymes of the xylulose phosphate cycle of formaldehyde fixation . The specific activity of classical transketolase fell during this adaptation . Extracts from carbon-limited C . boidinii contained an enzyme which catalysed oxidation of NADH when some preparations or ribose 5-phosphate were added, which was not a transketolase . This enzyme activity was dependent on an impurity in such ribose 5-phosphate preparations and can be confused with transketolase activity.

Proc Natl Acad Sci U S A, 1981 Oct, 78(10), 6354 - 8
Yeast transformation: a model system for the study of recombination; Orr-Weaver TL et al.; DNA molecules that integrate into yeast chromosomes during yeast transformation do so by homologous recombination . We have studied the way in which circular and linear molecules recombine with homologous chromosomal sequences . We show that DNA ends are highly recombinogenic and interact directly with homologous sequences . Circular hybrid plasmids can integrate by a single reciprocal crossover, but only at a low frequency . Restriction enzyme digestion within a region homologous to yeast chromosomal DNA greatly enhances the efficiency of integration . Furthermore, if two restriction cuts are made within the same homologous sequence, thereby removing an internal segment of DNA, the resulting deleted-linear molecules are still able to transform at a high frequency . Surprisingly, the integration of these gapped-linear molecules results in replacement of the missing segment using chromosomal information . The final structure is identical to that obtained from integration of a circular molecule . The integration of linear and gapped-linear molecules, but not of circular molecules, is blocked by the rad52-1 mutation . Consideration of models for plasmid integration and gene conversion suggests that RAD52 may be involved in the DNA repair synthesis required for these processes . Implications of this work for the isolation of integrative transformants, fine-structure mapping, and the cloning of mutations are discussed.

Proc Natl Acad Sci U S A, 1981 Oct, 78(10), 6334 - 8
The cyc1-11 mutation in yeast reverts by recombination with a nonallelic gene: composite genes determining the iso-cytochromes c; Ernst JF et al.; DNA sequence analysis of a cloned fragment directly established that the cyc1-11 mutation of iso-1-cytochrome c in the yeast Saccharomyces cerevisiae is a two-base-pair substitution that changes the CCA proline codon at amino acid position 76 to a UAA nonsense codon . Analysis of 11 revertant proteins and one cloned revertant gene showed that reversion of the cyc1-11 mutation can occur in three ways: a single base-pair substitution, which produces a serine replacement at position 76; recombination with the nonallelic CYC7 gene of iso-2-cytochrome c, which causes replacement of a segment in the cyc1-11 gene by the corresponding segment of the CYC7 gene; and either a two-base-pair substitution or recombination with the CYC7 gene, which causes the formation of the normal iso-1-cytochrome c sequence . These results demonstrate the occurrence of low frequencies of recombination between nonallelic genes having extensive but not complete homology . The formation of composite genes that share sequences from nonallelic genes may be an evolutionary mechanism for producing protein diversities and for maintaining identical sequences at different loci.

Nucleic Acids Res, 1981 Sep 25, 9(18), 4475 - 83
Use of a synthetic DNA oligonucleotide to probe the precision of RNA splicing in a yeast mitochondrial petite mutant; Tabak HF et al.; In some strains of Saccharomyces cerevisiae the mitochondrial gene coding for 21S rRNA is interrupted by an intron of 1143 bp . This intron contains a reading frame for 235 amino acids: Unassigned Reading Frame (URF) . In order to check whether expression of this URF is required for proper splicing of precursors to 21S rRNA, the precision of RNA splicing was analysed in a petite mutant, where no mitochondrial protein synthesis is possible anymore . We have devised a new assay to monitor the precision of the splicing event . The method is of general application, provided that the sequence of the splice boundaries is known . In the case of the 21S rRNA it involves the synthesis of the DNA oligonucleotide d(CGATCCCTATTGTC( complementary to the 5' d(CGATCCCTAT) and 3' d(TGTC) borders flanking the intron in the 21S rRNA gene . The oligonucleotide is labelled with 32p at the 5'-end, hybridised to RNA and subsequently subjected to digestion with S1 nuclease . Resistance to digestion will only be observed if the correct splice-junction is made . The petite mutant we have studied contains a 21S rRNA with the same migration behaviour as wildtype 21S rRNA . In RNA blotting experiments, using an intron specific hybridisation probe, the same intermediates in splicing are found both in wild type and petite mutant . Finally the synthetic oligonucleotide hybridises to petite 21S rRNA and its thermal dissociation behaviour is indistinguishable from a hybrid formed with wildtype 21S rRNA . We conclude that expression of the URF, present in the intron of the 21S rRNA gene, is not required for processing and correct splicing of 21S ribosomal precursor RNA.

Biochim Biophys Acta, 1981 Sep 24, 665(3), 596 - 601
Evidence for the presence of cytochrome P-450 functional in lanosterol 14 alpha-demethylation in microsomes of aerobically grown respiring yeast; Aoyama Y et al.; Recent studies have shown that a cytochrome P-450 present in microsomes of semi-anaerobically grown cells of Saccharomyces cerevisiae is functional in the 14 alpha-demethylation of lanosterol (4,4,14 alpha-trimethyl-5 alpha-cholesta-8,24-dien-3 beta-ol), but the occurrence of the same cytochrome P-450 in microsomes of aerobically grown yeast cells has not yet been reported . In this study, the microsomal fraction from aerobically grown cells was found to catalyze the lanosterol demethylation in the presence of NADPH and O2 and that this activity was sensitive to CO . In Ouchterlony double diffusion test, antibodies to the yeast cytochrome P-450 formed a single precipitin line with the microsomal fraction as well as with the purified yeast cytochrome P-450 and the two precipitin lines fused with each other . Furthermore, the antibodies inhibited the lanosterol demethylation activity of the microsomal fraction from aerobically grown cells . The quadratic-derivative absorption spectrum of the microsomal fraction measured in the presence of both Na2S2O4 and CO showed an absorption band at 450 nm which is attributable to the reduced CO compound of cytochrome P-450 . These facts led to the conclusion that cytochrome P-450 actually exists in aerobically grown yeast and participates in the lanosterol 14 alpha-demethylation which is essential for the ergosterol (5 alpha-ergosta-5,7,22-trien-3 beta-ol) biogenesis by yeast.

Biochemistry, 1981 Sep 15, 20(19), 5373 - 80
Synthesis and assembly of adenosinetriphosphatase in synchronous cultures of yeast; Somasundaram T et al.; Maximal respiration and expression of mitochondrial enzymes are found at the late-S phase of yeast cells growing synchronously in glucose medium . Adenosinetriphosphatase (ATPase) activity follows a similar pattern . However, the cytosolically synthesized F1-ATPase and also that released from the membrane accumulate in the cytosol during the G1 and early-S phases . After the mid-S phase, when the mitochondrially synthesized membrane factors are available, the enzyme migrates to the membrane and is integrated.

Biochemistry, 1981 Sep 15, 20(19), 5369 - 73
Synthesis and assembly of cytochrome c oxidase in synchronous cultures of yeast; Somasundaram T et al.; Yeast cells growing synchronously in glucose medium accumulate in the cytosol, the cytosolically made subunits of cytochrome oxidase, during the G1 and early-S phases . The mitochondrially made subunits, on the other hand, are detected only after the mid-S phase . The cytosolically synthesized subunits are integrated into the membrane after the mid-S phase.

J Biol Chem, 1981 Sep 10, 256(17), 9037 - 43
Localization of unassembled subunits of the mitochondrial ATPase in an assembly-defective yeast nuclear mutant; Todd RD et al.; The yeast nuclear mutant, pet 936, has previously been shown to be defective in the assembly of a functional mitochondrial ATPase (Todd, R . D., McAda, P . C., and Douglas, M . G . (1979) J . Biol . Chem . 254, 11134-11141) . In the present report, trypsin degradation and subunit-specific antibody binding have been used to localize subunits 1, 2, and 3 external to or associated with the outer aspect of the inner mitochondrial membrane in the mutant strain . A similar population of unassembled subunits was found in the parental strain as well . Isotope dilution experiments are compatible with those unassembled subunits being normal intermediates in the assembly pathway of the ATPase complex which are blocked from transport across the inner mitochondrial membrane in the mutant, pet 936.

J Biol Chem, 1981 Sep 10, 256(17), 9363 - 70
Further analysis of the polypeptide subunits of yeast cytochrome c oxidase . Isolation and characterization of subunits III, V, and VII; George-Nascimento C et al.; By using a modified purification procedure in which we have substituted detergent exchange gel filtration for DEAE-cellulose or hydroxylapatite chromatography (Mason, T . L., Poyton, R . O., Wharton, D . C., and Schatz, G . (1973) J . Biol . Chem . 248, 1346-1354), we have isolated yeast cytochrome c oxidase preparations which are low in contaminating polypeptides and which have been successfully used for the large scale purification of subunits . Subunits have been purified from this preparation by a simple two-step procedure which involves: 1) the release of subunits IV and VI from an "insoluble" core composed of subunits I, II, III, V, and VII; and 2) gel filtration of the "core" subunits in the presence of sodium dodecyl sulfate . Molecular weights of the isolated subunits, obtained from sodium dodecyl sulfate gel retardation coefficients (KR) derived from Ferguson plots, were: I, 54,000; II, 31,000; III, 29,500; IV, 14,500; V, 12,500; VI, 9,500; VII, 4,500 . In their purified state all subunits, except for subunit V, exhibited electrophoretic behavior similar to that exhibited by unpurified subunits in sodium dodecyl sulfate-dissociated holoenzyme preparations . As purified, subunit V exhibits a slightly smaller apparent molecular weight than its counterpart in the holoenzyme . Amino acid analysis of the isolated subunits revealed that subunit III, a mitochondrial translation product, contained 41.9% polar amino acids, whereas subunits V and VII, cytoplasmic translation products, each contained 47.7% polar amino acids . These results extend and support our previous finding that the mitochondrially translated subunits of yeast cytochrome c oxidase are more hydrophobic than the cytoplasmically translated subunits.

Mikrobiologiia, 1981 Sep-Oct, 50(5), 852 - 6
{Effect of the cultivation temperature on the growth and chemical composition of the methanol-assimilating yeast Candida boidinii}; Podgorskii VS; The yeast Candida boidinii T2A was cultivated in a medium containing methanol or glucose as a sole carbon and energy source, and the effect of the cultivation temperature on the specific growth rate, the economic coefficient and the chemical composition of the yeast was studied in a continuous chemostat process . The specific rates of the yeast growth increase with the cultivation temperature up to optimal limits and then lower down abruptly in the supraoptimal zone . The maximal specific rate of the yeast growth in a medium with methanol at 30 degrees C is 0.24 h-1, while in a medium with glucose a 32 degrees C, it equals 0.38 h-1 . In the suboptimal zone, the economic coefficient of the yeast growing in a medium with methanol at a dilution rate above 0.06 h-1 remains, for all practical purposes, at the same level (38-41%), while supraoptimal temperatures decrease the economic coefficient of the yeast . The results show a change in the content of protein and RNA as a function of the cultivation temperature and the dilution rate . It is concluded that the macromolecular composition of the yeast biomass is determined not only be the dilution rate, but also depends of temperature which regulates the rate of the yeast growth.

Mikrobiologiia, 1981 Sep-Oct, 50(5), 781 - 7
{Alternative carbon metabolic pathways and their regulation in the methylotrophic yeast Candida methylica}; Bykovskaia SV et al.; The activities of indicative enzymes involved in the dihydroxyacetone, glycolytic and pentose phosphate pathways, the citric acid cycle and the glyoxylate shunt were studied comparatively in the yeast Candida methylica growing in media with methanol, glucose and ethanol . Differences in the enzyme levels indicate that the pathways of substrate metabolism in methylotrophic yeast cells are regulated in an alternative and complicated manner . The nature of a carbon source, its concentration in the medium and the general direction of metabolic processes which, in turn, depend on the growth phase of the methylotrophic yeast are important regulatory factors of enzyme synthesis and activity.

Can J Microbiol, 1981 Sep, 27(9), 967 - 70
Endotrophic sporulation by the yeast Nadsonia fulvescens; Novak GE; Studies of carbon requirements for sporulation by Nadsonia fulvescens showed an unexpected appearance of spores in the absence of an exogenous carbon source, when the cells were grown on ethanol prior to induction of sporulation, Dextrose-grown cells taken from either the logarithmic or stationary phase required a carbon source (dextrose, ethanol, or glycerol) for sporulation . An inhibitory effect by acetate upon sporulation was demonstrated, and it appears to be due to a repression mechanism.

