|








| |
Journal of Bacteriology, August 2004, p . 5311-5320, Vol . 186,
No . 16
Molecular Analysis of Cytolysin A (ClyA) in Pathogenic Escherichia coli
Strains
Albrecht Ludwig,1* Christine von
Rhein,1 Susanne Bauer,2 Christian Hüttinger,1,2,
and Werner Goebel2
Institut für Medizinische Mikrobiologie, Klinikum der Johann Wolfgang
Goethe-Universität, 60596 Frankfurt am Main,1 Lehrstuhl für
Mikrobiologie, Theodor-Boveri-Institut für Biowissenschaften (Biozentrum),
Universität Würzburg, Am Hubland, 97074 Würzburg, Germany2
Received 5 December 2003/ Accepted 12 May 2004
Cytolysin A (ClyA) of Escherichia coli is a pore-forming hemolytic
protein encoded by the clyA (hlyE, sheA) gene that
was first identified in E . coli K-12 . In this study we
examined various clinical E . coli isolates with regard to the
presence and integrity of clyA . PCR and DNA sequence analyses
demonstrated that 19 of 23 tested Shiga toxin-producing E . coli
(STEC) strains, all 7 tested enteroinvasive E . coli (EIEC)
strains, 6 of 8 enteroaggregative E . coli (EAEC) strains, and
4 of 7 tested enterotoxigenic E . coli (ETEC) strains possess a
complete clyA gene . The remaining STEC, EAEC, and ETEC strains
and 9 of the 17 tested enteropathogenic E . coli (EPEC) strains
were shown to harbor mutant clyA derivatives containing 1-bp
frameshift mutations that cause premature termination of the coding
sequence . The other eight EPEC strains and all tested uropathogenic
and new-born meningitis-associated E . coli strains (n =
14 and 3, respectively) carried only nonfunctional clyA
fragments due to the deletion of two sequences of 493 bp and 204 or
217 bp at the clyA locus . Expression of clyA from
clinical E . coli isolates proved to be positively controlled
by the transcriptional regulator SlyA . Several tested E . coli
strains harboring a functional clyA gene produced basal amounts
of ClyA when grown under standard laboratory conditions, but
most of them showed a clyA-dependent hemolytic phenotype only
when SlyA was overexpressed . The presented data indicate that
cytolysin A can play a role only for some of the pathogenic E .
coli strains .
Many bacterial pathogens produce toxins that kill and lyse host cells
by interacting with the plasma membrane and by disrupting the
function of this membrane as a permeability barrier . The majority of
these cytolytic toxins are pore-forming proteins, and several of them
have been shown to represent important virulence factors of the
corresponding bacteria (2) .
In Escherichia coli several different pore-forming cytolysins
have been identified . The one most extensively studied is
-hemolysin
(HlyA), which is produced by many uropathogenic E . coli (UPEC)
strains and which contributes to their virulence as shown in
several animal models (14, 48) . E . coli
-hemolysin
is encoded by the hlyCABD operon and belongs to the family of
RTX (repeats-in-toxin) toxins that are widespread among gram-negative
pathogens (12, 26) . Several
UPEC strains have been shown to carry the hly gene cluster
within unique chromosomal inserts called pathogenicity islands that
are absent from the nonpathogenic E . coli laboratory strain
K-12 (15) .
A toxin related to
-hemolysin,
enterohemorrhagic E . coli (EHEC) hemolysin (EHEC-HlyA), has
been identified in EHEC strains of serotype O157:H7, which represent
the major etiological agents of the hemolytic-uremic syndrome and of
hemorrhagic colitis worldwide (4, 28,
38) . The EHEC hemolysin operon, EHEC-hlyCABD
(ehxCABD), is located on a large plasmid that is present in
almost all clinical E . coli O157:H7 isolates (4,
38) . Recent studies revealed that EHEC-hlyA
is also present in most EHEC strains belonging to less prevalent
serotypes, such as O157:H–, O26:H11/H–, and
O103:H2 (7, 20, 40) .
A novel pore-forming hemolysin not related to HlyA, cytolysin A
(ClyA), has recently been detected in E . coli K-12 . ClyA is a
34-kDa protein that is encoded by a chromosomal gene denoted clyA
(also referred to as hlyE and sheA) (3,
8, 13, 25,
30, 31) . The ClyA protein is
not produced at phenotypically detectable levels when E . coli
K-12 is grown under standard conditions on blood agar . This is
apparently due to repression of the transcription of clyA by
the nucleoid protein H-NS (49) . Nevertheless, the
expression of clyA in E . coli K-12 can be activated to a level
that suffices to evoke a hemolytic phenotype when certain transcriptional
regulators, such as SlyA from E . coli or Salmonella enterica
serovar Typhimurium (24, 25,
30), MprA (EmrR) from E . coli (8),
HlyX from Actinobacillus pleuropneumoniae (13),
or FnrP from Pasteurella haemolytica (43)
are overproduced in this strain .
Lipid bilayer experiments and electron microscopic studies have
shown that ClyA forms stable pores in target membranes by assembling
into ring-shaped toxin oligomers (25, 47) .
Due to this pore-forming activity, ClyA lyses erythrocytes from
several mammalian species . In addition, it has been reported that
ClyA is cytotoxic towards cultured mammalian cells and that it
induces macrophage apoptosis (22,
31), which suggests that this toxin might contribute to the
virulence of pathogenic E . coli strains . Consistent with this,
some EHEC strains of serotype O157:H7 have recently been shown to
harbor a complete clyA gene whose predicted product is almost
identical in amino acid sequence to ClyA from E . coli K-12
(ClyAK-12) (9, 17,
36) . Apart from that, however, the presence of
clyA in the different pathogroups of E . coli has not yet
been systematically studied . Interestingly, functional clyA
homologues have recently been identified in S . enterica serovar
Typhi and serovar Paratyphi A, demonstrating that ClyAK-12
represents the prototype of a novel family of bacterial cytolysins (33,
35, 47) .
In this study, we analyzed various E . coli wild-type strains
belonging to different pathogroups with regard to the presence
and sequence characteristics of clyA . In addition, we investigated
the expression of clyA from several of these strains and studied
the influence of SlyA on clyA regulation . The data presented
show that only some of the tested strains harbor a functional
clyA gene, which in turn indicates that ClyA can play a role
only for a subset of the pathogenic E . coli strains . The incidence
of functional copies of clyA particularly showed a correlation
with several E . coli pathogroups causing enteric diseases, while
all E . coli strains isolated from extraintestinal infections
merely harbored nonfunctional clyA fragments .
Bacteria, plasmids, and culture conditions. The E . coli
wild-type strains used in this study are listed in Table
1 . E . coli DH5
[F–
80
dlacZ M15
(lacZYA-argF)
U169 deoR recA1 endA1 phoA hsdR17 (rK– mK+)
supE44
–
thi-1 gyrA96 relA1] was employed as cloning host and for the
propagation of all plasmids except pCVD442 and pCVD442 derivatives,
which were propagated in E . coli SY327 pir
and E . coli SM10 pir
(29) . The plasmids used in this work are listed in
Table 2 . All E . coli strains were grown
aerobically at 37°C in 2x yeast
extract-tryptone (2xYT) broth (yeast
extract, 10 g/liter; tryptone, 16 g/liter; NaCl, 10 g/liter) or on YT
broth solidified with 1.5% (wt/vol) agar . For the preparation of
blood agar plates, the YT agar was supplemented with 4% defibrinated
horse blood (Oxoid) . When appropriate, antibiotic selection was
carried out using ampicillin (Amp), chloramphenicol (Cm), and
streptomycin (Str) at final concentrations of 100, 30, and 30 µg/ml,
respectively .
| TABLE 1 . E . coli wild-type strains used in this study
|
|
| TABLE 2 . Plasmids used in this work
|
|
DNA manipulations. DNA manipulations were performed with
standard protocols (37) . PCR was conducted either
with Taq DNA polymerase (Eppendorf), Deep Vent DNA polymerase
(New England Biolabs), or Phusion High Fidelity DNA polymerase
(Finnzymes) . Only PCR products synthesized by one of the latter two
DNA polymerases were cloned and sequenced . Nucleotide sequences of
DNA fragments were determined by automated cycle sequencing with
fluorescence dye terminator technology, using either the ABI PRISM
377 DNA Sequencer or the ABI PRISM 3700 DNA Analyzer (Applied
Biosystems) . Southern blot hybridizations were performed with the ECL
direct nucleic acid labeling and detection system (Amersham
Biosciences) following the recommendations of the manufacturer .
