Escherichia coli

Physiol Chem Phys, 1976, 8(2), 167 - 73
Biological ion exchanger resins; IX . Isolation and partial identification of a potassium sensitive contractile-like protein from E . coli; Minkoff L et al.; A protein fraction with actin-like characteristics has been isolated from E . coli . The fraction (referred to as A-L fraction) undergoes reversible increases in molecular weight under the same catalytic conditions that polymerize actin, exhibits a distinct peak on SDS electrophoresis at the characteristic molecular weight for actin, depends primarily on potassium for its polymerization, and is not "polymerized" by sodium . A-L fraction in the monomeric form was eluted in the void volume of a Sepharose 6B column, suggesting a large Stoke's radius and a molecular weight in excess of 400,000 . The fraction contained 30% RNA by weight that proved refractory to experimental efforts at removal.

Vet Med Nauki, 1976, 13(5), 56 - 60
{Sensitivity of E . coli strains to Fredericq-type colicins}; Todorov T et al.; Studied was the spectrum of sensitivity of various Escherichia coli strains to the standard types of colicine after Fredericq . The strains were isolated from dead and emergency slaughtered animals as well as from food products of animal origin . It was found that regardless of the type (colicinogenic and noncolicinogenic) and the origin of the strains almost a monotype spectrum of sensitivity is observed . With but few exceptions the strains proved sensitive to colicine of the types V, D, E+I, F, C, I, J+I, K, Sj, S3+I, S4 and S5 . The similarity referred to substantiates the expedience in determining the type of colicine of bacteria in epidemiologic and epizootiologic studies.

Immunol Commun, 1976, 5(1-2), 97 - 107
Resemblance of blast responses of C3H/HeJ mouse and rabbit spleen lymphocytes to B-cell mitogenic components of E . coli cell walls; Bona C; Nude mice lymphocytes were stimulated by heat-killed E.coli bacterial cells as well as by various components of their cell walls such as lipopolysaccharide, peptidoglycan and lipoprotein . Only bacterial cells, peptidoglycan and lipoprotein induce a high stimulation of C3H/HeJ mouse and rabbit lymphocytes . These data show the resemblance of mutant C3H/HeJ mice to rabbits with regard to blast response induced by various mitogenic components of E.Coli cell walls.

Cell, 1976 Jan, 7(1), 75 - 84
A novel nucleotide implicated in the response of E . coli to energy source downshift; Gallant J et al.; When E . coli cells are subjected to energy source downshift, the accumulation of RNA (and overall cell growth) is drastically restricted within 1 to 2 min . However, the identity of the primary metabolic signal for this adjustment is a mystery . Earlier studies, and further evidence presented here, show that there is no satisfactory correlation between the sudden adjustment of RNA accumulation and the kinetics of changes in the levels of prospective signalling compounds, such as glycolytic intermediates, ppGpp, ATP, or the three adenylate nucleotides . We have discovered an unusual nucleotide, which we call the phantom spot, whose level decreases dramatically within a minute of downshift, correlating well with the adjustment of RNA accumulation . Preliminary characterization of the phantom spot indicates that it is a triphosphate derived from the guanylate pathway, and suggests that it is a form of GTP with a modification of the imidazole portion of the purine ring . We postulate that this nucleotide serves as a regulatory facsimile of ATP, linking the rate of RNA accumulation and other anabolic processes to the overall rate of phosphorylation.

Allerg Immunol (Leipz), 1976, 22(2), 133 - 8
{Cellular immune reactivity to streptolysin O and E . Coli in premature infants and prenatally dystrophic newborns}; Wiersbitzky S et al.; A total of 62 neonates were examined by means of the in vitro lymphocyte transformation test (LTT) using streptolysin O and E . coli antigen with a view to determinating whether prematurely born babies and prenatally dystrophic neonates differ in their prenatal immunization by bacterial antigens or whether the immunological capabilities are different in the different groups examined . Positive controls with addition of phytohemagglutinin (PHA) and negative blank controls were also used . The results were the same in the two groups of test subjects, suggesting prenatal antigen contact in 30 to 72 percent of all infants tested, but without statistically evident differences being observed between the groups.

Acta Microbiol Pol, 1976, 25(2), 95 - 108
The role of polymerase III in conjugation between E . coli K12 donor and recipient strains carrying dnaE ts mutation; Blinkowa A; The possible role of DNA polimerase III in conjugation was studied in a series of mutants temperature-sensitive for DNA polymerase III synthesis . The temperature-sensitive DNA mutation called dnaE 486 (ts) prohibits vegetative DNA replication at 41-45 degrees . Transfer of episome and chromosome from temperature-sensitive donor, carrying dnaE mutation to wild-type recipient strains, revertants and dnaE recipients was investigated . In the first two cases the number of Lac+ sexductants being even slightly higher at 43 degrees . Conjugational synthesis accompanying transfer involving the combination of dnaE (ts) thymine dependent and thymine independent donor and recipient strains measured by incorporation of 14C thymine was observed at the restrictive temperature . In the case of conjugation with temperaturesensitive recipient strains a drop of Lac+ sexductants and Pro+ recombinants may be as a result of disturbances in the synthesis of complementary strand in recipient, known to be dependent on pol III . However, the episome investigated by centrifugation in neutral CsC1 gradient after its transfer to the recipient with faulty polymerase III was double stranded (replicated) at the restrictive temperature.

C R Acad Sci Hebd Seances Acad Sci D, 1975 Dec 22, 281(24), 2041 - 4
{Immunocytological characterization of cells recognizing antigen and producing antibody during immunization to oxazolone and E . coli lipopolysaccharide}; Jeannesson P et al.; A preferential cell mediated response is obtained after stimulation with oxazolone () and a humoral response is seen after E . coli lipopolysaccharide (LPS) immunization () . Thus a cytological study of selectively isolated antigen recognizing cells which form rosettes and antibody producing cells which form hemolytic plages has been performed during oxazolone and lipopolysaccharide stimulations . This investigation shows quantitative and qualitative differences of these immunocyte subpopulations in the two stimulations . First the antigen recognizing cells antibody producing cells ratio is fundamentally much higher at all the stages of the oxazolone stimulation than after lipopolysaccharide immunization . On the other hand among these immunocyte subpopulations, T and B cells are identified by electron microscopy in the oxazolone immune reaction, while only B cells are observed after LPS immunization.

Nucleic Acids Res, 1975 Dec, 2(12), 2365 - 78
Insertion of a rabbit beta-globin gene sequence into an E . coli plasmid; Rougeon F et al.; Double stranded DNA has been synthesized in vitro from rabbit globin messenger RNA and elongated with homopolymeric dG tails . An E . coli plasmid was cleaved by EcoRI . The cohesive ends were repaired and dC tails added, to permit reconstitution of the EcoRI sites upon annealing with the dG elongated globin DNA . Transformation of E . coli with the globin-plasmid DNA hybrid has yielded a clone which harbours a recombinant plasmid (pCR1-betaG1), as demonstrated by hybridization experiments with radioactive globin cDNA . The sequence carried by the recombinant plasmid corresponds to part of the gene sequence coding for the beta chain of rabbit globin . Circular DNA of the purified recombinant plasmid exhibits sensitivity to EcoRI.

Nucleic Acids Res, 1975 Dec, 2(12), 2315 - 28
E . coli tRNAs as inhibitors of viral reverse transcription in vitro; Cavalieri LF et al.; Reverse transcription of 70S AMV RNA by AMV reverse transcriptase has been studied in the presence of E . coli tRNAs . We have shown that inhibition of DNA synthesis occurs and that the tRNAs bind to the enzyme and not to the 70S RNA . The results have implications for the control of reverse transcription in vivo.

C R Acad Sci Hebd Seances Acad Sci D, 1975 Nov 24, 281(21), 1641 - 4
{Mannose dependent horse erythrocyte agglutinin specific to bovine enterotoxic E coli strains}; Tixier G et al.; We show that in enterotoxic or not enterotoxic E . coli strains from various origins, enterotoxic strains of E . coli from calves only agglutin horse red cells in presence of mannose . The haemagglutinins structure, not visible with electron microscope is compatible with presence of fimbriae . It would be K 99 antigen, specific adhesiveness structure for strains from calves.

C R Acad Sci Hebd Seances Acad Sci D, 1975 Nov 10, 281(19), 1431 - 3
{Hydrolysis of diphosphatidylglycerol in situ in E . coli by activation of specific phospholipase D}; Rampini C; E coli cells are harvested at early stationary phase and, first, incubated in phosphate buffer without energetic metabolites, conditions which invole the formation of an excess of diphosphatidylglycerol . If, in a second stage, they are cultivated again in normal medium, the diphosphatidylglycerol is metabolized very fast . It is mainly hydrolyzed, by activation of a specific phospholipase D, with formation of phosphatidylglycerol and phosphatidic acid . The latter is immediatly metabolized in bacteria in phosphatidylglycerol and phosphatidylethanolamine, both about equal in amount.

Mol Gen Genet, 1975 Nov 3, 141(1), 85 - 9
IS1 and IS2 mutations in the ribosomal protein genes of E . coli K-12; Saedler H et al.; The insertion mutations I15 and I16 in the ribosomal protein gene cluster at 64 min in Escherichia coli are identified as IS1 and IS2 using electron microscope heteroduplex analysis.

FEBS Lett, 1975 Nov 1, 59(1), 133 - 6
Joint use of light, X-ray and neutron scattering for investigation of RNA and protein mutual distribution within the 50S subparticle of E . coli ribosomes; Serdyuk IN et al.; The values of the RNA and protein radius of gyration obtained in these studies corroborate the conclusion reported earlier {1} that on average the RNA is nearer to the center of the particle than is the protein . (It should be noted for comparison that the minimal Rg value of the RNA corresponding to its dense packing as a sphere in the center of the 52S subparticle is 49 A.) Moreover, such a great difference in the radii of gyration of RNA and protein implies a definite scheme of mutual RNA and protein arrangement in the 50S subparticle -- namely the distribution of the greater mass of proteins on the RNA surface.