Mikrobiologiia, 1981 Sep-Oct, 50(5), 878 - 84
{Yeast growth under alternating temperature conditions and the possibility of originating thermotolerant forms}; Pozmogova IN et al.; The chemostat culture of Candida utilis was grown under the conditions of varying temperatures: one generation grew at an optimal temperature of 31 degrees C, the second at supraoptimal temperatures: either 35, 36 or 37 degrees C; these were alternated during 6-8 generations . Changes in the growth yield were studied as well as changes in the content of protein, RNA and DNA in cells and changes in the zeta-potential of cells at a growth rate of 0.34 hr-1 . At this rate, the population became "synchronous-like" and contained up to 60% of simultaneously budding cells . When the temperature of cultivation was periodically changed, the content of RNA and DNA in the biomass fluctuated at a decreasing amplitude around values found during the growth at the optimal temperature; the electro-kinetic characteristics of cells were also in the attenuated oscillating state approaching the norm . The authors discuss how the population retains the value of growth yield constant when it is grown under the conditions of varying temperatures and what is the origin of thermotolerant forms.

Biochem J, 1981 Sep 1, 197(3), 683 - 8
Affinity chromatography of yeast alpha-glucosidase using ligand-mediated chromatography on immobilized phenylboronic acids; Myohanen TA et al.; The synthesis of 3-nitro-4-(6-aminohexylamido)phenylboronic acid is described . The properties of two novel forms of immobilized phenylboronate agarose adsorbents {m-aminophenylboronic acid-Matrex Gel and 3-nitro-4-(6-aminohexylamido)phenylboronic acid-Sepharose CL-6B} were investigated . Both gels bind and selectively retard the glycoprotein alpha-glucosidase from yeast . The retardation is affected by following parameters: (i) pH, (ii) presence of sugar, (iii) concentration of sugar and (iv) buffer species (especially triethanolamine) . Five sugars were studied, namely sorbitol, fructose, ribose, glucose and maltose . The concentration of sugar required to produce significant retardation increased in the above order, whereas the ability of sugar to form a complex with boron decreases in the same order . These effects were observed with crude as well as pure enzyme . Since alpha-glucosidase is a glycoprotein, it is proposed that this protein is mainly bound to these immobilized phenylboronates via sugar (glyco) residues . Displacement of the enzyme from the column is effected by the sugar in the buffer (or in a preincubation mixture) . However, the marked pH-dependence (this retardation effect could only be observed at pH 7.4) suggests that these results are not due solely to hydrophobic or ionic mechanisms and are more complex than simple sugar-phenylboronic acid interactions.

Int J Radiat Biol Relat Stud Phys Chem Med, 1981 Sep, 40(3), 235 - 43
Comparison of sensitivity of rad mutants of diploid yeast to heat and gamma radiation: cellular target for heat inactivation; Reddy NM et al.; Wild type and radiation-sensitive mutants rad 53, 54 and 55 of the diploid yeast Saccharomyces cerevisiae, in stationary and log phase were exposed to gamma radiation and hyperthermia (51 degrees C) in order to compare their sensitivity to these agents . The wild type diploid strain exposed to gamma rays showed a sigmoidal survival curve both in stationary and log phase cultures . Log phase cells were significantly more resistant than stationary phase cells . When compared to wild type, the gamma radiation response of the mutants indicated that the mutations in these RAD loci render the cells sensitive in stationary phase and very sensitive in log phase . The response of mutants to hyperthermia was similar to that of wild type cells in both the phases . The log phase cells of both wild type and mutants wee gamma radiation response of the mutants indicated that the mutations in these RAD loci render the cells sensitive in stationary phase and very sensitive in log phase . The response of mutants to hyperthermia was similar to that of wild type cells in both the phases . The log phase cells of both wild type and mutants wee gamma radiation response of the mutants indicated that the mutations in these RAD loci render the cells sensitive in stationary phase and very sensitive in log phase . The response of mutants to hyperthermia was similar to that of wild type cells in both the phases . The log phase cells of both wild type and mutants were more sensitive to heat than stationary phase cells . These results suggest that the RAD loci are not involved in the repair of hyperthermic damage . Since it is known that the products of the RAD genes are involved in the repair of DNA damage, the wild type response of these rad mutants to hyperthermia indicates that the DNA may not be the principal target for hyperthermic killing . Furthermore, the enhanced thermal sensitivity of log phase cells, containing higher amounts of active enzymes and sensitive membrane, strongly suggests that proteins and/or membranes could be the primary targets for thermal inactivation.

Geburtshilfe Frauenheilkd, 1981 Sep, 41(9), 630 - 4
{New results in connection with the problem of a connection between oral contraception and vaginal yeast}; Gottlicher S et al.; PIP: During the years 1979-80, 8314 patients in a gynecologic practice were examined without any selection for vaginal yeast and trichomonas infection . The amount of yeast in all patients was 26.4% (1979: 29.5%; 1980: 23.5%) . Trichomonas infection was found in 1.52% (1979: 2.18; 1980: 0.91%) . An annual diagram was prepared from the individual monthly percentages, and it shows an increase in vaginal yeast in both summers (summer peak) and a decrease in the winter . The 2 diagrams differ slightly . Causes are discussed . The highest amounts of vaginal yeast were found in pregnant women: 35.5% (1979: 46.8% and 1980: 28.4%) . In patients using oral contraceptives (OCs), we found yeast in 28.8% as compared with women of the same age not using OCs (20.3%) . There is no direct relationship between the duration of use of OCs and the amount of vaginal yeast as was expected from previous research . On the contrary, the highest amount of vaginal yeast was found in the group of patients who had been using OCs for up to 2 years (32.4%) . In the group taking OCs for more than 6 years, we found the lowest amount (21.6%) . The groups using OCs for up to 4 years and up to 6 years showed results falling between the 2 (26% and 29%) . In the postmenopausal patients, we found yeast in 15.6% . Possible causes and connections are discussed . All results were examined for statistical significance . A general increase in yeast infections during the years 1979-80 could not be ascertained by the authors . (author's)

Biochim Biophys Acta, 1981 Aug 27, 655(1), 89 - 95
Conformational changes of yeast tRNAPhe upon interaction with intercalators probed by nuclease digestion; Nielsen PE; The conformational changes of yeast-tRNAPhe induced by various intercalators have been studied using limited digestions with nucleases S1 and T1 . The results show an increased sensitivity to T1 in the D-loop, suggesting a weakening of the D-loop-T-loop interaction . Furthermore, the results are best explained by a non-intercalative binding of the eyes, probably in the D-loop-T-loop cavity.

Nucleic Acids Res, 1981 Aug 25, 9(16), 4007 - 21
Sequences at the 3' ends of yeast viral dsRNAs: proposed transcriptase and replicase initiation sites; Brennan VE et al.; ScV is a double-stranded RNA virus of yeast consisting of two separately encapsidated dsRNAs (L and M) . ScV-1 and ScV-2 are two dsRNA viruses present in two different yeast killer strains, K1 and K2 . Our 3' end sequence analysis shows that the two sets of viral dsRNAs from ScV-1 and ScV-2 are very similar . Consensus sequences for transcriptase and replicase initiation are proposed . A stem and loop structure with a 3' terminal AUGC sequence, like that of several plant virus plus strand RNAs, is present at the putative replicase initiation site of one of the yeast viral RNA plus strands.

J Biol Chem, 1981 Aug 25, 256(16), 8646 - 51
Formation of a cytochrome c-like species from horse apoprotein and hemin catalyzed by yeast mitochondrial cytochrome c synthetase; Veloso D et al.; Cytochrome c synthetase in yeast mitochondria catalyzes the formation of a yeast cytochrome c-like species from the apoprotein and hemin (Basile, G., DiBello, C., and Taniuchi, H . (1980) J . Biol . Chem . 255, 7181-7191) . To test the specificity of this enzyme, 125I-labeled horse apocytochrome c was incubated with the yeast mitochondrial fraction in the presence of hemin, NADPH, and an ethanol extract of the postmitochondrial fraction . A radioactive 125I-labeled cytochrome c-like species was formed in yields of up to 26% . This 125I-labeled species is indistinguishable from horse cytochrome c by ion exchange chromatography (under the conditions which allow separation of horse and yeast cytochrome c), resistance in its reduced form to digestion by trypsin, resistance against autoxidation, reduction by cytochrome b2, and generation of the apoprotein after treatment with silver sulfate and dithiothreitol . With unlabeled horse apoprotein and {59Fe}hemin, the yield of a {59Fe-labeled horse cytochrome c-like species was up to 7% with respect to the apoprotein incubated . The yield of the 59Fe-labeled species was not altered by the addition of unlabeled FeCl3 . Conversely, synthesis of the 59Fe-labeled species was not detectable after incubation of yeast mitochondria with unlabeled horse apoprotein, unlabeled hemin, and 59FeCl3 . The formation of both 125I- and 59Fe-labeled cytochrome c-like species was sensitive to heat . Thus, we conclude that cytochrome c synthetase catalyzes direct bonding of heme (or hemin) to the apoprotein . Since the amino acid sequences of horse and yeast cytochromes c differ considerably, cytochrome c synthetase may recognize only a limited region(s) of the apoprotein.

Biochim Biophys Acta, 1981 Aug 13, 660(2), 199 - 203
In vitro and in situ studies on the inhibition of yeast AMP deaminase by fatty acids; Yoshino M et al.; The effect of various fatty acids on the purified and in situ AMP deaminase (AMP aminohydrolase, EC 3.5.4.6) was investigated: both the purified AMP deaminase and the permeabilized system of yeast cells were used as the enzyme sources . (1) All the saturated fatty acids, longer than 10 in the hydrocarbon chain, were inhibitors of the purified enzyme in the absence of ATP, whereas no or little inhibition of the enzyme was observed in the presence of ATP . Unsaturated fatty acids acted as more potent inhibitors of the purified enzyme, although the addition of ATP increased the I0.5 values for these fatty acids . Fatty acids acted as non-competitive inhibitors without alteration of the affinity for the substrate in the absence and presence of ATP . (2) Unsaturated fatty acids showed a powerful inhibition of the in situ AMP deaminase, and the presence of ATP could scarcely affect the inhibition of the in situ enzyme by these fatty acids . On the other hand, no or little inhibition of the in situ enzyme by saturated fatty acids was observed in the absence and presence of ATP . The difference in the kinetics properties between the in situ and the purified enzyme suggests that there is difference in protein interactions for AMP deaminase in situ and in vitro.

Biochim Biophys Acta, 1981 Aug 12, 637(1), 124 - 9
Electrogenic proton ejection coupled to electron transport through the energy-conserving site 2 and K+/H+ exchange in yeast mitochondria; Villalobo A et al.; The proton ejection coupled to electron flow from succinate and/or endogenous substrate(s) to cytochrome c using the impermeable electron acceptor ferricyanide is studied in tightly coupled mitochondria isolated from two strains of the yeast Saccharomyces cerevisiae . (1) The observed H+ ejection/2e- ratio approaches an average value of 3 when K+ (in the presence of valinomycin) is used as charge-compensating cation . (2) In the presence of the proton-conducting agent carbonyl cyanide m-chlorophenylhydrazone, an H+ ejection/2e- ratio of 2 is observed . (3) The low stoichiometry of 3H+ ejected (instead of 4) per 2e- and the high rate of H+ back-decay (0.1615 ln delta (ngatom)H+/s and a half-time of 4.6 s for 10 mg protein) into the mitochondrial matrix are related to the presence of an electroneutral K+/H+ antiporter which is demonstrated by passive swelling experiments in isotonic potassium acetate medium.

Biochim Biophys Acta, 1981 Aug 5, 676(1), 77 - 90
Subcellular distribution of enzymes in the yeast saccharomycopsis lipolytica, grown on n-hexadecane, with special reference to the omega-hydroxylase; Delaisse JM et al.; The subcellular localization of the omega-hydroxylase of Saccharomycopsis lipolytica was assessed by the analytical fractionation technique, originally described by de Duve C., Pressman, B.C., Gianetto, R., Wattiaux, R . and Appelmans, F., and hitherto little, if at all, applied to yeasts . Protoplasts were separated in six fractions by differential centrifugation . Some of these fractions were further fractionated by density gradient centrifugation . The distribution of omega-hydroxylase and 15 other constituents chosen as possible markers of its subcellular entities . (1) Mitochondria were characterized by particulate malate dehydrogenase, particulate Antimycin A-insensitive NADH-cytochrome c reductase, oligomycin-sensitive and K+-stimulated ATPase pH 9 . (2) Most if not all of the catalase and urate oxidase is peroxisomal . (3) Free ribosomes account for most RNA . (4) Nucleoside diphosphatase is for the first time reported in a yeast and appears to belong to an homogeneous population of small membranes . (5) The soluble compartment contains magnesium pyrophosphatase, alkaline, 5'-nucleotidase and part of the NADH-cytochrome c reductase . Latent arylesterase and ATPase pH 7 have an unspecific distribution . Alkaline phosphodiesterase I has not been detected.

