Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us


Vnitr Lek, 1994 Feb, 40(2), 118 - 21
{A review of new cephalosporin antibiotics}; Hupkova M et al.; The authors discuss some properties of recent cephalosporin antibiotics and the antibiotics effectiveness in particular of more recent generations of cephalosporins . The increasing resistance to penicillins and other antibiotics called for use effective cephalosporins of new generations . While cephalosporins of the 1st generation (cephalothin, cephazoline, and oral cephaloridine or cephaclor) are effective against Gram-positive bacteria, haemophilus bacteria and Klebsiellae, the resistance of other bacteria even against these antibiotics is increasing . Mephoxine and cephuroxime belong to the 2nd generation as their spectrum of efficiency is wider . Cephalosporins of the 3rd generation (cefotaxime, ceftriaxone, ceftazidime and others) are effective only against strains resistant to cephalosporins of the older generations . Oral preparations of cephalosporins of recent generations (Loracarbef, cefpodoxim, ceftibutene) are also useful.

Arch Dis Child, 1994 Feb, 70(2), 129 - 32
Successful treatment of epiglottitis with two doses of ceftriaxone; Sawyer SM et al.; Epiglottitis in childhood is caused by Haemophilus influenzae type b . The usual antibiotic treatment at the Royal Children's Hospital, Parkville, Victoria is a five day course of chloramphenicol . Increasingly, third generation cephalosporins are being used to treat invasive H influenzae type b infections and preliminary data suggest that they can be used successfully for epiglottitis . In a prospective, randomised trial, the efficacy of a short course (two days) of ceftriaxone was compared with that of five days of chloramphenicol for the treatment of epiglottitis . The ability of these treatment regimens to eradicate H influenzae type b from the throat was also studied . Fifty five children were enrolled over an 18 month period . Epiglottitis was diagnosed clinically and confirmed on inspection of the epiglottis at direct laryngoscopy . Fifty three (96%) of 55 patients had H influenzae type b detected from at least one site: 44/52 (85%) from blood cultures, 41/47 (87%) from throat swab, and 6/8 (75%) as H influenzae type b urinary antigen . Children were randomised to receive either ceftriaxone 100 mg/kg intravenously followed by a single dose of 50 mg/kg 24 hours later (28 patients), or chloramphenicol 40 mg/kg intravenously, then 25 mg/kg eight hourly for five days, intravenously then by mouth (27 patients) . All household contacts and patients receiving chloramphenicol received rifampicin 20 mg/kg daily for four days . Index patients randomised to ceftriaxone were not treated with rifampicin . There was no significant difference in outcome between the two groups with respect to the mean duration of fever, the duration of intubation, or the length of hospital admission . The proportion of patients colonised with H influenzae type b four weeks after discharge was not significantly different between the two groups: ceftriaxone 5/22 (23%) versus chloramphenicol and rifampicin 3/23 (13%) . A short course of ceftriaxone was successful in treating all patients with no significant side effects and no relapses . A short course of ceftriaxone is a safe, efficacious, and economic alternative to the standard treatment in children with epiglottitis.

J Infect Dis, 1994 Feb, 169(2), 430 - 3
Human microvascular endothelial cell toxicity caused by Brazilian purpuric fever-associated strains of Haemophilus influenzae biogroup aegyptius; Weyant RS et al.; An in vitro cytotoxicity model that uses an immortalized human microvascular endothelial cell line (HMEC-1) differentiates Brazilian purpuric fever (BPF)-associated Haemophilus influenzae biogroup aegyptius (HAE) strains from non-BPF-associated HAE strains . Toxic strains produced a characteristic HMEC-1 phenotype at an MOI of < 1 bacterium/1000 tissue culture cells (TCC) . Nontoxic strains required MOIs of > 1000 bacteria/TCC to produce an observable effect . The cytotoxic phenotype was characterized by the presence of large clumps of HMEC-1 cells, which detached from the monolayer within 48 h of inoculation by HAE cells . The cytotoxic phenotype was observed with 100% of BPF-associated HAE (40/40) and 14% of non-BPF-associated HAE (8/57; P < .001) . The ability to study a BPF-associated phenotype in vitro using human microvascular cells should enhance our knowledge of BPF pathogenesis.

J Infect Dis, 1994 Feb, 169(2), 425 - 9
High-molecular-weight surface-exposed proteins of Haemophilus influenzae mediate binding to macrophages; Noel GJ et al.; The molecular basis for direct bacteria-macrophage interactions that distinguishes nontypeable (NT) Haemophilus influenzae from type b organisms is not known . Because of similarities between filamentous hemagglutinin (FHA) adhesin of Bordetella pertussis and high-molecular-weight (HMW) proteins commonly expressed by NT H . influenzae, the role that HMW proteins play in determining NT H . influenzae-macrophage interactions was assessed . In tests with genetically engineered organisms, HMW protein-expressing bacteria bound significantly better than isogenic HMW protein-deficient bacteria to macrophages . HMW protein-dependent binding to macrophages is trypsin-sensitive, is independent of divalent cations, does not occur via the leukocyte integrin CD11b/CD18, and is not affected by galactose-containing carbohydrates . Organisms bound via HMW proteins remain largely extracellular and viable . Like FHA of Bordetella organisms, HMW proteins mediate binding of NT H . influenzae to macrophages . However, unlike the interaction determined by FHA, this interaction is characteristically one of adhesion and requires additional serum opsonization for efficient killing of bacteria by macrophages.

J Infect Dis, 1994 Feb, 169(2), 337 - 42
Evidence for capsule gene sequences among pharyngeal isolates of nontypeable Haemophilus influenzae; St Geme JW 3rd et al.; Haemophilus influenzae is a common commensal organism of the human respiratory tract and is an important cause of localized and systemic disease . While isolates recovered from the respiratory tract are generally nonencapsulated (serologically nontypeable), isolates from systemic sites typically express a polysaccharide capsule . To explore the possibility that nontypeable strains evolved from encapsulated organisms, a series of serologically nontypeable isolates were examined for the presence of capsule gene sequences . Pharyngeal isolates (123) were collected from healthy 3-year-old Finnish children and examined by Southern hybridization with pUO38, a plasmid that contains one complete set of cap genes from an H . influenzae type b strain . Twenty-four isolates (20%) demonstrated homology with capsule-specific sequences . Of these 24, 18 in addition to 14 others had evidence of one or more copies of IS1016, an insertion element that has been associated with encapsulation in H . influenzae . These results support the hypothesis that nontypeable strains of H . influenzae arose from an encapsulated ancestor . Possibly the selective pressure driving the loss of encapsulation relates to the disadvantage associated with encapsulation during respiratory tract colonization.

Cell Signal, 1994 Feb, 6(2), 187 - 99
Dietary linoleic acid-induced changes in respiratory beta-adrenergic receptor function and the form of arrhenius plots of isoprenaline- and prostaglandin E2-stimulated adenylate cyclase activity in a model for atopy; Loesberg C et al.; Varying dietary linoleic acid altered lung membrane fatty acid composition with linoleic acid content increasing from approximately 6% total in those on 3 en% diet to approximately 14% total fatty acid in those on a 12 en% diet . Accompanying this were two- to three-fold increases in the levels of the elongation products of linoleic acid, namely 20:2 (n-6) and 22:5 (n-6) and a decrease in 18:1 oleic acid from approximately 26% to approximately 19% total . Administration of Haemophilus influenzae, to animals on 6 en% linoleic acid, serving as a model for atopy, effected a small increase in the levels of 22:5 (n-3) and doubled those of 22:6 (n-3) . beta-Adrenergic-induced tracheal relaxation and stimulation of lung adenylate cyclase were elevated by increasing dietary linoleic acid from 3 to 6 en%, although such differences were abolished in the atopic model and when dietary linoleic acid was increased to 12 en% . Arrhenius plots of NaF-stimulated lung adenylate cyclase activities exhibited a break (t1) at approximately 26 degrees C in all dietary groups with unchanged activation energies and activity . In contrast, whilst both isoprenaline and PGE2-stimulated adenylate cyclase activities showed similar break-points in their Arrhenius plots, dietary linoleic acid manipulation markedly altered their form . As with NaF-stimulated activities then, irrespective of dietary manipulation and induction of atopy, these plots showed an invariant break occurring at approximately 26 degrees C . But, for animals on 3 and 6 en% diets, a second break was apparent at approximately 15 degrees C, which was slightly decreased to approximately 12 degrees C upon induction of atopy and completely abolished on increasing dietary linoleic acid to 12 en% . Accompanying such changes were marked alterations in activation energies . We suggest that profound changes in lung plasma membrane bilayer properties occur upon both altering dietary linoleic acid levels and in atopy . These selectively perturb adenylate cyclase activity when it is receptor-stimulated but not when it is activated by direct G-protein stimulation with NaF . We suggest that atopy and dietary challenge elicit an asymmetric perturbation of the plasma membrane that predominantly affects the outer half of the lipid bilayer.

J Chemother, 1994 Feb, 6(1), 35 - 8
In vitro evaluation of cefodizime, cefuroxime, ceftriaxone against respiratory pathogens; Paniara O et al.; The in vitro activity of cefodizime and two comparative cephalosporins, cefuroxime and ceftriaxone were studied against respiratory pathogens . MIC90s of cefodizime were 0.06-0.512 microgram/ml for Streptococcus pneumoniae, Moraxella catarrhalis and Haemophilus influenzae . MIC50s of cefodizime for Klebsiella pneumoniae and Staphylococcus aureus isolates were 2 micrograms/ml and 8 micrograms/ml respectively . Cefuroxime and ceftriaxone at a concentration of 2 micrograms/ml and 1 microgram/ml inhibited 50% of Klebsiella pneumoniae and 50% of Staphylococcus aureus strains studied respectively . Cefodizime inhibited many of the important respiratory pathogens and can be suggested as an active antimicrobial agent for respiratory tract infections.

J Korean Med Sci, 1994 Feb, 9(1), 1 - 8
Reaction of the sera of the Korean children free from Hib invasive diseases against H . influenzae type B capsular polysaccharide antigen; Kim KH et al.; The purpose of our experiment is to examine the level of anti-Haemophilus influenza polysaccharide antibody titer in the Korean population . Using ELISA, the level of Hib-PS antibodies in 384 infants and children who were all free from Hib invasive diseases, was tested . And the blood of 50 mothers within 24 hours of delivery and cord blood from their respective full-term neonates was also tested . The transport of Hib-PS IgG and IgG subclasses in paired sera from mothers and neonates was also measured . The titer of Hib-PS IgG varies with age . At birth the mean optical density of cord blood was 1.028; however, it declined to 0.609 up to 6 months and further decline was noted up to 2 years to 0.488 . Then the mean O.D . remained around 0.5 from 3 to 14 years of age . The mean O.D . of Hib-PS IgG in the mothers blood was 0.856 . The ratio of mean O.D . of anti-Hib PS IgG antibody in the cord blood to that in the maternal blood was 1.20 . The mean optical densities of IgG subclasses were: 1.18 for anti-Hib PS IgG1, 1.07 for anti-Hib PS IgG2, 1.01 for anti-Hib PS IgG3, and 1.09 for anti-Hib PS IgG4 . The sera from Korean children of almost all age groups reacted to Hib-PS antigen on ELISA . Also the active transport of anti-Hib PS IgG antibody through placenta was observed . Among four IgG subclasses, only IgG1 transport had significant experimental meaning.

Mol Cell Probes, 1994 Feb, 8(1), 23 - 37
Molecular typing of Haemophilus influenzae using a DNA probe and multiplex PCR; Cote S et al.; The use of new molecular typing methods for the characterization of Haemophilus influenzae strains is reported . Sixty-four isolates of H . influenzae originating from different types of infection and obtained from eight hospitals across Canada were first analysed for restriction polymorphism . Chromosomal DNA fragments generated by two different combinations of restriction endonucleases were electrophoresed and transferred to nylon membranes before hybridization with a species specific 32P-labelled DNA fragment (5 kb) used as a probe . The combinations Bg/II/PstI led to 11 typing groups (A-K) and BamHI/Bg/II/PstI to 14 sub-groups, respectively . Most of the isolates retrieved from cerebrospinal fluids (10/13; 76.9%) were classified in two groups (A and B) and two sub-groups . Isolates from respiratory tract infections were mostly found in groups C and E (24/32; 75.0%), and divided into seven sub-groups . Selected ampicillin-resistant, beta-lactamase-negative strains were also found in groups C and E (11/14; 78.6%) . Isolates from conjunctivitis and acute otitis media were classified in various groups . All biotypes (I-VIII) and serotypes (none, a-f) were spread among the typing groups although biotype I prevailed in groups A, B, and G; II in group E (sub-group 6); and III in group C . A PCR approach derived from the typing system was also tested . A set of 25-mer primers was selected from the 5-kb DNA probe for the amplification of a 317-bp region . This set of primers was used concomitantly in a PCR multiplex assay with a set of primers selected from the nucleotide sequence of the gene encoding the H . influenzae P1 protein . This multiplex assay was also able to discriminate the clonal origin of some H . influenzae strains because size polymorphism was observed in PCR products . The PCR approach was then used to determine the genetic relatedness of H . influenzae strains found persistently in sputa of some patients with cystic fibrosis . Genetically related strains could be isolated from some patients even after antibiotherapy and months between visits, whereas other patients showed distinct strains . In summary, our typing system is able to provide new characteristics for strains having identical biotype or serotype . The rapid PCR alternative may prove useful for specific epidemiological and strain-tracking studies.

