|
|
Infect Immun, 1982 Jun, 36(3), 1013 - 8 Blastogenic responses of lymphocytes from mice immunized by sublethal infection with yeast cells of Histoplasma capsulatum; Tewari RP et al.; Blastogenic responses of spleen cells to histoplasmin and ribosomal antigens and to the mitogens concanavalin A . phytohemagglutinin, and lipopolysaccharide were studied in normal and immunized mice (10(5) live yeast cells of Histoplasma capsulatum given by the subcutaneous route) . Cells (10(6) per well) were cultured with and without antigens and mitogens in microtiter plates with RPMI 1640-5% heat-inactivated normal mouse serum for 72 h at 37 degrees C . Cells were harvested after a 16- to 18-h pulse with 1 microCi of {3H}thymidine (6.7 Ci/mol), and thymidine incorporation was measured by scintillation counting . The initial blastogenic response to concanavalin A (54 X 10(3) cpm) was suppressed (P less than 0.001) from 4 to 14 days post-immunization and returned to control levels on day 21 . The response to phytohemagglutinin was suppressed up to 21 days . Lipopolysaccharide responses, however, were affected to a lesser degree . Blastogenic responses to histoplasmin and H . capsulatum ribosomes were similar on day 0 in normal and immune lymphocytes, but by day 4 cells from immunized mice were more responsive (P less than 0.01) . The maximum response to H . capsulatum antigens was detected on day 42 and was 9- to 16-fold higher than in controls . These results demonstrate in vitro responses of primed lymphocytes on exposure to H . capsulatum antigens and suppressed responses to mitogens during early stages of the immune response. J Inorg Biochem, 1982 Jun, 16(3), 201 - 13 Role of magnesium cations in the yeast orotate phosphoribosyltransferase catalyzed reaction . Mechanism of the inhibition by Cu++ and Ni++ ions; Dodin G et al.; The magnesium chelate of the N(3)H tautomer of orotate, L3Mg, is the true substrate in the biosynthesis of orotidine 5'-monophosphate (OMP) catalyzed by yeast orotate phosphoribosyltransferase (OPRTase, E.C . 2.4.210) with a Michaelis constant KmL3Mg equal to 12(2) muM . It is postulated that Mg++ cations activate the transport of orotate to the active site by neutralizing the orotate charges; the ligand N(3)H is then exchanged between the incoming cation and the cation bound to the enzyme, thus ensuring the stabilization of the appropriate isomeric structure of orotate . This scheme, together with kinetic and thermodynamic data on orotate complexation by Mg++ and Ca++, accounts for the role of Ca++ cations that neither activate nor inhibit OMP synthesis . Cu++ and Ni++ inhibiting properties arise from the formation of inert complexes of orotate . Ni++ complexes have a poor affinity for the protein, whereas Cu++ complexes have a Michaelis constant similar to that of the L3Mg active species . The inertness of these complexes is tentatively understood in terms of low phosphoribosyl transfer rates as postulated from the kinetic study of the protonation of the complexes in water. Biosci Rep, 1982 Jun, 2(6), 419 - 26 Does more than one mitochondrially synthesized protein in yeast have larger precursors? Ashraf J, Jayaraman J. Yeast cells undergoing derepression (the phase of mitochondriogenesis) were exposed to {14C}formate in the presence of cycloheximide, the cytosolic protein synthesis inhibitor, and of 1,10-phenanthroline, a metallo-protease inhibitor . Extensive labelling was obtained under such conditions . Incubation of these labelled products with mitochondrial lysates released small peptides (mol . wt . 500-1000) . These results indicate that mitochondria probably synthesize some of the proteins in the precursor form and they are processed by a specific matrix-located protease before proper integration. Proc Natl Acad Sci U S A, 1982 Jun, 79(11), 3493 - 7 Construction of a yeast actin gene intron deletion mutant that is defective in splicing and leads to the accumulation of precursor RNA in transformed yeast cells; Gallwitz D; The actin gene in yeast Saccharomyces cerevisiae is interrupted by a 309-base-pair intron within the protein-coding region . By using nuclease BAL-31, several intron deletion mutants were constructed to define sequences at the 5' splice junction that are required for RNA splicing . Extensive parts of the intron can be removed without affecting correct splicing . One mutant gene from which the invariant thymidine residue in the second intron position was deleted led to the accumulation of large amounts of unspliced actin mRNA when introduced into yeast cells through a recombinant high-copy-number plasmid . No evidence for the usage of alternative splice sites was obtained. Proc Natl Acad Sci U S A, 1982 Jun, 79(11), 3428 - 32 Protein complexes from active replicative fractions associate in vitro with the replication origins of yeast 2-micrometers DNA plasmid; Jazwinski SM et al.; In a search for a replication complex, the activity that replicates the 2-micrometers yeast DNA plasmid in vitro was isolated in a high molecular weight form (Mr approximately 2 X 10(6) by gel filtration and rate-zonal sedimentation from extracts prepared from cells of the budding yeast Saccharomyces . When obtained from cells in late logarithmic cultures this material or "complex" was labile compared to that from early logarithmic cultures, and it did not survive as a complex after ammonium sulfate precipitation . This suggests that, as cultures approach stationary phase and cells cease growth, the association of its protein constituents may be altered . A chimera of 2-micrometers DNA inserted into the plasmid pBR322 was used to test for binding of components of the complex . After a brief incubation of the chimera in vitro with the high molecular weight material containing replicating activity, a protein "knob" was found associated with the 2-micrometers DNA as shown by electron microscopy . This association was not random but was limited to two positions on the plasmid . In the same series of experiments, the in vitro origins of 2-micrometers plasmid replication were also mapped . Two origins were found, consistent in position with those that have been identified in vivo . Molecules utilizing both origins simultaneously in vitro were not observed, and replication in vitro was bidirectional . The location of the origins corresponded to the positions at which the protein knobs associated with 2-micrometers DNA . This and the fact that no replicative intermediates with associated complexes were detected raises the possibility that a specific protein complex may be involved in initiation of DNA replication. Chem Phys Lipids, 1982 Jun, 30(4), 297 - 308 Changes in the plasma membrane of yeast observed by spin label electron spin resonance and caused by photodynamic attack; Collins JM et al.; Spin label electron spin resonance (ESR) was used to characterize the response of lipid regions of the plasma membrane of yeast to photodynamic attack . Following photodynamic attack, the structure of these lipid regions changed resulting in the disappearance of an apparent order-disorder phase transition as well as impeding the diffusion of the steric acid based spin label 12NS into and across the plasma membrane . We propose that singlet molecular oxygen reacting with unsaturated carbon bonds in the fatty acyl chains of lipid surrounding channel proteins leads to an increase in the order of the lipid array and/or a change in the channel protein's conformation and is the cause of the lethal effect of externally sensitized photodynamic action. Cell, 1982 Jun, 29(2), 573 - 84 Genetic properties of chromosomally integrated 2 mu plasmid DNA in yeast; Falco SC et al.; We obtained strains of yeast with large segments of 2 mu plasmid DNA integrated at several chromosomal locations by selecting genetically for recombination between a chromosomal sequence carried on a 2 mu-circle-containing hybrid plasmid and a homologous sequence on the chromosome . In all diploids examined, the presence of 2 mu circle sequences causes a marked instability of the chromosome into which the 2 mu DNA is inserted . Although in some cases the loss of genetic markers is due to physical loss of the entire chromosome, in most cases the loss of markers appears to be due to a mitotic homozygotization of markers: the allelic information from the homologous chromosome replaces the information distal to the integrated 2 mu DNA . The instability caused by integrated 2 mu DNA sequences requires the activity of the specialized site-specific recombination system encoded by the 2 mu plasmid . We propose that the presence of integrated 2 mu DNA allows efficient integration of additional copies of the intact 2 mu plasmid by the action of the plasmid-coded special recombination system . Unequal sister-strand exchanges within the inverted repetition would result in the formation of dicentric chromosomes whose breakage during mitosis might begin a cycle analogous to the breakage-fusion-bridge cycle described many years ago in maize. Biokhimiia, 1982 Jun, 47(6), 1039 - 45 {Some features of methylpyrophosphate hydrolysis by yeast inorganic pyrophosphatase}; Mel'nik MS et al.; The interaction of yeast inorganic pyrophosphatase with methylpyrophosphate was studied . In the presence of Mg2+ the rate of hydrolysis of the methylpyrophosphate-Zn2+ complex by the enzyme was shown to decrease . This was accompanied by competition of Zn2+ and Mg2+ for one site of Me2+ binding on the enzyme . The kinetics of combined hydrolysis of zinc methylpyrophosphate and zinc pyrophosphate were studied . It was found that both substrates are hydrolyzed at the same active site of the enzyme . Free methylpyrophosphate when bound to a specific phosphorylation site on the enzyme surface accelerated magnesium pyrophosphate hydrolysis . Some kinetic parameters of this hydrolysis were determined. Mol Cell Biochem, 1982 May 28, 45(1), 41 - 8 Formation of lipid-linked sugars in mycelial and yeast-like forms of Mucor rouxii; Bernard EA et al.; Cell wall fragments from both yeast-like and mycelial forms of the dimorphic fungus Mucor rouxii were used as enzymatic preparations to study the synthesis and role of prenyl-phospho-sugars in these systems . In the presence of GDP {14C} mannose two main products were formed . One of them was characterized as dolichol-monophosphate beta-mannose on the following basis: solubility in organic solvents, behaviour upon paper chromatography, DEAE cellulose column chromatography, mild acid hydrolysis, alkali treatment, catalytic reduction and phenol degradation . The other product was identified as a glycoprotein containing a single mannose unit linked to a serine or threonine residue . It was degraded with pronase and by mild NaOH-NaBH4 treatment all the radioactivity was released as free mannitol . When UDP {14C} glucose was employed as sugar donor two butanol soluble components were isolated . One of them (25%) was characterized as dolichol-monophosphate-beta-glucose on the basis of the same criteria as described above . The other one (75%) was neutral and was not studied in detail . Mycelial enzymes were about 40 times more active in the synthesis of the dolichol derivatives . In addition, large amounts of glycogen were detected . The role that both dolichol derivatives might play in glycoprotein biosynthesis is discussed. J Biol Chem, 1982 May 25, 257(10), 5800 - 8 The biogenesis and regulation of yeast mitochondria RNA polymerase; Lustig A et al.; Yeast mitochondrial RNA polymerase is a nuclear-coded protein of approximately 90,000 daltons comprised of two 45,000-dalton subunits of pI 6.9 to 7.0 . To investigate the nature of the initial translation product of the RNA polymerase, we have analyzed those products of a cell-free translation system directed by yeast RNA that are immunoreactive with antibodies to the 45,000-dalton peptide of polymerase . A precursor of one or more of the subunits of the polymerase, 2,000 daltons later than the mature product, has been characterized using immunoreaction, immunocompetition, and peptide digestion . The role of transcription of the polymerase gene in catabolite repression of mitochondrial development has been investigated by analyzing the changes in cell-free synthesis of the RNA polymerase precursor during glucose and raffinose growth . The results indicate an increase in precursor synthesis and probably in the corresponding transcript abundance during glucose derepression . In contrast, the precursor is present at high levels until stationary phase during raffinose growth . These data indicate the involvement of increased transcription of the polymerase gene in the process of derepression. Nucleic Acids Res, 1982 May 25, 10(10), 3195 - 209 In vitro transcription by purified yeast RNA polymerase II . Coarse promoter mapping on homologous cloned genes; Carnevali F et al.; Clones of the yeast Tyl element and 2 microns plasmid have been selectively transcribed in vitro by partially or completely purified yeast RNA polymerase II . Electrophoretic analysis of whole and restricted ternary transcription complexes allows the localization of the in vitro actively transcribed regions of the analyzed genes . The DNA regions that actively promote in vitro transcription correspond to the nucleotide sequence that in the Tyl element encompasses the in vivo transcription