|








| |
Journal of Bacteriology, February 2004, p . 631-637, Vol . 186,
No . 3
Reversible Acyl-Homoserine Lactone Binding to Purified Vibrio fischeri
LuxR Protein
M . L . Urbanowski,1 C . P . Lostroh,2 and E . P .
Greenberg1*
Department of Microbiology and W . M . Keck Microbial Communities and Cell
Signaling Program, Carver College of Medicine, University of Iowa, Iowa City,
Iowa 52242,1 Department of Biology, The Colorado College, Colorado
Springs, Colorado 809032
Received 9 September 2003/ Accepted 27 October 2003
The Vibrio fischeri LuxR protein is the founding member of a
family of acyl-homoserine lactone-responsive quorum-sensing
transcription factors . Previous genetic evidence indicates that in
the presence of its quorum-sensing signal, N-(3-oxohexanoyl)
homoserine lactone (3OC6-HSL), LuxR binds to lux box DNA within
the promoter region of the luxI gene and activates transcription
of the luxICDABEG luminescence operon . We have purified LuxR
from recombinant Escherichia coli . Purified LuxR binds specifically
and with high affinity to DNA containing a lux box . This binding
requires addition of 3OC6-HSL to the assay reactions, presumably
forming a LuxR-3OC6-HSL complex . When bound to the lux box at
the luxI promoter in vitro, LuxR-3OC6-HSL enables E . coli
RNA polymerase to initiate transcription from the luxI
promoter . Unlike the well-characterized LuxR homolog TraR in complex
with its signal (3-oxo-octanoyl-HSL), the LuxR-30C6-HSL complex can
be reversibly inactivated by dilution, suggesting that 3OC6-HSL
in the complex is not tightly bound and is in equilibrium with the
bulk solvent . Thus, although LuxR and TraR both bind 3-oxoacyl-HSLs,
the binding is qualitatively different . The differences have
implications for the ways in which these proteins respond to
decreases in signal concentrations or rapid drops in population
density .
Acyl-homoserine lactone (acyl-HSL) quorum-sensing systems occur in
dozens of Proteobacteria and control different specific sets
of genes in different species . In general, acyl-HSL quorum-sensing
systems involve members of the LuxR family of transcription factors
as signal receptors (16, 21) . LuxR is the
Vibrio fischeri N-(3-oxohexanoyl)-HSL (3OC6-HSL) receptor,
functioning as a transcriptional activator of the luminescence genes
in this marine bacterium (27) . 3OC6-HSL is a
diffusible signal required for LuxR activation of the luxICDABEG
operon (8, 19, 29) .
There is a substantial literature on LuxR, but our knowledge
suffers from the fact that full-length native LuxR has not been
purified and studied in vitro . The LuxR polypeptide contains two
domains (3, 4, 18) .
3OC6-HSL is thought to interact with LuxR through a signal-binding
region involving residues 81 to 129 in the N-terminal domain (about
two-thirds of the polypeptide) . The interaction between LuxR and
3OC6-HSL is specific in that 3OC6-HSL analogs show limited or no
LuxR-mediated activation of the lux operon (25) .
The C-terminal one-third of LuxR is a DNA-binding domain, which
contains a helix-turn-helix motif (residues 200 to 224) (4) .
Specific amino acids between residues 193 and 220 in the C terminus
are critical for DNA binding, while others in this region are
critical for lux operon activation but not for DNA binding (10,
31) . This two-domain structure seems to be
conserved among LuxR family members, and it is supported by the
crystal structure of the LuxR homolog TraR, a quorum-sensing signal
receptor from Agrobacterium tumefaciens (32,
37) .
The DNA sequences required for LuxR activation at the luxI promoter
have also been studied in vivo . There is a 20-bp inverted repeat
termed the lux box, centered 42.5 bp upstream of the luxI
transcription start site, that is required for LuxR activation of
luxI transcription (5, 11,
20) .
Purification of full-length LuxR has proven difficult (20,
28) . Recently several other members of the LuxR
family have been purified (22, 23,
33, 38) . The crystal structure for TraR in
complex with its cognate signal, 3OC8-HSL, and its target lux
box-like sequence indicates that functional TraR is a dimer and
that the signal is entirely buried within its binding pocket (32,
37) . The purification of functional TraR required the
presence of 3OC8-HSL during the growth of recombinant TraR-producing
bacteria to ensure stability in vivo . In subsequent purification
steps, the incorporated acyl-HSL copurified with TraR and could
be removed only with extensive dialysis (38) . The acyl-HSL
requirement for TraR stability in vivo, the tenacious binding of the
acyl-HSL to TraR, and the discovery that the acyl-HSL is completely
buried within the acyl-HSL binding region of TraR have led to the
hypothesis (39) that the acyl-HSL is required for
proper folding of nascent TraR, thereby protecting mature TraR from
proteolytic digestion within the bacterial cell, and that acyl-HSL
binding to TraR in vivo is essentially irreversible . According to
this hypothesis, during the transition exiting the quorum-satisfied
state, the decrease in population density will lead to a decline in
the expression of quorum-controlled genes as previously formed
TraR-AI functional complexes are eventually proteolyzed . Furthermore,
in the nonquorum state, acyl-HSL-responsive TraR will not be
available in a cell in the absence of acyl-HSL .