Cloning of clyA from E . coli wild-type strains.
The clyA genes of the E . coli strains 3232/96, 12860, 5477/94,
G1253, 284/97, 297/87, and 212/87 were amplified by PCR, using
several forward primers designed according to DNA sequences present
244 to 563 bp upstream from clyA of E . coli K-12 (clyAK-12)
and using several reverse primers corresponding to DNA sequences
present 13 to 55 bp downstream from clyAK-12 . The PCR
products were cloned into pUC18 or pUC19 . Recombinant plasmids
carrying the clyA genes of the above strains in opposite
orientation relative to lacZ
of the vector were selected and named pCLYA3232/96, pCLYA12860,
pCLYA5477/94, pCLYAG1253, pCLYA284/97, pCLYA297/87, and pCLYA212/87 .
In all these plasmids the inserted clyA gene is controlled
only by its native 5'-flanking regulatory region . An additionally
isolated plasmid, pCLYA284/97A, carries clyA from E . coli
284/97 in the same orientation as lacZ .
In this case, the clyA gene is consequently not only under
control of its native promoter region but also under control of the
lacZ promoter (lacZp) .
Construction of plasmid pAL115. The slyA gene of
E . coli K-12 (slyAK-12) was amplified by PCR
from strain CC118 (27) using the forward primer 5'-GAAGCAGGCGGTCGACGACAAGCC-3',
which was designed to introduce a SalI restriction site (underlined)
316 bp upstream from slyA, and the reverse primer 5'-GTTTCTCCGCGCTGGATCCGTTTGCGTGTG-3',
which introduced a BamHI site 43 bp downstream from the slyA
stop codon . The 0.83-kb PCR product was cleaved with SalI and
BamHI, and the generated 0.8-kb SalI-BamHI fragment was subsequently
cloned into pUC18, resulting in pAL115 . The authenticity of the
insert of pAL115 was established by sequencing .
Construction of clyA knockout mutants of E . coli
strains. To delete clyA in the enteroinvasive E . coli
(EIEC) strains 12860 and 4608-58, a 0.9-kb SalI-BamHI fragment
comprising the DNA sequence present 1.04 to 0.14 kb upstream from
clyA was isolated by PCR with the forward primer 5'-TAGCTCTTCCAGCGTCGACATCACCCG-3'
and the reverse primer 5'-TATCAAACAGGATCCAATGTCATTATGGCG-3' .
Furthermore, a 1.03-kb BglII-SacI fragment representing the DNA
sequence immediately downstream from clyA was amplified by PCR
with the primers 5'-GTACCTGAAAGATCTTAAGCGATTATTCTC-3' and
5'-GCGTTTGAGAGCTCTTGTCCGCTTTCC-3' . The restriction sites at
the ends of these DNA fragments were introduced by the PCR primers
(see underlined sequences; only the SalI site was naturally present) .
The two DNA fragments were fused with each other by ligation of the
BamHI and BglII sites and then were inserted between the SalI and
SacI sites of the suicide vector pCVD442, resulting in plasmid pCH clyA .
pCH clyA
was transferred by conjugation from E . coli SM10 pir
into in vitro-selected Strr derivatives of E . coli
12860 and E . coli 4608-58 . Transconjugant clones were selected
on Amp/Str agar plates and were analyzed by Southern blot
hybridization of EcoRV-digested genomic DNA using the insert of pCH clyA
as probe . In both cases a clone was identified in which pCH clyA
was inserted into the chromosomal DNA sequence downstream from
clyA . These clones were then grown in the absence of antibiotics
to allow for excision of the suicide plasmid by a second event of
homologous recombination . Descendants that had lost the plasmid
(including the plasmid-encoded sacB gene) were selected on YT
agar plates supplemented with 1% (wt/vol) sucrose, and those
descendants in which the plasmid was excised by recombination between
the SalI-BamHI fragment of pCH clyA
and the corresponding chromosomal DNA fragment were identified
by Southern blot analysis, which was performed as described above . In
the latter clones, the excision of the suicide plasmid concomitantly
caused the deletion of the chromosomal clyA gene . This was
confirmed for two of these clones, E . coli 12860 clyA
and E . coli 4608-58 clyA,
by sequencing of the clyA locus . In both clyA knockout
mutants we detected the expected deletion of a 1.06-kb fragment
spanning the entire clyA gene and the 149-bp sequence
preceding clyA, which carries the clyA promoter region .
Isolation and analysis of proteins. The periplasmic proteins
of E . coli strains were isolated by osmotic shock as described
previously (25), precipitated by addition of
ice-cold trichloroacetic acid (final concentration, 10%), pelleted by
centrifugation at 12,000 x g, washed
with acetone, dried under vacuum, and dissolved in sample buffer
(50 mM Tris-HCl [pH 6.8], 10% glycerol, 5% ß-mercaptoethanol,
2% sodium dodecyl sulfate [SDS], 0.05% bromophenol blue) . Extracellular
proteins of E . coli strains were precipitated from cell-free
culture supernatants by addition of 10% trichloroacetic acid
and then were processed as described above for the periplasmic
proteins . To analyze the proteins of whole cells, bacteria grown in 2xYT
broth were harvested by centrifugation, washed with
phosphate-buffered saline, pH 7.4, (PBS) (37), resuspended in
PBS, and broken by ultrasonic treatment (10 times for 15 s each)
at 4°C . Subsequently, the cell lysate was mixed with an equal
volume of 2x sample buffer . Protein samples
were neutralized, if required, by addition of saturated Tris solution
and were boiled at 99°C prior to loading onto SDS-polyacrylamide
gels . SDS-polyacrylamide gel electrophoresis (SDS-PAGE) was
performed as previously described (21) . Western
immunoblotting was conducted according to Towbin et al . (42)
with the modification that the proteins were blotted onto
polyvinylidene difluoride membrane using a Tris-glycine transfer
buffer (25 mM Tris, 192 mM glycine, 10% methanol [pH 8.3]) .
Immunoblot analysis was performed either with a polyclonal antiserum
raised in a rabbit against purified ClyAK-12 (see below)
or with a polyclonal rabbit anti-HlyA antiserum (19) .
Horseradish peroxidase-conjugated anti-rabbit secondary antibodies
were used to detect the immunoreactive protein bands . These bands
were finally visualized by using either the ECL plus Western Blotting
Detection System (Amersham Biosciences) (in this case, the first and
secondary antibodies were used at final dilutions of 1:10,000 and
1:50,000, respectively) or by using 0.02% 4-chloro-1-naphthol/0.01% H2O2
in Tris-buffered saline (TBS) (10 mM Tris-HCl [pH 7.5], 150 mM NaCl)
for chromogenic detection (in this case, both antibodies were used at
final dilutions of 1:1,000 or 1:2,000) .