initiation sites and that in the 2 micrometer plasmid encompasses the starting codons of two oppositely oriented potential protein coding frames . The transcription assay that we describe herein may be applied to analyze rapidly the in vitro transcription of clones genes, to localize transcription initiation sites on supercoiled templates and to evaluate the differential in vitro promoter strength in RNA polymerase II served genes . Data obtained with RNA polymerase II at two different stages of purification are presented in parallel . Studies with a completely purified enzyme should certainly be preferred although the use of a partially purified RNA polymerase II may be convenient and may reveal factors which affect specificity. Nucleic Acids Res, 1982 May 25, 10(10), 3133 - 48 Molecular cloning and analysis of yeast gene for cycloheximide resistance and ribosomal protein L29; Fried HM et al.; A cosmid clone bank of yeast DNA has been used to isolate the cycloheximide resistance gene cyh2 of Saccharomyces cerevisiae . A cosmid carrying this gene was identified by cross hybridization to another cloned gene, tsm437 . The two genes, which are tightly linked genetically are both present on a 31 kb segment of cloned DNA . The cyh2 gene encodes ribosomal protein L29, a component of the large subunit . Blot hybridization analysis reveals that this gene is present as a single copy in the yeast genome, unlike many other yeast ribosomal protein genes which appear to be duplicated . The cyh2 gene also appears to contain an intervening sequence, a characteristic common to most yeast ribosomal protein genes that have been cloned. J Biol Chem, 1982 May 25, 257(10), 5866 - 72 Yeast DNA topoisomerase II . An ATP-dependent type II topoisomerase that catalyzes the catenation, decatenation, unknotting, and relaxation of double-stranded DNA rings; Goto T et al.; An activity from the yeast Saccharomyces cerevisiae, initially noted for its catalysis of aggregation of covalently closed double-stranded DNA rings in the presence of ATP, has been identified as a type II DNA topoisomerase and is designated yeast DNA topoisomerase II . The formation of the DNA aggregate, which has been shown to be a network of DNA rings that are topologically interlocked, requires the presence of a yeast DNA-binding protein in addition to the topoisomerase . In the absence of the binding protein, yeast DNA topoisomerase II catalyzes decatenation and unknotting of duplex DNA rings and the relaxation of negatively or positively supercoiled DNA . All reactions are ATP-dependent and require Mg(II) . Similar to other eukaryotic and phage T4-type II DNA topoisomerases, the yeast enzyme does not catalyze DNA supercoiling under the assay conditions employed . The activity is not sensitive to the gyrase inhibitor nalidixic acid, oxolinic acid, or novobiocin . Coumermycin inhibits the activity, however, at a concentration as low as 5 microgram/ml. Biochem J, 1982 May 1, 203(2), 523 - 5 The binding of glucose to yeast hexokinase monomers is independent of ionic strength; Mayes EL et al.; Hoggett & Kellett {Eur . J . Biochem . 66, 65-77 (1976)} have reported that the binding of glucose to the monomer of hexokinase PII isoenzyme is independent of ionic strength, in contrast to the subsequent claim of Feldman & Kramp {Biochemistry 17, 1541-1547 (1978)} that the binding is strongly dependent on ionic strength . Since measurements with native hexokinase P forms are complicated by the fact that the enzyme exists in a monomer-dimer association-dissociation equilibrium, we have now studied the binding of glucose to the proteolytically-modified S forms which are monomeric . At pH 8.5, the affinity of glucose for both SI and SII monomers is independent of salt concentration over the range of KCl concentrations 0-1.0 mol . dm-3 and is in good agreement with that of the corresponding P forms in both low and high salt . These observations confirm that the binding of glucose to hexokinase P monomers is independent of ionic strength and that the affinity of glucose for the hexokinase PII monomer is about an order of magnitude greater than that for the dimer. Clin Exp Immunol, 1982 May, 48(2), 411 - 6 Yeast opsonization in newborn infants and its relationship to parental atopy; Richardson VF et al.; Sera from 30 of 303 (9.9%) unselected term newborn infants were deficient in their ability to opsonize heat-killed baker's yeasts, an incidence which is almost double that seen in adults . Genetic influence is important in some since the mothers of 10 infants with defective opsonization showed the same defect, but it was not related to the sex or race of the infant or to the atopic state of the parents . In others the defect could be due to a functional maturation delay of the complement system, but not to inhibitory factors in neonatal serum since correction of opsonization was achieved with subopsonizing amounts of normal sera . Significantly more infants had sera with high opsonizing capacity (greater than 80% yeasts phagocytosed) when compared with adults; perhaps antibody independent immune mechanisms like this are important in the newborn . This study shows that a common specific immunodeficiency which may predispose to severe infection or atopy can be identified at birth. Cell, 1982 May, 29(1), 235 - 44 Nucleotide sequence comparisons and functional analysis of yeast centromere DNAs; Fitzgerald-Hayes M et al.; We determined the nucleotide sequence of DNA segments containing functional centromeres (CEN3 and CEN11) isolated from yeast chromosomes III and XI . The two centromere regions differ in primary nucleotide sequence, but contain structural features in common . Both centromere regions contain an extremely A + T-rich core segment 87-88 bp in length, flanked by two short sequences (14 bp and 11 bp) that are identical in both DNAs . These elements plus one additional 10 bp region of perfect homology are positioned in an almost identical spatial arrangement within the two centromere regions . Significant homologies are also observed among the sequences flanking the high A + T region and various satellite DNA sequences from higher eucaryotes, although no repeated sequences occur near the yeast centromeres . Centromere activity in vivo is maintained on relatively small DNA fragments (627 bp for CEN3 and 858 bp for CEN11), as assayed by mitotic stabilization of autonomously replicating ars plasmids in yeast. Biochimie, 1982 May, 64(5), 357 - 62 Formation of a catalytically active complex between tRNAAsp and aspartyl-tRNA synthetase from yeast in high concentrations of ammonium sulphate; Giege R et al.; The interactions of yeast tRNAAsp with cognate aspartyl-tRNA synthetase have been studied in high concentrations of either sodium chloride or ammonium sulphate by fluorescence titration and small-angle neutron scattering . In solutions containing more than 1M NaCl no complex is formed and enzymatic activity is abolished . In strong contrast, however, the physical measurements showed the formation of a two-to-one tRNA-enzyme complex, with high affinity, in 1.6 M (NH4)2SO4 . Aminoacylation assays under the same salt conditions showed the enzymatic fixation of aspartic acid to tRNAAsp to occur at an appreciable rate . The present study emphasizes that the effects of salts on protein-nucleic acid interactions do not depend only on ionic strength but also on the nature of the salt . This study has allowed a rational approach to the crystallisation of a functional tRNAAsp-aspartyl-tRNA synthetase complex (Giege, Lorber, Ebel, Thierry and Moras (1980) C.R . Acad . Sci . Paris, serie D, 291, 393-396). J Clin Microbiol, 1982 May, 15(5), 949 - 50 Peptone-yeast autolysate-fetal bovine serum 10, a simple, inexpensive liquid medium for cultivation of Leishmania spp; Palomino JC; A simple liquid medium for the cultivation of Leishmania parasites is described . Leishmania brasiliensis and Leishmania peruviana cultured in this medium reached cell densities greater than 10(7) promastigotes per ml within 7 days . This medium compares very favorably with the more complex media used to cultivate Leishmania spp . and other hemoflagellates. J Bacteriol, 1982 May, 150(2), 963 - 5 Oxygen-induced genetic changes in dry yeast cells; Hieda K; Cells of Saccharomyces cerevisiae were dried in vacuum, exposed to oxygen, nitrogen, air, and water vapor, and rehydrated with degassed medium without exposure to air . Drying per se caused few genetic changes, but the exposure of dry cells to oxygen increased the frequency of adenine-requiring colonies. Biokhimiia, 1982 May, 47(5), 864 - 8 {Different accessibility to RNase T1 of 5S- and 5.8S-rRNA in 60S subunits and 80S ribosomes of yeast}; Man'kin AS et al.; The accessibility of RNase T1 hydrolysis of small rRNAs in 60S subunits and 80S yeast cytoplasmic ribosomes was studied . It was shown that in 60S subunit 5S and 5.8S rRNAs are hydrolyzed by RNase T1, whereas in 80S ribosome no hydrolysis occurs . The participation of small rRNAs in the association of ribosomal subunits is discussed. Cell, 1982 May, 29(1), 245 - 55 Cloning yeast telomeres on linear plasmid vectors; Szostak JW et al.; We have constructed a linear yeast plasmid by joining fragments from the termini of Tetrahymena ribosomal DNA to a yeast vector . Structural features of the terminus region of the Tetrahymena rDNA plasmid maintained in the yeast linear plasmid include a set of specifically placed single-strand interruptions within the cluster of hexanucleotide (C4A2) repeat units . An artificially constructed hairpin terminus was unable to stabilize a linear plasmid in yeast . The fact that yeast can recognize and use DNA ends from the distantly related organism Tetrahymena suggests that the structural features required for telomere replication and resolution have been highly conserved in evolution . The linear plasmid was used as a vector to clone chromosomal telomeres from yeast . One Tetrahymena end was removed by restriction digestion, and yeast fragments that could function as an end on a linear plasmid were selected . Restriction mapping and hybridization analysis demonstrated that these fragments were yeast telomeres, and suggested that all yeast chromosomes might have a common telomere sequence . Yeast telomeres appear to be similar in structure to the rDNA of Tetrahymena, in which specific nicks or gaps are present within a simple repeated sequence near the terminus of the DNA. Cell, 1982 May, 29(1), 227 - 34 Recombination within the yeast plasmid 2mu circle is site-specific; Broach JR et al.; The multicopy yeast plasmid, 2mu circle, encodes a specialized recombination system . It contains two regions, each 599 bp in length, that are precise inverted repeats of each other and between which recombination occurs readily . In addition, this recombination requires the product of a 2mu circle gene, designated FLP . By examining the products of FLP-mediated recombination of plasmids containing single insertions within one of the repeated regions, we show that this recombination occurs only at a specific site within the repeat . This result was confirmed from analysis of the ability of plasmids containing various deletions within one of the repeated regions to serve as substrates for FLP-mediated recombination . These experiments limit the recombination site to a sequence of less than 65 bp . In addition, by mutational analysis of the recombination potential of a hybrid plasmid containing the entire 2mu circle genome, we have shown that FLP is only the 2mu circle gene necessary for this site-specific recombination . Finally, we describe a sensitive assay for recombination between the repeated sequences of 2mu circle; using it, we demonstrate that even in the absence of FLP gene product, recombination between the repeats occurs at a low but detectable level during meiosis. Proc Natl Acad Sci U S A, 1982 May, 79(9), 2874 - 7 Phosphorylation of the regulatory subunit of yeast cAMP-dependent protein kinase; Sy J et al.; In vitro phosphorylation of the regulatory subunit of yeast cAMP-dependent protein kinase was studied . The cAMP-binding regulatory subunit (R subunit) can be multiply phosphorylated . Three distinct phosphorylation sites were inferred from the different ATP concentrations required for phosphorylation and from the presence of two discrete mobility shifts in NaDodSO4/polyacrylamide gel electrophoresis of the R subunit on phosphorylation . Limited tryptic digestion of the phosphorylated R subunit showed that a Mr 37,000 cAMP-binding peptide contained one of the phosphorylation sites and that a separate Mr 12,000 peptide contained another phosphorylation site . The yeast R subunit is therefore similar to the type II R subunit of mammalian origin, although it has a larger Mr (64,000 vs . 