Genetics, 1975 Nov, 81(3), 459 - 68
Genetic analysis of regulatory mutants of alkaline phosphatase of E . coli; Kreuzer K et al.; A fine structure map of the phoR region of E . coli, mutations of which affect the rate of alkaline phosphatase synthesis, was constructed by Hfr X F- crosses . Mutations causing three different phenotypes (previously reported as phoRa, phoRb, phoRc (Garen and Echols 1962a,b) are clustered in three closely linked genetic loci . PhoR mutants of all three types, including the phoRb type not previously tested, are recessive to wild-type phoR+ . In addition, phoRa and phoRc complement each other, while phoRa and phoRb do not . Our results support the hypothesis of Morris et al . (1974) that phoRc mutants represent a cistron (phoB) different from phoR.

Nucleic Acids Res, 1975 Nov, 2(11), 2069 - 75
Primary structure of tRNA-Lys of E . coli B; Chakraburtty K et al.; The primary structure of tRNALys of E . coli was determined by use of {32P}-tRNA . The sequence is pGGGUCGUUAGCUCAGDDGGDAGAGCAGUUGACUmam5-s2-UUU-t6AApsiCAAUUGm7GXCGCAGGTpsiCGAAUCCUGCACGACCCACCA . No s4-U was detected in position 8 . No other lysine tRNA was detected but the existence of another species has not been ruled out.

Ital J Biochem, 1975 Nov-Dec, 24(6), 325 - 34
Effect of phospholipids on the activity of DNA polymerase I from E . coli; Novello F et al.; Sphingomyelin, phosphatidylethanolamine and lecithin at concentrations which destabilize the DNA helix enhance the DNA polymerase activity, but sphingosine and phosphatidylserine have only a moderate effect . MgCl2 was shown to modify the action of sphingomyelin on the DNA polymerase activity . The role of phospholipids in the DNA replicating process was analyzed.

Biull Eksp Biol Med, 1975 Nov, 80(11), 99 - 101
{The influence of differences in the Rec-genotype of E . coli cells on the function of sex factor F'}; Pavlovich AI; Functions of the sex factor F' depended not only on damage of the genes, controlling the recombination capacity of bacterial cells, but also on suppression of the rec-gene mutations . Suppression of mutations of these genes was accompanied by the capacity of the sex factor to mobilize the chromosome for the transfer from the rec-bacterial cells . If it were demonstrated that the cells of the Jc 9604-131 strain actually carried the inverse mutation of the rec A gene, this would prove that these mutations resulted in the restoration of a recombination possibility between the sex factor F' and the bacterial chromosome.

Z Naturforsch {C}, 1975 Nov-Dec, 30(6), 832 - 4
Phospholipids and ATPase activity of wild-type and ATPase deficient and uncoupled mutants of E . coli; Ahlers J et al.; The ATPase activities and the amounts of individual phospholipids in E . coli wild types B163 and ML-308-225 as well as in the mutants AN120, DL54 and etc-15 have been examined . The ATPase activities and the amount of cardiolipin are higher in the stationary phase than in the log phase, whereas the amounts of phosphatidylglycerol and phosphatidylserine are lower in the stationary phase . The decreased ATPase activity of the mutants is not due to an altered phospholipid composition.

Biokhimiia, 1975 Nov-Dec, 40(6), 1216 - 31
{Purification, molecular multiplicity and kinetic properties of "biosynthetic" L-threonine dehydratase from E . coli K-12}; Dorozhko IA et al.; "Biosynthetic" L-threonine dehydratase was purified to homogeneous state with yield 29% of total activity from E . coli K-12 . The cells were disrupted by means of ultra sound . Nucleic acids and nucleoproteins were precipitated with protamine sulphate, the proteins were fractioned with (NH4)2SO4, by gel filtration through Sephadex G-25 followed by chromatography on DEAE-cellulose using stepways elution by changing the pH-values . The homogenity of the enzyme was shown by polyacrylamide gel disc electrophoresis in the presence of dodecylsulphate . The enzyme consists of equal subunits having a molecular weight about 57000 . The polyacrylamide gel disc electrophoresis had shown that the native enzyme consists of a set of oligomeric forms . The multiplisity of molecular organization of the enzyme was relfected in complicated kinetic behavior: at pH greater than 9 on the plots of initial reaction rate (upsilon) versus initial substrate concentration ({S}0) there were four inflexion points (two intermediate plateaux) the position and deepness of which depended on enzyme concentration . Kinetic properties of the highly purified enzyme and the enzyme in crude cell extracts at pH 9.3 and 7.4 were identical . At pH 8,3 on the upsilon versus {S}0 plots appeared two inflexion points (one intermediate plateau), the position of which practically did not depend on enzyme concentration in the reaction mixture but strongly depended on the enzyme concentration in the stock solution . Repeated polyacrylamide gel disc electrophoresis of several oligomeric forms isolated by the first electrophoresis had shown that oligomeric forms underwent a slow polymerization . It is suggested that "biosynthetic" L-threonine dehydratase from E . coli K-12 is a set of multiple oligomeric forms having different kinetic parameters . Probably, each form of the enzyme has a "simple" kinetics characterized by hyperbolic or sigmoidal shape of upsilon versus {S}0 plots . The rate of equilibrium between the oligomeric forms is small in comparison with the enzyme reaction velosity, that lead to the complex kinetic curves appearing as a result of summing up the kinetics inherent to the individual forms.

Mol Gen Genet, 1975 Oct 22, 140(4), 309 - 332
Prophage induction and cell division in E . coli . III . Mutations sfiA and sfiB restore division in tif and lon strains and permit the expression of mutator properties of tif; George J et al.; In E . coli K12, cell filamentation promoted by tif is enhanced by the lon mutation; in contrast, prophage induction and repair of UV-irradiated phage lambda, also promoted by tif, are not affected by lon . From a tif lon double mutant, "revertants" having recovered the ability to divide at 41 degrees were isolated, among which most (95%) had also lost their Lon filamentous phenotype after ultraviolet (UV) irradiation . From these 95% of revertants: (1) 94% are suppressed for the whole Tif phenotype, by additional mutations that render them deficient in DNA repair, as judged from their high UV sensitivity; some have been characterized as recA mutants . (2) 1% have recovered a control on cell division at 41 degrees or after UV irradiation by means of secondary mutations altering neither the other phenotypic properties of tif and lon, nor the repair and recombination ability of the cells: in particular, this class of "revertants" remains thermoinducible upon lysogenisation; the mutations which specifically suppress filamentation have been mapped at two loci, sfiA and sfiB, cotransducible respectively with pyrD and leu . In the remaining 5% of revertants that still exhibit an UV-induced filamentous growth, 3% can be tentatively classified as true tif+ revertants; 2% behave as tif thermodependent revertants, showing suppression of the Tif (and Lon) phenotype only at 41 degrees: 2recAts have been identified in this class . Non-lysogenic tif lon sfi and tif sfi strains remain viable during prolonged growth at 41 degrees . Under these conditions, tif expresses mutator properties, which can be conveniently analyzed in this sfi background . The action of lif, lon and sfi mutations is tentatively interpreted on the basis of a negative control of cell division specifically associated with DNA repair.

Nature, 1975 Oct 9, 257(5526), 458 - 62
Identification of two copies of the gene for the elongation factor EF-Tu in E . coli; Jaskunas SR et al.; Two copies of the structural gene for the elongation factor EF-Tu have been identified in Escherichia coli: one near rif and the other near str . The latter seems to belong to a single transcriptional unit together with the genes for ribosomal protein S7, S12 (str) and the elongation factor EF-G (fus).

C R Acad Sci Hebd Seances Acad Sci D, 1975 Oct 6, 281(14), 1043 - 6
{Nearest-neighbor relationships among 50S ribosomal proteins of E . coli}; Barritault D et al.; Dimethyl suberimidate has been used to study the proximity relations between E . coli 50 S ribosomal proteins . The composition of two cross-linked protein complexes has been determined; one is a quaternary complex containg proteins L2, L20, L27 and L32-33, and the other is a ternary complex containing proteins L2, L13 and L20 . The vicinity of these proteins in the ribosome is discussed.

Nucleic Acids Res, 1975 Oct, 2(10), 1941 - 50
The influence of the peptide chain length on the activity of peptidyl-tRNA hydrolase from E . coli; Shiloach J et al.; The dependence of the Vmax and Km on the length of the peptide moiety in the peptidyl-tRNA series (Gly)n-Val tRNA, was measured in the system peptidyl-tRNA hydrolase-peptidyl-tRNA . It was found that the Km value decreases from 7.2 X 10-7 M for Gly-Val-tRNA to 4.6 X 10-7 M FOR (Gly)2-Val-tRNA and to 1.7 X 10-7M for (Gly)3-Val-tRNA; further increase of the peptide chain is not followed by decrease of the Km . The Vmax values are 5.7 pmole/min/EU for Gly-Val-tRNA and 42 pmole/min/EU for (Gly)3-Val-tRNA . The enzyme activity is inhibited competitively by uncharged tRNA with a KI value of about 10-5M . The significance of these results described in this paper, in relation to the fact that peptides and peptide esters do not inhibit the enzyme activity, and in relation to the proposed physiological role of the enzyme, is discussed.

Nucleic Acids Res, 1975 Oct, 2(10), 1793 - 804
Effect of sodium bisulfite modification on the arginine acceptance of E . coli tRNA Arg; Chakraburtty K; Escherichia coli tRNA Arg was treated with sodium bisulfite to convert exposed cytosine residues to uracil . This treatment resulted in the loss of amino acid acceptance of the tRNA Arg with pseudo first-order reaction kinetics . The active and inactive molecules were separated after about 60e active and inactive molecules were separated after about 60 percent inactivation and analyzed for U in various positions by finger-printing of the oligonucleotides produced by nucleases . The results show that C to U base transitions in the dihydrouridine loop and in the CCA terminus have no effect on the aminoacylation of this tRNA . Deamination of a cytosine residue at the second position of the anticodon resulted in the loss of amino acid acceptor activity of arginine transfer RNA.

