|
|
|
Antimicrobial Agents and Chemotherapy, May 2004, p . 1823-1836, Vol . 48, No . 5 Novel Non-mecA-Containing Staphylococcal Chromosomal Cassette Composite Island Containing pbp4 and tagF Genes in a Commensal Staphylococcal Species: a Possible Reservoir for Antibiotic Resistance Islands in Staphylococcus aureus
Kanokporn Mongkolrattanothai,1, Section of Pediatric Infectious Diseases, Department of Pediatrics, University of Chicago, Chicago, Illinois,1 Department of Pediatrics, University of Texas Southwestern Medical Center, Dallas, Texas2 Received 8 September 2003/ Returned for modification 30 October 2003/ Accepted 21 January 2004
Resistance to methicillin in S . aureus is an important clinical problem because few therapeutic options exist . The methicillin resistance phenotype results from mecA-directed production of the transpeptidase penicillin-binding protein 2' or 2a (PBP 2' or PBP 2a), which has decreased affinity for ß-lactam antibiotics . A site-specific integrative genetic element called staphylococcal chromosomal cassette mec (SCCmec) carries the mecA gene complex, which consists of the mecA gene itself, its regulating genes, when present, and the insertion sequence IS431mec (10) . It also contains unique cassette chromosome recombinase genes (ccr) that encode products responsible for the integration and excision of the SCCmec element (10) . In all methicillin-resistant S . aureus (MRSA) isolates, SCCmec elements are integrated into the S . aureus genome at a unique site (attBscc) located in frame at the 3' end of an open reading frame (ORF) of unknown function called orfX (10, 16) . When SCCmec integrates, it is flanked on either end with characteristic direct- and inverted-repeat sequences (DRSCC and IRSCC, respectively) . It is not clear how these elements are horizontally transferred, since there are no known genes encoding bacteriophage structural proteins or proteins involved in the horizontal transfer of the elements identified to date (10, 16) . SCCmec elements have been classified into types I to IV according to the class of mecA gene complex and the type of ccr gene complex present (11) . Three relatively large SCCmec elements, types I, II, and III, were initially described for MRSA isolates, which were mostly obtained from patients frequenting health care environments (10) . A smaller SCCmec element, type IV, was first identified in community-acquired MRSA (CA-MRSA) isolates from Chicago (4, 16) and was subsequently found in MRSA isolates from other geographic locales (3, 6, 18) and in Staphylococcus epidermidis (22) . Two other SCC elements that contain the essential features of SCCmec but lack the mecA gene have been recognized recently . SCCcap1, which carries the gene cluster encoding the type 1 capsular polysaccharide, was identified in S . aureus strain M, a methicillin-susceptible strain (15) . SCC12263 was recently identified in Staphylococcus hominis ATCC 27844 . Because it carries a functional pair of ccr genes and other sequences with variable homology to those found in SCCmec elements (13), it has been proposed that SCC12263 may be ancestral to SCCmec elements . The type IV SCCmec element has been of considerable interest because of its epidemiologic link to CA-MRSA and because its relatively small size makes it potentially amenable to interbacterial transfer, for example, on a bacteriophage . Molecular subdefinition of SCCmec type IV elements has been determined by DNA sequencing (4, 16) . The DNA sequences of SCCmec type IV elements from two Chicago CA-MRSA isolates were highly similar to each other in all regions except the left extremity (L-C) region (16), whose sequence differences resulted in the designation of SCCmec IV subtypes IVa and IVb . Recently, a third subtype, IVc, also with L-C region polymorphism relative to other SCCmec type IV elements, was reported among MRSA isolates from France (9) and Japan (11) . It has been proposed that the L-C region contains unrelated genes and pseudogenes (9) and a number of unnecessary ORFs (16) . Thus, this region has been termed a "junkyard" (9), a term suggesting functional insignificance . We have hypothesized that the L-C region is useful for understanding the molecular epidemiology of SCC elements . While characterizing the L-C region in SCCmec elements in CA-MRSA isolates in our collection, we identified a ca . 9-kb sequence in one of these isolates that was found in its entirety in the sequenced genome of S . epidermidis ATCC 12228 and in the recently described SCCmec IVc element . Upon analysis of the S . epidermidis genome sequence flanking this ca . 9-kb homologous region, the sequence was found to be part of a unique 57-kb SCC composite island that lacked mecA but carried two pairs of complete ccr recombinase genes of different types, each contained within a region of DNA flanked by SCC-specific terminal repeat sequences . We have called this element the SCC composite island because we also found that it contained a second, smaller SCC element, SCCpbp4, that carried a homolog of the gene encoding PBP 4 (pbp4), a gene encoding a teichoic acid biosynthesis protein (tagF), and three stretches of DNA (>2 to 10 kb) that are highly homologous to those found in S . aureus SCCmec elements . Thus, these two new members of the SCC family found in S . epidermidis could be ancestral to SCCmec elements found in S . aureus by acting as a reservoir for donation of sequences to SCC elements in S . aureus by homologous recombination .