Can J Microbiol, 1994 Feb, 40(2), 154 - 7
Clarification of the structure of the ampicillin-resistance plasmid RSF0885 from Haemophilus influenzae HR-885 serotype b; Albritton WL et al.; The nonconjugative ampicillin-resistance plasmid RSF0885 has been reported to be as small as 2.9 MDa and as large as 4.1 MDa with at least two restriction enzyme maps reported . In addition, the source of the original plasmid has been reported to be Haemophilus influenzae and Haemophilus parainfluenzae . Characterization of the source strains and sequencing data of the plasmids revealed that H . influenzae serotype b was the original source strain and that IS1-K in the larger plasmid was presumably acquired when the smaller plasmid was maintained in Escherichia coli in S . Falkow's laboratory during the late 1970s.

Singapore Med J, 1994 Feb, 35(1), 104 - 5
Neonatal meningitis due to non-encapsulated Haemophilus influenzae in a set of twins--a case report; Lim CT et al.; A set of twins born to a 24-year-old primigravida had evidence of sepsis 24 to 60 hours after birth and were treated empirically with penicillin and gentamicin . A non-encapsulated H . influenzae biotype IV strain was isolated from the blood cultures of both and from the CSF of twin II . The isolates were beta-lactamase positive and hence showed resistance to ampicillin and therapy was changed to chloramphenicol only . Twin II recovered but Twin I developed a brain abscess in the left occipital region which resolved with extended antibiotic treatment . Although ampicillin-resistant H . influenzae have been reported in Malaysia, invasive disease by such strains are rare.

Arch Fam Med, 1994 Feb, 3(2), 165 - 75
Cefuroxime axetil in the treatment of sinusitis . A review; Pakes GE et al.; Cefuroxime axetil is a beta-lactamase-stable, second-generation, oral cephalosporin that penetrates sinus tissue in concentrations exceeding the MIC90 values (the minimum concentration of drug needed to inhibit the growth of 90% of an isolate of a particular microorganism) for pathogens most commonly associated with acute sinusitis, including Streptococcus pneumoniae and Haemophilus influenzae . A review of all clinical data published to date demonstrates that cefuroxime axetil has been evaluated in the treatment of acute sinusitis and acute exacerbations of chronic sinusitis ("acute-on-chronic sinusitis") in 18 clinical trials involving 1516 assessable patients . In 12 randomized, comparative trials, the rates of satisfactory clinical outcomes (cure or improvement, 79% to 100%) and bacteriologic eradication (84% to 100%) reported with the use of 250 mg of cefuroxime axetil twice daily were similar to those observed with the use of amoxicillin, amoxicillin/clavulanate potassium, cefaclor, cefadroxil, cefixime, clarithromycin, and doxycycline . In these comparisons, no antibiotic demonstrated any therapeutic advantages over cefuroxime axetil regarding time to symptom abatement . Cefuroxime axetil was at least as well tolerated as the other antibiotics . Overall, the role of cefuroxime axetil in the treatment of sinusitis appears to be as one of the broad-spectrum antibiotics that can be used for infections due to the most commonly implicated sinus pathogens, especially those due to the increasing number of relatively penicillin-resistant strains of S pneumoniae and beta-lactamase-producing strains of H influenzae and Moraxella catarrhalis.

Arch Pediatr, 1994 Feb, 1(2), 143 - 6
{Anti-Haemophilus influenzae b (Hib) natural immunity in children in Burkina Faso}; Tall F et al.; BACKGROUND . Natural immunity to Haemophilus infection type b that is acquired by the mothers and passively transmitted to their newborns is not well-known in developing countries, where the frequency of Haemophilus meningitis in infancy is high . POPULATION AND METHODS . Blood samples (5 ml) were taken from 89 women at the time of delivery and from the cord of their babies . Blood samples were also taken from 290 infants and children, distributed into nine subgroups as a function of their age . Children with protein-calorie malnutrition and immune deficiency were excluded from the study . Antibodies against Haemophilus influenzae were measured by Elisa and radioimmunologic methods . Blood concentrations of 0.15 pg/ml or more were considered to be protective . RESULTS . All the blood samples of mothers and cords contained protective levels of antibodies, as did the samples from 30% of those infants aged 0-60 days (all the infants were less than 1 month) . No infant in the subgroup 12-23 months had protective levels of antibodies . The incidence of Haemophilus meningitis was correlated with the absence of antibodies . CONCLUSION . Maternal immunity is gradually lost by babies during their first 2 months of life, earlier than in developed countries . Early vaccination, at 3 months of age, is mandatory.

East Afr Med J, 1994 Feb, 71(2), 129 - 31
Haemophilus influenzae meningitis in parts of eastern Nigeria; Onyemelukwe NF; During a two-year period, January 1989 to January 1991, 39 (12%) of 331 children admitted to various hospitals and health centres in Enugu and Nsukka areas of Eastern Nigeria with symptoms of meningitis had Haemophilus influenzae isolated from their cerebrospinal fluids (CSF) . 90% were aged 24 months and below . Out of the 39 isolates, 37 were Pittman serotype b while the remaining 2 were type d . More males (61.5%) had H . influenzae meningitis in comparison with 38.5% of females . 69.2% of the cases occurred during the dry season while 30.7% occurred during the rainy season . All the isolates were sensitive to chloramphenicol and erythromycin, while 90% were sensitive to ampicillin and penicillin, using the disc diffusion method . The leading role of H . influenzae in meningitis in children who are 7 to 24 months of age in this part of the world and the increasing resistance of this organism to ampicillin and penicillin is hereby stressed.

East Afr Med J, 1994 Feb, 71(2), 113 - 7
Bacterial meningitis in children in southern Ghana; Commey JO et al.; One hundred and three children (1% of seriously ill children referred to the Korle Bu Teaching Hospital in Accra) were admitted with bacterial meningitis over a 17 month period . 43 of these children had been ill for more than 4 days before arrival at our centre . The main causative organisms were S . pneumoniae (47.9%), Neisseria meningitides (38.4%) and Haemophilus influenzae (9.6%) . All bacterial isolates were highly sensitive to ceftriaxone . Resistance to penicillin and chloramphenicol was however present in 5-17% of isolates . All cerebrospinal fluid samples were sterilised within 48 hours of antibiotic treatment . Case fatality rate was 22% with the majority of deaths occurring within hours of admission and closely related to S . pneumoniae infection . Neurological complications occurred in 22%; mild diarrhoea in 33% and secondary fever in 14.8% of survivors . No significant difference was noted among the three treatment regimens of ceftriaxone alone, penicillin plus chloramphenicol, and ceftriaxone alone for 48 hours followed by penicillin/chloramphenicol combination . Our overall outcome would have been better if patients had been started on appropriate antibiotic treatment within the earlier hours of the infection . Furthermore, the latter generation cephalosporins, including ceftriaxone, must be given consideration as antibiotics of first choice world widePIP: Between November, 1991, and March, 1993, in Accra, Ghana, physicians admitted 103 children, 2 months to 12 years old, to the Korle Bu Teaching Hospital with suspected bacterial meningitis . They constituted 1.04% of all children presenting at the emergency rooms . Late referral to the hospital was likely responsible for the high case fatality rate within the 1st 24 hours of admission (59.1% of all deaths) . 42.7% of all cases presented more than 96 hours after the onset of symptoms . 7 children died immediately after admission, allowing physicians no time to begin antibiotic treatment . The overall case fatality rate was 21.4% . Streptococcus pneumonia was isolated from the cerebrospinal fluid (CSF) in 53.8% of the early deaths and 55% of all 73 mortality cases from which bacteria were isolated . Leading causative organisms were $ . pneumoniae (47.9%), Neisseria meningitides (38.4%), and Hemophilus influenza (9.6%) . All bacterial isolates were sensitive to ceftriaxone . 5-17% of all isolates were resistant to penicillin and chloramphenicol . No bacteria were isolated in the CSF of any children within 48 hours of antibiotic treatment . The leading complications and sequelae of the 81 survivors were mild diarrhea (33%), neurological complications (22%), and secondary fever (14.8%) . Even though the chloramphenicol/penicillin treatment regimen had the highest survivor outcome results (43%), its results were not significantly different than those of ceftriaxone alone for 48 hours followed by chloramphenicol/penicillin and ceftriaxone alone (24% and 20%, respectively; p =.6) . These results suggest that health workers at less than optimum health facilities should administer the 1st dose of ceftriaxone to children suspected of having meningitis before transferring them to a tertiary facility for further management . This should greatly reduce case fatalities and sequelae . Health workers worldwide, even those in malaria endemic areas, should consider meningitis as a significant cause of fever .

Infect Immun, 1994 Feb, 62(2), 468 - 75
Identification of a gene essential for piliation in Haemophilus influenzae type b with homology to the pilus assembly platform genes of gram-negative bacteria; Watson WJ et al.; Haemophilus influenzae type b (Hib) pili are complex filamentous surface structures consisting predominantly of pilin protein subunits . The gene encoding the major pilin protein subunit of Hib adherence pili has been cloned and its nucleotide sequence has been determined . In order to identify specific accessory genes involved in pilus expression and assembly, we constructed isogenic Hib mutants containing insertional chromosomal mutations in the DNA flanking the pilin structural gene . These mutants were screened for pilin production, pilus expression, and hemagglutination . Pili and pilin production were assessed by immunoassays with polyclonal antisera specific for pilin and pili of Hib strain Eagan . Hemagglutination was semiquantitatively evaluated in a microtiter plate assay . Six Hib mutants produced proteins immunoreactive with antipilin antiserum but no longer produced structures reactive with antipilus antiserum . In addition, the mutants were unable to agglutinate human erythrocytes . Nucleotide sequence analysis localized the insertion sites in the six mutants to 2.5-kb open reading frame upstream of the pilin structural gene and immediately downstream of an Hib pilin chaperone gene . The amino acid sequence encoded by this open reading frame has significant homology to members of the pilus assembly platform protein family, including FhaA of Bordetella pertussis, MrkC of Klebsiella pneumoniae, and the Escherichia coli assembly platform proteins FimD and PapC . This open reading frame, designated hifC, appears to represent a gene essential to Hib pilus biogenesis that has genetic and functional similarity to the pilus platform assembly genes of other gram-negative rods.

Infect Immun, 1994 Feb, 62(2), 673 - 9
Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay; Forsgren J et al.; The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA . We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H . influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction . In some cases, the reticular crypt epithelium was focally infiltrated by H . influenzae . The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases . These mononuclear cells contained up to 200 intracellular H . influenzae cells . In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen . Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H . influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells.

Oral Microbiol Immunol, 1994 Feb, 9(1), 19 - 24
The influence of saliva on interbacterial adherence; Skopek RJ et al.; The mechanism of bacterial adherence to the mat of bacteria in preformed dental plaque is not well defined . This study measured the influence of saliva on the adherence of bacteria in suspension to a continuous bacterial surface in vitro . Twenty different pairs of bacteria were tested, consisting of Streptococcus spp., Haemophilus spp . and Actinomyces spp . The species were chosen based on the parameters of coaggregation, and salivary agglutination . The results were expressed as bacteria that adhered per mm2 of bacterial surface . When both the surface bacteria and the bacteria in suspension agglutinated in saliva, interbacterial adherence was increased 2.5-fold when a salivary coating was placed on the surface . When one or both of the bacteria did not agglutinate in saliva, interbacterial adherence was increased only slightly when the surface was saliva-coated . The results suggested that salivary-mediated adherence is significant to plaque formation once the tooth surface becomes covered with bacteria . Thus bacteria that are capable of agglutinating in saliva may have a distinct advantage in colonization of the plaque surface.