We have developed a LuxR purification procedure based on insights
about TraR . Like TraR, the acyl-HSL signal is required during
bacterial growth to obtain active LuxR . However, unlike purified
TraR, the activity of purified LuxR is dependent on added 3OC6-HSL,
indicating that this signal is not tightly bound . This suggests that
LuxR binding of acyl-HSL has a significantly different character than
acyl-HSL binding to TraR .
Bacterial strains and growth media. E . coli JM107 (36)
is F' traD36 lacIq
(lacZ)M15
proA+B+/e14
(lac-proAB)
thi gyrA96 endA1 hsdR17 relA1 glnV44 . E . coli BL21(DE3) (30)
is ompT gal dcm lon hsdSB and is lysogenized with
DE3
carrying the phage T7 RNA polymerase gene under the
control of the lacUV5 promoter and lacI . The culture
medium was Luria broth (LB) supplemented where indicated with
ampicillin (300 µg/ml), 25 µM 3OC6-HSL (N-[ß-ketocaproyl]-L-homoserine
lactone; Sigma, St . Louis Mo.), and 1 mM isopropyl-ß-D-1-thiogalactopyranoside
(IPTG; Sigma) .
Plasmid construction. A plasmid encoding a LuxR derivative
with a six-histidine (H6) C-terminal tag (pMLU117) was
constructed as follows . Plasmid pKE705 (10)
carries the V . fischeri MJ1 luxR gene coding region
under the control of the artificial tac promoter-Shine-Dalgarno
region . pKE705 was modified by deletion of an unnecessary SphI
restriction site in the nonfunctional tet gene by partial digestion
with SphI followed by blunting with T4 DNA polymerase, creating
pMU102 . The artificial Shine-Dalgarno region upstream of luxR
in pMU102 was replaced with the native luxR Shine-Dalgarno region
by replacing the approximately 220-bp EcoRI-XbaI luxR'
fragment in pMU102 with a PCR-generated luxR' fragment that
had its native Shine-Dalgarno region and 24 bp of upstream DNA
preceded by a synthetic EcoRI site formed from the PCR primer
(5'-AAGAATTCAAAACTTGCGACAAACAATAGGTAAGG) . The 3' end contained the
XbaI site from pMU102 . The resulting plasmid, pMLU89, contains
luxR under the control of the tac promoter and the native
luxR translation initiation region . Finally, the plasmid
coding for LuxR with a six-histidine tag was constructed by replacing
the 3'-SphI-XhoI fragment of luxR in pMLU89 with
a PCR fragment generated from an internal luxR primer and the
synthetic XhoI end primer
(5'-AAACTCGAGTTAATGATGATGATGATGATGATTTTTAAAGTATGGGCAATC) . The
resulting plasmid, pMLU117, was used to produce sufficient C-terminal
His-tagged LuxR for N-terminal amino acid sequence analysis .
The plasmid used for overexpression of native LuxR (pMLU115) was
constructed as follows . The luxR-coding region was amplified
by PCR with pMU102 as the template . The reverse primer included the
downstream BamHI site; the upstream primer was
5'-AAGCCATGGGTATGAAAAACATAAATGCCGACGAC-3' and included a synthetic
NcoI site centered on the luxR ATG start codon determined
below . The approximately 770-bp NcoI-BamHI fragment was
cloned into NcoI-BamHI-digested pET-3d (Novagen,
Madison, Wis.) from which its unnecessary HindIII site had been
deleted by deletion of a small EcoRI-EcoRV-EcoRV
vector fragment . In the resulting plasmid, pMLU115, luxR
expression is controlled by the phage T7 promoter .
Determination of the luxR translation start codon.
E . coli JM107 containing the LuxR-C-terminal His tag vector
pMLU117 was grown in 25 ml of LB at 37°C . IPTG was added at an
optical density at 600 nm (OD600) of 0.5, and incubation
was continued for an additional 3 h . Cells were harvested by
centrifugation, suspended, and lysed in the presence of 8 M urea, and
the denatured LuxR-His6 peptide was purified by affinity
chromatography on a His-Trap column (Pharmacia, Piscataway, N.J.)
according to the manufacturer's denaturing purification protocol . The
resulting LuxR-His6 preparation was further purified by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) .
The band at 28 kDa was excised from the gel and transferred to a
Problot polyvinylidene difluoride membrane (Bio-Rad, Hercules,
Calif.) according to the manufacturer's instructions . The N-terminal
amino acid sequence was determined at the University of Iowa
Molecular Analysis Facility .
Purification of LuxR. The purification protocol is based on
that used for the A . tumefaciens LuxR homolog TraR (38) .
