|








| |
Journal of Bacteriology, February 2003, p . 1391-1398, Vol . 185, No . 4
Subcellular Localization of a Small Sporulation Protein in Bacillus subtilis
Christiaan van Ooij and Richard Losick*
The Biological Laboratories, Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts 02138
Received 7 August 2002/
Accepted 19 September 2002
SpoVM is an unusually small (26-residue-long) protein that is produced in the mother cell chamber of the sporangium during the process of sporulation in Bacillus subtilis . We investigated the subcellular localization of SpoVM, which is believed to be an amphipathic
-helix, by using a fusion of the sporulation protein to the green fluorescence protein (GFP) . We found that SpoVM-GFP is recruited to the polar septum shortly after the sporangium undergoes asymmetric division and that the fusion protein localizes to the mother cell membrane that surrounds the forespore during the subsequent process of engulfment . We identified a patch of three residues near the N terminus of the proposed
-helix that is needed both for proper subcellular localization and for SpoVM function . We also identified a patch of residues on the opposite face of the helix and residues near both ends of the protein that are needed for SpoVM function but not for subcellular localization . Subcellular localization of SpoVM-GFP was found to require an unknown gene(s) under the control of the mother cell transcription factor
E . We propose that the N-terminal patch binds to an unknown anchoring protein that is produced under the control of
E and that other residues important in SpoVM function to recruit an unknown sporulation protein(s) to the mother cell membrane that surrounds the forespore . Our results provide evidence that SpoVM function depends on proper subcellular localization .
Subcellular localization is emerging as an important theme in understanding protein function in bacteria (11, 22) . Often, elucidation of the function of a protein depends on knowledge of its location within the cell . In this study, we investigated the relationship of function to location in the context of the sporulation protein SpoVM of Bacillus subtilis . SpoVM is remarkable for its small size and the essential role it plays in the process of spore formation (9, 21) . SpoVM, which is 26 residues in length, is believed to be an amphipathic
-helix whose charged surface mediates its interaction with the membrane (15) . We wondered whether SpoVM localizes to a particular membrane surface in the sporulating cell and, if so, whether this localization is important for its function in spore formation . In this study, we addressed these questions by using a fusion of the sporulation protein to the green fluorescent protein (GFP) .
Sporulation involves the formation of an asymmetrically positioned (polar) septum that divides the developing cell (the sporangium) into a small compartment called the forespore and a large compartment called the mother cell (2, 13, 14) . The compartments exhibit dissimilar programs of gene transcription that are set in motion by the transcription factors
F in the forespore and
E in the mother cell . The forespore and mother cell initially lie adjacent to each other in the sporangium, but later in development, the forespore is taken up by, and wholly incorporated into, the mother cell in a phagocytic-like process called engulfment . During engulfment, the membrane on the mother cell face of the polar septum migrates around the membrane surrounding the forespore, eventually pinching the forespore off as a free protoplast within the mother cell cytoplasm . In subsequent morphogenesis, a thick layer of peptidoglycan is produced in the space between the forespore membrane and the mother cell membrane that surrounds the forespore (also known as the outer forespore membrane) and a multilayer protein shell known as the coat is deposited around the developing spore (the forespore) from within the mother cell . Eventually, the fully ripened spore is released from the sporangium by lysis of the mother cell .
SpoVM is produced in the mother cell compartment of the sporangium under the control of mother cell-specific transcription factor
E (9) . SpoVM mutants are severely blocked in spore morphogenesis, being unable to produce a normal cortex and having only a thin, loosely attached coat (9) . Here we report that SpoVM-GFP localizes to the mother cell membrane that surrounds the forespore . Evidently, this localization is important for function because alanine substitution mutants in which SpoVM-GFP is not restricted to the outer forespore membrane are severely impaired in spore formation . These mutations define a patch of three residues located near the N terminus of the proposed
-helix, which we propose is responsible for binding to an anchoring protein located in the outer forespore membrane . The identity of the anchoring protein is unknown, but experiments presented herein indicate that it is the product of a gene(s) that, like spoVM, is under the control of
E . We also report the identification of other residues that are important for SpoVM function but not for subcellular localization . We propose that these residues are responsible for recruiting an unknown sporulation protein to the outer surface of the engulfed forespore .
Strains and plasmids.
