Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us


Proc Natl Acad Sci U S A, 1998 Jun 9, 95(12), 6613 - 8
Structure and function of the Bacillus hybrid enzyme GluXyn-1: native-like jellyroll fold preserved after insertion of autonomous globular domain; Ay J et al.; The 1,3-1,4-beta-glucanase from Bacillus macerans (wtGLU) and the 1, 4-beta-xylanase from Bacillus subtilis (wtXYN) are both single-domain jellyroll proteins catalyzing similar enzymatic reactions . In the fusion protein GluXyn-1, the two proteins are joined by insertion of the entire XYN domain into a surface loop of cpMAC-57, a circularly permuted variant of wtGLU . GluXyn-1 was generated by protein engineering methods, produced in Escherichia coli and shown to fold spontaneously and have both enzymatic activities at wild-type level . The crystal structure of GluXyn-1 was determined at 2.1 A resolution and refined to R = 17.7% and R(free) = 22.4% . It shows nearly ideal, native-like folding of both protein domains and a small, but significant hinge bending between the domains . The active sites are independent and accessible explaining the observed enzymatic activity . Because in GluXyn-1 the complete XYN domain is inserted into the compact folding unit of GLU, the wild-type-like activity and tertiary structure of the latter proves that the folding process of GLU does not depend on intramolecular interactions that are short-ranged in the sequence . Insertion fusions of the GluXyn-1 type may prove to be an easy route toward more stable bifunctional proteins in which the two parts are more closely associated than in linear end-to-end protein fusions.

Mol Microbiol, 1998 Apr, 28(2), 293 - 303
Antagonistic effects of dual PTS-catalysed phosphorylation on the Bacillus subtilis transcriptional activator LevR; Martin-Verstraete I et al.; LevR, which controls the expression of the levoperon of Bacillus subtilis, is a regulatory protein containing an N-terminal domain similar to the NifA/NtrC transcriptional activator family and a C-terminal domain similar to the regulatory part of bacterial anti-terminators, such as BgIG and LicT . Here, we demonstrate that the activity of LevR is regulated by two phosphoenolpyruvate (PEP)-dependent phosphorylation reactions catalysed by the phosphotransferase system (PTS), a transport system for sugars, polyols and other sugar derivatives . The two general components of the PTS, enzyme I and HPr, and the two soluble, sugar-specific proteins of the lev-PTS, LevD and LevE, form a signal transduction chain allowing the PEP-dependent phosphorylation of LevR, presumably at His-869 . This phosphorylation seems to inhibit LevR activity and probably regulates the induction of the lev operon . Mutants in which His-869 of LevR has been replaced with a non-phosphorylatable alanine residue exhibited constitutive expression from the lev promoter, as do levD or levE mutants . In contrast, PEP-dependent phosphorylation of LevR in the presence of only the general components of the PTS, enzyme I and HPr, regulates LevR activity positively . This phosphorylation most probably occurs at His-585 . Mutants in which His-585 has been replaced with an alanine had lost stimulation of LevR activity and PEP-dependent phosphorylation by enzyme I and HPr . This second phosphorylation of LevR at His-585 is presumed to play a role in carbon catabolite repression.

Mikrobiol Z, 1998 Jan-Feb, 60(1), 36 - 42
Influence of Bacillus subtilis sp . lectin on functional activity of phagocytes; Kishko IaH et al.; Intramuscular and intraperitoneal introduction of Bacillus subtilis sp . lectin to mongrel white mice is responsible for the increasing of values of functional activity of peripheral blood phagocytes and peritoneal macrophages of these animals . These results confirmed similar data obtained in vitro . Bactericidal activity of monocytes and neutrophils significantly increased at minimal doses of lectin (0.1-0.5 microgram/animal) . But this increase was lower at middle doses (0.5-5.0 micrograms/animal) and again increased at higher ones (5.0-25.0 micrograms/animal) . Dose-dependent effect of lectin on macrophages was similar, but it was observed at lower concentrations . Administration of lectin did not give increase of functional reserve of studied cells, but was responsible for the increase of the phagocyte number and phagocytic index of monocytes and neutrophils at relatively middle doses (1.0-5.0 micrograms/animal) . Phagocytic activity of macrophages did not increase . Thus, lectin of B . subtilis sp . is the agent non-toxic during studies in vivo, stimulating functional activity of phagocytes and macrophages.

J Bacteriol, 1998 Jun, 180(12), 3250 - 2
The Bacillus subtilis AraE protein displays a broad substrate specificity for several different sugars; Krispin O et al.; Bacillus subtilis 168 is unable to grow on xylose and galactose as sole carbon sources, owing to the lack of specific transporters . We show that they are imported into the cell by the activity of AraE, an arabinose transporter whose synthesis is induced by L-arabinose.

J Bacteriol, 1998 Jun, 180(12), 3222 - 6
The glucose kinase of Bacillus subtilis; Skarlatos P et al.; The open reading frame yqgR (now termed glcK), which had been sequenced as part of the genome project, encodes a glucose kinase of Bacillus subtilis . A 1.1-kb DNA fragment containing glcK complemented an Escherichia coli strain deficient in glucose kinase activity . Insertional mutagenesis of glcK resulted in a complete inactivation of glucose kinase activity in crude protein extracts, indicating that B . subtilis contains one major glucose kinase . The glcK gene encodes a 321-residue protein with a molecular mass of 33.5 kDa . The glucose kinase was overexpressed as a fusion protein to a six-His affinity tag and purified to homogeneity . The enzyme had K(m) values for ATP and glucose of 0.77 and 0.24 mM, respectively, and a Vmax of 93 mumol min-1 mg-1 . A B . subtilis strain deficient for glucose kinase grew at the same rate on different carbon sources tested, including disaccharides such as maltose, trehalose, and sucrose.

J Biol Chem, 1998 Jun 5, 273(23), 14403 - 10
Coordinate transcription and physical linkage of domains in surfactin synthetase are not essential for proper assembly and activity of the multienzyme complex; Guenzi E et al.; Bacterial peptide synthetases have two common features that appear to be strictly conserved . 1) The enzyme subunits are co-regulated at both transcriptional and translational level . 2) The organization of the different enzymatic domains constituting the enzyme fulfills the "colinearity rule" according to which the order of the domains along the chromosome parallels their functional hierarchy . Considering the high degree of conservation of these features, one would expect that mutations such as transcription uncoupling and domain dissociations, deletions, duplications, and reshuffling would result in profound effects on the quality and quantity of synthesized peptides . To start testing this hypothesis, we designed two mutants . In one mutant, the operon structure of surfactin synthetase was destroyed, thus altering the concerted expression of the enzyme subunits . In the other mutant, the thioesterase domain naturally fused to the last amino acid binding domain of surfactin was physically dissociated and independently expressed . When the lipopeptides secreted by the mutant Bacillus subtilis strains were purified and characterized, they appeared to be expressed approximately at the same level of the wild type surfactin and to be identical to it, indicating that specific domain-domain interactions rather than coordinated transcription and translation play the major role in determining the correct assembly and activity of peptide synthetases.

Nucleic Acids Res, 1998 May 15, 26(10), 2366 - 73
Sequence specificity of illegitimate plasmid recombination in Bacillus subtilis: possible recognition sites for DNA topoisomerase I; Meima R et al.; Previous work in our group indicated that structural plasmid instability in Bacillus subtilis is often caused by illegitimate recombination between non-repeated sequences, characterized by a relatively high AT content . Recently we developed a positive selection vector for analysis of plasmid recombination events in B . subtilis which enables measurement of recombination frequencies without interference of selective growth differences of cells carrying wild-type or deleted plasmids . Here we have used this system to further analyse the sequence specificity of illegitimate plasmid recombination events and to assess the role of the host-encoded DNA topoisomerase I enzyme in this process . Several lines of evidence suggest that single-strand DNA nicks introduced by DNA topoisomerase I are a major source of plasmid deletions in pGP100 . First, strains overproducing DNA topoisomerase I showed increased levels of plasmid deletion . Second, these deletions occurred predominantly (>90% of the recombinants) between non-repeated DNA sequences, the majority of which resemble potential DNA topoisomerase I target sites . Sequence alignment of 66 deletion end-points confirmed the previously reported high AT content and, most importantly, revealed a highly conserved C residue at position -4 relative to the site of cleavage at both deletion termini . Based on these genetic data we propose the following putative consensus cleavage site for DNA topoisomerase I of B.subtilis: 5'-A/TCATA/TTAA/TA/TA-3'.

J Bacteriol, 1998 Jun, 180(11), 2943 - 9
Mutational analysis of the TnrA-binding sites in the Bacillus subtilis nrgAB and gabP promoter regions; Wray LV Jr et al.; Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein . A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters . Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression . Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression . Spacer mutations that change the relative distance between the TnrA site and -35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site . Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression . The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo . These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein . TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium.

Biosci Biotechnol Biochem, 1998 Apr, 62(4), 622 - 7
NADH-dependent inhibition of branched-chain fatty acid synthesis in Bacillus subtilis; Oku H et al.; Addition of NADH to crude but not to pure branched-chain alpha-keto acid decarboxylase decreased the CO2 production from alpha-keto-beta-methylvalerate (KMV) suggesting the presence of an NADH dependent inhibitor in the crude enzyme from Bacillus subtilis . This NADH-dependent decarboxylase inhibitor was purified to homogeneity by a fast protein liquid chromatography system . The purified inhibitor was identical with leucine dehydrogenase as to N-terminal amino acid squence (35 residues) and molecular weight, and catalyzed the oxidative deamination of three branched chain amino acids (BCAAs), valine, leucine, and isoleucine . The decarboxylase inhibitor was therefore identified as leucine dehydrogenase . A decreased substrate availability caused by leucine dehydrogenase thus reasonably accounted for the NADH dependent inhibition of the decarboxylation . In turn, the observation that leucine dehydrogenase competes with the decarboxylase for branched-chain alpha-keto acid (BCKA) suggested an involvement of this enzyme in the branched chain fatty acid (BCFA) biosynthesis . This view was supported by the observation that addition of NAD to crude fatty acid synthetase increased the incorporation of isoleucine into BCFAs . Pyridoxal-5'-phosphate and alpha-ketoglutarate, cofactors for BCAA transaminase, modulated BCFA biosynthesis from isoleucine in vitro, suggesting also the involvement of transaminase reaction in BCFA biosynthesis.

J Bacteriol, 1998 Jun, 180(11), 2968 - 74
A spore coat protein, CotS, of Bacillus subtilis is synthesized under the regulation of sigmaK and GerE during development and is located in the inner coat layer of spores; Takamatsu H et al.; The spore coat of Bacillus subtilis has a unique morphology and consists of polypeptides of different sizes, whose synthesis and assembly are precisely regulated by a cascade of transcription factors and regulatory proteins . We examined the factors that regulate cotS gene expression and CotS assembly into the coat layer of B . subtilis by Northern blot and Western blot analysis . Transcription of cotS mRNA was not detected in sporulating cells of sigmaK and gerE mutants by Northern blot analysis . By Western blot analysis using anti-CotS antibody, CotS was first detected in protein samples solubilized from wild-type cells at 5 h after the start of sporulation . CotS was not detected in the vegetative cells and spores of a gerE mutant or in the spores of mutants deficient in sigmaE, sigmaF, sigmaG, or sigmaK . CotS was detected in the sporangium but not in the spores of a cotE mutant . The sequence of the promoter region of cotS was similar to the consensus sequences for binding of sigmaK and GerE . These results demonstrate that sigmaK and GerE are required for cotS expression and that CotE is essential for the assembly of CotS in the coat . Immunoelectron microscopic observation using anti-CotS antibody revealed that CotS is located within the spore coat, in particular in the inner coats of dormant spores.

J Bacteriol, 1998 Jun, 180(11), 2895 - 900
Nonnative proteins induce expression of the Bacillus subtilis CIRCE regulon; Mogk A et al.; The chaperone-encoding groESL and dnaK operons constitute the CIRCE regulon of Bacillus subtilis . Both operons are under negative control of the repressor protein HrcA, which interacts with the CIRCE operator and whose activity is modulated by the GroESL chaperone machine . In this report, we demonstrate that induction of the CIRCE regulon can also be accomplished by ethanol stress and puromycin . Introduction of the hrcA gene and a transcriptional fusion under the control of the CIRCE operator into Escherichia coli allowed induction of this fusion by heat shock, ethanol stress, and overproduction of GroESL substrates . The expression level of this hrcA-bgaB fusion inversely correlated with the amount of GroE machinery present in the cells . Therefore, all inducing conditions seem to lead to induction via titration of the GroE chaperonins by the increased level of nonnative proteins formed . Puromycin treatment failed to induce the sigmaB-dependent general stress regulon, indicating that nonnative proteins in general do not trigger this response . Reconstitution of HrcA-dependent heat shock regulation of B . subtilis in E . coli and complementation of E . coli groESL mutants by B . subtilis groESL indicate that the GroE chaperonin systems of the two bacterial species are functionally exchangeable.