Preparation of a polyclonal rabbit anti-ClyA antiserum. ClyA
was overexpressed in E . coli DH5
from plasmid pAL201 and was isolated by osmotic shock from the
periplasm of bacteria grown to the stationary phase . The periplasmic
proteins were mixed with 1 volume of 2x
sample buffer lacking ß-mercaptoethanol and bromophenol blue (100 mM
Tris-HCl [pH 6.8], 20% glycerol, 4% SDS) and separated without
previous boiling by SDS-PAGE . The predominant 34-kDa ClyA protein
band was excised from the gel, and ClyA was eluted by diffusion at
4°C into PBS . About 0.5 mg of the purified ClyA protein was used for
rabbit immunization . The serum taken 11 days after the third
injection was used as polyclonal anti-ClyA antiserum . This serum
reacted strongly with ClyA as established by Western blot analysis,
while the preimmune serum did not recognize ClyA (data not shown) .
Determination of hemolytic activity. Quantitative hemolytic
activity assays were performed with bacterial cell lysates which were
prepared as described above by ultrasonic treatment of bacteria
suspended in PBS . Different volumes (0.5 to 50 µl) of the lysates
were mixed with 600 µl of a suspension of horse erythrocytes in 0.9%
NaCl, containing about 7.0 x 108
red blood cells per ml . After incubation at 37°C for 30 min, the
erythrocytes were pelleted by centrifugation . The amount of
hemoglobin released into the supernatant was measured
spectrophotometrically at 543 nm .
Nucleotide sequence accession numbers. The clyA
sequences of the following strains have been submitted to the
EMBL/GenBank/DDBJ databases (accession numbers are given in
parentheses): Shiga toxin-producing E . coli (STEC) strain
3232/96 (AY576656);
EIEC strain 4608-58 (AY576657);
EIEC strain 12860 (AY576658);
enteroaggregative E . coli (EAEC) strain 5477/94 (AY576659);
enterotoxigenic E . coli (ETEC) strain G1253 (AY576660);
ETEC strain 284/97 (AY576661);
ETEC strain 297/87 (AY576662);
enteropathogenic E . coli (EPEC) strain 212/87 (AY576663);
EPEC strain E2348/69 (AY576664);
uropathogenic E . coli (UPEC) strain 536 (AY576665);
UPEC strain RZ443 (AY576666);
new-born meningitis-associated E . coli (NMEC) strain IHE3034 (AY576667) .
PCR analysis of E . coli strains. A significant number of
clinical E . coli isolates belonging to the most representative
groups of pathogenic E . coli was analyzed by PCR with regard
to the presence of the clyA gene, using primers designed
according to clyAK-12 and flanking DNA sequences .
The tested strains included 23 STEC, 7 EIEC, 8 EAEC, 7 ETEC, 17 EPEC,
14 UPEC, and 3 NMEC strains (Table 1) . Two
additional strains which were isolated from the stool of healthy
individuals, E . coli 764 and E . coli RS226, have not been assigned
to a specific pathogroup but belong to serotypes that are frequently
encountered among UPEC and NMEC strains, respectively .
By using several primer combinations, DNA fragments could be
amplified from all STEC, EIEC, and EAEC strains, from 5 of the 7 ETEC
strains (117/86, 147/1, G1253, 164/82, and ST3135B/01), and from 9 of
the 17 EPEC strains (111/87, 212/87, 402/87, 227/63, 315/60, 12810,
16-2, 6447/89, and 6587/85) that were indistinguishable in size, when
analyzed by agarose gel electrophoresis, from the PCR products
obtained under the same conditions from E . coli K-12 (Fig.
1) . Slightly shorter DNA fragments were amplified
from the ETEC strains 284/97 and 297/87, indicating the presence of
small deletions in the clyA genes of these strains . DNA fragments
about 0.7 kb shorter than expected were amplified from the remaining
eight EPEC strains, from all UPEC and NMEC strains, and from
E . coli 764 and E . coli RS226 when the PCR was conducted with
primers binding more than 0.16 kb upstream and immediately downstream
from clyAK-12 . In addition, no PCR products were
obtained from these strains when primers binding to the 5'-terminal
two-thirds of clyAK-12 or to the DNA region
preceding clyAK-12 were used, suggesting that the
latter strains have chromosomal deletions of about 0.7 kb affecting
clyA and the 5'-flanking DNA sequence .
|
FIG . 1 . (A) Schematic presentation of the clyA gene from E .
coli K-12 . The position of the SlyA-controlled clyA promoter
(p) (25) is indicated by an open box, and the
binding sites of several primers used for PCR are shown by arrows (P1,
5'-GCCAGCAGATCAATACTG-3'; P2, 5'-CATAATGAGAGTTACCCGATACC-3'; P3,
5'-CTTATGGATAGCCAGGATAAG-3'; P4, 5'-CAAATGGACCGTCGACGACACC-3') . The
position of deletion I and deletion II at the clyA locus of UPEC,
NMEC, and several EPEC strains is indicated by solid bars . (B) Agarose
gel electrophoresis of the PCR products obtained with the primer
combinations P1-P2 (lanes 1 to 6) and P3-P4 (lanes 7 to 12) from E .
coli K-12 (lanes 1 and 7), STEC (EHEC) strain 3232/96 (lanes 2 and
8), ETEC strain 284/97 (lanes 3 and 9), ETEC strain 297/87 (lanes 4 and
10), UPEC strain J96 (lanes 5 and 11), and UPEC strain 536 (lanes 6 and
12) . Lane M, DNA size markers (SPP1 DNA cleaved with EcoRI).
|
|
Characterization of the clyA sequences of E . coli
wild-type strains. Sequencing of the PCR-amplified clyA-carrying
or clyA-related DNA fragments from all 81 E . coli
strains listed in Table 1 yielded the following
results .
(i) Identification of an intact clyA gene in STEC, EIEC, EAEC,
and ETEC strains A complete clyA gene encoding, like clyAK-12,
a protein of 303 amino acid residues was found in 19 of the 23 tested
STEC strains, in all 7 tested EIEC strains, in 6 of 8 EAEC strains,
and in 4 of the 7 tested ETEC strains (Tables 1 and
3) . The clyA genes of some of these strains
(EAEC strains 17-2, 5477/94, and OPA065 and ETEC strain 117/86) were
identical in sequence to clyAK-12, but in most
cases several nucleotide substitutions (between 5 and 16) were
detected . Some of these substitutions proved to be highly conserved
in strains belonging to the same E . coli pathogroup or even in
members of different pathogroups .
| TABLE 3 . Characteristics of the clyA gene in E . coli
wild-type strains analyzed in this study
|
|
The amino acid sequences predicted for the clyA gene products
of the above strains were either identical to that of ClyAK-12
(EAEC strains 17-2, 5477/94, and OPA065; ETEC strain 117/86;
serogroup O26 STEC strain ST2415/01) or contained between one and
three amino acid exchanges, which corresponds to a sequence identity
of >99% . In particular, compared to ClyAK-12 the following
amino acid substitutions were found: a single N220 S
exchange in the putative ClyA proteins of several EIEC (78-5,
107-11), EAEC (D4140-86, 4185/95), and ETEC strains (147/1, G1253,
ST3135B/01); K75 N/A199 T
in ClyA of the EIEC strains 76-5, 4608-58, and 309-36/85; L99 F/V185 I
in ClyA of the EIEC strains 12860 and W7062 and of EAEC strain DEF40;
D64 N/N220 S/K279 N
in the ClyA proteins of all 18 serogroup O157 STEC strains harboring
an intact clyA gene .