58,000) and is multiply phosphorylated . In vivo, both phosphorylated and unphosphorylated forms of the R subunit were found in cells grown in lactate or to stationary phase in 1.5% glucose, while cells grown in 5% glucose contained the unphosphorylated form. Biophys Chem, 1982 May, 15(2), 169 - 76 Interaction of yeast 3-phosphoglycerate kinase with negatively charged carriers; Roustan C et al.; The aim of this study was to investigate the possibility of an interaction of yeast 3-phosphoglycerate kinase with negatively charged carriers such as polyanionic agents or a polarized electrode . Various polyanions were found to promote enzyme aggregation as judged by ultracentrifugation measurements and chemical modification . The data obtained suggest that these interactions are mediated through the N-terminal domain of the protein . However, the most striking property of 3-phosphoglycerate kinase described here is concerned with its significant dipolar moment as evidenced by electrocapillary measurements, which allows an orientation of the macromolecule in an electric field . Further, the enzyme could be absorbed by a negatively charged surface, first by hydrophobic links and then oriented perpendicularly to the surface . Therefore, the intrinsic properties of yeast 3-phosphoglycerate kinase agree with the formation of an enzyme-membrane complex and afford the ability for a specific orientation of the molecule at the lipid bilayer surface or in the cytoplasm. Biokhimiia, 1982 May, 47(5), 740 - 5 {Calorimetric assay of yeast inorganic pyrophosphatase interaction with magnesium and phosphate ions}; Vorob'eva NN et al.; The thermodynamic characteristics for the specific binding of one or two Mg2+ by the yeast inorganic pyrophosphatase and for the enzyme interaction with phosphate were determined . Saturation of the first binding site with Mg2+ causes structural rearrangements in the enzyme molecule without changing the temperature of protein denaturation . On the contrast, saturation of the second binding site results in stabilization of the system, i . e . a considerable fall in the entropy and a rise in the temperature of denaturation . Phosphorylation of the enzyme carboxylic group by inorganic phosphate requires saturation of the first binding site with Mg2+ and is not accompanied by changes in the enthalpy of the system . The pyrophosphate synthesis in the presence of the enzyme saturated with Mg2+ in both binding sites is associated with changes in the enthalpy and, possibly, in the entropy of the system. Biochim Biophys Acta, 1982 Apr 26, 697(1), 78 - 82 Stabilization of the tertiary structure of yeast phenylalanine tRNA by {Co(NH3)6}3+ . X-ray evidence for hydrogen bonding to pairs of guanine bases in the major groove; Hingerty BE et al.; The sites of three {Co(NH3)6}3+ ions bound to the phenylalanine tRNA of yeast have been determined by X-ray diffraction analysis . {Co(NH3)6}3+ binds to purine-purine sequences in yeast tRNA Phe . It is different from the binding fo Co2+, which binds to the base and phosphate of residue G15 . There are no direct metal-nucleotide bonds, although hydrogen bonding of the coordinated ammines to double-helical guanylguanosine sequences in the major groove and to phosphate oxygen in neighboring polynucleotide strands increases the stability of the structure . Hydrogen-bonding appears to be via cis ammine ligands to N(7) and O(6) positions of adjacent purine bases. Proc R Soc Lond B Biol Sci, 1982 Apr 22, 215(1198), 19 - 44 The amino acid sequence of yeast phosphoglycerate mutase; Fothergill LA et al.; The complete amino acid sequence of yeast phosphoglycerate mutase comprising 241 residues has been determined . The sequence was deduced from the two cyanogen bromide fragments, and from the peptides derived from these fragments after digestion by a number of proteolytic enzymes . Determination of this sequence now allows a detailed interpretation of the existing high-resolution X-ray crystallographic structure . A comparison of the sequence reported here with the sequences of peptides from phosphoglycerate mutases from other species, and with the sequence of erythrocyte diphosphoglycerate mutase, indicates that these enzymes have a high degree of structural homology . Autolysis of phosphoglycerate mutase by yeast extracts leads to the complete loss of mutase activity, and the formation of electrophoretically distinguishable forms (R . Sasaki, E . Sugimoto & H . Chiba, Archs Biochem . Biophys . 115, 53-61 (1966)) . It is apparent from the amino acid sequence that these changes are due to the loss of an 8-12 residue peptide from the C-terminus. Experientia, 1982 Apr 15, 38(4), 427 - 9 Reactivation of yeast glucose-6-phosphate dehydrogenase denaturated by saturated fatty acids; Tortora P et al.; Activity of yeast glucose-6-phosphate dehydrogenase, inactivated by treatment with saturated fatty acids, can be partially restored by incubation in a medium of suitable ionic composition . The effectiveness of ions in the reactivation process is inversely related to their 'chaotropic' properties . Time-dependence of reactivation extent suggests a 2-step mechanism of enzyme inactivation and the existence of an intermediate form that aggregates through a 2nd-order reaction, producing irreversibly inactive enzyme. Biochim Biophys Acta, 1982 Apr 13, 715(2), 143 - 50 Purification and properties of a transketolase responsible for formaldehyde fixation in a methanol-utilizing yeast, candida boidinii (Kloeckera sp.) No . 2201; Kato N et al.; Dihydroxyacetone synthase, present in methanol-grown Candida boidinii (Kloeckera sp.) No . 2201, catalyzes the transfer of the glycolaldehyde group from xylulose 5-phosphate to formaldehyde to form glyceraldehyde 3-phosphate and dihydroxyacetone . This enzyme was purified to electrophoretic homogeneity and found to be a new type of transketolase . The molecular weight of the enzyme was estimated to be 190,000 by gel filtration . The enzyme appeared to be composed of four identical subunits (Mr, 55,000) . Thiamin pyrophosphate and Mg2+ were required for the activity . The optimum pH was found to be 7.0 . With xylulose 5-phosphate as the ketol-donor, aliphatic aldehydes (C1-C7), glycolaldehyde and glyceraldehyde were better acceptors than ribose 5-phosphate . The kinetic data were consistent with a ping-pong bi-bi mechanism . The Km values obtained were as follows: xylulose 5-phosphate, 1.0 mM; formaldehyde, 0.43 mM; glyceraldehyde 3-phosphate, 0.42 mM; and dihydroxyacetone, 0.52 mM. J Biol Chem, 1982 Apr 10, 257(7), 4001 - 6 Spontaneous spatiotemporal organization in yeast extracts; Jacobsen H et al.; Stirred cytoplasmic extracts of the yeast Saccharomyces uvarum can, on addition of trehalose, display oscillations in the metabolite concentrations . Unstirred extracts may also develop spatiotemporal structures expressed in the metabolite concentrations . In this paper we present evidence of the existence of such patterns . The latter were recorded using the optical absorption of NADH in an annular cuvette, which was rotated in a photometer . Regularly spaced wavelike spatiotemporal standing waves were observed . At certain fixed points the NADH concentration appeared to remain constant . Such phenomena may improve our understanding of biochemical morphogenesis. Nucleic Acids Res, 1982 Apr 10, 10(7), 2439 - 51 Induced hydrolytic activity of yeast phenylalanyl-tRNA synthetase by tRNAPhe-CC; Kuhn W et al.; "Induced hydrolysis" a new hydrolytic activity, was found by measuring AMP-production during aminoacylation of tRNAPhe-CCA by yeast phenylalanyl-tRNA synthetase in the presence of tRNAPhe-CC under conditions of low ionic strength at pH 8.5 . Experiments using the elongation factor Tu . GTP provide evidence that transfer of phenylalanine to the tRNAPhe-CCA is followed by rapid hydrolysis in the presence of tRNAPhe-CC . A simple mechanism shows good agreement with the experimental data. Nucleic Acids Res, 1982 Apr 10, 10(7), 2419 - 37 Carbodiimide modification analysis of aminoacylated yeast phenylalanine tRNA: evidence for change in the apex region; Fritzinger DC et al.; The G- and U-specific reagent, carbodiimide was used to probe the solution structure of aminoacylated yeast phenylalanine tRNA . Both quantitative and qualitative changes in modification were observed when the modification patterns of tRNA-CCA(3'OH), tRNA-CCA(3'NH2) and phe-tRNA-CCA(3'NH2) were compared . Five nucleotides were modified in all cases, D16 and G20 in the D-loop, U33 and Gm34 in the anticodon loop and U47, in the region of the extra arm . Small changes occurred in the D-loop with incorporation of the adenosine analogue manifest as new, low levels of modification of G22 (D-stem) and a loss of sensitivity to Mg+2 in modification of D16 . Aminoacylation resulted in new modification of G19, modification of a residue in the T psi CG sequence, and a 2.5-fold increase in modification of G22 . Taken together the results show that aminoacylation causes increased exposure of bases in the apex region of the L-shaped molecule where the D- and psi-loops are joined . The effects observed could occur as a consequence of stable or dynamic changes in conformation. Nucleic Acids Res, 1982 Apr 10, 10(7), 2199 - 207 Binding of rat ribosomal proteins to yeast 5.8S ribosomal ribonucleic acid; Lee JC et al.; 5.8 S RNA-protein complexes were prepared using purified yeast 5.8 S RNA and proteins from the large ribosomal subunit of rat liver . Formation of such hybrid complexes, as measured by Millipore filtration, was dependent on protein concentration . Binding of proteins to the RNA could approach saturation . Such complexes were isolated from sucrose density gradient centrifugation and shown to contain proteins L6, L8, L19, L35 and L35a . These proteins were identified by their molecular weights on polyacrylamide gels containing dodecylsulfate and their mobilities on two dimensional polyacrylamide gels. Gene, 1982 Apr, 18(1), 29 - 37 Ribosomal protein genes of yeast contain intervening sequences; Bollen GH et al.; From a colony bank of HindIII-generated yeast DNA fragments we have isolated a number of recombinant DNAs carrying genes for ribosomal proteins (e.g., S10, S16A, S20, S24, S31, S33, L16, L25 and L34) of the yeast Saccharomyces carlsbergensis . By electron microscopic analysis of the R-loops formed between various DNA fragments and yeast mRNA, we could locate the ribosomal protein genes on the physical maps of the cloned DNA fragments . The R-loop structures observed indicate that a number of the ribosomal protein genes contain an intervening sequence. Biokhimiia, 1982 Apr, 47(4), 546 - 51 {Kinetics of NAD-dependent formate dehydrogenase from the methanol-utilizing yeast Candida methylica}; Zaks AM et al.; A kinetic analysis of the mechanism of action of NAD-dependent formate dehydrogenase (EC 1.2.1.2) from the methanol-utilizing yeast Candida methylica has been carried out . The dependence of the initial reaction rate on substrate concentrations and the inhibition by the reaction products and substrate analogs were investigated . The data obtained suggest that the kinetics of the formate dehydrogenase action are consistent with the formation of a ternary enzyme--substrate complex . NAD is the first substrate and NADH is the last product of the reaction, respectively. Mol Cell Biol, 1982 Apr, 2(4), 346 - 54 Yeast killer plasmid mutations affecting toxin secretion and activity and toxin immunity function; Bussey H et al.; M double-stranded RNA (MdsRNA) plasmid mutants were obtained by mutagenesis and screening of a diploid killer culture partially heat cured of the plasmid, so that a high proportion of the cells could be expected to have only on M plasmid . Mutants with neutral (nonkiller {K-}, immune {R+}) or suicide (killer {K+}, sensitive {R-} phenotypes were examined . All mutants became K- R- sensitives on heat curing of the MdsRNA plasmid, and showed cytoplasmic inheritance by random spore analysis . In some cases, M plasmid mutations were indicated by altered mobility of the MdsRNA by agarose gel electrophoresis or by altered size of in vitro translation products from denatured dsRNA . Neutral mutants were of two types: nonsecretors of the toxin protein or secretors of an inactive toxin . Of three neutral nonsecretors examined, one (NLP-1), probably a nonsense mutation, made a smaller protoxin precursor in vitro and in vivo, and two made full-size protoxin molecules . The in vivo protoxin of 43,000 molecular weight was unstable in the wild type and kinetically showed a precursor-product relationship to the processed, secreted 11,000-molecular-weight toxin . In one nonsecretor (N1), the protoxin appeared more stable in a pulse-chase experiment, and could be altered in a recognition site required for protein processing. Gene, 1982 Apr, 18(1), 47 - 59 The nucleotide sequence of the HIS4 region of yeast; Donahue TF et al.; We have determined the nucleotide sequence of the yeast HIS4 gene and its 5' and 3' flanking sequences . The protein chain has a calculated Mr-value of 87 935 . Th 5' end of the HIS4 transcript maps at a position 63 bp upstream from the site of initiation of protein synthesis . The 3' end of the HIS4 transcript maps at a position approx . 