Screening for subtypes IVa and IVb was conducted with primer pairs cLs1- DNA sequencing. Agarose gel-purified PCR products were sequenced by using a primer-walking strategy . (Primer sequences are available upon request.) Sequencing reactions were performed by using fluorescent dideoxy chain termination chemistry and an ABI Prism sequence detection system (Applied Biosystems, Foster City, Calif.) at the University of Chicago DNA Sequencing Facility . Homology searches were performed against all sequences in the GenBank database by using the BLAST search engine, available through the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov) (2) . DNA sequence alignments were performed by using ClustalW alignment software (version 1.81; Silicon Graphics) (CMBI ClustalW server) (21) . ORFs in the L-C region of isolate 2314 were identified by using ORF Finder, available on the NCBI website, or by comparison to annotated gene sequences in the S . epidermidis ATCC 12228 (GenBank accession no . AE016744) database . DNA sequences of the other SCCmec types (I to III) were obtained from GenBank . NCTC 10442 (GenBank accession no . AB033763), N315 (D86934), and 85/2082 (AB037671) sequences were used as the prototypes of SCCmec types I, II, and III, respectively (10) . SCCmec type IVa was from CA-MRSA isolates CA05 (GenBank accession no . AB063172) (16) and MW2 (3); SCCmec type IVc was from the health care-associated MRSA (HA-MRSA) isolate MR108 (GenBank accession no . AB096217) . Sequences from coagulase-negative staphylococci were from S . epidermidis ATCC 12228 (GenBank accession no . AE016744) (23) and S . hominis ATCC 27844 (AB063171) . Nucleotide sequence accession numbers. To annotate the SCC composite island and SCCpbp4 elements that we identified in the S . epidermidis ATCC 12228 sequence (GenBank accession no . AE016744), a third-party annotation (TPA BK001539) was added to GenBank . The sequence of the type IV SCCmec element of the Dallas CA-MRSA isolate 2314 was assigned GenBank accession no . AY271717 .
PCR amplification of the L-C region of the SCCmec type IV element from isolate 2314 with the type IVa-specific primer pair cLs1- We sequenced the ca . 9-kb PCR product (GenBank accession no . AY271717) to further characterize the L-C region of this SCCmec element . The amplified fragment had 9,612 bp and contained a 15-bp SCC-specific direct-repeat sequence (DRSCC-left [DRSCC-L]) (nucleotides [nt] 2691 through 2705; accession no . AY271717) juxtaposed to the left extremity, a feature that is characteristic of SCC elements . Adjacent to DRSCC-L was the 26-bp inverted-repeat sequence (IRSCC-L; nt 2706 through 2731), also characteristic of the left termini of SCCmec elements (Fig . 1) .