Mol Cell Biol, 1981 Aug, 1(8), 673 - 9
Yeast L double-stranded ribonucleic acid is synthesized during the G1 phase but not the S phase of the cell cycle; Zakian VA et al.; The cytoplasm of Saccharomyces cerevisiae contains two major classes of protein-encapsulated double-stranded ribonucleic acids (dsRNA's), L and M . Replication of L and M dsRNA's was examined in cells arrested in the G1 phase by either alpha-factor, a yeast mating pheromone, or the restrictive temperature for a cell cycle mutant (cdc7) . {3H}uracil was added during the arrest periods to cells prelabeled with {14C}uracil, and replication was monitored by determining the ratio of 3H/14C for purified dsRNA's . Like mitochondrial deoxyribonucleic acid, both L and M dsRNA's were synthesized in the G1 arrested cells . The replication of L dsRNA was also examined during the S phase, using cells synchronized in two different ways . Cells containing the cdc7 mutation, treated sequentially with alpha-factor and then the restrictive temperature, enter a synchronous S phase when transferred to permissive temperature . When cells entered the S phase, synthesis of L dsRNA ceased, and little or no synthesis was detected throughout the S phase . Synthesis of L dsRNA was also observed in G1 phase cells isolated from asynchronous cultures by velocity centrifugation . Again, synthesis ceased when cells entered the S phase . These results indicate that L dsRNA replication is under cell cycle control . The control differs from that of mitochondrial deoxyribonucleic acid, which replicates in all phases of the cell cycle, and from that of 2-micron DNA, a multiple-copy plasmid whose replication is confined to the S phase.

Tohoku J Exp Med, 1981 Aug, 134(4), 401 - 9
Prophylaxis of 3-methylcholanthrene-induced tumorigenesis in mice with the yeast polysaccharide preparation; Kumano N et al.; Prophylaxis of 3-methylcholanthrene-induced epithelial tumor formation in ddI mice with our Candida utilis glucomannan preparation (YPS) was confirmed further in the present system of fibrosarcoma production . A single subcutaneous dose of MCA (0.5 mg per mouse) was either preceded by or followed by 10 or 30 daily intraperitoneal (i.p.) injections of YPS at the dosage of 100 mg/kg per dose according to various time schedules . Protective effect of YPS was demonstrable by a significantly lengthened latent period before the tumor appearance and a slower rate of the subsequent tumor production until around day 100 . All the schedules of pre- or post-treatment were found to be effective, although the one delayed until two weeks post MCA was so only marginally . It was also disclosed by prolonging the observation period that this protection was of a transient nature, 100 per cent tumor incidence being found by around 150 days post MCA in all the experimental groups . A longer latency due to the treatment with YPS was generally found in association with a faster growth of the tumor and a shorter life span of the host animal . Temporary protection of MCA-induced tumorigenesis in ddI mice was not reproducible in C3H/He mice, and was thus suggested the possible strain-dependent nature of YPS effect.

J Gen Microbiol, 1981 Aug, 125(Pt 2), 415 - 20
Genetic and biochemical aspects of yeast sterol regulation involving 3-hydroxy-3-methylglutaryl coenzyme A reductase; Bard M et al.; Determinations of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMG-CoA reductase) activity in haploid strains and diploid hybrids of wild-type Saccharomyces cerevisiae revealed that a genetic basis exists for control of this key regulatory enzyme in which low enzyme activity is phenotypically dominant to high enzyme activity . These observations suggested the existence of an inhibitor of reductase activity or a suppressor of enzyme synthesis . Feeding studies using an early sterol intermediate (mevalonolactone) and end-product sterol (ergosterol) indicated that a secondary regulatory site in this pathway operates to decrease the activity of HMG-CoA reductase . This diminution of activity was paralleled by increases in the accumulation of squalene, suggesting that this intermediate (or another isoprenoid derivative) may also play a significant role in the in vivo regulation of sterol biosynthesis . Lastly, feedback inhibition of HMG-CoA reductase by ergosterol was demonstrated in a yeast mutant which is permeable to this sterol . These studies showed that yeast can serve as a eukaryotic model system for a combined biochemical and genetic investigation into the factors which control the activity of HMG-CoA reductase.

Eur J Cell Biol, 1981 Aug, 25(1), 58 - 65
Specific labeling of glycoproteins in yeast plasma membrane with concanavalin A; Maurer A et al.; The intramembranous particles of yeast Saccharomyces cereisiae plasma membrane form paracrystalline arrays or are randomly distributed as seen by freeze-fracture electron microscopy . Protoplasts with randomly distributed particles and with paracrystalline arrays were isolated and subsequently labeled with 3H-Con A, Con A and ferritin-Con A . The distribution of the Con A or the ferritin-Con A molecules on deep-etched exoplasmic surfaces strongly resembled the distribution of the intramembranous particles . The influence upon labeling of buffer ionic strength was investigated . Binding assays with 3H-Con A and freeze-etch electron microscopy demonstrated that the amount of non-specifically bound lectin molecules decreases by increasing buffer ionic strength . Only partial removal of Con A molecules was achieved by adding various concentrations of the specific sugar Methyl-alpha-D-Mannoside (alpha MM) to labeled protoplasts . By means of analytical ultracentrifugation it was found that alpha MM also promotes the formation of Con A dimers . fixed protoplasts were treated with detergents and 2-chloroethanol at various concentrations and subsequently labeled with 3H-Con A or ferritin-Con A . The amount of Con A bound to extracted cells did not decrease but ultrastructural changes of the deep-etched surfaces were observed . From our data it can be concluded that only the glycoproteins are labeled with Con A and they seem to be associated with the intramembranous particles {15} . Each intramembranous particle seems to bind 36 to 44 Con A molecules and therefore the glycoproteins seem to possess very long sugar chains . This further supports the hypothesis that the intramembranous particles are associated with the membrane-bound invertase.

Eur J Biochem, 1981 Aug, 118(2), 295 - 302
Amino-acid sequence of the cytochrome c from the yeast Hansenula anomala . Identification of three methylated positions; Becam AM et al.; The cytochrome c of the yeast Hansenula anomala has been purified and sequenced . A combination of automatic and manual sequencing methods was used on the whole protein and on fragments obtained by cyanogen bromide cleavage and proteolytic fragmentation . The cytochrome presents an amino-terminal extension of six residues and the C-terminal one-residue deletion typical of plant and fungal cytochrome c . Lysines 72 and 73 are trimethylated, lysine 55 partly monomethylated and partly dimethylated . Positions 73 and 55 have never been found methylated before.

Cell, 1981 Aug, 25(2), 517 - 24
A position-effect control for gene transposition: state of expression of yeast mating-type genes affects their ability to switch; Klar AJ et al.; Mating-type switches of the yeast Saccharomyces cerevisiae occur by unidirectional transposition of copies of unexpressed mating-type genetic information, residing at HML and HMR loci, into the expressed MAT locus . The HML and HMR loci remain unchanged . In contrast, in appropriate strains where the silent loci are also allowed to express, for example in mar mutants, efficient switches of HML and HMR are shown to occur at rates equivalent to those observed for MAT . Thus the position-effect control on the direction of transposition is affected by the state of expression of the locus under study the expressed loci switch regardless of their location.

Cell, 1981 Aug, 25(2), 409 - 19
An extensive deletion causing overproduction of yeast iso-2-cytochrome c; McKnight GL et al.; CYC7-H3 is a cis-dominant regulatory mutation that causes a 20-fold overproduction of yeast iso-2-cytochrome c . The CYC7-H3 mutation is an approximately 5 kb deletion with one breakpoint located in the 5' noncoding region of the CYC7 gene, approximately 200 base from the ATG initiation codon . The deletion apparently fuses a new regulatory region to the structural portion of the CYC7 locus . The CYC7-H3 deletion encompasses the RAD23 locus, which controls UV sensitivity and the ANP1 locus, which controls osmotic sensitivity . The gene cluster CYC7-RAD23-ANP1 displays striking similarity to the gene cluster CYC1-OSM1-RAD7, which controls, respectively, iso-1-cytochrome c, osmotic sensitivity and UV sensitivity . We suggest that these gene clusters are related by an ancient transpositional event.

Eur J Biochem, 1981 Aug, 118(2), 247 - 54
DNA synthesis catalyzed in vitro by yeast extracts; Badaracco G et al.; A procedure to prepare crude extracts from single colonies of Saccharomyces cerevisiae is described . Partially purified extracts catalyzed DNA synthesis directed by single-stranded fd DNA . Maximum activity requires the presence of ribonucleoside triphosphates although extensive DNA synthesis is observed in the presence of only deoxynucleoside triphosphates . Alkaline sucrose gradient analysis demonstrated that initiation of new DNA chains occurs in vitro and the DNA products synthesized are heterogeneous in size, Isopycnic analysis of the products of ribonucleotide-initiated fd DNA replication showed covalent linkage between the initiator RNA and the newly synthesized DNA . The fd-replicating capacity of extracts prepared from cell-division-cycle mutants, defective in events controlling DNA initiation of elongation, showed an increased thermosensitivity in the DNA replication reaction in vitro.

J Biol Chem, 1981 Jul 25, 256(14), 7610 - 9
Pathways of transcript splicing in yeast mitochondria . Mutations in intervening sequences of the split gene COB reveal a requirement for intervening sequence-encoded products; Schmelzer C et al.; We have studied the transcript processing of the split gene COB (or BOX) in yeast mtDNA, in both wild type and cob- mutants . Using various DNA fragments specific for coding or intervening sequences of this gene, we have determined the composition of splicing intermediates by DNA/RNA hybridization . The pattern of splicing intermediates detected in wild type reveals differing rates of the five splicings resulting in an apparent pathway of processing rather than an absolute order among the five cut and splice events . Effects of mutations in four of the five sequences have been studied . All of them interfere with transcript processing . Some block the excision of the sequence mutated only, but allow other splicing events to occur essentially as in the wild type . They suggest that in these mutants any order of splicings is possible, but that some are preferred . In contrast, other mutations located in four different sequences block several splicings simultaneously and thus suggest the existence of an obligatory order of events . In order to reconcile these findings we discuss the following hypotheses . (i) Some intervening sequences in COB specify products which are involved in transcript splicing; (ii) the biosynthesis of trace amounts of these products occurs on splicing intermediates . Their formation requires a certain order of splicing events to occur on a small number of COB transcripts . (iii) If expressed and functional, the intervening sequence-encoded products, together with other components, act on the bulk of COB transcripts, resulting in the steady state pattern of splicing intermediates observed in wild type.

Science, 1981 Jul 24, 213(4506), 455 - 6
Nalidixic acid, oxolinic acid, and novobiocin inhibit yeast glycyl- and leucyl-transfer RNA synthetases; Wright HT et al.; Nalidixic acid and novobiocin inhibit the aminoacylation and pyrophosphate exchange activities of glycyl- and leucyl-transfer RNA synthetases from bakers' yeast . Similar types of inhibition are observed for both enzymes, suggesting similar mechanisms . The potency of these inhibitors is comparable to that observed for their inhibition of in vivo DNA synthesis in eukaryotic cells.

Nature, 1981 Jul 23, 292(5821), 306 - 11
Gene conversion between duplicated genetic elements in yeast; Jackson JA et al.; The mitotic recombination behaviour of a duplication of the his4 region on chromosome III in the yeast Saccharomyces cerevisiae was studied . The major recombination event between the duplicated segments is gene conversion unassociated with reciprocal recombination . The rad52-1 mutation preferentially decreases mitotic gene conversion . These results suggest that mitotic gene conversion may occur by a different pathway from that occurring in meiosis . This mitotic gene conversion may be important in yeast mating type interconversion and the maintenance of sequence homogeneity in families of repeated eukaryotic genes.

Nucleic Acids Res, 1981 Jul 10, 9(13), 3205 - 16
Histone modifications in the yeast S . Cerevisiae; Davie JR et al.; The content of the acetylated histone species associated with the highly transcriptionally active chromatin of yeast was examined . We found yeast chromatin to contain very high levels of the acetylated species for histones H3, H4 and possibly the H2B variants, H2B-1 and H2B-2 . Sixty-three percent of the histone H4 species was represented by the di-, tri- and tetra-acetylated forms . These results make yeast chromatin among the most highly acetylated of any chromatins reported thus far . In addition, the results are consistent with the idea that hyperacetylation of histones allows chromatin to be transcribed at an increased rate.