The strains used in this study are described in Table 1 . The parent strain for all experiments was B . subtilis strain PY79 (26) . The cloning of all plasmids was performed in E . coli DH5 . Plasmids for single-recombination integration were isolated from E . coli TG1, which allows the isolation of concatenated plasmids, which provide a higher transformation frequency for single-recombination integration .
|
TABLE 1 . Strains used in this study
|
|
To fuse spoVM and gfp, we amplified spoVM and part of its promoter by PCR with primers VM-Prom 5' (GAGAATTCTATCAAGCAGAAAAAGATCAA) and VM3' (CGCTCGAGATCTTTTCTAAATGAGCCCAG) from the genomic DNA of PY79 . The resulting fragment was digested with EcoRI and XhoI (sites are underlined in the primer sequences) and cloned into pKL147 (8), producing pCVO110 . pCVO110 was introduced by single-recombination integration into the chromosome of PY79 to produce strain CVO1000 .
To place spoVM-gfp at the amyE locus, an EcoRI-HindIII fragment from pCVO110 was cloned into the integration vector pDG364 (6) . The resulting plasmid, pCVO180, was introduced into PY79 by double-recombinant integration to produce strain CVO1195 . To place spoVM at the amyE locus, spoVM was amplified by PCR from genomic DNA of PY79 with primers VM-Prom 5' and VM3-5 (GGACGGATCCTTAATCTTTTCTAAATGAGCCCAG) . The resulting fragment was digested with EcoRI and BamHI and cloned into integration vector pDG364, producing pCVO206 . This was introduced into strain EL200 ( spoVM) (1) to produce CVO1422 .
Transcriptional fusion of PspoVG and spoVM was accomplished by amplifying PspoVG with primers VG5'Prom (GGACGAATTCGAGATCTTGTGTTGAAGTCGCGAG) and VG3'Prom (GGTCGTCGACTAAAAGCATTAGTGTATCAATTCC), and that of PspoVG and spoVM-gfp was accomplished by amplifying PspoVG with primers VM5'RBS (GGTCGTCGACGTTATAGGAGGGGACAAAAATG) and odr78 (GCCGGATCCTTATTTGTATAGTTCATCCATGCC) by PCR and digesting the resulting fragments with EcoRI, SalI, and BamHI . The fragments were cloned by triple ligation into the integration vector pER82 (19) to produce pCVO130 . This vector was introduced into PY79 by double-recombination integration to yield CVO1035 . RL1061 ( spoIIGB::erm) (7) was transformed with genomic DNA from CVO1035 to produce CVO1040 . Genomic DNA from CVO1035 was also introduced into CVO1110 ( spoIID::cat
spoIIP::kan::tet spoIIM::Tn917
HU287::erm), a derivative of PE53 (3), to produce CVO1116 .
To produce CVO1218, spoVM-gfp was amplified with spoVM5RBS (GGGCAAGCTTTTATAGGAGGGGACAAAAATG) and GFP3-3 (GGGCTGCATGCTTATTTGTATAGTTCATCCATGCC) by PCR and cloned into pDR111 to form a transcriptional fusion with the Phyperspank promoter (a kind gift of D . Rudner, Harvard University) . Phyperspank is a modified version of Phyperspac (17) in which a second lac operator was placed 70.5 bp upstream (12) . Phyperspank retains promoter strength similar to that of Phyperspac under inducing conditions but has significantly lower basal expression in the absence of an inducer . The resulting plasmid (pCVO196) was introduced into PY79 to form strain CVO1218 .
To make strain CVO1165, pQP24 was made by amplifying the promoter region of spoIIQ by PCR with QPO133 (ATTGGAATTCGGCTGGCCTTCCATAAAATGT) and QPO134 (CAATCGGATCCAGCAACATTCTGAACACTTTTCTG) . The PCR product was digested with EcoRI and BamHI and cloned into integration vector pER82 . spoVM-gfp was amplified by PCR with spoVMRBS3 (GCGGGATCCTAAGGAGGGGACAAAAATGAAAATTTTACACC) and odr78 and cloned into the BamHI site of pQP24 to produce pCVO169 . PY79 was transformed with pCVO169 to produce CVO1160 . Genomic DNA from CVO1160 was used to transform CVO1110 ( spoIID::cat
spoIIP::kan::tet spoIIM::Tn917
HU287::erm) to produce CVO1165 .
To construct strain CVO1251, RL1275 (spoIIAC::erm; in a PY79 background) was transformed with genomic DNA from strain MLK947 (amyE::PspoIIE-spoII) (27) . This strain was transformed with genomic DNA from CVO1000 (spoVM-gfp) to produce strain CVO1252 .
Mutagenesis.
We used the QuikChange site-directed mutagenesis kit (Stratagene) to produce the site-directed spoVM and spoVM-gfp mutations . Primers were designed to change the targeted codon to a GCT codon flanked by 15 to 18 bases of complementarity on either side . Mutagenesis was carried out in accordance with the instructions of the manufacturer . To introduce mutations in spoVM, we used pCVO206 as the template . For mutations in spoVM-gfp, we used pCVO180 as the template . The presence of the mutations was confirmed by sequencing with the ABI Prism DNA sequencing kit (PE Applied Biosystems) . Plasmids encoding mutagenized spoVM were introduced into the amyE locus of EL200 ( spoVM) by double-recombinant integration, producing strains CVO1398 to -1421 . Plasmids encoding mutagenized spoVM-gfp fusions were introduced into the amyE locus of PY79 by double-recombinant integration, producing strains CVO1370 to -1397 .