We found that that the L-C region of the SCCmec element of isolate 2314 contained five tandem ORFs, each encoding >50 predicted amino acids, designated ORFs 1 through 5 in succession, beginning from the left extremity (Fig . 2) . The tandem architecture of the five ORFs was conserved in the L-C region of the type IVc SCCmec of HA-MRSA strain MR108 with 100% sequence identity . Downstream of ORF 5, there was one complete copy each of the ccrA and ccrB genes; these were determined by ClustalW sequence alignments (data not shown) to be of allotype 2 . The chromosomal sequence flanking the left extremity of the SCCmec element of isolate 2314 (nt 1396 through 2690) was identical to the region in methicillin-susceptible S . aureus isolate 8325 immediately downstream of orfX (GenBank accession no . AB014440), data consistent with a perfect insertion into orfX. This was in contrast to the type IVc SCCmec element in HA-MRSA strain MR108, which was adjacent to a ca . 6.5-kb element termed IE25923, present to the left of the type IVc SCCmec (11) .
Thus, the entire L-C region and the ccrA2 and ccrB2 genes of the type IV SCCmec of CA-MRSA strain 2314 were present in the genome of S . epidermidis ATCC 12228 as well as in the SCCmec type IVc element of the HA-MRSA strain MR108 . We designated this ca . 9-kb homologous region in S . epidermidis "the SCCmec type IVc L-C homologous region" (SCCmec IVc-L-C HR) to underscore the shared homology between these two SCCmec type IV elements and the related region of S . epidermidis (Fig . 3) .
To the right of pbp4 were ORFs encoding eight hypothetical proteins, spermidine acetyltransferase, TagF, and an additional hypothetical protein abutting the IRSCCpbp4-R sequence . Thus, SCCpbp4 carries ORFs that encode cell wall biosynthesis proteins in addition to PBP 4 . SCCpbp4 was found to be inserted into the same chromosomal location as SCCcap1 in S . aureus and SCC12263 in S . hominis . The DRSCCpbp4-R of SCCpbp4 was located in an orfX homolog that had 91% amino acid similarity to orfX of S . aureus (Fig . 3) . Description of the SCC composite island, a second, novel element in S . epidermidis ATCC 12228 that encompasses SCCpbp4. SCCpbp4 was found to be contained within a larger element that contained identical copies of the 28-bp sequence (5'-AAAAACCGCATCATTTATGATATGCTTC-3') referred to as DRSCC composite island at both its left and right extremities (Table 2; Fig . 3) . Interestingly, this 28-bp sequence was composed of the overlapping IRSCCpbp4-R and DRSCCpbp4-R sequences found at the right extremities of SCCpbp4 and other SCC elements (see sequences in Fig . 1 and 3) . Thus, the right extremity of the SCC composite island was also the right extremity of SCCpbp4 . Interestingly, this 28-bp sequence has not previously been observed at the left extremity of an SCC element . To the left of the DRSCCpbp4-L repeat, we found an IR/DRSCC-R sequence that overlapped the DRSCCpbp4-L sequence (see Fig . 3 and Table 2) . Previously, the right and left DR/IRSCC regions have been found only at the right and left extremities of SCC elements, separated by at least 20 to ca . 60 kb . In this novel arrangement, the overlapping right and left SCC terminal-repeat sequences formed a 55-bp sequence (AAAAACCGCATCACTTATGATATGCTTCTGCTTATCAGTTGATGATGCGGTTTTT) that contained a terminal 13-bp perfect complementary inverted repeat separated by 29 nt (AAAAACCGCATCA-N29-TGATGATGCGGTTTTT) . Since this repeat sequence was found at the left junction of the SCCpbp4 element within the SCC composite island, it has been designated the SCC composite island-SCCpbp4 junction inverted repeat . This inverted repeat was also present in the noncoding region downstream of a gene encoding abortive phage resistance protein and upstream of the hsdSR operon, encoding type I restriction proteins (Fig . 3), suggesting that it could contain a transcriptional terminator for the former . Further defining the SCC composite island was a second pair of ccrA and ccrB recombinase genes to the left of SCCpbp4 (Fig . 3) that were closely related to the newly identified type 4 ccrA and ccrB allotypes (see Fig . 6) found in the SCCmec element of MRSA strain HDE288 (20), the so-called pediatric clone . A truncated copy of another ccrA gene, which was too short to assign to an allotype, was also present . In addition, there were 3 copies of a transposase for an insertion sequence-like element that we have annotated as IS431 (TPA BK001539) and ORFs (see supplemental Table 2 at http://www.ucch.org/daum-boyle_lab-composite_island_figures/table2.htm) that encode cadmium resistance, mercury and heavy-metal transport proteins, the type I restriction system proteins HsdR and HsdS, truncated transposases, another copy of spermidine acetyltransferase, and 20 hypothetical proteins . As shown in Fig . 3, many of these features in the SCC composite island are present in other members of the SCC family .
