Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us


Vnitr Lek, 1994 Feb, 40(2), 118 - 21
{A review of new cephalosporin antibiotics}; Hupkova M et al.; The authors discuss some properties of recent cephalosporin antibiotics and the antibiotics effectiveness in particular of more recent generations of cephalosporins . The increasing resistance to penicillins and other antibiotics called for use effective cephalosporins of new generations . While cephalosporins of the 1st generation (cephalothin, cephazoline, and oral cephaloridine or cephaclor) are effective against Gram-positive bacteria, haemophilus bacteria and Klebsiellae, the resistance of other bacteria even against these antibiotics is increasing . Mephoxine and cephuroxime belong to the 2nd generation as their spectrum of efficiency is wider . Cephalosporins of the 3rd generation (cefotaxime, ceftriaxone, ceftazidime and others) are effective only against strains resistant to cephalosporins of the older generations . Oral preparations of cephalosporins of recent generations (Loracarbef, cefpodoxim, ceftibutene) are also useful.

Arch Dis Child, 1994 Feb, 70(2), 129 - 32
Successful treatment of epiglottitis with two doses of ceftriaxone; Sawyer SM et al.; Epiglottitis in childhood is caused by Haemophilus influenzae type b . The usual antibiotic treatment at the Royal Children's Hospital, Parkville, Victoria is a five day course of chloramphenicol . Increasingly, third generation cephalosporins are being used to treat invasive H influenzae type b infections and preliminary data suggest that they can be used successfully for epiglottitis . In a prospective, randomised trial, the efficacy of a short course (two days) of ceftriaxone was compared with that of five days of chloramphenicol for the treatment of epiglottitis . The ability of these treatment regimens to eradicate H influenzae type b from the throat was also studied . Fifty five children were enrolled over an 18 month period . Epiglottitis was diagnosed clinically and confirmed on inspection of the epiglottis at direct laryngoscopy . Fifty three (96%) of 55 patients had H influenzae type b detected from at least one site: 44/52 (85%) from blood cultures, 41/47 (87%) from throat swab, and 6/8 (75%) as H influenzae type b urinary antigen . Children were randomised to receive either ceftriaxone 100 mg/kg intravenously followed by a single dose of 50 mg/kg 24 hours later (28 patients), or chloramphenicol 40 mg/kg intravenously, then 25 mg/kg eight hourly for five days, intravenously then by mouth (27 patients) . All household contacts and patients receiving chloramphenicol received rifampicin 20 mg/kg daily for four days . Index patients randomised to ceftriaxone were not treated with rifampicin . There was no significant difference in outcome between the two groups with respect to the mean duration of fever, the duration of intubation, or the length of hospital admission . The proportion of patients colonised with H influenzae type b four weeks after discharge was not significantly different between the two groups: ceftriaxone 5/22 (23%) versus chloramphenicol and rifampicin 3/23 (13%) . A short course of ceftriaxone was successful in treating all patients with no significant side effects and no relapses . A short course of ceftriaxone is a safe, efficacious, and economic alternative to the standard treatment in children with epiglottitis.

J Infect Dis, 1994 Feb, 169(2), 430 - 3
Human microvascular endothelial cell toxicity caused by Brazilian purpuric fever-associated strains of Haemophilus influenzae biogroup aegyptius; Weyant RS et al.; An in vitro cytotoxicity model that uses an immortalized human microvascular endothelial cell line (HMEC-1) differentiates Brazilian purpuric fever (BPF)-associated Haemophilus influenzae biogroup aegyptius (HAE) strains from non-BPF-associated HAE strains . Toxic strains produced a characteristic HMEC-1 phenotype at an MOI of < 1 bacterium/1000 tissue culture cells (TCC) . Nontoxic strains required MOIs of > 1000 bacteria/TCC to produce an observable effect . The cytotoxic phenotype was characterized by the presence of large clumps of HMEC-1 cells, which detached from the monolayer within 48 h of inoculation by HAE cells . The cytotoxic phenotype was observed with 100% of BPF-associated HAE (40/40) and 14% of non-BPF-associated HAE (8/57; P < .001) . The ability to study a BPF-associated phenotype in vitro using human microvascular cells should enhance our knowledge of BPF pathogenesis.

J Infect Dis, 1994 Feb, 169(2), 425 - 9
High-molecular-weight surface-exposed proteins of Haemophilus influenzae mediate binding to macrophages; Noel GJ et al.; The molecular basis for direct bacteria-macrophage interactions that distinguishes nontypeable (NT) Haemophilus influenzae from type b organisms is not known . Because of similarities between filamentous hemagglutinin (FHA) adhesin of Bordetella pertussis and high-molecular-weight (HMW) proteins commonly expressed by NT H . influenzae, the role that HMW proteins play in determining NT H . influenzae-macrophage interactions was assessed . In tests with genetically engineered organisms, HMW protein-expressing bacteria bound significantly better than isogenic HMW protein-deficient bacteria to macrophages . HMW protein-dependent binding to macrophages is trypsin-sensitive, is independent of divalent cations, does not occur via the leukocyte integrin CD11b/CD18, and is not affected by galactose-containing carbohydrates . Organisms bound via HMW proteins remain largely extracellular and viable . Like FHA of Bordetella organisms, HMW proteins mediate binding of NT H . influenzae to macrophages . However, unlike the interaction determined by FHA, this interaction is characteristically one of adhesion and requires additional serum opsonization for efficient killing of bacteria by macrophages.

J Infect Dis, 1994 Feb, 169(2), 337 - 42
Evidence for capsule gene sequences among pharyngeal isolates of nontypeable Haemophilus influenzae; St Geme JW 3rd et al.; Haemophilus influenzae is a common commensal organism of the human respiratory tract and is an important cause of localized and systemic disease . While isolates recovered from the respiratory tract are generally nonencapsulated (serologically nontypeable), isolates from systemic sites typically express a polysaccharide capsule . To explore the possibility that nontypeable strains evolved from encapsulated organisms, a series of serologically nontypeable isolates were examined for the presence of capsule gene sequences . Pharyngeal isolates (123) were collected from healthy 3-year-old Finnish children and examined by Southern hybridization with pUO38, a plasmid that contains one complete set of cap genes from an H . influenzae type b strain . Twenty-four isolates (20%) demonstrated homology with capsule-specific sequences . Of these 24, 18 in addition to 14 others had evidence of one or more copies of IS1016, an insertion element that has been associated with encapsulation in H . influenzae . These results support the hypothesis that nontypeable strains of H . influenzae arose from an encapsulated ancestor . Possibly the selective pressure driving the loss of encapsulation relates to the disadvantage associated with encapsulation during respiratory tract colonization.