Nucleic Acids Res, 1981 Jul 10, 9(13), 3077 - 88
Yeast ochre suppressor SUQ5-ol is an altered tRNA Ser UCA; Waldron C et al.; Ochre suppressor tRNA was partially purified from strains of Saccharomyces cerevisiae containing the serine-inserting class III suppressor SUQ5-ol . RNA sequence analysis of this tRNA indicated that the suppressor is derived from a UCA-decoding tRNA Ser by a G leads to U substitution in the middle position of the anticodon . The suppressor further differs from the wild-type UCA-decoding tRNA Ser in that the mutant anticodon lacks the modified uridine found in the wobble position of the wild-type tRNA and contains instead another modification in or near the anticodon.

J Biol Chem, 1981 Jul 10, 256(13), 7077 - 85
myo-Inositol-1-phosphate synthase . Characteristics of the enzyme and identification of its structural gene in yeast; Donahue TF et al.; A purification procedure for L-myo-inositol-1-phosphate synthase (EC 5.5.1.4) from yeast is described . The method routinely produces enrichments of 500-fold with 20-40% yields . In addition, a procedure for obtaining highly specific and purified antibody against the protein is described . The molecular weight of the native enzyme as determined by gel filtration is approximately 240,000 . A single subunit of approximately Mr = 62,000 is detected upon sodium dodecyl sulfate-gel electrophoresis of the purified enzyme . The purified antibody was used to assay crude extracts of wild type and inositol-requiring mutants for the presence of cross-reacting material . Mutant ino1-13 produces an inactive but fully cross-reacting protein of a molecular weight identical with the wild type enzyme subunit . Mutant ino1-16 produces low levels of a fully active enzyme which appears to be more susceptible to proteolytic degradation . Mutants representing other unlinked loci (ino2 and ino4) do not produce cross-reacting protein . Based on this analysis, the ino1 locus is identified as the structural gene for the enzyme . Furthermore, it is shown that the Mr = 62,000 subunit is largely absent from crude extracts prepared from wild type yeast grown in the presence of repressing concentrations of inositol.

J Biol Chem, 1981 Jul 10, 256(13), 6990 - 4
Structure of the yeast mitochondrial adenosine triphosphatase . Results of trypsin degradation; Todd RD et al.; A comparison was made of the subunit sensitivities of the F1-ATPase and the Triton-solubilized ATPase complex to trypsin degradation . The dissociation of the F1-ATPase from ATPase complex increased the trypsin sensitivity of subunit 3 by a factor of 2 and increased the sensitivity of a particular trypsin site (or group of sites) on subunit 1 by 7-fold . The overall degradation of subunits 1 and 2 appears to be the same in solubilized ATPase complex and the F1-ATPase . Implications of these findings for structural models of the ATPase complex are discussed.

J Biol Chem, 1981 Jul 10, 256(13), 6984 - 9
A model for the structure of the yeast mitochondrial adenosine triphosphatase complex; Todd RD et al.; Monodisperse, Triton-solubilized ATPase complex was treated with the reversible protein-protein cross-linker dithiobis(succinimidyl)propionate under conditions where only intracomplex cross-links were formed . The resulting products were analyzed by two-dimensional sodium dodecyl sulfate-acrylamide slab gel electrophoresis under reducing and oxidizing conditions . Using the observed major subunit-subunit cross-links and the previously published subunit stoichiometries (Todd, R., Griesenbeck, T., and Douglas, M . (1980) J . Biol . Chem . 255, 5461-5467), a model of the ATPase complex was constructed . The model is a closed structure which could be formed by self-limited assembly of the subunits . The model also has the novel features of a pseudo-mirror symmetry and clustering of mitochondrially and nuclearly coded subunits into two different domains.

Biochemistry, 1981 Jul 7, 20(14), 4079 - 86
Investigation of the catalytic mechanism of yeast inorganic pyrophosphatase; Knight WB et al.; P1,P2-Bidentate Co(NH3)4PP was found to be a competitive inhibitor of pyrophosphatase vs . MgPP (Kis = 8.7 mM, pH 7) and, in the presence of Mg2+, an active substrate as well . P1,P2-Bidentate Cr(III) complexes of pyrophosphate, imidodiphosphate, and methylenediphosphonate were also competitive inhibitors vs . MgPP (pH 5.9; Kis = 0.2, 0.2, and 0.4 mM, respectively) . In the presence of Mg2+, P1,P2-bidentate Cr(H2O)4PP was found to have a Km 10-fold greater and a turnover number 36-fold smaller than MgPP at pH 5.9 . Mg2+, Mn2+, Co2+, Zn2+, Cd2+, Ni2+, and Fe2+ activate the CrPP--pyrophosphatase reaction, while Ca2+ and Ba2+ are not activators but serve as competitive inhibitors vs . Mg2+ (Kis = 0.35 and 2.3 mM) . At levels above 0.1 mM, Mn2+, Co2+, and Zn2+ show activator inhibition . Kinetic studies with CrPP and Mg2+ suggest that the kinetic mechanism is rapid equilibrium ordered, with CrPP adding before Mg2+ . pH studies of the MgPP/Mg2+ reaction and the CrPP/Mg2+ reaction suggest that the active form of the substrate is (MgPP)2- and that the uncomplexed metal ion cofactor interacts with at least two active-site residues, one possibly via H bonding and the other by direct coordination . The former group (pKa = 5.6) appears on the basis of temperature and solvent perturbation studies to be a carboxylic acid . The MgPP reaction also requires that an active-site residue (pKa = 7.5) be protonated . Temperature and solvent perturbation studies suggest that this residue is an amine . A mechanism accounting for these observations is presented.

Can J Microbiol, 1981 Jul, 27(7), 651 - 3
Hanseniaspora nodinigri, a new yeast species found in black knots (Dibotryon morbosum) of Prunus virginiana; Lachance MA; The new yeast species Hanseniaspora nodinigri is described to accommodate members of the genus Hanseniaspora that are unable to assimilate glucono-sigma-lactone and isolated from stromatal tissue of black knots (Dobotryon morbosum) of chokecherry, Prunus virginiana . The newly described taxon shows much resemblance, by other criteria, to H . vineae van der Walt et Tscheuschner and H . osmophila (Niehaus) Phaff, Miller et Shifrine.

Mikrobiologiia, 1981 Jul-Aug, 50(4), 636 - 44
{Conditions and dynamics of citrate, isocitrate and polyol excretion in yeast growth on glucose}; Mandeva RD et al.; The dynamics of metabolite excretions by Candida guilliermondii, Candida zeylanoides and Torulopsis candida was studied during their batch cultivation in media with glucose excess and low concentrations of N, P or S sources; the latter were the growth limiting factors and determined the transition to phase of retardation and the stationary phase of growth . Growth limitation with the above components in the presence of a carbon source results in the following: (a) the growth becomes linear and the phase of retardation falls into two periods differing in the absolute growth rate which initially is relatively high but then decreases; (b) protein content drastically decreases while lipid content and in particular, of glycogen increases, i . e . the direction of biosynthetic processes changes; (c) intensive excretion of citrate and isocitrate begins and continues (including the stationary phase) until the carbon source is exhausted . In contrast to citrate and isocitrate, polyols are excreted throughout all growth phases (including the exponential one) and strictly periodically, i . e . these metabolites are repeatedly excreted and re-utilized . The fact that polyols are excreted during the exponential growth phase proves that their overproduction apparently is not connected with the limitation of the cultural growth.

Biochem J, 1981 Jul 1, 197(1), 203 - 11
The interaction of yeast hexokinase with Procion Green H-4G; Clonis YD et al.; 1 . A number of reactive triazine dyes specifically and irreversibly inactive yeast hexokinase at pH 8.5 and 33 degrees C . Under these conditions, the enzyme is readily inactivated by 100 microM-Procion Green H-4G, Blue H-B, Turquoise H-7G and Turquoise H-A, is less readily inactivated by Procion Brown H-2G . Green HE-4BD, Red HE-3B and Yellow H-5G and is not inactivated at all by Procion Yellow H-A . 2 . The inactivation of hexokinase by Procion Green H-4G is competitively inhibited by the adenine nucleotides ATP and ADP and the sugar substrates D-glucose, D-mannose and D-fructose but not by nonsubstrates such as D-arabinose and D-galactose . 3 . Quantitatively inhibited hexokinase contains approx . 1 mol of dye per mol of monomer of mol.wt . 51000 . The inhibition is irreversible and activity cannot be recovered on incubation with high concentration (20 mM) of ATP or D-glucose . 4 . Mg2+ protects the enzyme against inactivation by Procion Green H-4G but enhances the rate of inactivation by all the other Procion dyes tested . In the presence of 10 mM-Mg2+ the apparent dissociation constant between enzyme and dye is reduced from 199.0 microM to 41.6 microM . Binding of the dye to hexokinase is accompanied by characteristic spectral changes in the range 560-700 nm . 5 . Mg2+ promotes binding of yeast hexokinase to agarose-immobilized Procion Green H-4G but not to the other dyes tested . Elution could be effected by omission of Mg2+ from the column irrigants or by inclusion of MgATP or D-glucose, but not by D-galactose . These effects can be exploited to purify hexokinase from crude yeast extracts . 6 . The specific active-site-directed binding of triazine dyes to yeast hexokinase is interpreted in terms of the crystallographic structure of the hexokinase monomer.

Biosci Rep, 1981 Jul, 1(7), 533 - 8
A low-molecular-weight RNA species in yeast mitochondria arising from a 3' end trimming of cytochrome b pre-mRNA; Halbreich A et al.; Immobilization of yeast mitochondrial RNA on nitrocellulose filters without prior alkali treatment revealed a low-MW RNA species (integral of 300 bases) which hybridizes specifically to the RNA coding strand of a DNA fragment BglII-HinfI at the 3' end of the COB-BOX gene . This RNA species (often a doublet) was found in several independent preparations of wild-type mtRNA and even in box- mutants blocked in the earliest steps of mRNA maturation (e.g . box 8-1) . It may, therefore, result from an endonucleolytic cut similar to that which precedes the addition of a poly-A tail in other systems.

Eur J Biochem, 1981 Jul, 117(3), 439 - 47
Fluorimetric study of yeast tRNAPheCCF in the complex with phenylalanyl-tRNA synthetase . Evidence for a correlation between the structural adaptation of both macromolecules and the appearance of the acylation activity; Lefevre JF et al.; The fluorescence properties of yeast tRNAPheCCF (tRNAPhe in which the 3'-terminal adenosine has been replaced by formycin) and tRNAPheCCFoxi-red (tRNAPheCCF after periodate oxidation followed by borohydride reduction) were studied in the complex with the cognate aminoacyl-tRNA synthetase . In both cases a conformational change affecting the 3' end was observed in a magnesium concentration range close to 1 mM . The modification of formycin fluorescence could be ascribed simultaneously to the existence of a tautomeric equilibrium of the fluorescent probe and to a pH effect raising from a prototropic effect at the active site of phenylalanyl-tRNA synthetase, and to a partial destacking of the 3'-formycin from the adjacent C residue . The observed transconformation, which can be related to the structure modification of the anticodon loop previously reported {Ehrlich, Lefevre, and Remy (1980) Eur . J . Biochem . 103, 145-153}, takes place in the magnesium concentration range allowing the transfer of the activated amino acid from the adenylate to the tRNA . The interconnection between the anticodon loop and the accepting end was further supported by the observation that wybutine excision hinders the specific structure modification of 3'-formycin upon binding to the synthetase . The tRNAPhe transconformations occurring in the complex with the cognate synthetase probably reflect a reciprocal adaptation of both macromolecules which might lead to the optimal aminoacylation velocity and thus contribute to the specificity of aminoacylation, since it was previously established that this specificity relies more strongly on the kinetics of the reaction than on a discrimination of tRNAs according to different affinities.

Biochimie, 1981 Jul, 63(7), 569 - 73
Photodependent incorporation of arylazido-beta-alanyl-NAD+ into the coenzyme binding site of yeast glyceraldehyde-3-phosphate dehydrogenase; Bayne S et al.; Yeast glyceraldehyde-3-phosphate dehydrogenase was labeled in a photodependent reaction by the arylazido-beta-alanyl derivative of NAD+ . This analogue was bound covalently to the enzyme and could be reduced in situ by the substrate glyceraldehyde-3-phosphate . That this derivative was bound to the active site in the proper orientation was shown by fluorescence experiments, from the retention of the enzymatic activity when the photolysis of the enzyme-analogue binary complex was carried out in the presence of NAD+ . In the dark a non-photodependent competitive inhibition corresponding to a KI-value of 150 microM was observed . Thiol groups of the enzyme were not modified in the photolabeling reaction . Of the various arylazido-beta-alanyl nucleotide derivatives studied, the NADP+ derivative influenced the enzymatic activity to the greatest extent; this is probably due to an ionic bond between enzyme and nucleotide, in addition to the covalent bond of the photolytic reaction.