The DNA sequences flanking the intact clyA genes of the different
E . coli strains proved to be very similar to those flanking
clyAK-12 . In several cases (STEC strain ST2415/01; EIEC
strains 12860, W7062, 76-5, 4608/58, and 309-36/85; EAEC strains
17-2, 5477/94, and OPA065; ETEC strains 117/86 and G1253) at least
the first 185 bp preceding clyA were the same as those in E .
coli K-12 . This DNA region carries the SlyA-controlled promoter
of clyA (25) . The remaining strains exhibited a
few nucleotide substitutions in the clyA 5'-flanking sequence,
but the –10 and –35 signals of the clyA promoter (78 to 84 and
102 to 107 bp upstream from the translational start codon of clyA)
were generally not affected . Most of the latter strains, including
all serogroup O157 STEC strains, exhibited a C T
and a G T
exchange in the spacer between the –10 and –35 signals and
a T C
substitution 61 bp upstream from the clyA start codon .
(ii) Detection of frameshift mutations in clyA of several
STEC, ETEC, and EPEC strains. Several E . coli wild-type strains
were shown by DNA sequencing to harbor mutant clyA derivatives
containing 1-bp frameshift mutations that cause premature truncation
of the clyA open reading frame (ORF) (Tables 1
and 3, Fig . 2) . In three serogroup O157
STEC strains (3817/96, 4299/96, and 4304/96) we found, for example,
a clyA derivative exhibiting a unique 1-bp deletion in codon
248 . Interestingly, this clyA derivative was otherwise identical
in sequence to the intact clyA gene found in all other tested
O157 STEC strains . In the clyA genes of the ETEC strains 284/97
and 297/87, which were already predicted from the PCR data to
contain small deletions, we detected not only an in-frame deletion of
the codons 179 to 182 but also an identical 1-bp insertion in codon
163 . Furthermore, a unique 1-bp deletion was found in codon 15 of
clyA from strain 297/87 . All nine EPEC strains that did not
exhibit noticeable clyA defects upon PCR analysis (111/87,
212/87, 402/87, 227/63, 315/60, 12810, 16-2, 6447/89, and 6587/85)
were shown by DNA sequencing to harbor a mutant clyA gene
exhibiting a specific 1-bp deletion in codon 165 . The same deletion
was also found in the EAEC strains DEF52 and DEF53, in ETEC strain
164/82, and in serogroup O128 STEC strain ST3494/03 . In clyA
of strain ST3494/03 we detected, in addition, a unique 1-bp deletion
in codon 278 . The clyA genes exhibiting the 1-bp deletion in
codon 165 generally proved to be very similar or even identical in
sequence . All of them encode an identical C-terminally truncated ClyA
derivative with a predicted molecular mass of 19.03 kDa .
|
FIG . 2 . Alignment of the amino acid sequences predicted for the
truncated clyA gene products of several clinical E . coli
isolates with the amino acid sequence of ClyA from E . coli K-12 .
Amino acid substitutions in the ClyA derivatives of the clinical E .
coli isolates are indicated by boldface type . The underlined
C-terminal amino acid sequences of the truncated ClyA derivatives
resulted from frameshift mutations in the corresponding clyA
genes . The asterisk behind the last amino acid residue indicates the
presence of a stop codon in the DNA sequence.
|
|
The promoter regions of the mutant clyA genes from the above
strains were either identical in sequence to that of clyAK-12
(ETEC strains 284/97, 297/87, and 164/82; all mentioned EPEC
strains; EAEC strains DEF52 and DEF53; STEC strain ST3494/03) or
corresponded to the clyA promoter regions of the O157 STEC
strains harboring an intact clyA gene (STEC strains 3817/96,
4299/96, and 4304/96), suggesting that all these clyA derivatives
may be expressed under appropriate conditions .
(iii) Detection of deletions at the clyA locus in UPEC, NMEC,
and several EPEC strains. Sequencing of the strikingly short clyA-related
PCR products obtained from all tested UPEC and NMEC strains as well
as from E . coli 764, E . coli RS226, and eight EPEC
strains (700-36/85, 22CH, 273-4, 12-1, 1104/80, 3715/67, E2348/69,
and 1083-36/91) demonstrated that all these strains harbor only DNA
sequences corresponding to an internal fragment and to the
3'-terminal region of clyA . The sequence data further
indicated that these clyA-related sequences are left from two
deletions at the clyA locus which we refer to as deletion I
and deletion II (Fig . 1, Tables 1
and 3) . Deletion I generally comprised the 493-bp
fragment spanning the 160 bp preceding clyA and the first 333
bp of clyA . Deletion II was found in two versions: in the UPEC
strains 536, RZ460, and RZ485 it comprised the 217-bp fragment
spanning the nucleotides 377 to 593 of clyA, while in all other
strains it comprised the 204-bp fragment from nucleotides 382
to 585 of clyA (codons 128 to 195) .
The residual clyA sequences of the above-mentioned E . coli
strains were at least 96% identical to the corresponding fragments of
clyAK-12 . Several nucleotide substitutions were found in
all or in most of these strains, whereas others could be detected
only in strains belonging to the same pathotype . The following
groups of strains harbored identical residual clyA sequences:
(i) the EPEC strains 700-36/85, 22CH, 273-4, 1104/80, 3715/67, and
E2348/69, UPEC strain RZ533, and E . coli 764; (ii) the three
UPEC strains exhibiting the larger version of deletion II (536,
RZ460, and RZ485); (iii) all tested UPEC strains containing the
smaller version of deletion II, except J96 and RZ533; (iv) all tested
NMEC strains (IHE3034, IHE3036, and RS218) and E . coli RS226 .
The clyA sequences of UPEC strain J96 differed from those of
the NMEC strains only at a single nucleotide position .
It is unlikely that these residual clyA sequences are expressed,
because they lack a translational start codon and a fortuitous
TAA stop codon is present 22 bp upstream from deletion I, in frame
with the clyA coding sequence . Furthermore, the clyA promoter
region is completely removed by deletion I .
Analysis of the stability of clyA in E . coli wild-type
strains. In order to test the stability of the clyA sequence in
E . coli wild-type strains, four randomly selected clyA+
strains (STEC 3232/96, EIEC 4608-58, EAEC 5477/94, and ETEC G1253)
were grown for 7 days in 2xYT
broth with daily dilution of the cultures (1:100) into fresh medium .
Subsequently, the clyA gene was amplified by PCR, using in
each case the bacteria from 1 µl of the final culture as template .
Sequencing of the PCR products yielded definite clyA sequences
identical to those originally determined for the corresponding
strains, indicating that the clyA genes of these strains are
quite stable upon prolonged subculturing .
Expression of clyA from clinical E . coli isolates in
E . coli K-12. The clyA genes of several clinical E . coli
isolates were cloned into pUC18 and pUC19 as described in Materials
and Methods . Four of the resulting plasmids, pCLYA3232/96,
pCLYA12860, pCLYA5477/94, and pCLYAG1253, carrying the functional
clyA genes from STEC 3232/96, EIEC 12860, EAEC 5477/94, and ETEC
G1253 under control of their native promoter regions, caused a
hemolytic phenotype when introduced into the E . coli K-12
strain DH5 .
The hemolytic activity on blood agar resembled in each case that of
DH5
carrying clyAK-12 on plasmid pAL202 (Fig.
3) . As shown in Fig . 4, these
recombinant DH5
clones also produced amounts of the 34-kDa ClyA protein similar to
amounts produced by E . coli DH5 /pAL202 .
Transformation of a slyAK-12-carrying plasmid
(pAL108) into the DH5
clones harboring pAL202, pCLYA3232/96, pCLYA12860, pCLYA5477/94, and
pCLYAG1253 resulted in each case in enhanced production of ClyA
and in a significantly stronger hemolytic phenotype on blood agar,
demonstrating that the clyA genes of the corresponding
clinical E . coli isolates are positively controlled by SlyA,
like clyAK-12 (Fig . 3 and 4) .