Nucleic Acids Res, 1975 Oct, 2(10), 1787 - 92
Primary structure of tRNA Arg II of E . coli B; Chakraburtty K; tRNA Arg II of E . coli has 77 nucleotides . There are eight minor nucleotides including inosine and 2-methyladenosine . Except for a few differences, the structure of tRNA Arg II is very similar to the structure of tRNA Arg I reported by Murao et al.3 . The major difference is in the size of dihydrouridine loop . tRNA Arg II does not contain 2-thiocytosine . The unidentified nucleoside X seems to be a different modification other than nucleoside N reported to be present in tRNA Arg I.

Can J Microbiol, 1975 Oct, 21(10), 1484 - 91
Nitrofurazone-reducing enzymes in E . coli and their role in drug activation in vivo; McCalla DR et al.; Earlier work showed that Escherichia coli contains at least two enzymes which reduce nitrofurazone and other nitrofuran derivatives . One of these enzymes is lacking in some nitrofurazone-resistant mutant strains . We now report that there are three separable nitrofuran reductases in this organism: reductase I (mol . wt . approximately 50 000, insensitive to O2), reductase IIa (mol . wt . approximately 120 000, inhibited by oxygen), reductase IIb (mol . wt . approximately 700 000, inhibited by O2) . Unstable metabolites formed during the reduction of nitrofurazone by preparations containing reductases IIa and IIb produce breaks in DNA in vitro . In vivo experiments with nitrofurazone-resistant strains, which lack reductase II but contain reductases IIa and IIb, demonstrated that lethality, mutation, and DNA breakage are all greatly increased when cultures are incubated under anaerobic conditions, i.e., conditions such that reductase II is active . These results provide further evidence for the importance of reductive activation of nitrofurazone.

C R Acad Sci Hebd Seances Acad Sci D, 1975 Sep 29, 281(13), 933 - 6
{Double-stranded sequences in RNA transcribed in vitro by E . coli RNA polymerase on wheat nuclear DNA}; Tuffet A et al.; RNA obtained through the transcription of wheat DNA by E . coli RNA polymerase was examined . This RNA contains double chain sequences which, after thermal denaturation, show instantaneous reassociation . A "hair-pin" like structure is proposed for this type of sequence.

Mol Gen Genet, 1975 Sep 15, 140(1), 51 - 60
Parameters of gene expression in the bipolar argECBH operon of E . coli K12 . The question of translational control; Cunin R et al.; The pattern of divergent transcription of the argEC BH cluster of genes previously demonstrated by the hybridization of RNA to the separated strand of a phi 80 darg transducing phage, is confirmed with the DNA of a set of different lambdadarg phages . The accurate determination of argE and argCBH m-RNA levels in different steady states of expression of the arg regulon supports the following conclusions: 1 . The ratio between maximal (derepressed) and minimal (repressed) rates of expression is lower when it is expressed in terms of % hybridizable RNA than in terms of expression is lower when it is expressed in terms of % hybridizable RNA than in terms of enzyme specific activities . The discrepancy is about 3 fold . Thus in conditions of repression, the cell produces relatively more unused m-RNA than in derepression . Different interpretations of this phenomenon appear possible: a) the messenger RNA molecules synthesized in repressed cells could be degraded more rapidly or translated less efficiently than in derepressed cells . b) an untranslated segment of the RNA could account for a larger part of the RNA detected in repression than in derepression . These interpretations are not mutually exclusive . 2 . The discrepancy observed between the amplitudes of variation of argE and argC BH expression, expressed in terms of enzyme specific activities, is, in fact, determined at the level of DNA transcription . This provides direct evidence for the occurrence of differential transcription effectiveness in a regulon exhibiting a correlative but not strictly coordinated pattern of enzyme synthesis . This also supports our earlier suggestion regarding the possible complexity of the internal operator region situated between argE and C.

Zh Mikrobiol Epidemiol Immunobiol, 1975 Sep, 0(9), 40 - 3
{Role of E . coli 06 in the epidemiology of acute intestinal diseases}; Belikova-Aldakova VD et al.; The authors demonstrated the etiological role of E . coli 06 in group acute intestinal diseases with the clinical picture of food poisoning . The leading role of the food factor in the spread of this infection was established . A study was made of 64 E . coli 06 cultures isolated from the patients in group infection and from the carriers examined by various indications . The cultures produced no keratoconjunctivitis in guinea pigs . The capacity to produce enterotoxin was revealed in 2 of 5 cultures tested in experiments with the intranasal infection of albino mice.

Gut, 1975 Sep, 16(9), 727 - 31
The agglutinating antibody response in the duodenum in infants with enteropathic E . coli gastroenteritis; McNeish AS et al.; The agglutinating antibody responses in duodenal fluid and serum were measured serially in 15 infants with enteropathogenic E . coli gastroenteritis . Peak levels of duodenal agglutinins were recorded eight to 18 days after the onset of symptoms, and the titres fell within the next seven to 14 days . These antibodies were mainly of the IgA class but IgM antibodies were detected early in the response, especially in the youngest infants . Serum antibody responses were detected in eight patients, but they correlated poorly with the titres of intestinal antibodies . No rise in serum antibodies was found in six infants . Further studies are required to determine whether these differences are host-derived or whether they reflect different pathogenic properties of the infecting organisms.

Nucleic Acids Res, 1975 Sep, 2(9), 1609 - 20
RNA nicking activity associated with DNA ligase of T4 infected E . coli: properties and influence on in vitro reactions of ligase; Sano H et al.; Highly purified DNA ligase from T4 infected E . coli displays an RNA nicking activity which cleaves endonucleolytically the RNA of ribo-desoxy-and ribo-ribo type doublestranded structures to oligonucleotides with 5'phosphoryl-and 3'hydroxy termini . In the presence of ATP the generated nicks are repaired by the ligase except at the ends of the doublestranded regions where some short oligonucleotides are released before ligation can occur . As judged from its behaviour during the various purification steps and from some of its properties, the nicking activity seems to be different from known nicking enzymes.

Biokhimiia, 1975 Sep-Oct, 40(5), 1004 - 15
{Correlation of protein synthesis and degradation of messenger RNA in E . coli}; Arbuzov VA; More than 80% of rapidly labelled RNA is found to be bound with cytoplasmic membranes of E . coli and only 17% was discovered in cytoplasmic fraction . 96% of DNA was found in the cytoplasmic membrane fraction . The treatment of E . coli homogenate with sodium deoxycholate resulted in the release of rapidly labelled RNA from membranes . The analysis of membrane-bound rapidly labelled RNA in sucrose density gradient (10-40%) revealed that it sedimented in the polyribosome region . Incubation of E . coli cells with actinomycin D for 10 min at 37 degrees C resulted in the decrease of membrane-bound radioactivity in the polysome region (31% as compared with 55% in the control culture which was incubated for 20 sec with 14C-orotate) . The inhibition of protein synthesis with chloramphenicol or puromycin interrupted the decomposition of polysomes in the presence of actinomycin D . The radioactivity of polysomes in these experiments was 50% and 47% respectively and was comparable with the control . Under dialysis of rapidly labelled RNA fraction against buffer with minimal concentration of Mg2+ (0,1 mM) the elimination of the label from the polysome region was observed . The prolongation of the incubation of cells with actinomycin D resulted in the decrease of protein synthetising ability of the membrane fraction . The increase of the inhibition level of protein synthesis by chloramphenicol was shown to result in the increase of the amount of membrane-bound rapidly labelled RNA, which remained stable in the presence of actinomycin D . A number of arguments of the hypothesis on the role of protein in the initiation mechanism of the decomposition of mRNA in bacteria is discussed.

Mol Biol (Mosk), 1975 Sep-Oct, 9(5), 706 - 9
{Immunogenic properties of DNA from E . coli and T4 phage, containing 5-bromouracil}; Zamchuk LA et al.; 5-BUDR incorporated into E . coli or T4 phage DNAs is an immunogenic determinant . Immunodominance of 5-BUDR is determined by the chemical structure of DNA molecule into which it is incorporated . In E . coli DNA, 5-BUDR inhibits immunogenic activity of all other bases . One can conclude that in this DNA 5-BUDR is the dominant antigenic determinant . In T4 DNA, 5-BUDR acts as an additional antigenic determinant . Anti-5-BUDR-T4-DNA contains antibodies to 5-BUDR and glucosylated 5-HMC.

Nature, 1975 Aug 14, 256(5518), 556 - 60
Multiple steps in DNA recognition by restriction endonuclease from E . coli K; Yuan R et al.; The process of DNA recognition by the activated form of the restriction endonuclease from E . coli K involves three enzyme-DNA complexes which can be differentiated experimentally . These are: an initial complex formed at a nonspecific site; a recognition complex involving the host specificity site; and a cleavage complex dependent on the presence of ATP.

Zentralbl Bakteriol {Orig A}, 1975 Aug, 232(4), 462 - 7
{Serotype 185 and E . coli O115 - two distinct bioseropathotypes (author's transl)}; Stenzel W; E . coli O115 strain 27w and TRABULSI's serotype 185 have been subjected by us to comparing examinations of the serological behaviour of their cell wall and their protoplasmatic antigens, of their biochemical and cultural behaviour and their pathogenicity for the mucous membranes of guinea-pigs . As a result of this inquiry it was found, that E . coli O115 27w and the dysentery-provoking serotype 185 are biological distinct bacteria which only share a minor cross relationship of their O-antigens, and which should not be classified together.