Sporulation conditions.
For microscopy, sporulation was induced by resuspension in Sterlini-Mandelstam medium at 37°C (24) . Cells were initially grown overnight at 25°C in growth medium (4) and resuspended in Sterlini-Mandelstam medium when the culture reached an optical density at 600 nm (OD600) of 0.5 to 0.7 . At the indicated times, a small aliquot was removed and resuspended in 1/10 volume of phosphate-buffered saline containing 1.5 µg of FM4-64 (Molecular Probes) per ml . Three microliters was placed on a microscope slide and covered with a coverslide that had been treated with poly-L-lysine (Sigma) .
Heat resistance assays.
Sporulation efficiency was determined by a heat resistance assay performed as described by Harwood and Cutting (4) . Briefly, 5 ml of Difco sporulation medium was inoculated with the strain to be tested and incubated at 37°C for 24 to 30 h . Cells were serially 10-fold diluted in T base supplemented with 1 mM MgSO4, and 100 µl was plated on Difco sporulation medium (DSM) agar . Cells were challenged at 80°C for 20 min, and again 100 µl was plated on DSM agar . Sporulation efficiency was determined by the ratio of heat-resistant CFU recovered from the mutant and the wild-type strain (PY79) .
Induction of SpoVM-GFP synthesis during vegetative growth.
To induce the synthesis of SpoVM-GFP during vegetative growth, strain CVO1218 was grown at 37°C in growth medium to an OD600 of 0.4 . Isopropyl-ß-D-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM . Cells were incubated at 37°C for 1 h and subsequently processed for microscopy as described previously, in the paragraph on sporulation conditions .
Microscopy.
Fluorescence microscopy was performed as described by Eichenberger et al . (3) with an Olympus BX60 fluorescence microscope . Typical acquisition times were 400 to 1,000 ms for GFP and 1,000 ms for FM4-64 . Images were captured and cropped with METAMORPH software . Some additional adjustments were made in Adobe Photoshop .
SpoVM localizes to the outer forespore membrane.
To investigate the subcellular localization of SpoVM, we joined the spoVM gene at its 3' terminus to the coding sequence for the GFP . The resulting gene fusion was introduced into the chromosome at the spoVM locus by single-reciprocal recombination, creating strain CVO1000, and at the amyE locus by double recombination, creating strain CVO1195 . Both strains were merodiploid, harboring both wild-type spoVM and the spoVM-gfp fusion . As described below, the SpoVM-GFP fusion protein exhibited a striking pattern of subcellular localization . This localization did not depend on the presence of a wild-type copy of the gene, but the capacity of the strains to sporulate did, indicating that the gene fusion was nonfunctional (data not shown) . SpoVM is an unusually small protein, and efforts to raise antibodies against it have been unsuccessful (15) . Therefore, we could not carry out immunofluorescence microscopy as an independent assessment of the pattern of SpoVM localization . Nonetheless, genetic analyses presented below reveal a close correlation between residues important for the localization of SpoVM-GFP and for the function of SpoVM itself .
Fluorescence microscopy of SpoVM-GFP was carried out with sporulating cells that had been stained with the vital membrane stain FM4-64 . Figure 1 shows the results for strain CVO1000, with panels A' to F' corresponding to the fusion protein and panels A" to F" corresponding to the membrane dye (essentially identical results were obtained with strain CVO1195) . In cells at the asymmetric division stage of sporulation, fluorescence from SpoVM-GFP colocalized with the polar septum and was seen as a straight line across the short axis of the cell (Fig . 1A' and A") . During the process of engulfment, SpoVM-GFP remained associated with the septal membrane as it migrated around the forespore (Fig . 1B' to E' and B" to E") . In many cases, fluorescence from SpoVM-GFP was weaker in the region of the engulfing membrane that was closest to the cytoplasmic membrane of the mother cell than elsewhere in the membrane . Conceivably, the juxtaposition of the engulfing membrane against the cytoplasmic membrane temporarily impeded the ability of SpoVM-GFP to track with the septal membrane as it migrated around the forespore . In any event, SpoVM-GFP eventually formed a uniform shell around the outer forespore membrane once engulfment was complete and the fusion protein remained associated with the outer forespore membrane during the subsequent stages of spore maturation . An example of a postengulfment sporangium in which SpoVM-GFP has formed a uniform shell around the forespore is shown in Fig . 1F' and F" . Note the absence of FM4-64 staining of the forespore in this sporangium, which is diagnostic of completion of engulfment . FM4-64 is membrane impermeable, and hence the forespore becomes inaccessible to the dye once engulfment is complete and the forespore is topologically isolated from the cytoplasmic membrane (23) .
