What Is PCR?

Polymerase Chain Reaction (PCR) is a molecular biological method for amplifying (creating multiple copies of) DNA without using a living organism, such as E. coli or yeast. PCR is commonly used in medical and biological research labs for a variety of tasks, such as the detection of hereditary diseases, the identification of genetic fingerprints, the diagnosis of infectious diseases, the cloning of genes, and paternity testing.

The basic method for performing PCR was invented by Kary Mullis, who was awarded the Nobel Prize in Chemistry in October 1993 for this achievement, only seven years after he first published his ideas. Mullis's idea was to develop a process by which DNA could be artificially multiplied through repeated cycles of duplication driven by an enzyme called DNA polymerase.

DNA polymerase occurs naturally in living organisms, where it functions to duplicate DNA when cells divide. It works by binding to a single DNA strand and creating the complementary strand. In Mullis's original PCR process, the enzyme was used in vitro (in a controlled environment outside an organism). The double-stranded DNA was separated into two single strands by heating it to 96°C. At this temperature, however, DNA-Polymerase was destroyed so that the enzyme had to be replenished after the heating stage of each cycle. Mullis's original PCR process was very inefficient since it required a great deal of time, vast amounts of DNA-Polymerase, and continual attention throughout the PCR process.

Later, this original PCR process was improved by the use of DNA-Polymerase taken from thermophilic (heat-loving) bacteria that grow in geysers at a temperature of over 110°C. The DNA-Polymerase taken from these organisms is thermostable (stable at high temperatures) and, when used in PCR, did not break down when the mixture was heated to separate the DNA strands. Since there was no longer a need to add new DNA-Polymerase for each cycle, the process of copying a given DNA strand could be simplified and automated.

One of the first thermostable DNA-Polymerases was obtained from Thermus aquaticus and called Taq. Taq polymerase is widely used in current PCR practice (May 2004). A disadvantage of Taq is that it sometimes makes mistakes when copying DNA, leading to mutations (errors) in the DNA sequence, since it lacks 3'->5' proofreading exonuclease activity. Polymerases such as Pwo or Pfu, obtained from Archaea, have proofreading mechanisms (mechanisms that check for errors) and can significantly reduce the number of mutations that occur in the copied DNA sequence. Combinations of both Taq and Pfu are available nowadays that provide both the high fidelity and accurate amplification of DNA

Patent wars The PCR technique was patented by Cetus Corporation, where Mullis worked when he invented the technique. The Taq polymerase enzyme is also covered by patents. There have been several high-profile lawsuits related to the technique, including most famously a lawsuit brought by DuPont. The pharmaceutical company Hoffmann-La Roche purchased the rights to the patents in 1992 and currently holds them.

PCR is used to amplify a short, well-defined part of a DNA strand. This can be a single gene, or just a part of a gene. As opposed to living organisms, the PCR process can copy only short DNA fragments, usually up to 10 kb (kb=kilo base pairs=1000 base pairs). DNA is double-stranded, and therefore, it is measured in complementary DNA building blocks (nucleic acids) called base pairs. Certain methods can copy fragments up to 40 kb in size, which is still much less than the chromosomal DNA of a eukaryotic cell--for example, a human cell contains about three billion base pairs.

PCR, as currently practiced, requires several basic components. These components are:

DNA template, which contains the region of the DNA fragment to be amplified Two primers, which determine the beginning and end of the region to be amplified (see following section on primers) DNA-Polymerase, which copies the region to be amplified Nucleotides, from which the DNA-Polymerase builds the new DNA Buffer, which provides a suitable chemical environment for the DNA-Polymerase The PCR reaction is carried out in a thermal cycler. This is a machine that heats and cools the reaction tubes within it to the precise temperature required for each step of the reaction. To prevent evaporation of the reaction mixture, a heated lid is placed on top of the reaction tubes or a layer of oil is put on the surface of the reaction mixture. These machines cost in the order of USD 2,500 in 2004.

Primers The DNA fragment to be amplified is determined by selecting primers. Primers are short, artificial DNA strands--not more than fifty (usually 18-25 bp) nucleotides (since DNA is usually double-stranded, its length is measured in base pairs; the length of single-stranded DNA is measured in bases or nucleotides) that exactly match the beginning and end of the DNA fragment to be amplified. They anneal (adhere) to the DNA template at these starting and ending points, where the DNA-Polymerase binds and begins the synthesis of the new DNA strand.

The choice of the length of the primers and their melting temperature (Tm) depends on a number of considerations. The melting temperature of a primer--not to be confused with the melting temperature of the DNA in the first step of the PCR process--is defined as the temperature below which the primer will anneal to the DNA template and above which the primer will dissociate (break apart) from the DNA template. The melting temperature increases with the length of the primer. Primers that are too short would anneal at several positions on a long DNA template, which would result in non-specific copies. On the other hand, the length of a primer is limited by the temperature required to melt it. Melting temperatures that are too high, i.e., above 80°C, can also cause problems since the DNA-Polymerase is less active at such temperatures. The optimum length of a primer is generally from twenty to forty nucleotides with a melting temperature between 60°C and 75°C.

Sometimes degenerate primers are used. These are actually mixtures of similar, but not identical, primers. They may be convenient if same gene is to be amplified from different organisms, as the genes themselves are probably similar but not identical. The other use for degenerate primers is when primer design is based on protein sequence. As several different codons can code for one amino acid, it is often difficult to deduce which codon is used in a particular case. Therefore primer sequence corresponding to the amino acid isoleucine might be "ATH", where A stands for adenine, T for thymine, and H for adenine, thymine, or cytosine. (See genetic code for further details about codons) Use of degenerate primers can greatly reduce the spesificity of the PCR amplification. The problem can be partly solved by using touchdown PCR.

Above mentioned considerations makes primer design very accurate process, on which depends product yield:

GC-content should be between 40-60. Calculated Tm for both primers used in reaction should not differ >5°C and Tm of the amplification product should not differ from primers by >10°C. Annealing temperature usually is -5°C the calculated lower Tm. However it should be chosen empirically for individual conditions. Inner self-complementary hairpins of >4 and of dimers >8 should be avoided. 3' terminus is extremely case sensitive - it must not be complementary to any region of the other primer used in the reaction and must provide correct base matching to template. There are programs to help design primers (see External links).

Procedure The PCR process consists of a series of twenty to thirty cycles. Each cycle consists of three steps (Fig. 2).

(1) The double-stranded DNA has to be heated to 94-96°C in order to separate the strands. This step is called melting; it breaks apart the hydrogen bonds that connect the two DNA strands. Prior to the first cycle, the DNA is often melted for an extended time to ensure that both the template DNA and the primers have completely separated and are now single-strand only. Time: 1-2 minutes.

(2) After separating the DNA strands, the temperature is lowered so the primers can attach themselves to the single DNA strands. This step is called annealing. The temperature of this stage depends on the primers and is usually 5°C below their melting temperature (45-60°C). A wrong temperature during the annealing step can result in primers not binding to the template DNA at all, or binding at random. Time: 1-2 minutes.

(3) Finally, the DNA-Polymerase has to fill in the missing strands. It starts at the annealed primer and works its way along the DNA strand. This step is called elongation. The elongation temperature depends on the DNA-Polymerase. The time for this step depends both on the DNA-Polymerase itself and on the length of the DNA fragment to be amplified. As a rule-of-thumb we use 1 minute per 1000bp.

The PCR product can be identified by its size using agarose gel electrophoresis. Agarose gel electrophoresis is a procedure that consists of injecting DNA into agarose gel and then applying an electric current to the gel. As a result, the smaller DNA strands move faster than the larger strands through the gel toward the positive current. The size of the PCR product can be determined by comparing it with a DNA ladder, which contains DNA fragments of known size, also within the gel (Fig. 3).

PCR optimisation Since PCR is very sensitive, adequate measures to avoid contamination from other DNA present in lab environment (bacteria, viruses, own DNA etc.) should be taken. Thus DNA sample preparation, reaction mixture assemblage and the PCR process, in addition to the subsequent reaction product analysis, should be performed in separate areas. For the preparation of reaction mixture, a laminar flow cabinet with UV lamp is recomended. Fresh gloves should be used for each PCR step as well as displacement pipettes with aerosol flters. The reagents for PCR should be prepared separately and used solely for this purpose. Aliquots should be stored separately from other DNA samples. A control reaction (inner control), omiting template DNA, should always be performed, to confirm the absence of contamination.

Recent developments in PCR techniques A more recent method which excludes a temperature cycle, but uses enzymes, is helicase-dependent amplification. A style of PCR that reduces nonspecific primer annealing is Touchdown PCR.

Uses of PCR PCR can be used for a broad variety of experiments and analyses. Some examples are discussed below.

Genetic fingerprinting Genetic fingerprinting is a forensic technique used to identify a person by comparing his or her DNA with a given sample, e.g., blood from a crime scene can be genetically compared to blood from a suspect. The sample may contain only a tiny amount of DNA, obtained from a source such as blood, semen, saliva, hair, etc. Theoretically, just a single strand is needed. First one breaks the DNA sample into fragments, then amplifies them using PCR. The amplified fragments are then separated using gel electrophoresis. The overall layout of the DNA fragments is called a DNA fingerprint.

Although these resulting 'fingerprints' are unique (except for identical twins), genetic relationships, for example, parent-child or siblings, can be determined from two or more genetic fingerprints, which can be used for paternity tests (Fig. 4). A variation of this technique can also be used to determine evolutionary relationships between organisms.

Detection of hereditary diseases The detection of hereditary diseases in a given genome is a long and difficult process, which can be shortened significantly by using PCR. Each gene in question can easily be amplified through PCR by using the appropriate primers and then sequenced to detect mutations.

Viral diseases, too, can be detected using PCR through amplification of the viral DNA. This analysis is possible right after infection, which can be from several days to several months before actual symptoms occur. Such early diagnoses give physicians a significant lead in treatment.

Cloning genes Cloning a gene--not to be confused with cloning a whole organism--describes the process of isolating a gene from one organism and then inserting it into another organism. PCR is often used to amplify the gene, which can then be inserted into a vector (a vector is a means of inserting a gene into an organism) such as a plasmid (a circular DNA molecule) (Fig. 5). The DNA can then be transferred into a different organism where the gene and its product can be studied more closely. Expressing a cloned gene (to express a gene means to produce the protein that it determines the production of) can also be a way of mass-producing useful proteins--for example, medicines.

Mutagenesis is a way of making changes to the sequence of nucleotides in the DNA. There are situations in which one is interested in mutated (changed) copies of a given DNA strand, for example, when trying to assess the function of a gene or in in-vitro protein evolution. Mutations can be introduced into copied DNA sequences in two fundamentally different ways in the PCR process. Site-directed mutagenesis allows the experimenter to introduce a mutation at a specific location on the DNA strand. Usually, the desired mutation is incorporated in the primers used for the PCR program. Random mutagenesis, on the other hand, is based on the use of error-prone polymerases in the PCR process. In the case of random mutagenesis, the location and nature of the mutations cannot be controlled. One application of random mutagenesis is to analyze structure-function relationships of a protein. By randomly altering a DNA sequence, one can compare the resulting protein with the original and determine the function of each part of the protein.