Colonies of the LuxR-overexpressing strain BL21(DE3)[pMLU115] freshly
grown overnight on LB-ampicillin plates at 37°C were used to
inoculate 1 liter of LB-ampicillin prewarmed at 37°C . The culture was
grown at 37°C to an OD600 of 0.5 and was then quickly
chilled in an ice bath to 28°C . IPTG and 3OC6-HSL were added,
together with additional ampicillin (200 µg/ml), and culture growth
was continued at 28°C for 4 h . Cells were harvested by centrifugation
at 8,000 x g for 10 min at 4°C
and were frozen overnight at -80°C . All subsequent steps were
performed at 0 to 4°C . The cells were suspended in 16 ml of A buffer
(50 mM Tris-HCl [pH 7.0 at 22°C], 100 mM KCl, 50 mM NaCl, 2 mM EDTA,
2 mM dithiothreitol, 10% glycerol, 0.5% Tween 20) containing 25 µM
3OC6-HSL and were lysed by sonication . The lysate was centrifuged
at 20,000 x g for 10 min, and
the resulting supernatant fluid was centrifuged at 100,000
x g for 1.5 h . The cleared 100,000
x g cell extract was chromatographed
on a 5-ml HiTrap heparin column (Amersham Pharmacia Biotech,
Piscataway, N.J.) equilibrated with A buffer plus 25 µM 3OC6-HSL . The
bound proteins were eluted using a 25-ml NaCl step gradient from 0.15
to 1 M . Fractions containing LuxR were pooled and dialyzed against
500 ml of A buffer containing 25 µM 3OC6-HSL and 20% (wt/vol)
polyethylene glycol (molecular weight, 8,000) for 4 h to simultaneously
lower the NaCl concentration and concentrate the sample twofold .
After dialysis the sample was diluted 1:1 with a KCl- and NaCl-free
version of A buffer plus 25 µM 3OC6-HSL to obtain a final salt
concentration of 75 mM and was immediately loaded onto a tandemly
arranged pair of ion-exchange columns comprising a 5-ml HiTrap Q
Sepharose Fast Flow column and a 5-ml HiTrap SP Sepharose Fast Flow
column (Amersham Pharmacia Biotech) . Both columns had been
equilibrated with B buffer (like buffer A, except that 50 mM KCl and
25 mM NaCl were used) plus 25 µM 3OC6-HSL . After the tandem columns
were washed with B buffer, the Q column was removed, and the proteins
bound to the SP column were eluted with a 100-ml linear NaCl gradient
of 0.075 to 0.5 M . Fractions containing >95% pure LuxR (as judged by
SDS-PAGE) were pooled and stored at -80°C at final concentrations
of 10 to 50 µM monomer .
Gel shift experiments. The gel shift protocol was based on
the methods of Fried and Crothers (14) and Garner
and Revzin (17) . The DNA probes were derived from
a 400-bp PCR product containing the luxI-luxR regulatory
region . This PCR product was labeled at both ends using [ 32-P]ATP
plus T4 nucleotide kinase and was subsequently cleaved with
MwoI, resulting in a 160-bp fragment and a 240-bp fragment (see
Fig . 1A) . Protein-DNA binding reaction mixtures contained
approximately 1 fmol each of the two DNA probes in a final volume of
20 µl of DNA binding buffer (20 mM Tris-HCl [pH 7.4 at 22°C],
50 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, 100 µg of bovine
serum albumin/ml, and 5% glycerol) . Purified LuxR and 3OC6-HSL were
added as indicated, and the reaction mixtures were incubated at 26°C
for 20 min . One microliter of loading dye (0.1% xylene cyanol in 50%
glycerol) was added, and the reaction mixtures were loaded onto a
native 5% Tris-glycine-EDTA gel at 4°C . Following electrophoresis at
10 V/cm at 4°C, the probes were detected and quantitated using a
Typhoon model 8600 phosphorimager with ImageQuant software (Molecular
Dynamics, Sunnyvale, Calif.) .
|
FIG . 1 . 3OC6-HSL-dependent DNA binding of purified LuxR . (A) The two DNA
fragments comprising the luxI-luxR promoter region used as
probes in the gel shift assay . The location of the 20-bp lux box
sequence is indicated by the open rectangle . The vertical dashed line
indicates the MwoI restriction site used to produce the two
probes from a 400-bp PCR product . The -10 regions, along with the
transcription start sites (+1) and Shine-Dalgarno regions (SD) for the
divergent luxR and luxI promoters, are indicated . (B) Gel
shift assay of LuxR binding to luxI promoter DNA . All lanes
contain approximately 1 fmol of an equimolar mixture of the two probes
and the indicated concentration of LuxR either with or without 6 µM
3OC6-HSL as indicated.
|
|
DNase I protection assays. DNase I footprinting was based on
previously described methods (26) . The DNA
fragment was the same as the probe used in gel shift experiments
(Fig . 1A), except that the full-length 400-bp PCR
fragment was first cloned as an EcoRI-BamHI fragment on
a plasmid . The fragment was isolated by digesting the plasmid at the
luxI end with BamHI, labeling with [ 32-P]ATP
and T4 DNA kinase, and digesting with EcoRI . The end-labeled
400-bp fragment was purified after sizing by 5% PAGE . Approximately
0.01 pmol of the 32P-labeled DNA probe, along with the
indicated amounts of LuxR protein or E . coli RNA polymerase ( 70
saturated; Epicentre, Madison, Wis.), was incubated in 120 µl of the
gel shift DNA binding buffer, either with or without 6 µM 3OC6-HSL,
for 20 min at 25°C to allow protein-DNA complexes to form . Six
microliters (150 mU) of RQ1 DNase I (in 25 mM Tris-HCl [pH 7.4 at
22°C]-30 mM MgCl2,-30 mM CaCl; Promega, Madison, Wis.) was
then added, and incubation was continued for an additional 30 s . The
reactions were stopped by addition of 25 µl of footprint stop
solution (3 M ammonium acetate, 0.25 M EDTA, 15 µg of sheared calf
thymus DNA/ml), and DNA was precipitated with 370 µl of ethanol .