J Bacteriol, 1998 Jun, 180(11), 2830 - 5
Enhanced secretory production of a single-chain antibody fragment from Bacillus subtilis by coproduction of molecular chaperones; Wu SC et al.; Formation of inclusion bodies is a major limiting factor for secretory production of an antidigoxin single-chain antibody (SCA) fragment from Bacillus subtilis . To address this problem, three new strains with enhanced production of molecular chaperones were constructed . WB600BHM constitutively produces the major intracellular molecular chaperones in an appropriate ratio without any heat shock treatment . This strain reduced the formation of insoluble SCA by 45% and increased the secretory production yield by 60% . The second strain, WB600B{pEPP}, overproduces an extracytoplasmic molecular chaperone, PrsA . An increase in the total yield of SCA was observed . The third strain, WB600BHM{pEPP}, coproduces both intracellular and extracytoplasmic molecular chaperones . This led to a further reduction in inclusion body formation and a 2.5-fold increase in the secretory production yield . SCA fragments secreted by this strain were biologically active and showed affinity to digoxin comparable to the affinity of those secreted by strains without overproduction of molecular chaperones . Interestingly, accumulation of a pool of periplasmic SCA was observed in the PrsA-overproducing strains . This pool is suggested to represent the secreted folding intermediates in the process of achieving their final configuration.

J Bacteriol, 1998 Jun, 180(11), 2817 - 21
Paradoxical enhancement of the activity of a bacterial multidrug transporter caused by substitutions of a conserved residue; Klyachko KA et al.; Substitution of threonine or serine for the evolutionary conserved intramembrane proline P347 of the Bacillus subtilis multidrug transporter Bmr significantly increases the toxin-effluxing activity of Bmr without affecting its abundance in the cell . In cocultivation experiments, we demonstrate that although the mutant T347 Bmr is advantageous to cells growing in the presence of a toxin, the wild-type P347 Bmr is advantageous under the conditions of nutritional limitation . This may explain why Bmr has evolved the way it did, that is, with proline at position 347 . These observations provide a basis for speculating that the evolution of Bmr has been determined by its presently unidentified natural function rather than by its ability to expel diverse toxins from the cell.

J Bacteriol, 1998 May, 180(10), 2694 - 700
In vitro and in vivo oxidation of methionine residues in small, acid-soluble spore proteins from Bacillus species; Hayes CS et al.; Methionine residues in alpha/beta-type small, acid-soluble spore proteins (SASP) of Bacillus species were readily oxidized to methionine sulfoxide in vitro by t-butyl hydroperoxide (tBHP) or hydrogen peroxide (H2O2) . These oxidized alpha/beta-type SASP no longer bound to DNA effectively, but DNA binding protected alpha/beta-type SASP against methionine oxidation by peroxides in vitro . Incubation of an oxidized alpha/beta-type SASP with peptidyl methionine sulfoxide reductase (MsrA), which can reduce methionine sulfoxide residues back to methionine, restored the alpha/beta-type SASP's ability to bind to DNA . Both tBHP and H2O2 caused some oxidation of the two methionine residues of an alpha/beta-type SASP (SspC) in spores of Bacillus subtilis, although one methionine which is highly conserved in alpha/beta-type SASP was only oxidized to a small degree . However, much more methionine sulfoxide was generated by peroxide treatment of spores carrying a mutant form of SspC which has a lower affinity for DNA . MsrA activity was present in wild-type B . subtilis spores . However, msrA mutant spores were no more sensitive to H2O2 than were wild-type spores . The major mechanism operating for dealing with oxidative damage to alpha/beta-type SASP in spores is DNA binding, which protects the protein's methionine residues from oxidation both in vitro and in vivo . This may be important in vivo since alpha/beta-type SASP containing oxidized methionine residues no longer bind DNA well and alpha/beta-type SASP-DNA binding is essential for long-term spore survival.

Genes Dev, 1998 May 1, 12(9), 1371 - 80
Prespore-specific gene expression in Bacillus subtilis is driven by sequestration of SpoIIE phosphatase to the prespore side of the asymmetric septum; Wu LJ et al.; The spoIIE gene is essential for the compartment-specific activation of transcription factor sigmaF during sporulation in Bacillus subtilis . SpoIIE is a membrane protein that is targeted to the potential sites of asymmetric septation near each pole of the sporulating cell . The cytoplasmic carboxy-terminal domain of SpoIIE contains a serine phosphatase that triggers the release of sigmaF in the prespore compartment after septation . To understand how septum-located SpoIIE is activated selectively in the prespore, we examined the distribution of a SpoIIE-GFP fusion protein . We show that the polar bands of SpoIIE protein actually form sequentially and that the most prominent band develops at the pole where the prespore forms . We also show that the protein is sequestered to the prespore side of the asymmetric septum . Sequestration of SpoIIE into the prespore compartment provides a mechanism that could explain the cell specificity of sigmaF activation.

Proc Natl Acad Sci U S A, 1998 Apr 28, 95(9), 5305 - 10
DNA strand separation during activation of a developmental promoter by the Bacillus subtilis response regulator Spo0A; Rowe-Magnus DA et al.; Spo0A is the central regulator of commitment to sporulation in Bacillus subtilis . Spo0A is a member of the response regulator family of proteins and both represses and stimulates transcription from promoters when activated . In vivo Spo0A activation takes place by phosphorylation and in vitro activation can be accomplished by phosphorylation or removal of the N-terminal domain of the protein . We have examined the mechanism of Spo0A stimulation of transcription from the promoter of the spoIIG operon . This operon encodes one of the first compartment specific sigma factors whose appearance regulates sporulation development . When activated Spo0A was incubated with RNA polymerase and a DNA fragment containing the spoIIG promoter, bases between -13 and -3, relative to the start site of transcription, were denatured . Addition of activated Spo0A or RNA polymerase alone did not induce denaturation . Heteroduplex templates that contained the nontemplate sequence of the wild-type promoter on both strands between positions -3 and -13 were efficiently transcribed without activated Spo0A . These data suggest that DNA strand separation is a two-step process and that the activation of Spo0A creates a form that interacts with the polymerase to induce the first of the two steps.

Proc Natl Acad Sci U S A, 1998 Apr 28, 95(9), 5067 - 71
Solution structure of SpoIIAA, a phosphorylatable component of the system that regulates transcription factor sigmaF of Bacillus subtilis; Kovacs H et al.; The establishment of differential gene expression in sporulating Bacillus subtilis involves four protein components, one of which, SpoIIAA, undergoes phosphorylation and dephosphorylation . We have used NMR spectroscopy to determine the solution structure of the nonphosphorylated form of SpoIIAA . The structure shows a fold consisting of a four-stranded beta-sheet and four alpha-helices . Knowledge of the structure helps to account for the phenotype of several strains of B . subtilis that carry known spoIIAA mutations and should facilitate investigations of the conformational consequences of phosphorylation.

J Mol Biol, 1998 Mar 27, 277(2), 393 - 407
Crystal structure of a catalytic-site mutant alpha-amylase from Bacillus subtilis complexed with maltopentaose; Fujimoto Z et al.; The X-ray crystal structure of a catalytic-site mutant EQ208 {Glu208-->Gln} of alpha-amylase from Bacillus subtilis cocrystallized with maltopentaose (G5) and acarbose has been determined by multiple isomorphous replacement at 2.5 A resolution . Restrained crystallographic refinement has resulted in an R-factor of 19.8% in the 7.0 to 2.5 A resolution range . EQ208 consists of three domains containing a (beta/alpha)8-barrel as observed in other alpha-amylases . Clear connected density corresponding to a pentasaccharide was observed, which was considered as the G5 molecule based on the high affinity of EQ208 for G5 that could replace pre-bound acarbose or a possible transglycosylation product of acarbose . The conformation around the third alpha-(1,4)-glucosidic bond makes a sharp turn, allowing the substrate to fit into the L-shaped cleft . Aromatic residues build the walls of the substrate binding cleft and leucine residues form the inner curvature of the cleft . The amide nitrogen of Gln208 forms a hydrogen bond with the glucosidic oxygen in the scissile bond between Glc3 and Glc4 (Glc1 is the non-reducing end glucose residue of the substrate) . This hydrogen-bonding manner may correspond to that of the protonated state of Glu208 in the initial kinetic complex between wild-type enzyme and substrate . The amide oxygen of Gln208 is anchored by two hydrogen bonds with Ala177 and a water molecule, assisting to make the amide proton point precisely to the place of the catalytic attack . The carboxyl oxygen atoms of the other catalytic-site residues Asp176 and Asp269 form hydrogen bonds with the oxygen atoms of Glc3 . The carboxyl group of Asp176 has non-bonded contacts to the anomeric carbon atom and to the endocyclic oxygen atom of Glc3 . These results suggest that Glu208 acts as a general acid and Asp176 as a general base . Glc3 forms seven hydrogen bonds with the surrounding protein groups and a stacking interaction with Tyr62, which is consistent with the fact that Glc3 has the lowest mean thermal factor of 13.2 A2 among the five sugar residues . Three calcium ions are found, one of which is positioned near the substrate binding site as found in other alpha-amylases and could contribute to stabilization of the structure of the active site .

Microbiology, 1998 May, 144 ( Pt 5), 1443 - 50
Comparison of PhoP binding to the tuaA promoter with PhoP binding to other Pho-regulon promoters establishes a Bacillus subtilis Pho core binding site; Liu W et al.; The phosphate-deficiency response in Bacillus subtilis is regulated by PhoP and PhoR, a pair of two-component regulatory proteins . PhoR is a histidine kinase and PhoP is a response regulator . Genetic evidence indicates that the Pho-regulon genes, which are induced or repressed under phosphate starvation conditions, are regulated by PhoP and PhoR at the transcriptional level . It has previously been shown that PhoP binds to four Pho-regulon promoters in both unphosphorylated and phosphorylated forms . This study demonstrates that another Pho-regulon gene promoter, the tuaA promoter preceding the operon which is responsible for cell wall teichuronic acid synthesis, is also transcriptionally regulated and is bound by PhoP . The binding affinity for phosphorylated PhoP was about 10-fold higher than that for unphosphorylated PhoP . Both unphosphorylated and phosphorylated PhoP bound upstream of the -20 region in the tuaA promoter . By aligning the PhoP-binding sites within the Pho-regulon promoters, a consensus core PhoP-binding region composed of four TT(A/T)ACA direct repeats, each separated by 5 +/- 2 non-conserved nucleotides was identified . PhoP, phosphorylated or unphosphorylated, binds to such a sequence in all Pho-regulon promoters studied . Phosphorylated PhoP binds to the core binding region with high affinity and to additional regions surrounding this region with similar or lower affinity.

Microbiology, 1998 May, 144 ( Pt 5), 1263 - 70
Characterization of plasmid pAW63, a second self-transmissible plasmid in Bacillus thuringiensis subsp . kurstaki HD73; Wilcks A et al.; Bacillus thuringiensis subspecies kurstaki HD73, toxic for lepidopteran larvae, contains two large self-transmissible plasmids of approximately 75 kb, pHT73 and pAW63 . The conjugative plasmid pHT73 has been studied extensively and has been shown to harbour the toxin gene cry1Ac, the transposon Tn4430 and several insertion sequences . In this study it was demonstrated that the minor plasmid pAW63 is also self-transmissible and about 10-30 times more efficient in mobilizing plasmid pBC16 . To facilitate direct selection for pAW63 transfer, the plasmid was tagged with the tetracycline resistance transposon Tn5401 and in intraspecies matings it was found that after 2 h, all recipients had acquired a copy of the plasmid . Mating experiments demonstrated that pAW63 could be transferred to Bacillus thuringiensis subsp . israelensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis and Bacillus sphaericus, and that the conjugative functions were expressed in these hosts . Hybridization studies showed that the replicons of pAW63 and pHT73 were distinct from one another . Sequences homologous to transposon Tn4430 and several insertion sequences were, however, shown to reside on both plasmids.