Cell Signal, 1994 Feb, 6(2), 187 - 99
Dietary linoleic acid-induced changes in respiratory beta-adrenergic receptor function and the form of arrhenius plots of isoprenaline- and prostaglandin E2-stimulated adenylate cyclase activity in a model for atopy; Loesberg C et al.; Varying dietary linoleic acid altered lung membrane fatty acid composition with linoleic acid content increasing from approximately 6% total in those on 3 en% diet to approximately 14% total fatty acid in those on a 12 en% diet . Accompanying this were two- to three-fold increases in the levels of the elongation products of linoleic acid, namely 20:2 (n-6) and 22:5 (n-6) and a decrease in 18:1 oleic acid from approximately 26% to approximately 19% total . Administration of Haemophilus influenzae, to animals on 6 en% linoleic acid, serving as a model for atopy, effected a small increase in the levels of 22:5 (n-3) and doubled those of 22:6 (n-3) . beta-Adrenergic-induced tracheal relaxation and stimulation of lung adenylate cyclase were elevated by increasing dietary linoleic acid from 3 to 6 en%, although such differences were abolished in the atopic model and when dietary linoleic acid was increased to 12 en% . Arrhenius plots of NaF-stimulated lung adenylate cyclase activities exhibited a break (t1) at approximately 26 degrees C in all dietary groups with unchanged activation energies and activity . In contrast, whilst both isoprenaline and PGE2-stimulated adenylate cyclase activities showed similar break-points in their Arrhenius plots, dietary linoleic acid manipulation markedly altered their form . As with NaF-stimulated activities then, irrespective of dietary manipulation and induction of atopy, these plots showed an invariant break occurring at approximately 26 degrees C . But, for animals on 3 and 6 en% diets, a second break was apparent at approximately 15 degrees C, which was slightly decreased to approximately 12 degrees C upon induction of atopy and completely abolished on increasing dietary linoleic acid to 12 en% . Accompanying such changes were marked alterations in activation energies . We suggest that profound changes in lung plasma membrane bilayer properties occur upon both altering dietary linoleic acid levels and in atopy . These selectively perturb adenylate cyclase activity when it is receptor-stimulated but not when it is activated by direct G-protein stimulation with NaF . We suggest that atopy and dietary challenge elicit an asymmetric perturbation of the plasma membrane that predominantly affects the outer half of the lipid bilayer.

J Chemother, 1994 Feb, 6(1), 35 - 8
In vitro evaluation of cefodizime, cefuroxime, ceftriaxone against respiratory pathogens; Paniara O et al.; The in vitro activity of cefodizime and two comparative cephalosporins, cefuroxime and ceftriaxone were studied against respiratory pathogens . MIC90s of cefodizime were 0.06-0.512 microgram/ml for Streptococcus pneumoniae, Moraxella catarrhalis and Haemophilus influenzae . MIC50s of cefodizime for Klebsiella pneumoniae and Staphylococcus aureus isolates were 2 micrograms/ml and 8 micrograms/ml respectively . Cefuroxime and ceftriaxone at a concentration of 2 micrograms/ml and 1 microgram/ml inhibited 50% of Klebsiella pneumoniae and 50% of Staphylococcus aureus strains studied respectively . Cefodizime inhibited many of the important respiratory pathogens and can be suggested as an active antimicrobial agent for respiratory tract infections.

J Korean Med Sci, 1994 Feb, 9(1), 1 - 8
Reaction of the sera of the Korean children free from Hib invasive diseases against H . influenzae type B capsular polysaccharide antigen; Kim KH et al.; The purpose of our experiment is to examine the level of anti-Haemophilus influenza polysaccharide antibody titer in the Korean population . Using ELISA, the level of Hib-PS antibodies in 384 infants and children who were all free from Hib invasive diseases, was tested . And the blood of 50 mothers within 24 hours of delivery and cord blood from their respective full-term neonates was also tested . The transport of Hib-PS IgG and IgG subclasses in paired sera from mothers and neonates was also measured . The titer of Hib-PS IgG varies with age . At birth the mean optical density of cord blood was 1.028; however, it declined to 0.609 up to 6 months and further decline was noted up to 2 years to 0.488 . Then the mean O.D . remained around 0.5 from 3 to 14 years of age . The mean O.D . of Hib-PS IgG in the mothers blood was 0.856 . The ratio of mean O.D . of anti-Hib PS IgG antibody in the cord blood to that in the maternal blood was 1.20 . The mean optical densities of IgG subclasses were: 1.18 for anti-Hib PS IgG1, 1.07 for anti-Hib PS IgG2, 1.01 for anti-Hib PS IgG3, and 1.09 for anti-Hib PS IgG4 . The sera from Korean children of almost all age groups reacted to Hib-PS antigen on ELISA . Also the active transport of anti-Hib PS IgG antibody through placenta was observed . Among four IgG subclasses, only IgG1 transport had significant experimental meaning.

Mol Cell Probes, 1994 Feb, 8(1), 23 - 37
Molecular typing of Haemophilus influenzae using a DNA probe and multiplex PCR; Cote S et al.; The use of new molecular typing methods for the characterization of Haemophilus influenzae strains is reported . Sixty-four isolates of H . influenzae originating from different types of infection and obtained from eight hospitals across Canada were first analysed for restriction polymorphism . Chromosomal DNA fragments generated by two different combinations of restriction endonucleases were electrophoresed and transferred to nylon membranes before hybridization with a species specific 32P-labelled DNA fragment (5 kb) used as a probe . The combinations Bg/II/PstI led to 11 typing groups (A-K) and BamHI/Bg/II/PstI to 14 sub-groups, respectively . Most of the isolates retrieved from cerebrospinal fluids (10/13; 76.9%) were classified in two groups (A and B) and two sub-groups . Isolates from respiratory tract infections were mostly found in groups C and E (24/32; 75.0%), and divided into seven sub-groups . Selected ampicillin-resistant, beta-lactamase-negative strains were also found in groups C and E (11/14; 78.6%) . Isolates from conjunctivitis and acute otitis media were classified in various groups . All biotypes (I-VIII) and serotypes (none, a-f) were spread among the typing groups although biotype I prevailed in groups A, B, and G; II in group E (sub-group 6); and III in group C . A PCR approach derived from the typing system was also tested . A set of 25-mer primers was selected from the 5-kb DNA probe for the amplification of a 317-bp region . This set of primers was used concomitantly in a PCR multiplex assay with a set of primers selected from the nucleotide sequence of the gene encoding the H . influenzae P1 protein . This multiplex assay was also able to discriminate the clonal origin of some H . influenzae strains because size polymorphism was observed in PCR products . The PCR approach was then used to determine the genetic relatedness of H . influenzae strains found persistently in sputa of some patients with cystic fibrosis . Genetically related strains could be isolated from some patients even after antibiotherapy and months between visits, whereas other patients showed distinct strains . In summary, our typing system is able to provide new characteristics for strains having identical biotype or serotype . The rapid PCR alternative may prove useful for specific epidemiological and strain-tracking studies.