DNase I digestion products were separated on 5% denaturing
polyacrylamide gels and were visualized and quantitated using
phosphorimager technology .
In vitro transcription assays. Runoff assays were performed
as previously described (35) by using purified
E . coli RNA polymerase ( 70
saturated; Epicentre) and purified LuxR . The linear DNA template was
a purified 612-bp restriction fragment carrying the divergent luxI-luxR
promoters . Transcription from the luxI promoter on this
fragment produces a 300-base runoff transcript . The predicted luxR
promoter transcript is 170 bases in length . In early experiments,
gels contained two molecular size standards to identify the 300-base
luxI runoff transcript; in later experiments, gels run under
identical conditions gave identical band patterns in the luxI
template lanes, and thus the molecular size standards were no longer
included . In brief, DNA template (1 nM) in transcription buffer (10
mM Tris-HCl [pH 7.4 at 22°C], 50 mM KCl, 8 mM MgCl2)
containing 10 µM 3OC6-HSL was preincubated either without or with
LuxR at the indicated concentrations for 5 min at 25°C . RNA
polymerase was then added (10 nM), and incubation was continued for
20 min . Nucleotide triphosphates containing [ 32-P]ATP
were added in the presence of 50 µg of heparin/ml, and a single round
of transcription was allowed to proceed for 15 min . Reactions
were stopped by addition of footprint stop solution (see above), and
the transcripts were separated on a 5% denaturing polyacrylamide gel .
Bands were visualized and quantitated by phophorimager technology .
LuxR purification. The luxR gene from V . fischeri
MJ1 was previously reported to encode a 250-amino-acid polypeptide (20) .
However, an in-frame AUG two codons upstream of the reported start
codon could also serve as a translation start site for luxR . A
carboxy-terminal histidine-tagged derivative of LuxR, overexpressed
in E . coli by using the native luxR Shine-Dalgarno
region, was purified by nickel-affinity chromatography and subjected
to N-terminal sequence analysis of the first 12 amino acids . More
than 90% of the LuxR-His6 polypeptide initiated at the
upstream AUG codon, indicating that native LuxR is encoded by the
longer 252-codon open reading frame .
LuxR purification was based on a method used for purifying the
LuxR homologue TraR from A . tumefaciens (38) . The
luxR coding region specifying the longer, 252-residue protein was
placed downstream of the T7 promoter and Shine-Dalgarno region of
plasmid pET-3d . E . coli BL21(DE3) carrying the resulting
plasmid pMLU115 was grown in LB, and luxR expression was
induced by IPTG in the presence or absence of the V . fischeri
signal molecule 3OC6-HSL (at 25 µM) . A gel mobility shift assay (see
below) demonstrated that clarified cell extracts of cultures grown in
the presence of 3OC6-HSL specifically bound DNA containing a lux
box sequence in a 30C6-HSL-dependent manner . Extracts of cultures
grown in the absence of 30C6-HSL did not show specific lux box
binding, and the 3OC6-HSL could not be replaced with octanoyl-HSL
(data not shown) . LuxR was purified from the clarified extract of
cells grown in the presence of 3OC6-HSL as described in Materials
and Methods . SDS-PAGE analysis of the pooled fractions and Western
blot analysis using a LuxR-specific antiserum indicated a single
polypeptide species (>95% purity) with an Mr of 28,000;
matrix-assisted laser desorption ionization—time-of-flight
(MALDI-TOF) analysis of the purified protein indicated a monomeric
molecular weight of 28,698 (data not shown) . Both values are in
agreement with the calculated LuxR molecular weight of 28,744 for the
252-amino-acid LuxR monomer .
LuxR binding to DNA depends on added 3OC6-HSL. LuxR DNA
binding activity was tested in a mobility shift assay using two DNA
probes, only one of which contained a lux box (Fig.
1A) . In the absence of 3OC6-HSL, LuxR did not bind to
either probe at the highest LuxR concentration tested (3.5 nM)
(Fig . 1B) . In the presence of 10 µM 3OC6-HSL, 3.5 nM LuxR
was sufficient to shift nearly all of the lux box probe without
affecting the mobility of the nonspecific probe (Fig . 1B;
compare lanes 1 to 4) . Titration of LuxR in the presence of 10 µM
3OC6-HSL indicated that, under these conditions, 0.2 nM LuxR
polypeptide was sufficient to shift 50% of the specific probe (Fig.