MMWR Recomm Rep, 1994 Jan 28, 43(RR-1), 1 - 38
General recommendations on immunization . Recommendations of the Advisory Committee on Immunization Practices (ACIP); Voltage gating of porins from Haemophilus influenzae type b; Department of Microbiology and Immunology, McGill University, Montreal, Quebec, CanadaThe major outer membrane protein of Haemophilus influenzae type b (Hib) is porin (M(r) 37,782; 341 amino acids) . Porins were purified from Hib strains representative of the three outer membrane protein subtypes 1H, 2L and 6U, reconstituted into artificial planar bilayers, and tested for their voltage dependency . At membrane potentials of 50-80 mV, individual Hib 2L and 6U porin channels showed a high probability of undergoing a reversible change to one of several lower conducting substates . Such behaviour was not observed for Hib 1H porin with transmembrane potentials up to 80 mV . The voltage dependence of Hib 2L and 6U porins was asymmetric: it occurred at only one polarity . The asymmetry was also observed for membranes with numerous porins incorporated, suggesting that Hib porin inserted asymmetrically into the bilayer . At macroscopic levels the voltage gating reduced the conductance by 25-50%, implying that the channels closed only partially . Hib 2L porin differs from Hib 1H porin by the substitution Arg166Gln and Hib 6U porin differs from Hib 1H porin by substitutions at ten amino acids including the change Arg166Leu . We conclude that substitutions at Arg166 residue, which is localized to surface-exposed loop number four, are associated with a lowered threshold potential for the voltage gating of Hib porin . This surface-exposed loop may play some role in the conformational changes that occur during voltage gating.

J Mol Biol, 1994 Jan 14, 235(2), 472 - 85
A Caulobacter DNA methyltransferase that functions only in the predivisional cell; Zweiger G et al.; Caulobacter crescentus was found to have a DNA methyltransferase, CcrM, that methylates the adenine base of the HinfI recognition sequence, GANTC . The ccrM gene was cloned, and DNA sequence analysis revealed that the predicted amino acid sequence has 49% identity with the Haemophilus influenzae methyltransferase HinfM . Expression of the ccrM gene was found to be restricted to the portion of the cell cycle immediately prior to cell division . At three separate chromosomal sites the CcrM recognition sequence is fully methylated in swarmer cells, becomes hemimethylated upon DNA replication in stalked cells, and does not become remethylated until just prior to cell division . The time of methyltransferase expression coincides with the time of methylation of these three chromosomal sites and of plasmid DNA in the predivisional cell . When ccrM gene expression is placed under control of a constitutive promoter, these chromosomal sites are fully methylated throughout the cell cycle . A high proportion of morphologically aberrant cells, and cells that have undergone an additional chromosome replication initiation, are found in this population . Thus, the temporal control of this methyltransferase appears to contribute to the accurate cell-cycle control of DNA replication and cellular morphology.

Ugeskr Laeger, 1994 Jan 10, 156(2), 191 - 3
{Vaccination of splenectomized children . Antibody response to Haemophilus influenzae type b conjugate vaccine}; Kristensen K; Twenty splenectomized children and adolescents aged four to 18 years were immunized once with a Haemophilus influenzae type b (Hib) polysaccharide tetanus toxoid conjugate vaccine . Prior to vaccination, ten of 20 patients had anticapsular antibodies below what could be considered the minimum protective level in the splenectomized (0.6 microgram per ml), whereas all obtained high antibody levels after vaccination . In addition, one infant with congenital asplenia was vaccinated at two, four, and six months of age, and was shown to respond well after the second and third injections, obtaining serum antibody concentrations of 0.84 and 10.7 microgram per ml respectively . Because asplenic individuals have an increased risk of invasive Hib infection, these data suggest that vaccination of such individuals against Hib may be justified.

South Med J, 1994 Jan, 87(1), 38 - 40
Impact of immunization against Haemophilus influenzae type b (HIB) on the incidence of HIB meningitis treated at Arkansas Children's Hospital; Buchanan GA et al.; The newly available Haemophilus influenzae type b (HIB) protein conjugate vaccines are efficacious among study populations in which a high proportion of infants and children are vaccinated . In this retrospective study, we show the impact of the availability of HIB conjugate vaccines on the incidence of HIB meningitis at Arkansas Children's Hospital (ACH) in Little Rock . The Arkansas State Health Department estimates that only 43% of children in the state younger than 2 years of age have received the appropriate vaccinations . From 1985 through 1987, 27.3 +/- 4 HIB meningitis cases per year were treated at ACH . Although an HIB conjugate vaccine was licensed for 18-month-old children in December 1987, the incidence of HIB meningitis treated at ACH did not decrease significantly; there were 19.0 +/- 2 cases per year from 1988 through 1990 . In December 1990, an HIB conjugate vaccine was licensed for use in infants beginning at 2 months of age . From that time through August 1992, there were five cases of HIB meningitis treated at ACH, representing a significant decrease over previous years . Four of these cases occurred in unimmunized infants younger than 6 months of age . The availability of HIB conjugate vaccines for infants has resulted in a dramatic decrease in the number of cases of HIB meningitis treated at ACH, despite a relatively low proportion of infants and children who are receiving vaccination.

Pediatrics, 1994 Jan, 93(1), 59 - 62
Serum C-reactive protein, erythrocyte sedimentation rate, and white blood cell count in acute hematogenous osteomyelitis of children; Unkila-Kallio L et al.; OBJECTIVE . The aim of this prospective study was to compare the clinical value of the erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), and white blood cell (WBC) count in diagnosis and follow-up of acute hematogenous osteomyelitis in children . DESIGN . Forty-four children aged 2 weeks to 14 years with bacteriologically confirmed acute hematogenous osteomyelitis were examined . Staphylococcus aureus was responsible in 39 cases (89%), Haemophilus influenzae type b in 3 cases (7%), pneumococcus in 1 case (2%), and a microaerophilic streptococcus in 1 case (2%) . ESR was measured at the time of admission and on days 3, 5, 7, 10, 14, 19, and 29 of treatment, and CRP was measured on the same days as ESR but also on days 2, 9, 12, 17, and 23 . WBC count was examined at the time of admission and on days 5, 10, 19, and 29 . RESULTS . ESR was elevated (> or = 20 mm/h) initially in 92% of the cases; the mean value was 45 mm/h, and the peak values (mean 58 mm/h) were reached on days 3 to 5 . After this the levels slowly returned to normal in approximately 3 weeks (mean 18 days) . CRP was elevated (> 19 mg/L) at the time of admission in 98% of the cases, the mean value being 71 mg/L . The peak CRP value was reached on day 2 (mean 83 mg/L) . The decrease was very rapid, normal values being reached within a week (mean 6.9 days) . The WBC count was a poor indicator of acute hematogenous osteomyelitis, since only 35% of the children had leukocytosis (WBCs > 12 x 10(9)/L) at the time of admission . CONCLUSIONS . In patients with acute hematogenous osteomyelitis, CRP increased and especially decreased significantly faster than ESR, reflecting the effectiveness of the therapy given and predicting recovery more sensitively than ESR or WBC count.

Infect Immun, 1994 Jan, 62(1), 9 - 14
Opposite effects of actively and passively acquired immunity to the carrier on responses of human infants to a Haemophilus influenzae type b conjugate vaccine; Barington T et al.; Vaccination of infants with Haemophilus influenzae type b (Hib) capsular polysaccharide (HibCP) coupled to carrier proteins has proven protective against invasive Hib diseases in several trials . However, insufficient immunogenicity has been noted in certain populations . Therefore, studies analyzing factors influencing the antibody response to conjugate vaccines are needed . In this study, the response to HibCP coupled to tetanus toxoid (TT) was examined in relation to (i) priming with or coadministration of the carrier protein and (ii) the levels of passively acquired maternal TT antibodies . One hundred forty-four infants were vaccinated with HibCP-TT at 5 and 6 months . They were randomized into three groups that received TT as part of a diphtheria-tetanus-polio vaccine at either 6 and 7 months (group A), 5 and 6 months (group B), or 4 and 5 months (group C) . Maternally acquired TT antibodies inhibited the anti-HibCP response to the first HibCP-TT dose in groups A and B (r = -0.5 and -0.4, respectively; P < 0.005) . In these groups, infants with prevaccination anti-TT levels above the median failed to reach the defined long-term protective level of HibCP antibodies (1 microgram/ml) more often than infants with low prevaccination levels after the first (P = 0.0001) and the second (P = 0.01) doses of HibCP-TT . In contrast, active priming with TT at 4 months resulted in a threefold-higher median level of anti-HibCP (group C; 1.34 micrograms/ml) than in the unprimed group (group A; 0.40 microgram/ml) after the first dose of HibCP-TT (P = 0.01) . Coadministration of TT had no enhancing effect (group B; 0.58 microgram/ml) . No significant differences between the median anti-HibCP levels were seen after the second HibCP-TT dose (6.72, 9.63, and 11.44 micrograms/ml in groups A, B, and C, respectively; P = 0.25).

Infect Immun, 1994 Jan, 62(1), 48 - 59
Identification and characterization of an iron-regulated hemopexin receptor in Haemophilus influenzae type b; Wong JC et al.; Heme can serve Haemophilus influenzae as a source of both essential porphyrin and iron . In extracellular mammalian body fluids neither free heme nor free iron is available, since they are tightly bound to hemopexin and transferrin, respectively . Since H . influenzae grows in the presence of iron-transferrin and heme-hemopexin and is known to express a saturable receptor for transferrin, we investigated the process by which this pathogen acquired heme from hemopexin for use as an iron source . The ability of human and rabbit hemopexin to donate heme as a source of iron to H . influenzae type b strains was demonstrated by plate bioassays . With a dot enzyme assay with biotinylated hemopexin as ligand, H . influenzae bound heme-hemopexin and apo-hemopexin following growth in iron-restricted, but not in iron-sufficient, medium . Competitive binding studies with heme-hemopexin and apo-hemopexin demonstrated saturability of binding . Neither heme, protoporphyrin IX, hemoglobin, nor transferrin blocked the binding of hemopexin to whole cells, demonstrating the specificity of binding . Treatment of whole H . influenzae cells with trypsin abolished binding . Taken together, these observations suggest that H . influenzae type b expresses an outer membrane protein(s) which acts as a receptor for hemopexin and which is regulated by the availability of iron in the growth medium . In iron-restricted media, H . influenzae 706705 and DL42 did not express the 100-kDa hemopexin-binding protein previously reported (M.S . Hanson, S.E . Pelzel, J . Latimer, U . Muller-Eberhard, and E.J . Hansen, Proc . Natl . Acad . Sci . USA 89:1973-1977, 1992) . The putative iron-regulated hemopexin receptor was solubilized from cell envelopes of H . influenzae 706705, DL42, and Eagan with the detergent CHAPS (3-{(3-cholamidopropyl)-dimethyl-ammonio}-1-propanesulfonate) and isolated by affinity chromatography on heme-hemopexin-Sepharose 4B . Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the proteins bound to the affinity resin revealed three proteins of 29, 38, and 57 kDa, of which the 57- and 29-kDa proteins bound hemopexin after Western blotting (immunoblotting) . A monoclonal antibody to the 57-kDa hemopexin-binding protein of 706705 recognized a 57-kDa protein on Western blots of the cell envelope proteins of 706705, DL42, and Eagan; no reaction was observed with the 100-kDa hemopexin-binding protein of DL42 . These data suggest that some H . influenzae strains possess at least two hemopexin receptors, the expression of which is determined by the prevailing growth environment.

J Immunol, 1994 Jan 1, 152(1), 184 - 92
Induction of protective immunity to Haemophilus ducreyi in the temperature-dependent rabbit model of experimental chancroid; Hansen EJ et al.; The temperature-dependent rabbit model for chancroid, a sexually transmitted disease caused by the fastidious Gram-negative bacterium Haemophilus ducreyi, was used to investigate the abilities of previous infection and immunization with an acellular preparation of H . ducreyi to induce protective immunity . In the first set of experiments, animals were infected intradermally with either the 35000 or Cha-1 strains of H . ducreyi and then rechallenged 30 days later with both the homologous and heterologous strains . In animals infected with the 35000 strain, statistically significant protective immunity occurred only against the homologous strain, whereas protection against both homologous and heterologous challenge was obtained in rabbits previously infected with strain Cha-1 . In a separate series of experiments, rabbits were immunized with cell envelopes from either strain 35000 or strain Cha-1 and then challenged with both the homologous and heterologous strains . In rabbits immunized with strain 35000 cell envelopes, significant protective immunity was observed only against challenge with the homologous strain . In animals immunized with strain Cha-1 cell envelopes, protection was obtained against both homologous and heterologous challenge . Histopathologic analysis of sites inoculated with strain 35000 (10(5) CFU) demonstrated that the inflammatory response in control animals was predominantly suppurative (i.e., heterophilic), whereas that of immunized animals was predominantly mononuclear and, at later time points, largely histiocytic . ELISA and Western blot analyses revealed that immunization produced a better humoral immune response than did infection and provided evidence for antigenic cross-reactivity between these two strains . These results provide the experimental basis for continued efforts to identify potential H . ducreyi vaccinogens.