Analysis of ancient DNA Using PCR, it becomes possible to analyze DNA that is thousands of years old. PCR techniques have been successfully used on animals, such as a forty-thousand-year-old mammoth, and also on human DNA, in applications ranging from the analysis of Egyptian mummies to the identification of a Russian tsar.

Genotyping of specific mutations Through the use of allele-specific PCR, one can easily determine which allele of a mutation or polymorphism an individual has. Here, one of the two primers is common, and would anneal a short distance away from the mutation, while the other anneals right on the variation. The 3' end of the allele-specific primer is modified, to only anneal if it matches one of the alleles. If the mutation of interest is a T or C single nucleotide polymorphism (T/C SNP), one would use two reactions, one containing a primer ending in T, and the other ending in C. The common primer would be the same. Following PCR, these two sets of reactions would be run out on an agarose gel, and the band pattern will tell you if the individual is homozygous T, homozygous C, or heterzygous T/C. This methodology has several applications, such as amplifying certain haplotypes (when certain alleles at 2 or more SNPs occur together on the same chromosome [Linkage Disequilibrium]) or detection of recombinant chromosomes and the study of meiotic recombination.

Comparison of gene expression Researchers have used traditional PCR as a way to estimate changes in the amount of a gene's expression. Ribonucleic acid (RNA) is the molecule into which DNA is transcribed prior to making a protein, and those strands of RNA that hold the instructions for protein sequence are known as messenger RNA (mRNA). Once RNA is isolated it can be reverse transcribed back into DNA (complementary DNA to be precise, known as cDNA), at which point traditional PCR can be applied to amplify the gene. In most cases if there is more starting material (mRNA) of a gene then during PCR more copies of the gene will be generated. When the product of the PCR reaction are run on an agarose gel (see Figure 3 above) a band, corresponding to a gene, will appear larger on the gel (note that the band remains in the same location relative to the ladder, it will just appear fatter or brighter). By running samples of amplified cDNA from differently treated organisms one can get a general idea of which sample expressed more of the gene of interest.

A DNA polymerase is an enzyme that assists in DNA replication. Such enzymes catalyze the polymerization of deoxyribonucleotides alongside a DNA strand, which they "read" and use as a template. The newly polymerized molecule is complementary to the template strand and identical to the template's partner strand.

All DNA polymerases synthesize DNA in the 5' to 3' direction. No known DNA polymerase is able to begin a new chain (de novo). They can only add a nucleotide onto a preexisting 3'- OH group. For this reason DNA polymerase needs a primer at which it can add the first nucleotide. Primers consist of RNA and DNA bases with the first two bases always being RNA and are synthesized by another enzyme called primase. An enzyme known as a helicase is required to unwind DNA from a double stranded structure to a single stranded structure to facilitate replication of each strand consistent with the semiconservative model of DNA replication.

DNA polymerases have highly conserved structure which means that their overall catalytic subunits vary, on a whole, very little from species to species. Conserved structures usually indicate evolutionary advantages.

DNA polymerase is considered to be a holoenzyme since it requires a Magnesium ion as a co-factor to function properly. In the absence of the Magnesium ion, it is referred to as an apoenzyme.

Error correction is a property of some, but not all, DNA polymerases. This process corrects mistakes in newly synthesized DNA. When an incorrect base pair is recognized, DNA polymerase reverses its direction by one base pair of DNA. The 3'-5' exonuclease activity of the enzyme allows the incorrect base pair to be excised. Following base excision, the polymerase can re-insert the correct base and replication can continue.

Some viruses also encode special DNA polymerases which may selectively replicate viral DNA through a variety of mechanisms. Retroviruses encode an unusual DNA polymerase called reverse transcriptase, which is an RNA-dependent DNA polymerase (RdDp). It polymerizes DNA from a template of RNA.

Kary Banks Mullis (born December 28, 1944) is a biochemist. In the 1980s, he invented the polymerase chain reaction (PCR), a central technique in molecular biology which allows the amplification of specified DNA sequences. He was awarded the Nobel Prize in Chemistry and the Japan Prize for this work in 1993.

Mullis was born in North Carolina, and grew up in Columbia, South Carolina. He attended the Georgia Institute of Technology, and received a PhD in biochemistry from the University of California, Berkeley in 1973.

He has been married four times (including his current marriage), and has two sons and one daughter. He is the founder of the company Altermune, LLC.

Mullis holds several highly idiosyncratic views. In his 1998 essay collection Dancing Naked in the Mind Field he relates experiences that he attributes to space alien visitors. (Actually, he says it is similiar in form to such experiences; he doesn't claim it's aliens. He was walking alone at night, he encountered a talking racoon, and then lost all memory of what happened the next 5 hours.) He also claims that the evidence behind astrology has not been adequately appreciated. For those who do appreciate it, let us quote his book: "I was born at 17:38 Greenwich Mean Time on December 28, 1944 in Lenoir, North Carolina. You can find out more about me from that than you can from reading this book." He had a weird experience that he gives a parapsychological explanation.

Kary Mullis is among a scientific minority that claims that there is no sufficient evidence for stating that HIV causes AIDS (see AIDS reappraisal).

He has also advocated that concentrations be measured in "number of things per milliliter" instead of "moles per milliliter" because of the arbitrariness of Avogadro's number. (This is inaccurate; the essay really is about thinking outside convention, where conventionally different types of chemicals had different concentration scales, like "activity" for enzymes.) He denigrates the hysteria about global warming, denying that it is human caused, and he believes we are more likely entering an ice age.

Mullis, according to the above mentioned essay collection, has been at various times an avid surfer and drug-user. (Nitrous oxide, marijuana, DET, LSD (before it was illegal)) He currently resides in Newport Beach, California and in Anderson Valley, California.

If it seems the above emphasises the idiosyncratic, it is only because his book does likewise. The main theme is the quest to escape mental ruts.

Genetic fingerprinting or DNA testing is a technique to distinguish between individuals of the same species using only samples of their DNA. Its invention by Sir Alec Jeffreys at the University of Leicester was announced in 1985.

Two humans will have the vast majority of their DNA sequence in common. Genetic fingerprinting exploits highly variable repeating sequences called microsatellites. Two unrelated humans will be likely to have different numbers of microsatellites at a given locus. By using PCR to detect the number of repeats at several loci, it is possible to establish a match that is extremely unlikely to have arisen by coincidence.

Genetic fingerprinting is used in forensic science, to match suspects to samples of blood, hair, saliva or semen. It has also lead to several exonerations of formerly convicted suspects. It is also used in such applications as studying populations of wild animals, paternity testing, identifying dead bodies, and establishing the province or composition of foods. It has also been used to generate hypotheses on the pattern of the human diaspora in prehistoric times.

One of the common bases is adenine (a purine derivative), coupled to ribose it is called adenosine, coupled to deoxyribose it is called deoxyadenosine. The 5′-triphosphate derivative of adenosine, commonly called ATP, for adenosine triphosphate, is an important energy transport molecule in cells.

See nucleic acid nomenclature for a diagram showing the numbered positions in a 5′-monophosphate nucleotide.

2-deoxyribose and ribose nucleotides are often found in unbranched 5′-3′ polymers. In these structures the 3′ carbon of one monomer unit is linked to a phosphate that is attached to the 5′ carbon of the next unit, and so on. These polymer chains often contain many millions of monomer units. Since long polymers have physical properties distinctly different from small molecules they are called macromolecules. The sugar-phosphate-sugar chain is called the backbone of the polymer. One end of the backbone has a free 5′ phosphate and the other end has a free 3′ OH group. The backbone structure is independent of which particular bases are attached to the individual sugars.

Genetic material in earthly life often contains poly 5′-3′, 2′-deoxyribose nucleotides, in structures called chromosomes, where each monomer is one of the nucleotides deoxy- adenine, thymine, guanine or cytosine. This material is commonly called deoxyribonucleic acid, or simply DNA for short.

DNA in chromosomes forms very long helical structures containing two molecules with the backbones running in opposite directions on the outside of the helix and held together by hydrogen bonds between complementary nucleotide bases lying between the helical backbones. The lack of the 2′ hydroxyl group in DNA appears to allows the backbone the flexibility to assume the full conformation of the long double helix, which involves not only the basic helix, but additional coiling necessary to fit these very long molecules into the very small volume of a cell nucleus.

In contrast, very similar molecules, containing ribose instead of deoxyribose, and known generically as RNA, are only known to form relatively short double helical complementary base paired structures. These are well known, for instance, in ribosomal RNA molecules and in transfer RNA (tRNA), where so called hairpin structures form from palindromic sequences within one molecule.

Ribose is a five carbon sugar (pentose) that is critical to living creatures. It is a component of the RNA that is used for genetic transcription, and is related to deoxyribose which is a component of DNA. It is also a component of ATP, NADH, and several other chemicals that are critical to the metabolic process.

Refer to the article on Deoxyribose for more information on both sugars, how they relate to each other, and how they relate to genetic material.

Pyrimidine is an organic compound, a conjugated amine which is similar to benzene, but with a heterocyclic ring: two nitrogen atoms taking the place of carbon atoms at positions 1 and 3 relative to each other around the six-member ring.

Three bases of the nucleic acids, namely cytosine, thymine, and uracil, are pyrimidine derivatives. In DNA, these bases form hydrogen bonds with their complementary purines.

A nucleic acid is a complex, high-molecular-weight biochemical macromolecule composed of nucleotide chains that convey genetic information. The most common nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Nucleic acids are found in all living cells and viruses.

Nucleic acid, so called because of its prevalence in cellular nuclei, is the generic name of family of biopolymers. The monomers are called nucleotides, and each consists of three components: a nitrogenous heterocyclic base (either a purine or a pyrimidine), a pentose sugar, and a phosphate group. Different nucleic acid types differ in the specific sugar found in their chain (e.g. DNA or deoxyribonucleic acid contains 2-deoxyriboses). Also, the nitrogenous bases possible in the two nucleic acids are different: adenine, cytosine, and guanine are possible in both RNA and DNA, while thymine is possible only in DNA and uracil is possible only in RNA.

The sugars and phosphates in nucleic acids are connected to each other in an alternating chain through shared oxygens (forming a phosphodiester functional group). Using the conventional nomenclature, the carbons to which the phosphate groups are attached are the 3' and the 5' carbons. The bases extend from a glycosidic linkage to the 1' carbon of the pentose ring.

Nucleic acids may be single-stranded or double-stranded. A double-stranded nucleic acid consists of two single-stranded nucleic acids hydrogen-bonded together. RNA is usually single-stranded, but any given strand is likely to fold back upon itself to form double-helical regions. DNA is usually double-stranded, though some viruses have single-stranded DNA as their genome.

Nucleic acids are primarily biology's means of storing and transmitting genetic information, though RNA is also capable of acting as an enzyme.

Deoxyribonucleic acid (DNA) is a nucleic acid which carries genetic instructions for the biological development of all cellular forms of life and many viruses. DNA is sometimes referred to as the molecule of heredity as it is inherited and used to propagate traits. During reproduction, it is replicated and transmitted to offspring.