Mutat Res, 1981 Jul-Sep, 91(4-5), 381 - 90
Rat hepatic vinyl chloride metabolites induce gene conversion in the yeast strain D7RAD in vitro and in vivo; Eckardt F et al.; We have tested the genetic activity of gaseous vinyl chloride in vitro and in vivo using the gene-conversion system (trp5-12/trp5-27 leads to TRP+) in the yeast strain D7RAD . To induce, in vitro, TRP+ convertants with 2.5% gaseous vinyl chloride, a rat-liver microsomal system for metabolic activation of the vinyl chloride and dividing yeast cells are required . Neither a deficiency in excision repair (rad3) nor in the error-prone repair pathway (rad6) increased the vinyl-chloride-induced conversion frequencies compared with the repair-competent D7RAD strain . When logarithmically growing cells of the D7RAD strain were injected intravenously into male Wistar rats which inhaled 1% vinyl chloride in air for 24 h, a significant enhancement of the TRP+ conversion frequencies was found compared with that in cells re-isolated from untreated rats . These results indicate that vinyl chloride metabolites from the metabolizing hepatocytes diffuse into yeast cells, which accumulate in the liver capillaries . This supports the hypothesis that the endothelial cells of the liver sinuses, which have hardly any metabolic activity, but give rise to vinyl-chloride-induced hemangiotheliomas (rare type of liver tumor), are transformed by diffusible metabolites of the procarcinogen vinyl chloride.

Mutat Res, 1981 Jul, 82(2), 285 - 94
Rbe of densely ionizing radiation for wild-type and radiosensitive mutants of yeast; Petin VG et al.; Survival curves were obtained for haploid and diploid yeasts, Saccharomyces cerevisiae, of wild-type strains and radiosensitive mutants exposed to gamma-rays and alpha-particles . A correlation between the values of the relative biological effectiveness (RBE) of high-LET radiation and cell-repair capacity was found . The difference in radiosensitivities of the wild-type diploid strain and homozygous rad mutants incapable of recovery was significantly higher after low-LET radiation than after high-LET radiation . Possible reasons for the observed radiation responses to low- and high-LET exposure of yeast cells with various genotype are discussed.

Biochim Biophys Acta, 1981 Jun 26, 654(1), 11 - 25
Synthesis and intramolecular crosslinking of chlorambucilyl (prolyl)n {3H}phenylalanyl-tRNAPhe (yeast), n = 0, 5, 11 and 15; Reuben MA et al.; Rigid, variable-length oligoproline crosslinking reagents, which we call molecular rulers, are a potentially powerful tool for probing the solution structures of tRNA and other biological macromolecules . We wish to demonstrate the feasibility of molecular rulers on a well-studied model system, yeast phenylalanine tRNA, before applying them to less well understood structures . We have found chlorambucil (4-(4-(bis(2-chloroethyl)amino)phenyl)-butanoic acid) to be suitable for use as an alkylating function attached to the imino end of oligo-L-proline spacers which are peptide bonded at their carboxyl ends to the alpha-amine of {3H}Phe-tRNAPhe (yeast) . Chlorambucil and chlorambucilyl oligoprolines may be readily and sensitively assayed by their alkylation kinetics with aqueous pyridine as measured by optical absorbance of the product . The pyridine reaction seemed to be the first order in chlorambucil, k1 = (5.4 +/- 1.0) X 10(-3) min-1, zero order in pyridine, and was strongly inhibited by Me2SO . Filter assays of tRNA alkylation by chlorambucilyl {3H}prolyl proline suggested that this reaction is also first order in alkylation reagent, but somewhat dependent on tRNA concentration, and also strongly inhibited by Me2SO . Full alkylation activity was regained upon removal of Me2SO . Modification of {3H}Phe-tRNAPhe (yeast) with the N-hydroxysuccinimide esters of chlorambucilyl (prolyl)n was accomplished with yields of 100% for n = 0, 92% for n = 5, 94% for n = 11 and 44% for n = 15, in 80% Me2SO/CHCl3 at pH 9, 37 degrees C, conditions under which chlorambucil alkylation of tRNA is strongly inhibited . The rates of intramolecular crosslinking of chlorambucilyl (prolyl)n {3H}Phe-tRNAPhe (yeast) were measured assuming a first-order process, giving K1 = (5.3 +/- 0.2) X 10(-3) min-1 for n = 0, (3.2 +/- 0.4) X 10(-4) min-1 for n = 5, (6.8 +/- 0.8) X 10(-5) min-1 for n = 11 and (1.6 +/- 0.4) X 10(-4) min-1 for n = 15 . Yields of intramolecularly crosslinked tRNA were 80% for n = 0 after 4 h in 10 mM NH4OAc (pH 6)/1 mM Mg(OAc)2 at 37 degrees C, 7% for n = 5, 3% for n = 11, and 5% for n = 15.

Philos Trans R Soc Lond B Biol Sci, 1981 Jun 26, 293(1063), 43 - 52
Structural dynamics of yeast hexokinase during catalysis; Steitz TA et al.; The binding of the substrate glucose to yeast hexokinase results in a substantial enzyme conformational change that is essential for catalysis and may be important for the enzyme's specificity, as well as the control of its activity . From high-resolution crystal structures of the monomeric enzyme crystallized both in the presence and in the absence of glucose, we find that glucose binds into the deep cleft that separates the molecule into two lobes and causes these two lobes to move together and close off the cleft . The structure of the hexokinase crystallized in the presence of xylose and ADP is being determined at low resolution . In this crystal form, the enzyme was thought to be in the conformation of the ternary complex . However, a low-resolution structure of this crystal form shows clearly that the enzyme is in the 'open' form and is not a ternary complex . Crystals of the A isozyme with glucose and ADP may be . Further, chemically sequenced tryptic peptides are being incorporated into the model obtained by crystallographic refinement at 2.1 A resolution . Completion of the sequence and the structure of the ternary complex should allow a detailed description of the enzymatic mechanism of this kinase and the role of substrate-induced conformational changes in catalysis and control.

J Biol Chem, 1981 Jun 25, 256(12), 6496 - 501
Trans action and the var1 determinant region on yeast mitochondrial DNA . Specific labeling of mitochondrial translation products in zygotes; Lopez IC et al.; We have studied the specification of the apparent molecular weight form of the var1 polypeptide by the var1 determinant region located on mitochondrial DNA of Saccharomyces cerevisiae . A complementation assay has been developed whereby mitochondrial translation products can be labeled selectively in zygotes with 35SO42- . The procedure takes advantage of the fact that met- cys- grande (rho +) strains are unable to incorporate 35SO42- into protein . When such a strain is crossed with a met+ cys petite (rho -) and cells of the mating mixture are labeled with 35SO42- in the presence of cycloheximide under conditions where glycolysis is inoperative, only mitochondrial translation products within zygotes are labeled . Using this procedure with petites containing the var1 determinant region, we find that as much as 75% of the total polypeptide synthesized in zygotes is the form specified by the petite var1 allele . Moreover, mitochondria containing mixed mitochondrial genomes (rho + and rho -) can be isolated from zygotes, and both the rho + and rho - var1 alleles are expressed in vitro . From these results and the analysis of discriminating petites in which var1 recombination can be distinguished from complementation, we conclude that the var1 determinant can specify the apparent molecular weight form of the var1 polypeptide in trans.

Nucleic Acids Res, 1981 Jun 25, 9(12), 2961 - 70
Structural comparison of two yeast tRNA Glu 3 genes; Eigel A et al.; DNA sequences in a 1.7 kb Pst fragment from yeast have been determined . This fragment is part of a yeast 7.4 kb Hind III segment cloned ino pBR322 (pY 5) . The fragment carries a single gene for a glutamate tRNA . The coding portion of this gene is identical in sequence to that of the tRNA Glu 3 gene from pY 20 {1} . The flanking regions differ in their sequences, but possible secondary structures within the 5'-flanking regions bear similar features . Sequence homologies between pY 5 and pY 20 were detected far outside the tRNA genes . More surprisingly, extended sequence homologies were seen between the flanking regions of the pY 20 tRNA Glu 3 gene and a tRNA Ser gene {2,3} . We have also checked the known tRNA genes for structural similarities . Hybridization studies indicate that portions of the Pst fragment are repeated within the yeast genome.

Nucleic Acids Res, 1981 Jun 25, 9(12), 2949 - 59
Sequence of a yeast DNA fragment containing a chromosomal replicator and a tRNA Glu 3 gene; Feldmann H et al.; The sequence of a 1.9 kb Bam x Hind III fragment from yeast has been determined . This fragment is part of a yeast 6.7 kb Hind III segment cloned into pBR322 (pY20) . The fragment carries a single gene for a glutamate tRNA which has no intron . According to genetic analyses {1} this fragment also contains a yeast chromosomal replicator . We have analyzed the sequence for potential open reading frames and for several structural features which are thought to be involved in the initiation of DNA replication . Hybridization studies have revealed that portions of this sequence are repeated within the yeast genome.

Nature, 1981 Jun 11, 291(5815), 464 - 9
Only one of two closely related yeast suppressor tRNA genes contains an intervening sequence; Olson MV et al.; The yeast genes that code for the serine-inserting SUP-RL1 amber and SUQ5 ochre suppressors have been cloned and sequenced . These two unlinked genes differ by only three base pairs in their coding regions yet they encode tRNAs of different translational specificities, and while the SUP-RL1 gene has a 19-base pair intervening sequence, the SUQ5 gene has none.

Biochemistry, 1981 Jun 9, 20(12), 3629 - 33
Purification of yeast tubulin by self-assembly in vitro; Kilmartin JV; Tubulin was purified from yeast homogenate by DEAE-Sephadex column chromatography and temperature-dependent assembly . The yeast tubulin subunits comigrate with the brain alpha-tubulin subunit on one-dimensional sodium dodecyl sulfate gel electrophoresis . The in vitro yeast tubulin assembly is inhibited by the fungicide methyl N-(benzimidazol-2-yl)carbamate, the active component of benomyl, whereas in vitro brain 6S tubulin assembly is resistant . This suggests that the inhibitory effect of benomyl on yeast cell division is due to its antimicrotubule action.

Biokhimiia, 1981 Jun, 46(6), 1119 - 26
{Isolation and properties of NAD-dependent formate dehydrogenase from the yeast Candida methylica}; Egorova OA et al.; NAD-dependent formate dehydrogenase was purified from a cell-free extract of methanol-consuming yeast Candida methylica, using chromatography on DEAE-cellulose and gel-filtration on Sephadex G-200 . The enzyme is electrophoretically homogeneous, consists of two identical subunits with molecular weight of 46,000 and is active within the pH range of 6-9; the Km values for NAD and formate are 1 . 10(-4) and 1,3 . 10(-2) M, respectively . Formate dehydrogenase is inhibited by p-chloromercurybenzoate, iodoacetate, dithionitrobenzoate and azide.

Genetics, 1981 Jun, 98(2), 239 - 55
Differential mitotic stability of yeast disomes derived from triploid meiosis; Campbell D et al.; The frequencies of recovered disomy among the meiotic segregants of yeast (Saccharomyces cerevisiae) triploids were assessed under conditions in which all 17 yeast chromosomes were monitored simultaneously . The studies employed inbred triploids, in which all homologous centromeres were identical by descent, and single haploid testers carrying genetic markers for all 17 linkage groups . The principal results include: (1) Ascospores from triploid meiosis germinate at frequencies comparable to those from normal diploids, but most fail to produce visible colonies due to the growth-retarding effects of high multiple disomy . (2) The probability of disome formation during triploid meiosis is the same for all chromosomes; disomy for any given chromosome does not exclude simultaneous disomy for any other chromosome . (3) The 17 yeast chromosomes fall into three frequency classes in terms of disome recovery . The results support the idea that multiply disomic meiotic segregants of the triploid experience repeated, nonrandom, post-germination mitotic chromosome losses (N + 1 leads to N) and that the observed variations in individual disome recovery are wholly attributable to inherent differences in disome mitotic stability.