|
FIG . 1 . Localization of SpoVM-GFP . (A' to F") Cells of strain CVO1000 (spoVM-gfp) were viewed 2.5 h after the start of sporulation . (A' to F') Fluorescence from SpoVM-GFP . (A" to F") Fluorescence from FM4-64 staining of the same cells . (G' and G") Fluorescence of CVO1000 spores . (G') Fluorescence from SpoVM-GFP . (G") The same field viewed by phase-contrast microscopy . (H' and H") Fluorescence from a mixture of PY79 (wild type) and CVO1000 spores . (H') Fluorescence of the spores . (H") The corresponding phase-contrast image . Arrows indicate nonfluorescing spores, and the arrowhead indicates a fluorescent spore.
|
|
Finally, fluorescence from SpoVM-GFP could be detected in mature spores that had been released from the sporangia by lysis of the mother cell (Fig . 1) . The fusion protein was distributed in a nonhomogeneous manner, being present as caps at both ends of the oblong spores, a pattern similar to that observed previously for the spore coat protein SpoIVA (16) and CotE (25) . Because spores are known to be autofluorescent, it was important to verify that the fluorescence observed in Fig . 1G' was principally due to the fusion protein and not due to autofluorescence . To do this, we compared the proportion of highly fluorescent spores among spores of SpoVM-GFP-producing strain CVO1000 to that of a 1:1 mixture of spores from wild-type parent strain PY79 and spores from strain CVO1000 . Approximately half of the spores from the mixture exhibited a fluorescence signal (Fig . 1H'), whereas in a sample that contained only CVO1000 spores, all of the spores were fluorescent (Fig . 1G') .
Residues in the N-terminal region of SpoVM are required for its proper localization.
We then turned to the task of identifying the region(s) of SpoVM-GFP responsible for its pattern of subcellular localization . Because of the unusually small size of SpoVM, it was convenient to assess the function of almost all of its 26 residues by a site-directed mutagenesis strategy in which we replaced every codon with an alanine codon (except for the initiation codon and codon 18, which is already an alanine codon) . The localization of the resulting mutant proteins was assessed by the use of fusions to gfp, which were integrated into the chromosome at the amyE locus . Of the 24 substitution mutant forms created, three (F3A, I6A, and P9A) detectably altered the pattern of SpoVM localization (Fig . 2A) . The most severe was P9A, which caused SpoVM-GFP to be substantially mislocalized . The F3A and I6A substitutions significantly increased the amount of fluorescence along the periphery of the mother cell compared to wild-type SpoVM-GFP . Nonetheless, fusion proteins with the F3A and I6A substitutions were enriched at the outer membrane of the forespore, albeit to a lesser degree than the wild-type protein .
|
FIG . 2 . Mislocalization of SpoVM-GFP mutant proteins . (A) Fluorescence from the F3A, I6A, and P9A SpoVM-GFP substitution mutant proteins and from wild-type SpoVM-GFP . Images were collected 3 h after the induction of sporulation . The top panels show the fluorescence from SpoVM-GFP, and the bottom panels show the membrane (FM4-64) staining of the same cells . Note the higher level of fluorescence from SpoVM-GFP at the cytoplasmic membrane of the mutant proteins compared to that of the wild type . (B) Model of SpoVM . SpoVM is represented as a cylinder on the basis of the model of Prajapati et al . (15) . The two panels are rotated 180° along the long axis relative to each other, with the face thought to be exposed to the membrane at the top and the face thought to be exposed to the cytoplasm at the bottom . Residues involved in localization are in boldface, whereas residues involved in function but not localization are not.
|
|
Because all three substitution mutants were unimpaired in their membrane association (cytoplasmic or engulfment), we infer that the substitutions interfered with specific localization but not with the general tendency of SpoVM to associate with membranes . Immunoblotting experiments with anti-GFP antibodies confirmed that the mutant proteins were indistinguishable in size from the wild-type protein and had not undergone degradation (data not shown) . Evidently, the three substitutions had neither altered the overall conformation of SpoVM in a way that blocked its membrane association capacity nor rendered the protein subject to proteolysis . Rather, it appears that F3A, I6A, and P9A disrupted a specific region of SpoVM that is responsible for targeting the protein to the outer forespore membrane .