1B) . In similar experiments, titration of 3OC6-HSL in
the presence of 3.5 nM LuxR showed that 100 nM 3OC6-HSL was
required to shift 50% of the specific probe (Fig . 2A) . A Hill
plot of the data in Fig . 2A yielded a Hill coefficient
of 0.9, indicating that the stimulation by 3OC6-HSL of LuxR-DNA
complex formation is a noncooperative process (Fig . 2B) .
|
FIG . 2 . Estimation of LuxR binding affinity for 3OC6-HSL . (A) Gel shift
reactions using increasing concentrations of 3OC6-HSL in the presence of
3.5 nM LuxR were run . The fractional amount of the specific probe
shifted (y axis) was determined at each concentration of 3OC6-HSL
(x axis) and averaged . Error bars, standard errors of the means .
(B) Hill plot of the data in Fig . 2A.
|
|
DNase I footprinting was used to test whether LuxR binds specifically
to the lux box . In the presence of 10 µM 3OC6-HSL, LuxR
protected a 28-bp region that included the 20-bp lux box (Fig .
3A) . The presence of two unprotected bases within this region
suggests that, like TraR (36), LuxR may bind to only
one face of the DNA . Additionally, LuxR binding resulted in enhanced
DNase I digestion approximately 8 bp upstream and downstream of
the lux box . DNase I protection assays can also be used as an
alternative method to measure binding to DNA under equilibrium
conditions (2) . We used LuxR concentrations varying over 4
orders of magnitude in the DNase I protection assay to measure the
LuxR-lux box DNA dissociation constant (Fig . 3B) .
Under our experimental conditions, 0.1 nM LuxR was sufficient to give
a fractional protection of 0.5, in good agreement with the apparent
affinity indicated by the gel shift experiments . Because the
footprint experiments indicate that the luxI promoter fragment
contains only a single LuxR binding site, it is not surprising that a
Hill plot of the data in Fig . 3B indicated noncooperative
binding of this DNA fragment by LuxR (Hill coefficient, 0.85
[data not shown]) .
|
FIG . 3 . DNase I protection of the lux box by LuxR . (A) A 32P-labeled
probe derived from the luxI-luxR promoter region was preincubated
in the presence of 10 µM 3OC6-HSL either without (lane 1) or with (lane
2) 10 nM LuxR and was then partially digested with DNase I, as described
in Materials and Methods . Lane 3, Maxam-Gilbert A+G sequencing ladder of
the probe . The open vertical box on the left delineates the region
protected by LuxR in lane 2 . The sequence of this protected region is
given on the right, including the sequence comprising the lux box
(indicated by heavy vertical lines) . Arrows indicate two positions of
enhanced DNase I digestion in lane 2 . (B) Estimation of LuxR-DNA
affinity by DNase I protection assays . A series of DNase I footprinting
reactions using increasing concentrations of LuxR in the presence of 10
µM 3OC6-HSL was run . The fractional protection (y axis) of
several bands within the LuxR-protected region was determined at each
concentration of LuxR (x axis) and averaged . Error bars, standard
errors of the means.
|
|
LuxR stabilizes RNA polymerase binding to the luxI promoter.
A previous study concluded that E . coli RNA polymerase- 70
alone could not bind to the luxI promoter in vitro . However,
in the presence of a C-terminal DNA-binding domain fragment of LuxR
(LuxR N),
which by itself had no specific lux box binding activity, both
proteins formed a DNase I-resistant complex encompassing the lux
box-luxI promoter region (28) . We tested whether
full-length LuxR can similarly mediate RNA polymerase binding to the
luxI promoter in vitro . In agreement with the previous study,
E . coli RNA polymerase alone failed to protect the luxI
promoter region from DNase I attack (Fig . 4;
compare lanes 1 and 4) . When RNA polymerase was added in the presence
of LuxR and exogenous 3OC6-HSL, the LuxR-protected region was
extended through the luxI promoter region to approximately bp
+20 (Fig . 4; compare lanes 2, 3, and 4) .
|
FIG . 4 . LuxR-3OC6-HSL stimulation of RNA polymerase binding to the
luxI promoter . All lanes contain 6 µM 3OC6-HSL and the same
end-labeled probe used in the footprint shown in Fig . 2 .
Where indicated, LuxR is present at 3.5 nM and E . coli RNA
polymerase (RNAP) is present at 3.3 nM . Elements of the luxI
promoter are indicated to the right of the gel.
|
|
LuxR stimulates transcription from the luxI promoter in vitro.
The truncated LuxR N
peptide had also been shown to be necessary and sufficient to
activate transcription of the luxI promoter by E . coli
RNA polymerase in vitro (29) . However, high levels
of the LuxR N
peptide (>2,500 nM) were required to mediate this activation,
presumably because it lacked the 3OC6-HSL binding region and was
therefore insensitive to the facilitating effects of the signal . We
showed above that 3OC6-HSL-dependent binding to the lux box by
full-length purified LuxR occurs at nanomolar concentrations .