118 bp after the UAG termination codon . There is no evidence for intervening sequences within the transcription unit . Functional sub-regions within the HIS4 coding frame have been identified by determining the sequence changes for various his4 mutations. Mutat Res, 1982 Apr, 104(1-3), 79 - 86 The use of a yeast strain with a temperature-sensitive DNA ligase to estimate DNA repair after exposure to mutagens; Tippins RS et al.; The yeast strain cdc9 which possesses a temperature-sensitive DNA ligase, was used to estimate DNA repair after mutagen exposure . Following low UV fluences, single-strand breaks in DNA were detected after an incubation at the restrictive temperature but were absent at the permissive temperature . These DNA breaks were shown to be equal to the number of pyrimidine dimers induced in DNA as measured by the presence of UV-endonuclease sensitive sites . Similarly, after exposure to the chemical mutagen 4-chloromethyl-biphenyl (4CMB) single-strand breaks accumulated at the restrictive temperature . Hence the technique described should be applicable for the estimation of the early steps of repair of a wide range of different types of DNA damage induced in yeast by exposure to either physical or chemical mutagens. Eur J Biochem, 1982 Apr 1, 123(2), 267 - 74 Affinity labelling of yeast phenylalanyl-tRNA synthetase with a 3'-oxidised tRNAPhe . Isolation and sequence of the labelled peptide; Renaud M et al.; Yeast phenylalanyl-tRNA synthetase was specifically labelled with a 3'-oxidised tRNAPhe . Stoichiometric inactivation was achieved with the incorporation of 2 mol oxidised tRNA Phe/mol enzyme which corresponds exactly to the stoichiometry of tRNA binding . The labelled peptide has been isolated using a quick chromatographic procedure which can be applied to any covalent complex formed between a tRNA and an aminoacyl tRNA synthetase . The isolated peptide (18 amino acids) was found to encompass the unique cysteine sequence of the smaller beta subunit of the enzyme. J Clin Microbiol, 1982 Apr, 15(4), 723 - 4 Aniline blue-containing buffered charcoal-yeast extract medium for presumptive identification of Legionella species; Holmes RL; By utilizing buffered charcoal-yeast extract medium containing 0.01% aniline blue in conjunction with a long-wave UV light, the differentiation of five species of Legionella was facilitated . L . pneumophila, when grown on this medium, did not absorb the aniline blue dye; however, L . micdadei, L . dumoffii, L . bozemanii, and L . gormanii absorbed the dye in varying amounts and produced colonies of various shades of blue. J Cell Biol, 1982 Apr, 93(1), 217 - 22 Ultrastructural organization of yeast chromatin; Rattner JB et al.; The ultrastructural organization of yeast chromatin was examined in Miller spread preparations of samples prepared from spheroplasts or isolated nuclei of Saccharomyces cerevisiae . Micrographs from preparations dispersed in 1 mM Tris (pH 7.2) illustrate that the basic chromatin fiber in yeast exists in two ultrastructurally distinct conformations . The majority (up to 95%) of the chromatin displays a beaded nucleosomal organization, although adjacent nucleosomes are separated by internucleosomal linkers of variable lengths . Ribonucleoprotein (RNP) fibrils are only occasionally associated with chromatin displaying the conformation . The remaining 5-10% of the chromatin appears to be devoid of discrete nucleosomes and has a smooth contour with a fiber diameter of 30-40 A . Transcriptional units, including putative ribosomal precursor RNA genes, defined by the presence of nascent RNP fibrils are restricted to chromatin displaying this smooth morphology . Chromatin released from nuclei in the presence of 5 mM Mg++ displays higher-order chromatin fibers, 200-300 A in diameter, these fibers appear to be arranged in a manner than reflects the two forms of the basic chromatin fiber. Arch Tierernahr, 1982 Apr, 32(4), 267 - 75 {Carcinogenicity test in long-term bioassay of Fermosin-yeast grown on petroleum hydrocarbons}; Schramm T et al.; To test "fermosinR'-yeast grown on petroleum hydrocarbons for carcinogenic potency the product was fed chronically at a dietary level of 15% to male and female rats (Wistar) . Animals of the control group received the Institute's stock diet, similar to the yeast diet but without "fermosinR' . Feeding of "fermosinR'-diet did not affect the incidence nor the latency period nor the type of tumors compared with the control rats . Studies in mice (XVII) included two separate experiments . In the first one the dorsal skin of the animals was painted by extracts from yeast twice weekly and treated with the co-carcinogenic agent croton oil once a week . In the second experiment the mice were painted by extracts from pork of animals feed with "fermosinR' . The results obtained in rats and in mice did not reveal any evidence for carcinogenic potency of "fermosinR'-yeast. Genetics, 1982 Apr, 100(4), 565 - 77 Determination of the order of gene function in the yeast nuclear division pathway using cs and ts mutants; Moir D et al.; Cold-sensitive (cs) and heat-sensitive (ts) conditional-lethal mutations that affect specifically the cell division cycle of budding yeast (Saccharomyces cerevisiae) were used to determine the order of gene function . Reciprocal temperature-shift experiments using cs-ts double mutants revealed a detailed order of function among genes whose execution points and mutant phenotypes are very similar . The data suggest that the nuclear branch of the overall cell-cycle pathway itself contains at least one branch. Genetics, 1982 Apr, 100(4), 547 - 63 Cold-sensitive cell-division-cycle mutants of yeast: isolation, properties, and pseudoreversion studies; Moir D et al.; We isolated 18 independent recessive cold-sensitive cell-division-cycle (cdc) mutants of Saccharomyces cerevisiae, in nine complementation groups . Terminal phenotypes exhibited include medial nuclear division, cytokinesis, and a previously undescribed terminal phenotype consisting of cells with a single small bud and an undivided nucleus . Four of the cold-sensitive mutants proved to be alleles of CDC11, while the remaining mutants defined at least six new cell-division-cycle genes: CDC44, CDC45, CDC48, CDC49, CDC50 and CDC51.--Spontaneous revertants from cold-sensitivity of four of the medial nuclear division cs cdc mutants were screened for simultaneous acquisition of a temperature-sensitive phenotype . The temperature-sensitive revertants of four different cs cdc mutants carried single new mutations, called Sup/Ts to denote their dual phenotype: suppression of the cold-sensitivity and concomitant conditional lethality at 37 degrees . Many of the Sup/Ts mutations exhibited a cell-division-cycle terminal phenotype at the high temperature, and they defined two new cdc genes (CDC46 and CDC47) . Two cold-sensitive medial nuclear division cdc mutants representing two different cdc genes were suppressed by different Sup/Ts alleles of another gene which also bears a medial nuclear division function (CDC46) . In addition, the cold-sensitive medial nuclear division cdc mutant csH80 was suppressed by a Sup/Ts mutation yielding an unbudded terminal phenotype with an undivided nucleus at the high temperature . This mutation was an allele of CDC32 . These results suggest a pattern of interaction among cdc gene products and indicate that cdc gene proteins might act in the cell cycle as complex specific functional assemblies. Proc Natl Acad Sci U S A, 1982 Apr, 79(7), 2355 - 9 Isolation and characterization of yeast mutants deficient in adenylate cyclase and cAMP-dependent protein kinase; Matsumoto K et al.; Mutants of Saccharomyces cerevisiae that require cAMP for growth have been isolated . Some of the mutants isolated were deficient in adenylate cyclase activity and mapped at a locus, cyr1, located near the centromere of chromosome X . Growth of cells carrying the cyr1 mutation was arrested at the G1 phase of the yeast cell cycle in the absence of cAMP . The cyr1 mutation was suppressed by a secondary mutation designated bcy1 . The bcy1 mutation bypassed the need for cAMP for growth . The bcy1 mutants had extremely low levels of cAMP-binding protein and cAMP-dependent protein kinase but produced a high level of cAMP-independent protein kinase . The results indicate that cAMP is an essential factor for yeast cells to proceed through the cell cycle via the activation of protein kinase. J Biol Chem, 1982 Mar 25, 257(6), 3203 - 10 Temperature-sensitive yeast mutants deficient in asparagine-linked glycosylation; Huffaker TC et al.; A {3H}mannose suicide selection has been used to isolate mutants in yeast which contain temperature-sensitive defects in asparagine-linked glycosylation . The surviving cells were screened at the nonpermissive temperature for a decreased ability to incorporate {3H}mannose and for defects in glycosylation of the secreted protein invertase . One of these mutants (alg1-1) has been characterized and found to be blocked in the assembly of the lipid-linked oligosaccharide precursor . The alg1-1 cells synthesize mannosyl compounds at 60% of the wild type level at the nonpermissive temperature and 105% of the wild type level at the permissive temperature . In vivo labeling experiments have demonstrated that alg1-1 cells are able to synthesize GlcNAc2-lipid but are unable to synthesize any mannose-containing oligosaccharide-lipids . This result was confirmed by in vitro labeling of yeast membranes . When incubated with UDP-{3H}GlcNAc, alg1-1 membranes synthesized GlcNAc2-lipid but failed to elongate it when GDP-Man was added . The alg1-1 membranes also failed to elongate exogenous GlcNAc2-lipid but were able to convert Man1GlcNAc2-lipid to Man5-Glc-NAc2-lipid in the presence of GDP-Man . These results indicate that the alg1-1 mutant is blocked specifically in the addition of the first mannose residue to the lipid-linked oligosaccharide precursor. J Biol Chem, 1982 Mar 25, 257(6), 2822 - 8 AMP deaminase reaction as a control system of glycolysis in yeast . Activation of phosphofructokinase and pyruvate kinase by the AMP deaminase-ammonia system; Yoshino M et al.; The role of AMP deaminase (EC 3.5.4.6) reaction in the stimulation of the regulatory enzymes of glycolysis was investigated using permeabilized yeast cells . 1) The addition of polyamine activated AMP deaminase in situ, resulting in the subsequent increase in ammonium production, which can stimulate the activity of 6-phosphofructokinase (EC 2.7.1.11) and pyruvate kinase (EC 2.7.1.40) . 2) Zn2+ inhibited AMP deaminase activity, followed by a decrease in ammonium ion concentration which reduced the activity of phosphofructokinase . 3) Polyamine and Zn2+ did not activate or inhibit directly the activity of phosphofructokinase and pyruvate kinase . 4) A simple Michaelis-Menten relationship was observed between the various levels of ammonium ion and of fructose 1,6-biphosphate formed in situ, indicating that phosphofructokinase activity or glycolytic flux was dependent upon the level of ammonium produced through the action of AMP deaminase . 5) The increase in Pi concentration resulted in the decreased magnitude of activation by NH4+ and marked stimulation by Pi itself of phosphofructokinase, and further reduced the production of NH4+ through the inhibition of AMP deaminase, suggesting that phosphofructokinase activity may not be regulated by the level of NH4+ but by Pi concentration under conditions of increased Pi levels . The AMP deaminase-ammonium system shows a regulatory function in glycolysis of yeast cells in the presence of physiological Pi levels, whereas glycolysis may be principally controlled by Pi level under the conditions of elevated Pi concentration . Polyamines may play a part in the stimulation of glycolysis through the elevated level of ammonium ion under the conditions of increased ATP utilization during cell proliferation, and can participate in the catabolic processes as well as anabolic processes through the stimulation of the AMP deaminase-ammonium system. Mol Cell Biochem, 1982 Mar 19, 43(2), 89 - 95 Calculation of half-lives of proteins in vivo . Heterogeneity in the rate of degradation of yeast proteins; Gancedo JM et al.; A method is given for the calculation of half-lives of proteins in vivo from the measurement of the decrease of radioactivity in pulse-labelled proteins with time . This method could be particularly useful for the study of the degradation of proteins in cells that have a low growth rate . The method applied to growing yeast indicates that there are two major classes of protein . The class with low turnover constitutes the bulk of yeast protein and has a half-life of 160 h in a medium with glucose or galactose and of 50 h in a medium with ethanol . The class of proteins with high turnover (half-life between 0.8 and 2.4 hours) represents from 1% of total protein in yeast growing on glucose to 7% in yeast growing on ethanol . It is shown that some proteins which are depressed during growth on ethanol or induced during growth on galactose are particularly susceptible to degradation in a medium which contains glucose . It is proposed that protein degradation is regulated by a coarse control at the level of protease activity and a fine control on the susceptibility of individual proteins to proteases. Biochemistry, 1982 Mar 16, 21(6), 1295 - 302 Substrate synergism and the kinetic mechanism of yeast hexokinase; Viola RE et al.; Michaelis constants for MgATP with yeast hexokinase vary from 28 microM with D-mannose to above 4 mM for the slow ATPase reaction, with the different values reflecting the degree of synergism in binding of MgATP and the sugar substrate . The best substrates show the greatest synergism, but the correlation is not exact . Similar synergistic binding between MgADP or its methylene analogue and phosphorylated sugars is seen . Product inhibiton of MgADP vs . MgATP and vice versa