It should be pointed out that the stronger hemolytic phenotype of the
DH5
double transformants does not completely reflect the enhancement of
clyA expression, because ClyA overproduced in E . coli
accumulates in the periplasmic space and only small amounts of it are
released from the bacteria (25 and data not
shown) .
|
FIG . 3 . Hemolytic phenotypes of E . coli DH5
clones harboring the following plasmids: pAL202 (1a), pCLYA3232/96 (1b),
pCLYA12860 (1c), pCLYA5477/94 (1d), pCLYAG1253 (1e), pCLYA212/87 (2a),
pCLYA284/97 (2b), pCLYA297/87 (2c), pAL202 and pAL108 (3a), pCLYA3232/96
and pAL108 (3b), pCLYA12860 and pAL108 (3c), pCLYA5477/94 and pAL108
(3d), pCLYAG1253 and pAL108 (3e), pCLYA212/87 and pAL108 (4a),
pCLYA284/97 and pAL108 (4b), and pCLYA297/87 and pAL108 (4c) . A single
colony of each strain was picked onto blood agar containing 100 µg of
ampicillin/ml . The agar plate was photographed after overnight
incubation at 37°C . Phenotypes identical to those shown here were
observed in at least three independent experiments.
|
|
|
FIG . 4 . Western blot analysis of the expression of cloned clyA
genes from clinical E . coli isolates in E . coli DH5 ,
using a polyclonal anti-ClyA antiserum . The production of ClyA was
determined in E . coli DH5
clones carrying the following plasmids: pAL202 (lane 1), pCLYA3232/96
(2), pCLYA12860 (3), pCLYA5477/94 (4), pCLYAG1253 (5), pCLYA212/87 (6),
pCLYA284/97 (7), pCLYA297/87 (8), pAL202 and pAL108 (9), pCLYA3232/96
and pAL108 (10), pCLYA12860 and pAL108 (11), pCLYA5477/94 and pAL108
(12), pCLYAG1253 and pAL108 (13), pCLYA212/87 and pAL108 (14),
pCLYA284/97 and pAL108 (15), pCLYA297/87 and pAL108 (16), and
pCLYA284/97A (17) . Whole-cell proteins from 25 µl of an overnight
culture (grown for 18 h) were analyzed in each case . The immunoreactive
bands were visualized by chromogenic detection . The arrows in lanes 6,
7, 14, 15, and 17 point to truncated ClyA derivatives . Positions of
marker proteins are shown on the right . The data presented are
representative of three separate experiments.
|
|
By using the method of quantitative real-time reverse transcription-PCR
we recently observed that transcription of clyA in exponentially
growing E . coli DH5 /pAL202/pAL108
is 5- to 10-fold stronger than in E . coli DH5
carrying pAL202 only in combination with the vector pACYC184 (C . von
Rhein and A . Ludwig, unpublished data) . Similar results would be
expected for corresponding experiments performed with isogenic E .
coli DH5
clones carrying pCLYA3232/96, pCLYA12860, pCLYA5477/94, or pCLYAG1253
instead of pAL202 .
The plasmids pCLYA212/87, pCLYA284/97, and pCLYA297/87, carrying
the mutant clyA genes of EPEC 212/87 (clyA212/87), ETEC
284/97 (clyA284/97), and ETEC 297/87 (clyA297/87)
under control of their own promoter sequences, did not cause a
hemolytic phenotype when introduced into E . coli DH5 .
Furthermore, transformation of pAL108 into the DH5
clones harboring these plasmids caused in each case only very weak
hemolytic activity on blood agar due to the SlyA-mediated induction
of the chromosomal clyAK-12 gene (Fig.
3 and 4) . Proteins corresponding in size to
the predicted products of clyA212/87 (19.03 kDa)
and clyA284/97 (19.28 kDa) were specifically
detected by Western blot analysis in cell lysates of E . coli
DH5
harboring pCLYA212/87 and pCLYA284/97, respectively . The
corresponding DH5
double transformants carrying pAL108 as well produced markedly larger
amounts of these ClyA derivatives, confirming that clyA212/87
and clyA284/97 are positively controlled by SlyA
(Fig . 4) . Nevertheless, in the absence as well as
in the presence of pAL108 the cellular levels of ClyA212/87
and ClyA284/97 were significantly lower than those of complete,
functional ClyA proteins expressed under identical conditions,
which suggests that these truncated ClyA derivatives are more
unstable . E . coli DH5
transformed with pCLYA284/97A, a pUC18 derivative carrying clyA284/97
under control of the lacZ promoter, produced rather large
amounts of ClyA284/97 (Fig . 4) but was
also nonhemolytic on blood agar . In addition, no significant
hemolytic activity could be detected in cell lysates of this strain
by a quantitative hemolytic activity assay . The product of clyA297/87
(predicted molecular mass, 2.63 kDa) could be detected neither in
lysates of E . coli DH5 /pCLYA297/87
nor in those of DH5
carrying both pCLYA297/87 and pAL108 .
Analysis of the expression of clyA in clinical E . coli
isolates. Several E . coli strains possessing a functional
clyA gene, such as STEC (EHEC) 3232/96, EIEC 12860, EIEC 4608-58,
and ETEC G1253 showed a nonhemolytic phenotype when grown overnight
on blood agar containing horse erythrocytes (the weak enterohemolytic
phenotype of STEC strain 3232/96 caused by the production of
EHEC-HlyA was visible only on sheep blood agar) . Nevertheless, the
colonies of EIEC strain 12860 developed a hemolytic phenotype on
horse blood agar when the agar plate was stored for several days at
4°C after the initial overnight incubation at 37°C . A clyA
knockout mutant of strain 12860 (E . coli 12860 clyA)
remained nonhemolytic under the same conditions, demonstrating that
this hemolytic phenotype is clyA dependent (Fig .
5A) .
|
FIG . 5 . (A) Phenotypes of the EIEC strains 12860 and 4608-58 and of
derivatives of these strains on blood agar . Shown are E . coli
12860 (1a), E . coli 12860/pAL115 (1b), E . coli12860 clyA
(1c), E . coli 12860 clyA/pAL115
(1d), E . coli 4608-58 (2a), E . coli 4608-58/pAL115 (2b),
E . coli 4608-58 clyA
(2c), and E . coli 4608-58 clyA/pAL115
(2d) . A single colony of each strain was picked onto a blood agar plate .
The agar plate was incubated overnight at 37°C and then was stored for 2
weeks at 4°C prior to taking the photograph . (B) Analysis of the
production of ClyA protein in different E . coli strains by
immunoblotting using a polyclonal anti-ClyA antiserum . Lane 1, ClyA
purified from the periplasmic protein fraction of E . coli DH5 /pAL201
employing the Model 491 Prep Cell (Bio-Rad); lane 2, E . coli DH5 ;
lane 3, E . coli 4608-58; lane 4, E . coli 12860; lane 5,
E . coli12860 clyA .
In lanes 2 to 5, whole-cell proteins of approximately 107
bacteria harvested from overnight cultures of the specified strains were
analyzed . The immunoreactive bands were visualized with the ECL plus
Western Blotting Detection System (Amersham Biosciences) . The data
presented are representative of three independent experiments.
|
|
To further study the expression of clyA in E . coli strains
possessing a functional chromosomal clyA gene, we analyzed the
cellular ClyA levels in stationary-phase cultures by immunoblotting
with a polyclonal anti-ClyA antiserum . When a highly sensitive
Western blotting detection system was employed, a protein of about 34
kDa corresponding to ClyA could be specifically detected in
cell lysates of all tested E . coli strains harboring an intact
clyA gene, such as DH5 ,
4608-58, and 12860, but not in lysates of E . coli 12860 clyA
(Fig . 5B) . The amounts of ClyA found in the
different clyA+ strains were very similar to each other,
indicating that all these strains expressed clyA at similar
low, basal levels . According to these data, the hemolytic phenotype
of older colonies of EIEC strain 12860 is apparently not due to
a stronger expression of clyA in this strain compared to that
in the other strains but most likely is due to enhanced release of
the toxin from the bacteria .