Gene, 1998 Jun 8, 212(2), 179 - 88
Characterization of yhcN, a new forespore-specific gene of Bacillus subtilis; Bagyan I et al.; A new Bacillus subtilis sporulation-specific gene, yhcN, has been identified, the expression of which is dependent on the forespore-specific sigma factor sigmaG and to a much lesser extent on sigmaF . A translational yhcN-lacZ fusion is expressed at a very high level in the forespore, and the protein encoded by yhcN was detected in the inner spore membrane . A yhcN mutant sporulates normally and yhcN spores have identical resistance properties to wild-type spores . However, the outgrowth of yhcN spores is slower than that of wild-type spores.

Nucleic Acids Res, 1998 Jun 15, 26(12), 2941 - 7
Combining diverse evidence for gene recognition in completely sequenced bacterial genomes; Frishman D et al.; Analysis of a newly sequenced bacterial genome starts with identification of protein-coding genes . Functional assignment of proteins requires the exact knowledge of protein N-termini . We present a new program ORPHEUS that identifies candidate genes and accurately predicts gene starts . The analysis starts with a database similarity search and identification of reliable gene fragments . The latter are used to derive statistical characteristics of protein-coding regions and ribosome-binding sites and to predict the complete set of genes in the analyzed genome . In a test on Bacillus subtilis and Escherichia coli genomes, the program correctly identified 93.3% (resp . 96.3%) of experimentally annotated genes longer than 100 codons described in the PIR-International database, and for these genes 96.3% (83.9%) of starts were predicted exactly . Furthermore, 98.9% (99.1%) of genes longer than 100 codons annotated in GenBank were found, and 92.9% (75.7%) of predicted starts coincided with the feature table description . Finally, for the complete gene complements of B.subtilis and E.coli , including genes shorter than 100 codons, gene prediction accuracy was 88.9 and 87.1%, respectively, with 94.2 and 76.7% starts coinciding with the existing annotation.

Biochemistry, 1998 May 19, 37(20), 7103 - 12
Crystal structure of ErmC', an rRNA methyltransferase which mediates antibiotic resistance in bacteria; Bussiere DE et al.; The prevalent mechanism of bacterial resistance to erythromycin and other antibiotics of the macrolide-lincosamide-streptogramin B group (MLS) is methylation of the 23S rRNA component of the 50S subunit in bacterial ribosomes . This sequence-specific methylation is catalyzed by the Erm group of methyltransferases (MTases) . They are found in several strains of pathogenic bacteria, and ErmC is the most studied member of this class . The crystal structure of ErmC' (a naturally occurring variant of ErmC) from Bacillus subtilis has been determined at 3.0 A resolution by multiple anomalous diffraction phasing methods . The structure consists of a conserved alpha/beta amino-terminal domain which binds the cofactor S-adenosyl-l-methionine (SAM), followed by a smaller, alpha-helical RNA-recognition domain . The beta-sheet structure of the SAM-binding domain is well-conserved between the DNA, RNA, and small-molecule MTases . However, the C-terminal nucleic acid binding domain differs from the DNA-binding domains of other MTases and is unlike any previously reported RNA-recognition fold . A large, positively charged, concave surface is found at the interface of the N- and C-terminal domains and is proposed to form part of the protein-RNA interaction surface . ErmC' exhibits the conserved structural motifs previously found in the SAM-binding domain of other methyltransferases . A model of SAM bound to ErmC' is presented which is consistent with the motif conservation among MTases.

Appl Environ Microbiol, 1998 Jun, 64(6), 2079 - 85
Isolation, characterization, molecular gene cloning, and sequencing of a novel phytase from Bacillus subtilis; Kerovuo J et al.; The Bacillus subtilis strain VTT E-68013 was chosen for purification and characterization of its excreted phytase . Purified enzyme had maximal phytase activity at pH 7 and 55 degrees C . Isolated enzyme required calcium for its activity and/or stability and was readily inhibited by EDTA . The enzyme proved to be highly specific since, of the substrates tested, only phytate, ADP, and ATP were hydrolyzed (100, 75, and 50% of the relative activity, respectively) . The phytase gene (phyC) was cloned from the B . subtilis VTT E-68013 genomic library . The deduced amino acid sequence (383 residues) showed no homology to the sequences of other phytases nor to those of any known phosphatases . PhyC did not have the conserved RHGXRXP sequence found in the active site of known phytases, and therefore PhyC appears not to be a member of the phytase subfamily of histidine acid phosphatases but a novel enzyme having phytase activity . Due to its pH profile and optimum, it could be an interesting candidate for feed applications.

Protein Eng, 1998 Feb, 11(2), 109 - 17
Engineering subtilisin YaB: restriction of substrate specificity by the substitution of Gly124 and Gly151 with Ala; Mei HC et al.; The 3-D structure of subtilisin YaB was computer modelled using the structures of subtilisin BPN', subtilisin Carlsberg and thermitase as templates . Gly124 and Gly151 located on both sides of the waist of the S1 pocket were selected for site-directed mutagenesis based on the modelled structure . The mutated ale genes coding for the mutant subtilisin YaB were expressed in Bacillus subtilis DB104 . All of the G124 and G151 series of mutants exhibited an increase of relative catalytic activity for elastin-orcein against casein and myofibrillar proteins . The S1 substrate specificity of G124A, G124V and G151A mutants were assessed using various carbobenzoxy-amino acid-nitrophenyl esters and succinyl-Ala-Ala-(Pro or Val)-(Ala, Phe or Leu)-p-nitroanilide {AA(P/V) (A/F/L)} . While G124A and G124V mutants hydrolyzed only Ala and Gly esters, G151A mutant hydrolyzed Ala, Leu and Gly esters . The G124A and G124V mutants did not hydrolyze AAPF and AAPL . However, these two mutants hydrolyzed AAPA and AAVA with kcat/Km values approximately 3-10-fold higher than those of the wild-type enzyme . The G151A mutant did not hydrolyze AAPF, but hydrolyzed AAPL, AAPA and AAVA with kcat/Km values approximately 1-4-fold higher than those of the wild-type enzyme . These results clearly indicate that the S1 substrate specificity of G124A and G124V mutants was restricted to Ala and Gly, and G151A mutant to Ala, Gly and Leu.

J Biochem (Tokyo), 1998 Jun, 123(6), 1156 - 63
Properties of glutamate racemase from Bacillus subtilis IFO 3336 producing poly-gamma-glutamate; Ashiuchi M et al.; We found glutamate racemase activity in cell extracts of Bacillus subtilis IFO 3336, which abundantly produces poly-gamma-glutamate . The highest activity was obtained in the early stationary phase of growth . The racemase was purified to homogeneity . The enzyme was a monomer with a molecular mass of about 30 kDa and required no cofactor . It almost exclusively catalyzed the racemization of glutamate; other amino acids, including alanine and aspartate but not homocysteinesulfinate, were inactive as either substrates or inhibitors . Although the Vmax value of the enzyme for L-glutamate is 21-fold higher than that for D-glutamate, the Vmax/Km value for L-glutamate is almost equal to that for the D-enantiomer . The racemase gene, glr, was cloned into Escherichia coli cells and sequenced . The racemase was overproduced in the soluble fraction of the E . coli clone cells with the substitution of ATG for TTG, the initial codon of the glr gene . D-Amino acid aminotransferase activity was not detected in Bacillus subtilis IFO 3336 cells . B . subtilis CU741, a leuC7 derivative of B . subtilis 168, showed lower glutamate racemase activity and lower productivity of poly-gamma-glutamate than B . subtilis IFO 3336 . These results suggest that the glutamate racemase is mainly concerned in D-glutamate synthesis for poly-gamma-glutamate production in B . subtilis IFO 3336.

Gene, 1998 May 28, 212(1), 111 - 8
Bacillus licheniformis sigB operon encoding the general stress transcription factor sigma B; Brody MS et al.; The general stress response of the Gram-positive soil bacterium Bacillus subtilis is controlled by the sigma B transcription factor . sigma B activity is regulated by the newly discovered partner switching mechanism of signal transduction, which integrates the two different classes of challenges which posttranslationally activate sigma B: environmental stress and energy stress . Our investigation of a possible sigma B homologue in the related soil bacterium B . licheniformis had two goals . First, this study would contribute to understanding the distribution of the sigma B general stress system among Gram-positive bacteria . Second, a phylogenetic comparison of regulatory systems can supplement genetic and biochemical analysis by revealing conserved features that are critical for function . We report here that (1) B . licheniformis cells contain a protein that closely resembles B . subtilis sigma B in size and antigenic properties; (2) the level of this potential sigma B homologue rapidly increases following environmental or energy stress; and (3) the B . licheniformis genome encodes a homologue of the sigB general stress operon, including the sigma B structural gene and seven rsb regulatory genes . Based on these results, B . licheniformis possesses a general stress system likely regulated by two coupled partner switching modules that sense and integrate the two broad classes of activating stress signals.

Genes Dev, 1998 May 15, 12(10), 1539 - 50
The competence transcription factor of Bacillus subtilis recognizes short A/T-rich sequences arranged in a unique, flexible pattern along the DNA helix; Hamoen LW et al.; The development of genetic competence in Bacillus subtilis is regulated by a complex signal transduction cascade, which leads to the synthesis of the competence transcription factor (CTF) . Previous studies suggested that CTF is encoded by comK . ComK is required for the transcription of comK itself, as well as of the late competence genes encoding the DNA uptake machinery and of genes required for homologous recombination . Here, we used purified ComK to study its role in transcription and to determine the DNA recognition sequence for ComK . In vitro transcription from the comG promoter, which depends on ComK in vivo, was observed on the addition of purified ComK together with Bacillus subtilis RNA polymerase, proving that ComK is CTF . To determine the DNA sequences involved in ComK recognition, footprinting analysis was performed with promoter fragments of the CTF-dependent genes: comC, comE, comF, comG, comK, and addAB . The ComK binding sites determined by DNase I protection experiments were unusually long, with average lengths of approximately 65 bp, and displayed only weak sequence similarities . Hydroxy-radical footprinting, performed with the addAB promoter, revealed a unique arrangement of four short A/T-rich sequences . Gel retardation experiments indicated that four molecules of ComK bound the addAB promoter and the dyad symmetrical arrangement of the four A/T-rich sequences implied that ComK functions as a tetramer composed of two dimers each recognizing the motif AAAAN5TTTT . Comparable A/T-rich sequences were identified in all six DNase I footprints and could be used to predict ComK targets in the B . subtilis genome . On the basis of the variability in distance between the ComK-dimer binding sites, ComK-regulated promoters could be divided into three classes, demonstrating a remarkable flexibility in the binding of ComK.The pattern of hydroxy-radical protections suggested that ComK binds at one face of the DNA helix through the minor groove . This inference was strengthened by the observation that minor groove binding drugs inhibited the binding of ComK.

Biochem Cell Biol, 1997, 75(6), 709 - 15
Chemical modifications of Bacillus subtilis tryptophanyl-tRNA synthetase; Xue H et al.; A concerted conformational change in Bacillus subtilis tryptophanyl-tRNA synthetase (TrpRS) was evident from previous fluorescence on the quenching of the single Trp residue Trp-92 in the 4FTrp-AMP complexed enzyme . In this study, chemical modifications of the B . subtilis TrpRS were employed to further characterize this conformational change, with the single Trp residue serving as a marker for monitoring the change . Modifications of the enzyme by means of the Trp-specific agent N-bromosuccinimide (NBS) or 3-bromo-3-methyl-2-(2-nitrophenylmercapto)-3H-indole (BNPS-skatole) inactivated the enzyme in accord with the essential role of Trp-92, as identified previously by site-directed mutagenesis . ATP sensitized TrpRS toward inactivation by NBS and BNPS-skatole, which suggested a conformational change that resulted in greater accessibility of Trp-92 toward modifications . In contrast, the cognate tRNATrp substrate exerted a specific protective effect against inactivation by both of the reagents, indicating that the TrpRS-tRNATrp interaction reduces the accessibility of Trp-92 under our experimental conditions . By comparison, modification of sulfhydryl groups by means of iodoacetamide did not reduce TrpRS activity . Observations on Trp-specific modification and substrate protection effects are discussed in the context of the Bacillus stearothermophilus TrpRS crystal structure.