Can J Microbiol, 1994 Feb, 40(2), 154 - 7
Clarification of the structure of the ampicillin-resistance plasmid RSF0885 from Haemophilus influenzae HR-885 serotype b; Albritton WL et al.; The nonconjugative ampicillin-resistance plasmid RSF0885 has been reported to be as small as 2.9 MDa and as large as 4.1 MDa with at least two restriction enzyme maps reported . In addition, the source of the original plasmid has been reported to be Haemophilus influenzae and Haemophilus parainfluenzae . Characterization of the source strains and sequencing data of the plasmids revealed that H . influenzae serotype b was the original source strain and that IS1-K in the larger plasmid was presumably acquired when the smaller plasmid was maintained in Escherichia coli in S . Falkow's laboratory during the late 1970s.

Singapore Med J, 1994 Feb, 35(1), 104 - 5
Neonatal meningitis due to non-encapsulated Haemophilus influenzae in a set of twins--a case report; Lim CT et al.; A set of twins born to a 24-year-old primigravida had evidence of sepsis 24 to 60 hours after birth and were treated empirically with penicillin and gentamicin . A non-encapsulated H . influenzae biotype IV strain was isolated from the blood cultures of both and from the CSF of twin II . The isolates were beta-lactamase positive and hence showed resistance to ampicillin and therapy was changed to chloramphenicol only . Twin II recovered but Twin I developed a brain abscess in the left occipital region which resolved with extended antibiotic treatment . Although ampicillin-resistant H . influenzae have been reported in Malaysia, invasive disease by such strains are rare.

Arch Fam Med, 1994 Feb, 3(2), 165 - 75
Cefuroxime axetil in the treatment of sinusitis . A review; Pakes GE et al.; Cefuroxime axetil is a beta-lactamase-stable, second-generation, oral cephalosporin that penetrates sinus tissue in concentrations exceeding the MIC90 values (the minimum concentration of drug needed to inhibit the growth of 90% of an isolate of a particular microorganism) for pathogens most commonly associated with acute sinusitis, including Streptococcus pneumoniae and Haemophilus influenzae . A review of all clinical data published to date demonstrates that cefuroxime axetil has been evaluated in the treatment of acute sinusitis and acute exacerbations of chronic sinusitis ("acute-on-chronic sinusitis") in 18 clinical trials involving 1516 assessable patients . In 12 randomized, comparative trials, the rates of satisfactory clinical outcomes (cure or improvement, 79% to 100%) and bacteriologic eradication (84% to 100%) reported with the use of 250 mg of cefuroxime axetil twice daily were similar to those observed with the use of amoxicillin, amoxicillin/clavulanate potassium, cefaclor, cefadroxil, cefixime, clarithromycin, and doxycycline . In these comparisons, no antibiotic demonstrated any therapeutic advantages over cefuroxime axetil regarding time to symptom abatement . Cefuroxime axetil was at least as well tolerated as the other antibiotics . Overall, the role of cefuroxime axetil in the treatment of sinusitis appears to be as one of the broad-spectrum antibiotics that can be used for infections due to the most commonly implicated sinus pathogens, especially those due to the increasing number of relatively penicillin-resistant strains of S pneumoniae and beta-lactamase-producing strains of H influenzae and Moraxella catarrhalis.

Arch Pediatr, 1994 Feb, 1(2), 143 - 6
{Anti-Haemophilus influenzae b (Hib) natural immunity in children in Burkina Faso}; Tall F et al.; BACKGROUND . Natural immunity to Haemophilus infection type b that is acquired by the mothers and passively transmitted to their newborns is not well-known in developing countries, where the frequency of Haemophilus meningitis in infancy is high . POPULATION AND METHODS . Blood samples (5 ml) were taken from 89 women at the time of delivery and from the cord of their babies . Blood samples were also taken from 290 infants and children, distributed into nine subgroups as a function of their age . Children with protein-calorie malnutrition and immune deficiency were excluded from the study . Antibodies against Haemophilus influenzae were measured by Elisa and radioimmunologic methods . Blood concentrations of 0.15 pg/ml or more were considered to be protective . RESULTS . All the blood samples of mothers and cords contained protective levels of antibodies, as did the samples from 30% of those infants aged 0-60 days (all the infants were less than 1 month) . No infant in the subgroup 12-23 months had protective levels of antibodies . The incidence of Haemophilus meningitis was correlated with the absence of antibodies . CONCLUSION . Maternal immunity is gradually lost by babies during their first 2 months of life, earlier than in developed countries . Early vaccination, at 3 months of age, is mandatory.

East Afr Med J, 1994 Feb, 71(2), 129 - 31
Haemophilus influenzae meningitis in parts of eastern Nigeria; Onyemelukwe NF; During a two-year period, January 1989 to January 1991, 39 (12%) of 331 children admitted to various hospitals and health centres in Enugu and Nsukka areas of Eastern Nigeria with symptoms of meningitis had Haemophilus influenzae isolated from their cerebrospinal fluids (CSF) . 90% were aged 24 months and below . Out of the 39 isolates, 37 were Pittman serotype b while the remaining 2 were type d . More males (61.5%) had H . influenzae meningitis in comparison with 38.5% of females . 69.2% of the cases occurred during the dry season while 30.7% occurred during the rainy season . All the isolates were sensitive to chloramphenicol and erythromycin, while 90% were sensitive to ampicillin and penicillin, using the disc diffusion method . The leading role of H . influenzae in meningitis in children who are 7 to 24 months of age in this part of the world and the increasing resistance of this organism to ampicillin and penicillin is hereby stressed.