Wien Klin Wochenschr, 1994, 106(7), 187 - 92
{Haemophilus influenzae meningitis 1983 to 1992--epidemiology and sequelae of the disease}; Rauter L et al.; During the ten-year period 1983-1992 40 children (16 girls and 24 boys) were treated for pyogenic meningitis caused by Haemophilus influenzae type b (Hib) . The incidence was 1 case per year out of 5500 children younger than 6 years of age . The youngest child was 5.5 months old, 8 children (20%) were younger than 12 months . The highest incidence was during the second year of life (16 patients) . The oldest patient was 11.5 years old . The course of Hib meningitis varied . The disease ran a fulminant course in 10 children . In 9 patients the symptoms evolved more gradually over a period of more than 48 hours, whereby 4 of these patients were only slightly ill on admission . Treatment until 1987 consisted of a combination of ampicillin and chloramphenicol, thereafter cetriaxon and ampicillin were used . Two patients died . One child was left with devastating handicaps and 5 children suffer from minor, but persisting sequelae (seizure disorder, delay in psychomotor development, attention deficit hyperactivity disorder, learning problems, speech delay) . Transient disorders were found in 8 patients (EEG abnormalities, delay in psychomotor development, transient hearing problems) . Severe hearing loss was seen in only one patient . 24 children (60% of all cases) recovered without any sequelae . Our results, in accordance with the literature, show that in spite of prompt availability of medical assistance, potent antibodies and a high standard of hospital care, the mortality and morbidity following Hib meningitis are still unacceptably high . Hence, we emphasize the need to eliminate Hib infection by immunization programmes.

Zh Mikrobiol Epidemiol Immunobiol, 1994 Jan-Feb, (1), 21 - 7
{The biological properties of Haemophilus influenza isolated from healthy children and from patients with acute and chronic respiratory diseases}; Katosova LK et al.; The comparative study of the biological properties of H . influenzae strains isolated from healthy children and from patients with acute and chronic respiratory diseases has been made, taking into account the biochemical features (biotypes) and adhesive activity of these strains . Differences in various biotypes of H . influenzae strains isolated from patients with bronchopulmonary diseases and from healthy carriers have been established . H . influenzae strains isolated from various sources differ by their adhesive properties: strains isolated from patients with acute bronchopulmonary diseases have the highest adhesive activity, while strains isolated from healthy controls have the lowest adhesive activity . The data thus obtained indicate the possible dependence of the degree and duration of the colonization of the respiratory tract by H . influenzae on the biological properties of these microorganisms . The monitoring of the sensitivity of H . influenzae strains to antibiotics has demonstrated that these strains retain high sensitivity to ampicillin, chloramphenicol, gentamicin and exhibit a tendency towards an increase in resistance to penicillin and erythromycin.

Acta Otorhinolaryngol Belg, 1994, 48(1), 1 - 9
Bacterial interference in nasopharyngeal bacterial flora of otitis-prone and non-otitis-prone children; Bernstein JM et al.; The quantitative bacteriology of the adenoid was studied in 34 otitis-prone and 25 non-otitis prone children . Viridans streptococci appeared to be the predominant normal flora in children who are non-otitis prone . There was a significant decrease in viridans streptococci in the otitis-prone child compared to the non-otitis-prone child . There was a significant increase in nontypable Haemophilus influenzae (NTHI) in the otitis-prone child . The mechanisms responsible for this alteration of the microecology of bacteria of the nasopharynx may be related, in part, to bacterial interference or to the inappropriate use and over-use of antibiotics . In vitro inhibition of growth of NTHI was demonstrated with selective strains of viridans streptococci . A preliminary analysis of an inhibitory strain and a non-inhibitory strain of viridans streptococci are presented and their biochemical profiles and antibiotic sensitivities were entirely different . A possible mechanism for the inhibition on NTHI by viridans streptococci has been suggested . This mechanism may be related to an alteration of pH in the growth media or the possibility of the utilization of nutrients required for growth of NTHI.

Pediatr Infect Dis J, 1994 Jan, 13(1), 27 - 33
Antibodies against Haemophilus influenzae type b and tetanus in infants after subcutaneous vaccination with PRP-T/diphtheria, or PRP-OMP/diphtheria-tetanus vaccines; Carlsson RM et al.; In an open randomized study, serum antibodies against Haemophilus influenzae type b capsular polysaccharide (PRP) and tetanus toxoid were determined in 146 Swedish infants; 75 of them received PRP conjugated to tetanus toxoid (PRP-T) concurrently with diphtheria toxoid vaccine, and 71 received PRP conjugated to an outer membrane complex of Neisseria meningitidis (PRP-OMP) concurrently with diphtheria-tetanus toxoid vaccine . Injections were given subcutaneously at ages 3, 5 and 12 months . One month after the second injection, the PRP-T recipients had a geometric mean (GM) concentration of 0.38 microgram/ml and only 69% had PRP antibodies > or = 0.15 microgram/ml (considered a protective level) . In the PRP-OMP group the GM concentration was 0.44 microgram/ml and 85% had PRP antibodies > or = 0.15 microgram/ml . One month after the third injection, 99% of the infants in both groups had PRP antibodies > or = 0.15 microgram/ml, but PRP-T recipients had significantly higher GM concentration than infants vaccinated with PRP-OMP, 10.21 micrograms/ml vs . 1.90 micrograms/ml (P < 0.001) . After all three injections the diphtheria-tetanus toxoid vaccine elicited higher GM concentrations of tetanus toxoid antibodies than did the PRP-T vaccine, but both vaccines induced antibodies above the proposed protective level, 0.01 IU/ml . The reason for the lower than expected immunogenicity of the two Haemophilus influenzae type b conjugate vaccines has yet not been established . For PRP-OMP the most probable explanation is the use of a lot of low immunogenicity, but the route of administration also has to be considered.(ABSTRACT TRUNCATED AT 250 WORDS)

J Infect, 1994 Jan, 28(1), 93 - 7
Cerebrospinal fluid rhinorrhoea and Haemophilus influenzae meningitis 37 years after a head injury; Crawford C et al.; Bacterial meningitis secondary to CSF rhinorrhoea is well recognised . We present a case of meningitis due to Haemophilus influenzae type b associated with a CSF fistula . The patient was 40 years of age at presentation, having sustained a head injury when 3-years-old . He had suffered intermittent rhinorrhoea for 18 months before admission . Delays between head injury and meningitis are well recognised, but our case may represent the longest recorded interval . H . influenzae meningitis in adults is discussed.

Int J Technol Assess Health Care, 1994 Winter, 10(1), 7 - 13
The promise of new technologies; La Montagne JR et al.; Efforts to provide the benefits of immunization to the world's children have reached an important crossroad . While remarkable progress has been achieved in successfully administering six important childhood vaccines (diphtheria, tetanus, polio, pertussis, measles, and tuberculosis), the benefits of new vaccines, such as hepatitis B and Haemophilus influenzae type B glycoconjugate vaccines, have not been realized except in the most developed countries . The three reasons often cited to explain this problem include poor access to immunization services, the evolution of complex primary immunization schedules, and the additional expense associated with new vaccines, potentially depleting scarce resources . The establishment of the Children's Vaccine Initiative is an organized effort to improve immunization by both technological and organizational innovation . Simplification of the vaccination process can be achieved by developing new combination vaccines or reducing the number of immunizations with vaccines that stimulate protective immune responses . Improvements in the organization of efforts to immunize children will also enhance the prospects of protecting the world's children from infectious diseases . To achieve the goals articulated in the Declaration of New York, the issues of transition from the old to the new vaccines must be addressed . Research on vaccines and technological innovation at all levels will be required to achieve these goals.

Int J Technol Assess Health Care, 1994 Winter, 10(1), 167 - 76
Glycoconjugate vaccines . What next?
Stein KE.
The principle that infants can be protected from invasive diseases caused by encapsulated organisms has been proved with the introduction of Haemophilus influenzae type b conjugate vaccines . The use of glycoconjugates to implement some of the goals of the Children's Vaccine Initiative requires a clear delineation of the chemical and immunological specifications for optimal vaccines.

Int J Technol Assess Health Care, 1994 Winter, 10(1), 143 - 53
Maternal immunization to prevent infectious diseases in the neonate or infant; Insel RA et al.; The approach of providing passive protection to young infants by immunizing pregnant women can bypass the problems of immunological immaturity in the neonate, avoid or delay active immunization of the infant in the first year of life, and prevent transmission of an infection from the mother to the neonate . Optimal vaccines for this approach should induce high immunoglobulin G antibody titers that quickly reach their maximum level after immunization and persist at protective levels for several years, thus providing passive protection in subsequent pregnancies . Specific applications of this approach include the worldwide practice of maternal immunization with tetanus toxoid vaccine and ongoing studies of maternal immunization to prevent Haemophilus influenzae type b, group B streptococcal, pneumococcal, meningococcal, and human immunodeficiency virus infection in the infant . Addressing the cultural, sociological, and legal aspects of maternal immunization will be required to ensure the success of this approach.

FEMS Immunol Med Microbiol, 1994 Jan, 8(1), 63 - 8
In vivo human immune response to transferrin-binding protein 2 and other iron-regulated proteins of Neisseria meningitidis; Ferreiros CM et al.; When grown under iron restriction, Neisseria meningitidis expresses new outer-membrane proteins, some of which are antigenic and potentially useful as vaccine components . This is particularly relevant to N . meningitidis serogroup B, against which neither polysaccharide nor conjugate vaccines are effective . We investigated recognition of N . meningitidis serogroup B outer-membrane antigens by three sera from patients recovered from meningitis . Recognition of antigens from the homologous strain provided information on in vivo expression during infection and immunogenicity, while cross-reactivity with outer membrane proteins from the other two strains and from another five strains in our collection allowed evaluation of antigenic heterogeneity . Our results demonstrate that transferrin-binding protein 2 (TBP2) is immunogenic in humans, to varying degrees depending on the strain, and that TBP2s (like the equivalent proteins of Haemophilus influenzae type b) are among the most important iron-regulated outer membrane antigens expressed during infection . Other immunogenic outer membrane proteins (some iron-regulated) are also expressed during infection; in a previous study in mouse, three of these proteins (with M(r) of 50, 70 and 77 kDa) did not induce an immune response . Our cross-reactivity data provide some support for Robki et al.'s two-group classification of N . meningitidis strains, and provide evidence against the possibility that the antigenic domains shared by the TBP2s of all N . meningitidis strains induce immune responses in vivo.

Enferm Infecc Microbiol Clin, 1994 Jan, 12(1), 34 - 7
{Bacteremia caused by Haemophilus influenzae with special reference to its relation to HIV infection}; Teira R et al.; BACKGROUND: The association between infection by Haemophilus influenzae and infection by the human immunodeficiency virus (HIV) has been clearly demonstrated . However, some characteristics of this association still remain poorly defined . METHODS: The medical records of all adult patients admitted to a general hospital over a period of four years with blood cultures positive for Haemophilus influenzae were reviewed . Patients were grouped according to whether HIV infection or no evidence of HIV infection existed . Clinical and epidemiologic data were collected and compared . The main features of data corresponding to seropositive patients are reported . RESULTS: Of a total of 29 cases of bacteremia by Haemophilus influenzae, 19 were diagnosed in adults: 5 in patients with HIV infection and 14 in patients without HIV infection . Over the following 18 months one additional case was reported . The incidence (calculated in cases per 100,000 people/year) was 1.9 in the general population, 1.5 in adults, 70 in adults with HIV infection and 360 in AIDS patients . All the cases diagnosed in adults below the age of 30 years were reported in HIV carriers . Five of the 16 (31%) H . influenzae strains tested were resistant to ampicillin, with a significant difference being found between those isolated from HIV positive patients (4/5) and from HIV negative patients (1/11) . No patient with HIV infection died during the episode . But five of the HIV negative adults died . CONCLUSIONS: HIV infection seems to be frequent risk factor for bacteremia by Haemophilus influenzae . It should always be considered on diagnosis in adults under the age of 30 . Likewise, the high probability of resistance to ampicillin should also be taken into account for the empiric treatment.