J Biochem (Tokyo), 1975 Jul, 78(1), 165 - 79
Transport of sugars and amino acids in bacteria . XV . Comparative studies on the effects of various energy poisons on the oxidative and phosphorylating activities and energy coupling reactions for the active transport systems for amino acids in E . coli; Anraku Y et al.; The effects of various energy poisons on oxidation of respiratory substrate, synthesis of cellular ATP, and energy transformation reaction in intact Escherichia coli cells were studied systematically . Various mutants were, therefore, used in which specific functions in the energy-transducing reactions were defective or altered . The energy poisons examined were: sodium azide . DPPA and azidebenzenes which are inhibitors of respiratory-chain phosphorylation, SF6847, and CCCP which are known to be uncouplers, zinc sulfate which is an inhibitor for certain dehydrogenases, and sodium arsenate and sodium fluoride which are inhibitors of glycolytic synthesis of ATP . The preferential inhibitions occurred in the oxidation reactions with certain respiratory substrates by energy poisons used . DPPA inhibited glycerol oxidation much more strongly than succinate oxidation . However, DPPA could inhibit the oxidation of both glycerol 3-phosphate and succinate by membrane fraction strongly while the oxidation of NADH and D-lactate slightly . It inhibited glycerol 3-phosphate dehydrogenase {EC 1.1.2.1} strongly as well as succinate dehydrogenase {EC 1.3.99.1},.but not D-lactate dehydrogenase of membrane fraction . MAB and other azidebenzene derivatives inhibited succinate oxidation preferentially . SF6847 and CCCP inhibited succinate oxidation strongly, while sodium azide inhibited it weakly and these three poisons were less inhibitory for glycerol oxidation . DPPA, sodium azide, SF6847, and CCCP inhibited the synthesis of ATP coupled with respiration but not with glycolysis . Zinc sulfate inhibited the cellular ATP synthesis coupled with either respiration or glycolysis.

Brookhaven Symp Biol, 1975 Jul, (26), 53 - 76
Processing of E . coli tRNA precursors; Schedl P et al.; Our results indicate that RNase P has a very general role in the processing of tRNA precursors in E . coli, being responsible for the cleavage of virtually all precursor molecules at a site corresponding to the 5' end of the mature tRNA, and that at least two other RNases play specific roles in precursor processing . One of these, which may be RNase II, is responsible for removing extra nucleotides from the 3' end of tRNA precursors . The other, which we call RNase P2, is an endonuclease that cleaves precursors in spacer regions between different tRNA sequences; this enzyme is involved in the processing of large multimeric precursors.

Poult Sci, 1975 Jul, 54(4), 1292 - 6
Vitamin E or vitamin A protects chickens against E . coli infection; Tengerdy RP et al.; The supplementation of either vitamin E (300 mg./kg . diet) or vitamin A (60,000 I.U./kg . diet) to a standard chick ration increased the protection of six week old immunized chickens against E coli infection, decreasing mortality from about 40% to 5% . The combination of the two vitamins, however, did not give as much protection as either vitamin alone . Vitamin E or A did not protect chicks from weight loss and severe morbidity due to infection, but slightly increased the rate of recovery.

Immunology, 1975 Jul, 29(1), 31 - 8
Adsorption in vitro to Escherichia coli of antibodies and other proteins in bovine serum and colostrum and its effects on the production of E . coli agglutinins; Steel ED; IgGl, IgG2, IgA and IgM from bovine serum and colostrum are adsorbed by Escherichia coli in vitro; lactoferrin is also adsorbed from colostrum and alpha2 macroglobulin from serum . The colostral adsorbed proteins on E . coli appear to reduce formation of agglutinins when the treated bacteria are injected into rabbits and guinea-pigs . Assay of the concentration of proteins dissociated from colostrum-treated cells showed equal amounts of secretory IgA AND IgGl, half that amount of IgG2, and traces of IgM and lactoferrin . Dissociation of proteins from serum-treated E . coli yielded equal amounts of IgGl and IgG2, traces of IgA and an alpha2 macroglobulin, but no IgM.

Mol Biol Rep, 1975 Jul, 2(2), 129 - 34
A tw0-component ribonucleotidyl transferase from E . coli; Prangishvili DA et al.; Some properties of an enzyme designated as a two component ribonucleotidyl transferase from E . coli are presented . The enzyme in the presence of magnesium ions catalyzes the synthesis of polyribonucleotide chains using all four nucleoside triphosphates as substrates . The enzyme consists of two components; component A in the presence of Mg2+ catalyzes the synthesis of homo- and heteropolymers using ATP, CTP and UTP but not GTP as substrates . Component B itself does not catalyze any synthesis at all, but its addition to component A affects this component in two ways: quantitatively- the activity of component A considerably increases, and qualitatively- both components together are capable of catalyzing the synthesis of polyribonucleotides consisting of all four ribonucleotides.

Mol Biol (Mosk), 1975 Jul-Aug, 9(4), 509 - 15
{Specific modification of phenylalanine:tRNA-ligases of E . coli MRE-600 with N-chlorambucilyl-14c-phenylalanyl-tRNA}; Gorshkova II et al.; N-Chlorambucilyl-{14C}phenylalanyl-tRNA was used for the affinity modification of phenylalanine : tRNA-ligase from E . coli MRE-600 . It has been found that N-chlorambucilyl-{14C}phenylalanyl-tRNA selectively inactivates phenylalanine : tRNA-lagase that results in formation of a covalent bond between the tRNA derivative and the enzyme at pH 5.8, 25 degrees C . The rate fall of the aminoacylation of tRNA with {14C}phenylalanine was observed after the enzyme incubation with N-chlorambucilyl-{14C}phenylalanyl-tRNA at pH 7.5, 25 degrees C . It has been shown that this modification results in a similar rate decrease of tRNA aminoacylation with {14C}phenylalanine, ATP-{32P}pyrophosphate exchange and reaction of the enzymatic deacylation of {14C}phenylalanyl-tRNA . This fact evidences in favour of the possibility of the alkylation to proceed in the proximity of the active centre of the enzyme . The covalent complex obtained seems to be an interesting model for the studies of the mechanisms involved in tRNA aminoacylation as well as for elucidation of the tertiary structure of tRNA bound with the enzyme.

Mol Gen Genet, 1975 Jun 19, 138(3), 257 - 68
Transcriptional control of the isoleucine-valine messenger RNA's in E . coli K-12; Childs GJ et al.; Hybridization of messenger ribonucleic acid (mRNA) isolated from Escherichia Coli K-12 to deoxyribonucleic acid (DNA) from lambdaCI857st68h80dilv was used to detect isoleucine-valine (ilv) specific mRNA . A number of strains partially constitutive for the isoleucine-valine enzymes had levels of ilv mRNA 2 to 3-fold higher than the parent strain . Starvation for any of the branched-chain amino acids resulted in a 20 to 23-fold increase in ilv mRNA as compared to repressed levels . These differences were not due to altered growth rates or to changes in the stability of ilv mRNA . These data indicate that regulation of the isoleucine-valine enzymes by multivalent repression occurs mainly at the level of transcription . Kinetics of elongation of ilv mRNA after repression are consistent with the assumption that the mechanism of multivalent repression involves the prevention of further initiations by RNA polymerase.

Experientia, 1975 Jun 15, 31(6), 662 - 4
Inhibitors of the adhesiveness of enteropathogenic E . coli; Rivier DA et al.; The entero-pathogenic strain of E . coli 0125: K 70 was able to adhere to washed guinea-pig erythrocytes and to cause their agglutination . Electron microscopy revealed this strain to be rich in fimbriae . They were able to cause hemagglutination by themselves, generally at protein concentration of 10 to 100 mug per ml . D-mannose and alpha-methylmannoside were able to inhibit hemagglutination by the whole bacteria or their isolated fimbriae at concentrations of 0.003 to 0.012 mg/ml . L-mannose, D-lactose, D-glucose, N-acetylglucosamine, D-galactose, N-acetyl-D-galactosamine, D-fucose, did not exert any inhibiting effect at concentrations as high as 50 mg/ml . N-acetyl-neuraminic acid was also uneffective at concentration as high as 9 mg/ml.

Nature, 1975 Jun 12, 255(5509), 533 - 8
Isolation of histone genes from unfractionated sea urchin DNA by subculture cloning in E . coli; Kedes LH et al.; Histone genes have been cloned selectively in Escherichia coli directly from unfractionated sea urchin DNA using labelled mRNA probe . The cloning method used is potentially applicable for isolating any genetic sequence for which a probe is available . The several eukaryotic gene fragments introduced into bacteria by this method collectively contain all or nearly all of the DNA sequences represented in histone mRNA.

Nucleic Acids Res, 1975 Jun, 2(6), 787 - 98
The 3' terminal oligonucleotide of E . coli 16S ribosomal RNA: the sequence in both wild-type and RNase iii- cells is complementary to the polypurine tracts common to mRNA initiator regions; Reversions of the two missense and one nonsense trp-mutations induced by UV-light or methyl methanesulfonate in E . coli wild type and its polAi and uvrE502 mutants; Two missense mutations, trpA58 and trpA78, and one nonsense mutation-trp-ochre, were used to determine the types of base-pair substitution caused by ultra, violet irradiation and methyl methanesulfonate (MMS) in Escherichia coli . UV irradiation of the wild-type bacteria led to the formation of revertants mainly arising as a result of GC yields AT transitions (suppressor revertants of the trpA58 mutant) . True revertants of the trp- mutant (arising via transitions of AT pairs) and 5-methyl tryptophan-sensitive (MT-s) Trp+ of the trpA78 mutant (arising via unidentified transversions) occurred at a lower frequency . The polAI mutation did not change the frequency of the UV-induced transitions GC yields AT or that of the substitutions of the AT pairs . The uvrE502 mutation significantly increased the frequency of the UV-induced revertants arising via the transition GC yields AT . Treatment of the wild-type bacteria with MMS resulted in the formation of revertants mainly due to the GC yields AT substitution, and with a lower frequency to the AT yields GC transitions . MMS also induced, with a low frequency, some transversions . The frequency of the MMS-induced GC yields AT transitions was enhanced in the uvrE502 mutant . On the other hand, the uvrE502 mutation eliminated or significantly lowered MMS-induced revertants arising as a result of AT yields GC transitions or transversions.

Zh Mikrobiol Epidemiol Immunobiol, 1975 May, (5), 33 - 6
{Genetic determinants of the O-antigens of serologically typed E . coli}; Shchipkova NI et al.; A study was made of the genetic determinants of the O-antigenicity in the E . coli, O25 and O86 serological groups in experiments on conjugation and transduction . In analysis of genetic recombinants selected from the crosses of the serologically typed and nontyped bacteria there was revealed a relationship between the inheritance of the antigenic signs (O25+ and O86+) and the capacity of histidine to synthesis . The S-form and the O25-antigenicity signs were readily cotransduced with the his+ marker, this pointing to the close linking of the corresponding genes loci on the bacterial chromosome.