In bacteria and other simple cell organisms, DNA is distributed more or less throughout the cell. In the complex cells that make up plants, animals and in other multi-celled organisms, most of the DNA is found in the chromosomes, which are located in the cell nucleus. The energy-generating organelles known as chloroplasts and mitochondria also carry DNA, as do many viruses.

Although sometimes called "the molecule of heredity", pieces of DNA as people typically think of them are not single molecules. Rather, they are pairs of molecules, which entwine like vines to form a double helix (see the illustration at the right).

Each vine-like molecule is a strand of DNA: a chemically linked chain of nucleotides, each of which consists of a sugar, a phosphate and one of four kinds of Aromatic hydrocarbon "bases". Because DNA strands are composed of these nucleotide subunits, they are polymers.

The diversity of the bases means that there are four kinds of nucleotides, which are commonly referred to by the identity of their bases. These are adenine (A), thymine (T), cytosine (C), and guanine (G).

In a DNA double helix, two polynucleotide strands can associate through the hydrophobic effect. Specificity of which strands stay associated is determined by complementary pairing. Each base forms hydrogen bonds readily to only one other -- A to T and C to G -- so that the identity of the base on one strand dictates the strength of the association; the more complementary bases exist, the stronger and longer-lasting the association.

The cell's machinery is capable of melting or disassociating a DNA double helix, and using each DNA strand as a template for synthesizing a new strand which is nearly identical to the previous strand. Errors that occur in the synthesis are known as mutations. The process known as PCR mimics this process in vitro in a nonliving system.

Because pairing causes the nucleotide bases to face the helical axis, the sugar and phosphate groups of the nucleotides run along the outside, and the two chains they form are sometimes called the "backbones" of the helix. In fact, it is chemical bonds between the phosphates and the sugars that link one nucleotide to the next in the DNA strand.

The role of the sequence Within a gene, the sequence of nucleotides along a DNA strand defines a protein, which an organism is liable to manufacture or "express" at one or several points in its life using the information of the sequence. The relationship between the nucleotide sequence and the amino-acid sequence of the protein is determined by simple cellular rules of translation, known collectively as the genetic code. The genetic code is made up of three letter 'words' (termed a codon) formed from a sequence of three nucleotides (eg. ACT, CAG, TTT). These codons can then be translated with messenger RNA and then transfer RNA, with a codon corresponding to a particular amino acid. Since there are 64 possible codons, most amino acids have more than one possible codon. There are also three 'stop' or 'nonsense' codons signifying the end of the coding region.

In many species of organism, only a small fraction of the total sequence of the genome appears to encode protein. The function of the rest is a matter of speculation. It is known that certain nucleotide sequences specify affinity for DNA binding proteins, which play a wide variety of vital roles, in particular through control of replication and transcription. These sequences are frequently called regulatory sequences, and researchers assume that so far they have identified only a tiny fraction of the total that exist. "Junk DNA" represents sequences that do not yet appear to contain genes or to have a function.

Testing is subject to the legal code of the jurisdiction in which it is performed. Usually the testing is voluntary, but it can be made compulsory by such instruments as a search warrant or court order. Several jurisdictions have also begun to assemble databases containing DNA information of convicts. DNA fingerprinting begins by extracting DNA from the cells in a sample of blood, saliva, semen, or other appropriate fluid or tissue. Next, restriction fragment length polymorphism (RFLP) analysis is performed by using a restriction enzyme to cut the DNA into fragments which are separated into bands during agarose gel electrophoresis. Next, the bands of DNA are transferred via a technique called Southern blotting from the agarose gel to a nylon membrane. The DNA probe binds to certain and specific DNA sequences on the membrane and the excess DNA probe is washed off. An X-ray film is placed next to the nylon membrane to detect the radioactive pattern. This film is then developed to make a visible pattern of bands called DNA fingerprinting. Recently, an additional technique for genetic fingerprinting has been introduced: AFLP, or amplified fragment length polymorphism. This new technique is similar to RFLP analysis, but introduces a few other features, like two rounds of amplification and specially made primers. AFLP analysis is now highly automated, and allows for easy creation of phylogenetic trees based on comparing individual samples of DNA. One of the most modern and widely accepted methods for producing DNA fingerprints in criminal cases, is that of polymerase chain reaction (PCR). PCR involves the amplification of specific regions of DNA that are known to be highly variable from one individual to another. e, l, c, c, j. This amplification process allows the scientist to start with a very small amount of material, and the outcome is a highly discriminating outcome, with the chance of a random match being in the 1 in a billion region. PCR is by far the most common method for presenting DNA evidence in a forensic context.

Sequence also determines a DNA segment's susceptibility to cleavage by restriction enzymes, the quintessential tools of genetic engineering. The position of cleavage sites throughout an individual's genome determines one kind of an individual's "DNA fingerprint".

The hydrogen bonds between the strands of the double helix are weak enough that they can be easily separated by enzymes. Enzymes known as helicases unwind the strands to facilitate the advance of sequence-reading enzymes such as DNA polymerase. The unwinding requires that helicases chemically cleave the phosphate backbone of one of the strands so that it can swivel around the other. The strands can also be separated by gentle heating, as used in PCR, provided they have fewer than about 10,000 base pairs (10 kilobase pairs, or 10 kbp). The intertwining of the DNA strands makes long segments difficult to separate.

When the ends of a piece of double-helical DNA are joined so that it forms a circle, as in plasmid DNA, the strands are topologically knotted. This means they cannot be separated by gentle heating or by any process that does not involve breaking a strand. The task of unknotting topologically linked strands of DNA falls to enzymes known as topoisomerases. Some of these enzymes unknot circular DNA by cleaving two strands so that another double-stranded segment can pass through. Unknotting is required for the replication of circular DNA as well as for various types of recombination in linear DNA.

The DNA helix can assume one of three slightly different geometries, of which the "B" form described by James D. Watson and Francis Crick is believed to predominate in cells. It is 2 nanometres wide and extends 3.4 nanometres per 10 bp of sequence. This is also the approximate length of sequence in which the helix makes one complete turn about its axis. This frequency of twist (known as the helical pitch) depends largely on stacking forces that each base exerts on its neighbors in the chain.

The narrow breadth of the double helix makes it impossible to detect by conventional electron microscopy, except by heavy staining. At the same time, the DNA found in many cells can be macroscopic in length -- approximately 5 centimetres long for strands in a human chromosome. Consequently, cells must compact or "package" DNA to carry it within them. This is one of the functions of the chromosomes, which contain spool-like proteins known as histones, around which DNA winds.

The B form of the DNA helix twists 360° per 10.6 bp in the absence of strain. But many molecular biological processes can induce strain. A DNA segment with excess or insufficient helical twisting is referred to, respectively, as positively or negatively "supercoiled". DNA in vivo is typically negatively supercoiled, which facilitates the unwinding of the double-helix required for RNA transcription.

The two other known double-helical forms of DNA, called A and Z, differ modestly in their geometry and dimensions. The A form appears likely to occur only in dehydrated samples of DNA, such those used in crystallography experiments, and possibly in hybrid pairings of DNA and RNA strands. Segments of DNA that cells have methylated for regulatory purposes may adopt the Z geometry, in which the strands turn about the helical axis like a mirror image of the B form.

DNA sequence reading The asymmetric shape and linkage of nucleotides means that a DNA strand always has a discernible orientation or directionality. Because of this directionality, close inspection of a double helix reveals that nucleotides are heading one way along one strand (the "ascending strand"), and the other way along the other strand (the "descending strand"). This arrangement of the strands is called antiparallel.

For reasons of chemical nomenclature, people who work with DNA refer to the asymmetric termini of each strand as the 5' and 3' ends (pronounced "five prime" and "three prime"). DNA workers and enzymes alike always read nucleotide sequences in the "5' to 3' direction". In a vertically oriented double helix, the 3' strand is said to be ascending while the 5' strand is said to be descending.

As a result of their antiparallel arrangement and the sequence-reading preferences of enzymes, even if both strands carried identical instead of complementary sequences, cells could properly translate only one of them. The other strand a cell can only read backwards. Molecular biologists call a sequence "sense" if it is translated or translatable, and they call its complement "antisense". It follows then, somewhat paradoxically, that the template for transcription is the antisense strand. The resulting transcript is an RNA replica of the sense strand and is itself sense.

Some viruses blur the distinction between sense and antisense, because certain sequences of their genomes do double duty, encoding one protein when read 5' to 3' along one strand, and a second protein when read in the opposite direction along the other strand. As a result, the genomes of these viruses are unusually compact for the number of genes they contain, which biologists view as an adaptation.

Topologists like to note that the juxtaposition of the 3' end of one DNA strand beside the 5' end of the other at both termini of a double-helical segment makes the arrangement a "crab canon".

Single-stranded DNA (ssDNA) and repair of mutations In some viruses DNA appears in a non-helical, single-stranded form. Because many of the DNA repair mechanisms of cells work only on paired bases, viruses that carry single-stranded DNA genomes mutate more frequently than they would otherwise. As a result, such species may adapt more rapidly to avoid extinction. The result would not be so favorable in more complicated and more slowly replicating organisms, however, which may explain why only viruses carry single-stranded DNA. These viruses presumably also benefit from the lower cost of replicating one strand versus two.

The discovery of DNA and the double helix Working in the 19th century, biochemists initially isolated DNA and RNA (mixed together) from cell nuclei. They were relatively quick to appreciate the polymeric nature of their "nucleic acid" isolates, but realized only later that nucleotides were of two types--one containing ribose and the other deoxyribose. It was this subsequent discovery that led to the identification and naming of DNA as a substance distinct from RNA.

Considerations when evaluating DNA evidence In the early days of the use of genetic fingerprinting as criminal evidence, juries were often swayed by spurious statistical arguments by defence lawyers along these lines: given a match that had a 1 in 5 million probability of occurring by chance, the lawyer would argue that this meant that in a country of say 60 million people there were 12 people who would also match the profile. This was then translated to a 1 in 12 chance of the suspect being the guilty one. This argument is not sound unless the suspect was drawn at random from the population of the country. In fact, a jury should consider how likely it is that an individual matching the genetic profile would also have been a suspect in the case for other reasons. The false assumption that a 1 in 5 million probability of a match automatically translates into a 1 in 5 million probability of innocence is known as the prosecutor's fallacy. Nowadays, more testing is carried out so that the theoretical risk of a coincidental match is 1 in 100 billion (100,000,000,000). However, the rate of laboratory error may be much higher than this, and often actual laboratory procedures do not reflect the theory under which the coincidence probabilities were computed. For example, the coincidence probabilities may be calculated based on the probabilities that markers in two samples have bands in precisely the same location, but a laboratory worker may conclude that similar -- but not precisely identical -- band patterns result from identical genetic samples with some imperfection in the agarose gel. b, b, h, k, f. However, in this case, the laboratory worker increases the coincidence risk by expanding the criteria for declaring a match. Recent studies have quoted relatively high error rates which may be cause for concern. The cautious juror should not convict on genetic fingerprint evidence alone if other factors raise doubt.