East Afr Med J, 1994 Feb, 71(2), 113 - 7
Bacterial meningitis in children in southern Ghana; Commey JO et al.; One hundred and three children (1% of seriously ill children referred to the Korle Bu Teaching Hospital in Accra) were admitted with bacterial meningitis over a 17 month period . 43 of these children had been ill for more than 4 days before arrival at our centre . The main causative organisms were S . pneumoniae (47.9%), Neisseria meningitides (38.4%) and Haemophilus influenzae (9.6%) . All bacterial isolates were highly sensitive to ceftriaxone . Resistance to penicillin and chloramphenicol was however present in 5-17% of isolates . All cerebrospinal fluid samples were sterilised within 48 hours of antibiotic treatment . Case fatality rate was 22% with the majority of deaths occurring within hours of admission and closely related to S . pneumoniae infection . Neurological complications occurred in 22%; mild diarrhoea in 33% and secondary fever in 14.8% of survivors . No significant difference was noted among the three treatment regimens of ceftriaxone alone, penicillin plus chloramphenicol, and ceftriaxone alone for 48 hours followed by penicillin/chloramphenicol combination . Our overall outcome would have been better if patients had been started on appropriate antibiotic treatment within the earlier hours of the infection . Furthermore, the latter generation cephalosporins, including ceftriaxone, must be given consideration as antibiotics of first choice world widePIP: Between November, 1991, and March, 1993, in Accra, Ghana, physicians admitted 103 children, 2 months to 12 years old, to the Korle Bu Teaching Hospital with suspected bacterial meningitis . They constituted 1.04% of all children presenting at the emergency rooms . Late referral to the hospital was likely responsible for the high case fatality rate within the 1st 24 hours of admission (59.1% of all deaths) . 42.7% of all cases presented more than 96 hours after the onset of symptoms . 7 children died immediately after admission, allowing physicians no time to begin antibiotic treatment . The overall case fatality rate was 21.4% . Streptococcus pneumonia was isolated from the cerebrospinal fluid (CSF) in 53.8% of the early deaths and 55% of all 73 mortality cases from which bacteria were isolated . Leading causative organisms were $ . pneumoniae (47.9%), Neisseria meningitides (38.4%), and Hemophilus influenza (9.6%) . All bacterial isolates were sensitive to ceftriaxone . 5-17% of all isolates were resistant to penicillin and chloramphenicol . No bacteria were isolated in the CSF of any children within 48 hours of antibiotic treatment . The leading complications and sequelae of the 81 survivors were mild diarrhea (33%), neurological complications (22%), and secondary fever (14.8%) . Even though the chloramphenicol/penicillin treatment regimen had the highest survivor outcome results (43%), its results were not significantly different than those of ceftriaxone alone for 48 hours followed by chloramphenicol/penicillin and ceftriaxone alone (24% and 20%, respectively; p =.6) . These results suggest that health workers at less than optimum health facilities should administer the 1st dose of ceftriaxone to children suspected of having meningitis before transferring them to a tertiary facility for further management . This should greatly reduce case fatalities and sequelae . Health workers worldwide, even those in malaria endemic areas, should consider meningitis as a significant cause of fever .

Infect Immun, 1994 Feb, 62(2), 468 - 75
Identification of a gene essential for piliation in Haemophilus influenzae type b with homology to the pilus assembly platform genes of gram-negative bacteria; Watson WJ et al.; Haemophilus influenzae type b (Hib) pili are complex filamentous surface structures consisting predominantly of pilin protein subunits . The gene encoding the major pilin protein subunit of Hib adherence pili has been cloned and its nucleotide sequence has been determined . In order to identify specific accessory genes involved in pilus expression and assembly, we constructed isogenic Hib mutants containing insertional chromosomal mutations in the DNA flanking the pilin structural gene . These mutants were screened for pilin production, pilus expression, and hemagglutination . Pili and pilin production were assessed by immunoassays with polyclonal antisera specific for pilin and pili of Hib strain Eagan . Hemagglutination was semiquantitatively evaluated in a microtiter plate assay . Six Hib mutants produced proteins immunoreactive with antipilin antiserum but no longer produced structures reactive with antipilus antiserum . In addition, the mutants were unable to agglutinate human erythrocytes . Nucleotide sequence analysis localized the insertion sites in the six mutants to 2.5-kb open reading frame upstream of the pilin structural gene and immediately downstream of an Hib pilin chaperone gene . The amino acid sequence encoded by this open reading frame has significant homology to members of the pilus assembly platform protein family, including FhaA of Bordetella pertussis, MrkC of Klebsiella pneumoniae, and the Escherichia coli assembly platform proteins FimD and PapC . This open reading frame, designated hifC, appears to represent a gene essential to Hib pilus biogenesis that has genetic and functional similarity to the pilus platform assembly genes of other gram-negative rods.

Infect Immun, 1994 Feb, 62(2), 673 - 9
Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay; Forsgren J et al.; The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA . We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H . influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction . In some cases, the reticular crypt epithelium was focally infiltrated by H . influenzae . The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases . These mononuclear cells contained up to 200 intracellular H . influenzae cells . In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen . Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H . influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells.

Oral Microbiol Immunol, 1994 Feb, 9(1), 19 - 24
The influence of saliva on interbacterial adherence; Skopek RJ et al.; The mechanism of bacterial adherence to the mat of bacteria in preformed dental plaque is not well defined . This study measured the influence of saliva on the adherence of bacteria in suspension to a continuous bacterial surface in vitro . Twenty different pairs of bacteria were tested, consisting of Streptococcus spp., Haemophilus spp . and Actinomyces spp . The species were chosen based on the parameters of coaggregation, and salivary agglutination . The results were expressed as bacteria that adhered per mm2 of bacterial surface . When both the surface bacteria and the bacteria in suspension agglutinated in saliva, interbacterial adherence was increased 2.5-fold when a salivary coating was placed on the surface . When one or both of the bacteria did not agglutinate in saliva, interbacterial adherence was increased only slightly when the surface was saliva-coated . The results suggested that salivary-mediated adherence is significant to plaque formation once the tooth surface becomes covered with bacteria . Thus bacteria that are capable of agglutinating in saliva may have a distinct advantage in colonization of the plaque surface.