appears noncompetitive at low levels of variable substrate but becomes competitive at high levels . These patterns show that MgATP can combine with E-glucose-6-P (Ki = 4 mM) and MgADP with E-glucose (Ki = 1.6 mM) . Isotope partitioning studies with glucose or glucose-6-P have determined the rates of release of these substrates from binary and ternary complexes and, together with reverse isotope exchange studies and the product inhibition studies mentioned above, have shown that the kinetic mechanism is a somewhat random one in which dissociation of sugars from productive ternary complexes is very slow, but release from nonproductive ternary complexes occurs at rates similar to those from binary enzyme-sugar complexes . D-Arabinose-5-P has a Km of 4.6 mM and a Vmax 5% that for glucose-6-P, confirming that the high Km for D-arabinose in the forward direction is caused by the low proportion in the furanose form . The dissociation constant of MgADP in the absence of sugars was determined from the Ki of 5.8 mM for MgADP as a competitive inhibitor vs . MgATP of the slow ATPase reaction. Nucleic Acids Res, 1982 Mar 11, 10(5), 1661 - 78 Separation and sequence of the 3' termini of M double-stranded RNA from killer yeast; Thiele DJ et al.; Four subspecies of M double-stranded RNA from a killer strain of Saccharomyces cerevisiae were isolated . Each subspecies were susceptible to heat cleavage, presumably at an internal 190 base pair A,U-rich region, generating two discrete fragments corresponding to each side of the A, U-rich region . Enzymatic and chemical RNA sequence analysis defined the 3'-terminal 175 bases for the larger fragment (M-1) and 231 bases for the smaller fragment (M-2) . All four subspecies of M have identical size and 3'-terminal sequences . Potential translation initiation codons are present on the corresponding 5' termini of both fragments, and a possible 18S ribosomal RNA binding site is also present on the 5' terminus of M-1 . Stem and loop structures for the 5' and 3' termini of M-1 may function as recognition sites for replication, transcription, and translation. Nucleic Acids Res, 1982 Mar 11, 10(5), 1625 - 33 Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast; Sor F et al.; The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene . In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences . The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3') . We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast . When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA . Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae . The 5' and 3' terminal structures of all these sequences are highly constant. Biochemistry, 1982 Mar 2, 21(5), 855 - 61 Enzymatic replacement of the anticodon of yeast phenylalanine transfer ribonucleic acid; Bruce AG et al.; An efficient procedure for the replacement of the anticodon and the adjacent hypermodified nucleotide (residues 34-37) of yeast tRNAPhe with any desired oligoribonucleotide sequence has been developed . The four residues are removed by chemical cleavage at Y-37 and partial ribonuclease A digestion at U-33 . An oligonucleotide is inserted in three steps by using T4 RNA ligase and T4 polynucleotide kinase . When different oligonucleotides are inserted, both the size of the loop and the sequence of nucleotides in the anticodon region of this tRNA can be varied . The ability of the different anticodon loop substituted tRNAs to be aminoacylated by yeast phenylalanyl-tRNA synthetase is dependent upon the sequence of the oligonucleotide inserted . This suggests that there is an important interaction between the anticodon region of yeast tRNAPhe and its synthetase. Mikrobiologiia, 1982 Mar-Apr, 51(2), 220 - 3 {Action of ozone on the membrane-dependent functions of Candida utilis yeast cells}; Konev SV et al.; The action of ozone on the structural-functional state of plasmic membranes was studied with Candida utilis cells . The damage of the membranes resulting in disorders of permeability barriers for nucleotides was not identical to damages which made the cells stained with methylene blue . The curve for the damage of membrane integrity (staining with methylene blue) coincided with the curve for the survival of C . utilis cells; therefore, the bacterial action of ozone consists mainly in damaging the surface cell structures. Biochem J, 1982 Mar 1, 201(3), 473 - 9 The molecular composition of the volutin granule of yeast; Jacobson L et al.; The volutin granule was isolated from yeast by disruption of freeze-dried cells in an organic solvent and density-gradient-gradient centrifugation . The granule is composed of two types of macromolecule, a linear-chain polyphosphate and four basic proteins, of molecular weights ranging from 10 000 to 20 000 . In the dissolved granule these macromolecules are in a complex that is uniform by hydrodynamic criteria (s20,w = 22.3 S) . The polyphosphate separated from this complex gives a single 31P n.m.r . resonance and in the analytical ultracentrifuge behaves as a monodisperse solute of molecular weight 245 000 +/- 1000 . In the 31P n.m.r . spectrum of yeast used for its isolation, this polyphosphate accounts for 14% of total cell polyphosphate. Scand J Immunol, 1982 Mar, 15(3), 297 - 304 The cytotoxic effect of mouse macrophages stimulated in vitro by a beta-1,3-D-glucan from yeast cell walls; Bogwald J et al.; Macrophages stimulated by an insoluble beta-1,3-D-glucan from yeast cell walls were able to destroy tumour cells as measured by the release of radioactive label from prelabelled 14C-thymidine cells . Target cells were B-16 melanoma, P-815 mastocytoma, and the L-929 cell line . A significant target cell killing by macrophages stimulated by glucan was observed after 72-96 h . The cytolysis of L-929 cells was investigated in some detail . No stable soluble cytolytic factor appeared to be released into the medium during the stimulation of macrophages by glucan, since cell-free spent medium had no cytotoxic effect on L-929 cells . The densities of the macrophage monolayers were critical for an effective target cell killing; dense cultures showed more cytotoxicity than less dense cultures . The kinetics of the development of macrophage-mediated cytotoxicity suggests a minimum stimulation period of 4 days for maximal cytolysis. Cell, 1982 Mar, 28(3), 551 - 61 Directionality of yeast mating-type interconversion; Klar AJ et al.; The mating-type a and alpha alleles of the yeast Saccharomyces cerevisiae interconvert by a transposition-substitution reaction where replicas of the silent mating loci, at HML and HMR, are transmitted to the expressed mating-type locus (MAT) . HML is on the left arm and HMR on the right arm, while MAT is in the middle of chromosome III . Cells with the genotype HML alpha HMRa switch mating type efficiently at a frequency of about 86% . Since well over 50% of the cells switch, it is thought that switches do not occur randomly, but are directed to occur to the opposite mating-type allele . In contrast, we report that strains possessing the reverse HMLa HMR alpha arrangement switch (phenotype) inefficiently at a maximum of about 6% . The basis for this apparent reduced frequency of switching is that these strains preferentially yield futile homologous MAT locus switches--that is, MATa to MATa and MAT alpha to MAT alpha--and consequently, most of these events are undetected . We used genetically marked HM loci to demonstrate that alpha cells preferentially choose HMR as donor and a cells preferentially choose HML as donor, irrespective of the genetic content of the silent loci . Because of this feature, HML alpha HMRa strains generate predominantly heterologous while HMLa HMR alpha strains produce predominantly homologous MAT switches . The control for directionality of switching therefore is not at the level of transposing heterologous mating-type information, but only at the level of choosing HML versus HMR as the donor . In strains where the preferred donor locus is deleted, the inefficient donor becomes capable of donating efficiently . Thus the preference seems to be mediated by competition between the HM loci for donating information to MAT. Proc Natl Acad Sci U S A, 1982 Mar, 79(5), 1484 - 7 The two yeast histone H2A genes encode similar protein subtypes; Choe J et al.; The sequences of the two histones H2A genes in the yeast Saccharomyces cerevisiae have been determined . These genes encode two histone H2A subtypes which are 131 amino acids in length but differ at 2 amino acid positions: an Ala leads to Thr and a Thr leads to Ala change at positions 124 and 125 . Thus, the two histone H2A subtypes have identical amino acid compositions . The coding regions of the two H2A genes are homologous at 369 of 393 bases (94%), with all but 2 of the 24 changes being silent . There is only 30% homology in the 5' flanking sequences of the two H2A genes . Like other eukaryotic histone genes, the yeast H2A genes are not interrupted by intervening sequences . When the yeast H2A histones are compared to those from other eukaryotes, there is at least 80% homology in amino acid sequence. Mutat Res, 1982 Mar, 93(1), 83 - 100 The oxygen effect in haploid and diploid yeast strains of different sensitivities; Mock G et al.; The extent of the oxygen effect for cell survival was studied in diploid and haploid wild-type yeast and in mutants belonging to the rad2, rad6 and rad50 epistatic group . In haploids, reduced oxygen enhancement ratios were found in rad52, rad6 and rad18 . The latter two also showed some influence of the mating type . In diploids the oxygen effect was decreased in rad2, rad52 and rad18. Chem Biol Interact, 1982 Mar 1, 39(1), 1 - 15 Toxicity, interstrand cross-links and DNA fragmentation induced by 'activated' cyclophosphamide in yeast: comparative studies on 4-hydroperoxy-cyclophosphamide, its monofunctional analogon, acrolein, phosphoramide mustard, and nor-nitrogen mustard; Fleer R et al.; Activated cyclophosphamide (CP) is known to achieve its cytotoxic and alkylating capacity upon spontaneous hydrolytic breakdown of the oxazaphosphorine ring structure . Treatment of yeast cells with the chemically activated form of CP (4-hydroperoxy-CP, 4-OOH-CP) and with several potentially toxic cleavage products revealed that cytotoxicity is closely linked to the formation of DNA interstrand cross-links and to DNA fragmentation . While this holds true for 4-OOH-CP and its bifunctional alkylating breakdown products, phosphoramide mustard (PM) and nor-nitrogen mustard (NNM), equimolar concentrations of acrolein and the monofunctional analogon of activated CP were inactive . NNM, the ultimate cleavage product within the successive degradation of the oxazaphosphorine structure was five times more toxic than 4-OOH-CP, whereas the cytotoxic action of PM was only slightly enhanced . The high cytotoxicity of NNM was matched by its ability to induce DNA interstrand cross-links: at concentrations and treatment times producing equal cell killing, 4-OOH-CP and NNM produced the same extent of cross-linking and DNA fragmentation . Biochemical potency of NNM is in contrast to data found with the NBP colorimetric assay which suggest that NNM loses its alkylating activity at neutral pH . 4-OOH-CP and PM are much more stable than predicted from half-life measurements performed via the NBP colorimetric assay: they retain a considerable fraction of their cytotoxic and cross-linking activity in spite of a 12-h preincubation at pH 7 and 36 degrees C. Genetics, 1982 Mar, 100(3), 387 - 412 A new mapping method employing a meiotic rec-mutant of yeast; Klapholz S et al.; A rapid new mapping method has been developed for localizing a dominant or recessive mutation to a particular chromosome of yeast . The procedure utilizes the ability of strains homozygous for the spo11-1 mutation to undergo chromosome segregation without appreciable recombination during sporulation . The level of sporulation in spo11-1/spo11-1 diploids is reduced and asci are often immature or abnormal in appearance; spore viability is less than 1% . The first step of the mapping procedure is the construction of a haploid spo11-1 strain carrying a recessive drug-resistance marker and the unmapped mutation(s) . This strain is crossed to a set of three spo11-1 mapping tester strains containing, among them, a recessive marker on each chromosome . The resulting spo11-1/spo11-1 diploids are sporulated and plated on drug-containing medium . Viable meiotic products that express the drug-resistance marker due to chromosome haploidization are selectively recovered . These meiotic products are haploid for most, but generally not all, chromosomes . The level of disomy for individual chromosomes averages 19% . Each of the recessive chromosomal markers is expressed in approximately a third of the drug-resistant segregants . Ninety-eight percent of these segregants show no evidence of intergenic recombination . Thus, two markers located on the same chromosome, but on different homologs, are virtually never expressed in the same drug-resistant clone . The utility of this mapping procedure is demonstrated by confirming the chromosomal location of seven known markers, as well as by the assignment of a previously unmapped mutation, spo12-1, to chromosome VIII . In addition, the analysis of the products of