Enferm Infecc Microbiol Clin, 1994 Jan, 12(1), 21 - 5
{Clinical and etiological features of community-acquired pneumonia in the elderly}; Llorente JL et al.; BACKGROUND: The aim of the present study was to know the clinical and etiologic features of community-acquired pneumonia (CAP) in elderly patients requiring hospital admission . METHODS: A prospective study of 36 consecutive patients aged over 70 years, admitted to a general hospital was performed . Standard analytical determinations, blood cultures, and serologic studies were performed in all patients using invasive techniques: aspirative transthoracic puncture (ATP) with ultrafine needle in 35 (97%) cases, and telescopic catheter (TC) in 1 case . RESULTS: The mean age was 79 years (range: 71-90) . Twenty-two patients had received antibiotic treatment prior to admission (61%) and 17 (47%) presented chronic debilitating diseases . The clinical characteristics of CAP were "typical" with acute presentation in most . Fifteen cases (42%) were etiologically diagnosed and the most frequently isolated agents were Streptococcus pneumoniae (22%) and Haemophilus influenzae (8%) . Empiric treatment was changed on the basis of isolations in 7 cases (19%) . Eight patients died (22%) . CONCLUSIONS: According to our results community-acquired pneumonia in the population studied: 1) generally showed an acute presentation with "typical" characteristics, carrying a high mortality rate (22%), 2) is of bacterial etiology, with S . pneumoniae and H . influenzae being the most frequently isolated microorganisms, 3) the use of ATP in community-acquired pneumonia offers a high diagnostic effectiveness, good tolerance and low risk of complications.

Soz Praventivmed, 1994, 39(1), 56 - 62
{Vaccination coverage of 2-year-old children in Geneva}; Bouvier P et al.; OBJECTIVE: To measure the immunization uptake among 2 year-old children living in Geneva . METHODS: Review of the vaccination cards, systematically checked because of the compulsory vaccination against diphtheria, during the year in 1991 . RESULTS: 3937 immunization cards were reviewed, ie . 93.6% of the children in the given age group . Immunization uptake rates were, for diphtheria and tetanus (3 doses) 96.8%; pertussis (3 doses) 96.1%; poliomyelitis (3 doses) 96.6% . For measles, mumps and rubella vaccine (MMR) (1 dose), 78.4% . For the Haemophilus influenzae b vaccine, recently introduced: 68.5% . The uptake rate for MMR was lower among children of swiss origin (75.5%) than among children of other nationalities (84.6%, p < 0.0001) . The highest rates were found among children coming from southern Europe and Latin America . CONCLUSIONS: From the point of view of the community risk, immunization uptake rates for diphtheria, tetanus, pertussis and poliomyelitis can be considered satisfactory . For MMR vaccine, the rate was higher than 2 years earlier, but still insufficient, compared to the level which could block the transmission of the target diseases in the population . The persistence of such a low rate of immunization uptake will not prevent the occurrence of epidemics in the population.

Eur Respir J, 1994 Jan, 7(1), 94 - 101
The intrabronchial microbial flora in chronic bronchitis patients: a target for N-acetylcysteine therapy?
Riise GC, Larsson S, Larsson P, Jeansson S, Andersson BA.
Chronic bronchitis is common among smokers, often together with recurrent infectious exacerbations . Streptococcus pneumoniae and Haemophilus influenzae are the pathogens traditionally considered most important . N-acetylcysteine (NAC) treatment has been shown to reduce the number of infectious exacerbations in patients with chronic bronchitis . The mechanism behind this is unknown . We attempted to characterize the intrabronchial bacterial flora in patients with chronic bronchitis in an infection-free interval, and to determine whether pharmacological and immunological factors effected the bacterial occurrence . Twenty two smokers with non-obstructive chronic bronchitis, 19 smokers with chronic bronchitis and chronic obstructive pulmonary disease (COPD) and 14 healthy nonsmokers underwent bronchoscopy . To obtain uncontaminated intrabronchial samples, a protected specimen brush was used . Quantitative bacterial cultures and virus isolations were performed . Significantly positive bacterial cultures (> 1,000 colony-forming units (cfu).ml-1) were found only in the patients . S . pneumoniae and H . influenzae were found in five patients, and only in the patients without NAC treatment . The most common bacterium was alpha-haemolytic streptococcus . Negative cultures were more common in the healthy controls . Of the various factors examined, only NAC medication had an influence on bacterial numbers . Significantly fewer patients with NAC medication had positive cultures (3 out of 16) than in the group of patients without NAC therapy (15 out of 21) . Our results confirm that chronic bronchitis in smokers leads to increased intrabronchial bacterial colonization . We could also confirm that 1,000 cfu.ml-1 is an adequate cut-off level for significant bacterial growth when using the protected specimen brush . NAC medication was associated with low bacterial numbers.

Eur Respir J, 1994 Jan, 7(1), 102 - 4
Two family outbreaks of Chlamydia pneumoniae infection; Blasi F et al.; During autumn 1992, we observed two unrelated family outbreaks of Chlamydia pneumoniae infection . Family A consisted of grandmother (aged 77 yrs), father (aged 41 yrs), mother (aged 38 yrs), daughter (aged 10 yrs), and two sons (aged 6 yrs and 3 months, respectively) . The grandmother and daughter suffered from pneumonia, father from pharyngitis and bronchitis and the older son from mild bronchitis . No symptoms were recorded in the mother and younger son . Symptomatic subjects showed a fourfold increase in immunoglobulin G (IgG) titre for Chlamydia pneumoniae, determined by a microimmunofluorescence test with specific antigen (TW-183) . Other serological studies against Mycoplasma pneumonia, Legionella pneumophila, influenza virus type A and B, adenovirus and respiratory syncytial virus (RSV) were negative . Sputum culture gave a positive result for Haemophilus influenzae, colony forming units (cfu) = 10(4).ml-1 in the grandmother . No serum positivity was recorded in the mother and younger son, who remained asymptomatic . All symptomatic patients were successfully treated with macrolides . Family B consisted of mother (aged 63 yrs) and daughter (aged 36 yrs) . Both suffered from Chlamydia pneumoniae pneumonia . Diagnosis was made by means of serological microimmunofluorescence test, and direct identification using an indirect immunofluorescence test on pharyngeal swab . Sputum culture and other serological tests remained negative . Both patients were successfully treated with macrolides . These observations emphasize the relevance of Chlamydia pneumoniae in family cluster respiratory infections.

Arch Pediatr Adolesc Med, 1994 Jan, 148(1), 51 - 6
Eradication of Haemophilus influenzae type b disease in southern California . Kaiser-UCLA Vaccine Study Group; Vadheim CM et al.; OBJECTIVE: To assess the effects of Haemophilus influenzae vaccination of infants . RESEARCH DESIGN: We evaluated H influenzae type b (Hib) disease rates in Los Angeles County, California (population, 9 million; 1983 through 1992), and in the Southern California Kaiser Health Plan (2.5 million enrollees; 1988 through 1992) during the past decade . Cases were obtained through active and passive disease surveillance in the two populations . The following vaccines were used during the study period (1983 through 1992): (1) Hib polysaccharide vaccine (polyribosyl ribitol phosphate) (used from 1985 through 1987 for children 24 through 60 months of age); (2) Hib polysaccharide-diphtheria toxoid conjugate, Hib polysaccharide CRM197 mutant diphtheria toxoid conjugate vaccine, and Hib polysaccharide outer-membrane protein of group B meningococcus conjugate vaccine in older children (1988 through 1990; ages 15 through 60 months); and (3) Hib polysaccharide CRM197 mutant diphtheria toxoid conjugate vaccine and Hib polysaccharide outer-membrane protein of group B meningococcus conjugate vaccine used in infants (1991 through 1992) . MEASUREMENTS AND RESULTS: Between 1983 and 1988, the Hib disease incidence in Los Angeles County was unchanged (32.7 to 42.5/100,000 person-years in children younger than 5 years) . In 1989 through 1990, before Hib conjugate licensure for infant use, Hib disease rates in all age groups declined . After licensure of Hib vaccines for infants in 1990, there was a further fivefold decrease in infants . More dramatic decreases occurred in the better-immunized Kaiser Health Plan children aged 0 through 60 months (53 cases in 1989, only two cases in 1992) . CONCLUSIONS: The Hib disease has been nearly eradicated in a fully immunized population (Kaiser Health Plan), and significant reductions have also occurred in Los Angeles County.

Arch Pediatr Adolesc Med, 1994 Jan, 148(1), 47 - 50
Epiglottitis in children, 1979 through 1992 . Effects of Haemophilus influenzae type b immunization; Gorelick MH et al.; OBJECTIVE: To examine secular trends in the epidemiology, bacteriology, and clinical presentation of acute epiglottitis in children in the years surrounding the introduction of vaccine against Haemophilus influenzae type b . DESIGN: Retrospective chart review of patient series . SETTING: Large, urban, tertiary care pediatric hospital . SUBJECTS: One hundred forty-two children with epiglottitis admitted during a 14-year period (1979 through 1992) . MAIN RESULTS: The average annual incidence of epiglottitis declined from 10.9 per 10,000 admissions before 1990 to 1.8 per 10,000 admissions from 1990 through 1992 . The median age increased from 35.5 months in the earlier period to 80.5 months (P = .007) . Overall, H influenzae type b was identified as the causative organism in 76% of patients, but in only 25% of the cases since 1990 (P = .004) . Of the eight cases from 1990 through 1992, three had group A beta-hemolytic streptococcus isolated from a surface culture of the epiglottis; three other cases of group A beta-hemolytic streptococcus were identified earlier . These patients were significantly older than those with H influenzae type b disease (117.5 vs 35 months, P = .004) . No important differences were found in any of a number of clinical characteristics based on causative organism or year of diagnosis . CONCLUSION: Acute epiglottitis has diminished in frequency since 1990 . Patients whose conditions have been diagnosed since then tend to be older and to have disease caused by organisms other than H influenzae type b (particularly group A beta-hemolytic streptococcus) . However, the clinical presentation appears to be similar to that seen previously.

Sex Transm Dis, 1994 Jan-Feb, 21(1), 36 - 42
Enzyme immunoassays (EIAs) for the detection of anti-Haemophilus ducreyi serum IgA, IgG, and IgM antibodies; Roggen EL et al.; BACKGROUND AND OBJECTIVES: Chancroid is a risk factor for heterosexually acquiring HIV . Controlling its spread may reduce HIV transmission . GOAL OF THE STUDY: To develop EIAs for assessing antibody levels and for seroepidemiologic studies . STUDY DESIGN: Anti-Haemophilus ducreyi IgA, IgG and IgM EIAs were standardized using a crude cocktail antigen . Evaluation was on sera from Kenya, Rwanda, Thailand and The Gambia . The two-tailed student's t test was used to compare results . RESULTS: The specificity of IgA was 97% (95% confidence interval (CI): 95-99%), of IgG was 92% (95% CI: 89-95%), and of IgM was 99% (95% CI: 98-100%) . The sensitivity of IgA was 88% (95% CI: 83-93%), of IgG was 93% (95% CI:89-97%), and of IgM was 78% (95% CI:71-85%) in patients having an ulceration for more than eight days . Thus, 95% (95% CI:92-98%) of the chancroid patients were seropositive for at least one antibody type . The IgG and IgA EIAs were more sensitive in patients older than 24 years of age . Higher IgG rates were found in HIV infected chancroid patients . CONCLUSION: The EIAs should be useful for studying the kinetics of antibody levels and the epidemiology of H . ducreyi infectionPIP: In Belgium, the Department of Infection and Immunity of the Institute of Tropical Medicine in Antwerp modified an experimental enzyme immunoassay (EIA) for the detection of serum IgG to Hemophilus ducreyi to develop EIAs for detection of anti-H . ducreyi IgA and IgM antibodies . They tested the modified EIA on sera from people in Nairobi, Kenya; Kigali, Rwanda; Banjul, The Gambia; and Bangkok, Thailand, who had a sexually transmitted disease . The EIA was able to identify correctly those who did not have anti-H ducreyi IgA, IgG, and IgM antibodies in 97%, 92%, and 99% of cases, respectively . Among people with a genital ulceration for more than 8 days, it was able to identify correctly those who had IgA, IgG, and IgM antibodies in 88%, 93%, and 78% of cases, respectively . 95% of all culture-proven chancroid patients tested seropositive for at least 1 antibody type . The sensitivity of IgG and IgA EIAs was significantly enhanced in patients with culture-proven chancroid who were older than 24 years old (p .01) . HIV seropositive people from Kigali who had culture-proven chancroid had higher anti-H . ducreyi IgG seropositivity rates (but not IgA and IgM seropositivity rates), than did HIV seronegative chancroid people from Kigali (p .05) . The increased IgG seropositivity rate was not related to higher antibody titers, however, suggesting that HIV infection modifies the response to H . ducreyi . These results show that the 3 EIAs hold promise as a means to study the kinetics of antibodies and the epidemiology of chancroid .