Friedrich Miescher (1844-1895) discovered a substance he called "nuclein" in 1869. Somewhat later, he isolated a pure sample of the material now known as DNA from the sperm of salmon, and in 1889 his pupil, Richard Altmann, named it "nucleic acid". This substance was found to exist only in the chromosomes.

Max Delbrück, Nikolai V. Timofeeff-Ressovsky, and Karl G. Zimmer published results in 1935 suggesting that chromosomes are very large molecules the structure of which can be changed by treatment with X-rays, and that by so changing their structure it was possible to change the heritable characteristics governed by those chromosomes. (Delbrück and Salvador Luria were awarded the Nobel Prize in 1969 for their work on the genetic structure of viruses.) In 1943, Oswald Theodore Avery discovered that traits proper to the "smooth" form of the Pneumococcus could be transferred to the "rough" form of the same bacteria merely by making the killed "smooth" (S) form available to the live "rough" (R) form. Quite unexpectedly, the living R Pneumococcus bacteria were transformed into a new strain of the S form, and the transferred S characteristics turned out to be heritable.

In 1944, the renowned physicist, Erwin Schrödinger, published a brief book entitled What is Life?, where he maintained that chromosomes contained what he called the "hereditary code-script" of life. He added: "But the term code-script is, of course, too narrow. The chromosome structures are at the same time instrumental in bringing about the development they foreshadow. They are law-code and executive power -- or, to use another simile, they are architect's plan and builder's craft -- in one." He conceived of these dual functional elements as being woven into the molecular structure of chromosomes. By understanding the exact molecular structure of the chromosomes one could hope to understand both the "architect's plan" and also how that plan was carried out through the "builder's craft." Francis Crick, James D. Watson, Maurice Wilkins, Rosalind Franklin, Seymour Benzer, et al., took up the physicist's challenge to work out the structure of the chromosomes and the question of how the segments of the chromosomes that were conceived to relate to specific traits could possibly do their jobs.

Just how the presence of specific features in the molecular structure of chromosomes could produce traits and behaviors in living organisms was unimaginable at the time. Because chemical dissection of DNA samples always yielded the same four nucleotides, the chemical composition of DNA appeared simple, perhaps even uniform. Organisms, on the other hand, are fantastically complex individually and widely diverse collectively. Geneticists did not speak of genes as conveyors of "information" in such words, but if they had, they would not have hesitated to quantify the amount of information that genes need to convey as vast. The idea that information might reside in a chemical in the same way that it exists in text--as a finite alphabet of letters arranged in a sequence of unlimited length--had not yet been conceived. It would emerge upon the discovery of DNA's structure, but few researchers imagined that DNA's structure had much to say about genetics.

In the 1950s, only a few groups made it their goal to determine the structure of DNA. These included an American group led by Linus Pauling, and two groups in Britain. At the University of Cambridge, Crick and Watson were building physical models using metal rods and balls, in which they incorporated the known chemical structures of the nucleotides, as well as the known position of the linkages joining one nucleotide to the next along the polymer. At King's College, London, Maurice Wilkins and Rosalind Franklin were examining x-ray diffraction patterns of DNA fibers.

A key inspiration in the work of all of these teams was the discovery in 1948 by Pauling that many proteins included helical (see alpha helix) shapes. Pauling had deduced this structure from x-ray patterns. Even in the initial crude diffraction data from DNA, it was evident that the structure involved helices. But this insight was only a beginning. There remained the questions of how many strands came together, whether this number was the same for every helix, whether the bases pointed toward the helical axis or away, and ultimately what were the explicit angles and coordinates of all the bonds and atoms. Such questions motivated the modeling efforts of Watson and Crick.

In their modeling, Watson and Crick restricted themselves to what they saw as chemically and biologically reasonable. Still, the breadth of possibilities was very wide. A breakthrough occurred in 1952, when Erwin Chargaff visited Cambridge and inspired Crick with a description of experiments Chargaff had published in 1947. Chargaff had observed that the proportions of the four nucleotides vary between one DNA sample and the next, but that for particular pairs of nucleotides -- adenine and thymine, guanine and cytosine -- the two nucleotides are always present in equal proportions.

Watson and Crick had begun to contemplate double helical arrangements, and they saw that by reversing the directionality of one strand with respect to the other, they could provide an explanation for Chargaff's puzzling finding. This explanation was the complementary pairing of the bases, which also had the effect of ensuring that the distance between the phosphate chains did not vary along a sequence. Watson and Crick were able to discern that this distance was constant and to measure its exact value of 2 nanometres from an X-ray pattern obtained by Franklin. The same pattern also gave them the 3.4 nanometre-per-10 bp "pitch" of the helix. The pair quickly converged upon a model, which they announced before Franklin herself published any of her work.

The great assistance Watson and Crick derived from Franklin's data has become a subject of controversy, and it has angered people who believe Franklin has not received the credit due to her. The most controversial aspect is that Franklin's critical X-ray pattern was shown to Watson and Crick without Franklin's knowledge or permission. Wilkins showed it to them at his lab while Franklin was away.

Watson and Crick's model attracted great interest immediately upon its presentation. Arriving at their conclusion on February 21, 1953, Watson and Crick made their first announcement on February 28. Their paper 'A Structure for Deoxyribose Nucleic Acid' (http://www.nature.com/genomics/human/watson-crick/) was published on April 25. In an influential presentation in 1957, Crick laid out the "Central Dogma", which foretold the relationship between DNA, RNA, and proteins, and articulated the "sequence hypothesis." A critical confirmation of the replication mechanism that was implied by the double-helical structure followed in 1958 in the form of the Meselson-Stahl experiment. Work by Crick and coworkers deciphered the genetic code not long afterward. These findings represent the birth of molecular biology.

Watson, Crick, and Wilkins were awarded the 1962 Nobel Prize for Medicine for discovering the molecular structure of DNA, by which time Franklin had died. Nobel prizes are not awarded posthumously.

DNA replication or DNA synthesis is the process of copying a double-stranded DNA strand, prior to cell division (in eukaryotes, during the S phase of mitosis and meiosis). The two resulting double strands are identical (if the replication went well), and each of them consists of one original and one newly synthesized strand. This is called semiconservative replication. The process of replication consists of three steps, initiation, replication and termination.

In the initiation step, several key factors are recruited to an origin of replication. This origin of replication is unwound, and the partially unwound strands form a "replication bubble", with one replication fork on either end. Each group of enzymes at the replication fork proceeds away from the origin, unwinding and replicating the DNA strands as they move.

The factors involved are collectively called the pre-replication complex. They are the following:

A helicase, which unwinds the DNA ahead of the fork. A primase, which generates an RNA primer to be used in DNA replication. A DNA holoenzyme, which is actually a complex of enzymes that performs the actual replication. Replication After the helicase unwinds the DNA, single-strand binding protein is used to hold the DNA strands in place. RNA primase is then bound to the starting DNA site.

At the beginning of replication, an enzyme called DNA polymerase binds to the RNA primase, which indicates the starting point for the replication. DNA polymerase can only synthesize new DNA from the 5’ to 3’ (of the new DNA). Because of this, the DNA polymerase can only travel on one side of the original strand without any interruption. This original strand, which goes from 3’ to 5’, is called a leading strand. The opposite original strand, from 5’ to 3’, is a lagging strand.

Since the DNA replication on the lagging strand is not continuous, a new DNA polymerase has to be added each time as the helicase unwinds more DNA. As a result, the replicated DNA is fragmented, called Okazaki fragments. Another enzyme, DNA ligase, is used to connect the fragments.

Coupled leading strand and lagging strand synthesis is achieved by the action of the polIII holoenzyme.

Termination When the polymerase reaches the end of replication, there is another problem due to the antiparallel structure. The RNA primer on the leading strand occupies a small portion of the DNA, which is not exposed to polymerase and therefore is not copied.

As a result, there would be a gap on the newly duplicated DNA at the original leading strand on the 5’ end. The solution is quite simple. The sticking out 3’ end consists of noncoding DNA called the telomere, which can be simply cut off.

Before the DNA replication is finally complete, enzymes are used to proofread the sequences to make sure the nucleotides are paired up correctly. If mistake or damage occurs, an enzyme called nuclease will remove the incorrect DNA. DNA polymerase will then fill in the gap.

The average human chromosome contains an enormous number of nucleotide pairs that are copied at about 50 base pairs per second. Yet, the entire replication process takes only about an hour. This is because there are many replication origin sites on a eukaryotic chromosome. Therefore, replication can begin at some origins earlier than at others. As replication nears completion, "bubbles" of newly replicated DNA meet and fuse, forming two new molecules.

When evaluating a DNA match, the following questions should be asked: Could it be an accidental random match? If not, could the DNA sample have been planted? If not, did the accused leave the DNA sample at the exact time of the crime? If yes, does that mean that the accused is guilty of the crime? Fake DNA evidence The value of DNA evidence has to be seen in light of recent cases where criminals planted fake DNA samples at crime scenes. In one notorious case, a criminal even planted fake DNA evidence in his own body: Dr. Schneeberger of Canada raped one of his sedated patients in 1992 and left semen on her underwear. His DNA was tested on three occasions, never showing a match. It turned out that he had surgically inserted a Penrose drain into his arm and filled it with foreign blood and anticoagulants. Cases British baker Colin Pitchfork was the first person to be convicted using DNA evidence in 1988. h, i, c, f, j. In 1992, DNA evidence was used to prove that Nazi doctor Josef Mengele was buried in Brazil as Wolfgang Gerhard. The science was made famous in the United States in 1994 when prosecutors heavily relied on and through expert witnesses exhaustively presented and explained DNA evidence allegedly linking O. J. Simpson to a double murder.

With multiple replication origin sites, a question is: how does the cell know which DNA has already been replicated and which still awaits replication? To date, two replication control mechanism have been identified: one positive and one negative. For DNA to be replicated, each replication origin site must be bound by a set of proteins called the origin recognition complex. These remain attached to the DNA throughout the replication process. Specific accessory proteins, called licensing factors, must also be present for initiation of replication. Destruction of these proteins after initiation of replication prevents further replication cycles from occurring. This is because licensing factors are only produced when the nuclear membrane of a cell breaks down during mitosis.

Measurement Conditional mutants Measurement of DNA replication can be done using conditional mutants. Mutants that grow at 30°C but not at 42°C are collected. These mutants should incorporate nucleotides into DNA at 30° but not at 42°C. Protein synthesis should not be affected.

There are two outcomes for a graph of incorporation of labelled nucleotides into DNA vs time:

Quick stop indicates the mutation is in a DNA synthesis factor. Slow stop indicates the mutation is possibly in an initiation factor. (dnaA). The assay can measure the imcorporation of deoxyribonucleotides into acid or ethanol insoluble forms. Gel filtration chromatography or ion exchange chromatography is used to get all protein fractions and is followed by assay for DNA polymerase.

Within a chromosome or a genome, the "junk" DNA are those portions of the DNA for which no function has been identified. The term "junk" is recognized as something of a misnomer, especially in light of the fact that molecular biology is a young science and segments of DNA may function in additional ways that have not yet been discovered. Recent work, as of 2004, suggests that junk DNA may indeed perform unrecognized functions.