Zentralbl Bakteriol {Orig A}, 1975 May, 231(4), 437 - 50
{Mucous (M) mutants of enteropathogenic, septicemic and saprophytic E . coli (author's transl)}; Parnas J et al.; Mucoid M mutants of enteropathogenic (for suckling pigs), septicemic (for calves), and saprophytic E . Coli were subject of the study . The characteristics of the M colonies have been listed in Table 1 . Both spontaneously occurring M mutants which had been isolated by culturing of E . coli strains (S form) in normal horse serum (undiluted) for several weeks were observed . Enzymatic-biochemical tests revealed the existence of M mutants with full enzmatic activity which are identical with the homologous S and R forms . There were also M mutants exhibiting a considerably reduced enzymatic activity . Antigenic-serological analysis (agglutination) exhibited M mutants which were agglutinated by the homologous sera, at low and high titres . In contrast to this, one group of M mutants was found not to be agglutinable, despite autoclaving at 120 degrees C for 2 hours . Some mutants cultured in broth for several weeks were re-exhibiting S colonies of full biochemical activity and full antigen reactivity against homologous agglutinating sera.

Zentralbl Bakteriol {Orig A}, 1975 May, 231(4), 426 - 36
{The endotoxin from S-, R- and M-forms of enteropathogenic E . coli O 149: pyrogenicity, Shwartzman-phenomenon and hypersensitivity (author's transl)}; Parnas J et al.; The authors are interested in elucidation of the role of endotoxin from S, R- and M-forms of E . coli O 149, and of the role of hypersensitivity in pathogenesis of Colibacillosis . It was shown in this experiment that all S, R- and M-form of E . coli O149 possess endotoxin with almost the same pyrogenicity in normal rabbits . The pyrogenicity increases enormously in the hypersensitized rabbit . There were also not observed differences between endotoxins extracted from S, R, M-mutnants . All 3 endotoxins evoke in normal rabbits the skin Shwartzman-Phenomenon, the S-endotoxin was there much stronger . This phenomenon increases in capacity in hypersensitized rabbits . Thus again, the role of hypersensitivity in Colibacillosis was proved to be important.

Immunology, 1975 May, 28(5), 847 - 54
Age-related decline in the antibody response to E . coli lipopolysaccharide in New Zealand Black mice; Blankwater MJ et al.; A thymus-independent immune function in ageing NZB and BALB/c mice was compared by measuring the antibody response to E . coli lipopolysaccharide (LPS) . Since it was found that 10-13 month-old NZB mice was particularly sensitive to LPS, this antigen had to be detoxified by alkali treatment . The anti-LPS splenic plaque-forming cell (PFC) response of NZB mice decreases with age and was lower than that of BALB/c mice in all age groups studied . The response of 4- and 10-month-old NZB mice showed an irregular time course and a number of mice showed no response . The present results indicate that, besides an impairment of T-cell functions, an impairment on the B-cell level must also be considered in ageing NZB mice.

Immunology, 1975 May, 28(5), 841 - 6
Experimental Escherichia coli O6 pyelonephritis in rabbits . Effect on O6 antibody quantity and avidity of prior immunization with E . coli O2 bacteria; Ahlstedt S et al.; Haematogenous pyelonephritis was induced in rabbits using Escherichia coli 06:K13:H1 bacteria and the amounts and avidities of antibodies to the 06 antigen were analysed by the ammonium sulphate precipitation technique of Farr . In a group of six animals preimmunized with E . coli 02:K2ab:H1, five developed pyelonephritis and one pyelitis, as determined by histological examination . All aminals showed a considerable antibody response to E . coli 06 antigen during the infection . The animal with pyelitis gave a slightly smaller response than the others . The antibody avidity showed a pronounced variation . In a second group of six rabbits not preimmunized, five animals developed pyelonephritis . The titres of antibodies against E . coli 06 antigen increased during the infection inall of the six animals . However, the increase was significantly smaller than for the animals preimmunized with E . coli 02:K2ab:H1 (P smaller than 0.01) . The pattern of the antibody avidities in this group was also heterogenous . The results are consistent with previous findings that exposure to serologically heterologous E . coli bacteria can enhance the development of the homologous antibody titres . This could be of relevance for serological diagnostic work as well as in the determination of the protective capacity of the antibody.

Biosystems, 1975 May, 6(4), 205 - 8
Possible mechanism of E . coli messenger RNA degration: non-enzymatic degradation; Ko TS; The present paper points out lack of evidence to support the presently prevailing concept that E . coli mRNA turnover, in the gene expression process, cannot take place without mRNase(s) . The present paper draws attention to possible physicochemical factors involved in the degradation, and advances a notion of non-enzymatic spontaneous degradation of E . coli mRNA in its expression process . This suggested hypothesis helps to explain hitherto reported findings on the mode of E . coli mRNA degradation.

Mol Biol (Mosk), 1975 May-Jun, 9(3), 331 - 9
{Structure of the DNA molecule in the course of reparation process after ultraviolet irradiation of E . coli cells}; Osakovskii VP et al.; Kinetics was studied of DNA degradation, processing and synthesis in the course of post-radiation incubation (irradiation dose 0-2000 erg/mm2) . It has been shown that contrary to the endonuclease splitting of DNA strands, DNA degradation requires energy . DNA degradation is not enhanced upon an increase of the irradiation up to 400 erg/mm2 and more and at the incubation duration exceeding 120 min . The degradation involves not more than 40% of the total DNA quantity . It takes place in the absence of resynthesis registered by the incorporation of {3h} thymidine and 32P and dephinylamine reaction . The number of single-strand breaks in DNA (per one E . coli chromosome strans) reaches a maximum value after 120-180 min . of incubation . This maximal value is linearily increased upon an increase of the irradiation dose from 0 to 1200 erg/mm2 and does not change when the dose increases further . The number of single-strand breaks does not exceed 35-50, this value being dependent on the presence of glucose . On the basis of the data obtained a suggestion is put forward that in the course of the reparative degradation of DNA, prolonged (10(4)-10(5) nucleotides) single-stranded regions are formed . Possible role of these 'nicks" in the appearance of mutations is discussed.

Mol Biol (Mosk), 1975 May-Jun, 9(3), 331 - 9
{Structure of the DNA molecule in the course of reparation process after ultraviolet irradiation of E . coli cells}; Osakovskii VP et al.; Kinetics was studied of DNA degradation, processing and synthesis in the course of post-radiation incubation (irradiation dose 0-2000 erg/mm2) . It has been shown that contrary to the endonuclease splitting of DNA strands, DNA degradation requires energy . DNA degradation is not enhanced upon an increase of the irradiation up to 400 erg/mm2 and more and at the incubation duration exceeding 120 min . The degradation involves not more than 40% of the total DNA quantity . It takes place in the absence of resynthesis registered by the incorporation of {3h} thymidine and 32P and dephinylamine reaction . The number of single-strand breaks in DNA (per one E . coli chromosome strans) reaches a maximum value after 120-180 min . of incubation . This maximal value is linearily increased upon an increase of the irradiation dose from 0 to 1200 erg/mm2 and does not change when the dose increases further . The number of single-strand breaks does not exceed 35-50, this value being dependent on the presence of glucose . On the basis of the data obtained a suggestion is put forward that in the course of the reparative degradation of DNA, prolonged (10(4)-10(5) nucleotides) single-stranded regions are formed . Possible role of these 'nicks" in the appearance of mutations is discussed.

Z Naturforsch {C}, 1975 May-Jun, 30(3), 412 - 6
Activation and inhibition of the Mg-Ca-ATPase from E . coli by Mg2+ and Ca2+; Ahlers J et al.; MgATP of CaATP is the substrate of the Mg-Ca-ATPase . At low Mg2+- or Ca2+-concentrations the ATPase is activated by Mg2+ or Ca2+, the activator being essential for activity . At higher Mg2+- or Ca2+-concentrations the Mg-Ca-ATPase is inhibited competitively . Thus the real Km is smaller than reported in the literature . H+ competes with Mg2+ or Ca2+ for the metal binding sites.

Zh Mikrobiol Epidemiol Immunobiol, 1975 May, (5), 70 - 3
{Some properties of the alpha-hemolysin produced by a hemolytic strain of E . coli}; Palkina NA et al.; It was found that alpha-hemolysin of E . coli P 678 HIy+ was maximally active against human erythrocytes at pH 6.5 . The hemolytic activity is characterized in time by a distinct lag-phase and a phase of the greatest velocity of the reaction immediately following it . The duration of the lag-phase and also the rate of hemolysis depends on alpha-hemolysin concentration, whose increase is accompanied by a decrease of the lag-phase and acceleration of hemolysis . There is a definite limit below which the duration of the lag-phase remains unchanged with further increase of hemolysin concentration . There was noted a linear relationship between the amount of erythrocytes taken for the test and the rate of hemoglobin release and also a temperature activation of the hemolytic reaction.

Biochim Biophys Acta, 1975 Apr 2, 383(4), 446 - 51
Tertiary structure in E . coli tRNA Arg and tRNA Val; Wong KL et al.; 300 MHz proton NMR has been used to demonstrate that both Escherichia coli tRNA Arg and tRNA(1) Val have a tertiary structure base pair between 4-thiouridine (s-4U) at position 8 and A at position 14 . Formation of this s-4U(8)-A(14) base pair leads to a very low field (14.8 ppm) resonance in the spectra of both molecules . When s-4U is converted to U the 14.8 resonance is replaced by a new resonance which appears at 14.3 ppm . The presence of the tertiary structure s-4U(8)-A(14) base pair greatly constrains the folding of these tRNAs in solution.

Zh Mikrobiol Epidemiol Immunobiol, 1975 Apr, (4), 95 - 7
{Influence of the recA- mutation on spontaneous filamentation and the titer of the lambda phage in ylonB- mutants of E . coli K12 (lambda)}; Ivasiuk LA; A study was made of the effect of recA- mutation on the spontaneous filament formation and the spontaneous induction of the lambda prophage in the E . coli K12 strain bearing lonB- mutation . It was revealed that in the absence of a functionally-active product of the recA- gene the lonB- strain of E . coli K12 displayed but a partial depression of spontaneous formation of filamentous forms and of spontaneous induction of the lambda prophage.