Introduction of a slyAK-12-carrying plasmid (pAL105 or
pAL115) into the E . coli strains 3232/96, 12860, 4608-58, and
G1253 by electroporation caused in each case a hemolytic phenotype,
in line with the finding that the functional clyA genes of these
strains are positively controlled by SlyA . Consistent with this,
it was recently shown at the protein level that overexpression
of SlyA in EIEC strain 12860 causes enhanced production of ClyA (41) .
As shown in Fig . 5A, E . coli 12860/pAL115 exhibited
clearly stronger hemolytic activity on blood agar than E . coli
4608-58/pAL115, again suggesting that strain 12860 releases ClyA more
readily than other clyA+ E . coli strains .
clyA knockout mutants of E . coli 12860 and E . coli
4608-58 (12860 clyA
and 4608-58 clyA)
remained nonhemolytic after introduction of pAL115, confirming that
the hemolytic activity of the SlyA-overproducing wild-type strains
is dependent on clyA .
ETEC strain 297/87 and EPEC strain 212/87 (Ampr) were nonhemolytic
on blood agar and retained this phenotype after introduction of
slyAK-12-carrying plasmids (pAL105 and pAL108, respectively),
consistent with the finding that the clyA genes of both strains
encode only truncated, obviously nonhemolytic ClyA derivatives .
ETEC strain 284/97 (Cmr), also harboring a defective clyA gene
(see above), exhibited a strongly hemolytic phenotype that was
not affected by introduction of pAL105 . Southern blot analysis of
genomic DNA from E . coli 284/97 using an E . coli
-hemolysin-specific
DNA probe isolated from plasmid pANN202-812 revealed a single
DNA fragment that hybridized with this probe . In addition, a protein
possessing a molecular mass similar to that of HlyA (approximately
110 kDa) was specifically detected in culture supernatants of E .
coli 284/97 by Western blot analysis using a polyclonal anti-HlyA
antiserum (data not shown) . These findings indicated that the
hemolytic activity of E . coli 284/97 is most likely due to the
production and secretion of
-hemolysin
or of a closely related toxin .
Recent studies have shown that the ClyA protein of E . coli K-12
is a pore-forming toxin which lyses erythrocytes from various
species and which exhibits cytotoxic and apoptotic activity towards
cultured mammalian cells (22, 25,
30, 31, 47) . Based
on these findings the questions arose whether E . coli strains
are generally able to produce ClyA and whether this toxin is
involved in the virulence of strains causing intestinal or extraintestinal
infections .
The data presented in this study demonstrate that only part of the
pathogenic E . coli strains possess a functional clyA
gene, while others harbor mutant clyA derivatives or even only
clyA fragments . In particular, an intact clyA gene was found
in all tested EIEC strains, in most of the tested STEC and EAEC
strains, and also in several ETEC strains, but it was not detected in
any of the tested EPEC, UPEC, and NMEC strains . Some STEC, EAEC, and
ETEC strains and about half of the tested EPEC strains were shown to
harbor clyA derivatives containing 1-bp frameshift mutations
that cause premature truncation of the clyA ORF . In the
remaining EPEC strains and in all tested UPEC and NMEC strains we
found only nonfunctional clyA fragments that are apparently
left from two deletions at the clyA locus . One of these deletions,
denoted here as deletion I, generally comprised a 493-bp fragment
spanning the 160-bp sequence preceding clyA and the 5'-terminal
111 clyA codons . The other deletion (deletion II) proved to
be slightly heterogeneous in size, because in three of the tested
UPEC strains it comprised a 217-bp fragment spanning the nucleotides
377 to 593 of clyA while in all other strains it comprised only
the 204-bp fragment from nucleotides 382 to 585 of clyA (codons
128 to 195) .
Interestingly, deletion I and deletion II were found only in
combination, but we do not know whether these deletions occurred
simultaneously or separately . It is also unclear whether or to what
extent deletions I and II occurred independently in different E .
coli strains . In any case, vertical DNA transfer most likely
played an important role in the spreading of these deletions, even if
they occurred in several strains . It is remarkable in this context
that we did not observe the appearance of these deletions (nor of any
other clyA mutations) upon prolonged cultivation of several
E . coli strains harboring a functional clyA gene, which
suggests that the clyA sequence is quite stable and not
particularly prone to mutations .
Regarding deletion I, it is interesting that in E . coli K-12
and other clyA+ E . coli strains two very similar
sequence motifs of 22 and 23 bp (AAGCATTCGCCATAATGACATT and
AAGCATCCGCCCAGAAAGACATT) are centered 160 bp upstream and 333 bp
downstream, respectively, from the 5' end of clyA (i.e., at
the end points of the sequence that is removed by deletion I) . This
suggests that deletion I occurred by homologous recombination between
these related sequences . The processes that resulted in deletion II
are, however, less clear because the corresponding deleted clyA
fragment is not flanked by obvious direct repeats . Nevertheless, it
is noteworthy that the 48-bp (or 43-bp) fragment left between
deletion I and deletion II includes an imperfect palindromic
sequence .
Results from immunoblot analyses demonstrated that E . coli K-12
and several tested clinical clyA+ E . coli
isolates produce ClyA at similar low, basal levels when grown in rich
medium . Consistent with this, a basal-level expression of ClyA in
E . coli K-12 has recently also been observed by Oscarsson et al .
(32) . Thus, clyA is not totally silent in
E . coli strains under in vitro cultivation conditions . The
amounts of ClyA produced in E . coli K-12 and several other
clyA+ E . coli strains are, however, apparently
below the threshold that has to be passed to cause detectable
hemolysis on blood agar . Nevertheless, in the case of EIEC strain
12860 we observed that the colonies grown on blood agar develop a
clyA-dependent hemolytic phenotype when the agar plate is stored
for several days at 4°C . To our knowledge, E . coli 12860 is
the first reported phenotypically hemolytic E . coli wild-type
strain in which the clyA gene has been identified as the
genetic determinant of the hemolytic activity .
Western blot analyses of recombinant E . coli DH5
clones revealed that the clyA genes from clinical E . coli
isolates are positively controlled, like clyAK-12,
by the transcriptional regulator SlyA . In line with this finding,
several tested E . coli wild-type strains possessing a
functional clyA gene showed a clyA-dependent hemolytic
phenotype when SlyA was overexpressed . This in turn indicates that
these strains are able to release substantial amounts of ClyA under
environmental conditions that cause increased cellular levels of SlyA
and/or other factors involved in the positive regulation of clyA .
It is tempting to speculate that such conditions might exist during
the infection of host organisms .
Given the data presented in this work, it appears to be quite
possible that cytolysin A contributes to the virulence of several
STEC, EIEC, EAEC, and ETEC strains . In line with this, it was
recently observed that EIEC strain 4608-58 exhibits significantly
stronger cytotoxic activity towards J774 macrophage-like cells than a
clyA knockout mutant of this strain (C . Hüttinger, W . Goebel,
and A . Ludwig, unpublished data) . The finding that all tested UPEC,
NMEC, and EPEC strains are unable to produce functional cytolysin A
suggests, on the other hand, that this toxin is not an important
virulence factor for the latter groups of strains .
We thank Helge Karch, Jörg Hacker, and Philippe J . Sansonetti for
providing most of the E . coli wild-type strains used in this
study .
This work was supported by grants from the Deutsche Forschungsgemeinschaft
(SFB 176/B10 and LU 842/1-1) .
* Corresponding author . Mailing address: Institut für
Medizinische Mikrobiologie, Klinikum der Johann Wolfgang Goethe-Universität,
Paul-Ehrlich-Straße 40, 60596 Frankfurt am Main, Germany . Phone: (49) 69 6301
7165 . Fax: (49) 69 6301 5767 . E-mail:
albrecht.ludwig@em.uni-frankfurt.de .