Jpn J Cancer Res, 1998 Mar, 89(3), 235 - 45
Monitoring of solar-UV exposure among schoolchildren in five Japanese cities using spore dosimeter and UV-coloring labels; Munakata N et al.; To monitor personal exposure to biologically effective solar-UV radiation, Bacillus subtilis spores on a membrane filter and UV-coloring labels were incorporated into a monitoring badge . The samples were covered with one of three types of filter sheet, dependent on the season, to reduce the amounts of exposure to measurable levels . Five fifth- or sixth-grade classes of primary schools, each consisting of 30-40 children, were chosen in northern (Sapporo), central (Tsukuba and Tokyo), and southern (Miyazaki and Naha) cities in Japan . In all four season, each child wore a badge on an upper arm for the entire waking hours, changing it daily, for a week . Upon collection of the badges, the survival of spores and the extent of coloration of the label were determined . The results were used to estimate the amount of daily exposure to biologically effective UV radiation, expressed as the value of spore inactivation dose . Unexpectedly, the average amounts of exposure were not directly correlated with the outdoor UV irradiance: in the two southern cities, despite high outdoor irradiance from spring to autumn, the average amounts of exposure were less than 3.1% of the average irradiance . Highly concentrated exposures occurred in two central cities on three days when extensive outdoor exercise took place . These results contradict the simple notion that children's exposure is in proportion to the outdoor UV irradiance, and support the view that the extent of solar-UV exposure is primarily determined by life-style rather than living location.

Bioorg Med Chem, 1998 Apr, 6(4), 409 - 15
Synthesis of 2,6-dioxo-(1H,3H)-9-N-ribitylpurine and 2,6-dioxo-(1H,3H)-8-aza-9-N-ribitylpurine as inhibitors of lumazine synthase and riboflavin synthase; Cushman M et al.; 2,6-Dioxo-(1H,3H)-9-N-ribitylpurine (6) and 2,6-dioxo-(1H,3H)-8-aza-9-N-ribitylpurine (7) have been synthesized and evaluated as inhibitors of lumazine synthase and riboflavin synthase . Reaction of 5-amino-6-ribitylaminouracil hydrochloride (8) with diethoxymethyl acetate (9) afforded the purine 6, while diazotization of 8 afforded the 8-aza purine 7 . Compounds 6 and 7 were evaluated against lumazine synthase of Bacillus subtilis and riboflavin synthase of Escherichia coli . Both 6 and 7 were better inhibitors of lumazine synthase than riboflavin synthase . The 8-azapurine 7 had a lower KI (0.33 and 0.39 mM) than the purine 6 (0.47 and 0.54 mM) when evaluated with lumazine synthase and riboflavin synthase, respectively.

Science, 1998 May 1, 280(5364), 752 - 5
Ribonuclease P protein structure: evolutionary origins in the translational apparatus; Stams T et al.; The crystal structure of Bacillus subtilis ribonuclease P protein is reported at 2.6 angstroms resolution . This protein binds to ribonuclease P RNA to form a ribonucleoprotein holoenzyme with optimal catalytic activity . Mutagenesis and biochemical data indicate that an unusual left-handed betaalphabeta crossover connection and a large central cleft in the protein form conserved RNA binding sites; a metal binding loop may comprise a third RNA binding site . The unusual topology is partly shared with ribosomal protein S5 and the ribosomal translocase elongation factor G, which suggests evolution from a common RNA binding ancestor in the primordial translational apparatus.

FEMS Microbiol Lett, 1998 May 1, 162(1), 93 - 6
The Bacillus subtilis glpD leader and antiterminator protein GlpP provide a target for glucose repression in Escherichia coli; Glatz E et al.; Expression of the Bacillus subtilis glpD gene which encodes glycerol-3-phosphate (G3P) dehydrogenase is regulated by the GlpP protein which, in the presence of G3P, causes antitermination of transcription of glpD . The glpD gene leader fused to lacZ was integrated into the chromosome of Escherichia coli deleted for the lac operon and carrying the B . subtilis glpP gene on a plasmid . beta-Galactosidase activity of this strain was increased by the addition of G3P . When G3P and glucose, glucose-6-phosphate or fructose-6-phosphate were added, beta-galactosidase activity was reduced showing that GlpP mediates catabolite repression of transcription from the glpD leader in the absence of any other B . subtilis protein.

Prog Nucleic Acid Res Mol Biol, 1998, 60, 29 - 46
Transcription activation and repression by interaction of a regulator with the alpha subunit of RNA polymerase: the model of phage phi 29 protein p4; Rojo F et al.; Regulatory protein p4, encoded by Bacillus subtilis phage phi 29, has proved to be a very useful model to analyze the molecular mechanisms of transcription regulation . Protein p4 modulates the transcription of phage phi 29 genome by activating the late A3 promoter (PA3) and simultaneously repressing the two main early promoters, A2b and A2c (or PA2b and PA2c) . This review describes in detail the regulatory mechanism leading to activation or repression, and discusses them in the context of the recent findings on the role of the RNA polymerase alpha subunit in transcription regulation . Activation of PA3 implies the p4-mediated stabilization of RNA polymerase at the promoter as a closed complex . Repression of the early A2b promoter occurs by binding of protein p4 to a site that partially overlaps the -35 consensus region of the promoter, therefore preventing the binding of RNA polymerase to the promoter . Repression of the A2c promoter, located 96 bp downstream from PA2b, occurs by a different mechanism that implies the simultaneous binding of protein p4 and RNA polymerase to the promoter in such a way that promoter clearance is inhibited . Interestingly, activation of PA3 and repression of PA2c require an interaction between protein p4 and RNA polymerase, and in both cases this interaction occurs between the same surface of protein p4 and the C-terminal domain of the alpha subunit of RNA polymerase, which provides new insights into how a protein can activate or repress transcription by subtle variations in the protein-DNA complexes formed at promoters.

Zhonghua Wai Ke Za Zhi, 1996 Aug, 34(8), 457 - 9
{A comparative study of ethylene oxide and ionizing radiation for sterilizing bone grafts}; Sang H et al.; To find a good way for sterilization and disinfection of bone grafts, we compared the sterilization capacity of gaseous ethylene oxide (EO) and cobalt-60 gamma radiation . The bone chips were contaminated with 10(7) bacteria per milliliter of Staphylococcus aureus ATCC 25923, Bacillus subtilis globigii 8017 and Bacillus cereus 4001, then sterilized with various doses of gaseous EO or cobalt- 60 gamma radiation . The sterilization effect of EO was more stronger and faster than that of 60Co gamma radiation . The application of moderate doses of EO for sterilizing particulate bone grafts was recommended.

Proteins, 1998 May 15, 31(3), 258 - 70
High-resolution solution structure of Bacillus subtilis IIAglc; Chen Y et al.; The high-resolution solution structure of the phosphocarrier protein IIAglc from Bacillus subtilis is determined using 3D and 4D heteronuclear NMR methods . B . subtilis IIAglc contains 162 amino acid residues and is one of the larger proteins for which high-resolution solution structure has been determined by NMR methods . The structures have been calculated from a total of 2,232 conformational constraints . Comparison with the X-ray crystal structure indicates that the overall fold is the same in solution and in crystalline environments, although some local structural differences are observed . These occur largely in turns and loops, and mostly correspond to regions with high-temperature factors in the crystal structure . The N-terminus of IIAglc is disordered in solution . The active site is located in a concave region of the protein surface . The histidine, which accepts the phosphoryl group (His 83), interacts with a neighboring histidine (His 68) and is surrounded by hydrophobic residues.

Mol Microbiol, 1998 Apr, 28(1), 119 - 30
Sites internal to the coding regions of phoA and pstS bind PhoP and are required for full promoter activity; Liu W et al.; Bacillus subtilis PhoP and PhoR, a pair of two-component regulatory proteins, regulate the phosphate starvation response . Here, we used two other pho regulon promoters, the phoA and pstS promoters, to examine the mechanism of PhoP-specific activation of its target promoters . Both gel shift and DNase I footprinting assays indicate that PhoP bound to the two promoters . Unphosphorylated PhoP bound only to the multiple TTAACA-like sequences upstream of these two promoters, while phosphorylated PhoP extended the binding region in both the 5' and the 3' direction and, additionally, protected sequences internal to the coding region of these two genes . The PhoP binding sites in the coding region were necessary for full induction from either promoter during phosphate starvation . Deletion of these sites eliminated approximately 75% and 45% of the induced promoter activity of the phoA and pstS promoters respectively . In vitro transcription assays using the phoA promoters with various 3' ends confirmed the requirement of the PhoP-P binding to the coding region for full promoter activity . The multiple TTAACA-like sequences in the phoA and pstS promoters were essential for promoter activity, and deletion of one or more of these sequences in either promoter eliminated the promoter activity . Two pairs of TTAACA-like sequences were required for efficient PhoP binding and were suggested to be one B . subtilis Pho box . Based on our data, we have proposed a model for activation of the phoA and the pstS promoter by PhoP.

Mol Microbiol, 1998 Apr, 28(1), 103 - 17
Circularization of Tn916 is required for expression of the transposon-encoded transfer functions: characterization of long tetracycline-inducible transcripts reading through the attachment site; Celli J et al.; A detailed transcriptional analysis of the conjugative transposon Tn916 was carried out, which revealed that transcription of the transfer functions requires excision of the element and dramatically increases in the presence of tetracycline . The key components of this regulatory system are two contiguous transposon-borne genes, orf7 and orf8, located downstream from and having the same polarity of transcription as the tetracycline resistance determinant tetM . The gene orf7 encodes a 140-amino-acid (aa) protein exhibiting limited homology with sigmaF of Bacillus subtilis, whereas orf8 encodes a 76-aa peptide that does not share any sequence homology with any cognate proteins . In the presence of tetracycline, an attenuation mechanism enables the transcription of orf7 and orf8 from the tetM promoter . The resulting increased synthesis of ORF7 and ORF8 activates the promoter Porf7 located upstream from orf7, which then directs the expression of the transfer functions in the transposon circular intermediate through long transcripts encompassing the attachment site . The apparently non-regulated promoter Pxis located upstream of the excisionase encoding gene xis could also participate in the expression of the tra genes . We also demonstrate that Tn916 carries another regulated promoter, Porf9, which directs transcription of a single gene, orf9, located downstream from and transcribed counterclockwise to tetM . This gene encodes a 117-aa putative transcriptional repressor, but the exact role of this protein in the mobility of Tn916, as well as the regulation of its expression, remains to be elucidated . Our results constitute the molecular basis for the observation that tetracycline increased the transfer frequency of this type of element.

Mikrobiologiia, 1998 Jan-Feb, 67(1), 55 - 60
{Intercellular matrix of Bacillus subtilis 271: polymeric composition and function}; Safronova IIu et al.; It was found that the intercellular matrix of Bacillus subtilis 271 mainly consists of alpha-1,4-glucan (65% of dry matter), branched at some C-3 residues of the polymeric chain, and poly-D-glutamic acid (19% of dry matter) . The kinematic viscosity of aqueous solutions of the native matrix was four times as great as that of deproteinized matrix . Increasing the pH of aqueous solutions of the native matrix from 4 to 6 or decreasing their temperature from 38.5 to 11.5 degrees C caused a three- and sevenfold increase in the viscosity of these solutions, respectively . The integrity of the matrix appears to be essential for maintaining the homeostasis of Bacillus subtilis populations.

Electrophoresis, 1998 Apr, 19(4), 515 - 27
Global analysis of genomic texts: the distribution of AGCT tetranucleotides in the Escherichia coli and Bacillus subtilis genomes predicts translational frameshifting and ribosomal hopping in several genes; Henaut A et al.; Present availability of the genomic text of bacteria allows assignment of biological known functions to many genes (typically, half of the genome's gene content) . It is now time to try and predict new unexpected functions, using inductive procedures that allow correlating the content of the genomic text to possible biological functions . We show here that analysis of the genomes of Escherichia coli and Bacillus subtilis for the distribution of AGCT motifs predicts that genes exist for which the mRNA molecule can be translated as several different proteins synthesized after ribosomal frameshifting or hopping . Among these genes we found that several coded for the same function in E . coli and B . subtilis . We analyzed in depth the situation of the infB gene (experimentally known to specify synthesis of several proteins differing in their translation starts), the aceF/pdhC gene, the eno gene, and the rplI gene . In addition, genes specific to E . coli were also studied: ompA, ompFand tolA (predicting epigenetic variation that could help escape infection by phages or colicins).