Cancer Lett, 1981 Jun, 13(1), 7 - 14
Inhibition of spontaneous mutagenesis in yeast cultures by selenite, selenate and selenide; Rosin MP; Sodium selenite (1--15 mumol/plate) was found to completely suppress spontaneous mutagenesis at 2 independent loci in both wild (YO-300-IC) and mutator (mut 1-1, mut 2-2, mut 3-1, mut 4-1, mut 5-2, mut 6-1, mut 8-1, mut 9-1 and mut 10-1) isogenic strains of Saccharomyces cerevisiae . The 2 loci which where studied were his 1-7, a missense mutation, and lys 1-1, a super-suppressible mutant of the amber variety . The degree of suppression of spontaneous reversion to prototrophy at these 2 loci depended on the concentration of sodium selenite present, the strain of yeast being studied, and the loci being studied . Greater concentrations of sodium selenite (up to 30-fold higher) were required to suppress the frequency of spontaneous reversion at the histidine locus compared to quantities necessary to elicit a similar inhibition of lysine spontaneous reversion rates . The 2 loci also responded differently to the presence of 2 other inorganic selenium derivatives . Spontaneous mutagenesis at the lysine locus for strain YO-800-1C (mu 1-1) was completely inhibited by sodium selenide at 3 mumol/plate with complete suppression of histidine reversion occurring at 30 mumol/plate . Sodium selenate suppressed the spontaneous mutagenesis at the lysine, but not the histidine locus . These results indicate that environmentally added components can have a significant effect on the genetically controlled predisposition of an organism to mutagenesis and suggest the complexity of such interactions.

Mutat Res, 1981 Jun, 89(2), 179 - 85
Genetic activity of vinylidene chloride in yeast; Bronzetti G et al.; Vinylidene chloride (VDC) was tested for its ability to induce both point mutation and mitotic gene conversion in a diploid strain (D7) of the yeast Saccharomyces cerevisiae in a suspension test with and without a mammalian microsomal activation system, and in the intrasanguineous host-mediated assay in mice . In suspension tests with D7, VCD was toxic but not genetically active without microsomal activation . When a mouse liver 10 000 X g supernatant was included in the suspension tests, dose-related increases in both point mutation and mitotic gene conversion were seen at survival levels greater than 50%, at doses of VCD above 20 mM . In the host-mediated assay, VDC induced both point mutation and mitotic gene conversion when recovered from the liver and kidneys after both acute and sub-acute dosing . Yeasts recovered from the lungs showed little, if any, increase in either point mutation or mitotic gene conversion.

Mutat Res, 1981 Jun, 82(1), 87 - 93
Comparison of petite induction in yeast by acridines, ethidium and their photoaffinity probes; Fukunaga M et al.; The production of petite mutations by different acridine analogs was studied in Saccharomyces cerevisiae . Compounds with amino substituents at the 2 and 3 positions of the acridine nucleus and methylation at position 10 were effective for petite induction in growing cells but not in resting cells, while those with chloro, nitro and methoxy substituents were not effective in either resting or growing cells . Photosensitive azido derivatives of the acridines were tested to evaluate the role of covalent drug attachment for mutagenesis in resting cells . Photolysis of resting cells with 9-axido, 3-azido-6-amino-, 9-azido-10-methyl-, or 3-azido-6-amino-10-methyl-acridine was highly toxic . 3-Azido-6-amino-acridine, and especially 3-azido-10-methyl-, and 3-azido-6-amino-10-methyl-acridine, were effective petite inducers in resting cells . Thus, the photosensitive (azido) group at position 9 produced only cell killing while the azido group at position 3 and/or 6 led to effective petite induction in resting cells . In contrast, petite induction was observed only for growing cells, for dark control experiments with these compounds or with the monoazide precursor compounds.

Mutat Res, 1981 Jun, 82(1), 69 - 85
DNA synthesis in UV-irradiated yeast; di Caprio L et al.; The amount and quality of DNA synthesized in excision-defective strains of yeast was assayed using alkaline sucrose gradients . It was observed that, in such strains, there was less newly synthesized DNA in irradiated cells and that this material was in smaller pieces than in unirradiated controls . The molecular weight was inversely proportional to dose . The low molecular weight DNA chased into normally high molecular weight material during a post-pulse incubation period . This chase was inhibited by higher doses of UV, by hydroxyurea, and required the function of the RAD18 gene . The RAD6 gene function was necessary to prevent degradation of template DNA in irradiated excision-defective strains.

Lipids, 1981 Jun, 16(6), 411 - 7
Increased proportion of medium chain fatty acids in nystatin-resistant yeast mutants; Nagai J et al.; Fatty acid composition of phospholipids and steryl esters from four nystatin-resistant mutants of Saccharomyces cerevisiae was compared to that from the wild strain . All the mutant strains which produce several ergosterol intermediates incorporated two- to three-fold as much medium chain fatty acids, especially 14:1 in phospholipids, and 12:0, 14:0 and 14:1 in steryl esters as the wild strain did . The increase in the relative amount of medium chain fatty acids in these mutants was found at all the growth temperatures and the growth phases examined, and in all the phospholipid species.

Cell, 1981 Jun, 24(3), 679 - 86
The effect of temperature-sensitive RNA mutants on the transcription products from cloned ribosomal protein genes of yeast; Rosbash M et al.; The levels of four ribosomal protein (rp) mRNAs in different mutant strains were determined by hydridization of radiolabeled cloned genes to RNA fractionated on CH3HgOH gels and transferred to DBM paper . Two ribosomal protein genes (rp 51 and rp 52) controlled by the locus RNA2 have dramatically decreased mRNA levels after a shift-up to the nonpermissive temperature in a strain carrying the rna2 mutation (ts368) . Two ribosomal protein genes not controlled by the RNA2 locus and several control nonribosomal protein genes are relatively unaffected by the temperature shift in this strain . Other genes in the vicinity of one of the rna2-sensitive ribosomal protein genes (th rp 51 gene) are insensitive to the rna2 gene product, suggesting that all ribosomal protein genes do not occur in clusters and that the RNA2 gene product does not affect a large region of chromatin . In ts368 at the nonpermissive temperature, the concentration of higher molecular weight transcripts complementary to the rp 51 and the rp 52 plasmids is increased . Analysis of the rp 51 plasmid transcripts reveals that the temperature-induced higher molecular weight transcripts differ from the mature rp 51 mRNA by the presence of an intron . This observation and the kinetics with which the concentration of the various rp 51 transcripts change after a temperature shift suggest that the effect of rna2 may be at the level of processing of rp mRNA.

J Gen Microbiol, 1981 Jun, 124(Pt 2), 309 - 16
The interrelation transketolase and dihydroxyacetone synthase activities in the methylotrophic yeast Candida boidinii; Waites MJ et al.; Crude extracts of Candida boidinii grown on glucose, xylose or ethanol gave single peaks of classical transketolase activity following chromatography, on columns of hydroxylapatite; the enzyme was heat-stable and showed no appreciable activity with formaldehyde as acceptor in place of ribose 5-phosphate . Extracts of methanol-grown cells showed two peaks of transketolase activity following chromatography on both hydroxylapatite and DEAE-cellulose . One peak was identified with that found for the cells grown on substrates other than methanol; the other peak showed dihydroxyacetone synthase activity in addition to transketolase activity . Both activities in the latter peak were very unstable and have been ascribed to one enzyme on the basis of identical rates of denaturation at all temperatures tested between 0 and 40 degrees C . It is suggested that this enzyme is a special transketolase synthesized only during methylotrophic growth of the yeast and in contrast to classical transketolase, is capable of using equally well either formaldehyde or ribose 5-phosphate as glycolaldehyde acceptor . A method based on heat treatment has been suggested for the simultaneous assay of both transketolases present in crude extracts of a methylotrophically grown yeast.

Biochim Biophys Acta, 1981 May 29, 653(3), 368 - 77
The interaction of yeast RNA polymerase I and Cibacron blue F3GA; Bull P et al.; The interaction between yeast RNA polymerase I and Cibacron blue F3GA has been studied by difference spectrophotometry and column chromatography . The enzyme is reversibly inhibited by the dye . 50% inhibition is obtained with 7.5 x 10(-6) M Cibacron blue . 1 mol Cibacron blue binds per mol enzyme . This interaction, which is inhibited by salt, occurs at a site different from the active site . When RNA polymerase I is chromatographed in Blue dextran-Sepharose columns, two polypeptides, of 48 000 and 36 000 daltons, are dissociated from the enzyme . The resulting enzyme is completely inactive, ATP (5 mM) present in the elution buffer prevents both the dissociation of the polypeptides and the inactivation of the enzyme.

Biochemistry, 1981 May 26, 20(11), 3267 - 72
Utilization and metabolism of methyl-sterol derivatives in the yeast mutant strain GL7; Buttke TM et al.; Sterols modified at various positions of the tetracyclic nucleus were tested as growth supplements for Saccharomyces cerevisiae strain GL7 erg12 heme3 . Derivatives of 3 beta-cholestanol or delta 7-3 beta-cholestenol bearing either a single alpha-oriented methyl group of a gem-dimethyl group at C-4 supported the growth of the mutant whereas 4 beta-methyl sterols did not . The nutritionally active alkyl derivatives were metabolized to 4-demethyl sterols while 4 beta-methyl derivatives were incorporated unchanged, indicating that the C-4 demethylase of yeast is specific for alpha-oriented methyl groups . It appears that 4-demethyl sterols are obligatory for growth of this organism . C-4 methyl derivatives of cholesterol did not support growth, suggesting that the delta 5 double bond blocks demethylation at the adjacent C-4 . In other experiments, 14 alpha-methyl sterols were effective growth supplements, while 3 alpha-methylcholesterol was totally inactive . Removal of the C-19 methyl group of cholesterol (19-noncholesterol) rendered the sterol somewhat less effective as a sterol source . The sterol specificity for yeast appears to be particularly strict with regard to substituents that add bulk to the A ring of the steroid nucleus.

J Biol Chem, 1981 May 25, 256(10), 5144 - 52
The yeast his4 multifunctional protein . Immunochemistry of the wild type protein and altered forms; Bigelis R et al.; A procedure for rapid purification of the yeast his4 protein has been developed . A combined biochemical and immunological study of the his4 proteins from wild type and a number of mutant strains indicates that the his4 gene product is a trifunctional protein with three independent functional domains . Active fragments of the his4 protein possessing one or several activities can result from proteolysis or from genetic alteration . Such fragments can be purified to homogeneity by electrophoresis in polyacrylamide gels containing sodium dodecyl sulfate . Immunological experiments with antibody to the wild type protein and with antibody to genetically or proteolytically altered forms indicate that the sole product of the wild type his4 region is a 95,000-dalton protein . Furthermore, such data indicates that each mutant protein has a characteristic stability that correlates with the type of mutation and with the location of the mutation within the his4 locus . By varying the ionic strength of the extraction buffer, it is possible to find conditions under which such mutant proteins are quite stable.

J Biol Chem, 1981 May 25, 256(10), 5226 - 32
Transcriptional initiation and 5' termini of yeast mitochondrial RNA; Levens D et al.; We have used vaccinia virus guanylyltransferase to label polyphosphate-terminated yeast mitochondrial RNAs in vitro with {alpha-32P}GTP . Hybridization of RNA labeled in vitro indicates the presence of multiple transcriptional initiation sites in both grande and petite mitochondrial genomes . Agarose/urea gel electrophoresis of capped RNA suggests the existence of a precursor to the small (14 S) rRNA . In contrast, direct examination of the large (21 S) rRNA by partial ribonuclease T1 digestion reveals a complete lack of processing of the 5' end of the primary transcript of this RNA.

Eur J Biochem, 1981 May 15, 116(2), 413 - 7
Phosphorylated intermediate of the ATPase from the plasma membrane of yeast; Malpartida F et al.; A purified preparation of the plasma-membrane ATPase from Saccharomyces cerevisiae was phosphorylated when incubated with {gamma-32P}ATP . The phosphoprotein formed has the characteristics of an enzyme intermediate because of its rapidity of phosphorylation and dephosphorylation . When the phosphorylated enzyme was analyzed by polyacrylamide gel electrophoresis in sodium dodecylsulfate only one band with a molecular weight of 100000 contained radioactivity . This band represented about 80% of the protein of the preparation and its enrichment in the course of the purification correlated with the increase in the specific ATPase activity . Both the ATPase reaction and the phosphorylation of the enzyme exhibited an apparent dissociation constant for the enzyme-ATP complex of 0.2 mM, further implicating the phosphoenzyme as an intermediate of the reaction . The sensitivity of the phosphoenzyme bond to alkaline pH and hydroxylamine indicate that it is an acylphosphate . From the maximum level of intermediate (0.7 nmol/mg) and the maximum ATPase activity at 30 degrees C (21 mumol x min-1 x mg-1) a turnover number of 30000 min-1 can be calculated . The level of phosphoenzyme was not affected by either the ATPase inhibitors vanadate and dicyclohexylcarbodiimide or by ADP . These results indicate that the yeast plasma-membrane ATPase has a subunit composition and reaction mechanism similar to the cation-pumping ATPases of animal plasma membranes.