Sex Transm Dis, 1994 Jan-Feb, 21(1), 13 - 23
Development of a polymerase chain reaction assay for the detection of Haemophilus ducreyi; Johnson SR et al.; BACKGROUND AND OBJECTIVES: Haemophilus ducreyi, the causative agent of chancroid is a fastidious organism difficult to culture and identify . Consequently, culture is an insensitive method for diagnosis . The polymerase chain reaction (PCR) offers a sensitive and specific nonculture method for the detection of bacterial pathogens . STUDY DESIGN: A polymerase chain reaction (PCR) assay was developed to detect the presence of Haemophilus ducreyi . A pair of primers was selected from sequences of an anonymous fragment of DNA cloned from H . ducreyi . The primers were tested in amplification reactions with both purified DNA and lysed organisms for their ability to detect H . ducreyi, and with DNA from a variety of different bacteria for their specificity . The utility of the primers for the detection of H . ducreyi in samples taken from genital ulcers was also tested and compared with culture . RESULTS: PCR was positive for 62% of the specimens that were culture-positive, however, PCR was also positive for 49% of the culture-negative specimens . Comparison of specimens that were dark field positive for T . pallidum and PCR-positive with those that were culture-positive for herpes simplex virus and PCR positive suggested that PCR was giving true and not random positive results . Additional studies demonstrated that the failure of PCR to detect H . ducreyi in all of the culture-positive specimens probably resulted from inhibitors of the Taq DNA polymerase that were present in the nucleic acids extracted from the clinical specimen . CONCLUSION: PCR should be a useful method for the detection of H . ducreyi in genital lesions, especially where culture sensitivity is poor . However, the presence of unidentified Taq polymerase inhibitors in some ulcers specimens require the development of improved methods for specimen handling.

West J Med, 1994 Jan, 160(1), 31 - 7
The new macrolides . Azithromycin and clarithromycin; Kanatani MS et al.; Clarithromycin and azithromycin are among the new generation of macrolides that have recently been approved for use . Compared with currently available antibiotics, these agents may be given less frequently and, in the case of azithromycin, for a shorter duration . In vitro data suggest an antimicrobial advantage of both clarithromycin and azithromycin against atypical mycobacterial and toxoplasmal species and possibly Haemophilus influenzae . The cost of both these agents is substantially higher than that of erythromycin and doxycycline, although the convenience of single-dose azithromycin is appealing compared with a 7-day course of doxycycline for chlamydial urethritis and cervicitis . These agents appear to offer advantages over erythromycin in the treatment of Mycobacterium avium-intracellulare . Additional data are needed to establish their role in other bacterial infections.

J Clin Microbiol, 1994 Jan, 32(1), 187 - 9
Evaluation of API NH, a new 2-hour system for identification of Neisseria and Haemophilus species and Moraxella catarrhalis in a routine clinical laboratory; Barbe G et al.; API NH is a new 2-h system (bioMerieux, La Balme-les-Grottes, France) for the identification of most Neisseria and Haemophilus spp . of clinical significance and of Moraxella catarrhalis and for the detection of penicillinase production . Furthermore, this system allows the biotyping of Haemophilus influenzae and Haemophilus parainfluenzae . Three hundred eighteen strains belonging to these species, previously identified by conventional methods, were tested . Among the 305 strains belonging to species included in the data base, 225 (73.8%) were identified without additional tests, 79 (25.9%) were correctly identified after extra tests, and 1 strain (0.3%) was misidentified . For 131 (90.3%) of the 145 H . influenzae and H . parainfluenzae strains, results of biotyping were in agreement with results of standard methods . API NH is an accurate and reliable method for the routine identification of these bacteria in a clinical laboratory, for biotyping of Haemophilus spp., and for the detection of penicillinase-producing strains . The system is ready to use and time saving; inoculation of the system and reading of results are easy.

Jpn J Antibiot, 1994 Jan, 47(1), 11 - 21
{In vitro antimicrobial susceptibilities and beta-lactamase production of clinical isolates . beta-Lactamase Study Group in Chubu-area}; Ito Y et al.; Antimicrobial susceptibilities and beta-lactamase production of clinical isolates from 1986 to 1991 except 1988 were determined . beta-Lactamase was detected frequently in Escherichia coli (84.7%), Klebsiella pneumoniae (65.4%), Staphylococcus aureus (62.3%), and not frequently in Haemophilus influenzae (22.4%) . Methicillin-resistant S . aureus was also resistant to many antimicrobials except to arbekacin and minocycline, and imipenem showed markedly high activity against methicillin-sensitive S . aureus . Susceptibilities of E . coli and K . pneumoniae to cefuzonam, imipenem and ofloxacin were quite high and that of H . influenzae to ofloxacin and cefuzonam was also very high.

Pediatr Pulmonol, 1994 Jan, 17(1), 6 - 10
C-reactive protein is not a useful indicator of intermittent bacterial colonization in early lung disease of patients with cystic fibrosis; Watkin SL et al.; C-reactive protein (CRP) is a general marker of the systemic inflammatory response to bacterial infection . Serial measurement of CRP is useful in monitoring respiratory exacerbations in patients with cystic fibrosis (CF) and chronic infection with Pseudomonas aeruginosa . We hypothesized that regular monitoring of CRP in young children with CF prior to colonization with P . aeruginosa might provide an objective guide to the need for antibiotic treatment . Twenty-two children were studied prospectively over a 6 month period . We measured CRP every 2 months and at the beginning and end of respiratory exacerbations . In samples taken when the children were well, median CRP was 0.45 microgram/mL compared with 1.92 micrograms/mL when they were symptomatic with positive culture results (P < 0.05) . Despite this difference there was considerable overlap between CRP levels for infected and noninfected patients . A CRP value of > 1.82 micrograms/mL (the upper 95% confidence interval for a control group of well children without CF) had a sensitivity of 49% and a specificity of 83% in determining a symptomatic exacerbation . We conclude that in this group of patients CRP measurements were of little value in monitoring respiratory exacerbations in patients who become intermittently infected with either Haemophilus influenzae or Staphylococcus aureus.

Przegl Epidemiol, 1994, 48(1-2), 39 - 44
{Polysaccharide vaccines against Haemophilus influenzae type B}; Wysokinska T et al.; Epidemiological situation of Haemophilus influenzae infection was described . Conjugated polysaccharide vaccines used all over the world and available in Poland were discussed according to their efficacy and safety.

Scand J Infect Dis Suppl, 1994, 93, 33 - 9
Bacterial resistance in eastern Europe--selected problems; Hryniewicz W; The profile of infection and pattern of bacterial resistance in Eastern Europe is distinct from that observed in other parts of the world . Several Polish investigations have reported that environmental pollution may increase the risk of respiratory disease . Studies from Hungary and Romania have documented a dramatic increase in the proportion of Streptococcus pneumoniae strains resistant to antibiotics . In comparison, resistance to these agents amongst Polish pneumococci isolates is lower, although these pathogens and Streptococcus pyogenes have displayed increasing tetracycline resistance . 20% of Polish Haemophilus influenzae isolates and a high percentage of Moraxella catarrhalis strains exhibit ampicillin resistance . Methicillin-resistant Staphylococcus aureus (MRSA) has been found to constitute 22% of Polish S . aureus strains . Two major clones of MRSA have been identified in Poland which differ in their degree of antimicrobial resistance . The pattern of antimicrobial resistance amongst Polish respiratory pathogens is undoubtedly a reflection of management policies and the use of these drugs . It is hoped that the economic and political changes taking place within Eastern Europe will provide the information and resources to establish more efficient infection control and antibiotic policy and thus delay and limit the appearance of bacterial resistance.

Scand J Infect Dis Suppl, 1994, 93, 20 - 32
Microbiology and management of otitis media; Brook I et al.; Otitis media is a complex and multifactorial condition with four defined stages: myringitis, acute otitis media, secretory (serous) otitis media and chronic otitis media . Drugs utilized in its treatment are antihistamines, decongestants, mucolytic agents, non-steroidal anti-inflammatory agents, corticosteroids, vaccine therapy and antibiotics . The rationale for using antibiotics is that inflammation has been associated with the presence of virulent bacteria in all types of otitis media . In acute otitis media the major organisms, present are Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis . In chronic otitis media these organisms, plus Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa and anaerobic bacteria are all prevalent . The microbiological flora of the middle ear in secretory otitis media is almost identical with that in acute otitis media . Empirical therapy can be given in most instances of acute and serous otitis media . However, in cases of failure, in the immunocompromised and in instances of chronic otitis media, establishing the individual microbiology of the inflamed middle ear is very helpful . The growing resistance of H . influenzae and M . catarrhalis to amoxycillin, due to beta-lactamase production, increases the risk of treatment failure of acute and serous otitis media . By adding a beta-lactamase inhibitor (clavulanic acid) to amoxycillin, or using second-generation cephalosporins, clearance can be achieved . Management of chronic otitis media requires surgical correction, drainage and coverage of anaerobic bacteria with agents such as amoxycillin plus clavulanic acid, or clindamycin plus antimicrobials against other pathogens such as Pseudomonas spp . where present.

Scand J Infect Dis, 1994, 26(2), 141 - 7
Interferon-gamma in cerebrospinal fluid from patients with viral and bacterial meningitis; Glimaker M et al.; Interferon (IFN)-gamma was analysed immunologically in cerebrospinal fluid (CSF) sampled in the acute phase from 27 patients (15-66 years) with viral meningitis and from 18 patients (0.5-90 years) with bacterial meningitis . Increased CSF concentrations were observed in 19/27 viral and in 13/18 bacterial cases . CSF-IFN-gamma did not distinguish between viral and bacterial meningitis . Five of 8 patients with meningitis due to herpes simplex virus type 2 (HSV-2) had CSF-IFN-gamma levels above the highest found in enteroviral meningitis . Thus, a markedly increased CSF-IFN-gamma value in patients with suspected viral meningitis ought to indicate HSV-2 etiology . The patients with Streptococcus pneumoniae meningitis (6 adults and 1 child) had significantly higher levels than the 7 children with Haemophilus influenzae meningitis . This may indicate that S . pneumoniae induces more IFN-gamma secretion than H . influenzae, and/or that during meningitis, adults are more apt to react with IFN-gamma production, than are children.

Diagn Microbiol Infect Dis, 1994 Jan, 18(1), 41 - 7
In vivo therapeutic efficacy of cefdinir (FK482), a new oral cephalosporin, against Staphylococcus aureus and Haemophilus influenzae in mouse infection models; Cohen MA et al.; Cefdinir (FK482), a new oral cephalosporin, displayed potent oral activity versus induced infections in mice . In studies using beta-lactamase-nonproducing (beta LAC-) and -producing (beta LAC+) Staphylococcus aureus strains, respective PD50s (in mg/kg) were 11 and 24 for preventing subcutaneous abscess and 2.7 and 2.3 for preventing lethal systemic infection . In studies using beta LAC- and beta LAC+ Haemophilus influenzae, respective PD50s were 5.8 and 3.1 for preventing lethal systemic infection . Time-kill studies versus H . influenzae showed that 6- to 12-mg/kg dosing was effective in reducing viable counts of these strains in blood by > or = 100-fold by 24 h after challenge . This in vivo performance was comparable to or exceeded values generated by cefaclor, cefpodoxime proxetil, and ampicillin.

Am J Nephrol, 1994, 14(1), 67 - 71
Concurrent presentation of hemolytic uremic syndrome in two adult siblings: effects of plasma therapy on hemolysis and renal function; von Gameren II et al.; We describe 2 sisters who presented with the hemolytic uremic syndrome (HUS) almost simultaneously . In both patients an upper airway infection with Haemophilus influenzae immediately preceding HUS may have been the environmental trigger . Fresh plasma infusion had only minor therapeutic effects but plasma exchange was followed by hematological remissions . One patient stayed dialysis dependent, the other had slow recovery of renal function on prolonged plasma exchange . These case histories suggest that in genetically predisposed patients HUS can be triggered by an infection with H . influenzae . Furthermore, when there is a poor response to plasma infusion recovery may be accelerated by plasma exchange.