A third important stretch of similarity between other SCC elements and the SCC composite island was the ca . 9-kb region at the left extremity of SCCpbp4 referred to as the L-C HR, mentioned above (Fig . 3) . In summary, a large, novel composite island was found in the genome sequence of S . epidermidis ATCC 12228 . This composite island lacks mecA but contains two pairs of ccr recombinases of different allotypes (ccrA2/ccrB2 and ccrA4/ccrB4) described previously in SCCmec elements in S . aureus . Nested within the composite island was a smaller (19-kb) element, SCCpbp4, that had a ca . 9-kb stretch of sequence homology 98 to 99% similar to a region in the SCCmec element of a CA-MRSA strain that harbors an SCCmec type IV element and of an HA-MRSA isolate that harbors type IVc SCCmec (11) . Furthermore, outside the SCCpbp4 region, at the left extremity, genes that encoded resistance determinants against toxic heavy metals, identical to those found in the large S . aureus type III SCCmec, were identified . Conservation of repeat sequences and L-C region ORFs in the SCC composite island and other members of the SCC family among staphylococci . (i) Repeat elements. The IRSCC-R sequences of SCCpbp4 of S . epidermidis were more closely related to those in SCCmec type I, II, and IV (Fig . 1A) than those in SCCmec type III and SCCcap1 (Fig . 1B) . In contrast, the IRSCC-L of SCCpbp4 was closely related to that of SCCmec type III as well as types I, II, and IV but was unrelated to the IR-L of SCCcap1 . The 15-bp DRSCC-L in CA-MRSA strain 2314 contained two mismatches with the 15-bp DRSCCpbp4-L contained in SCCpbp4 in S . epidermidis ATCC 12228 . The 26-bp IRSCCpbp4-Lof S . epidermidis ATCC 12228 was 100% identical to the IRSCC-L's in the SCCmec elements of strain 2314 and similar to other MRSA isolates (N315, CA05, MW2, 8/6-3P) (3, 10, 16) . (ii) Comparison of ORFs with those in other SCC elements. Inspection of the aligned regions from the left extremities of many SCC elements depicted in Fig . 2 and the data in supplemental Table 2 (available at the URL given above) suggests a model by which SCCmec elements may have evolved from the SCCpbp4 element in the 57-kb SCC composite island of S . epidermidis . As noted, all five ORFs (shown as solid rectangles in Fig . 2) present in the L-C HR of the SCC composite island were conserved in the L-C region of two SCCmec type IV elements in strain 2314 and SCCmec IVc in strain MR108 . ORFs SE0042 and SE0041, encoding abortive phage resistance protein and Abi-alpha protein, annotated in the sequence of S . epidermidis ATCC 12228, were not found in any other SCC element except SCCpbp4, SCCmec IV in strain 2314, and SCCmec IVc in strain MR108 . It is possible that these two ORFs were either lost by deletion from a primordial element such as SCCpbp4 or gained by homologous recombination . An ORF with a high degree of similarity to SE0040 was found in five SCC elements: the type II SCCmec elements of N315 and Mu50, the type IV SCCmec elements of strains 2314 and MR108, and the SCC element found in S . hominis . ORFs homologous to ORF SE0039 were found in nine SCC elements: SCCmec type II of strains Mu50 and N315, SCCmec type IV of strains 2314 and MR108, SCCmec IVa of strains CA05 and MW2, SCCmec type I of strain