In the genomes of most plants and animals, the biological role of an overwhelming percentage of the DNA is not known. The portions of a chromosome which are genes are often identifiable as open reading frames even when biologists lack full information about the proteins these genes presumably encode. Genome scientists find it reasonable to assume that these regions are important, even if they do not yet know exactly how. There are also "noncoding" DNA sequences that are known to be important. These include origins of replication, which define the starting points of DNA replication, and regulatory sequences such as promoters, which are involved in turning genes on and off.

About 97% of the human genome has been designated as "junk". The onion genome is 12 times the size of the human one, presumably because it contains even more junk. In contrast, the pufferfish genome is only about one tenth the size of the human, yet seems to have about the same number of genes. Therefore it seems that the ratio of functional and junk DNA differs widely per species.

A DNA sequence (sometimes genetic sequence) is a succession of letters representing the primary structure of a real or hypothetical DNA molecule or strand, The possible letters are A, C, G, and T, representing the four nucleotide subunits of a DNA strand (adenine, cytosine, guanine, thymine), and typically these are printed abutting one another without gaps, as in the sequence AAAGTCTGAC. This coded sequence is sometimes referred to as genetic information. A succession of any number of nucleotides greater than four is liable to be called a sequence. With regard to its biological function, which may depend on context, a sequence may be sense or anti-sense (see DNA), and either coding or noncoding. DNA sequences can also contain "junk DNA".

Mutations are permanent, transmissible changes to the genetic material (usually DNA or RNA) of a cell. Mutations can be caused by copying errors in the genetic material during cell division and by exposure to radiation, chemicals, or viruses, or can occur deliberately under cellular control during the processes such as meiosis or hypermutation. In multicellular organisms, mutations can be subdivided into germline mutations, which can be passed on to progeny and somatic mutations, which (when accidental) often lead to the malfunction or death of a cell and can cause cancer. Mutations are considered the driving force of evolution, where less favorable (or deleterious) mutations are removed from the gene pool by natural selection, while more favorable (or beneficial) ones tend to accumulate. Neutral mutations do not affect the organism's chances of survival in its natural environment and can accumulate over time, which might result in what is known as punctuated equilibrium; the modern interpretation of classic evolutionary theory. It should be noted that, contrary to science fiction, the overwhelming majority of mutations have no real effect.

Adenine is one of the two purine bases used in forming nucleotides of the nucleic acids DNA and RNA. In DNA, adenine (A) binds to thymine (T) to assist in stabilizing the nucleic acid structures. In RNA, adenine binds to uracil (U).

Adenine forms adenosine, a nucleoside, when attached to ribose, and deoxyadenosine when attached to deoxyribose, and it forms adenosine triphosphate (ATP), a nucleotide, when three phosphate groups are added to adenosine. Adenosine triphosphate is used in cellular metabolism as one of the basic methods of transferring chemical energy between reactions.

In older literature, adenine was sometimes called Vitamin B4. However it is no longer considered a true vitamin. (See Vitamin B.) It has a chemical formula of C5H5N5.

Thymine (C5H6N2O2, 2-oxy-4-oxy-5-methylpyrimidine, 2,4-dioxy-5-methylpyrimidine, 5-methyluracil) is one of the bases of the nucleic acid found in DNA. It can base pair with adenine.

Thymine combined with deoxyribose creates the nucleoside thymidine. Thymidine can be phosphorylated with one, two or three phosphoric acid groups, creating respectively TMP, TDP or TTP (thymidine mono- di- or triphosphate).

In RNA thymine is replaced with uracil.

Uracil is one of the four RNA bases, replacing thymine as found in DNA. Just like thymine, uracil can form a base pair with adenine via two hydrogen bonds, but it lacks the methyl group present in thymine. Uracil, in comparison to thymine, will more readily degenerate into cytosine.

In June of 2003, because of new DNA evidence, Dennis Halstead, John Kogut and John Restivo won a re-trial on their murder conviction. The three men had already served 18 years of their 30-plus year sentences. A paternity test is conducted to prove that a man is or is not the biological father of another individual. This may be relevant in view of rights and duties of the father. Similarly a maternity test can be carried out. This is less common because at least during childbirth it is obvious who the mother is. This can best be achieved by DNA analysis of the three individuals, although older methods have included ABO blood group typing, analysis of various other proteins and enzymes, or using HLA antigens. For the most part however, DNA has all but taken over all the other forms of testing. The DNA of an individual is almost exactly the same in each and every somatic cell. e, f, k, c, e. Sexual reproduction brings the DNA of both parents together randomly to create a unique combination of genetic material in a new cell, so the genetic material of an individual is derived from the genetic material of their parents. This genetic material is known as the nuclear genome of the individual, because it is found in the nucleus.

Uracil is also known as 2-oxy-4-oxy pyrimidine.

Cytosine is one of the 5 main nitrogenous bases used in storing and transporting genetic information within a cell. It is a pyrimidine derivative, with a heterocyclic aromatic ring and two substituents attached (an amine group at position 4 and a keto group at position 2). The nucleoside of cytosine is cytidine.

The other names for cytosine are 2-oxy-4-aminopyrimidine and 4-amino-2(1H)-pyrimidinone. It has a chemical formula of C4H5N3O and a molecular weight of 111.10 atomic mass units.

Cytosine was first discovered in 1894 when it was isolated from calf thymus tissues. A structure was proposed in 1903, and was synthesized (and thus confirmed) in the laboratory in the same year.

Cytosine can be found as part of DNA, RNA or as a part of a nucleotide. As cytosine triphosphate (CTP), it can act as a co-factor to enzymes, and can transfer a phosphate to convert adenosine diphosphate (ADP) to adenosine triphosphate (ATP).

In DNA and RNA, cytosine is paired with guanine. However, it is inherently unstable, and can change into uracil (spontaneous deamination).

Cytosine can also be methylated into 5-methylcytosine by an enzyme called DNA methyltransferase.

Guanine (2-amino-6-oxypurine) is one of the four main nitrogenous bases found in nucleic acids (e.g., DNA and RNA). Guanine is a purine derivative and in Watson-Crick base pairing forms hydrogen bonds in the plane of the fused rings with cytosine. Guanine "stacks" vertically with the other bases via aromatic interactions. Guanine exists as tautomers (see Keto-enol tautomerism), as depicted graphically on the right. The nucleoside is called guanosine.

Guanine is also the name of a white amorphous substance found in the scales of certain fishes, the guano of sea-birds, and the liver and pancreas of mammals.

A purine is a bicyclic organic compound, consisting of a fused pyrimidine/imidazole ring. Two of the bases in nucleic acids, adenine and guanine, are purines. In DNA, these bases form hydrogen bonds with their complementary pyrimidines thymine and cytosine.

These hydrogen bonding modes are for classical Watson-Crick base pairing. Other hydrogen bonding modes are seen in both DNA and RNA, although the additional 2'-hydroxyl group of RNA expands the configurations through which RNA can form hydrogen bonds.

Some other purines are xanthine, hypoxanthine, and caffeine.

Purines from food (or from tissue turnover) are metabolized by several enzymes, including xanthine oxidase, into uric acid. High levels of uric acid can predispose to gout when the acid crystalizes in joints; this phenomenon only happens in humans and some animal species (e.g. dogs) that lack an intrinsic urease enzyme that can further degrade uric acid.

History

Purine was named by the German chemist Emil Fisher in 1884. He synthesized it in 1898. Fisher showed that the Purines were part of a single chemical family.

In chemistry, a hydrogen bond is a type of attractive intermolecular force that exists between two partial electric charges of opposite polarity. Although stronger than most other intermolecular forces, the hydrogen bond is much weaker than both the ionic bond and the covalent bond. Within macromolecules such as proteins and nucleic acids, it can exist between two parts of the same molecule, and figures as an important constraint on such molecules' overall shape.

As the name "hydrogen bond" implies, one part of the bond involves a hydrogen atom. The hydrogen must be attached to a strongly electronegative heteroatom, such as oxygen, nitrogen or fluorine, which is called the hydrogen-bond donor. This electronegative element attracts the electron cloud from around the hydrogen nucleus and, by decentralizing the cloud, leaves the atom with a positive partial charge. Because of the small size of hydrogen relative to other atoms and molecules, the resulting charge, though only partial, nevertheless represents a large charge density. A hydrogen bond results when this strong positive charge density attracts a lone pair of electrons on another heteroatom, which becomes the hydrogen-bond acceptor.

The hydrogen bond is not like a simple attraction between point charges, however. It possesses some degree of orientational preference, and can be shown to have some of the characteristics of a covalent bond. This covalency tends to be more extreme when acceptors bind hydrogens from more electronegative donors.

Strong covalency in a hydrogen bond begs the question, to which molecule or atom does the hydrogen nucleus belong, as well as which should be labelled "donor" and which called "acceptor." According to chemical convention, the donor generally is that atom to which, on separation of donor and acceptor, the retention of the hydrogen nucleus (or proton) would cause no increase in the atom's positive charge. The acceptor meanwhile is the atom or molecule that would become more positive by retaining the positively charged proton.

The most ubiquitous, and perhaps simplest, example of a hydrogen bond is found between water molecules. In a discrete water molecule, water has two hydrogen atoms and one oxygen atom. Two molecules of water can form a hydrogen bond between them. The oxygen of one water molecule has two lone pairs of electrons, each of which can form a hydrogen bond with hydrogens on two other water molecules. This can repeat so that every water molecule is H-bonded with four other molecules (two through its two lone pairs, and two through its two hydrogen atoms.)

H-O-H...O-H2 Liquid water's high boiling point is due to the high number of hydrogen bonds each molecule can have relative to its low molecular mass. Water is unique because its oxygen atom has two lone pairs and two hydrogen atoms, meaning that the total number of bonds of a water molecule is four. (For example, hydrogen bromide- which has two lone pairs on the Br atom but only one H atom - can have a total of only two bonds.)

H-Br...H-Br...H-Br In ice, the crystalline lattice is dominated by a regular array of hydrogen bonds which space the water molecules farther apart than they are in liquid water. This accounts for water's decrease in density upon freezing. In other words, the presence of hydrogen bonds enables ice to float, because this spacing causes ice to be less dense than liquid water.

Were the bond strengths more equivalent, one might instead find the atoms of two interacting water molecules partitioned into two polyatomic ions of opposite charge, specifically hydroxide and hydronium.

H-O- H3O+ Indeed, in pure water under conditions of standard temperature and pressure, this latter formulation is applicable only rarely; on average about one in every 107 molecules gives up a proton to another water molecule, in accordance with the value of the dissociation constant for water under such conditions.

Hydrogen bonding also plays an important role in determining the three-dimensional structures adopted by proteins and nucleic acids. In these macromolecules, bonding between parts of the same macromolecule cause it to fold into a specific shape, which helps determine the molecule's physiological or biochemical role. The double helical structure of DNA, for example, is due largely to hydrogen bonding between the base pairs, which link one complementary strand to the other and enable replication.