Zh Mikrobiol Epidemiol Immunobiol, 1994 Jan-Feb, (2), 49 - 53
{Respiratory chlamydial infection in children with a complicated course of acute respiratory viral infections}; Kvetnaia AS et al.; The role and influence of Chlamydia trachomatis on the development and course of acute respiratory virus infections (ARVI) in 130 children admitted to the hospital of the Research Institute of Children's Infections (St . Petersburg) was studied . The occurrence of respiratory Chlamydia infections in ARVI patients with an unfavorable premorbid background was 35-36% . The disease took its course simultaneously with the mixed infection of the respiratory tract with viruses, pneumococci and their associations with staphylococci and Haemophilus influenzae . Chlamydia infection in children had no influence on the character of the clinical manifestation of ARVI with the exception of the obstruction syndrome which was constantly observed in children with ARVI (p < 0.001).

Bull Soc Pathol Exot, 1994, 87(1), 22 - 7
{Importance of culture media choice in the isolation of Haemophilus ducreyi . Experience in Senegal}; Dieng Sarr A et al.; Genital ulcerations typify one of the major reasons clients seek STD consultation in developing countries . The usual etiologies are syphilis, chancroid and herpes . The ideal diagnostic approach is to undertake complete laboratory examination that are rarely possible in structure destitute of laboratory analysis possibilities which is the case for most of the STD transmission agents . Chancroid is caused by Haemophilus ducreyi, a short Gram negative bacteria . The bacteriological diagnosis is based on direct examination, isolation and identification of the bacteria . The nutritive exigence of the bacteria required 3 medium of isolation (PPLO base Pasteur), GC base (GIBCO) and Muller Hinton base (Becton & Dickinson, with "chocolate" agar) have been tested from the chancre samples of 108 male patients who had a median age of 31 years . Direct exams were positive in 66 cases (61%) and culture exams positive in 53 cases (49%) . The Muller Hinton base with "chocolate" agar produced the best results and seems to be the medium of choice for isolated strains in Senegal . The culture mediums currently used in Europe are apparently inappropriate for the germ culture in Senegal . We have also observed that all the isolated strains were producers of beta-lactamase . Antibiotic treatment before the sample swab is taken seems to have an inhibiting effect on the culture . Direct examination with a sensibility of 94.3% and a specificity of 70.9% remains sufficient in routine presumptive diagnosis in endemic areas.

Ann Fr Anesth Reanim, 1994, 13(3), 280 - 4
{Comparison of amoxicillin and cefamandole in the prevention of bronchopulmonary infections in pulmonary surgery . A randomized double-blind study}; Train M et al.; Antibiotic prophylaxis is currently recommended in clean-contamined surgery (type II of Altemeier classification) . Pulmonary surgery belongs to this type . This prospective randomized and controlled study was designed to compare amoxicillin and cefamandole for prevention of pleural and bronchopulmonary infections after pulmonary resections . It included 256 patients, admitted between October 1st 1989 and July 1st 1991, for elective thoracotomy and probable pulmonary resection . The patients were allocated into two groups, group A (amoxicillin) and group C (cefamandole) . The first intravenous antibiotic injection took place immediately after induction of anaesthesia (1 g of amoxicillin or 1.5 g of cefamandole) . Postoperative injections were performed every 6 hours during 36 hours (i.e . a total of 6 injections) . Infection was defined by the association of general signs including hyperthermia (> 38 degrees C), hyperleucocytosis (> 12,000/mm3), and local signs such as bronchitis (B), pneumonia (P), empyema (E), wound sepsis (W) and non thoracic infection (S) . Follow-up included the hospital stay and a period of eight months after surgery for possible rehospitalisation for infection . Respiratory infections (bronchitis n = 35, pneumonia n = 5, empyema n = 2) occurred in 18% of the total population . No difference was seen between the two groups concerning the type of infection and the repartition of infection in relation to the type of pulmonary surgery . The causative bacterial organisms were Haemophilus influenzae (n = 4), Streptococcus pneumoniae (n = 2), Escherichia coli (n = 1), anaerobic bacteria (n = 1) . Multiple bacteria were found in one case . The empyema and wound sepsis occurred in the amoxicillin group.(ABSTRACT TRUNCATED AT 250 WORDS)

Ann Dermatol Venereol, 1994, 121(2), 127 - 30
{Chancroid in Yaounde . Apropos of 42 cases}; Koueke P et al.; In Yaounde, chancroid occurs frequently among adolescents and young men (95 p . 100 of the cases) who have sexual contacts regularly with prostitutes . Apart of classical clinical forms complicated in 2/3 of cases by inguinal adenopathies, we have observed furuncular chancroid which is quite characteristic of the disease . Giemsa stain represents for us a simple and reliable diagnostic method for this disease because in 1/3 of smears, typical cultural aspects of Haemophilus ducreyi were seen.

Acta Neurochir Suppl (Wien), 1994, 60, 45 - 7
Diffuse astrocytic swelling and increased second messenger activity following acute Haemophilus influenzae meningitis--evidence from a rat model; Maxwell WL et al.; Despite numerous epidemiological analyses of bacterial meningitis there is very little pathological data concerning the acute glial and neuronal responses to the disease . We have developed a safe, easily used rat model for Haemophilus influenzae type b meningitis . We measured cerebral blood flow, glucose utilisation and second messenger activity in this model, and carried out parallel light and ultrastructural analysis of glial and neuronal responses . Only protein kinase C activity was changed from control values . We obtained evidence for massive astrocytic swelling and neuronal degeneration . We posit that cytotoxic mechanisms may contribute to the pathology of meningitis.

Med Dosw Mikrobiol, 1994, 46(1-2 Suppl), 59 - 66
{Bacterial flora of respiratory tract infections}; Bialecka A et al.; In this paper the bacterial flora of respiratory tract diseases of children and adults was described . Significant differences in the frequency of isolation of various species of bacteria in connection with the age and the clinical form of disease were observed . Haemophilus influenzae was isolated from the accessory sinuses of the nose of children with significantly higher frequency than from adults . This microorganism occurred as the only etiological agent in more than 50% of cases.

Pathobiology, 1994, 62(2), 109 - 12
Destruction of human microvascular endothelial cell capillary-like microtubules by Brazilian purpuric fever-associated Haemophilus influenzae biogroup aegyptius; Quinn FD et al.; When grown in the presence of Matrigel, monolayers of an immortalized human microvascular cell line (HMEC-1) form capillary-like microtubule networks . Previous work, using HMEC-1 monolayers, demonstrated a significant difference in in vitro cytotoxicity between Brazilian purpuric fever (BPF)-associated Haemophilus influenzae biogroup aegyptius (HAE) strains and non-BPF-associated HAE strains . The present study demonstrates that BPF-related cytotoxic differences can also be observed in HMEC-1 microtubule networks . At a multiplicity of infection (MOI) of 2 x 10(-2) bacteria/tissue culture cell, BPF-associated strain F3031 disrupted the microtubule network, producing random clumps of rounded cells at 48 h of incubation . Infection with non-BPF-associated strain F1947 at the same MOI produced no observable microtubule disruption . The ability of HMEC-1 microtubule model to differentiate virulent and avirulent HAE in vitro will further aid in the study of BPF pathogenesis . In addition, the fact that the HMEC-1 cells can be induced to form microtubules make it an excellent model system for the general study of many of the agents of vascular purpura.

Lancet, 1994 Jan 1, 343(8888), 12 - 6
Haemophilus parainfluenzae antigen and antibody in renal biopsy samples and serum of patients with IgA nephropathy; Suzuki S et al.; IgA nephropathy may be associated with colonisation with Haemophilus parainfluenzae . In patients with glomerular diseases, we examined renal-biopsy specimens for presence of bacterial antigen by immunofluorescence microscopy with rabbit antiserum against H parainfluenzae, and by enzyme-linked immunosorbent assay looked for IgA antibody against H parainfluenzae in patient sera . The rabbit antiserum recognised by immunoblotting four components of H parainfluenzae outer membranes (OMHP) of molecular weights 19.5, 30, 33, and 40.5 kDa . All 44 patients with IgA nephropathy and 2 of 39 patients with other glomerular diseases showed mesangial deposition of OMHP antigens (p < 0.001) . Patients with IgA nephropathy had significantly more IgA antibody against H parainfluenzae than did patients with other glomerular diseases . IgA antibody in the sera of patients with IgA nephropathy recognised by immunoblotting the same four components of OMHP as recognised by rabbit antiserum . Glomerular deposition of OMHP antigens and the presence of IgA antibody against OMHP in patients with IgA nephropathy suggest that H parainfluenzae has a role in the aetiology of this disease.

J Med Microbiol, 1994 Jan, 40(1), 48 - 54
The role of HSV-induced Fc- and C3b (i)-receptors in bacterial adherence; De Graaf-Miltenburg LA et al.; Herpes simplex virus type-1 (HSV-1) induces Fc- and C3b(i)-receptors on infected cells . The role of these receptors in bacterial superinfection was studied by comparing the adherence of non-opsonised and opsonised bacteria to HSV-infected and non-infected HEp-2 cells . A flow cytometric adherence assay, based on the fluorescent quantitation of FITC-labelled bacteria, was developed . Opsonisation of Staphylococcus epidermidis with human serum, resulted in a marked increase in adherence to HSV-infected cells and revealed a role for C3b(i)R- and FcR-mediated adhesion . However, the enhanced adherence never exceeded the level of attachment to non-infected cells . Increased adherence of other pathogenic bacteria, including Escherichia coli, Streptococcus pneumoniae, Haemophilus influenzae and Pseudomonas aeruginosa was not observed, indicating that the HSV-receptors play a minor role in secondary infections . Bacterial adhesion factors such as the fimbriae of E . coli played a more dominant role in the adherence of bacteria to HSV-infected cells.

Probl Tuberk, 1994, (5), 19 - 21
{Role of immunologic studies in the diagnosis of tuberculosis in adolescents}; Firsova VA et al.; Tuberculous antigens and antibodies, antigens and antibodies to pneumococcus, haemophilus bacteria . Klebsiella pneumonia, proteus bacteria were determined in 100 adolescents (87 with tuberculosis and 13 with nonspecific lung diseases) . Specific antigens and antibodies were detected in 62% of tuberculous and 7.7% of nontuberculous patients . The most pronounced immune response to M . tuberculosis antigens and antibodies as well as to nonspecific flora was registered in patients with long-term and disseminated processes . Immunological investigations are thought an important tool in diagnosis, differential diagnosis of tuberculosis and planning combined treatment policy.

Rev Elev Med Vet Pays Trop, 1994, 47(2), 177 - 9
A clinical note on Haemophilus aegyptius infection in sheep in Nigeria; Akpavie SO et al.; An outbreak of Haemophilus aegyptius infection in a livestock farm located in Maya, Oyo State, Nigeria is reported . Diagnosis was based on clinical signs of central nervous system disturbance, histopathological findings of meningoencephalomyelitis, acute multifocal necrotising purulent hepatitis and the isolation of Haemophilus aegyptius from the spinal cord . Other diseases that can cause nervous disturbance are discussed.

Scand J Infect Dis, 1994, 26(5), 611 - 4
Cost-benefit analysis of general vaccination against Haemophilus influenzae type b in Sweden; Trollfors B; A cost-benefit analysis of general vaccination of infants with a conjugated Haemophilus influenzae type b (HIB) vaccine was performed . Information on incidence and prognosis of HIB meningitis and acute epiglottitis in children was obtained from nation-wide retrospective studies covering the years 1981-83, when the birth rate was approximately 93,000 per year . The annual cost for hospitalization, neurologic and auditory sequelae and parents' absence from work amounted to 54 million Swedish crowns (SEK) . A mean of 6 children died every year . Inclusion of value of lives lost added SEK 72 million to the cost of disease . With vaccine prices (approximately SEK 125/dose) and birth rate (approximately 120,000 per year) prevailing in 1993, vaccine costs would be SEK 45 million, provided that 3 doses are sufficient to offer protection close to 100% . Other costs for vaccination, e.g . physicians' and nurses' time, needles and syringes, are negligible, since the vaccine can be given at the same time as other infant vaccinations at already existing Child Health Centres . In conclusion, general vaccination of infants against HIB is cost-effective, saves lives and reduces human suffering.