NCTC 10442, SCCmec type III of strain 85/2082, and SCC12263 of S . hominis . ORFs similar to SE0040, SE0039, and SE0038 were present together in only four of the SCC elements identified to date . Homologs of the ORF (SE0038) closest to the ccrA2 genes were present in all SCC elements, including SCCmec types I, II, III, and IV, SCCpbp4, and SCC12263, with various degrees of conservation . ORF SE0038 of S . epidermidis ATCC 12228 was highly conserved (97% identity) in strains 2314 (ORF 5), MR108 (ORF R004), and N315 (ORF N031) . In contrast, the nucleotide and predicted amino acid sequences of these ORFs in strain 2314 and strain MR108 differed considerably at the 5' end of the gene (from the start codon to bp 450 to 550) and the amino terminus of the translated protein from the corresponding ORFs in the type IVa SCC elements of isolates MW2 (ORF MW0040) and CA05 (ORF Q003), and the type IVb SCC elements of isolate 8/6-3P (ORF M002) . Nevertheless, the 3' terminus of this ORF in CA-MRSA strain 2314 was 95 to 96% identical to those of CA-MRSA isolates MW2, CA05, and 8/6-3P . Thus, surprisingly, ORF 5 of CA-MRSA strain 2314 was more closely related to the corresponding ORFs of S . epidermidis ATCC 12228 and HA-MRSA strains with type II SCCmec (N315 and Mu50) than to those in CA-MRSA strains with either SCCmec subtype IVa (MW2 and CA05) or IVb (strain 8/6-3P) or SCCmec type I or III . Interestingly, the 3' terminus of ORF SE0038 in S . epidermidis ATCC 12228 is conserved among SCC elements that have the type 2 ccr gene complex but is less similar to the corresponding ORFs contained in SCC elements carrying the type 1 or type 3 ccr gene complex . The 3' terminus of ORF 5 of CA-MRSA strain 2314 was 89% similar to the corresponding ORF 13 in S . hominis ATCC 27844 and SCCmec type I in the MRSA strain NCTC 10442 . In summary, there was a tendency for an ORF from the L-C HR to be conserved in a greater number of SCC elements when the position of the ORF in S . epidermidis was closer to the ccr genes . (iii) ccr gene comparisons. An alignment was performed between the two sets of ccrAB genes in CA-MRSA strain 2314 and SCCpbp4 and genes of ccrAB allotypes 1, 2, 3, and 4 . The ccrA gene identified in isolate 2314 was 98% identical to those of SCCpbp4 and CA-MRSA strain CA05 and was 96 to 97% identical to the ccrA2 alleles of isolates MW2, N315, and 8/6-3P . The ccrB gene was also 96 to 97% identical to the ccrB2 alleles of isolates 8/6-3P, N315, MW2, and CA05, in contrast to 92% homology to that of ATCC 12228 . Thus, the ccrA and ccrB genes in CA-MRSA strain 2314 and SCCpbp4 are related to the type 2 ccr gene allotype, a feature of type IV and type II SCCmec elements . Pairwise comparison of the translated amino acid sequences from the ccrA4 and ccrB4 genes of the SCC composite island and SCCmec of strain HDE288 (accession no . AF411935) revealed that ccrA4 had 91.2% similarity and 87.2% identity, and ccrB4 had 80.4% similarity and 80.1% identity, between these strains (Fig . 6B) . In the SCC composite island, the ccrB4 ORF was larger than that of strain HDE288 (1,629 versus 1,329 bp, encoding 542 versus 453 amino acid [aa] residues, respectively) due to the deletion of a single nucleotide (adenine) at position 1326 of the latter ORF (Fig . 6A) .