Prajapati and colleagues have suggested that SpoVM forms an amphipathic
-helix along its entire length and that association with the membrane is mediated by positively charged residues on one face of the helix (15) . In their model, F3, I6, and P9 lie near each other on the same face of the helix, forming a patch near the N-terminal end of the helix (Fig . 2B, top; although the proline residue at position 9 could interrupt the
-helix) . Interestingly, this is the same surface of the helix that is thought to interact with the membrane . Extending the analysis of Prajapati and colleagues (15), we propose that F3, I6, and P9 represent a patch on the surface of the SpoVM helix that interacts with an unknown anchoring protein in the outer forespore membrane .
Localization of SpoVM is required for its function.
Next, we investigated the effect of the alanine substitution mutations on SpoVM function as assessed by the ability of cells harboring the mutant gene to sporulate . For this purpose, the mutant genes, in this case not fused to gfp, were introduced into the chromosome at the amyE locus in a strain with spoVM deleted . The resulting mutants were tested for the ability to sporulate as judged by the production of heat-resistant CFU . As shown in Table 2, the F3A, I6A, and P9A alanine substitution mutants were markedly impaired in sporulation . Therefore, it appears that proper localization is a requirement for SpoVM function . Conversely, the demonstration that F3A, I6A, and P9A both impair the function of SpoVM and cause mislocalization of SpoVM-GFP is consistent with the view that the subcellular localization properties of the fusion protein are physiologically significant . Underscoring their importance, I6 and P9 are identically conserved in SpoVM orthologs from other endospore-forming species, including the distantly related Clostridium species (Fig . 3) .
|
TABLE 2 . Effects of alanine substitutions on sporulation efficiency and localization of SpoVM-GFPa
|
|
|
FIG . 3 . Amino acid sequences of Bacillus and Clostridium SpoVM orthologs . The numbering at the top refers to positions in the B . subtilis SpoVM amino acid sequence, and the numbers in boldface are positions at which substitutions caused a strong defect in sporulation . The alignment was performed with ClustalW (available at http://www.ebi.ac.uk/clustalw/) . The X in the B . anthracis sequence is a position of sequence uncertainty.
|
|
Interestingly, several alanine substitutions that had no measurable effect on the localization of SpoVM-GFP nonetheless impaired sporulation (Table 2) . Leaving aside substitutions that had only a mild effect on sporulation, these localization-competent but functionally impaired mutants fell into three groups: one (L2A) that was located near the N terminus, one (K25A) that was near the C terminus, and a group of seven substitutions that defined a patch on the proposed cytosol-exposed face of the
-helix . Reinforcing the view that they are important in the function of SpoVM, many of these residues are conserved in SpoVM orthologs from other endospore-forming species (Fig . 3) . We postulate that the proposed cytosol-exposed face of the helix represents a surface that is responsible for interaction with another protein(s) that plays an important role in sporulation .
Our demonstration of the importance of residues P9 and L25 is consistent with previous reports that a proline-to-leucine substitution at residue 9 and deletion of the codons for residues 24 to 26 render B . subtilis asporogenous (1, 15) .
Localization of SpoVM is sporulation specific.
SpoVM is normally produced only during sporulation . We wondered whether it would localize in a specific manner in vegetative cells . We investigated this by placing the spoVM-gfp fusion under control of the IPTG-inducible Phyperspank promoter . When synthesis of SpoVM-GFP was induced for 1 h during the mid-exponential phase of growth (OD600 = 0.4), we observed that SpoVM-GFP was uniformly distributed along the cell membrane (Fig . 4A' and A") . The pattern of SpoVM-GFP staining was indistinguishable from that of FM4-64 staining, without any detectable enrichment of the fusion protein at the division septum . This is in contrast to the situation in sporulating cells in which SpoVM-GFP selectively localized to the polar septum and later to the engulfment membrane (which is derived from the polar septum) . The absence of specific localization of SpoVM-GFP during vegetative growth supports the idea that a sporulation-specific gene product is required for the proper localization of SpoVM .
SpoVM-GFP is unlocalized in the absence of
E.
Because SpoVM is produced under the control of
E, we wondered whether its localization is dependent upon another gene in the
E regulon . To investigate this possibility, we engineered cells to produce SpoVM-GFP in a
E-independent manner by placing spoVM-gfp under the control of PspoVG, a sporulation promoter that is activated at the onset of sporulation (28) . Thus, when SpoVM-GFP was produced under the control of PspoVG, synthesis of the fusion protein commenced earlier than normal . In sporangia that had not yet undergone polar division, the fusion protein was found to be unlocalized, being distributed uniformly along the cytoplasmic membrane (data not shown) . Later, however, after asymmetric division had taken place, localization of the fusion protein was found to be restricted to the polar septum . Thus, by the time the polar septum had formed, the pattern of localization of SpoVM-GFP produced under the control of PspoVG was indistinguishable from that observed for SpoVM-GFP synthesized under the direction of its own promoter . A simple interpretation of the results is that SpoVM-GFP had undergone redistribution from the cytoplasmic membrane to the septal membrane once the polar septum had formed .