Biochim Biophys Acta, 1981 May 14, 659(1), 70 - 85
Simultaneous inactivation of the catalytic activities of yeast glutathione reductase by N-alkylmaleimides; Dubler RE et al.; A series of straight chain N-alkymaleimides was shown to simultaneously inactivate the reductase, transhydrogenase and diaphorase activities of yeast glutathione reductase (NAD(P)H: oxidized-glutathione oxidoreductase, EC 1.6.4.2.) at pH 7.5 and 25 degrees C . Apparent second-order rate constants for the inactivation of all enzyme activities exhibited parallel increases with increasing chainlength from C-2 through C-7 of the alkyl substituent of the enhanced binding of maleimides through nonpolar interactions with the enzyme . Reduction of the active site disulfide with NADPH was required prior to addition of maleimide for inactivation to occur . NADP, AcPyADP, SNADP, AADP, and oxidized glutathione all protected the enzyme from inactivation . 2'AMP, 3' AMP, 2'-phospho-5' AMP, 2'-phospho5'-ADP and 2'-phospho-ADP-ribose although all coenzyme-competitive inhibitors failed to protect the enzyme from N-ethylmaleimide inactivation . N-Phenyl and N-alkylmaleimides covalently modified two, of six available sulfhydryl groups per subunit . No other amino acid residues were modified . The reactivity of these sulfhydryl groups was at least two orders of magnitude higher than any reported for the N-ethylmaleimide reaction with many other 'essential sulfhydryl' enzymes . No change in the charge transfer band of the reduced enzyme was observed upon complete inactivation by N-ethyl, N-heptyl or N-phenylmaleimide . The retention of the charge transfer band after selective modification of two sulfhydryl groups suggests the involvement of a third reactive sulfhydryl group in the functioning of the yeast enzyme . No inactivation was observed when coenzymatically reduced enzyme was incubated with the site-specific sulfhydryl reagent, diazotized AADP.

J Biol Chem, 1981 May 10, 256(9), 4362 - 7
Binding of arylazidocytochrome c to yeast cytochrome c peroxidase; Bisson R et al.; Cytochrome c derivatives modified with a photoactivatable arylazido group in selected lysine residues were irradiated in the presence of cytochrome c peroxidase (EC 1.11.1.5) . A derivative modified at lysine 13 was able to cross-link to the enzyme and inhibit electron transfer activity . Complete inhibition of cytochrome c peroxidase activity was obtained when 1 mol of cytochrome c was covalently bound per mol of cytochrome c peroxidase . Chemical cleavage of the covalent complex has been used for a preliminary characterization of the site of cross-linking of cytochrome c to cytochrome c peroxidase . This linkage site was localized to the NH2 terminal part of cytochrome c peroxidase including residues 1-51.

J Biol Chem, 1981 May 10, 256(9), 4175 - 7
Reconstitution of the proton-translocating adenosine triphosphatase of yeast plasma membranes; Malpartida F et al.; The plasma membrane ATPases of eukaryotic cells of the vegetable type (fungi, plants, and algae) have been postulated to operate as proton pumps which generate membrane potentials and drive the uptake of nutrients by proton co-transport (Poole, R . J . (1978) Annu . Rev . Plant Physiol . 29, 437-460) . In order to verify this important physiological role, a purified preparation of the yeast plasma membrane ATPase has been reconstituted with soybean phospholipids by a freeze-thaw-sonication procedure . The reconstituted proteoliposomes catalyzed a 32Pi-ATP exchange partially sensitive to proton ionophores (uncouplers) and to the proton-potassium exchange carrier nigericin . The reaction was completely inhibited by the nonspecific ionophore gramicidin and by the combination of uncouplers with the potassium ionophore valinomycin . These results are interpreted as evidence for two types of proton transport catalyzed by the enzyme preparation: electrogenic proton transport and electroneutral proton-potassium exchange.

Biochim Biophys Acta, 1981 May 6, 643(2), 376 - 86
Lipid phase separations and intramembranous particle movements in the yeast tonoplast; Moeller CH et al.; The tonoplast of Saccharomyces cerevisiae contains regions depleted of intramembranous particles as the cells enter stationary phase . Freeze-fracture studies on intact cells from this growth stage show that a dispersed particle distribution predominates if the cell temperature is raised to 40 degrees C but that particle-depleted areas prevail at or below the cell growth temperature of 30 degrees C . Tonoplasts of isolated vacuoles also contain particle-depleted regions . Differential thermal analysis of lipids extracted from isolated vacuoles show an endothermic transition which encompasses the cell growth temperature . These results suggest that the tonoplast at this stage contains patches of gel-phase lipid and that these patches correspond to the intramembranous particle-depleted areas of the freeze-fractured tonoplast.

J Bacteriol, 1981 May, 146(2), 746 - 54
Isolation of cell size mutants of a fission yeast by a new selective method: characterization of mutants and implications for division control mechanisms; Fantes PA; Previously known cell size (wee) mutations of fission yeast suppress the mitotic block caused by a defective cdc25 allele . Some 700 revertants of cdc25-22 were obtained after ultraviolet mutagenesis and selection at the restrictive temperature . Most revertants carried the original cdc25 lesion plus a mutation in or very close to the wee1 gene . Two partial wee1 mutations of a new type were found among the revertants . Two new wee mutations mapping at the cdc2 gene (cdc2-w mutants) were also obtained . The various mutations were examined for their effects on cell division size, their efficiency as cdc25 suppressors, and their dominance relations . Full wee1 mutations were found to suppress cdc25 lesions very efficiently, whereas partial wee1 mutations were poor suppressors . The cdc25 suppression ability of cdc2-w mutations was allele specific for cdc2, suggesting bifunctionality of the gene product . The wee1 mutations were recessive for cdc25 suppression; cdc2-w mutations were dominant . A model is proposed for the genetic control of mitotic timing and cell division size, in which the cdc2+ product is needed and is rate limiting for mitosis . The cdc2+ activity is inhibited by the wee1+ product, whereas the cdc25+ product relieves this inhibition.

Mikrobiologiia, 1981 May-Jun, 50(3), 414 - 7
{Hydrogen peroxide release into the medium by growing and resting yeast cells}; Eremina SS et al.; The yeast Candida mycoderma and its mutant lacking cytochrome oxidase and cytochromes b were grown in the glucose-mineral Rieder medium and liberated hydrogen peroxide . The evolution of hydrogen peroxide was found also in the resting cells of the parent strain and its mutant when they oxidized glucose, ethanol and endogenous substrates . The evolution of hydrogen peroxide was registered also during the growth of other yeast cultures, in particular, those belonging to Saccharomyces and Torulopsis.

J Biochem (Tokyo), 1981 May, 89(5), 1439 - 43
Minor conformational changes of yeast tRNAPhe anticodon loop occur upon aminoacylation as indicated by Y base fluorescence; Okabe N et al.; The Y base fluorescence of highly purified yeast tRNAPhe was measured in order to detect possible conformational changes of the anticodon loop, which were induced as a consequence of aminoacylation . A small enhancement of Y base fluorescence intensity in the order of 5% was observed in situ during aminoacylation . The rotational mobility of the Y base of Phe-tRNAPhe and tRNAPhe was determined by measuring the fluorescence polarization at various temperatures between 5 degrees C and 35 degrees C . Differences in the fluorescence polarization of the Y base between these tRNAs were however not observed . These results confirm that minor changes in the microenvironment of the Y base occur upon aminoacylation, whereas significant conformational changes of the anticodon loop can be excluded.

J Biochem (Tokyo), 1981 May, 89(5), 1391 - 6
Subcellular localization of the enzymes involved in the late stage of ergosterol biosynthesis in yeast; Nishino T et al.; The subcellular distribution of enzymes involved in the reaction sequence from zymosterol to ergosterol was studied . The spheroplasts obtained from cells aerobically grown on ethanol were gently disrupted and the homogenate was fractionated into the subcellular organelles by differential centrifugation . Inspection of the distribution of several marker enzymes revealed that the fractionation was reasonably effected . As a result of experiments, delta 8-delta 7-sterol isomerase, S-adenosylmethionine: delta 24-sterol methyltransferase and the enzyme involved in the reaction sequence from episterol to ergosterol were localized in microsomes . These results suggest the localization of enzymes involved in the late stage of ergosterol synthesis in microsomes.

Eur J Biochem, 1981 May, 116(1), 101 - 8
N-Glycosylation of yeast proteins . Characterization of the solubilized oligosaccharyl transferase; Sharma CB et al.; The enzyme transferring the oligosaccharide from DolPP-(GlcNAc)2(Glc)3 to asparagine residues of glycoproteins has been solubilized from yeast membranes by extraction with detergents . Enzyme activity was tested by measuring transfer of the glycosyl moiety from DolPP-{14C}saccharides to the hexapeptide Tyr-Asn-Leu-Thr-Ser-Val . The rate of transfer was linear for 20 min, with about 40% of dolichyl-diphosphate-bound radioactivity transferred to the peptide . The solubilized enzyme has been characterized as follows: 1 . The enzyme is most efficiently solubilized (60% of the membrane-associated activity) by 0.5% Nonidet P40 at a protein/detergent ratio of 2 . Octylglucoside solubilizes one third of the activity, but strongly inhibits the reaction if present in the test at a concentration of 1% . 2 . Divalent cations are absolutely required . 1 mM Mn2+ is optimal; Mg2+ at a concentration of 10mM yields only one third the activity observed with Mn2+ . 3 . The enzyme transfers besides dolichyl-diphosphate-bound (GlcNAc)2(Man)9(Glc)3 also (GlcNAc)2(Man)1 and (GlcNAc)2; the rate decreases in this order . No transfer is observed from DolPP-(GlcNAc)2(Man)9 and from DolPP-GlcNAc . 4 . The Km value for DolPP-(GlcNAc)2(Man)9(Glc)3 of 0.5 microM does not differ significantly from that for DolPP-(GlcNAc)2 of 1.2 microM . A broad pH-optimum for the reaction with both substrates was found between 6.5 and 7.7 . 5 . However, a clear difference in Km values for the hexapeptide was observed with difference dolichol-linked sugar derivatives . With DolPP-(GlcNAc)2 a peptide concentration of 0.6 mM resulted in half-maximal transfer rate, whereas 0.05 mM peptide were sufficient with DolPP-(GlcNAc)2(Man)9(Glc)3 as donor.

Mutat Res, 1981 May, 91(3), 215 - 9
Mitotic gene conversion induced in yeast by isoniazid . influence of a transition metal and of the physiological conditions of the cells; Zetterberg G et al.; Isoniazid (INH) induced mitotic gene conversion at the trp5 locus of strain D7 of Saccharomyces cerevisiae . A suggested mechanism involving autoxidation of INH and production of hydrogen peroxide is supported by the facts that (i) the presence of a transition metal, Mn(II), greatly enhanced the effect of INH, (ii) cells stored for a long time in the refrigerator are much more sensitive to INH + Mn(II) than fresh cells probably due to loss of catalase and/or peroxidase activity, (iii) presence of S9 mix during the treatment eliminated the effect of INH + Mn(II).

Cell, 1981 May, 24(2), 377 - 84
Yeast histone genes show dosage compensation; Osley MA et al.; The copy number of yeast histone genes was increased by inserting an extra H2A,H2B gene pair into the haploid genome by the technique of yeast transformation . The presence of this extra gene copy has no detectable effect on cell growth . The steady-state levels of histone H2A,H2B mRNAs are not elevated in transformed strains, and they correspond to the levels measured for the parental strain . The transcription rate is increased in these strains, however, and the parental steady-state levels of histone mRNAs are maintained by increased turnover of histone transcripts . These results demonstrate that yeast histone genes display dosage compensation through the operation of posttranscriptional controls . They also suggest that maintainance of a constant ratio between histone mRNA concentration and the rate of chromosome replication may be of general importance to histone mRNA metabolism.

Cell, 1981 May, 24(2), 367 - 75
Cell-cycle regulation of yeast histone mRNA; Hereford LM et al.; The levels of H2A and H2B mRNAs as a function of cell-cycle stage were determined by hybridization methods . The analysis was extended to H3 and H4 mRNAs by in vitro translation . Cells were partitioned into cell-cycle stages either by centrifugal elutriation or by G1 synchronization with the yeast mating pheromone, alpha factor . The data lead to the following conclusions . First, histone mRNA can be detected in significant quantities only in S-phase cells . Second, the point of maximal accumulation of histone mRNA is not coincident with the point of maximal DNA synthesis; rather, histone mRNA begins accumulating very early in S, reaching a maximum when less than one half of the DNA has replicated . From this point in the cell cycle the histone mRNA levels decrease, reaching basal levels at the end of S . Third, in spite of the fact that the rate of histone mRNA accumulation is not coincident with the rate of DNA synthesis, the two processes are coupled; inhibition of DNA synthesis results in an extremely rapid disappearance of histone mRNA that is much shorter than the normal histone mRNA half-life . Fourth, there is no visible accumulation of mRNA precursors at any cell-cycle stage . We can conclude that, in yeast, histone mRNA levels are tightly and coordinately regulated throughout cell division and that this regulation most likely occurs at both transcriptional and posttranscriptional levels . We also show that the two genetically unlinked H2B genes present in yeast are both expressed at comparable levels and are regulated . The regulation is probably sequence-specific, since genes in close proximity to the histones are not subject to cell-cycle control.