The SCC composite island had several large regions of substantial homology with SCCmec elements (summarized in Fig . 3) . A 6.9-kb area in the L-C region of SCCpbp4 was nearly identical to the L-C region of SCCmec type IV elements of CA-MRSA strain 2314 and HA-MRSA strain MR108 . This region also shared homology with the SCC element of S . hominis . Also, the left side of the island contained a ca . 10-kb stretch of DNA with 92% similarity to a region within SCCmec type III (10) that has mercury resistance genes flanked on either end by IS431. The CadR region of the SCC composite island contained a 2.5-kb stretch of similarity to the type III element . Also, a highly homologous region of ca 5.3 kb that included the ccrAB4 genes was present in both the SCC composite island and the SCCmec element of MRSA isolate HDE288 . Thus, >25 kb of the 57-kb DNA sequence of the SCC composite island was conserved in other SCCmec elements . The presence of these regions of virtual identity to two distinct SCCmec element types suggests that there has been extensive horizontal genetic exchange between this SCC composite island in S . epidermidis and the SCCmec elements found in MRSA isolates . The SCC composite island is unique within this family in several regards . First, within the SCC composite island are two pairs of ccrA and ccrB genes of different allotypes (types 2 and 4) . One pair was within the nested element SCCpbp4 . Second, several novel arrangements of the DRSCC and IRSCC sequences were present . The 28-bp direct repeat sequence (DRSCC composite island) that flanks the SCC is composed of exact copies of the overlapping composite island DRSCCpbp4-R and IRSCCpbp4-R sequences, whereas in SCCmec elements, the structures of the DRSCC and IRSCC sequence junctions differ slightly at the left and right extremities . Moreover, a third copy of this DRSCC composite island was present overlapping with the SCCpbp4 left terminal repeat sequences . This presence of a direct repeat at the margins of the SCC composite island is similar to the architecture of the ends of pathogenicity islands in bacteria (7) . The terminal-repeat sequences of the nested SCCpbp4 element were more typical of SCCmec elements . However, the DRSCC composite island sequence (i.e., an IR/DRSCC-R terminal-repeat sequence) overlapping the DR/IRSCCpbp4-L sequence was atypical (Fig . 3) . Previously, the left and right terminal repeats had been detected at least 20 kb apart at the left and right termini of SCC elements, respectively . The overlap created a novel 55-bp sequence flanked by a B-bp complementary inverted repeat in the intergenic region between SCCpbp4 and the left portion of the SCC composite island, downstream of an ORF encoding a phage resistance protein (a probable restriction protein) . The significance of this novel juxtaposition of these repeats at the junction of SCCpbp4 remains to be determined . It is possible that this sequence contains a transcriptional terminator for the phage resistance protein . The SCC composite island and the nested SCCpbp4 element are the third and fourth members of the family of SCC elements identified to date that have intact ccrA and ccrB genes and the characteristic direct- and inverted-repeat sequences . These are features previously shown to allow excision and integration of the element (12) . SCCcap1 (15) is another member of this family, but it lacks a ccrA gene homolog, limiting its potential for excision and spread . In this regard, the ccrAB2 allotype is the only allotype to date shown to mediate excision activity . The functionality of the ccrAB4 allotype has not yet been investigated, but the ccrB4 gene in the SCC composite island of ATCC 12228 appears to be more intact than that of HDE288, which has a truncated ccrB gene (see Fig . 