Curr Microbiol, 1998 May, 36(5), 259 - 65
Transcriptional regulation of the Prevotella ruminicola recA gene; Aminov RI et al.; The regulation of the recA gene expression in the obligately anaerobic rumen bacterium Prevotella ruminicola was investigated by monitoring the recA-specific transcript level . P . ruminicola recA forms a monocistronic unit, but no SOS-box sequences resembling those of Escherichia coli or Bacillus subtilis can be identified upstream of the recA coding region . At the same time, we observed a fivefold increase in the level of recA mRNA in response to DNA damaging agents, mitomycin C and methyl methanesulfonate, as well as under conditions of oxidative stress . No induction was detected when growth of P . ruminicola was arrested by shifting to acidic (pH 4.8) conditions . Primer extension experiment revealed the three very close transcriptional start sites for recA . The putative -10 and -35 RNA polymerase binding regions were proposed on the basis of transcript mapping . These regions bear very little similarity to the E . coli (sigma70) and B . subtilis (sigmaA) consensus sequences, as well as to the recognition sites of other minor sigma-factors . Transcript mapping experiments in E . coli expressing P . ruminicola recA confirmed that the transcription machineries of these two bacteria recognize completely different regulatory sequences on the template to initiate transcription . Preliminary DNase I footprinting analysis data revealed that the region of imperfect dyad symmetry (AATTATAATCAATTATAAAT) found between the putative -10 region and the translation initiation codon may serve as an SOS-box-like regulatory sequence in P . ruminicola . This sequence bears no similarity to the known SOS-box sequences and, in particular, to that of E . coli and other Gram-negative bacteria.

Proc Natl Acad Sci U S A, 1998 Apr 14, 95(8), 4652 - 7
Bipolar localization of Bacillus subtilis topoisomerase IV, an enzyme required for chromosome segregation; Huang WM et al.; In Bacillus subtilis, parE and parC were shown to be essential genes for the segregation of replicated chromosomes . Disruption of either one of these genes resulted in failure of the nucleoid to segregate . Purified ParE and ParC proteins reconstituted to form topoisomerase IV (topo IV), which was highly proficient for ATP-dependent superhelical DNA relaxation and decatenation of interlocked DNA networks . By immunofluorescence microscopy and by directly visualizing fluorescence by using green fluorescence protein fusions, we determined that ParC is localized at the poles of the bacteria in rapidly growing cultures . The bipolar localization of ParC required functional ParE, suggesting that topo IV activity is required for the localization . ParE was found to be distributed uniformly throughout the cell . On the other hand, fluorescence microscopy showed that the GyrA and GyrB subunits of gyrase were associated with the nucleoid . Our results provide a physiologic distinction between DNA gyrase and topo IV . The subcellular localization of topo IV provides physical evidence that it may be part of the bacterial segregation machinery.

J Biol Chem, 1998 Apr 10, 273(15), 8860 - 6
Studies of the cytochrome subunits of menaquinone:cytochrome c reductase (bc complex) of Bacillus subtilis . Evidence for the covalent attachment of heme to the cytochrome b subunit; Yu J et al.; The menaquinone:cytochrome c reductase, or bc complex, of Bacillus subtilis belongs to a third class of bc-type complex, distinct from the bc1 and b6f classes . Using a mutagenesis approach, we demonstrate that the cytochrome b (QcrB) and c (QcrC) subunits of the complex give rise to bands at 22 and 29 kDa, respectively, after denaturing electrophoresis; that both subunits are required for proper complex assembly and/or stability; and that both subunits retain one heme molecule under denaturing conditions . This unusual property of a b-type cytochrome was investigated further . We present evidence for the existence of a covalent linkage between the polypeptide and heme bH and of an important role for Cys43 in binding of heme bH . It is proposed that heme is also covalently attached to the cytochrome b subunit of b6f complexes of chloroplasts and cyanobacteria.

Appl Microbiol Biotechnol, 1998 Mar, 49(3), 321 - 7
Protein secretion in phosphate-limited cultures of Bacillus subtilis 168; Muller JP et al.; The secretion of proteins from Bacillus subtilis was studied under physiologically well-defined conditions in continuous cultures at a range of specific growth rates . The kinetics of secretion was analysed by using pulse-chase and immunoprecipitation techniques that allowed both processing and release to be monitored . Growth conditions were selected that were known to lead to significant changes in the anionic polymer composition of the cell wall . Under magnesium limitation only low levels of native proteins were released into the growth medium . In contrast, much higher amounts of released protein were observed under phosphate limitation . Although synthesis of native secretory proteins appeared to be highly regulated, only minor changes in the secretion of heterologous proteins were detected . Comparable kinetics of protein release of cells grown under different conditions indicated similar cell wall permeabilities . The large changes in the amounts of released proteins were not reflected in the production of chaperones and components required fro protein secretion . The data suggest that the capacity of the secretion machinery is not a major limiting step in the export of native secretory proteins.

Microbiology, 1998 Apr, 144 ( Pt 4), 885 - 93
The N-acetylmuramoyl-L-alanine amidase encoded by the Bacillus subtilis 168 prophage SP beta; Regamey A et al.; Heat shock of Bacillus subtilis CU1147, a strain lysogenic for SP beta c2, a prophage with a thermosensitive repressor, results in phage induction and subsequent cell lysis . Cloning in Escherichia coli and sequencing of a DNA fragment of prophage SP beta led to the identification of blyA, the gene encoding a 367 amino acid polypeptide with a molecular mass of 39.6 kDa . Purified BlyA obtained from the E . coli clone exhibited an N-acetylmuramoyl-L-alanine amidase activity . Insertional mutagenesis confirmed that the latter enzyme was associated with SP beta-phage-mediated cell lysis . Analysis of the neighbouring sequence suggested that the two ORFs immediately downstream of blyA and belonging to the same operon encode polypeptides which may be involved in the release of the endolysin . The presence on the chromosomes of B . subtilis or related Bacillus spp . of other, similar genes, and their possible relationship, is discussed.

Microbiology, 1998 Apr, 144 ( Pt 4), 877 - 84
A 35.7 kb DNA fragment from the Bacillus subtilis chromosome containing a putative 12.3 kb operon involved in hexuronate catabolism and a perfectly symmetrical hypothetical catabolite-responsive element; Rivolta C et al.; The Bacillus subtilis strain 168 chromosomal region extending from 109 degrees to 112 degrees has been sequenced . Among the 35 ORFs identified, cotT and rapA were the only genes that had been previously mapped and sequenced . Out of ten ORFs belonging to a single putative transcription unit, seven are probably involved in hexuronate catabolism . Their sequences are homologous to Escherichia coli genes exuT, uidB, uxaA, uxaB, uxaC, uxuA and uxuB, which are all required for the uptake of free D-glucuronate, D-galacturonate and beta-glucuronide, and their transformation into glyceraldehyde 3-phosphate and pyruvate via 2-keto-3-deoxygluconate . The remaining three ORFs encode two dehydrogenases and a transcriptional regulator . The operon is preceded by a putative catabolite-responsive element (CRE), located between a hypothetical promoter and the RBS of the first gene . This element, the longest and the only so far described that is fully symmetrical, consists of a 26 bp palindrome matching the theoretical B . subtilis CRE sequence . The remaining predicted amino acid sequences that share homologies with other proteins comprise: a cytochrome P-450, a glycosyltransferase, an ATP-binding cassette transporter, a protein similar to the formate dehydrogenase alpha-subunit (FdhA), protein similar to NADH dehydrogenases, and three homologues of polypeptides that have undefined functions.

Microbiology, 1998 Apr, 144 ( Pt 4), 859 - 75
The 172 kb prkA-addAB region from 83 degrees to 97 degrees of the Bacillus subtilis chromosome contains several dysfunctional genes, the glyB marker, many genes encoding transporter proteins, and the ubiquitous hit gene; Noback MA et al.; A 171812 bp nucleotide sequence between prkA and addAB (83 degrees to 97 degrees) on the genetic map of the Bacillus subtilis 168 chromosome was determined and analysed . An accurate physical/genetic map of this previously poorly described chromosomal region was constructed . One hundred and seventy open reading frames (ORFs) were identified on the DNA fragment . These include the previously described genes cspB, glpPFKD, spoVR, phoAIV, papQ, citRA, sspB, prsA, hpr, pbpF, hemEHY, aprE, comK and addAB . ORF yhaF in this region corresponds to the glyB marker . Among the striking features of this region are: an abundance of genes encoding (putative) transporter proteins, several dysfunctional genes, the ubiquitous hit gene, and five multidrug-resistance-like genes . These analyses have also revealed the existence of numerous paralogues of ORFs in this region: about two-thirds of the putative genes seem to have at least one paralogue in the B . subtilis genome.

J Bacteriol, 1998 May, 180(9), 2285 - 91
Involvement of superoxide dismutase in spore coat assembly in Bacillus subtilis; Henriques AO et al.; Endospores of Bacillus subtilis are enclosed in a proteinaceous coat which can be differentiated into a thick, striated outer layer and a thinner, lamellar inner layer . We found that the N-terminal sequence of a 25-kDa protein present in a preparation of spore coat proteins matched that of the Mn-dependent superoxide dismutase (SOD) encoded by the sod4 locus . sod4 is transcribed throughout the growth and sporulation of a wild-type strain and is responsible for the SOD activity detected in total cell extracts prepared from B . subtilis . Disruption of the sod4 locus produced a mutant that lacked any detectable SOD activity during vegetative growth and sporulation . The sodA mutant was not impaired in the ability to form heat- or lysozyme-resistant spores . However, examination of the coat layers of sodA mutant spores revealed increased extractability of the tyrosine-rich outer coat protein CotG . We showed that this condition was not accompanied by augmented transcription of the cotG gene in sporulating cells of the sodA mutant . We conclude that SodA is required for the assembly of CotG into the insoluble matrix of the spore and suggest that CotG is covalently cross-linked into the insoluble matrix by an oxidative reaction dependent on SodA . Ultrastructural analysis revealed that the inner coat formed by a sodA mutant was incomplete . Moreover, the outer coat lacked the characteristic striated appearance of wild-type spores, a pattern that was accentuated in a cotG mutant . These observations suggest that the SodA-dependent formation of the insoluble matrix containing CotG is largely responsible for the striated appearance of this coat layer.

Oral Microbiol Immunol, 1997 Dec, 12(6), 372 - 6
An inexpensive solid medium for obtaining colony-forming units of oral spirochetes; Chan EC et al.; A method for the enumeration of colony-forming units of oral anaerobic spirochetes in new oral spirochete agarose (NOS-A) medium was described recently . However, the high cost of agarose limits the extent to which large assays can be carried out . Accordingly, a search for an inexpensive gelling agent that remains molten at 37 degrees C and gels at 25 degrees C was undertaken . Varying amounts of Noble agar or Bacto agar (0.5 to 1.5%, w/v) were mixed with varying amounts of gelatin (0.5 to 1.0%, w/v) in NOS medium . NOS medium containing 0.5% gelatin-0.5% Noble agar (NOS-GN) or 0.5% gelatin-0.5% Bacto agar (NOS-GB) met the above criteria . NOS-GN and NOS-GB media yielded higher colony-forming units with Treponema denticola than NOS-A medium in that order . However, all three media, NOS-GN, NOS-GB and NOS-A, performed equally well in the recovery of viable counts of T . vincentii . The NOS-GN medium was not liquefied by subgingival bacteria or two gelatinase-producing species of bacteria, Bacillus subtilis and Staphylococcus aureus . Thus NOS-GN medium is the recommended medium both in cost and performance for obtaining colony counts of spirochetes.

J Struct Biol, 1998 Jan, 121(1), 53 - 60
Evidence for local 32 symmetry in homotrimeric riboflavin synthase of Escherichia coli; Meining W et al.; Riboflavin synthase is a trimer of identical 23-kDa subunits . The primary structure is characterized by considerable similarity of the C-terminal and N-terminal parts . Recombinant riboflavin synthase of Escherichia coli and Bacillus subtilis was crystallized by the vapor diffusion method . Crystals of E . coli riboflavin synthase belong to the orthorhombic system, space group P2(1)2(1)2(1), with unit cell dimensions a = 53.2 A, b = 117.6 A, c = 150.9 A, alpha = beta = gamma = 90 degrees . They diffract to better than 3.3 A resolution and have presumably one trimer in the asymmetric unit . The self rotation function indicates local 32 symmetry . Twofold local symmetry is an unexpected result in a trimeric protein . In conjunction with primary structure arguments and mechanistic considerations, we propose that the protein is a pseudohexamer where each of the peptide subunits fold into two topologically similar domains.