spo11-1 meiosis indicates that several markers previously assigned to either chromosome XIV or chromosome XVII are actually on the same chromosome. Cell, 1982 Mar, 28(3), 563 - 73 DNA sequence required for efficient transcription termination in yeast; Zaret KS et al.; The cyc1-512 mutation is a 38 base pair deletion in the 3' nontranslated region of the CYC1 locus in the yeast Saccharomyces cerevisiae . The deletion occurred between two 7 bp directly repeated sequences . The cyc1-512 mutant produces approximately 10% of the normal amount of the CYC1 gene product, iso-1-cytochrome c, and produces 5%--10% of the normal steady-state amount of CYC1 mRNA . Most of the mRNAs in cyc1-512 are longer at their 3' ends by up to 1000 nucleotides, suggesting that the 38 bp deletion in cyc1-512 prevents proper transcription termination . The improper transcription termination is shown to cause converging transcription between CYC1 and an adjacent gene . The fact that all of the aberrantly sized mRNAs in cyc1-512 are polyadenylated leads us to suggest that polyadenylation may be coupled to transcription termination in yeast . We have uncovered a consensus sequence between the region deleted in cyc1-512 and the 3' nontranslated regions of some but not all yeast genes, and discuss the possible role of this sequence in transcription termination. Proc Natl Acad Sci U S A, 1982 Mar, 79(5), 1583 - 7 Suppressor of yeast mitochondrial ochre mutations that maps in or near the 15S ribosomal RNA gene of mtDNA; Fox TD et al.; A polypeptide chain-terminating mutation in the yeast mitochondrial oxi 1 gene has been shown to be an ochre (TAA) mutation by DNA sequence analysis . Mitochondrially inherited revertants of this mutation include two types: In the first, the ochre codon has been changed to a sense codon by further mutation in the oxi 1 gene while, in the second, the ochre codon is still present, indicating the occurrence of an extrageneic ochre suppressor mutation . This mitochondrial ochre suppressor, termed MSU1, has been "cloned" in rho- strains of yeast and tested against other oxi 1 mutations . Several additional mutations are also suppressible, and those examined so far are also ochre mutations . MSU1 does not suppress known frameshift or missense mutations at oxi 1 . Isoelectric focusing of the gene product (cytochrome oxidase subunit II) from a suppressed-mutant strain indicates that suppression does not involve insertion of charged amino acids . Physical mapping of the mtDNA retained in the MSU1-carrying rho- clones localizes the suppressor mutation to the gene coding the 15S rRNA or a site not more than 300 base pairs from it . No known tRNA genes occur this close to the 15S rRNA gene, and mtDNA from a suppressor-carrying rho- does not hybridize detectably to mitochondrial tRNAs . These results suggest that MSU1 may be an alteration in the 15S rRNA. J Biol Chem, 1982 Feb 25, 257(4), 1902 - 5 Interaction between yeast beta-(1 goes to 3)glucan synthetase and activating phosphorylated compounds . A kinetic study; Notario V et al.; Yeast beta-(1 goes to 3)glucan synthetase is stimulated by ATP or GTP . The structural requirements for the activation were investigated by testing several phosphorylated compounds . The simplest substance with stimulatory ability was inorganic pyrophosphate . Addition of a nucleoside, as in GDP, decreased the concentration required for half-maximal stimulation; a third phosphate group, as in GTP, further enhanced the stimulatory capacity . On the other hand, esterification of the terminal phosphate of GTP with a nucleoside or a methyl group led to a total loss of activating ability: dinucleoside triphosphates and the gamma-phosphate methyl ester of GTP acted as competitive antagonists of the activators . alpha,beta- and beta,gamma-imino and -methylene derivatives of both ATP and GTP stimulated the enzymatic activity, suggesting that activation can occur without covalent transfer either of the terminal phosphate or pyrophosphate, or of the nucleotidyl residue . The stimulatory effect of the beta,gamma-imino derivatives of ATP and GTP was not additive . The inhibition constants obtained with gamma-phosphate esters of GTP were the same for either one of the two imino analogs . It is concluded that adenosine and guanosine derivatives bind to the same domain of the enzyme . It is also postulated that activators may interact with the enzyme or with a regulatory protein at two locations, a binding site for the nucleoside moiety and a "functional" site for the pyrophosphate residue. Mycopathologia, 1982 Feb 19, 77(2), 69 - 73 Cysteine-independent and cysteine-requiring yeast-strains of Histoplasma capsulatum; Jacobson ES et al.; Recently we described a strain of Histoplasma capsulatum, designated H-35, which is able to grow as yeast on a minimal medium consisting of inorganic salts, glucose and a trace of biotin . Using this strain as a prototrophic wild type we sought auxotrophic mutants . Mutagenized yeast-cells were starved for inorganic sulfate in sulfur-free minimal medium . Sulfate was then added, and growing prototrophic cells were killed by addition of amphotericin B . After 24 hours non-growing auxotrophs were 'rescued' by removal of amphotericin and addition of yeast extract . This 'mutant enrichment' cycle was repeated two additional times, after which the cells were plated on blood agar and 800 yeast-colonies were picked . Seventeen of these yeast-strains required cysteine for growth, as compared with strain H-35, which grew as yeast on minimal medium. Nucleic Acids Res, 1982 Feb 11, 10(3), 1093 - 6 Isolation and structure of a yeast initiator tRNAmet gene; Venegas A et al.; Sixteen bacterial clones containing yeast initiator tRNAmet genes have been isolated . The size of the BamHI fragments encoding these genes ranges from 4,000 to 23,000 base pairs . The nucleotide sequence of one member of this group has been determined . It has no intervening sequences. J Biol Chem, 1982 Feb 10, 257(3), 1149 - 55 Studies of the kinetic mechanism of hypoxanthine-guanine phosphoribosyltransferase from yeast; Ali LZ et al.; An assay procedure, utilizing high pressure liquid chromatography, has been designed which allows both reactions catalyzed by hypoxanthine-guanine phosphoribosyltransferase to be monitored simultaneously . Using this procedure and the theories described by Huang (Huang, C . V . (1979) Methods . Enzymol . 63, 486-500) for alternate substrate kinetic analysis, we have determined that purified hypoxanthine-guanine phosphoribosyltransferase from yeast catalyzes the formations of both IMP and GMP through the use of an Ordered Bi Bi kinetic mechanism, and that guanine is highly preferred over hypoxanthine as substrate in the forward reaction . This proposed kinetic mechanism has been confirmed using flow dialysis experiments in which a binary enzyme-5-phosphoribosyl-alpha-1-pyrophosphate complex was characterized but where enzymic complexes, with either guanine or hypoxanthine, were not detected . Also consistent with this kinetic mechanism was our observation that an exchange of label between {14C}guanine or {14C}hypoxanthine and their respective nucleotides (GMP and IMP) was not catalyzed by hypoxanthine-guanine phosphoribosyltransferase . However, a significant exchange of label between {32P}pyrophosphate and 5-phosphoribosyl-alpha-1-pyrophosphate is observed upon incubation with this enzyme, suggesting that hypoxanthine-guanine phosphoribosyltransferase may exist, in part, as a phosphoribosyl-enzyme complex in the presence of 5-phosphoribosyl-alpha-1-pyrophosphate. Genetics, 1982 Feb, 100(2), 159 - 74 {HOK}, a new yeast non-Mendelian trait, enables a replication-defective killer plasmid to be maintained; Wickner RB et al.; The K1 killer plasmid, {KIL-k1}, of Saccharomyces cerevisiae is a 1.25 x 10(6) dalton linear double-stranded RNA plasmid coding for a protein toxin and immunity to that toxin . The {KIL-sd1} plasmid is a replication-defective mutant of {KIL-k1} that depends on one of the recessive chromosomal superkiller (ski-) mutations for its maintenance (Toh-e and Wickner 1979) . This report concerns a means by which {KIL-sd1} can be stably maintained in a SKI+ host . Strains carrying a plasmid we call {HOK} (helper of killer) stably maintain {KIL-sd1} . {HOK} segregates 4 {HOK}:0 in meiotic crosses and is efficiently transferred by cytoplasmic mixing (heterokaryon formation) . {HOK} depends for its maintenance on the products of PET18, MAK3, and MAK10, three chromosomal genes needed to maintain {KIL-k1}, but is independent of 10 other MAK genes and of MKT1 . {HOK} is not mitochondrial DNA and is unaffected by agents which convert psi+ strains to psi- . {HOK} is also distinct from the previously described plasmids {URE3}, 20S RNA, 2 mu DNA, and {EXL} . Strains lacking {HOK} consistently have a four-fold lower copy number of L double-stranded RNA than strains carrying {HOK}. Can J Biochem, 1982 Feb, 60(2), 100 - 7 pH dependence of free and immobilized yeast alcohol dehydrogenase kinetics; Mazid MA et al.; A study was made of the influence of pH on the reaction between NAD and ethanol, catalyzed by yeast alcohol dehydrogenase, both in free solution and attached to the inner surface of a nylon tube . A new least-squares analysis of the results has been devised; it is simpler to apply and is more realistic than those previously employed . Analysis of the results for the free enzyme indicated that the free enzyme has two active ionizing groups having pK values of about 6.6 and 8.8 . These pK values undergo only small changes when the enzyme is bound to NAD and when it is bound to both NAD and ethanol . With the immobilized enzyme and saturating concentrations of ethanol the rates went through a maximum as the pH was varied from 6.5 to 10.0 . With saturating concentrations of NAD there was a steady increase in rate, with no falling off at pH 10 . Immobilization generally brought about an increase in the pK values . These increases are attributed partly to a residual negative surface charge which attracts the leaving H+ ions . They are also attributed partly to the formation in the reaction of H+ ions, which cause the local pH to be lower than that in the bulk solution . This effect is more important with saturating NAD ions, since the buffer anions will then be less mobile and less able to mediate the movement of protons. Biochimie, 1982 Feb, 64(2), 113 - 26 The hierarchical approach to the DNA stability problem . II . Some applications and speculations with yeast mitochondrial DNA as an example; Michel F et al.; As discussed in the preceding article {1} hierarchical analysis of DNA sequences should make it possible to treat complex unfolding (and refolding) processes involving both equilibrium and non-equilibrium subtransitions . Hence a variety of actual experimental situations may be analyzed . This is demonstrated with the help of a 1950 bp yeast mitochondrial DNA sequence encompassing part of the 21S ribosomal RNA gene: excellent fit of complex denaturation and renaturation profiles is achieved with only two adjustable parameters . The advantage of dealing with objectively defined stability units is also apparent when stability profiles are compared to known functional maps: striking correlations may be brought out and their possible significance is briefly discussed. Proc Natl Acad Sci U S A, 1982 Feb, 79(3), 786 - 9 Localization of genes for the double-stranded RNA killer virus of yeast; Welsh JD et al.; The M double-stranded RNA (ds RNA) genome segment of the cytoplasmically inherited killer virus of yeast codes for two polypeptides when denatured and translated in vitro: a previously known 32,000-dalton peptide and a newly discovered 19,000-dalton peptide (NaDodSO4/polyacrylamide gel electrophoresis) . An internal 190-base-pair region of the ds RNA is selectively degraded by S1 nuclease treatment at 65 degrees C, resulting in two ds RNA fragments which contain the termini of the original ds RNA . The larger fragment codes for the 32,000-dalton polypeptide and the smaller fragment codes for the 19,000-dalton polypeptide . Thus, the two gene products of M are encoded by distinct regions of this ds RNA. Jpn J Exp Med, 1982 Feb, 52(1), 1 - 7 Direct activation of human adherent cells by yeast cell wall in vitro; Mashiba H et al.; Adherent cells from human peripheral blood could be activated by cocultivation with yeast cell wall for 3 days and the acid phosphatase activity of these cells was elevated . Lymphocyte response to phytohemagglutinin (PHA) was reduced in the presence of yeast cell wall ranging from 0.1 microgram/ml to 1000 micrograms/ml . When the activated adherent cells were added to non-adherent cells or the cells from lymphoid cell line (HD-10), derived from Hodgkin's disease, DNA synthesis of these target cells was suppressed . The supernatants from the activated adherent cells were also inhibitory to the proliferation of the cell line . It is suggested that this in vitro system is useful in investigating the mechanisms of macrophage activation and the roles of macrophages in immune responses. Biokhimiia, 1982 Feb, 47(2), 323 - 8 {Methylpyrophosphate, the simplext organic substrate of yeast inorganic phyrophosphatase}; Mel'nik MS et al.; The interaction between yeast inorganic pyrophosphatase and the simplest