When, however, SpoVM-GFP was produced under the control of PspoVG in a strain lacking the gene for
E (spoIIGB), the fusion protein was found to localize in a nonspecific manner even after polar division, being uniformly distributed along the cytoplasmic membrane and the septal membrane (Fig . 5, left) . SpoVM-GFP appears to be somewhat enriched at the septum in the
E mutant, but this is explained by the fact that the fusion protein was produced prior to asymmetric division . Hence, it would have been present in both sporangial compartments and thus on both the mother cell and forespore faces of the septum . The conclusion that SpoVM-GFP was unlocalized in the absence of
E is reinforced by the similarity of the pattern of fluorescence from the fusion protein to that of the membrane stain FM4-64 (Fig . 5) .
A complication in the interpretation of the experiment of Fig . 5 is that sporangia from a
E mutant differ from the wild type in their inability to undergo engulfment (5) . So that the effect of the absence of
E could be examined in a manner that avoided this complication, we introduced the PspoVG-spoVM-gfp fusion into a spoIID spoIIM spoIIP triple mutant strain . Cells with mutations in these
E-controlled genes are blocked at the earliest stage of engulfment, producing straight polar septa that do not arch around the forespore, a phenotype similar to that of a
E mutant (3) . The results show that SpoVM-GFP readily localized to the polar septum in sporangia of the triple mutant (Fig . 5, right) . Thus, proper subcellular localization depends on an unknown gene(s) under the control of
E but not on the process of engulfment .
SpoVM-GFP is unable to localize in the forespore.
Because SpoVM-GFP localization is dependent on
E, we anticipated that the fusion protein would be unable to localize in the forespore because
E is a mother cell-specific transcription factor . To investigate this possibility, we constructed a strain (CVO1265) that transcribes spoVM-gfp from a promoter (PspoIIQ) that is under the control of the forespore-specific transcription factor
F (10) . To simplify the analysis, we carried out the experiment in the presence of mutations in spoIID, spoIIM, and spoIIP that block engulfment at an early stage (3) . The results show that SpoVM-GFP uniformly decorated the membrane surrounding the forespore without any significant enrichment at the septum (Fig . 4B' and B") .
Investigation of the dependence of SpoVM-GFP localization on
F.
Finally, we investigated the question of whether the localization of SpoVM-GFP in the mother cell depends on
F-dependent gene expression in the forespore . This is a difficult question to address because SpoVM-GFP localization, as we have seen, depends on
E and because the appearance of
E in the mother cell depends on
F via the synthesis of a signaling protein (SpoIIR) that is produced in the forespore under the control of
F (14) . To circumvent this complication, we took advantage of a previously described construct (amyE::PspoIIE-spoIIR in strain MLK947) that allows SpoIIR to be produced in a
F-independent manner (27) . We introduced the amyE::PspoIIE-spoIIR construct into strain RL1275 (spoIIAC::erm), which is a
F mutant, to create CVO1251 . Finally, we introduced spoVM-gfp into CVO1251 to create strain CVO1252 . Because of the misregulation of
E, cells of CVO1252 frequently failed to undergo asymmetric division but about 12% of the cells did produce normal-looking sporangia (those with a single polar septum) in which a fluorescent signal from SpoVM-GFP could be detected . A large majority (82%, n = 180) of these sporangia exhibited a clear pattern of subcellular localization in which SpoVM-GFP was enriched at, or substantially restricted to, the polar septum (Fig . 4C) . In about 5% of the sporangia, SpoVM-GFP was uniformly distributed along all membranes, and in the remainder, the fusion protein displayed a heterogeneous staining pattern . Because localization could be studied in only a minority of the population, we regard our findings as preliminary . Nonetheless, the simplest interpretation of the results is that localization of SpoVM-GFP is not dependent on the expression of a
F-controlled gene in the forespore (other than the indirect dependence of
E activation on
F-directed synthesis of SpoIIR) .
Despite its remarkably small size, SpoVM plays a critical role in sporulation . A principal contribution of the present work is the demonstration that the function of this small protein is strongly dependent upon its ability to localize to the mother cell membrane that surrounds the forespore . We identified a patch of amino acids near the N terminus of the protein, which is proposed to have an
-helical conformation, that is needed both for tightly restricting SpoVM-GFP to the outer forespore membrane and for the normal function of SpoVM in sporulation . We also identified residues that are required for SpoVM function but are not needed for localization . The simplest interpretation of these results is that the N-terminal patch interacts with an anchoring protein located in the outer forespore membrane and that the other residues important for SpoVM function help to recruit an unidentified sporulation protein(s) needed for morphogenesis .