Biull Eksp Biol Med, 1975 Apr, 79(4), 104 - 7
{Properties of the F' factors formed in crosses of E . coli Hfr donor cells with recipient cells by means of defects in recombination}; Pavlovich AI; Meriploids isolated from the crosses of donor cells HfrH, KL-96, KL-99 and the recipient cells AB 2463 recA carried sex factors of different structures (different in length) and activities: 1) typical F1-factors with the proximal chromosomal markers; 2) "long" F1-factors of different structures with defective genes, which controlled sensitivity to phagef2; 3) "long" F1-factors of different structures with defective genes, which controlled conjugation transfer . Chromosomal markers can be incorporated into the sex factor regardless of their position in respect to the sex factor in the initial Hfr cells . Defects of the sex factor proper in the genome are accompanied by the loss of some chromosomal genes incorporated into the sex factor . At the same time the typical F'-factors preserve their structure completely.

Nucleic Acids Res, 1975 Apr, 2(4), 501 - 7
Modification of E . coli ribosomes and coliphage MS2 RNA by bisulfite: effects on ribosomal binding and protein synthesis; Braverman B et al.; The reaction of E . coli 70s ribosomes with 0.2 M NaH-35 s03 (pH 7.1, 3.5hrs, 37 degree) led to the conversion of 4.5% of the uracil residues of the R, RNA into 5.6-dihydrouracil-6-sulfonate residues . The modified ribosomes exhibited a significant decrease in their ability to bind (14-C)-phenylalanyl-(RNA-phe and to incorporate (14-C)-phenylalanine into protein in the presence of polyuridylic acid . The ability of the modified ribosomes to form an initiation complex as measured by the A-U-G or coliphage MS2 RNA dependent binding of (14-C)-fmet-tRNA-fmet was also impaired, as was their ability to incorporate (14-C) lysine into protein with MS2 RNA as messenger . Treatment os MS RNA with 0.2 M sodium (35-S) bisulfite, pH 7.0 at 25 degrees C resulted in the substitution of 2.7% and 6.2% of the uracil residues by bisulfite after 1 and 3.5 hrs of reaction, respectively . Impairment of function of the MS2 RNA in both initiation complex formation and transplantation assays was observed . These reactions of uracil residues of mRNA and rRNA may be a cause of biological damage inflicted by sodium bisulfite and sulfur dioxide.

Nucleic Acids Res, 1975 Apr, 2(4), 469 - 75
Sequence of E . coli tRNA-Glu1 by automated sequential degradation; Uziel M et al.; A minor tRNA-Glu1 constituent of a preparation of E . coli B tRNA-Glu (Oak Ridge) has a guanosine residue at position 66 rather than an adenosine as in the tRNA-Glu2 described by Ohashi et al . (3) . Automated sequential degradation was used to sequence this region.

Cell, 1975 Apr, 4(4), 337 - 45
Properties of membrane-associated folded chromosomes of E . coli related to initiation and termination of DNA replication; Ryder OA et al.; Analysis of folded chromosomes prepared from amino acid-starved E . coli cells of from a dnaC initiation mutant indicates that a unique structure is associated with completion or near completion of rounds of chromosome replication in E . coli . Chromosomes remain associated with portions of the bacterial cell envelope throughout the DNA replication cycle, but become more rapidly sedimenting as replication proceeds in the absence of reinitiation . Before reinitiation of chromosome replication occurs after restoring required amino acids to amino acid-starved cells or after lowering the temperature in a thermosensitive dnaC mutant, sedimentation velocities of the membrane-associated folded chromosomes decrease substantially . The decrease in sedimentation velocity does not depend on renewed DNA synthesis, but does require the activity of at least the dnaC gene product.

Zh Mikrobiol Epidemiol Immunobiol, 1975 Apr, (4), 115 - 8
{Increase in resistance to UV-light in E . coli bearing the Hly plasmid resistance}; Bryzgunova NI et al.; Hly plasmide of wild type and its derepressive (by transmission) mutant communicated to the E . coli cells an increased resistance to the action of ultraviolet rays . Hly plasmide failed to compensate the defects associated with the excision and postreplicative DNA reparation or the reparative DNA synthesis . Hly plasmide increased the resistance to the ultraviolet light in the lon--mutant in which the ultraviolet irradiation disturbed the process of cell division . It is supposed that the resistance to the ultraviolet light connected with Hly plasmide was caused by the influence of the plasmide on some stages of cell division following the ultraviolet irradiation.

Br J Pharmacol, 1975 Apr, 53(4), 485 - 8
E . coli endotoxin shock in the cat; treatment with indomethacin; Parratt JR et al.; 1 . An earlier study had demonstrated that indomethacin, administered before E . coli endotoxin, abolished the initial pulmonary vasoconstriction and delayed the onset of the secondary shock phase that results from the intravenous injection of this agent in cats . The object of the present study was to determine whether indomethacin modified the shock phase when administered after endotoxin . 2 . All the cats (whether or not they received indomethacin, 10 mg/kg) exhibited the characteristic features of the delayed shock phase that result from the administration of endotoxin (2 mg/kg) . These included systemic hypotension, hypoglycaemia, reductions in arterial pH, cardiac output and systolic ejection time and an increase in arterial lactate . Five out of the ten animals given indomethacin survived 4 h compared with four out of twelve in the control (endotoxin along) group . 3 . These results do not support the suggestion that antipyretic-analgesic drugs like indomethacin may be of benefit when given during bacteraemic or septic shock . They do support the suggestion that the acute pulmonary changes (hypertension and decreased compliance) that occur in this species within a few minutes of endotin administration ultimately contribute to the severity of the shock phase.

Biochim Biophys Acta, 1975 Mar 28, 384(1), 277 - 82
19-F NMR studies of the binding of a fluorine-labeled phosphonate ion to E . coli alkaline phosphatase; Lilja H et al.; The interaction of a fluorinated phosphonate with Zn-2+-and Mn-2+-alkaline phosphatase as studied by 19-F NMR revealed a stoichiometry of 1:1 for the binding of the phosphonate anion to the enzyme . In the presence of two metal ions, one fluorinated phosphonate ion was found to interact strongly with the enzyme, while a different interaction was observed when the number of metal ions per enzyme exceeded two . Phosphate replaced enzyme bound phosphonate, as is shown by the 19-F NMR spectra . No direct interaction between the fluorinated phosphonate and the metal ion responsible for enzyme activity was indicated by the 19-F NMR data . This observation supports the idea of a considerable distance between metal ion and substrate binding site in Escherichia coli alkaline phosphatase.

Biokhimiia, 1975 Mar-Apr, 40(2), 389 - 94
{Isolation and characteristics of homopolyribonucleotide synthesized in toluene-treated E . coli cells}; Mardashchev SP; Optimal conditions of homopolyribonucleotide (poly-A-14C) synthesis in toluene-treated E . coli cells under incubation with ADP-14C, Mg2+ and tris . HCl buffer (pH 8.0) are studied . Optimal Mg2+ concentration was 0.75.-10(-3) M . Heterogeneity of the isolated poly-A-14C from E . coli cell was demonstrated by means of sucrose density gradient (5-20%) centrifugation and polyacrylamide gel electrophoresis . Actinomycin D was found not to affect the reaction rate of polymerization of ADP-14C, UDP-14C and GDP-14C, catalyzed by polynucleotide phosphorylase in toluene-treated E . coli cells.

Nucleic Acids Res, 1975 Mar, 02(3), 373 - 81
The secondary structure of E . coli ribosomes and ribosomal RNA's: a spectrophotometric approach; Araco A et al.; The thermal denaturation spectra of E . coli 50s and 30s ribosomal sub units and of their isolated RNA's were studied over the wavelength range of 2300-3000 Angstrom . It was possible to fit the experimental denaturation spectra with super positions of the reference spectra for denaturation of A - U and G - C base pairs derived from model polyribonucleotides . The coefficients of these linear combinations were used to calculate the fractions of A - U and G - C base pairs in the samples . It was found that the helical content of the RNA's inside the subunits is smaller than that of the isolated RNA's, thus suggesting that proteins may affect the secondary structure of RNA in the ribosome.

J Cell Sci, 1975 Mar, 17(3), 287 - 306
Electron-microscopic mapping of AT-rich regions and of E . coli RNA polymerase-binding sites on the circular kinetoplast DNA of Trypanosoma cruzi; Brack C et al.; Partial alkaline denaturation of the circular kinetoplast DNA (kDNA) of Trypanosoma cruzi has shown the existence of 4 small, well-defined AT-rich regions with an average size of about 200 base pairs . They are almost equally distributed, separated by approximately 90 degrees on the circular molecule . All minicircles, whether free or linked in networks, have the same denaturation pattern and, therefore, seem to contain the same information . The long linear molecules present in low amounts in the kDNA samples do not show the same denaturation pattern . Partial denaturation of molecules in larger associations indicates that the circular units may be linked to each other by one strand only . kDNA can be transcribed in vitro by the RNA polymerase of E . coli . RNA polymerase-kDNA complexes have been studied in the electron microscope . By spreading the DNA-protein complexes by adhesion to positively charged carbon films and dark-field observation, it was possible to show the existence of 4 specific binding sites of the E . coli RNA polymerase on the kDNA circles . Comparing the position of the polymerase-binding sites and the AT-rich melted zones, it is suggested that a correlation exists between the two . As had been shown in earlier work, the replication of circular kDNA can be blocked by treating the trypanosomes with the trypanocidal drug Berenil . The comparison of the relative position of the Berenil-blocked replication forks with the position of the 4 denaturation loops shows that the DNA replication is stopped at these AT-rich regions . Since there is evidence that Berenil binds preferentially to AT-rich DNA and seems to be involved in inhibition of DNA replication, the following hypothetical model can be proposed . The replication of the circular kDNA molecules is discontinuous and involves the synthesis of RNA primers; when Berenil is bound to the AT-rich regions, synthesis of new RNA primers is inhibited and replication is blocked at these points, leading to the accumulation of replicating intermediates with defined branch lengths.