MMWR Recomm Rep, 1994 Jan 28, 43(RR-1), 1 - 38
General recommendations on immunization . Recommendations of the Advisory Committee on Immunization Practices (ACIP); Voltage gating of porins from Haemophilus influenzae type b; Department of Microbiology and Immunology, McGill University, Montreal, Quebec, CanadaThe major outer membrane protein of Haemophilus influenzae type b (Hib) is porin (M(r) 37,782; 341 amino acids) . Porins were purified from Hib strains representative of the three outer membrane protein subtypes 1H, 2L and 6U, reconstituted into artificial planar bilayers, and tested for their voltage dependency . At membrane potentials of 50-80 mV, individual Hib 2L and 6U porin channels showed a high probability of undergoing a reversible change to one of several lower conducting substates . Such behaviour was not observed for Hib 1H porin with transmembrane potentials up to 80 mV . The voltage dependence of Hib 2L and 6U porins was asymmetric: it occurred at only one polarity . The asymmetry was also observed for membranes with numerous porins incorporated, suggesting that Hib porin inserted asymmetrically into the bilayer . At macroscopic levels the voltage gating reduced the conductance by 25-50%, implying that the channels closed only partially . Hib 2L porin differs from Hib 1H porin by the substitution Arg166Gln and Hib 6U porin differs from Hib 1H porin by substitutions at ten amino acids including the change Arg166Leu . We conclude that substitutions at Arg166 residue, which is localized to surface-exposed loop number four, are associated with a lowered threshold potential for the voltage gating of Hib porin . This surface-exposed loop may play some role in the conformational changes that occur during voltage gating.

J Mol Biol, 1994 Jan 14, 235(2), 472 - 85
A Caulobacter DNA methyltransferase that functions only in the predivisional cell; Zweiger G et al.; Caulobacter crescentus was found to have a DNA methyltransferase, CcrM, that methylates the adenine base of the HinfI recognition sequence, GANTC . The ccrM gene was cloned, and DNA sequence analysis revealed that the predicted amino acid sequence has 49% identity with the Haemophilus influenzae methyltransferase HinfM . Expression of the ccrM gene was found to be restricted to the portion of the cell cycle immediately prior to cell division . At three separate chromosomal sites the CcrM recognition sequence is fully methylated in swarmer cells, becomes hemimethylated upon DNA replication in stalked cells, and does not become remethylated until just prior to cell division . The time of methyltransferase expression coincides with the time of methylation of these three chromosomal sites and of plasmid DNA in the predivisional cell . When ccrM gene expression is placed under control of a constitutive promoter, these chromosomal sites are fully methylated throughout the cell cycle . A high proportion of morphologically aberrant cells, and cells that have undergone an additional chromosome replication initiation, are found in this population . Thus, the temporal control of this methyltransferase appears to contribute to the accurate cell-cycle control of DNA replication and cellular morphology.

Ugeskr Laeger, 1994 Jan 10, 156(2), 191 - 3
{Vaccination of splenectomized children . Antibody response to Haemophilus influenzae type b conjugate vaccine}; Kristensen K; Twenty splenectomized children and adolescents aged four to 18 years were immunized once with a Haemophilus influenzae type b (Hib) polysaccharide tetanus toxoid conjugate vaccine . Prior to vaccination, ten of 20 patients had anticapsular antibodies below what could be considered the minimum protective level in the splenectomized (0.6 microgram per ml), whereas all obtained high antibody levels after vaccination . In addition, one infant with congenital asplenia was vaccinated at two, four, and six months of age, and was shown to respond well after the second and third injections, obtaining serum antibody concentrations of 0.84 and 10.7 microgram per ml respectively . Because asplenic individuals have an increased risk of invasive Hib infection, these data suggest that vaccination of such individuals against Hib may be justified.

South Med J, 1994 Jan, 87(1), 38 - 40
Impact of immunization against Haemophilus influenzae type b (HIB) on the incidence of HIB meningitis treated at Arkansas Children's Hospital; Buchanan GA et al.; The newly available Haemophilus influenzae type b (HIB) protein conjugate vaccines are efficacious among study populations in which a high proportion of infants and children are vaccinated . In this retrospective study, we show the impact of the availability of HIB conjugate vaccines on the incidence of HIB meningitis at Arkansas Children's Hospital (ACH) in Little Rock . The Arkansas State Health Department estimates that only 43% of children in the state younger than 2 years of age have received the appropriate vaccinations . From 1985 through 1987, 27.3 +/- 4 HIB meningitis cases per year were treated at ACH . Although an HIB conjugate vaccine was licensed for 18-month-old children in December 1987, the incidence of HIB meningitis treated at ACH did not decrease significantly; there were 19.0 +/- 2 cases per year from 1988 through 1990 . In December 1990, an HIB conjugate vaccine was licensed for use in infants beginning at 2 months of age . From that time through August 1992, there were five cases of HIB meningitis treated at ACH, representing a significant decrease over previous years . Four of these cases occurred in unimmunized infants younger than 6 months of age . The availability of HIB conjugate vaccines for infants has resulted in a dramatic decrease in the number of cases of HIB meningitis treated at ACH, despite a relatively low proportion of infants and children who are receiving vaccination.

Pediatrics, 1994 Jan, 93(1), 59 - 62
Serum C-reactive protein, erythrocyte sedimentation rate, and white blood cell count in acute hematogenous osteomyelitis of children; Unkila-Kallio L et al.; OBJECTIVE . The aim of this prospective study was to compare the clinical value of the erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), and white blood cell (WBC) count in diagnosis and follow-up of acute hematogenous osteomyelitis in children . DESIGN . Forty-four children aged 2 weeks to 14 years with bacteriologically confirmed acute hematogenous osteomyelitis were examined . Staphylococcus aureus was responsible in 39 cases (89%), Haemophilus influenzae type b in 3 cases (7%), pneumococcus in 1 case (2%), and a microaerophilic streptococcus in 1 case (2%) . ESR was measured at the time of admission and on days 3, 5, 7, 10, 14, 19, and 29 of treatment, and CRP was measured on the same days as ESR but also on days 2, 9, 12, 17, and 23 . WBC count was examined at the time of admission and on days 5, 10, 19, and 29 . RESULTS . ESR was elevated (> or = 20 mm/h) initially in 92% of the cases; the mean value was 45 mm/h, and the peak values (mean 58 mm/h) were reached on days 3 to 5 . After this the levels slowly returned to normal in approximately 3 weeks (mean 18 days) . CRP was elevated (> 19 mg/L) at the time of admission in 98% of the cases, the mean value being 71 mg/L . The peak CRP value was reached on day 2 (mean 83 mg/L) . The decrease was very rapid, normal values being reached within a week (mean 6.9 days) . The WBC count was a poor indicator of acute hematogenous osteomyelitis, since only 35% of the children had leukocytosis (WBCs > 12 x 10(9)/L) at the time of admission . CONCLUSIONS . In patients with acute hematogenous osteomyelitis, CRP increased and especially decreased significantly faster than ESR, reflecting the effectiveness of the therapy given and predicting recovery more sensitively than ESR or WBC count.