A candidate for a sporulation protein recruited to the outer forespore membrane by SpoVM is the morphogenetic protein SpoIVA . SpoIVA is needed for cortex formation and for proper assembly of the coat around the forespore . SpoIVA has been shown by immunofluorescence microscopy and by use of a GFP fusion (GFP-SpoIVA) to surround the forespore in a shell-like structure that is believed to serve as a basement layer for the coat and that somehow helps to trigger cortex formation in the space between the inner and outer forespore membranes (3, 15) . Localization of the GFP-SpoIVA fusion is aberrant in an spoVM mutant (16), but recent work indicates that, in the absence of SpoVM, the fusion protein transiently localizes in a partial crescent around the forespore before misassembling in the mother cell cytoplasm (C.V.O., unpublished results) . This could indicate that SpoIVA does not interact with SpoVM directly or that SpoVM is one of two or more proteins involved in the adherence of SpoIVA to the region around the forespore . In any event, the partial localization of SpoIVA in the absence of SpoVM could provide an explanation for the finding that an spoVM mutant has a less severe coat defect than does an spoIVA mutant (9) .
We do not know the identity of the anchoring protein for SpoVM, but our evidence indicates that it is the product of a gene under the control of
E or a protein whose localization is
E dependent . A further issue is whether localization of SpoVM additionally depends on a gene(s) under the control of
F in the forespore . This is a difficult question to address because the appearance of
E in the mother cell depends on
F via synthesis of the SpoIIR signaling protein in the forespore (14) . An experiment based on the use of a strain in which the appearance of
E was uncoupled from its normal dependence on
F favors the view, at least provisionally, that the localization of SpoVM-GFP does not depend on
F-directed gene expression in the forespore . If this is so, then the topological information for distinguishing the outer forespore membrane from the cytoplasmic membrane is generated from within the mother cell with no significant contribution from the forespore .
SpoVM joins the growing list of proteins produced in the mother cell that colocalize with the outer forespore membrane . Among these are the integral membrane proteins SpoIVFA, SpoIVFB, and BofA, which form a heterotrimeric complex in the outer forespore membrane that governs the appearance of the late-appearing mother cell transcription factor
K (18, 19) . Localization of SpoIVFB, which has been studied in the greatest detail, commences at the stage of polar septation . Recent work favors the view that SpoIVFB reaches its target by a diffusion-and-capture mechanism in which the protein (alone or in a complex with SpoIVFA and BofA) is initially inserted into the cytoplasmic membrane of the mother cell and then reaches the polar septum by diffusion, where it is retained (captured) (20) . Localization of SpoVM, as we have seen, also commences at the stage of polar division, and it will be interesting to see if its pattern of localization is similarly achieved by a diffusion-and-capture mechanism .
We thank D . Rudner for critical reading of the manuscript and for plasmid pDR111 and Qi Pan for plasmid pQP24 .
C.V.O . is supported by National Institutes of Health National Research Service Award GM20165 . This work was supported by National Institutes of Health grant GM18568 to R.L .
* Corresponding author . Mailing address: The Biological Laboratories, Department of Molecular and Cellular Biology, Harvard University, 16 Divinity Ave., Cambridge, MA 02138 . Phone: (617) 495-4905 . Fax: (617) 496-4642 . E-mail: losick{at}mcb.harvard.edu .
- Cutting, S., M . Anderson, E . Lysenko, A . Page, T . Tomoyasu, K . Tatematsu, T . Tatsuta, L . Kroos, and T . Ogura. 1997 . SpoVM, a small protein essential to development in Bacillus subtilis, interacts with the ATP-dependent protease FtsH . J . Bacteriol . 179:5534-5542.
- Driks, A. 2002 . Proteins of the spore core and coat, p . 527-536 . In A . L . Sonenshein, J . A . Hoch, and R . Losick (ed.), Bacillus subtilis and its closest relatives . ASM Press, Washington, D.C.
- Eichenberger, P., P . Fawcett, and R . Losick. 2001 . A three-protein inhibitor of polar septation during sporulation in Bacillus subtilis . Mol . Microbiol . 42:1147-1162.
- Harwood, C . R., and S . M . Cutting. 1990 . Molecular biological methods for Bacillus . John Wiley & Sons, Inc., New York, N.Y.
- Illing, N., and J . Errington. 1991 . Genetic regulation of morphogenesis in Bacillus subtilis: roles of
E and
F in prespore engulfment . J . Bacteriol . 173:3159-3169.
- Karmazyn-Campelli, C., L . Fluss, T . Leighton, and P . Stragier. 1992 . The spoIIN279(ts) mutation affects the FtsA protein of Bacillus subtilis . Biochimie 74:689-694.