Therefore, we used a runoff transcription assay to test whether low
levels of full-length LuxR can stimulate transcription of the luxI
promoter by E . coli RNA polymerase in vitro . In the absence of
LuxR, RNA polymerase failed to produce a transcript from the luxI
promoter (Fig . 5), even at the highest
concentrations tested (64 nM [data not shown]) . Addition of LuxR at
levels as low as 5 nM activated transcription from the luxI
promoter; quantitation of the 300-base luxI transcript
indicated that maximum transcript levels occurred in the presence of
20 nM LuxR .
|
FIG . 5 . LuxR-3OC6-HSL stimulation of transcription from the luxI
promoter . A 612-bp double-stranded linear DNA fragment carrying the
luxI-luxR promoter region was used as a template in an in vitro
transcription runoff assay . Reaction mixtures contained 1 nM DNA
template, 10 nM E . coli RNA polymerase, [ 32-P]ATP-labeled
deoxynucleoside triphosphates, and 10 µM 3OC6-HSL, either with (lanes 1
to 6) or without (lane 7) purified LuxR, as indicated . Open arrows
indicate calculated positions of the 395- and 130-base molecular size
standards . Filled arrow points to the 300-base luxI runoff
transcript . Because no significant transcription is seen in the absence
of LuxR (lane 7), the LuxR-dependent transcripts above the 300-base
luxI band are likely due to transcription that initiated at the
luxI promoter but was extended beyond the template 3' end by a
loop-around mechanism described previously (24).
|
|
Although the luxR promoter is also present on the template DNA
(12), a 170-base transcript predicted from the previously
determined start site for this promoter is not seen (Fig.
5) . Previous studies indicated that the catabolite
repressor protein Crp and its effector cyclic AMP activate luxR
transcription (6, 7) . Another
study identified the V . fischeri LitR protein as a positive
transcriptional regulator of luxR (13) . It is likely
that expression from the luxR promoter in vitro requires CRP-cyclic
AMP, LitR, or both .
The current model for quorum sensing in V . fischeri (recently
reviewed in reference 15) holds that the association of
3OC6-HSL with LuxR is a key step enabling the activator to bind
lux box DNA at the luxICDABEG operon and thereby
facilitate the binding and activation of RNA polymerase at the
luxI promoter . The role of 3OC6-HSL in potentiating these
functions of LuxR has not been determined . In the case of A .
tumefaciens, TraR is quickly degraded when synthesized in vivo in
the absence of its cognate effector 3OC8-HSL . The presence of
3OC8-HSL during synthesis of the apoactivator promotes formation of a
much more protease-resistant TraR dimer containing two molecules of
3OC8-HSL that, in an X-ray crystallographic structure of the complex,
were shown to be buried in a closed pocket inside each TraR monomer (32,
37, 39) . These two molecules of
effector were tightly bound to TraR, forming an effectively
irreversible holo-TraR complex that retained 3OC8-HSL throughout the
purification procedure . Isolation of apo-TraR required extensive
dialysis of the TraR-3OC8-HSL complex in the presence of 3% Tween 20
(38) . The tight binding of 3OC8-HSL to TraR led to
the conclusion that dissociation of 3OC8-HSL from the complex is
unlikely to play a significant role in deactivation of the
quorum-controlled genes in A . tumefaciens (39) .
Our results indicate that cultures of the E . coli LuxR overexpression
strain must also be grown in the presence of the cognate acyl-HSL
(in this case 3OC6-HSL) in order to obtain extracts that have
lux box-specific DNA binding activity . Addition of this effector
to DNA binding reactions cannot rescue this activity from extracts
of 3OC6-HSL-free cultures (data not shown) . In contrast to what
has been reported for TraR, the results presented here show that the
specific DNA binding activity of extracts from 3OC6-HSL-supplemented
cultures, as well as the activity of purified LuxR isolated from
them, can easily and reversibly be rendered 3OC6-HSL dependent by
simple dilution into 3OC6-HSL-free buffer . We conclude that formation
of the LuxR-3OC6-HSL complex is reversible . We have determined an
effective equilibrium constant for formation of this complex to be
approximately 100 nM under the conditions of our assays . This value
is consistent with previous in vivo studies that determined the
effective response to 3OC6-HSL of lux operon reporters in
E . coli (9), and it is also within the range of
3OC6-HSL concentrations thought to occur during quorum-sensing-mediated
gene regulation in V . fischeri (1,
19) . We have not been able to demonstrate whether the switch
between the active and inactive forms of LuxR upon dilution or
addition of 3OC6-HSL is due to a change in the oligomeric state of
LuxR or whether it involves a conformational change in a single
oligomeric species . The in vitro transcription assays highlight an
additional distinction between TraR and LuxR . The former requires
supercoiled promoter DNA for efficient transcription (38),
while the latter can utilize a linear DNA template . These contrasting
requirements may reflect different mechanisms of activation by LuxR
and TraR .
The differences between LuxR and TraR are quite interesting and
may point to ways in which these acyl-HSL binding proteins are used
differently in different bacteria . The fact that LuxR immediately
loses its ability to bind to target DNA when the acyl-HSL signal is
diluted suggests that the V . fischeri quorum-sensing system
can rapidly adjust to decreases in population density, whereas A .
tumefaciens may respond more slowly, requiring degradation of
active TraR . Members of the LuxR family of proteins show a
significant but minimal sequence identity . The identity in the
acyl-HSL binding regions of LuxR and TraR is less than 30% (34) .