Infect Immun, 1994 Jan, 62(1), 9 - 14
Opposite effects of actively and passively acquired immunity to the carrier on responses of human infants to a Haemophilus influenzae type b conjugate vaccine; Barington T et al.; Vaccination of infants with Haemophilus influenzae type b (Hib) capsular polysaccharide (HibCP) coupled to carrier proteins has proven protective against invasive Hib diseases in several trials . However, insufficient immunogenicity has been noted in certain populations . Therefore, studies analyzing factors influencing the antibody response to conjugate vaccines are needed . In this study, the response to HibCP coupled to tetanus toxoid (TT) was examined in relation to (i) priming with or coadministration of the carrier protein and (ii) the levels of passively acquired maternal TT antibodies . One hundred forty-four infants were vaccinated with HibCP-TT at 5 and 6 months . They were randomized into three groups that received TT as part of a diphtheria-tetanus-polio vaccine at either 6 and 7 months (group A), 5 and 6 months (group B), or 4 and 5 months (group C) . Maternally acquired TT antibodies inhibited the anti-HibCP response to the first HibCP-TT dose in groups A and B (r = -0.5 and -0.4, respectively; P < 0.005) . In these groups, infants with prevaccination anti-TT levels above the median failed to reach the defined long-term protective level of HibCP antibodies (1 microgram/ml) more often than infants with low prevaccination levels after the first (P = 0.0001) and the second (P = 0.01) doses of HibCP-TT . In contrast, active priming with TT at 4 months resulted in a threefold-higher median level of anti-HibCP (group C; 1.34 micrograms/ml) than in the unprimed group (group A; 0.40 microgram/ml) after the first dose of HibCP-TT (P = 0.01) . Coadministration of TT had no enhancing effect (group B; 0.58 microgram/ml) . No significant differences between the median anti-HibCP levels were seen after the second HibCP-TT dose (6.72, 9.63, and 11.44 micrograms/ml in groups A, B, and C, respectively; P = 0.25).

Infect Immun, 1994 Jan, 62(1), 48 - 59
Identification and characterization of an iron-regulated hemopexin receptor in Haemophilus influenzae type b; Wong JC et al.; Heme can serve Haemophilus influenzae as a source of both essential porphyrin and iron . In extracellular mammalian body fluids neither free heme nor free iron is available, since they are tightly bound to hemopexin and transferrin, respectively . Since H . influenzae grows in the presence of iron-transferrin and heme-hemopexin and is known to express a saturable receptor for transferrin, we investigated the process by which this pathogen acquired heme from hemopexin for use as an iron source . The ability of human and rabbit hemopexin to donate heme as a source of iron to H . influenzae type b strains was demonstrated by plate bioassays . With a dot enzyme assay with biotinylated hemopexin as ligand, H . influenzae bound heme-hemopexin and apo-hemopexin following growth in iron-restricted, but not in iron-sufficient, medium . Competitive binding studies with heme-hemopexin and apo-hemopexin demonstrated saturability of binding . Neither heme, protoporphyrin IX, hemoglobin, nor transferrin blocked the binding of hemopexin to whole cells, demonstrating the specificity of binding . Treatment of whole H . influenzae cells with trypsin abolished binding . Taken together, these observations suggest that H . influenzae type b expresses an outer membrane protein(s) which acts as a receptor for hemopexin and which is regulated by the availability of iron in the growth medium . In iron-restricted media, H . influenzae 706705 and DL42 did not express the 100-kDa hemopexin-binding protein previously reported (M.S . Hanson, S.E . Pelzel, J . Latimer, U . Muller-Eberhard, and E.J . Hansen, Proc . Natl . Acad . Sci . USA 89:1973-1977, 1992) . The putative iron-regulated hemopexin receptor was solubilized from cell envelopes of H . influenzae 706705, DL42, and Eagan with the detergent CHAPS (3-{(3-cholamidopropyl)-dimethyl-ammonio}-1-propanesulfonate) and isolated by affinity chromatography on heme-hemopexin-Sepharose 4B . Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the proteins bound to the affinity resin revealed three proteins of 29, 38, and 57 kDa, of which the 57- and 29-kDa proteins bound hemopexin after Western blotting (immunoblotting) . A monoclonal antibody to the 57-kDa hemopexin-binding protein of 706705 recognized a 57-kDa protein on Western blots of the cell envelope proteins of 706705, DL42, and Eagan; no reaction was observed with the 100-kDa hemopexin-binding protein of DL42 . These data suggest that some H . influenzae strains possess at least two hemopexin receptors, the expression of which is determined by the prevailing growth environment.

J Immunol, 1994 Jan 1, 152(1), 184 - 92
Induction of protective immunity to Haemophilus ducreyi in the temperature-dependent rabbit model of experimental chancroid; Hansen EJ et al.; The temperature-dependent rabbit model for chancroid, a sexually transmitted disease caused by the fastidious Gram-negative bacterium Haemophilus ducreyi, was used to investigate the abilities of previous infection and immunization with an acellular preparation of H . ducreyi to induce protective immunity . In the first set of experiments, animals were infected intradermally with either the 35000 or Cha-1 strains of H . ducreyi and then rechallenged 30 days later with both the homologous and heterologous strains . In animals infected with the 35000 strain, statistically significant protective immunity occurred only against the homologous strain, whereas protection against both homologous and heterologous challenge was obtained in rabbits previously infected with strain Cha-1 . In a separate series of experiments, rabbits were immunized with cell envelopes from either strain 35000 or strain Cha-1 and then challenged with both the homologous and heterologous strains . In rabbits immunized with strain 35000 cell envelopes, significant protective immunity was observed only against challenge with the homologous strain . In animals immunized with strain Cha-1 cell envelopes, protection was obtained against both homologous and heterologous challenge . Histopathologic analysis of sites inoculated with strain 35000 (10(5) CFU) demonstrated that the inflammatory response in control animals was predominantly suppurative (i.e., heterophilic), whereas that of immunized animals was predominantly mononuclear and, at later time points, largely histiocytic . ELISA and Western blot analyses revealed that immunization produced a better humoral immune response than did infection and provided evidence for antigenic cross-reactivity between these two strains . These results provide the experimental basis for continued efforts to identify potential H . ducreyi vaccinogens.