Mol Biol Rep, 1975 Mar, 2(1), 35 - 40
A new two-dimensional gel electrophoresis system for the analysis of complex protein mixtures: application to the ribosome of E . coli; Knopf UC et al.; A new method for two-dimensional polyacrylamide gel electrophoresis of proteins is described . The method, illustrated here by its application for the analysis of ribosomal proteins of E . coli, has a high resolving power . The proteins S15 and S16 can be resolved either following alkylation or under reducing conditions . This was not possible with urea gel systems previously employed . The method should be advantageous in the identification of the components of dimers formed with the reagent methyl 4-mercaptobutyrimidate . An additional advantage of the new method is that both dimensions are run at an acidic pH . For ribosomal proteins it is therefore unnecessary to either polymerize the protein sample in the middle of the first dimension disc gel or to electrophorese two samples with opposite polarity.

Cell, 1975 Feb, 4(2), 107 - 11
The general affinity of lac repressor for E . coli DNA: implications for gene regulation in procaryotes and eucaryotes; Lin S et al.; By equilibrium competition experiments, the dissociation constant (K(RD)) of lac repressor for E . coli DNA carrying a deletion of the lac operon was measured at a variety of salt concentrations . These data are used in the consideration of several aspects of protein-DNA interaction: Quantitative estimates of specificity are made . Specificity changes only slightly with salt concentration . We calculate that in vivo, 98 percent or more of repressor is bound to DNA predominately at sites other than the lac operator . Inducers shift repressor from operator to nonoperator DNA, but do not free it from DNA . The general affinity of repressor for E . coli DNA is sufficient to support a model where repressor slides along DNA for significant distances . The effective dissociation constant of repressor for operator (K(eff)) is very sensitive to the total DNA concentration . We propose that "junk" DNA in eucaryotes functions to maintain total DNA at an optimum concentration . We consider the lac operon in the nucleus of a lymphocyte, point out that severe difficulties would be encountered, and suggest possible solutions.

Biophys Chem, 1975 Feb, 3(1), 21 - 34
Anomalous sedimentation behaviour of the E.coli ribosomal system: 50S-30S forms 50S PLUS 30S; Shcherbukhn VV; An experimenal and theoretical study has been made into the effect of association-dissociation reactions on the sedimentation of the E.coli ribosomal 50S-30S forms 50S plus 30S . It has been found that (a) the sedimentation pattern is strongly dependent on the rotor speed: (b) the ratio of components as measured using high-speed ultracentrifugation (30000-40000 r.p.m.) is independent of rotor speed; and (c) the speed of ultracentrifugation has a strong effect on the sedimentation coefficeint of the ribosomal system as determined by the mean square second moment . The results of this paper demonstrate that ribosome sedimentation at low-speed ultracentrifugation is affected by some artefactual processes . A theoretical analysis of the experimental findings has shown that the observed effects cannot be attributed to the effect of the association-dissociation reaction nor to the pressure dependence of the equilibrium constant of that reaction . On the other hand, at high-speed ultracentrifugation the ribosomal system sediments as a heterogeneous mixture of non-interacting components . Consequently, the shape of the boundary in this case will reflect the equilibrium composition of the ribosomal system.

Int J Radiat Biol Relat Stud Phys Chem Med, 1975 Feb, 27(2), 143 - 56
The effects of rifampicin on electron- and neutron-irradiated E . coli B/r and BS-1: Survival, DNA degradation and DNA synthesis by membrane fragments; Cramp WA et al.; The effect of rifampicin after irradiation with electrons or neutrons on cell-killing, DNA degradation and the ability of DNA-membrane complex extracted from irradiated bacteria to synthesize DNA was studied in strains E . coli B/r and BS minus 1 . Post-irradiation treatment with rifampicin greatly enhanced the lethal effects of both electrons and neutrons on the repair-proficient strain E . coli B/r under anoxic conditions . However, the same post-irradiation treatment of the repair-deficient strain E . coli BS minus 1 with rifampicin gave no consequent increase in lethality . Rifampicin did not alter the extent of DNA degradation in either strain after irradiation with electrons or neutrons . The DNA-synthetic activity of DNA-membrane complex from electron-irradiated E . coli B/r and BS minus 1 was not altered by post-irradiation treatment with rifampicin, nor did this treatment affect synthesis by DNA-membrane complex isolated from neutron-irradiated BS minus 1; but the complex, isolated from E . coli B/r which had been irradiated under anoxic conditions with neutrons, showed a marked decrease in activity . We suggest that post-irradiation sensitization with rifampicin of the repair-proficient E . coli B/r, especially after irradiation under anoxic conditions, indicates that initiation of the synthesis of an RNA molecule is involved . In addition our results suggest that the structure of the membrane complex in E . coli B/r and BS minus 1 is different.

Mol Cell Biochem, 1975 Jan 31, 6(1), 33 - 41
The protein topography of the E . coli 30S ribosomal subunit: a preliminary model E . coli/30S subunit/ribosome/spatial arrangement of proteins; Sun TT et al.; A three dimensional model is presented which shows the apatial arrangement of 20 of the 21 proteins of the 30S ribosomal subunit of Escherichia coli . The model fulfills several purposes: (a) It summarizes currently available structural and functional data on ribosomal proteins; (b) It suggests an interesting correlation between stoichiometry and function . Functional proteins are both clustered and fractional; (c) It can be evaluated in relationships or point out critical experiments by which it can be tested.

S Afr J Med Sci, 1975, 40(4), 197 - 203
Synthesis of certain puromycin analogues and their use in studying the peptidyl synthetase enzyme of e . coli and rat liver ribosomes; Ariatti M et al.; The beta-alanyl and L-histidyl analogues of puromycin were synthesized chemically and tested for their ability to release {3H} N-acetylphenylalanine from its tRNA carrier in the rat liver and E . Coli ribosomal systems . Both analogues were found to be inactive in releasing {3H} N-acetylphenylalanine . Reasons for the inactivity of these compounds are discussed in relation to the structure of the puromycin molecule and the requirements for puromycin-like activity.

Arch Exp Veterinarmed, 1975, 29(1), 33 - 62
{Experimental studies on the pathogenesis of coli enterotoxemia in swine . I . Comparison of toxin effect of 2 different E . coli serotypes following parenteral toxin administration}; Johannsen U et al.; Broth culture filtrate containing endotoxin, prepared from serotype O 139:K82(?):H1 was given by the intra-enteric route with and without dimethyl sulphoxide, and with or without blockade of the RES by intravenous injection of trypan blue, using about five piglets for each of the four combinations . Clinical signs, blood pressure, ECG, respiration, temperature, haematology and pathological findings were recorded . Coli enterotoxaemia manifested by fatal endotoxin shock developed in all ten piglets given toxin plus dimethyl sulphoxide, and in 4 of 5 similarly treated after RES blockade . The sondrmoe did not develop in piglets given large amounts of toxin without dimethyl sulphoxide, whether the RES was blocked or not . When enteric absorption of toxin was promoted by dimethyl sulphoxide, RES blockade increased the sensitivity of the animal to toxin (shortening of the time till death) . The results show that there are two functional barriers to endotoxin: - the intestinal barrier, which normally prevents large amounts of toxin from entering the circulation; and RES, which plays a part in detoxifying and eliminating endotoxin which has been absorbed . Application of these findings to the pathogenesis of coli, enterotoxaemia is discussed.

Arch Exp Veterinarmed, 1975, 29(4), 531 - 49
{Toxicity of S-, R- and M-forms of enteropathogenic E . coli O149:K91:H10}; Parnas J et al.; Toxicity of freeze-dried lysates of the organism for unweaned mice (3-4 days old) increased in the order:smooth-mucoid-rough . The toxicity was neutralized by mixing the toxin with immune serum of group O149 . All toxins of the smooth, rough and mucoid variants of the Escherichia coli strain possessed hypersensitivity, skin necrosis, abortion and diarrhoea factors, which could be partly or completely neutralized by binding with homologous immune serum.

Mol Gen Genet, 1975, 137(4), 277 - 87
Direct selection of mutants restricting efficiency of suppression and misreading levels in E . coli B; Elseviers D et al.; We describe a method for the direct selection of E . coli mutants restricting efficiency of suppression and misreading levels using a T4-coded nonsense suppressor . One mutant isolated has the phenotype expected for a restrictive mutant and may be ribosomal . Other possibilities are discussed.

Mol Gen Genet, 1975, 137(1), 17 - 28
IS1 is involved in deletion formation in the gal region of E . coli K12; Reif HJ et al.; The DNA sequence IS1, which is 800 pairs long, has been shown to integrate into various bacterial and phage operons . The presence of this DNA sequence in the gal operon of E . coli K12 leads to an 30-2000 fold increase in deletion formation in the gal region as compared to wildtype . This high frequency of deletion formation is specific for IS1 and is independent of the cellular recA function . While the frequency of reversion of gal::IS1 mutations, which also is independent of recA, is not affected by the growth temperature of the cells, the formation of deletions in the gal::IS1 system is strongly dependent on the temperature of growth . Mapping experiments showed that one endpoint of the deletions in most cases is at the site of the IS1 mutation and the second endpoint seems to be at various but preferred sites . The formation of the different classes of delections observed is affected differently by the growth temperature of the cells . A model to account for these results is presented.

Acta Microbiol Pol A, 1975, 7(2), 99 - 105
Comparison of mutagenic efficiency of decay of 32P incorporated in E . coli WP-2 and E . coli WP-2S cells; Pluciennik H; 32P-labeled Escherichia coli WP-2 and Escherichia coli WP-2S cells were stored at minus 196 degrees . The lethal effect induced by 32P decay was equal in both strains . Lethal efficiency of 32P leads to 32P transmutation in DNA amounted to 0.046 . Reversion try leads to try+ were induced with a ten times higher efficiency in UV--sensitive strain WP-2S, as compared with strain WP-2.

Scand J Gastroenterol, 1975, 10(5), 491 - 3
Inhibition of leucocyte migration by antigens from human colon and E . coli O 14 in patients with ulcerative colitis; Fixa B et al.; In 55 patients with ulcerative colitis and in 25 controls the leucocyte migration inhibition test was performed . As antigens the extract from human fetal colon and the lipopolysaccharide antigen from E . coli O 14 were used . The leucocyte migration in patients with ulcerative colitis was significantly inhibited in the presence of the antigens mentioned . In patients with an active form of ulcerative colitis the leucocyte migration was significantly inhibited as compared to the leucocyte migration in patients with a nonactive form of the disease.