In proteins, hydrogen bonds form between the backbone oxygens and amide hydrogens. When the spacing of the amino acid residues participating in a hydrogen bond occurs regularly between positions i and i+4, an alpha helix is formed. When the spacing is less, between positions i and i+3, then a 310 helix is formed. When two strands are joined by hydrogen bonds involving alternating residues on each participating strand, a beta sheet is formed.(See also protein folding).

Thermal cycler or thermocycler or PCR machine is a laboratory apparatus used for PCR. The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then rises and lowers the temperature of the block in discreet, pre-programmed steps.

Modern thermal cyclers are often equipped with hot bonnet, a heated plate that presses against the lids of the reaction tubes. This prevents condensation of water from the reaction mixtures to the insides of the lids and makes it unnecessary to use PCR oil. Some thermal cyclers are equipped with multiple blocks allowing several different PCR reactions to be carried out simultaneously. Also some apparatuses have a gradient function, which allowes different temperatures in different parts of the block. This is particularly useful when testing suitable annealing temperatures for primers. The prizes for thermal cyclers start from USD 2500 (in 2004).

Comparing the DNA sequence of an individual to that of another individual can show if one of them was derived from the other or not. Specific sequences are usually looked at to see if they were copied verbatim from one of the individuals genome to the other. If that was the case, then this proves that the genetic material of one individual was derived from that of the other (i.e.: one is the parent of the other). This way, paternity can be proved or disproved. Besides the nuclear DNA in the nucleus, the mitochondria in the cells also have their own genetic material termed the mitochondrial genome. Mitochondrial DNA comes only from the mother, without any shuffling. Proving a relationship based on comparison of the mitochondrial genome is much easier than that based on the nuclear genome. g, i, a, h, k. However, testing the mitochondrial genome can only prove if two individuals are related by common descent through maternal lines only from a common ancestor and is thus of limited value (for instance, it could not be used to test for paternity).

A nucleotide is an organic molecule consisting of a nitrogenous heterocyclic base (a purine or a pyrimidine), a pentose sugar (deoxyribose in DNA or ribose in RNA), and a phosphate or polyphosphate group. (A nucleoside is similar, except that it contains only the sugar and base, without a phosphate.)

Nucleotide names are abbreviated into standard four-letter codes. The first letter is lower case and indicates whether the nucleotide in question is a ribonucleotide (r) or deoxyribonucleotide (d). The second letter indicates the nitrogenous base included (G,A,T,C,U). The third and fourth letters indicate the number of attached phosphates (Mono-, Di-, Tri-) and the presence of a phosphate (P). For example, deoxy-cytosine-triphosphate is abbreviated as dCTP.

Nucleotides are the monomers of nucleic acids and also play important roles in cellular energy transport and transformations (notably ATP and NAD+/NADH) and in enzyme regulation (see for example, protein kinase).

Peptide sequence or amino acid sequence is the order in which amino acid residues, connected by peptide bonds, lie in the chain. The sequence is generally reported from the N-terminal end containing free amino group to the C-terminal end containing free carboxyl group. Peptide sequence is often called protein sequence if it represent the primary structure of a protein.

Several deductions can be made from the sequence. Long stretches of hydrophobic residues may indicate transmembrane helices. Certain residues indicate a beta sheet area. If full-lenght protein sequence is available, it is possible to estimate the isoelectric point of the protein. Methods for determining the peptide sequence include deduction from DNA sequence, Edman degradation, and mass spectrometry.

The genetic code is a set of rules, which maps DNA sequences to proteins in the living cell, and is employed in the process of protein synthesis. Nearly all living things use the same genetic code, called the standard genetic code, although a few organisms use minor variations of the standard code.

The genetic information carried by an organism - its genome - is inscribed in a DNA molecule. Each functional portion of this molecule is referred to as a gene. Each gene is transcribed into a short template molecule of the related polymer RNA, which is better suited for protein synthesis. This in turn is translated, by mediation of a machinery consisting of ribosomes and a set of transfer RNAs and associated enzymes, into an amino acid chain (polypeptide).

The gene sequence inscribed in DNA, and thus in RNA, is composed of units called codons, each coding for an amino acid, hence the phrase genetic code. The polypeptide is ultimately folded into a 3-dimensional protein structure, which will go on to perform some specific function in the cell such as an enzyme subunit or cell membrane component. This chain of events involving RNA transcription, and polypeptide translation is referred to as gene expression. Some genes encode other elements such as ribosomal RNAs and transfer RNAs, both of which are involved in protein synthesis.

Both DNA and RNA are comprised of 4 nucleotide bases. In the case of DNA this is comprised of adenine (A), guanine (G), cytosine (C) and thymine (T). RNA is identical with the exception that thymine (T) is substituted with uracil (U). Codons are non-overlapping groups of the three bases. There are 43 = 64 codons. For example, the RNA sequence UUUAAACCC contains the codons UUU, AAA and CCC, each of which specifies one amino acid. So, this RNA sequence represents a protein sequence, three amino acids long. (DNA is also a sequence of nucleotide bases, but there thymine takes the place of uracil.)

The standard genetic code is shown in the following tables. Table 1 shows what amino acid each of the 64 codons specifies. Table 2 shows what codons specify each of the 20 standard amino acids involved in translation. These are called forward and reverse codon tables, respectively. For example, the codon AAU represents the amino acid asparagine (Asp), and cysteine (Cys) is represented by UGU and by UGC.

In classical genetics, the stop codons were given names: UAG was amber, UGA was opal, and UAA was ocher. These names were originally the names of the specific genes in which mutation of each of these stop codons was first detected. Translation starts with a chain initiation codon (start codon). But unlike stop codons, these are not sufficient to begin the process; nearby initiation sequences are also required to induce transcription into mRNA and binding by ribosomes. The most notable start codon is AUG, which also codes for methionine. CUG and UUG, and in prokaryotes GUG and AUU, also work.

Many codons are redundant; i.e., two codons may code for the same amino acid. This redundancy is typically confined to the third position, e.g. both GAA and GAG code for the amino acid glutamine. A codon is said to be four-fold degenerate if any nucleotide at its third position specifies the same amino acid; it is said to be two-fold degenerate if only two of four possible nucleotides at its third position specify the same amino acid. In two-fold degenerate codons, the equivalent third position nucleotides are always either two purines (A/G) or two pyrimidines (C/T).

These properties of the genetic code make it more fault-tolerant for mutations. For example, four-fold degenerate codons can tolerate any mutation at the third position; two-fold degenerate codons can tolerate one out of the three possible mutations at the third position. Since transition mutations (purine to purine or pyrimidine to pyrimidine mutations) are more likely than transversion (purine to pyrimidine or vice-versa) mutations, the equivalence of purines or that of pyrimidines at two-fold degenerate sites adds a further fault-tolerance.

These variable codes for amino acids are possible because of modified bases in the first base of the anticodon, and the basepair formed is called a wobble base pair. The modified bases include inosine and the U-G basepair.

Only two amino acids are specified by a single codon; one of these is the amino-acid methionine, specified by the codon AUG, which also specifies the start of transcription; the other is tryptophan, specified by the codon UGG.

Origin of the genetic code Numerous variations of the standard genetic code are found in mitochondria, energy-burning organelles. Ciliate protozoa also have some variation in the genetic code: UAG and often UAA code for Glutamine (a variant also found in some green algae), or UGA codes for Cysteine. Another variant is found in some species of the yeast candida, where CUG codes for Serine. In some species of bacteria and archaea, a few non-standard amino acids are substituted for standard stop codons; UGA can code for selenocysteine and UAG can code for pyrrolysine. There may be other non-standard amino acids and codon interpretations that are not known.

Despite these variations, the genetic codes used by all known forms of life on Earth are very similar. Since there are many possible genetic codes that are thought to have similar utility to the one used by Earth life, the theory of evolution suggests that the genetic code was established very early in the history of life.

One can ask the question: is the genetic code completely random, just one set of codon-amino acid correspondences that happened to establish itself and be "frozen in" early in evolution, although functionally any other of the near-infinite set of possible transcription tables would have done just as well? Already a cursory look at the table shows patterns that suggest that this is not the case.

Recent aptamer experiments have shown, that amino acids have indeed a selective chemical affinity for the base triplets that code for them. This suggests, that the current, complex transcription mechanism involving tRNA and associated enzymes is a later development, and that originally, protein sequences were directly templated on base sequences. Also, evidence has been found that originally the number of different amino acids used may have been considerably smaller than today.

Helicase-dependent amplification (HDA) is a method for in vitro DNA amplification like the polymerase chain reaction.

The disadvantage of PCR is that it consumes a lot of time with uncoiling the double-stranded DNA with heat into single strands (a proces called denaturation) and copying the single strands to create new double-stranded DNA (synthesis). Instead of these thermocycles, HDA mimics nature’s method of replicating DNA by using helicase (an enzyme) to denature the DNA at a constant temperature of 37°C.

The advantages of HDA over PCR are increased speed, reduced costs and the prospect of creating a hand-held DNA diagnostic device. The disadvantage is that HDA still requires a relatively big amount of DNA, so it presumably will not be used in cases where high precision is needed.

Obtaining news that a child either is or isn't one's own is someting that a parent or ersthwhile parent can undertake at their own expense, without necessarily informing anyone either about the test or its result. Tests can also be ordered by courts when proof of paternity is required. It is accepted that a father's permission should be sought for a paternity test in any circumstance. It is always better to know. In genetics, two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds are called a base pair (often abbreviated bp). As DNA is usually double-stranded, the number of base pairs in the dsDNA strand equals the number of nucleotides in one of the strands. In DNA, adenine and thymine, as well as guanine and cytosine, can be a base pair. In RNA, thymine is replaced by uracil. A nucleotide is an organic molecule consisting of a nitrogenous heterocyclic base (a purine or a pyrimidine), a pentose sugar (deoxyribose in DNA or ribose in RNA), and a phosphate or polyphosphate group. a, f, e, d, c. (A nucleoside is similar, except that it contains only the sugar and base, without a phosphate.) Nucleotide names are abbreviated into standard four-letter codes. The first letter is lower case and indicates whether the nucleotide in question is a ribonucleotide (r) or deoxyribonucleotide (d). The second letter indicates the nitrogenous base included (G,A,T,C,U). The third and fourth letters indicate the number of attached phosphates (Mono-, Di-, Tri-) and the presence of a phosphate (P). For example, deoxy-cytosine-triphosphate is abbreviated as dCTP.

Helicase is an enzyme vital to all living organisms. Its function is to temporarily separate the two strands of a DNA double helix so that DNA or RNA synthesis can take place. RNA polymerase has its own helicase activity, whereas in DNA polymerase the helicase is a separate subunit.

Helicase subunit in DNA polymerase is a donut-shaped enzyme and is produced by the DnaB gene. In conjunction with DNA primase helicase promotes DNA unwinding by binding to the initiator proteins and loading into the DNA. Helicase then denatures (untwists) the DNA by hydrolysis of adenosine triphosphate (ATP). Continuous hydrolysis of ATP allows helicase to move along the single strand of DNA, untwisting doube-stranded DNA that it encounters. An enzyme topoisomerase binds to the double-stranded DNA downstream of the unwound DNA to prevent excess strain on the helix.