Although many of the residues in this region of TraR that interact
directly with the signal are conserved in LuxR, it is clear that
other, nonconserved residues must somehow define important
differences between these family members, not only in acyl-HSL
specificity but also in how these systems might respond to changes in
population densities . The purification of LuxR may now allow
crystallization of this founding member of the family in order to
identify the structural basis of this diversity .
This work was supported by a grant from the W . M . Keck Foundation .
C.P.L . was supported by a U.S . Public Health Training Grant
(T32-AI07511) .
* Corresponding author . Mailing address: Department of
Microbiology, EMRB, University of Iowa, Iowa City, IA 52242 . Phone: (319)
335-7775 . Fax: (319) 335-7949 . E-mail: everett-greenberg@uiowa.edu.
- Boettcher, K . J., and E . G . Ruby. 1995 . Detection and
quantification of Vibrio fischeri autoinducer from symbiotic squid
light organs . J . Bacteriol . 177:1053-1058.
- Brenowitz, M., D . F . Senear, and R . E . Kingston. 1998 .
DNase I footprint analysis of protein-DNA binding., p . 12.4.1-12.4.16 . In
F . M . Ausubel, R . Brent, R . E . Kingston, D . D . Moore, J . G . Seidman, J . A .
Smith, and K . Struhl (ed.), Current protocols in molecular biology, vol . 2 .
John Wiley and Sons, Inc., New York, N.Y.
- Choi, S . H., and E . P . Greenberg. 1991 . The C-terminal
region of the Vibrio fischeri LuxR protein contains an
inducer-independent lux gene activating domain . Proc . Natl . Acad . Sci .
USA 88:11115-11119.
- Choi, S . H., and E . P . Greenberg. 1992 . Genetic
dissection of DNA binding and luminescence gene activation by the Vibrio
fischeri LuxR protein . J . Bacteriol . 174:4064-4069.
- Devine, J . H., G . S . Shadel, and T . O . Baldwin. 1989 .
Identification of the operator of the lux regulon from the Vibrio
fischeri strain ATCC 7744 . Proc . Natl . Acad . Sci . USA 86:5688-5692.
- Dunlap, P . V., and E . P . Greenberg. 1985 . Control of
Vibrio fischeri luminescence gene expression in Escherichia coli by
cyclic AMP and cyclic AMP receptor protein . J . Bacteriol . 164:45-50.
- Dunlap, P . V., and E . P . Greenberg. 1988 . Control of
Vibrio fischeri lux gene transcription by a cyclic AMP receptor
protein-LuxR protein regulatory circuit . J . Bacteriol . 170:4040-4046.
- Eberhard, A., A . L . Burlingame, C . Eberhard, G . L . Kenyon, K .
H . Nealson, and N . J . Oppenheimer. 1981 . Structural identification of
autoinducer of Photobacterium fischeri luciferase . Biochemistry 20:2444-2449.
- Egland, K . A., and E . P . Greenberg. 2000 . Conversion of
the Vibrio fischeri transcriptional activator, LuxR, to a repressor . J .
Bacteriol . 182:805-811 .
- Egland, K . A., and E . P . Greenberg. 2001 . Quorum sensing
in Vibrio fischeri: analysis of the LuxR DNA binding region by
alanine-scanning mutagenesis . J . Bacteriol . 183:382-386 .
- Egland, K . A., and E . P . Greenberg. 1999 . Quorum sensing
in Vibrio fischeri: elements of the luxI promoter . Mol .
Microbiol . 31:1197-1204.
- Engebrecht, J., and M . Silverman. 1987 . Nucleotide
sequence of the regulatory locus controlling expression of bacterial genes for
bioluminescence . Nucleic Acids Res . 15:10455-10467.
- Fidopiastis, P . M., C . M . Miyamoto, M . G . Jobling, E . A .
Meighen, and E . G . Ruby. 2002 . LitR, a new transcriptional activator in
Vibrio fischeri, regulates luminescence and symbiotic light organ
colonization . Mol . Microbiol . 45:131-143.
- Fried, M., and D . M . Crothers. 1981 . Equilibria and
kinetics of lac repressor-operator interactions by polyacrylamide gel
electrophoresis . Nucleic Acids Res . 9:6505-6525.
- Fuqua, C., and E . P . Greenberg. 2002 . Listening in on
bacteria: acyl-homoserine lactone signalling . Nat . Rev . Mol . Cell Biol . 3:685-695.
- Fuqua, C., M . R . Parsek, and E . P . Greenberg. 2001 .
Regulation of gene expression by cell-to-cell communication: acyl-homoserine
lactone quorum sensing . Annu . Rev . Genet . 35:439-468.
- Garner, M . M., and A . Revzin. 1981 . A gel
electrophoresis method for quantifying the binding of proteins to specific DNA
regions: application to components of the Escherichia coli lactose
operon regulatory system . Nucleic Acids Res . 9:3047-3060.
- Hanzelka, B . L., and E . P . Greenberg. 1995 . Evidence
that the N-terminal region of the Vibrio fischeri LuxR protein
constitutes an autoinducer-binding domain . J . Bacteriol . 177:815-817.
- Kaplan, H . B., and E . P . Greenberg. 1985 . Diffusion of
autoinducer is involved in regulation of the Vibrio fischeri
luminescence system . J . Bacteriol . 163:1210-1214.