J Bacteriol, 1998 May, 180(9), 2574 - 8
Identification and enzymatic characterization of the maltose-inducible alpha-glucosidase MalL (sucrase-isomaltase-maltase) of Bacillus subtilis; Schonert S et al.; A gene coding for a putative alpha-glucosidase has been identified in the open reading frame yvdL (now termed malL), which was sequenced as part of the Bacillus subtilis genome project . The enzyme was overproduced in Escherichia coli and purified . Further analyses indicate that MalL is a specific oligo-1,4-1,6-alpha-glucosidase (sucrase-maltase-isomaltase) . MalL expression in B . subtilis requires maltose induction and is subject to carbon catabolite repression by glucose and fructose . Insertional mutagenesis of malL resulted in a complete inactivation of the maltose-inducible alpha-glucosidase activity in crude protein extracts and a Mal- phenotype.

J Bacteriol, 1998 May, 180(9), 2434 - 41
The prosequence of pro-sigmaK promotes membrane association and inhibits RNA polymerase core binding; Zhang B et al.; Pro-sigmaK is the inactive precursor of sigmaK, a mother cell-specific sigma factor responsible for the transcription of late sporulation genes of Bacillus subtilis . Upon subcellular fractionation, the majority of the pro-sigmaK was present in the membrane fraction . The rest of the pro-sigmaK was in a large complex that did not contain RNA polymerase core subunits . In contrast, the majority of the sigmaK was associated with core RNA polymerase . Virtually identical fractionation properties were observed when pro-sigmaE was analyzed . Pro-sigmaK was completely solubilized from the membrane fraction and the large complex by Triton X-100 and was partially solubilized from the membrane fraction by NaCl and KSCN . The membrane association of pro-sigmaK did not require spoIVF gene products, which appear to be located in the mother cell membrane that surrounds the forespore, and govern pro-sigmaK processing in the mother cell . Furthermore, pro-sigmaK associated with the membrane when overproduced in vegetative cells . Overproduction of pro-sigmaK in sporulating cells resulted in more pro-sigmaK in the membrane fraction . In agreement with the results of cell fractionation experiments, immunofluorescence microscopy showed that pro-sigmaK was localized to the mother cell membranes that surround the mother cell and the forespore in sporulating wild-type cells and mutant cells that do not process pro-sigmaK . Treatment of extracts with 0.6 M KCl appeared to free most of the pro-sigmaK and sigmaK from other cell constituents . After salt removal, sigmaK, but not pro-sigmaK, reassociated with exogenous core RNA polymerase to form holoenzyme . These results suggest that the prosequence inhibits RNA polymerase core binding and targets pro-sigmaK to the membrane, where it may interact with the processing machinery.

J Bacteriol, 1998 May, 180(9), 2426 - 33
Activation of the proprotein transcription factor pro-sigmaE is associated with its progression through three patterns of subcellular localization during sporulation in Bacillus subtilis; Hofmeister A; The activity of the sporulation transcription factor sigmaE in Bacillus subtilis is governed by an intercellular signal transduction pathway that controls the conversion of the inactive proprotein pro-sigmaE to the mature and active form of the factor . Here I use immunofluorescence microscopy to show that the activation of the proprotein is associated with its progression through three patterns of subcellular localization . In the predivisional sporangium, pro-sigmaE was found to be associated with the cytoplasmic membrane . Next, at the stage of asymmetric division, pro-sigmaE accumulated at the sporulation septum . Finally, after processing, mature sigmaE was found to be distributed throughout the mother cell cytoplasm . The results of subcellular fractionation and sedimentation in density gradients of extracts prepared from postdivisional sporangia confirmed that pro-sigmaE was chiefly present in the membrane fraction and that sigmaE was predominantly cytoplasmic, findings that suggest that the pro-amino acid sequence is responsible for the sequestration of pro-sigmaE to the membrane . The results of chemical cross-linking experiments showed that pro-sigmaE was present in a complex with its putative processing protein, SpoIIGA, or with a protein that depended on SpoIIGA . The membrane association of pro-sigmaE was, however, independent of SpoIIGA and other proteins specific to B . subtilis . Likewise, accumulation of pro-sigmaE at the septum did not depend on its interaction with SpoIIGA . Sequestration of pro-sigmaE to the membrane might serve to facilitate its interaction with SpoIIGA and may be important for preventing its premature association with core RNA polymerase . The implications of these findings for the compartmentalization of sigmaE are discussed.

Appl Environ Microbiol, 1998 May 1, 64(5), 1958 - 62
Small, Acid-Soluble Spore Proteins of the alpha/beta Type Do Not Protect the DNA in Bacillus subtilis Spores against Base Alkylation
Setlow B, Tautvydas KJ, Setlow P.
Ethyl methanesulfonate (EMS) killed wild-type Bacillus subtilis spores as rapidly as spores lacking small, acid-soluble proteins (SASP) of the alpha/beta type (alpha-beta- spores), and 20% of the survivors had obvious mutations . A recA mutation increased the EMS sensitivity of wild-type and alpha-beta- spores similarly but reduced their mutagenesis; EMS treatment of dormant spores also resulted in the induction of RecA synthesis during spore germination . EMS generated similar levels of alkylated bases in wild-type and alpha-beta- spore DNAs, in purified DNA, or in DNA saturated with alpha/beta-type SASP . Ethylene oxide (EtO) also generated similar levels of base alkylation in wild-type and alpha-beta- spore DNAs . These data indicate that EMS and EtO kill spores at least in part by DNA damage but that alpha/beta-type SASP, which protect DNA against many types of damage, do not protect spore DNA from base alkylation.

Biosci Biotechnol Biochem, 1998 Mar, 62(3), 540 - 5
Suppression of the lethal effect of acidic-phospholipid deficiency in Escherichia coli by Bacillus subtilis chromosomal locus ypoP; Inoue K et al.; An acidic-phospholipid deficiency caused by the pgsA3 allele that encodes a defective phosphatidylglycerophosphate synthase in Escherichia coli is lethal . The only known mutations that suppress this lethality fully have been related to the major outer-membrane lipoprotein . We isolated a Bacillus subtilis chromosomal locus that suppresses the lethality when harbored in a low copy-number plasmid, without restoring the synthase activity or phospholipid composition to normal . The locus was first recognized to suppress the conditional lethality of E . coli YA5512 (pgsA3) that harbored an unidentified mutation(s), allowing its growth in LB medium but not in media of lower osmolarities . The locus was then found to suppress the lethality of pgsA3 in wild-type E . coli W3110 . This locus, named ypoP in the database, had 37% nucleotide identity with the E . coli mprA gene, but the amplification of mprA had no suppressive effect . Plasmid pPOP1 containing ypoP completely prevented the decrease in the amount of a porin protein, OmpF, in the outer membrane and also cell mucoidy caused by pgsA3 . The mechanisms underlying these unusual effects are discussed in relation to a putative stress signal(s) generated by the acidic-phospholipid deficiency.

Mol Microbiol, 1998 Mar, 27(6), 1157 - 69
A novel protein kinase that controls carbon catabolite repression in bacteria; Reizer J et al.; HPr(Ser) kinase is the sensor in a multicomponent phosphorelay system that controls catabolite repression, sugar transport and carbon metabolism in gram-positive bacteria . Unlike most other protein kinases, it recognizes the tertiary structure in its target protein, HPr, a phosphocarrier protein of the bacterial phosphotransferase system and a transcriptional cofactor controlling the phenomenon of catabolite repression . We have identified the gene (ptsK) encoding this serine/threonine protein kinase and characterized the purified protein product . Orthologues of PtsK have been identified only in bacteria . These proteins constitute a novel family unrelated to other previously characterized protein phosphorylating enzymes . The Bacillus subtilis kinase is shown to be allosterically activated by metabolites such as fructose 1,6-bisphosphate and inhibited by inorganic phosphate . In contrast to wild-type B . subtilis, the ptsK mutant is insensitive to transcriptional regulation by catabolite repression . The reported results advance our understanding of phosphorylation-dependent carbon control mechanisms in Gram-positive bacteria.

Biotechnol Appl Biochem, 1998 Apr, 27 ( Pt 2), 125 - 32
Rendering one autolysis site in Bacillus subtilis neutral protease resistant to cleavage reveals a new fission; Van den Burg B et al.; Autolytic degradation of the thermolysin-like proteinase of Bacillus subtilis (TLP-sub) is responsible for the irreversible inactivation of the enzyme at elevated temperatures . Previously we have reported five cleavage sites in TLP-sub {Van den Burg et al . (1990) Biochem . J . 272, 93-97} . In an attempt to render the enzyme less susceptible to autolytic breakdown, one of the fission sites, located between Leu-156 and Ile-157, was modified by replacing Ile-157, C-terminally located with respect to the fission site, by an Asp residue . Aspartic acid is less preferred at this position with respect to the substrate preference of TLP-sub . Modelling studies indicated that this mutation was unlikely to cause conformational changes in the enzyme . Although the 156-157 fission was not observed in the mutant enzyme, a new fission site, between Gly-148 and Val-149, was now observed.

Biotechnol Appl Biochem, 1998 Apr, 27 ( Pt 2), 117 - 24
Heterologous expression of human granzyme K in Bacillus subtilis and characterization of its hydrolytic activity in vitro; Babe LM et al.; Human granzyme K, a serine protease found in secretory granules of cytotoxic T-lymphocytes, was produced in its catalytically active form by recombinant technology using Bacillus subtilis as host . The enzyme displays 40-45% identity to other members of the human granzyme group, and its closest homologue (75% identity) is the rat tryptase RNK-tryp2 . The recombinant protein can be recovered in its mature form from the bacterial culture supernatant and purified by cation exchange chromatography . Initial characterization reveals a protein of approximately 28 kDa that is specifically labelled by {3H}di-isopropyl fluorophosphate . Measurements of Kcat/K(m) for single-residue thioester substrates show approximately a two-fold preference for a Lys versus Arg residue at Pl . No activity was observed on ester substrates with various other residues at the Pl position . Using oligopeptide substrates, the enzyme displays peptidolytic activity C-terminal to both Lys and Arg residues with comparable rates of hydrolysis . Likewise, substrate hydrolysis is blocked most efficiently by inhibitors that contain Lys or Arg at position Pl . The availability of the cloned enzyme will facilitate the analysis of biological roles for this novel granzyme, and differentiate its activity from that of other granzymes.

Mol Gen Genet, 1998 Mar, 257(5), 534 - 41
Unique organization of the dnaA region from Prochlorococcus marinus CCMP1375, a marine cyanobacterium; Richter S et al.; In order to study DNA replication control elements in cyanobacteria we cloned and sequenced the dnaA gene from the marine cyanobacterium Prochlorococcus marinus . The dnaA gene is ubiquitous among bacteria and encodes the DNA replication initiation factor DnaA . The deduced amino acid sequence of the P . marinus DnaA protein shows highest similarity to the DnaA protein from the freshwater cyanobacterium Synechocystis sp . PCC6803 . Using a solid-phase DNA binding assay we demonstrated that both cyanobacterial DnaA proteins specifically recognize chromosomal origins, oriC, of Escherichia coli and Bacillus subtilis in vitro . The genetic environment of dnaA is not conserved between the two cyanobacteria . Upstream of the P . marinus dnaA gene we identified a gene encoding a putative ATP-binding cassette (ABC) transport protein . The gor gene encoding glutathione reductase lies downstream of dnaA . Comparison of the genetic structure of dnaA regions from 15 representative bacteria shows that the pattern of genes flanking dnaA is not universally conserved among them.

J Bacteriol, 1998 Apr, 180(8), 2194 - 200
A Bacillus subtilis gene induced by cold shock encodes a membrane phospholipid desaturase; Aguilar PS et al.; Bacillus subtilis grown at 37 degrees C synthesizes saturated fatty acids with only traces of unsaturated fatty acids (UFAs) . However, when cultures growing at 37 degrees C are transferred to 20 degrees C, UFA synthesis is induced . We report the identification and characterization of the gene encoding the fatty acid desaturase of B . subtilis . This gene, called des, was isolated by complementation of Escherichia coli strains with mutations in either of two different genes of UFA synthesis . The des gene encodes a polypeptide of 352 amino acid residues containing the three conserved histidine cluster motifs and two putative membrane-spanning domains characteristic of the membrane-bound desaturases of plants and cyanobacteria . Expression of the des gene in E . coli resulted in desaturation of palmitic acid moieties of the membrane phospholipids to give the novel mono-UFA cis-5-hexadecenoic acid, indicating that the B . subtilis des gene product is a delta5 acyl-lipid desaturase . The des gene was disrupted, and the resulting null mutant strains were unable to synthesize UFAs upon a shift to low growth temperatures . The des null mutant strain grew as well as its congenic parent at 20 or 37 degrees C but showed severely reduced survival during stationary phase . Analysis of operon fusions in which the des promoter directed the synthesis of a lacZ reporter gene showed that des expression is repressed at 37 degrees C, but a shift of cultures from 37 to 20 degrees C resulted in a 10- to 15-fold increase in transcription . This is the first report of a membrane phospholipid desaturase in a nonphotosynthetic organism and the first direct evidence for cold induction of a desaturase.