Helicase is a necessary enzyme for eukaryote DNA because DNA polymerase requires a single-stranded DNA as a template in order to replicate DNA.

The enzyme RNA polymerase or RNAP is a nucleotidyltransferase that polymerises ribonucleotides in accordance with the information present in DNA. RNA polymerase enzymes are essential and are found in all cells of all organisms.

RNAP accomplishes de novo synthesis. It is able to do this because specific interactions with the initiating nucleotide hold RNAP rigidly in place, facilitating chemical attack on the incoming nucleotide. Such specific interactions explain why RNAP prefers to start transcripts with ATP (followed by GTP, UTP, and then CTP).

RNAP was discovered independently by Sam Weiss and Jerard Hurwitz in 1960.

RNA polymerase in prokaryotes In prokaryotes, the same enzyme catalyzes the sythesis of all three types of RNA: mRNA, rRNA and tRNA.

RNAP in E. coli is a relatively huge molecule of about 449 kD. Its core is made of 4 subunits: two α subunits, one β subunit, and one β' subunit. The RNAP holoenzyme consists of α2ββ'σ. The role of the σ subunit is to bind to a specific site of the DNA matrix, called promoter, to start the transcription. The σ subunit is released once the promoter is found. The rest of the enzyme, i.e. α2ββ', is where polymerization takes place. The structure RNAP exhibits a groove with a length of 55 Å and a diameter of 25 Å. This groove fits well the 20 Å double strand of DNA. The 55 Å length can accept 16 nucleotides.

Touchdown PCR or Touchdown style PCR is a method of PCR (polymerase chain reaction) by which degenerate primers will avoid amplifying nonspecific sequence. The temperature at which primers anneal during a cycle of PCR determines the specificity of annealing. The melting point of the primer sets the upper limit on annealing temperature. At temperatures just below this point, only very specific base pairing between the primer and the template will occur. At lower temperatures, the primers bind less specifically. Nonspecific primer binding obscures PCR results, as the nonspecific sequences to which primers anneal in early steps of amplification will "swamp out" any specific sequences because of the exponential nature of PCR amplification.

The earliest steps of a Touchdown PCR cycle have high annealing temperatures. For every subsequent cycle, the annealing temperature is decreased by 1 degree Celsius. The primer will anneal at the highest (and therefore, least-permissive of nonspecific binding) temperature at which it is able. Thus, the first sequence amplified is the one between the regions of greatest primer specificity; it is most likely that this is the sequence of interest. These fragments will be further amplified during subsequent rounds at lower temperatures, and will swamp out the nonspecific sequences to which the primers will bind at those lower temperatures. If the primer initially binds to the sequence of interest at a low temperature, subsequent rounds of PCR can be performed upon the product to further amplify those fragments.

Touchdown PCR was first reported in Nucleic Acids Research (http://nar.oupjournals.org/)

Its original description can be found in the following article: RH Don, PT Cox, BJ Wainwright, K Baker, and JS Mattick 'Touchdown' PCR to circumvent spurious priming during gene amplification Nucleic Acids Res. 1991 19: 4008

What is a polymerase? A polymerase is a naturally occurring enzyme, a biological macromolecule that catalyzes the formation and repair of DNA (and RNA). The accurate replication of all living matter depends on this activity -- an activity scientists have learned to manipulate. In the 1980s, Kary Mullis at Cetus Corporation conceived of a way to start and stop a polymerase's action at specific points along a single strand of DNA. What is the chain reaction? Mullis also realized that by harnessing this component of molecular reproduction technology, the target DNA could be exponentially amplified. When other Cetus scientists eventually succeeded in making the polymerase chain reaction perform as desired in a reliable fashion, they had an immensely powerful technique for providing essentially unlimited quantities of the precise genetic material molecular biologists and others required for their work.

What is PCR? Though the simplest and most convenient way to define PCR is as a technique, such compartmentalizing eliminates the history of PCR's invention, thereby covering over the contingent manner of its emergence and the practices and subjects required to make it work. The next simplest answer is to name an individual as the inventor of the concept. The obvious candidate is Kary B. Mullis, who was awarded the 1993 Nobel Prize for chemistry for PCR. However, this terrain is contested. Other scientists, including, Henry Erlich, Norman Arnheim, Randall Saiki, Glen Horn, Corey Levenson, Steven Scharf, Fred Faloona and Tom White, were instrumental in making PCR work. A third argument holds that PCR did not exist until it was made to work in an experimental system. In this view, merely thinking of a concept is not sufficient; a scientific advance must include creating a way to show that the concept has successfully been put into practice.

When Science named PCR and the polymerase that it employs as its first "Molecule of the Year" in 1989, the editor, Daniel Koshland Jr., provided a succinct explanation of PCR. He wrote: "The starting material for PCR, the 'target sequence,' is a gene or segment of DNA. In a matter of hours, this target sequence can be amplified a million fold. The complementary strands of a double-stranded molecule of DNA are separated by heating. Two small pieces of synthetic DNA, each complementing a specific sequence at one end of the target sequence, serve as primers. Each primer binds to its complementary sequence. Polymerases start at each primer and copy the sequence of that strand. Within a short time, exact replicas of the target sequence have been produced. In subsequent cycles, double-stranded molecules of both the original DNA and the copies are separated; primers bind again to complementary sequences and the polymerase replicates them. At the end of many cycles, the pool is greatly enriched in the small pieces of DNA that have the target sequences, and this amplified genetic information is then available for further analysis."

Nucleotides are the monomers of nucleic acids and also play important roles in cellular energy transport and transformations (notably ATP and NAD+/NADH) and in enzyme regulation (see for example, protein kinase). Deoxyribose (more precisely 2-deoxyribose) is a five-carbon sugar (a pentose) derived from the pentose sugar ribose by the repacement of the hydroxyl group at the 2 position with hydrogen, leading to the net loss of an oxygen. Ribose forms a five member ring composed of four carbon atoms and one oxygen. Hydroxyl groups are attached to three of the carbons. The other carbon and a hydroxyl group are attached to one of the carbon atoms adjacent to the oxygen. In deoxyribose, the carbon furthest from the attached carbon is stripped of the oxygen atom in what would be a hydroxyl group in ribose. Sugars are members of a group of chemical compounds called carbohydrates. Biological importance of Deoxyribose Ribose and 2-deoxyribose derivatives have an important role in biology. Among the most important derivatives are those with phosphate groups attached at the 5 position. Mono, di, and triphosphate forms are important, as well as 3-5 cyclic monophosphates. j, l, c, f, j. There are also important diphosphate dimers called coenzymes that contain ribose, examples are NAD and FAD. Aromatic bases called purines and pyrimidines form an important class of compounds with ribose and deoxyribose. When these purine and pyrimidine devivatives are coupled to a ribose sugar they are called nucleosides. In these compounds, the convention is to put a ′ (pronounced "prime") after the carbon numbers of the sugar, so that in nucleoside derivatives a name might include, for instance, the term "5′-monophosphate", meaning that the phosphate group is attached to the fifth carbon of the sugar, and not to the base. The bases are attached to the 1′ ribose carbon in the common nucleosides. Phosphorylated nucleosides are called nucleotides.

Koshland described described PCR entirely in terms of molecular biological technique. In his "molecule of the year" history, Koshland said absolutely nothing about who invented PCR. In an account he gave to the Smithsonian Institution's Archive of Biotechnology, Kary B. Mullis defined PCR not as a specific technique, or bundle of techniques, but rather as a concept. For Mullis, PCR came into existence at the moment he conceived of it. For him, making the concept work was of secondary importance. He says: "The thing that was the 'Aha!' the 'Eureka!' thing about PCR wasn't just putting those [things] together ...the remarkable part is that you will pull out a little piece of DNA from its context, and that's what you will get amplified. That was the thing that said, 'My God, you could use this to isolate a fragment of DNA from a complex piece of DNA, from its context. That was what I think of as the genius thing.[...]..In a sense, I put together elements that were already there. [ ] You can't make up new elements, usually. The new element, if any, it was the combination, the way they were used. ... The fact that I would do it over and over again, and the fact that I would do it in just the way I did, that made it an invention...the legal wording is 'presents an unanticipated solution to a long-standing problem,' that's an invention and that was clearly PCR."

Mullis's thesis is partially plausible: he is correct that the specific techniques that composed PCR were not new per se. However, his general claim that technical elements are not invented is totally implausible. It is possible to date the technique for making oligonucleotides (short strings of bases of defined length and composition); the development of the electrophoretic gel on which DNA is made to migrate by an electrical current, the means used to separate out strands of different sizes; and the techniques used to transfer these strands to a membrane and detect them. What was original, powerful and significant was the concept that combined -- and reconfigured -- these existing techniques.

Almost everyone now agrees that Kary Mullis thought up the concept of PCR. However, a group of former Cetus scientists and technicians maintains that it only when an experimental system was developed did PCR become a scientific entity. In this view, PCR needed to be more than a series of disparate technical elements, and more than the synthesizing of these elements into a distinctly innovative concept. The concept needed to be practiced, producing results that met scientific standards. As Henry Erlich, a senior scientist at Cetus during PCR's development puts it: "Once PCR had been worked out, i.e. developed, only then was it useful." Erlich and other Cetus scientists seem to agree with Francois Jacob's dictum: "In biology, any study begins with the choice of a 'system.' On this choice depends the experimenter's freedom to maneuver, the nature of the questions he is free to ask, and even, often the type of answer he can obtain."

Further, although Mullis claims that PCR was the solution to a long-standing problem, he never says what that problem was. Another scientist at Cetus, Stephen Scharf, is more perceptive when he says that the truly astonishing thing about PCR is precisely that it wasn't designed to solve a problem; once it existed, problems began to emerge to which it could be applied. One of PCR's distinctive characteristics is unquestionably its extraordinary versatility. That versatility is more than its "applicability" to many different situations. PCR is a tool that has the power to create new situations for its use and those required to use it.

PCR's versatility has been astounding, scientists have produced new contexts and new uses with stunning regularity. These uses have opened new avenues of research, which have in turned proved amenable to new uses of PCR. In less than a decade, PCR has become simultaneously an absolutely routine component of practically every molecular biology laboratory and a constantly changing tool whose potential has shown no signs of leveling off.

PCR is an acronym which stands for polymerase chain reaction. The PCR technique is basically a primer extension reaction for amplifying specific nucleic acids in vitro. The use of a thermostable polymerase allows the dissociation of newly formed complimentary DNA and subsequent annealling or hybridization of primers to the target sequence with minimal loss of enzymatic activity. PCR will allow a short stretch of DNA (usually fewer than 3000 bp) to be amplified to about a million fold so that one can determine its size, nucleotide sequence, etc. The particular stretch of DNA to be amplified, called the target sequence, is identified by a specific pair of DNA primers, oligonucleotides usually about 20 nucleotides in length.

The technique of Polymerase Chain Reaction (PCR) has played an important role in the advancement of molecular biology and the enhancement of DNA isolation, detection and amplification. This simulation experiment demonstrates the process of DNA Amplification by PCR and how the amplified product is detected by separating the reaction mixture by agarose gel electrophoresis.