- Kaplan, H . B., and E . P . Greenberg. 1987 . Overproduction
and purification of the luxR gene product: transcriptional activator of
the Vibrio fischeri luminescence system . Proc . Natl . Acad . Sci . USA
84:6639-6643.
- Miller, M . B., and B . L . Bassler. 2001 . Quorum sensing
in bacteria . Annu . Rev . Microbiol . 55:165-199.
- Minogue, T . D., M . Wehland-von Trebra, F . Bernhard, and S .
B . von Bodman. 2002 . The autoregulatory role of EsaR, a quorum-sensing
regulator in Pantoea stewartii ssp . stewartii: evidence for a
repressor function . Mol . Microbiol . 44:1625-1635.
- Nasser, W., M . L . Bouillant, G . Salmond, and S . Reverchon.
1998 . Characterization of the Erwinia chrysanthemi expI-expR
locus directing the synthesis of two N-acyl-homoserine lactone signal
molecules . Mol . Microbiol . 29:1391-1405.
- Oostra, B . A., A . C . Arnberg, G . Ab, and M . Gruber.
1981 . Terminal strand-switching of E . coli RNA polymerase transcribing
a truncated DNA fragment . Biochim . Biophys . Acta 655:446-448.
- Schaefer, A . L., B . L . Hanzelka, A . Eberhard, and E . P .
Greenberg. 1996 . Quorum sensing in Vibrio fischeri: probing
autoinducer-LuxR interactions with autoinducer analogs . J . Bacteriol . 178:2897-2901.
- Schmitz, A., and D . J . Galas. 1979 . The interaction of
RNA polymerase and Lac repressor with the lac control region . Nucleic
Acids Res . 6:111-137.
- Shadel, G . S., and T . O . Baldwin. 1991 . The Vibrio
fischeri LuxR protein is capable of bidirectional stimulation of
transcription and both positive and negative regulation of the luxR
gene . J . Bacteriol . 173:568-574.
- Stevens, A . M., K . M . Dolan, and E . P . Greenberg. 1994 .
Synergistic binding of the Vibrio fischeri LuxR transcriptional
activator domain and RNA polymerase to the lux promoter region . Proc .
Natl . Acad . Sci . USA 91:12619-12623 .
- Stevens, A . M., and E . P . Greenberg. 1997 . Quorum
sensing in Vibrio fischeri: essential elements for activation of the
luminescence genes . J . Bacteriol . 179:557-562.
- Studier, F . W., A . H . Rosenberg, J . J . Dunn, and J . W .
Dubendorff. 1990 . Use of T7 RNA polymerase to direct expression of cloned
genes . Methods Enzymol . 185:60-89.
- Trott, A . E., and A . M . Stevens. 2001 . Amino acid
residues in LuxR critical for its mechanism of transcriptional activation
during quorum sensing in Vibrio fischeri. J . Bacteriol . 183:387-392 .
- Vannini, A., C . Volpari, C . Gargioli, E . Muraglia, R .
Cortese, R . De Francesco, P . Neddermann, and S . D . Marco. 2002 . The
crystal structure of the quorum sensing protein TraR bound to its autoinducer
and target DNA . EMBO J . 21:4393-4401 .
- Welch, M., D . E . Todd, N . A . Whitehead, S . J . McGowan, B . W .
Bycroft, and G . P . Salmond. 2000 . N-Acyl homoserine lactone binding
to the CarR receptor determines quorum-sensing specificity in Erwinia.
EMBO J . 19:631-641 .
- Whitehead, N . A., A . M . Barnard, H . Slater, N . J . Simpson,
and G . P . Salmond. 2001 . Quorum-sensing in Gram-negative bacteria . FEMS
Microbiol . Rev . 25:365-404.
- Wu, W . F., M . L . Urbanowski, and G . V . Stauffer. 1995 .
Characterization of a second MetR-binding site in the metE metR
regulatory region of Salmonella typhimurium. J . Bacteriol . 177:1834-1839.
- Yanisch-Perron, C., J . Vieira, and J . Messing. 1985 .
Improved M13 phage cloning vectors and host strains: nucleotide sequences of
the M13mp18 and pUC19 vectors . Gene 33:103-119.
- Zhang, R . G., T . Pappas, J . L . Brace, P . C . Miller, T .
Oulmassov, J . M . Molyneaux, J . C . Anderson, J . K . Bashkin, S . C . Winans, and
A . Joachimiak. 2002 . Structure of a bacterial quorum-sensing transcription
factor complexed with pheromone and DNA . Nature 417:971-974.
- Zhu, J., and S . C . Winans. 1999 . Autoinducer binding by
the quorum-sensing regulator TraR increases affinity for target promoters in
vitro and decreases TraR turnover rates in whole cells . Proc . Natl . Acad . Sci .
USA 96:4832-4837 .
- Zhu, J., and S . C . Winans. 2001 . The quorum-sensing
transcriptional regulator TraR requires its cognate signaling ligand for
protein folding, protease resistance, and dimerization . Proc . Natl . Acad . Sci .
USA 98:1507-1512 .
Free Online Full-text Article
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
|