Vet Res, 1998 Jan-Feb, 29(1), 47 - 58
In vivo studies on lysosubtilin . 2 . Efficacy for treatment of post-partum endometritis in cows; Biziulevichius GA et al.; Lysosubtilin is a broad-spectrum preparation of lytic enzymes from Bacillus subtilis designed for veterinary medicine . This study demonstrates its efficacy for the treatment of post-partum endometritis in cows . Prior to the determination of optimal therapeutic doses, samples taken from the uterus of sick animals were examined microbiologically . The examinations revealed a high incidence of polymicrobial infections (65.0%) caused by various mixtures of bacteria (both Gram-positive and Gram-negative) and fungi/yeasts . Dose-determination studies involved 160 cows with clinical signs of post-partum endometritis . For treatment both aqueous and oil-based formulations were tested and the optimal dose was found to be 2 x 10(6) U lysosubtilin dissolved in 100 mL of distilled water . When administered intrauterinarily twice a week until recovery this dose resulted in a 100% clinical recovery rate (versus 90%) and a statistically significant decrease (73 +/- 5 d), when compared with cows treated with neofur (92 +/- 9 d, P < 0.05) in the calving-to-conception interval . These findings were confirmed by results of field trials performed in four Former Soviet Union republics (Byelarus, Estonia, Lithuania, Russia) on 932 cows . Increases in clinical recovery (93.7 versus 80.2%, P < 0.05) and conception rates (64.4 versus 45.8%, P < 0.01) were found to be statistically significant when compared with cows treated with neofur or uterosan . We therefore conclude that lytic enzyme preparations are prospective antimicrobial drugs and when used to combat animal diseases they may serve as a possible alternative to common antibiotics.

J Bacteriol, 1998 Apr, 180(8), 2265 - 70
The Bacillus subtilis galE gene is essential in the presence of glucose and galactose; Krispin O et al.; Bacillus subtilis is unable to grow by consuming galactose because it is unable to transport it into the cell . The transcription of galE is not influenced by galactose but is repressed by glucose . Galactose is toxic for galE-negative bacteria because it results in elevated levels of metabolic intermediates . These negative effects are reduced in galK and galT mutants . Glucose is also toxic for galE-negative strains.

J Bacteriol, 1998 Apr, 180(8), 2201 - 11
The Bacillus subtilis DinR binding site: redefinition of the consensus sequence; Winterling KW et al.; Recently, the DinR protein was established as the cellular repressor of the SOS response in the bacterium Bacillus subtilis . It is believed that DinR functions as the repressor by binding to a consensus sequence located in the promoter region of each SOS gene . The binding site for DinR is believed to be synonymous with the formerly identified Cheo box, a region of 12 bp displaying dyad symmetry (GAAC-N4-GTTC) . Electrophoretic mobility shift assays revealed that highly purified DinR does bind to such sites located upstream of the dinA, dinB, dinC, and dinR genes . Furthermore, detailed mutational analysis of the B . subtilis recA operator indicates that some nucleotides are more important than others for maintaining efficient DinR binding . For example, nucleotide substitutions immediately 5' and 3' of the Cheo box as well as those in the N4 region appear to affect DinR binding . This data, combined with computational analyses of potential binding sites in other gram-positive organisms, yields a new consensus (DinR box) of 5'-CGAACRNRYGTTYC-3' . DNA footprint analysis of the B . subtilis dinR and recA DinR boxes revealed that the DinR box is centrally located within a DNA region of 31 bp that is protected from hydroxyl radical cleavage in the presence of DinR . Furthermore, while DinR is predominantly monomeric in solution, it apparently binds to the DinR box in a dimeric state.

J Bacteriol, 1998 Apr, 180(8), 2110 - 7
Lysis genes of the Bacillus subtilis defective prophage PBSX; Krogh S et al.; Four genes identified within the late operon of PBSX show characteristics expected of a host cell lysis system; they are xepA, encoding an exported protein; xhlA, encoding a putative membrane-associated protein; xhlB, encoding a putative holin; and xlyA, encoding a putative endolysin . In this work, we have assessed the contribution of each gene to host cell lysis by expressing the four genes in different combinations under the control of their natural promoter located on the chromosome of Bacillus subtilis 168 . The results show that xepA is unlikely to be involved in host cell lysis . Expression of both xhlA and xhlB is necessary to effect host cell lysis of B . subtilis . Expression of xhlB (encoding the putative holin) together with xlyA (encoding the endolysin) cannot effect cell lysis, indicating that the PBSX lysis system differs from those identified in the phages of gram-negative bacteria . Since host cell lysis can be achieved when xlyA is inactivated, it is probable that PBSX encodes a second endolysin activity which also uses XhlA and XhlB for export from the cell . The chromosome-based expression system developed in this study to investigate the functions of the PBSX lysis genes should be a valuable tool for the analysis of other host cell lysis systems and for expression and functional analysis of other lethal gene products in gram-positive bacteria.

J Bacteriol, 1998 Apr, 180(8), 2057 - 62
The katX gene, which codes for the catalase in spores of Bacillus subtilis, is a forespore-specific gene controlled by sigmaF, and KatX is essential for hydrogen peroxide resistance of the germinating spore; Bagyan I et al.; Previous work has shown that the katX gene encodes the major catalase in dormant spores of Bacillus subtilis but that this enzyme has no role in dormant spore resistance to hydrogen peroxide . Expression of a katX-lacZ fusion began at approximately h 2 of sporulation, and >75% of the katX-driven beta-galactosidase was packaged into the mature spore . A mutation in the gene coding for the sporulation-specific RNA polymerase sigma factor sigmaF abolished katX-lacZ expression, while mutations in genes encoding sigmaE, sigmaG, and sigmaK did not . Induction of sigmaF synthesis in vegetative cells also resulted in katX-lacZ expression, while induction of sigmaG expression did not; the katX-lacZ fusion was also not induced by hydrogen peroxide . Upstream of the in vivo katX transcription start site there are sequences with good homology to those upstream of known sigmaF-dependent start sites . These data indicate that katX is an additional member of the forespore-specific sigmaF regulon . A mutant in the katA gene, encoding the major catalase in growing cells, was sensitive to hydrogen peroxide during sporulation, while a katX mutant was not . However, outgrowth of katX spores, but not katA spores, was sensitive to hydrogen peroxide . Consequently, a major function for KatX is to protect germinating spores from hydrogen peroxide.

Structure, 1998 Mar 15, 6(3), 337 - 50
Adaptation of an enzyme to regulatory function: structure of Bacillus subtilis PyrR, a pyr RNA-binding attenuation protein and uracil phosphoribosyltransferase; Tomchick DR et al.; BACKGROUND: The expression of pyrimidine nucleotide biosynthetic (pyr) genes in Bacillus subtilis is regulated by transcriptional attenuation . The PyrR attenuation protein binds to specific sites in pyr mRNA, allowing the formation of downstream terminator structures . UMP and 5-phosphoribosyl-1-pyrophosphate (PRPP), a nucleotide metabolite, are co-regulators with PyrR . The smallest RNA shown to bind tightly to PyrR is a 28-30 nucleotide stem-loop that contains a purine-rich bulge and a putative-GNRA tetraloop . PyrR is also a uracil phosphoribosyltransferase (UPRTase), although the relationship between enzymatic activity and RNA recognition is unclear, and the UPRTase activity of PyrR is not physiologically significant in B . subtilis . Elucidating the role of PyrR structural motifs in UMP-dependent RNA binding is an important step towards understanding the mechanism of pyr transcriptional attenuation . RESULTS: The 1.6 A crystal structure of B . subtilis PyrR has been determined by multiwavelength anomalous diffraction, using a Sm co-crystal . As expected, the structure of PyrR is homologous to those proteins of the large type I PRTase structural family; it is most similar to hypoxanthine-guanine-xanthine PRTase (HGXPRTase) . The PyrR dimer differs from other PRTase dimers, suggesting it may have evolved specifically for RNA binding . A large, basic, surface at the dimer interface is an obvious RNA-binding site and uracil specificity is probably provided by hydrogen bonds from mainchain and sidechain atoms in the hood subdomain . These models of RNA and UMP binding are consistent with biological data . CONCLUSIONS: The B . subtilis protein PyrR has adapted the substrate- and product-binding capacities of a PRTase, probably an HGXPRTase, producing a new regulatory function in which the substrate and product are co-regulators of transcription termination . The structure is consistent with the idea that PyrR regulatory function is independent of catalytic activity, which is likely to be extremely low under physiological conditions.

J Mol Biol, 1998 Feb 27, 276(3), 591 - 602
Crystal structure of the IIB subunit of a fructose permease (IIBLev) from Bacillus subtilis; Schauder S et al.; The bacterial phosphoenolpyruvate-dependent phosphotransferase system (PTS) mediates both the uptake of carbohydrates across the cytoplasmic membrane and their phosphorylation . During this process, a phosphoryl group is transferred from phosphoenolpyruvate via the general PTS proteins enzyme I, HPr and the sugar-specific components IIA, IIB to the transported sugar . The crystal structure of the IIB subunit of a fructose transporter from Bacillus subtilis (IIBLev) was solved by MIRAS to a resolution of 2.9 A . IIBLev comprises 163 amino acid residues that are folded into an open, mainly parallel beta-sheet with helices packed on either face . The phosphorylation site (His15) is located on the first loop (1/A) at one of the topological switch-points of the fold . Despite different global folds, IIBLev and HPr have very similar active-site loop conformations with the active-site histidine residues located close to the N terminus of the first helix . This resemblance may be of functional importance, since both proteins exchange a phosphoryl group with the same IIA subunit . The structural basis of phosphoryl transfer from HPr to IIAMan to IIBMan was investigated by modeling of the respective transition state complexes using the known HPr and IIAMan structures and a homology model of IIBMan that was derived from the IIBLev structure . All three proteins contain a helix that appears to be suitable for stabilization of the phospho-histidine by dipole and H-bonding interactions . Smooth phosphoryl transfer from one N-cap position to the other appears feasible with a minimized transition state energy due to simultaneous interactions with the donor and the acceptor helix.

Enzyme Microb Technol, 1998 Apr, 22(5), 348 - 54
Expression of carboxymethylcellulase on the surface of Escherichia coli using Pseudomonas syringae ice nucleation protein; Jung HC et al.; Ice-nucleation protein (INP), an outer membrane protein from Pseudomonas syringae, is able to catalyze the ice crystal formation of supercooled water . It was exploited for anchoring of Bacillus subtilis carboxymethylcellulase (CMCase) on the surface of Escherichia coli . A surface anchoring vector, pGINP21M, was created that contains the multicloning sites including BamHI, SmaI and EcoRI at the end of the 3' flanking region encoding the C-terminus of INP instead of the stop codon for subcloning the foreign genes . The CMCase gene was in-frame subcloned for making INP-CMCase fusion proteins . The ability of this vector for directing the actual synthesis of INP-CMCase fusion proteins was confirmed by Western blotting analysis . CMCase targeted on the surface of cells was verified by measuring whole cell CMCase activity and ice-nucleation activity . CMCase activity was mainly detected on the cell surface whereas no enzyme activity was detected in the culture supernatant . Ice-nucleation activity was also maintained even if an INP-CMCase hybrid was made . This means that the fusion protein is functionally expressed and has its biological conformation on the surface . INP-CMCase fusion proteins were stable in the stationary phase . INP deleted of the repeating domain, thus producing no ice-nucleation activity, could also direct CMCase on the cell surface . This suggests that it has the secretion and targeting signal to the outer membrane.