- Kenney, T . J., and C . P . Moran, Jr. 1987 . Organization and regulation of an operon that encodes a sporulation-essential sigma factor in Bacillus subtilis . J . Bacteriol . 169:3329-3339.
- Lemon, K . P., and A . D . Grossman. 1998 . Localization of bacterial DNA polymerase: evidence for a factory model of replication . Science 282:1516-1519.
- Levin, P . A., N . Fan, E . Ricca, A . Driks, R . Losick, and S . Cutting. 1993 . An unusually small gene required for sporulation by Bacillus subtilis . Mol . Microbiol . 9:761-771.
- Londono-Vallejo, J . A., C . Frehel, and P . Stragier. 1997 . SpoIIQ, a forespore-expressed gene required for engulfment in Bacillus subtilis . Mol . Microbiol . 24:29-39.
- Losick, R., and L . Shapiro. 1999 . Changing views on the nature of the bacterial cell: from biochemistry to cytology . J . Bacteriol . 181:4143-4145.
- Müller, J., S . Oehler, and B . Müller-Hill. 1996 . Repression of lac promoter as a function of distance, phase and quality of an auxiliary lac operator . J . Mol . Biol . 257:21-29.
- Paidhungat, M., and P . Setlow. 2002 . Spore germination and outgrowth, p . 537-548 . In A . L . Sonenshein, J . A . Hoch, and R . Losick (ed.), Bacillus subtilis and its closest relatives . ASM Press, Washington, D.C.
- Piggot, P . J., and R . Losick. 2002 . Sporulation genes and intercompartmental regulation, p . 483-518 . In A . L . Sonenshein, J . A . Hoch, and R . Losick (ed.), Bacillus subtilis and its closest relatives . ASM Press, Washington, D.C.
- Prajapati, R . S., T . Ogura, and S . M . Cutting. 2000 . Structural and functional studies on an FtsH inhibitor from Bacillus subtilis . Biochim . Biophys . Acta 1475:353-359.
- Price, K . D., and R . Losick. 1999 . A four-dimensional view of assembly of a morphogenetic protein during sporulation in Bacillus subtilis . J . Bacteriol . 181:781-790.
- Quisel, J . D., W . F . Burkholder, and A . D . Grossman. 2001 . In vivo effects of sporulation kinases on mutant Spo0A proteins in Bacillus subtilis . J . Bacteriol . 183:6573-6578.
- Resnekov, O., S . Alper, and R . Losick. 1996 . Subcellular localization of proteins governing the proteolytic activation of a developmental transcription factor in Bacillus subtilis . Genes Cells 1:529-542.
- Rudner, D . Z., and R . Losick. 2002 . A sporulation membrane protein tethers the pro-sigma K processing enzyme to its inhibitor and dictates its subcellular localization . Genes Dev . 16:1007-1018.
- Rudner, D . Z., Q . Pan, and R . M . Losick. 2002 . Evidence that subcellular localization of a bacterial membrane protein is achieved by diffusion and capture . Proc . Natl . Acad . Sci . USA 99:8701-8706.
- Sandman, K., R . Losick, and P . Youngman. 1987 . Genetic analysis of Bacillus subtilis spo mutations generated by Tn917-mediated insertional mutagenesis . Genetics 117:603-617.
- Shapiro, L., and R . Losick. 1997 . Protein localization and cell fate in bacteria . Science 276:712-718.
- Sharp, M . D., and K . Pogliano. 1999 . An in vivo membrane fusion assay implicates SpoIIIE in the final stages of engulfment during Bacillus subtilis sporulation . Proc . Natl . Acad . Sci . USA 96:14553-14558.
- Sterlini, J . M., and J . Mandelstam. 1969 . Commitment to sporulation in Bacillus subtilis and its relationship to development of actinomycin resistance . Biochem . J . 113:29-37.
- Webb, C . D., A . Decatur, A . Teleman, and R . Losick. 1995 . Use of green fluorescent protein for visualization of cell-specific gene expression and subcellular protein localization during sporulation in Bacillus subtilis . J . Bacteriol . 177:5906-5911.
- Youngman, P., J . B . Perkins, and R . Losick. 1984 . Construction of a cloning site near one end of Tn917 into which foreign DNA may be inserted without affecting transposition in Bacillus subtilis or expression of the transposon-borne erm gene . Plasmid 12:1-9.
- Zhang, L., M . L . Higgins, P . J . Piggot, and M . L . Karow. 1996 . Analysis of the role of prespore gene expression in the compartmentalization of mother cell-specific gene expression during sporulation of Bacillus subtilis . J . Bacteriol . 178:2813-2817.
- Zuber, P., and R . Losick. 1983 . Use of a lacZ fusion to study the role of the spo0 genes of Bacillus subtilis in developmental regulation . Cell 35:275-283.
Free Online Full-text Article
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
|