6) . The presence of cadmium and mercury resistance genes, also present in other SCCmec elements, suggests that SCC elements are also used by staphylococci for horizontal transfer of genes encoding resistance to heavy metals . The presence of restriction system genes in the SCC composite island both within and outside SCCpbp4 suggests that at some time, both portions of the element were transferable between bacterial species . It remains to be determined whether the SCC composite island is a feature only of S . epidermidis ATCC 12228 or whether it can be found among other S . epidermidis isolates . If it is common, it is possible that S . epidermidis, a skin commensal, acts as a reservoir of DNA sequences that have been horizontally transferred and recombined within SCCmec elements by homologous recombination . It was recently proposed that an SCC element found in S . hominis was an ancestral element providing sequences for SCCmec elements (13) . Our data describe two additional possible ancestral SCC elements present in a commensal staphylococcal species that could also act as a source of DNA for SCCmec elements . In this regard, the SCC12263 element in S . hominis carries type 1 ccr genes, whereas the SCC composite island in S . epidermidis carries type 2 and 4 ccr genes . Thus, S . epidermidis and S . hominis would be able to provide diversity to SCCmec elements by contributing to their different types of ccr genes . In this regard, the GC content of SCC elements is very close to that of staphylococcal genomes, supporting the notion that the elements have indeed likely originated from staphylococcal species . It is not known how SCC elements are horizontally transferred between S . aureus strains and other Staphylococcus species . The SCCpbp4 and SCCmec elements both carry important cell wall synthesis genes, and SCCcap1 carries genes responsible for a capsular polysaccharide . These data suggest that SCC elements are specialized elements in staphylococci that carry genes encoding cell wall synthesis enzymes . In this scenario, SCCmec elements have been exploited for the transfer of antibiotic resistance by importation of a PBP gene with low affinity for ß-lactams . The biological importance of carrying PBP genes such as these on presumably mobile genetic elements remains to be determined but could account for the functional redundancy of PBPs in staphylococci . Inspection of the aligned maps of tandem ORFs located adjacent to the ccr genes in SCCmec elements suggests a model in which SCCmec elements evolved from the SCCpbp4 element in S . epidermidis (Fig . 2) . Isolated in 1996, Dallas CA-MRSA isolate 2314 was one of the first CA-MRSA isolates to be recognized . All five ORFs positioned between the ccr genes and the DRSCCpbp4-L sequence were present in the L-C region of this isolate and the HA-MRSA strain MR108 . The type IV SCCmec elements from more-recent CA-MRSA isolates such as MW2, CA05, and 8/6-3P have remnants of ORF 5 but do not contain ORFs 1, 2, 3, and 4 . Furthermore, ORFs 3, 4, and 5, upstream of ccrA in CA-MRSA isolate 2314, were more closely related to the corresponding ORFs found in HA-MRSA strains bearing SCCmec type II . Thus, the ORFs in this region that were closer to the ccr genes were more likely to be conserved among a greater range of SCC element types than those more distal to the ccr genes . These data also suggest that recombination events have resulted in gradual elimination of ORFs 1, 2, 3, and 4 from SCCmec as SCCmec type II evolved into SCCmec type IVc and ultimately types IVa and IVb . The left portion of the novel SCCpbp4 element in SCCmec type IVc provides evidence that, at some point, there was horizontal genetic exchange between the progenitors of CA-MRSA strain 2314 and S . epidermidis ATCC 12228 . It is not clear whether isolate 2314 obtained the L-C portion of SCCmec IVc from the SCCpbp4 element of ATCC 12228 or vice versa . A model whereby homologous pairing occurred between the DRSCC and ccr gene sequences of the two SCC elements, resulting in gene replacement in the L-C region of a previously extant SCCmec cassette, is one plausible explanation .
What Is Bioassay?,
What Is Antibiotic?,
What Is Bioreactor?,
What Is Amino Acid?,
What Is Genetics?,
c,
Bacteriology,
a,
Bacterium,
s,
Microorganisms,
s,
Microorganism,
e,
Microbes,
o,
Thermophile,
i,
Bacillus,
o,
Meningococcus,
e,
Antibiotics,
a,
Microorganism,
a,
Thermophile,
a,
Antibiotics,
i,
Bacteria,
s,
Staphylococcus,
o,
Campylobacter,
a,
Antibiotics,
c,
S. cerevisiae,
i,
Haemophilus,
n,
Sepsis,
n,
Fermentations,
e,
Escherichia coli,
c,
S. cerevisiae,
c,
Enterobacters,
s,
Fermentations,
i,
E coli O157,
o,
Growth media
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||