Wien Klin Wochenschr, 1994, 106(7), 187 - 92
{Haemophilus influenzae meningitis 1983 to 1992--epidemiology and sequelae of the disease}; Rauter L et al.; During the ten-year period 1983-1992 40 children (16 girls and 24 boys) were treated for pyogenic meningitis caused by Haemophilus influenzae type b (Hib) . The incidence was 1 case per year out of 5500 children younger than 6 years of age . The youngest child was 5.5 months old, 8 children (20%) were younger than 12 months . The highest incidence was during the second year of life (16 patients) . The oldest patient was 11.5 years old . The course of Hib meningitis varied . The disease ran a fulminant course in 10 children . In 9 patients the symptoms evolved more gradually over a period of more than 48 hours, whereby 4 of these patients were only slightly ill on admission . Treatment until 1987 consisted of a combination of ampicillin and chloramphenicol, thereafter cetriaxon and ampicillin were used . Two patients died . One child was left with devastating handicaps and 5 children suffer from minor, but persisting sequelae (seizure disorder, delay in psychomotor development, attention deficit hyperactivity disorder, learning problems, speech delay) . Transient disorders were found in 8 patients (EEG abnormalities, delay in psychomotor development, transient hearing problems) . Severe hearing loss was seen in only one patient . 24 children (60% of all cases) recovered without any sequelae . Our results, in accordance with the literature, show that in spite of prompt availability of medical assistance, potent antibodies and a high standard of hospital care, the mortality and morbidity following Hib meningitis are still unacceptably high . Hence, we emphasize the need to eliminate Hib infection by immunization programmes.

Zh Mikrobiol Epidemiol Immunobiol, 1994 Jan-Feb, (1), 21 - 7
{The biological properties of Haemophilus influenza isolated from healthy children and from patients with acute and chronic respiratory diseases}; Katosova LK et al.; The comparative study of the biological properties of H . influenzae strains isolated from healthy children and from patients with acute and chronic respiratory diseases has been made, taking into account the biochemical features (biotypes) and adhesive activity of these strains . Differences in various biotypes of H . influenzae strains isolated from patients with bronchopulmonary diseases and from healthy carriers have been established . H . influenzae strains isolated from various sources differ by their adhesive properties: strains isolated from patients with acute bronchopulmonary diseases have the highest adhesive activity, while strains isolated from healthy controls have the lowest adhesive activity . The data thus obtained indicate the possible dependence of the degree and duration of the colonization of the respiratory tract by H . influenzae on the biological properties of these microorganisms . The monitoring of the sensitivity of H . influenzae strains to antibiotics has demonstrated that these strains retain high sensitivity to ampicillin, chloramphenicol, gentamicin and exhibit a tendency towards an increase in resistance to penicillin and erythromycin.

Acta Otorhinolaryngol Belg, 1994, 48(1), 1 - 9
Bacterial interference in nasopharyngeal bacterial flora of otitis-prone and non-otitis-prone children; Bernstein JM et al.; The quantitative bacteriology of the adenoid was studied in 34 otitis-prone and 25 non-otitis prone children . Viridans streptococci appeared to be the predominant normal flora in children who are non-otitis prone . There was a significant decrease in viridans streptococci in the otitis-prone child compared to the non-otitis-prone child . There was a significant increase in nontypable Haemophilus influenzae (NTHI) in the otitis-prone child . The mechanisms responsible for this alteration of the microecology of bacteria of the nasopharynx may be related, in part, to bacterial interference or to the inappropriate use and over-use of antibiotics . In vitro inhibition of growth of NTHI was demonstrated with selective strains of viridans streptococci . A preliminary analysis of an inhibitory strain and a non-inhibitory strain of viridans streptococci are presented and their biochemical profiles and antibiotic sensitivities were entirely different . A possible mechanism for the inhibition on NTHI by viridans streptococci has been suggested . This mechanism may be related to an alteration of pH in the growth media or the possibility of the utilization of nutrients required for growth of NTHI.

Pediatr Infect Dis J, 1994 Jan, 13(1), 27 - 33
Antibodies against Haemophilus influenzae type b and tetanus in infants after subcutaneous vaccination with PRP-T/diphtheria, or PRP-OMP/diphtheria-tetanus vaccines; Carlsson RM et al.; In an open randomized study, serum antibodies against Haemophilus influenzae type b capsular polysaccharide (PRP) and tetanus toxoid were determined in 146 Swedish infants; 75 of them received PRP conjugated to tetanus toxoid (PRP-T) concurrently with diphtheria toxoid vaccine, and 71 received PRP conjugated to an outer membrane complex of Neisseria meningitidis (PRP-OMP) concurrently with diphtheria-tetanus toxoid vaccine . Injections were given subcutaneously at ages 3, 5 and 12 months . One month after the second injection, the PRP-T recipients had a geometric mean (GM) concentration of 0.38 microgram/ml and only 69% had PRP antibodies > or = 0.15 microgram/ml (considered a protective level) . In the PRP-OMP group the GM concentration was 0.44 microgram/ml and 85% had PRP antibodies > or = 0.15 microgram/ml . One month after the third injection, 99% of the infants in both groups had PRP antibodies > or = 0.15 microgram/ml, but PRP-T recipients had significantly higher GM concentration than infants vaccinated with PRP-OMP, 10.21 micrograms/ml vs . 1.90 micrograms/ml (P < 0.001) . After all three injections the diphtheria-tetanus toxoid vaccine elicited higher GM concentrations of tetanus toxoid antibodies than did the PRP-T vaccine, but both vaccines induced antibodies above the proposed protective level, 0.01 IU/ml . The reason for the lower than expected immunogenicity of the two Haemophilus influenzae type b conjugate vaccines has yet not been established . For PRP-OMP the most probable explanation is the use of a lot of low immunogenicity, but the route of administration also has to be considered.(ABSTRACT TRUNCATED AT 250 WORDS)

J Infect, 1994 Jan, 28(1), 93 - 7
Cerebrospinal fluid rhinorrhoea and Haemophilus influenzae meningitis 37 years after a head injury; Crawford C et al.; Bacterial meningitis secondary to CSF rhinorrhoea is well recognised . We present a case of meningitis due to Haemophilus influenzae type b associated with a CSF fistula . The patient was 40 years of age at presentation, having sustained a head injury when 3-years-old . He had suffered intermittent rhinorrhoea for 18 months before admission . Delays between head injury and meningitis are well recognised, but our case may represent the longest recorded interval . H . influenzae meningitis in adults is discussed.