organic substrate, methylpyrophosphate, was studied . Methylpyrophosphate hydrolysis occurred most intensively in the presence of Zn2+ less intensively in the presence of CO2+ and Mn2+ and did not occur at all in the presence of Mg2+ . The complex convertible into reaction products contains two Zn2+ and one molecule of zinc methylpyrophosphate per one active center . The activator metal ions are linked with pyrophosphatase consecutively; each of the two enzyme forms produced can bind to the substrate . The values of the maximal velocity and the constants of the substrate binding to the pyrophosphatase were calculated. Nucleic Acids Res, 1982 Jan 22, 10(2), 513 - 24 Evidence for ribosomes involved in splicing of yeast mitochondrial transcripts; Schmelzer C et al.; We have investigated the processing of transcripts of the split gene COB in yeast mitochondrial DNA from cells whose mitochondrial translation was blocked by chloramphenicol for several generations of cell growth . First analysis of transcripts by electrophoresis and RNA/DNA-hybridization clearly showed that cell growth in the presence of CAP leads to an inhibition of processing yielding an increasing amount of splicing intermediates of the COB transcript and decreasing amounts of the 18S mRNA coding for apocytochrome b . This observation is in accordance with the now widely favoured idea that mitochondrial proteins are involved in splicing of COB transcripts and that their reduction should hamper processing and - therefore - lead to an accumulation of pre-mRNAs . However, further information obtained by pulse-labeling of pre-mRNA in vivo in the presence of CAP for various times shows that even 30 minutes after addition of CAP a reduction of the processing rate is obtained . Based on these findings we conclude that maturation of mtRNAs is not only dependent on mitochondrial proteins, but also on a more direct interaction of the translation machinery and RNA processing whose nature is so far unknown. Biochemistry, 1982 Jan 19, 21(2), 309 - 16 Regulation of the nuclear-coded peptides of yeast cytochrome c oxidase; Lustig A et al.; We have analyzed the catabolite regulation of cytochrome oxidase by assaying changes in the synthesis of precursors of the nuclear-coded peptides (IV--VII) of cytochrome c oxidase in an in vitro reticulocyte cell-free system programmed with RNA isolated from cells grown in either glucose or raffinose . As a first step, we have characterized antibodies which bind to the precursors of subunits V and VI . Initial translation products for subunits IV and VII have also been tentatively identified by utilizing these antibodies . The messenger RNAs coding for the precursors of the nuclear-coded subunits fall in the expected size range of 8--15 S . Catabolite repression of the nuclear-coded oxidase peptides appears to be regulated by the abundance of their messenger RNAs . Translation of messenger RNA isolated from yeast cells grown on glucose indicates a coordinate and uniform increase in precursor synthesis during glucose derepression . In contrast, when RNA isolated from raffinose (derepressed) grown cells is used to direct cell-free translation, precursor abundance is high throughout growth, although the synthesis of some of the species changes in a complex pattern of ratio and abundance . These data indicate that the abundance of the messengers for the nuclear-coded precursors is regulated in a fashion dependent on the physiologic state of the cell. J Biol Chem, 1982 Jan 10, 257(1), 39 - 41 Overproduction and control of the LEU2 gene product, beta-isopropylmalate dehydrogenase, in transformed yeast strains; Hsu YP et al.; Two transformed yeast strains, 21D/pYT14-LEU2 and AH22/CV9-2, were found to produce beta-isopropylmalate dehydrogenase to such an extent that the enzyme constitutes 2 and 1%, respectively, of the total extractable protein . This is 30 and 15 times, respectively, above wild type level . beta-Isopropylmalate dehydrogenase was purified from strain 21D/pYT14-LEU2 to a purity of about 95% in essentially three steps . Strain 21D/pYT14-LEU2 carries the LEU2 gene on a vector that also contains the yeast 2-micrometers plasmid and therefore replicates autonomously, whereas strain AH22/CV9-2 carries multiple copies of the LEU2 gene integrated at its normal chromosomal location . Despite the different genetic arrangements, regulation of LEU2 gene expression by leucine and leucine plus threonine was normal . Immunotitration showed that the decrease in specific activity caused by leucine and threonine corresponded to a decrease in immunoreactive material. J Am Coll Nutr, 1982, 1(3), 263 - 74 Effect of high-chromium brewer's yeast on human serum lipids; Elwood JC et al.; A group of 11 normolipidemic and a group of 16 hyperlipidemic adult subjects were given orally 20 gm daily of a high-chromium brewer's yeast (2.4 micrograms Cr+++/gm, ie, 48 micrograms Cr+++ daily) for 8 weeks . A significant decrease in total cholesterol in both groups of subjects was observed (24-26 mg/dl) . High density lipoprotein cholesterol (HDL-C) was significantly increased (5-6 mg/dl) in normo- and hyperlipidemic subjects by brewer's yeast supplementation . However, following supplementation, the triglyceride blood levels were not changed in either the normo- or hyperlipidemic group . When the multiple complex risk factor (total cholesterol/HDL-C) was calculated, 84% of all subjects receiving brewer's yeast showed a decrease in this ratio, and the mean decrease in this ratio in all subjects was significant at P less than 0.01 . A second group of 19 normolipidemic, predominantly male, adult subjects was given orally 10 gm of a high-chromium brewer's yeast (2.4 micrograms/gm, ie, 24 micrograms Cr+++ daily) for 8 weeks . The total circulating serum cholesterol was significantly decreased by a modest amount in this group after supplementation . The HDL-C levels were significantly increased (4 mg/dl) . The total cholesterol/HDL ratio was decreased in 79% of the subjects, and the mean TC/HDL-C decrease of the entire group was significant at P less than 0.01. J Immunopharmacol, 1982-83, 4(4), 265 - 78 Inhibition of yeast phagocytosis by dexamethasone in macrophage cultures: reversibility of the effect and enhanced suppression in cultures of stimulated macrophages; Grasso RJ et al.; This investigation was initiated to characterize further the ability of 1 microM dexamethasone to suppress the ingestion of heat-killed Saccharomyces cerevisiae particles in cultures of murine resident peritoneal macrophages . Time course studies revealed that the inhibitory response required the continual presence of the steroid in the culture medium . In addition, increased inhibitory responses occurred after dexamethasone was supplied to previously untreated cultures of resident macrophages that became stimulated by differentiating in vitro . These findings indicate that glucocorticoids act directly on macrophages to decrease their phagocytic capacity, which in vivo would reduce host resistance. Prog Clin Biol Res, 1982, 102 Pt C, 65 - 74 Structure and function of yeast acid phosphatase; Mildner P et al.; A pronounced heterogeneity of purified acid phosphatase has been observed . The size heterogeneity which was demonstrated by electrophoretic methods is in agreement with the finding that the enzyme preparation contains families of molecules differing in the carbohydrate content (38% - 70%) . The charge heterogeneity was shown by isoelectric focusing indicating the existence of several slightly different protein chains in the enzyme preparation . It was found that the enzyme is a dimer with a mean molecular weight of 252000 Daltons . There are 16 N-glycosidically linked carbohydrate chains, differing in size from 15-150 mannose units, and a very small amount of O-glycosidically linked mannose . Properties of acid phosphatase deglycosilated by treatment with beta-endo-N-acetylglucosaminidase, were compared with the native enzyme and it was found that the carbohydrate chains do not play a direct role in the catalytic activity of the enzyme, but stabilize the tridimensional structure of the molecule . A drastic increase of sensitivity of the deglycosilated enzyme against proteolysis was found. Z Allg Mikrobiol, 1982, 22(7), 503 - 5 The temperature profile of growth, death and yield of the starch-converting yeast Lipomyces kononenkoae; Spencer-Martins I et al.; A strain of Lipomyces kononenkoae earlier proposed for industrial starch bioconversion was found to have a dissociative temperature profile . The Arrhenius plot of sustained exponential growth displayed a single branch between the optimum (32-33 degrees C) and the maximum (about 35 degrees C) temperature for growth while the extrapolated Arrhenius plots of growth and thermal death intersected at a biologically non-significant value . The yield of L . kononenkoae on glucose did not decrease at supraoptimal temperatures while the associative yeast Saccharomyces cerevisiae suffered yield decreases above the optimum temperature for growth with increasing temperature. Z Allg Mikrobiol, 1982, 22(7), 477 - 86 {Polysaccharide structure of cell wall preparations from the food protein yeast Candida spec . H}; Nuske J et al.; More than 27% of the cell wall are unstably bound components: Proteophosphomannan as a main polysaccharide of the cell wall, mannose and manno-oligosides which are bound to peptides or phosphate . 19% are glycosidically linked with a phosphate bridge or O-glycosidically (Ser/Thr) linked with the protein which is covalently bound to the cell wall . Besides mannose and glucose, manno-oligosides and gluco-oligosides are involved in this linkage . A preparation consisting of glucan and chitin remains after careful degradation . It contains (1,2)-, (1,3)- and (1,6)- linked glucose, (1, 2, 3)-, (1, 2, 6)- or (1, 3, 6)-glucose-branchpoints and (1,4)-linked N-acetylglucosamine. Folia Microbiol (Praha), 1982, 27(4), 242 - 4 Long-term preservation of yeast cultures in liquid nitrogen; Hubalek Z et al.; Nineteen strains of taxonomically diverse yeast species tested survived freezing and subsequent five-year storage in liquid nitrogen at - 196 degrees C, using a medium M 2 composed of malt extract, yeast extract, peptone, calf serum and dimethyl sulfoxide . Viability of the yeast cultures after long-term storage ranged from 5 to 97% (average 62%) compared with the viability of the cultures prior to freezing . The use of liquid nitrogen refrigeration for preserving yeast cultures is strongly advocated. Z Allg Mikrobiol, 1982, 22(1), 29 - 40 {Mannan localization with concanavalin A in conjunction with electron microscopy and chemical analysis of differently prepared cell walls of the food protein yeast Candida spec . H}; Fischer W et al.; Regions of different electron densities after concanavalin A-peroxidase-reaction have been observed in cell walls of intact cells as well as in isolated cell walls: In the peripheral region of intact cell walls two mannan layers appear . Treating isolated cell wall with pronase, NaOH, ethylendiamine or citrate buffer, respectively, we find on A binding spots in the inner cell wall regions which appear electron transparent in the untreated cell walls . Apparently the mannan component of the inner cell wall regions is masked by proteins . In correspondence with chemical analysis our results cannot confirm the existence of inner cell wall regions which are free of mannan. Z Naturforsch {C}, 1982 Jan-Feb, 37(1-2), 102 - 6 Immobilization of yeast cells by radiation-induced polymerization; Fujimura T et al.; Radiation-induced polymerization method was applied to the immobolization of yeast cells . The effects of irradiation, cooling and monomer, which are necessary for polymerization, were recovered completely bu subsequent aerobic incubation of yeast cells . The ethanol productive in immobilized yeast cells increased with the increase of aerobic incubation period . The growth of yeast cells in immobilized yeast cell was indicated . The maximum ethanol productivity in immobilized yeast cell system was around three times as much as that in free yeast cell system. Z Allg Mikrobiol, 1982, 22(3), 175 - 83 {Use of dielectrophoresis for the preparative separation of thermotolerant yeast cells}; Krause G et al.; Dielectrophoresis as a new method for preparative separation of cells is being presented . This method responds to differences in the polarization of cells, which correlate with a number of complex physiological properties of cells . It is shown that yeast cells of different thermotolerant properties can be differentiated by dielectrophoresis . Moreover, the application of this method permitted to separate cells with a high selectivity, which produce more biomass at a temperature of 40 degrees C than the initial population . Investigations on the ability of cells to survive in an inhomogeneous a.c . field have shown that the number of dead cells at frequencies of 10(5) cps and 10(6) cps and at field strengths (on the surface of the central electrode) below 2.4 X 10(5) V/m is small . This fact should be considered when picking out suitable separation conditions. Mol Gen Genet, 1982, 185(3), 506 - 9 Cell cycle inhibition of yeast spheroplasts; Murakami S et al.; Osmotically stabilized yeast spheroplasts are capable of extensive DNA synthesis . Although the rate of DNA synthesis in spheroplasts is approximately one-third that of intact cells, the relative amounts of nuclear and mitochondrial DNA synthesized by spheroplasts is very similar to the relative amounts synthesized by intact cells . Furthermore, nuclear but not mitochondrial DNA synthesis is inhibited in MATa spheroplasts by the application of the yeast mating pheromone, alpha-factor . Similarly, DNA synthesis is reversibly temperature-sensitive in spheroplasts created from cdc7 and cdc8 mutant cells. Genetics, 1982 Jan, 100(1), 19 - 33 Regulatory mutations of inositol biosynthesis in yeast: isolation of inositol-excreting mutants; Greenberg ML et al.; The enzyme inositol-1-phosphate synthase (I-1-P synthase), product of the INO1 locus, catalyzes the synthesis of inositol-1-phosphate from the substrate glucose-6-phosphate . The activity of this enzyme is dramatically repressed in the presence of inositol . By selecting for mutants which overproduce and excrete inositol, we have identified mutants constitutive for inositol-1-phosphate synthase as well as a mutation in phospholipid biosynthesis . Genetic analysis of the mutants indicates that at least three loci (designated OPI1, OPI2 and OPI4) direct inositol-mediated repression of I-1-P synthase . Mutants of these loci synthesize I-1-P synthase constitutively . Three loci are unlinked to each other and to INO1, the structural gene for the enzyme . A mutant of a fourth locus, OPI3, does not synthesize I-1-P synthase constitutively, despite its inositol excretion phenotype . This mutant is preliminarily identified as having a defect in phospholipid synthesis. Mol Gen Genet, 1982, 185(2), 367 - 8 Pentose phosphate pathway mutants of yeast; Lobo Z et al.; A glucose-negative mutant of Saccharomyces cerevisiae lacking 6-phosphogluconate dehydrogenase, the second enzyme of the pentose phosphate pathway, has been obtained by inositol starvation . Suppression of this mutant for growth on glucose takes place by the loss of glucose 6-phosphate dehydrogenase . A lesion in the latter enzyme alone leaves growth practically unaffected . The mutations define the respective structural genes. Comp Biochem Physiol B, 1982, 71(4), 577 - 82 Comparative studies on the kinetic parameters and product analyses of chicken and rat liver and yeast fatty acid synthetase; Aprahamian SA et al.; 1 . Comparative kinetics and product analyses of chicken and rat liver and yeast fatty acid synthetase . 2 . Vmax's for the three enzymes studied decrease with increasing primer chain-length, while Km's (except for yeast) increases . 3 . Palmitate is the main product (approximately 90%) of the rat synthetase whereas palmitate (60%) and stearate (40%) are the products of chicken and yeast enzymes . Increasing the primary chain length does not alter palmitate synthesis by rat and chicken enzymes but increases stearate synthesis by the yeast synthetase . 4 . The three synthetases could not synthesize fatty acids in the absence of primer acetyl-CoA suggesting that malonyl-CoA decarboxylase is not a component. Cell, 1982 Jan, 28(1), 145 - 54 Two differentially regulated mRNAs with different 5' ends encode secreted with intracellular forms of yeast invertase; Carlson M et al.; The SUC2 gene of yeast (Saccharomyces) encodes two forms of invertase: a secreted, glycosylated form, the synthesis of which is regulated by glucose repression, and an intracellular, nonglycosylated enzyme that is produced constitutively . The SUC2 gene has been cloned and shown to encode two RNAs (1.8 and 1.9 kb) that differ at their 5' ends . The stable level of the larger RNA is regulated by glucose; the level of the smaller RNA is not . A correspondence between the presence of the 1.9 kb RNA and the secreted invertase, and between the 1.8 kb RNA and the intracellular invertase, was observed in glucose-repressed and -derepressed wild-type cells . In addition, cells carrying a mutation at the SNF1 locus fail to derepress synthesis of the secreted invertase and also fail to produce stable 1.9 kb RNA during growth in low glucose . Glucose regulation of invertase synthesis thus is exerted, at least in part, at the RNA level . A naturally silent allele (suc2 degrees) of the SUC2 locus that does not direct the synthesis of active invertase was found to produce both the 1.8 and 1.9 kb RNAs under normal regulation by glucose . A model is proposed to account for the synthesis and regulation of the two forms of invertase: the larger, regulated mRNA contains the initiation codon for the signal sequence required for synthesis of the secreted, glycosylated form of invertase; the smaller, constitutively transcribed mRNA begins within the coding region of the signal sequence, resulting in synthesis of the intracellular enzyme. Basic Life Sci, 1982, 19, 305 - 29 Functional mutants of yeast alcohol dehydrogenase; Wills C et al.; Selection of petite strains of yeast (that is, strains unable to respire aerobically) on media containing allyl alcohol will result in enrichment for mutants at the ADC1 locus . This locus codes for the constitutive alcohol dehydrogenase, ADH-I, which is primarily responsible for the production of ethanol in yeast . The mutant enzymes are functional, and confer resistance to allyl alcohol on the cell by shifting the NAD-NADH balance in the direction of NADH . These mutants exhibit altered Km's for cofactor, substrate, or both, and often have altered Vmax's . In this paper, the methodology for obtaining these mutants and for determining the amino acid substitutions responsible for these changes is presented . Several new mutants have been at least approximately localized, and one, DB-AA3-N15, has been shown to be due to the substitution of an arginine for a tryptophan at position 54 . This substitution would be expected, by analogy with the known tertiary structure of the horse liver alcohol dehydrogenase, to decrease the hydrophobic environment of the active site pocket . The substitution has a pronounced effect on the Km for ethanol, but far less on that for acetaldehyde . The current status of investigation of other classes of functional mutants of this enzyme, and the potential both for selection of useful variants of this molecule and for an increase understanding of its function are discussed. Mutat Res, 1982 Jan-Feb, 100(1-4), 145 - 51 The effects of BC, 4CMB and 4HMB upon the induction of mitotic gene conversion in yeast; Parry JM; Both BC and 4CMB but not 4HMB were shown to be capable of inducing mitotic gene conversion in exponential phase cultures of the JDI strain of the yeast Saccharomyces cerevisiae . The results obtained indicate that in terms of the relative frequency of genetic events per lethal event 4CMB was more active than BC in this test system. Mutat Res, 1982 Jan-Feb, 100(1-4), 113 - 7 A comparison of the response to 4CMB, 4HMB and BC of 5 yeast strains differing in their radiosensitivities; North TA et al.; The test compounds 4CMB, 4HMB and BC were assayed for their genotoxicity using stationary phase cultures of 5 yeast strains which differ in their mutagen sensitivity . It was found that 4HMB produced no differences in survival between the 5 strains whereas 4CMB and BC caused more lethality in the triple red strain than the other 4 strains . The results indicate that both BC and 4CMB are capable of inducing DNA damage which results in cell lethality in the repair-deficient triple mutant. J Membr Biol, 1982, 64(3), 175 - 9 Anilinonaphthalene sulfonate fluorescence and amino acid transport in yeast; Slavik J et al.; Fluorescence of 1-anilinonaphthalene-8-sulfonate in yeast membranes appears to be caused predominantly by binding to lipids (ANS protein:ANS lipid approximately 1 : 20) as indicated by the fluorescence lifetime, degree of polarization, and excitation spectra . It was insensitive to short-circuiting the membrane potential . Fluorescence intensity increased as cells (especially after pretreatment with energy donors such as glucose) were exposed to some amono acids, in particular, aspartic and glutamic acids . The character of fluorescence shifted to that of protein-bound ANS, suggesting an exposure of new protein sites accessible to the probe . This shift could be prevented by inhibitors of energy transduction as well as of transport . The K1/2 of the shift was at 2.5 mM aspartic acid. Mol Gen Genet, 1982, 188(2), 179 - 83 Development of the genetic map of the yeast Saccharomycopsis lipolytica; Ogrydziak D et al.; Tetrad and random spore analyses have been used to further develop the genetic map of Saccharomycopsis lipolytica . Mutations in 23 new nuclear genes have been isolated . Eight genes have been located on linkage fragment 1, 4 on fragment 2, 2 on fragment 5 and 3 on fragment 6 . Linkage fragments 3 and 4 have been shown to be linked, and this fragment now contains 12 markers . A tentative map of the linkage fragments 1 and 3 is presented (Fig . 1) . Markers exhibiting possible centromere linkage have been identified . Interference estimates suggest that there is little interference in S . lipolytica. Peptides, 1982 Jan-Feb, 3(1), 31 - 5 Relationship of yeast-injection induced changes in brain met-enkephalin and analgesia; Chipkin RE et al.; Subplantar injection of Brewer's yeast induces a hyperalgesia that is associated with an increase in the level of striatal Met-enkephalin (ME); there was no change in the hypothalamus of periaqueductal gray . To test the relationship between striatal ME and analgesia, naloxone (10, 3, 0.5 mg/kg, SC) or thiorphan (100 micrograms, ICV) were administered . Neither drug caused a potentiation or a reduction in the hypersensitivity . These data suggest that an increase in striatal does not result in altered pain sensitivity in this model. Folia Microbiol (Praha), 1982, 27(5), 350 - 3 Immunological changes after long-term feeding of germfree piglets with protein isolates and yeast cell walls from Candida utilis as food additives; Fencl Z et al.; Germfree piglets were fed a diet supplemented with cell walls and a protein isolate from Candida utilis for 54 days . Besides morphological signs of activation of the lymphoid tissue which occurred primarily in the intestine of piglets which had been fed yeast cell walls, even an increased serum immunoglobulin level could be detected . In sera and intestinal content of piglets fed both with cell walls and isolated protein, specific antibodies capable of agglutinating yeasts were present . Even though a limited number of experimental animals was employed it can be concluded that the yeast material added to the diet elicited an immune response. EMBO J, 1982, 1(12), 1635 - 40 Sequence and structure of yeast phosphoglycerate kinase; Watson HC et al.; The structure of yeast phosphoglycerate kinase has been determined with data obtained from amino acid sequence, nucleotide sequence, and X-ray crystallographic studies . The substrate binding sites, as deduced from electron density maps, are compatible with known substrate specificity and the stereochemical requirements for the enzymic reaction . A carboxyl-imidazole interaction appears to be involved in controlling the transition between the open and closed forms of the enzyme. Physiol Chem Phys, 1982, 14(4), 315 - 22 Isolation of yeast nuclei . Evidence of chromatin-associated proteolytic activity; Ruggieri S et al.; Purified yeast nuclei contain proteolytic activities which are associated with chromatin . pH optimum is in the range 8.0--8.5 . Partial purification reveals the presence of three fractions corresponding to different molecular weights . Boiled chromatin supernatants are able to inhibit proteolytic activity . The inhibition effect of various compounds is also described . The purity of the chromatin preparation seems to rule out artifacts due to contamination. Chromosoma, 1982, 87(1), 125 - 32 The ultrastructural meiotic phenotype of the radiation sensitive mutant rad 6-1 in yeast; Kundu SC et al.; An ultrastructural analysis of three yeast rad 6-1/rad 6-1 diploids on sporulation medium for 0, 6, 10, and 24 h shows that arrest occurs at meiotic prophase . Two strains, CL 139 and PU 6, fail to complete chromosome synapsis based on the continued presence of single chromosomal cores in arrested nuclei . A clone derived from CL 139, however, showed complete pairing as evident from the presence of 17 synaptonemal complexes . All three strains underwent spindle pole body duplication but the poles failed to form a proper metaphase I spindle . A revertant Rad 6+ isolated from CL 139 showed normal chromosome behaviour and normal kinetic functions . It is concluded that the absence of meiotic recombination in some Rad 6- strains may result from asynapsis, but that in other strains (e.g., CL 139s) recombination fails in spite of complete synapsis . In all cases the lack of sporulation is adequately explained by failure of the kinetic apparatus to form a metaphase I spindle. Acta Biochim Pol, 1982, 29(1-2), 159 - 73 Replication of the 2-micrometer DNA plasmid of yeast; Jazwinski SM; The 2-micrometer DNA plasmid of yeast provides an useful probe for the analysis of the factors involved in the initiation of chromosomal DNA replication in the cell division cycle . Cell-free extracts prepared from growing yeast cells stimulate DNA replication directed by this plasmid . The plasmid |