J AOAC Int, 1998 Mar-Apr, 81(2), 398 - 402
Comparison of monolayer and bilayer plates used in antibiotic assay; Reamer RH et al.; Standard curves of 5 antibiotics were determined in an antibiotic assay using bilayer and monolayer agar plates and AOAC-specified test organisms and agar media . Micrococcus luteus ATCC 9341a and antibiotic medium No . 2 were used to prepare the penicillin G standard curve . The same organism and antibiotic medium No . 11 were used to prepare the erythromycin standard curve . Standard curves for streptomycin, tetracycline, and gentamicin were prepared, respectively, with antibiotic medium No . 5 and Bacillus subtilis ATCC 6633, antibiotic medium No . 8 and B . cereus ATCC 11778, and antibiotic medium No . 11 and Staphylococcus epidermidis ATCC 12228 . Assays of inhibition by meat fortified with penicillin, streptomycin, gentamicin, tetracycline, erythromycin also were performed on monolayer and bilayer plates . Differences in standard curves and inhibitory responses obtained with monolayer and bilayer plates were < 10% . Thus, monolayer plates are acceptable for use in analyses of meat and poultry for antibiotics residues, with savings in laboratory resources and time.

J Nat Prod, 1998 Mar, 61(3), 358 - 61
Four new bioactive lobane diterpenes of the soft coral Lobophytum pauciflorum from Mindoro, Philippines; Edrada RA et al.; The marine soft coral Lobophytum pauciflorum collected from Mindoro Island, Philippines, yielded four new lobane diterpene derivatives: the acetate congeners of epoxylobatrienol and lobatrienediol (2 and 7, respectively), a methoxyl congener of lobatetraene (10), and an oxepin congener of lobatrienetriol (11), and six known derivatives (1, 3-6, and 8) . The structures of the new compounds were unambiguously established on the basis of NMR spectroscopic (1H, 13C, COSY, 1H-detected direct, and long-range 13C-1H correlations) and mass spectrometric (EIMS) data . All of the compounds were active against the phytopathogenic fungus Cladosporium cucumerinum . Compound 1 was found to be active against the Gram-positive bacteria Bacillus subtilis and the yeast Saccharomyces cerevisiae . The isolated lobane diterpenes were also active in the brine shrimp lethality test . In the latter bioassay, compounds 8 and 10 were the most active congeners with LC50's of 0.64 and 4.18 micrograms/mL, respectively.

Appl Environ Microbiol, 1998 Apr, 64(4), 1344 - 9
Buffering capacity and membrane H+ conductance of neutrophilic and alkalophilic gram-positive bacteria; Rius N et al.; Buffering capacity and membrane H+ conductance were examined in three gram-positive bacteria, Staphylococcus aureus, Bacillus subtilis, and Bacillus alcalophilus . An acid pulse technique was used to measure both parameters . The buffering capacity and membrane H+ conductance of B . alcalophilus are influenced by the pH of the medium and the culture conditions . Suspensions of B . alcalophilus cells from both H . A . medium and L-malate medium cultures grown at pH 10.5 exhibited higher values for these parameters than cells grown at pH 8.5 . B . alcalophilus grown aerobically had a lower buffering capacity and a lower membrane conductance for protons than the neutrophilic bacteria S . aureus and B . subtilis . Fermenting cells exhibited significantly higher values for both variables than respiring cells.

Proc Natl Acad Sci U S A, 1998 Mar 17, 95(6), 3162 - 7
Negative regulation of the proteolytic activation of a developmental transcription factor in Bacillus subtilis; Resnekov O et al.; The sporulation transcription factor sigmaK of Bacillus subtilis is controlled by a signal transduction pathway that operates at the level of the proteolytic processing of the inactive precursor protein pro-sigmaK . The conversion of pro-sigmaK to sigmaK requires the putative processing enzyme SpoIVFB and is governed by the regulatory proteins SpoIVFA and BofA . We engineered vegetative cells to carry out processing of pro-sigmaK by inducing the synthesis of the proprotein, a modified form of the putative processing enzyme, and its two regulators during growth . The results showed that (i) modified SpoIVFB was the only sporulation protein necessary to achieve processing of pro-sigmaK; (ii) SpoIVFA stimulated processing, apparently by protecting the processing enzyme from degradation; (iii) BofA inhibited processing in a manner that did not involve degradation of SpoIVFB; and (iv) the inhibition of SpoIVFB by BofA was dependent on SpoIVFA . We conclude that BofA and SpoIVFA act synergistically and are the only two sporulation proteins needed to inhibit the function of SpoIVFB . Our results are consistent with the idea that activation of pro-sigmaK occurs by a reversal of the BofA/SpoIVFA-mediated inhibition of the processing enzyme.

EMBO J, 1998 Mar 2, 17(5), 1515 - 25
Comparative photocross-linking analysis of the tertiary structures of Escherichia coli and Bacillus subtilis RNase P RNAs; Chen JL et al.; Bacterial ribonuclease P contains a catalytic RNA subunit that cleaves precursor sequences from the 5' ends of pre-tRNAs . The RNase P RNAs from Bacillus subtilis and Escherichia coli each contain several unique secondary structural elements not present in the other . To understand better how these phylogenetically variable elements affect the global architecture of the ribozyme, photoaffinity cross-linking studies were carried out . Photolysis of photoagents attached at homologous sites in the two RNAs results in nearly identical cross-linking patterns, consistent with the homology of the RNAs and indicating that these RNAs contain a common, core tertiary structure . Distance constraints were used to derive tertiary structure models using a molecular mechanics-based modeling protocol . The resulting superimposition of large sets of equivalent models provides a low resolution (5-10 A) structure for each RNA . Comparison of these structure models shows that the conserved core helices occupy similar positions in space . Variably present helical elements that may play a role in global structural stability are found at the periphery of the core structure . The P5.1 and P15.1 helical elements, unique to the B.subtilis RNase P RNA, and the P6/16/17 helices, unique to the E.coli RNA, occupy similar positions in the structure models and, therefore, may have analogous structural function.

Mol Microbiol, 1998 Mar, 27(5), 1031 - 8
Transcription-repair coupling factor is involved in carbon catabolite repression of the Bacillus subtilis hut and gnt operons; Zalieckas JM et al.; A Bacillus subtilis mutant that partially relieves carbon catabolite repression (CCR) of the hut operon was isolated by transposon mutagenesis . Characterization of this mutant revealed that the transposon had inserted into the gene, mfd, that encodes transcription-repair coupling factor . The Mfd protein is known to promote strand-specific DNA repair by displacing RNA polymerase stalled at a nucleotide lesion and directing the (A)BC excinuclease to the DNA damage site . A set of transcriptional lacZ fusions was used to demonstrate that the mfd mutation relieves CCR of hut and gnt expression at the cis-acting cre sequences located downstream of the transcriptional start site but does not affect CCR at sites located at the promoters . CCR of the amyE and bglPH genes, which contain cre sequences that overlap their promoters, is not altered by the mfd mutation . These results support a model in which the Mfd protein displaces RNA polymerase stalled at downstream cre sites that function as transcriptional roadblocks and reveal a new role for Mfd in cellular physiology.

J Med Genet, 1998 Mar, 35(3), 244 - 7
Molecular basis of variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene; Frank J et al.; Variegate porphyria (VP) is an autosomal dominant disorder characterised by a partial defect in the activity of protoporphyrinogen oxidase (PPO), and has recently been genetically linked to the PPO gene on chromosome 1q22-23 (Z=6.62) . In this study, we identified a mutation in the PPO gene in a patient with VP and two unaffected family members . The mutation consisted of a previously unreported T to C transition in exon 13 of the PPO gene, resulting in the substitution of a polar serine by a non-polar proline (S450P) . This serine residue is evolutionarily highly conserved in man, mouse, and Bacillus subtilis, attesting to the importance of this residue . Interestingly, the gene for Gardner's syndrome (FAP) also segregates in this family, independently of the VP mutation . Gardner's syndrome or familial adenomatous polyposis (FAP) is also an autosomal dominantly inherited genodermatosis, and typically presents with colorectal cancer in early adult life secondary to extensive adenomatous polyps of the colon . The specific gene on chromosome 5 that is the site of the mutation in this disorder is known as APC (adenomatous polyposis coli), and the gene has been genetically linked to the region of 5q22.

Biochim Biophys Acta, 1998 Feb 17, 1382(2), 186 - 90
Thermostable glycerol kinase from Thermus flavus: cloning, sequencing, and expression of the enzyme gene; Huang HS et al.; The thermostable glycerol kinase (EC 2.7.1.30) gene from Thermus flavus was cloned and expressed in Escherichia coli DH5 alpha . An open reading frame of 1488 bp for the glycerol kinase gene (glpK) starting with an ATG methionine codon was found, which encodes a protein of 496 amino acid residues whose calculated molecular weight is 54,835 . The amino acid sequence of T . flavus glycerol kinase is 80.6% and 64.1% identical with those of Bacillus subtilis and E . coli . Transformants of E . coli DH5 alpha harboring plasmid pGYK12 with a 1505 bp chromosomal DNA fragment containing the T . flavus glycerol kinase gene showed about 23.8-fold higher glycerol kinase activity than T . flavus.

Microbiology, 1998 Jan, 144 ( Pt 1), 73 - 82
The role of autolysins during vegetative growth of Bacillus subtilis 168; Blackman SA et al.; A set of isogenic mutants of Bacillus subtilis 168, insertionally inactivated in the genes encoding a number of lytic enzymes and a sigma factor (sigma D, which controls the expression of a number of autolysins) was constructed . Phenotypic analysis of the mutants determined the individual and combined roles of the autolysins in vegetative growth . The major vegetative autolysins of B . subtilis, LytC (50 kDa amidase) and LytD (90 kDa glucosaminidase), were shown to have roles in cell separation, cell wall turnover, antibiotic-induced lysis and motility . LytC was also shown to have a role in general cell lysis induced by sodium azide . Renaturing SDS-PAGE of cell-wall-binding protein extracts of the mutant strains revealed the presence of a novel autolysin that was previously masked by LytC . This 49 kDa enzyme was shown to be sigma D-controlled and was identified as a candidate cell separation and cell wall turnover enzyme . A multiple mutant strain, lacking LytC, LytD and the 49 kDa enzyme, retained at least ten bands of autolytic activity . These may correspond to individual or proteolytically processed novel autolysins, the functions of which are unknown . The multiple mutant strains facilitate the study of these, and other lytic enzymes, to determine their cellular functions.

J Bacteriol, 1998 Apr, 180(7), 1869 - 77
Thioredoxin is an essential protein induced by multiple stresses in Bacillus subtilis; Scharf C et al.; Thioredoxin, a small, ubiquitous protein which participates in redox reactions through the reversible oxidation of its active center dithiol to a disulfide, is an essential protein in Bacillus subtilis . A variety of stresses, including heat or salt stress or ethanol treatment, strongly enhanced the synthesis of thioredoxin in B . subtilis . The stress induction of the monocistronic trxA gene encoding thioredoxin occurs at two promoters . The general stress sigma factor, sigmaB, was required for the initiation of transcription at the upstream site, S(B), and the promoter preceding the downstream start site, S(A), was presumably recognized by the vegetative sigma factor, sigmaA . In contrast to the heat-inducible, sigmaA-dependent promoters preceding the chaperone-encoding operons groESL and dnaK, no CIRCE (for controlling inverted repeat of chaperone expression) was present in the vicinity of the start site, S(A) . The induction patterns of the promoters differed, with the upstream promoter displaying the typical stress induction of sigmaB-dependent promoters . Transcription initiating at S(A), but not at S(B), was also induced after treatment with hydrogen peroxide or puromycin . Such a double control of stress induction at two different promoters seems to be typical of a subgroup of class III heat shock genes of B . subtilis, like clpC, and it either allows the cells to raise the level of the antioxidant thioredoxin after oxidative stress or allows stressed cells to accumulate thioredoxin . These increased levels of thioredoxin might help stressed B . subtilis cells to maintain the native and reduced state of cellular proteins.

J Bacteriol, 1998 Apr, 180(7), 1855 - 61
Characterization of a novel member of the DegS-DegU regulon affected by salt stress in Bacillus subtilis; Dartois V et al.; As a soil bacterium also found in estuarine and marine habitats, Bacillus subtilis has evolved various sensing and adaptation systems in order to face salt stress conditions . Among these regulatory mechanisms is the DegS-DegU signal transduction system, which was previously shown to be stimulated by high salt concentrations . A search for promoters regulated in response to salt stress led to the identification of wapA, encoding a wall-associated protein, which is strongly expressed at low salt concentrations and almost completely repressed in the presence of 0.7 M disodium succinate . Repression of wapA transcription by salt stress was shown to require the phosphorylated form of DegU . Moreover, DegU-mediated repression of wapA occurred only in high-salt medium . Alignment between the control region of wapA and other DegU-regulated promoters allowed the identification of a putative DegU ta