Polymerase chain reaction (PCR) is a technique which is used to amplify the number of copies of a specific region of DNA, in order to produce enough DNA to be adequately tested. This technique can be used to identify with a very high-probability, disease-causing viruses and/or bacteria, a deceased person, or a criminal suspect.

In order to use PCR, one must already know the exact sequences which flank (lie on either side of) both ends of a given region of interest in DNA (may be a gene or any sequence). One need not know the DNA sequence in-between.The building-block sequences (nucleotide sequences) of many of the genes and flanking regions of genes of many different organisms are known. We also know that the DNA of different organisms is different (while some genes may be the same, or very similar among organisms, there will always be genes whose DNA sequences differ among different organisms - otherwise, would be the same organism (e.g., same virus, same bacterium, an identical twin; therefore, by identifying the genes which are different, and therefore unique, one can use this information to identify an organism). A gene's building-block sequence is the precise order of appearance, one after the other, of 4 different components (deoxyribonucleotides) within a stretch of DNA (deoxyribonucleic acid). The 4 components are: Adenine, Thymidine, Cytosine and Guanine, abbreviated as: A, T, C and G, respectively (a 4-letter alphabet). The arrangement of the letters (one after the other) of this 4-letter alphabet generates a "sentence" (a gene sequence). The number of letters in the sentence may be relatively few, or relatively many, depending on the gene. If the sentence is 1000 letters-long, the sequence would be said to be 1 kilobase (1000 bases).

As an example: ATATCGGGTTAACCCCGGTATGTACGCTA would represent part of one gene. DNA is double-stranded (except in some viruses), and the two strands pair with one another in a very precise way. EACH letter in a strand will pair with only one kind of letter across from it in the opposing strand: A ALWAYS pairs with T; and, C ALWAYS pairs with G across the two strands. So: TTAACGGGGCCCTTTAAA........TTTAAACCCGGGTTT Would pair with: AATTGCCCCGGGAAATTT........AAATTTGGGCCCAAA

Now, let's say that the above sequences "flank" (are on either end of..) the gene, which includes a long stretch of letters designated as: ..............These are known, absolutely identified to be, the sequence of letters which ONLY flank a particular region of a particular organism's DNA, and NO OTHER ORGANISM'S DNA. This region would be a target sequence for PCR.

The first step for PCR would be to synthesize "primers" of about 20 letters-long, using each of the 4 letters, and a machine which can link the letters together in the order desired - this step is easily done, by adding one letter- at-a-time to the machine (DNA synthesizer). In this example, the primers we wish to make will be exactly the same as the flanking sequences shown above. We make ONE primer exactly like the lower left-hand sequence, and ONE primer exactly like the upper right-hand sequence, to generate: TTAACGGGGCCCTTTAAA........TTTAAACCCGGGTTT AATTGCCCCGGGAAATTT.......................> and: TTTAAACCCGGGTTT...........AATTGCCCCGGGAAATTT ........AAATTTGGGCCCAAA

Now. the ........ may be a very long set of letters in-between; doesn't matter. If you look at this arrangement, you can see that if the lower left-hand primer sequence (italics) paired to the upper strand could be extended to the right in the direction of the arrow, and the upper right-hand sequence paired to the lower strand could be extended to the left in the direction of the arrow (remembering that the ......... also represent letters, and opposite pairing will ALWAYS be A to T and C to G), one could successfully exactly duplicate the original gene's entire sequence. Now there would be four strands, where originally there were only two. If one leaves everything in there, and repeats the procedure, now there will be eight strands, do again - now 16, etc.. therefore, about 20 cycles will theoretically produce approximately one-million copies of the original sequences (2 raised to the 20th power). Thus, with this amplification potential, there is enough DNA in one-tenth of one-millionth of a liter (0.1 microliter) of human saliva (contains a small number of shed epithelial cells), to use the PCR system to identify a genetic sequence as having come from a human being! Consequently, only a very tiny amount of an organism's DNA need be available originally. Enough DNA is present in an insect trapped within 80 million year-old amber (fossilized pine resin) to amplify by this technique! Scientists have used primers which represent present-day insect's DNA, to do these amplifications.

Here is how PCR is performed: First step: unknown DNA is heated, which causes the paired strands to separate (single strands now accessible to primers). Second step: add large excess of primers relative to the amount of DNA being amplified, and cool the reactionmixture to allow double-strands to form again (because ofthe large excess of primers, the two strands will alwaysbind to the primers, instead of with each other). Third step: to a mixture of all 4 individual letters (deoxyribonucleotides), add an enzyme which can "read" theopposing strand's "sentence" and extend the primer's"sentence" by "hooking" letters together in the order inwhich they pair across from one another - A:T and C:G. Thisparticular enzyme is called a DNA polymerase (because makes DNA polymers). One such enzyme used in PCR is called Taq polymerase (originally isolated from a bacterium that can live in hot springs - therefore, can withstand the high temperature necessary for DNA-strand separation, and can be left in the reaction). Now, we have the enzyme synthesizing new DNA in opposite directions - BUT ONLY THIS PARTICULAR REGION OF DNA.

After one cycle, add more primers, add 4-letter mixture, and repeat the cycle. The primers will bind to the "old" sequences as well as to the newly-synthesized sequences. The enzyme will again extend primer sentences ... Finally, there will be PLENTY of DNA - and ALL OF IT will be copies of just this particular region. Therefore, by using different primers which represent flanking regions of different genes of various organisms in SEPARATE experiments, one can determine if in fact, any DNA has been amplified. If it has not, then the primers did not bind to the DNA of the sample, and it is therefore highly unlikely that the DNA of an organism which a given set of primers represents, is present. On the other hand, appearance of DNA by PCR will allow precise identification of the source of the amplified material.

The polymerase chain reaction (PCR) is one of the most important and powerful technique, that is being applied in virtually all fields of modern molecular biology. PCR was invented by Kary Mullis at the Cetus Corporation for which he received in 1993 the Nobel prize. The first description of this method on amplifying Beta-globin sequences in sickle cell anemia was published in 1985.

PCR is a method for the in vitro exponential amplification of a specific DNA region (called target region), that lies between two regions (called primers) of known DNA sequence, resulting in a large quantity of DNA (this means micrograms of DNA).

Most organisms copy their DNA in the same way: DNA polymerases carry out the synthesis of a complementary strand of DNA in the 5' to 3' direction using a single-stranded template. The PCR mimics this process, only it does it in a test tube and employs two primers, each complementary to opposite strands of the region of DNA. The PCR amplification occurs by repeated cycles of three temperature dependent steps:

denaturation annealing elongation The three parts of the PCR are carried out in the same vial, but at different temperatures. The vial contains all necessary components. In its native state, DNA exists as a double helix. The first step of the PCR (denaturation) separates the two DNA chains by heating the test tube to 90 - 95 degrees centigrade (Scheme - Denaturation).

Annealing of the primers is the second step of the PCR. The primers cannot bind (anneal) to the strands of DNA at temperature of the denaturation, so the vial is cooled to 45-60 degrees C (Scheme - Annealing of the primers) .

The final step of the reaction is elongation of the primers - the synthesis of new strands by making a complete copy of the templates. Since the Taq polymerase, which is usually added to the PCR, works the best at around 72 degrees centigrade, the temperature of the test tube is raised (Scheme - Elongation).

At the end of a cycle of these three steps, each target region of DNA in the vial has been duplicated. This cycle is usually repeated 30 times. Each new DNA piece can act in the next cycle as a new template, so after 30 cycles, 1 million copies of a single fragment of DNA can be produced (Scheme - Diagram of PCR).

The PCR solves two of the more universal problems in the chemistry of natural nucleic acids. It allows for the separation of any sequence of interest from its context, and then it provides an in vitro amplification of this sequence virtually without limit.

PCR is an acronym which stands for polymerase chain reaction. The PCR technique is basically a primer extension reaction for amplifying specific nucleic acids in vitro. The use of a thermostable polymerase allows the dissociation of newly formed complimentary DNA and subsequent annealling or hybridization of primers to the target sequence with minimal loss of enzymatic activity. PCR will allow a short stretch of DNA (usually fewer than 3000 bp) to be amplified to about a million fold so that one can determine its size, nucleotide sequence, etc. The particular stretch of DNA to be amplified, called the target sequence, is identified by a specific pair of DNA primers, oligonucleotides usually about 20 nucleotides in length.

Polymerase Chain Reaction (PCR) is one method of producing mass quantities of DNA for experimental use. In this process, a strand of DNA is added to a solution containing individual nucleotides, DNA polymerase, and synthesized sequences of nucleotides called primers which define what section of the DNA is amplified. The solution is then heated to nearly 100 degrees Centigrade, at which point the hydrogen bonds between the two DNA strands break. While cooling, the synthesized primers bind to their complimentary regions on the separated DNA strands. From there the DNA polymerase recognizes the primers as starting points and begin moving down the DNA strands, adding a complimentary nucleotide for each nucleotide on the template DNA. The end result is two new DNA molecules, each one single stranded before the primer and double stranded after the primer (Samson, 1996).

When the solution is heated again, the new DNA strands melt, allowing primers to attach to the appropriate site, and the process continues until one decides enough DNA has been made. This shouldn't be very much time, since the amount of DNA is doubled each time the cycle is enacted.

One problem posed by this method is that most DNA polymerases dissociate, or unfold, well before 100 C. To solve this, DNA polymerases from a bacterium living in hot springs, which have evolved to function in boiling water, is used.

Electrophoresis After a large amount of DNA has been replicated, each sample is run out on an agarose gel. Because different lengths of DNA move through the gel at different speeds (the smaller the molecule, the more rapid the movement) the length of DNA can be compared. In our experiment, those who have the mutant CCR-5 allele, which is 32 base-pairs shorter than the wild-type, will have their DNA move more quickly through the gel. The positions of the DNA in relation to each other and to a reference run of known molecular weights can be compared visually, and recorded by taking a simple picture of the gel after staining the DNA with ethidium bromide.

PCR is a method for in vitro amplification of DNA. It has substantially accelerated the pace of research in many fields of biology, both by reducing the time required to perform routine manipulations of DNA, and by making new manipulations possible. In essence, PCR is multiple rounds of primer extension reactions in which complementary strands of a defined region of a DNA molecule are simultaneously synthesized by a thermostable DNA polymerase. During repeated rounds of these reactions, the number of newly synthesized DNA strands increases exponentially so that after 20 to 30 reaction cycles, the initial template DNA will have been replicated several million–fold. This power to faithfully amplify, along with the low cost and simplicity of the method, has made PCR an indispensable tool.

What Is Botulism?, What Is Bioreactor?, What Is Cell Biology?, What Is Amino Acid?, What Is Water Purification?, i, Bacteria, e, Bacterium, o, Microorganisms, a, Microbes, o, Microorganism, i, Thermophile, r, Microorganism, n, Microorganism, r, Bacteriological, r, Microorganism, e, E coli O157, e, Bacillus subtilis




 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005