Chemotherapy, 1994, 40(6), 399 - 403
Susceptibility of clinically significant Haemophilus influenzae strains to oral antimicrobial agents used in Saudi Arabia; Shibl AM et al.; The incidence of beta-lactamase production by Haemophilus influenzae strains and their susceptibility to commonly used oral antimicrobial agents were evaluated . From 1990 to 1992, 600 significant isolates of H . influenzae obtained from various hospitals throughout Saudi Arabia were identified, serotyped and tested for beta-lactamase production using cefinase discs and susceptibility to various antibiotics using the agar dilution method . The study revealed that 17% of the strains produced beta-lactamase; 21% of them were type b . The overall level of resistance was 30% to erythromycin, 28% to tetracycline, 14.3% to co-trimoxazole, 6.6% to chloramphenicol, 1.8% to amoxicillin-clavulanate and 1.5% to cefaclor . About 1.3% of the strains that did not produce beta-lactamase were resistant to ampicillin . Resistance of H . influenzae to antibiotics is increasing and in several parts of the world resistance to ampicillin has reached substantial levels particularly in type b strains . Information on resistance is needed for the appropriate selection of initial empiric therapy among patients in whom H . influenzae is a suspected pathogen.

Rev Pneumol Clin, 1994, 50(2), 63 - 7
{Treatment of community-acquired pneumonia by pristinamycin (Pyostacine 500) . Results of a non comparative open study}; Petitpretz P et al.; Activity of natural streptogramin (NSG) appears well adapted to pathogens responsible for CAP . The goal of this multicenter pilot study was to bring first data about efficacy of NSG in treatment of CAP . PATIENTS METHOD: Ten days of a NSG (1 gr b.i.d . or t.i.d.) regimen was administered to 46 hospitalized adult patients for CAP defined with fever > 38 degrees C, respiratory symptoms and X-ray opacity . Severely ill patients were excluded . A broncho-pulmonar sample (expectoration or trantracheal aspiration or protected distal sample) was performed in all patients . RESULTS: two patients were excluded because of pulmonary embolism (n = 1) or tuberculosis (n = 1) and 44 patients were analyzed . 50% of them had associated disease, 20% had failure of prior antibiotherapy . At inclusion, mean fever was 39.2 +/- 0.7 degrees C, respiratory rate was 22 +/- 5/mn, PaO2 was 74 +/- 10 mmHg, chest X-ray showed bilateral opacity in 16%, unilateral in 84% and pleural fluid level in 6 cases . Etiological diagnosis was determined in 70% of cases . Streptococcus pneumoniae (n = 14), Haemophilus influenzae (n = 5), Legionella pneumophila (n = 2), Mycoplasma pneumoniae (n = 2) and Chlamydia psittaci (n = 1) were the most frequent isolated pathogens . 40 patients (91%) were cured with NSG and delay to obtain apyrexia was 4.4 +/- 3.9 days . NSG was stopped in 4 patients: 1 clinical and bacteriological failure (Klebsiella pneumoniae), 2 clinical failures (1 pneumococcus with purulent pleurisy, 1 pneumococcus with worsening of respiratory status), 1 patient with resistant H . influenzae strain in spite of favourable clinical evolution . NSG was well tolerated in 86% of patients . CONCLUSION: these data invite to carry on evaluation of first line therapy of CAP with NSG.

Ann Trop Paediatr, 1994, 14(3), 183 - 8
The immunogenicity and safety of Haemophilus influenzae type b-tetanus toxoid conjugate vaccine in Gambian infants; Mulholland EK et al.; In developing countries, Haemophilus influenzae type b is a major cause of meningitis and pneumonia in the 1st year of life . The safety and immunogenicity of a Haemophilus influenzae type b polysaccharide-tetanus toxoid conjugate vaccine (PRP-T) were evaluated in two studies of Gambian infants . In the first study, 131 infants were recruited and randomized into three groups to receive PRP-T at 1 and 3 months (group A), PRP-T at 2 and 4 months (group B) or no PRP-T (group C) . The liquid form of PRP-T was used . The geometric mean titre (GMT) of anti-PRP antibody 1 month after the second dose was 0.26 microgram/ml in group A and 0.41 microgram/ml in group B . In the second study, 66 infants were given PRP-T in the lyophilized form at 2, 3 and 4 months of age . The GMT 1 month after the first dose was 0.09 microgram/ml, after the second 0.74 microgram/ml and after the third 2.32 micrograms/ml . After the third dose, 72% of children had antibody levels greater than 1.0 microgram/ml and 93% greater than 0.15 microgram/ml . No serious side-effects were observed and the rate of adverse reactions was consistent with the concurrent administration of diphtheria-tetanus-pertussis (DPT) vaccinePIP: In Sukuta, Gambia, in 1989, 128 newborns were randomly allocated to receive the liquid form of the Haemophilus influenzae type b (Hib) polysaccharide-tetanus toxoid (PRP-T) vaccine at 1 and 3 months (group A), 2 and 4 months (group B), or not to receive the vaccine (group C) . All these children also received the oral polio vaccine and the diphtheria-pertussis-tetanus (DPT) vaccine . In 1990, in Bakau, Gambia, 66 infants received the lyophilized form of the PRP-T vaccine at the same time as they received DPT vaccine: 2, 3, and 4 months . The investigators aimed to determine the safety and immunogenicity of PRP-T as a forerunner to the upcoming PRP-T efficacy trial in Gambia . In the 1989 study, the geometric mean titer (GMT) of anti-PRP antibody 1 month after the second dose was higher in group B than in group A (0.41 vs . 0.26 mcg/ml) . In the 1990 study, the GMT of anti-PRP antibody was 0.09 mcg/ml after the first dose, 0.74 mcg/ml after the second dose, and 2.32 mcg/ml after the third dose . One month after the final dose, the lyophilized PRP-T vaccine yielded higher antibody levels than the liquid form . For example, 72% of infants in the lyophilized group had an antibody level greater than 1 mcg/ml compared with 18% for the liquid group . 93% of all infants in groups A and B had antibody levels above 0.15 mcg/ml, the level considered to provide immediate protection, compared with 53% for the liquid group . Serious side effects were not observed . The rate of adverse reactions correlated with the concurrent delivery of DPT vaccine . Advantages of the PRP-T vaccine include: it mixes well with DPT; if administered in a three-dose schedule to Gambian infants, it is safe and elicits a protective antibody response in most infants; and it also protects against Hib infection, a major cause of meningitis and pneumonia in infants and an important cause of major childhood-acquired disability in developing countries .

Scand J Infect Dis, 1994, 26(5), 545 - 51
Children with persistent cough--outcome with treatment and role of Moraxella catarrhalis?
Gottfarb P, Brauner A.
52 children with severe cough persisting for more than 10 days were randomized to treatment with amoxycillin/clavulanic acid or placebo in a prospective double-blinded study . Clinically suspected cases of pertussis were excluded, yet 12 (23%) of the children had laboratory verified pertussis infection . The nasopharyngeal colonization showed a predominance of Moraxella catarrhalis which was isolated in 37 (71%) children . Streptococcus pneumoniae and Haemophilus influenzae were isolated in 11 (20%) and 16 (30%) children, respectively . The antibiotic-treated group had a significantly better recovery in both the pediatrician's estimation (p = 0.02) and the independent parental judgement (p = 0.002) . These findings are consistent with the view that Moraxella catarrhalis could be directly involved in the pathogenesis of persistent cough in children.

Ann Trop Paediatr, 1994, 14(2), 97 - 103
Epidemiology of invasive Haemophilus influenzae infections in Cape Town, South Africa; Hussey G et al.; The full spectrum of invasive Haemophilus influenzae disease has not been documented previously in Africa . This 1-year prospective study was designed to determine the epidemiology of invasive Haemophilus influenzae disease in Cape Town children . During this period, 142 children with invasive disease were hospitalized; 85 (59.9%) presented with meningitis, 35 (24.6%) with pneumonia and 22 (15.5%) with other diseases . No cases of epiglottitis were seen . Sixty per cent of cases were male and 40% female . The median age of the children was 9 months, with a range of 1-144 months, and 65.5% were aged < 12 months . Neurological dysfunction was noted in 40% and 18% of children with meningitis on admission and discharge, respectively . The overall case fatality rate (95% confidence intervals) was 9.2% (4.9-15.7), and for meningitis, pneumonia and septicaemia it was 4.7% (1.2-16.4), 14.3% (4.6-31.8) and 40% (8-78.1), respectively . Serotype b accounted for 86.5% of all cases, 97.3% of cases of meningitis, 71.4% of cases of pneumonia, 50% of cases of septicaemia, all cases of arthritis and cellulitis and none of mastoiditis . The incidence rates (95% confidence intervals) for all invasive type b infections were 169 (122-198) and 47 (39-57) per 100,000 population for children < 1 and < 5 years, respectively . For meningitis the rates were 112 (84-148) and 34 (25-40) per 100,000, respectively . Rates for mixed race and white children were similar, but those for black children were more than double those rates.(ABSTRACT TRUNCATED AT 250 WORDS)

J Clin Microbiol, 1994 Jan, 32(1), 54 - 8
Utility of gram stain in evaluation of sputa from patients with cystic fibrosis; Sadeghi E et al.; The utility of sputum Gram stain in assessing salivary contamination and in predicting the presence of pathogens on the basis of morphology was investigated in 287 respiratory specimens from patients with cystic fibrosis . Where acceptability for culture was defined as a leukocyte/squamous epithelial cell ratio of > 5, 76.6% (220 of 287) of respiratory specimens received in the laboratory were considered acceptable . Unacceptable specimens were more common in younger patients . The positive predictive value of the Gram stain for growth from acceptable sputum samples was 98% for Pseudomonas aeruginosa, 84.4% for Pseudomonas cepacia, 86.3% for Staphylococcus aureus, and 100% for Haemophilus influenzae . In cystic fibrosis patients, as has been reported for respiratory specimens in general, Gram stain of respiratory specimens in helpful for interpreting culture results.

Clin Diagn Lab Immunol, 1994 Jan, 1(1), 21 - 5
Antibody response to polyribosyl-ribitol phosphate antigen of Haemophilus influenzae in Ecuadorian and German children; Brussow H et al.; Serum samples from 1,221 Ecuadorian children 0 to 5 years of age and from 236 German subjects were tested by enzyme-linked immunosorbent assay for class-specific antibodies to the capsular polysaccharide of Haemophilus influenzae type b (PRP antigen) . A gradual prevalence increase of and mean titer increase in immunoglobulin M (IgM) antibody was seen in Ecuadorian but not in German children older than 6 months . At the end of the first year of life, about 50% of the Ecuadorian children showed IgM and IgG antibody to PRP . Seroepidemiological analysis revealed that living at a low altitude and lower calorie intake (a proxy measure of breast-feeding) were factors associated with earlier acquisition of PRP antibody . Children from low-altitude areas of Ecuador also experienced significantly more episodes of significant respiratory infections . The acquisition of PRP-reactive antibodies in Ecuadorian children might thus reflect exposure to encapsulated H . influenzae type b in lower respiratory tract infections.

Gene, 1993 Dec 22, 136(1-2), 35 - 40
The sequence of the Haemophilus influenzae mutB gene indicates it encodes a DNA helicase II-like protein; Walter RB et al.; A 6.2-kb Haemophilus influenzae genomic DNA fragment which partially complemented both the mutator and ultraviolet light sensitive (UVs) phenotypes of the H . influenzae mutB1 mutant was isolated . This fragment was also able to complement the UVs phenotype of Escherichia coli uvrD mutant hosts . The uvrD+ gene complemented the mutator phenotype of mutB1 hosts . The nucleotide (nt) sequence of the 6.2-kb fragment revealed an open reading frame (ORF) of 2184 bp . This ORF shows similarity at both the nt and amino acid (aa) levels with the uvrD gene of E . coli . Comparison of the sequences revealed eight regions of aa conservation in addition to seven previously identified helicase superfamily domains . The nt sequence 5' to the mutB ORF contains several potential regulatory motifs, including a LexA-binding site . Based upon these observations, we are confident that the mutB gene of H . influenzae encodes an ATP-dependent DNA helicase-like activity.

Gene, 1993 Dec 22, 136(1-2), 281 - 6
The Haemophilus influenzae dnaG sequence and conserved bacterial primase motifs; Versalovic J et al.; The dnaG gene encodes primase which synthesizes the primer RNA essential for Escherichia coli chromosomal DNA replication . The nucleotide sequence was determined for the Haemophilus influenzae dnaG gene and used in the molecular evolutionary analysis of primases from six bacterial species . The predicted amino acid (aa) sequence of H . influenzae DnaG contains 593 residues and shares 56% identity with E . coli DnaG . The N-terminal 60% of six aligned bacterial primases contains all 71 absolutely conserved aa residues and several conserved motifs . All six bacterial primases which were sequenced contained a conserved CPFHXEKTPSF(T/S/A)VXXXKQX(F/Y)HCFGC zinc finger (zf) in the N terminus . A basic regio