Present address: Institut für Molekulare Infektionsbiologie,
Universität Würzburg, 97070 Würzburg, Germany .
- Achtman, M., A . Mercer, B . Kusecek, A . Pohl, M . Heuzenroeder,
W . Aaronson, A . Sutton, and R . P . Silver. 1983 . Six widespread bacterial
clones among Escherichia coli K1 isolates . Infect . Immun . 39:315-335.
- Alouf, J . E. 2001 . Pore-forming bacterial protein toxins:
an overview . Curr . Top . Microbiol . Immunol . 257:1-14.
- Atkins, A., N . R . Wyborn, A . J . Wallace, T . J . Stillman, L .
K . Black, A . B . Fielding, M . Hisakado, P . J . Artymiuk, and J . Green. 2000 .
Structure-function relationships of a novel bacterial toxin, hemolysin E . J .
Biol . Chem . 275:41150-41155 .
- Bauer, M . E., and R . A . Welch. 1996 . Characterization of
an RTX toxin from enterohemorrhagic Escherichia coli O157:H7 . Infect .
Immun . 64:167-175.
- Bielaszewska, M., H . Schmidt, M . A . Karmali, R . Khakhria, J .
Janda, K . Blahova, and H . Karch. 1998 . Isolation and characterization of
sorbitol-fermenting Shiga toxin (verocytotoxin)-producing Escherichia coli
O157:H– strains in the Czech republic . J . Clin . Microbiol . 36:2135-2137 .
- Blum, G., M . Ott, A . Lischewski, A . Ritter, H . Imrich, H .
Tschäpe, and J . Hacker. 1994 . Excision of large DNA regions termed
pathogenicity islands from tRNA-specific loci in the chromosome of an
Escherichia coli wild-type pathogen . Infect . Immun . 62:606-614.
- Brunder, W., H . Schmidt, M . Frosch, and H . Karch. 1999 .
The large plasmids of Shiga-toxin-producing Escherichia coli (STEC) are
highly variable genetic elements . Microbiology 145:1005-1014.
- del Castillo, F . J., S . C . Leal, F . Moreno, and I . del
Castillo. 1997 . The Escherichia coli K-12 sheA gene encodes
a 34-kDa secreted haemolysin . Mol . Microbiol . 25:107-115.
- del Castillo, F . J., F . Moreno, and I . del Castillo.
2000 . Characterization of the genes encoding the SheA haemolysin in
Escherichia coli O157:H7 and Shigella flexneri 2a . Res . Microbiol.
151:229-230.
- Donnenberg, M . S., and J . B . Kaper. 1991 . Construction
of an eae deletion mutant of enteropathogenic Escherichia coli
by using a positive-selection suicide vector . Infect . Immun . 59:4310-4317.
- Donnenberg, M . S., S . Tzipori, M . L . McKee, A . D . O'Brien,
J . Alroy, and J . B . Kaper. 1993 . The role of the eae gene of
enterohemorrhagic Escherichia coli in intimate attachment in vitro and
in a porcine model . J . Clin . Investig . 92:1418-1424.
- Felmlee, T., S . Pellett, and R . A . Welch. 1985 .
Nucleotide sequence of an Escherichia coli chromosomal hemolysin . J .
Bacteriol . 163:94-105.
- Green, J., and M . L . Baldwin. 1997 . The molecular basis
for the differential regulation of the hlyE-encoded haemolysin of
Escherichia coli by FNR and HlyX lies in the improved activating region 1
contact of HlyX . Microbiology 143:3785-3793.
- Hacker, J., C . Hughes, H . Hof, and W . Goebel. 1983 .
Cloned haemolysin genes from Escherichia coli that cause urinary tract
infection determine different levels of toxicity in mice . Infect . Immun .
42:57-63.
- Hacker, J., G . Blum-Oehler, I . Mühldorfer, and H . Tschäpe.
1997 . Pathogenicity islands of virulent bacteria: structure, function and
impact on microbial evolution . Mol . Microbiol . 23:1089-1097.
- Hale, T . L., P . J . Sansonetti, P . A . Schad, S . Austin, and
S . B . Formal. 1983 . Characterization of virulence plasmids and
plasmid-associated outer membrane proteins in Shigella flexneri,
Shigella sonnei, and Escherichia coli . Infect . Immun . 40:340-350.
- Hayashi, T., K . Makino, M . Ohnishi, K . Kurokawa, K . Ishii,
K . Yokoyama, C.-G . Han, E . Ohtsubo, K . Nakayama, T . Murata, M . Tanaka, T .
Tobe, T . Iida, H . Takami, T . Honda, C . Sasakawa, N . Ogasawara, T . Yasunaga, S .
Kuhara, T . Shiba, M . Hattori, and H . Shinagawa. 2001 . Complete genome
sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic
comparison with a laboratory strain K-12 . DNA Res . 8:11-22.
- Hull, R . A., R . E . Gill, P . Hsu, B . H . Minshew, and S .
Falkow. 1981 . Construction and expression of recombinant plasmids encoding
type 1 or D-mannose-resistant pili from a urinary tract infection
Escherichia coli isolate . Infect . Immun . 33:933-938.
- Jarchau, T., T . Chakraborty, F . Garcia, and W . Goebel.
1994 . Selection for transport competence of C-terminal polypeptides derived
from Escherichia coli hemolysin: the shortest peptide capable of
autonomous HlyB/HlyD-dependent secretion comprises the C-terminal 62 amino
acids of HlyA . Mol . Gen . Genet . 245:53-60.
- Karch, H., S . Schubert, D . Zhang, W . Zhang, H . Schmidt, T .
Ölschläger, and J . Hacker. 1999 . A genomic island, termed
high-pathogenicity island, is present in certain non-O157 Shiga
toxin-producing Escherichia coli clonal lineages . Infect . Immun . 67:5994-6001 .
- Laemmli, U . K. 1970 . Cleavage of structural proteins
during the assembly of the head of bacteriophage T4 . Nature 227:680-685.
- Lai, X.-H., I . Arencibia, A . Johansson, S . N . Wai, J .
Oscarsson, S . Kalfas, K.-G . Sundqvist, Y . Mizunoe, A . Sjöstedt, and B . E .
Uhlin. 2000 . Cytocidal and apoptotic effects of the ClyA protein from
Escherichia coli on primary and cultured monocytes and macrophages .
Infect . Immun . 68:4363-4367 .
- Levine, M . M., E . J . Bergquist, D . R . Nalin, D . H . Waterman,
R . B . Hornick, C . R . Young, S . Sotman, and B . Rowe. 1978 . Escherichia
coli strains that cause diarrhea but do not produce heat-labile or
heat-stable enterotoxins and are non-invasive . Lancet i:1119-1122.
- Ludwig, A., C . Tengel, S . Bauer, A . Bubert, R . Benz, H.-J .
Mollenkopf, and W . Goebel. 1995 . SlyA, a regulatory protein of
Salmonella typhimurium, induces a haemolytic and pore-forming protein in
Escherichia coli . Mol . Gen . Genet . 249:474-486.
- Ludwig, A., S . Bauer, R . Benz, B . Bergmann, and W . Goebel.
1999 . Analysis of the SlyA-controlled expression, subcellular localization and
pore-forming activity of a 34 kDa haemolysin (ClyA) from Escherichia coli
K-12 . Mol . Microbiol . 31:557-567.
- Ludwig, A., and W . Goebel. 1999 . The family of the
multigenic encoded RTX toxins, p . 330-348 . In J . E . Alouf and J . H .
Freer (ed.), The comprehensive sourcebook of bacterial protein toxins, 2nd ed .
Academic Press, London, United Kingdom.
- Manoil, C., and J . Beckwith. 1985 . TnphoA: a
transposon probe for protein export signals . Proc . Natl . Acad . Sci . USA 82:8129-8133.