Science, 1981 May 1, 212(4494), 543 - 5
Changes in DNA during meiosis in a repair-deficient mutant (rad 52) of yeast; Resnick MA et al.; The kinetic patterns of DNA synthesis in wild-type (RAD+) and rad 52 mutants of yeast, which exhibit high levels of synchrony during meiosis, are comparable . However, RAD 52 mutants accumulate single-strand breaks in parental DNA during the DNA synthesis period . Thus, the product of the RAD 52 gene has a role in meiotic DNA metabolism, as well as in the repair of DNA damage during mitotic growth . The observed breaks may be unresolved recombination intermediates.

Mol Cell Biol, 1981 May, 1(5), 387 - 93
Linear mitochondrial deoxyribonucleic acid from the yeast Hansenula mrakii; Wesolowski M et al.; The mitochondrial deoxyribonucleic acid (mtDNA) from a petite-negative yeast, Hansenula mrakii, was studied . A linear restriction map was constructed with 11 restriction enzymes . The linearity of the genome was confirmed by direct end labeling of the molecule, followed by restriction analysis . The molecular weight of the DNA was found to be 55,000 base pairs . This is the first linear mtDNA found in yeast species . Using specific gene probes obtained from Saccharomyces cerevisiae mtDNA, we have constructed a gene map of H . mrakii mtDNA . The arrangement of genes in this linear genome was very different from the circular mtDNA of other known yeasts.

Infect Immun, 1981 May, 32(2), 731 - 8
Influence of yeast mannan on human neutrophil functions: inhibition of release of myeloperoxidase related to carbohydrate-binding property of the enzyme; Wright CD et al.; We investigated the possibility that dissolved mannan polysaccharide from Candida may have an inhibitory influence on the host defense mechanisms associated with neutrophils and thereby contribute to the pathogenesis of candidoses . We created a model for this hypothesis by using mannan derived from bakers' yeast (Saccharomyces cerevisiae) and mannan isolated from the serum of a patient with chronic mucocutaneous candidosis . We observed that these mannans inhibited the respiratory burst and release of myeloperoxidase stimulated by phagocytosis of serum-opsonized zymosan in vitro . Mannan did not inhibit release of three other lysosomal enzymes . The selective inhibition of release of myeloperoxidase was attributable to a carbohydrate-binding property of the enzyme, with the mannan causing co-sedimentation of the enzyme with the cellular fraction.

Eur J Biochem, 1981 May, 116(1), 47 - 50
Reactivation of the phospho form of the NAD-dependent glutamate dehydrogenase by a yeast protein phosphatase; Hemmings BA; A protein phosphatase was isolated from the yeast, Candida utilis, which could reactivate (dephosphorylate) the phosphorylated form of the NAD-dependent glutamate dehydrogenase . The protein could also dephosphorylate casein, histone and kemptide (a heptapeptide corresponding to the phosphorylation site of liver pyruvate kinase) . Reactivation of the phosphorylated glutamate dehydrogenase was stimulated by the simultaneous addition of NAD and L-glutamate; 2-oxoglutarate, NH+4 and NADH had no effect . The reactivation of phosphorylated glutamate dehydrogenase could be inhibited by phosphate, pyrophosphate and fluoride.

Biochemistry, 1981 Apr 28, 20(9), 2633 - 8
Nucleoside 5'-{gamma-S}triphosphates will initiate transcription in isolated yeast nuclei; Ide GJ; Transcription was carried out in isolated nuclei by endogenous ribonucleic acid (RNA) polymerase in the presence of nucleoside 5'-{gamma-S}triphosphates . The resulting 5'-gamma-thiophosphate on the synthesized RNA allows separation of in vitro initiated RNA from bulk RNA . Analysis of this in vitro initiated RNA shows that 5S RNA and pre-tRNA are initiated in vitro by RNA polymerase III . Yeast RNA polymerase III also reinitiates discrete distribution of RNA species as large as 28 S . The RNA populations initiated with adenosine 5'-{gamma-S}triphosphate and guanosine 5'-{gamma-S}triphosphate are different.

Biochim Biophys Acta, 1981 Apr 27, 653(2), 145 - 59
Study of the interaction between yeast tRNAphe and yeast phenylalanyl-tRNA synthetase by monochromatic ultraviolet irradiation at various wavelengths . Advantages and limits of the method; Renaud M et al.; The interactions between yeast tRNAphe and phenylalanyl-tRNA synthetase were studied by analysis of the covalent adducts obtained upon monochromatic ultraviolet irradiation at different wavelengths (248, 282, 292, 302 and 313 nm) . The high extent of inactivation of phenylalanyl-tRNA synthetase, together with the partial modification of tRNA, as well as the peculiar instability of most of the covalent bonds formed upon irradiation constitute severe limitations to the use of the technique and to the interpretation of the results . These disadvantages led us to select an irradiation wavelength of 248 nm and to use only mild isolation procedures allowing a good recovery of the covalent adducts formed . Seven major tryptic peptides of the enzyme were found to be cross-linked to tRNAPhe whereas six major T1-oligonucleotides were covalently linked to the protein, among these, the three cross-linked oligonucleotides previously described by Shoemaker and Schimmel (J . Biol . Chem . 250 (1975) 4440-4444) in the same system . The difference in the number of covalently linked oligonucleotides is discussed in the light of the instability of the covalent linkages . The localization of the six oligonucleotides at the inside of the two branches forming the L-shaped tRNA molecule is similar to that observed in the yeast valine system (Renaud et al., Eur . J . Biochem . 101 (1979) 475-483) and is consistent with the interaction model previously described (Rich and Schimmel, Nucl . Acids Res . 4 (1977) 1649-1665 and Ebel et al . in Transfer RNA: structure, properties and recognition, (1979) pp . 325-343 Cold Spring Harbor Laboratory, NY) . The occurrence of covalent cross-linking upon irradiation in the tryptophan absorption band (302 nm) strongly suggests the participation of this residue in the stabilization of the tRNA enzyme complex.

J Biol Chem, 1981 Apr 25, 256(8), 3791 - 6
Inactivation of yeast alpha-isopropylmalate synthase by CoA . Antagonism between CoA and adenylates and the mechanism of CoA inactivation; Hampsey DM et al.; Yeast alpha-isopropylmalate synthase (EC 4.1.3.12) is inactivated by micromolar concentrations of CoA in the presence of Zn2+ . We report here that rapid reactivation of inactivated enzyme (full recovery in less than 10 min) occurred in the presence of millimolar concentrations of ATP or ADP, using permeabilized cells . With purified, CoA-inactivated enzyme, ATP had only a weak reactivating effect which increased drastically, however, when a chelator was added at a concentration (0.1 mM) which by itself had little effect . Higher concentrations of chelator (1 mM) caused rapid reactivation even in the absence of ATP . Reactivation was also possible by removing CoA from equilibrium with oxidized glutathione, with acetyl phosphate in the presence of phosphotransacetylase, or by dialysis; however, these processes were very slow . Protection against CoA inactivation of alpha-isopropylmalate synthase was provided by high concentrations of ATP and, to a much lesser extent, ADP, by a high adenylate energy charge, by chelators, and by 3'-dephospho-CoA . Enzyme which had been inactivated with {3H}CoA did not retain any radioactivity (above control) when extracted with phenol . This result, together with other observations, is interpreted to mean that inactivation does not involve covalent modification, but is more likely the result of the formation of an enzyme.CoA.zinc complex held together by noncovalent forces . The physiological significance of the CoA effect is discussed.

Biochim Biophys Acta, 1981 Apr 22, 643(1), 265 - 8
Membrane potentials in yeast cells measured by direct and indirect methods; Vacata V et al.; The membrane potential, delta psi, of various yeasts estimated from the distribution of tetraphenylphosphonium cations ranged from -50 to -120 mV, depending on species, incubation conditions and technique of measurement . Values obtained directly with a microelectrode in Endomyces magnusii were consistently lower than those determined indirectly.

Biochemistry, 1981 Apr 14, 20(8), 2141 - 50
High-resolution phosphorus nuclear magnetic resonance spectra of yeast phenylalanine transfer ribonucleic acid . Metal ion effects and tentative partial assignment of signals; Gorenstein DG et al.; The temperature and metal ion dependence of the 31P NMR spectra of yeast phenylalanine tRNA is presented, and a tentative assignment of some of the individual phosphate signals is offered . Signals A, C, F, P, and T have been assigned to the magnesium binding site of phosphates by monitoring the magnesium ion dependence in the 31P NMR spectra . In the presence of 10 mM Mg2+, specific paramagnetic line broadening effects are observed for signals A, D, E, and U upon addition of 0.001-0.1 Mn2+ ion per tRNA molecule . Through the combination of the above metal in experiments, X-ray studies, and earlier 1H and 31P NMR studies {particularly the tRNA modification 31P NMR experiments of Salemink et al . {Salemink, P..J.M., Swarthof T., & Hilbers, C.W . (1979) Biochemistry 18, 3477}}, an initial assignment of some of these signals is attempted.

J Biol Chem, 1981 Apr 10, 256(7), 3525 - 31
Expression of the "split gene" COB in yeast mtDNA . Translation of intervening sequences in mutant strains; Bechmann H et al.; This study deals with the effects that mutations in the COB region of yeast mtDNA have on the expression of mitochondrially made polypeptides . Based on the detection of two series of polypeptide chain-terminating mutations, we conclude that two proteins are specified by this region, apocytochrome b (Mr = 30,000) and a polypeptide of Mr = 42,000 . One series of mutations generates new polypeptides ranging in size from 8,000 to 29,000 daltons; all of them are precipitated by serum direct against apocytochrome b . These mutations are located in five distinct segments of the COB region, the sequences alpha to epsilon coding for apocytochrome b . The second series of mutations, generating new polypeptides ranging in size from 17,000 to 41,000 daltons, is located within the first intervening sequence (alpha/beta) of the split gene for apocytochrome b . These mutations cause premature chain termination in the COOH-terminal part of a 42,000-dalton polypeptide . Its NH2-terminal part is likely to be specified by sequence alpha and thus to be homologous to that of apocytochrome b . We conclude that the 42,000-dalton polypeptide is translated on a processing intermediate of th COB transcript by reading through sequence alpha into sequence alpha/beta . We discuss the hypothesis that this polypeptide has a function in the expression of the COB region, possibly at the level of transcript processing.

J Biol Chem, 1981 Apr 10, 256(7), 3271 - 5
Use of formylated yeast initiator Met tRNA to define the NH2-terminal residues of rat preproinsulin and pregrowth hormone; Chan SJ et al.; A method for unambiguously determining the initiator methionine residue and the adjacent NH2-terminal amino acid sequence of cell-free translation products of eukaryotic messenger RNA is described . In this procedure, the NH2 termini of nascent peptides are blocked by incorporating labeled formylmethionine instead of methionine, using yeast initiator tRNA in the wheat germ cell-free system . After immunoprecipitation of the desired product the radiolabeled material is treated with dansyl-Cl to irreversibly block all remaining free amino groups . The material is then deformylated by mild acid hydrolysis and subjected to automated Edman degradation . Only those products that had been synthesized with formylmethionine residues at their NH2-termini can then give rise to labeled phenylthiohydantoin derivatives during degradation . Using this method, we have defined the initiation sites in both rat preproinsulin and pregrowth hormone messenger RNAs.






What Is Listeria Monocytogenes?, What Is Dna?, What Is Bioreactor?, What Is Salmonella?, What Is Growth Medium?, i, Bacteriology, o, Microorganisms, n, Microorganism, e, Microbe, c, Microbes, e, Kluyveromyces, i, Microflora, o, Gram negative, c, Salmonella, i, Salmonellosis, n, Agrobacterium, o, Enterobacteriacea, a, Streptococci, c, Haemophilus, o, Saccharomyces yeast, n, Yeasts, e, Haemophilus, o, Pseudomonas, a, Microbial, r, Streptococci, e, Bacteriological, o, Escherichia coli, i, Yeasts, o, Escherichia coli, c, Candida albicans, i, Multidrug resistant




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005