Biokhimiia, 1975 Jan-Feb, 40(1), 25 - 31
{2 phosphotransferase systems that control the second stage of phosphoenolpyruvate-dependent glucose phosphorylation in E . coli}; Golub EI et al.; Analysis of E . coli W mutants defective in glucose transport suggests an existence of two enzyme systems which carry out the second step of phosphoenolpyruvate (PEP)-dependent glucose phosphorylation, thus controlling the glucose transport into E . coli cells . One system (PTS-glu-alpha) controls phosphorylation and transport of both glucose and alpha-methylglucoside, the other system (PTS-glu-beta) controls phosphorylation and transport of glucose only . PTS-glu-alpha system is damaged in the mutants studied, but PTS-glu-beta system is intact . On account of this fact the mutants do not uptake 14-C-alpha-methylglucoside and their extracts are practically incapable of its phosphorylation, phosphoenolpyruvate being used as phosphate donor . At the same time the mutants are capable of 14-C-glucose uptake and PEP-dependent 14-C-glucose phosphorylation . In one of the strain, having the intact PTS-glu-alpha system, the uptake of glucose and alpha-methylglucoside was stimulated by the addiction of glucose in the cultural medium . No such effect was observed in bacteria with the disturbed PTS-glu-alpha system and the intact PTS-glu-beta system . Probably, the PTS-glu-alpha system can be inducible, in contrast with the PTS-glu-beta system . The damage of the PTS-glu-alpha system results in resistance of bacteria to glucose-induced inhibition of the enzyme synthesis.

Immunology, 1975 Jan, 28(1), 83 - 95
Inhibition of Escherichia coli by bovine colostrum and post-colostral milk . II . The bacteriostatic effect of lactoferrin on a serum susceptible and serum resistant strain of E . coli; Reiter B et al.; Two strains of Escherichia coli were inhibited by complement-inactivated cow serum and to a lesser extent by precolostral calf serum devoid of specific antibodies . They were not inhibited by undiluted colostral whey or milk but colostral whey became bacteriostatic after dialysis or dilution in Kolmer saline and addition of precolostral calf serum or lactoferrin . The inhibition in all these fluids was due to iron-binding proteins (transferrin or lactoferrin) . Undiluted dialysed milk was not inhibitory because of its low content of lactoferrin but became inhibitory after addition of 1 mg/ml of lactoferrin . The lack of inhibition in undiluted whey is due to the high concentration of citrate in colostral whey (and milk) and it is suggested that citrate competes with the iron-binding proteins for iron and makes it availabe to the bacteria . Addition of bicarbonate, which is required for the binding of iron by transferrin and lactoferrin, can overcome the effect of citrate; hence, the bacteriostatic effect of cow serum and precolostral calf serum is due to the presence of both transferrin and bicarbonate as well as the low lefel of citrate.

Acta Biol Med Ger, 1975, 34(11-12), 1787 - 92
{RNA and protein biosynthesis in toluene treated E . coli B}; Brux B et al.; The conditions for RNA- and protein synthesis in toluenized E . coli B are investigated . The kinetics of RNA- and protein synthesis indicate that a coupled synthesis of both macromolecules takes place in these preparations . Treatment with 1% Brij 58 alters the permeability of toluenized E . coli in such a way that the protein synthesis depends on the addition of supernatant proteins (chromotographed S100 from E . coli) and tRNA.

Boll Ist Sieroter Milan, 1975, 54(6), 487 - 91
Effects of E . coli O 127 endotoxin on regenerating rat liver; Rossolini A et al.; The Authors investigated the effect produced by endotoxin upon regenerating rat liver . The animals were divided into three groups after hepatectomy . The first group of animals received physiological solution, the second group received 0.5 mg of E . coli endotoxin soon after hepatectomy and the last group received the same quantity of endotoxin 22 hours after hepatectomy . To estimate hepatic regeneration we used: percentage of liver regeneration and mitotic activity . It was noted that the percentage of hepatic regeneration and mitotic activity were higher in the two groups of treated animals than in the control group . Mitotic activity and hepatic regeneration were higher in the animals treated 22 hours after hepatectomy than in the animls of second group . These results lead us to conclude that E . coli O 127 endotoxin is mitogenic also in vivo.

Mol Biol (Mosk), 1975 Jan-Feb, 9(1), 70 - 7
{Transcription of DNA by RNA polymerases of E . coli and calf thymus}; Kozlov IuV et al.; The paper deals with the comparative investigation of initiation and in vitro RNA synthesis on DNA template by E . coli RNA polymerase and B-form of calf thymus RNA polymerase . It was shown in hybridization experiments that in the range of Cot values between 10(2) and 10(4) RNA synthesized by calf thymus RNA polymerase was hybridized with homologous DNA more effectively than RNA synthesized by E . coli RNA polymerase . No differences were observed in the case of low Cot values . RNA chains synthesized by calf thymus RNA polymerase contained in average about 300-600 nucleotides per chain as determined in the kinetic experiments with ATP-gamma-32P and GTP-gamma-32P . These values are in average 5-10 times lower than in the case of bacterial enzyme . The data presented show that calf thymus and E . coli RNA polymerases initiate the RNA synthesis at apparently different sites of calf thymus DNA . The results obtained make the possibility of specific transcription of eucaryotic DNA by bacterial RNA polymerase to be doubtful.

Zentralbl Bakteriol {Orig B}, 1975, 160(1), 40 - 9
{Investigations of the influence of pH on the oxidative degradation of glucose by E . coli (biochemical glucose demand) (author's transl)}; Wilderer P et al.; The oxidative degradation of glucose by E . coli was studied in the Warburg manometer . The pH of the medium was established in these studies at values between 5.5 and 8.0 . Analysis of the reaction kinetics by plotting time/consumption curves shows that three consecutive reactions can be distinguished as the substrate is eliminated from the medium: An adaptation phase which is generally relatively brief is followed by two reactions, of which the first proceeds more rapidly or more slowly than reaction 3, depending on pH . The important feature in reactions 1 and 2 is that the oxygen demand is evidently independent of the initial concentration of substrate . In spite of these differences, if the reaction is regarded as a whole, there are no relations involving significant dependence on pH of medium . Neither the substrate-specific biochemical oxygen demand nor the reaction time necessary for catabolism show statistically significant dependence within the range of pH examined . It can be assumed therefore that E . coli possesses a regulation mechanism which compensates for unfavourable environmental conditions . The division of substrate catabolism into constituent reactions, combined with a change in concentration of pacemaker enzyme and a "competitive inhibition" may be of significance in this regulations.

Med Microbiol Immunol (Berl), 1975, 161(1), 11 - 3
Adenosine 3',5'-cyclic monophosphate in rabbit cerebrospinal fluid during fever induced by E . coli-endotoxin; Philipp-Dormston WK et al.; In rabbit cerebrospinal fluid during fever induced by E . coli-endotoxin adenosine 3',5'-cyclic monophosphate concentrations are about 2-fold higher in comparison to normal values . In addition to prostaglandins of the E series adenosine 3',5'-cyclic monophosphate might act as another mediator in the genesis of fever during infectious diseases.

Ann Sclavo, 1974 Nov-Dec, 16(6), 655 - 72
{Changes in the blood lipid pattern in experimental poisoning with lipopolysaccharides of E . coli O 127}; Rossolini A et al.; After a short notice on the relations between the endotoxine and lipydic metabolism the AA . refer on the inquiry on 60 animals divided in three groups according to the dosis of the injected endotoxin . The dosis were 0.010-1-5 mg of the lypopolisaccaride from E . coli O-127; seven animals were appointed as controls . In the all animals were examined proofs of blood after 4, 12, 24, 36, 48, 60 and 72 hours from the start of experience . The total lipids, the triglycerides, the phospholypids, the NEFA, the free and esterified cholesterol were doses . The data of lethality and the value of determinations of the single fractions obtained were registered . In the all experienced animals, independently from the injected dosis, an independently from the injected dosis, an increase of the lypidic fractions was remarked: the free fatty acids were the first to rise, suived by triglycerides and phospholypids and denn by the two fractions of cholesterol . The highest dosis of endotoxine have comported a blok in the esterification of cholesterol . This early and persistent hiperlypemie can be caused initially by increased incretion of catecolamine.

What Is Growth Medium?, What Is Genetics?, What Is Activated Sludge?, What Is Environmental Microbiology?, What Is Genetic Engineering?, c, Bacteriology, c, Bacterium, n, Microorganisms, e, Microbiology, a, Microbes, c, Escherichia coli, n, Escherichia coli, r, Bacteriological, r, Staphylococcus aureus, i, Bacteria, a, Bacteriological, i, Bacillus, a, Escherichia coli, e, Escherichia coli, i, Yeasts, r, Antimicrobial, o, Gram positive, a, Bacillus, e, Escherichia coli, o, Yeasts, e, Microorganisms, c, Escherichia coli, s, Pseudomonas, s, Eubacterium, o, Microorganisms, e, Antibiotics

Scientific Publications - Work Done by Microbiology Reader Bioscreen C
Agricultural Microbiology Anaerobic Microbiology Antimicrobial Susceptibility Artificial Atmosphere Bioassay of Antibiotics Biofilm Microbiology Bioreactor Technology Biotechnology Cell Biology Clinical Microbiology Environmental Microbiology Experiments with Yeast	Fermentation Food Microbiology Functional Genomics Gene Technology Growth Media Development Growth Rate and Lag Time Industrial Microbiology Medical/Pharmaceutical Field Microbiological Assay Microbiological Research Microbiology of Cosmetics go to a specific theme...	Military Microbiology Molecular Microbiology Mutagenicity and Genotoxicity Oral Microbiology Patents Postantibiotic Studies Soil Microbiology Spore Microbiology Veterinary Microbiology Waste/Wastewater Treatment Water Microbiology Wine Microbiology

� 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com

Last modified: May 25, 2005