- Mead, P . S., and P . M . Griffin. 1998 . Escherichia
coli O157:H7 . Lancet 352:1207-1212.
- Miller, V . L., and J . J . Mekalanos. 1988 . A novel
suicide vector and its use in construction of insertion mutations:
osmoregulation of outer membrane proteins and virulence determinants in
Vibrio cholerae requires toxR . J . Bacteriol . 170:2575-2583.
- Oscarsson, J., Y . Mizunoe, B . E . Uhlin, and D . J . Haydon.
1996 . Induction of haemolytic activity in Escherichia coli by the
slyA gene product . Mol . Microbiol . 20:191-199.
- Oscarsson, J., Y . Mizunoe, L . Li, X.-H . Lai, A . Wieslander,
and B . E . Uhlin. 1999 . Molecular analysis of the cytolytic protein ClyA
(SheA) from Escherichia coli . Mol . Microbiol . 32:1226-1238.
- Oscarsson, J., M . Westermark, L . Beutin, and B . E . Uhlin.
2002 . The bacteriophage-associated Ehly1 and Ehly2 determinants from
Escherichia coli O26:H- strains do not encode enterohemolysins
per se but cause release of the ClyA cytolysin . Int . J . Med . Microbiol .
291:625-631.
- Oscarsson, J., M . Westermark, S . Löfdahl, B . Olsen, H .
Palmgren, Y . Mizunoe, S . N . Wai, and B . E . Uhlin. 2002 . Characterization
of a pore-forming cytotoxin expressed by Salmonella enterica serovars
Typhi and Paratyphi A . Infect . Immun . 70:5759-5769 .
- Ott, M., J . Hacker, T . Schmoll, T . Jarchau, T . K . Korhonen,
and W . Goebel. 1986 . Analysis of the genetic determinants coding for the
S-fimbrial adhesin (sfa) in different Escherichia coli strains
causing meningitis or urinary tract infections . Infect . Immun . 54:646-653.
- Parkhill, J., G . Dougan, K . D . James, N . R . Thomson, D .
Pickard, J . Wain, C . Churcher, K . L . Mungall, S . D . Bentley, M . T . G . Holden,
M . Sebaihia, S . Baker, D . Basham, K . Brooks, T . Chillingworth, P . Connerton,
A . Cronin, P . Davis, R . M . Davies, L . Dowd, N . White, J . Farrar, T . Feltwell,
N . Hamlin, A . Haque, T . T . Hien, S . Holroyd, K . Jagels, A . Krogh, T . S .
Larsen, S . Leather, S . Moule, P . O'Gaora, C . Parry, M . Quail, K . Rutherford,
M . Simmonds, J . Skelton, K . Stevens, S . Whitehead, and B . G . Barrell.
2001 . Complete genome sequence of a multiple drug resistant Salmonella
enterica serovar Typhi CT18 . Nature 413:848-852.
- Perna, N . T., G . Plunkett III, V . Burland, B . Mau, J . D .
Glasner, D . J . Rose, G . F . Mayhew, P . S . Evans, J . Gregor, H . A . Kirkpatrick,
G . Posfai, J . Hackett, S . Klink, A . Boutin, Y . Shao, L . Miller, E . J .
Grotbeck, N . W . Davis, A . Lim, E . Dimalanta, K . Potamousis, J . Apodaca, T . S .
Anantharaman, J . Lin, G . Yen, D . C . Schwartz, R . A . Welch, and F . R . Blattner.
2001 . Genome sequence of enterohaemorrhagic Escherichia coli O157:H7 .
Nature 409:529-533.
- Sambrook, J., and D . W . Russell. 2001 . Molecular
cloning: a laboratory manual, 3rd ed . Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y.
- Schmidt, H., C . Kernbach, and H . Karch. 1996 . Analysis
of the EHEC hly operon and its location in the physical map of the
large plasmid of enterohaemorrhagic Escherichia coli O157:H7 .
Microbiology 142:907-914.
- Schmidt, H., M . Bielaszewska, and H . Karch. 1999 .
Transduction of enteric Escherichia coli isolates with a derivative of
Shiga toxin 2-encoding bacteriophage
3538
isolated from Escherichia coli O157:H7 . Appl . Environ . Microbiol .
65:3855-3861 .
- Schmidt, H., C . Geitz, P . I . Tarr, M . Frosch, and H . Karch.
1999 . Non-O157:H7 pathogenic Shiga toxin-producing Escherichia coli:
phenotypic and genetic profiling of virulence traits and evidence for
clonality . J . Infect . Dis . 179:115-123.
- Spory, A., A . Bosserhoff, C . von Rhein, W . Goebel, and A .
Ludwig. 2002 . Differential regulation of multiple proteins of
Escherichia coli and Salmonella enterica serovar Typhimurium by the
transcriptional regulator SlyA . J . Bacteriol . 184:3549-3559 .
- Towbin, H., T . Staehelin, and J . Gordon. 1979 .
Electrophoretic transfer of proteins from polyacrylamide gels to
nitrocellulose sheets: procedure and some applications . Proc . Natl . Acad . Sci .
USA 76:4350-4354.
- Uhlich, G . A., P . J . McNamara, J . J . Iandolo, and D . A .
Mosier. 1999 . Cloning and characterization of the gene encoding
Pasteurella haemolytica FnrP, a regulator of the Escherichia coli
silent hemolysin SheA . J . Bacteriol . 181:3845-3848 .
- van den Bosch, J . F., U . Verboom-Sohmer, P . Postma, J . de
Graaff, and D . M . MacLaren. 1980 . Mannose-sensitive and mannose-resistant
adherence to human uroepithelial cells and urinary virulence of Escherichia
coli . Infect . Immun . 29:226-233.
- Vial, P . A., R . Robins-Browne, H . Lior, V . Prado, J . B .
Kaper, J . P . Nataro, D . Maneval, A . Elsayed, and M . M . Levine. 1988 .
Characterization of enteroadherent-aggregative Escherichia coli, a
putative agent of diarrheal disease . J . Infect . Dis . 158:70-79.
- Vogel, M., J . Hess, I . Then, A . Juarez, and W . Goebel.
1988 . Characterization of a sequence (hlyR) which enhances synthesis
and secretion of hemolysin in Escherichia coli . Mol . Gen . Genet .
212:76-84.
- Wallace, A . J., T . J . Stillman, A . Atkins, S . J . Jamieson,
P . A . Bullough, J . Green, and P . J . Artymiuk. 2000 . E . coli
hemolysin E (HlyE, ClyA, SheA): X-ray crystal structure of the toxin and
observation of membrane pores by electron microscopy . Cell 100:265-276.
- Welch, R . A., E . P . Dellinger, B . Minshew, and S . Falkow.
1981 . Haemolysin contributes to virulence of extra-intestinal E . coli
infections . Nature 294:665-667.
- Westermark, M., J . Oscarsson, Y . Mizunoe, J . Urbonaviciene,
and B . E . Uhlin. 2000 . Silencing and activation of ClyA cytotoxin
expression in Escherichia coli . J . Bacteriol . 182:6347-6357 .
- Zingler, G., M . Ott, G . Blum, U . Falkenhagen, G . Naumann, W .
Sokolowska-Köhler, and J . Hacker. 1992 . Clonal analysis of Escherichia
coli serotype O6 strains from urinary tract infections . Microb . Pathog .
12:299-310.
- Zingler, G., G . Blum, U . Falkenhagen, I . Orskov, F . Orskov,
J . Hacker, and M . Ott. 1993 . Clonal differentiation of uropathogenic
Escherichia coli isolates of serotype O6:K5 by fimbrial antigen typing and
DNA long-range mapping techniques . Med . Microbiol . Immunol . 182:13-24.
Free Online Full-text Article
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
|