Int J Technol Assess Health Care, 1994 Winter, 10(1), 7 - 13
The promise of new technologies; La Montagne JR et al.; Efforts to provide the benefits of immunization to the world's children have reached an important crossroad . While remarkable progress has been achieved in successfully administering six important childhood vaccines (diphtheria, tetanus, polio, pertussis, measles, and tuberculosis), the benefits of new vaccines, such as hepatitis B and Haemophilus influenzae type B glycoconjugate vaccines, have not been realized except in the most developed countries . The three reasons often cited to explain this problem include poor access to immunization services, the evolution of complex primary immunization schedules, and the additional expense associated with new vaccines, potentially depleting scarce resources . The establishment of the Children's Vaccine Initiative is an organized effort to improve immunization by both technological and organizational innovation . Simplification of the vaccination process can be achieved by developing new combination vaccines or reducing the number of immunizations with vaccines that stimulate protective immune responses . Improvements in the organization of efforts to immunize children will also enhance the prospects of protecting the world's children from infectious diseases . To achieve the goals articulated in the Declaration of New York, the issues of transition from the old to the new vaccines must be addressed . Research on vaccines and technological innovation at all levels will be required to achieve these goals.

Int J Technol Assess Health Care, 1994 Winter, 10(1), 167 - 76
Glycoconjugate vaccines . What next?
Stein KE.
The principle that infants can be protected from invasive diseases caused by encapsulated organisms has been proved with the introduction of Haemophilus influenzae type b conjugate vaccines . The use of glycoconjugates to implement some of the goals of the Children's Vaccine Initiative requires a clear delineation of the chemical and immunological specifications for optimal vaccines.

Int J Technol Assess Health Care, 1994 Winter, 10(1), 143 - 53
Maternal immunization to prevent infectious diseases in the neonate or infant; Insel RA et al.; The approach of providing passive protection to young infants by immunizing pregnant women can bypass the problems of immunological immaturity in the neonate, avoid or delay active immunization of the infant in the first year of life, and prevent transmission of an infection from the mother to the neonate . Optimal vaccines for this approach should induce high immunoglobulin G antibody titers that quickly reach their maximum level after immunization and persist at protective levels for several years, thus providing passive protection in subsequent pregnancies . Specific applications of this approach include the worldwide practice of maternal immunization with tetanus toxoid vaccine and ongoing studies of maternal immunization to prevent Haemophilus influenzae type b, group B streptococcal, pneumococcal, meningococcal, and human immunodeficiency virus infection in the infant . Addressing the cultural, sociological, and legal aspects of maternal immunization will be required to ensure the success of this approach.

FEMS Immunol Med Microbiol, 1994 Jan, 8(1), 63 - 8
In vivo human immune response to transferrin-binding protein 2 and other iron-regulated proteins of Neisseria meningitidis; Ferreiros CM et al.; When grown under iron restriction, Neisseria meningitidis expresses new outer-membrane proteins, some of which are antigenic and potentially useful as vaccine components . This is particularly relevant to N . meningitidis serogroup B, against which neither polysaccharide nor conjugate vaccines are effective . We investigated recognition of N . meningitidis serogroup B outer-membrane antigens by three sera from patients recovered from meningitis . Recognition of antigens from the homologous strain provided information on in vivo expression during infection and immunogenicity, while cross-reactivity with outer membrane proteins from the other two strains and from another five strains in our collection allowed evaluation of antigenic heterogeneity . Our results demonstrate that transferrin-binding protein 2 (TBP2) is immunogenic in humans, to varying degrees depending on the strain, and that TBP2s (like the equivalent proteins of Haemophilus influenzae type b) are among the most important iron-regulated outer membrane antigens expressed during infection . Other immunogenic outer membrane proteins (some iron-regulated) are also expressed during infection; in a previous study in mouse, three of these proteins (with M(r) of 50, 70 and 77 kDa) did not induce an immune response . Our cross-reactivity data provide some support for Robki et al.'s two-group classification of N . meningitidis strains, and provide evidence against the possibility that the antigenic domains shared by the TBP2s of all N . meningitidis strains induce immune responses in vivo.

Enferm Infecc Microbiol Clin, 1994 Jan, 12(1), 34 - 7
{Bacteremia caused by Haemophilus influenzae with special reference to its relation to HIV infection}; Teira R et al.; BACKGROUND: The association between infection by Haemophilus influenzae and infection by the human immunodeficiency virus (HIV) has been clearly demonstrated . However, some characteristics of this association still remain poorly defined . METHODS: The medical records of all adult patients admitted to a general hospital over a period of four years with blood cultures positive for Haemophilus influenzae were reviewed . Patients were grouped according to whether HIV infection or no evidence of HIV infection existed . Clinical and epidemiologic data were collected and compared . The main features of data corresponding to seropositive patients are reported . RESULTS: Of a total of 29 cases of bacteremia by Haemophilus influenzae, 19 were diagnosed in adults: 5 in patients with HIV infection and 14 in patients without HIV infection . Over the following 18 months one additional case was reported . The incidence (calculated in cases per 100,000 people/year) was 1.9 in the general population, 1.5 in adults, 70 in adults with HIV infection and 360 in AIDS patients . All the cases diagnosed in adults below the age of 30 years were reported in HIV carriers . Five of the 16 (31%) H . influenzae strains tested were resistant to ampicillin, with a significant difference being found between those isolated from HIV positive patients (4/5) and from HIV negative patients (1/11) . No patient with HIV infection died during the episode . But five of the HIV negative adults died . CONCLUSIONS: HIV infection seems to be frequent risk factor for bacteremia by Haemophilus influenzae . It should always be considered on diagnosis in adults under the age of 30 . Likewise, the high probability of resistance to ampicillin should also be taken into account for the empiric treatment.

Enferm Infecc Microbiol Clin, 1994 Jan, 12(1), 21 - 5
{Clinical and etiological features of community-acquired pneumonia in the elderly}; Llorente JL et al.; BACKGROUND: The aim of the present study was to know the clinical and etiologic features of community-acquired pneumonia (CAP) in elderly patients requiring hospital admission . METHODS: A prospective study of 36 consecutive patients aged over 70 years, admitted to a general hospital was performed . Standard analytical determinations, blood cultures, and serologic studies were performed in all patients using invasive techniques: aspirative transthoracic puncture (ATP) with ultrafine needle in 35 (97%) cases, and telescopic catheter (TC) in 1 case . RESULTS: The mean age was 79 years (range: 71-90) . Twenty-two patients had received antibiotic treatment prior to admission (61%) and 17 (47%) presented chronic debilitating diseases . The clinical characteristics of CAP were "typical" with acute presentation in most . Fifteen cases (42%) were etiologically diagnosed and the most frequently isolated agents were Streptococcus pneumoniae (22%) and Haemophilus influenzae (8%) . Empiric treatment was changed on the basis of isolations in 7 cases (19%) . Eight patients died (22%) . CONCLUSIONS: According to our results community-acquired pneumonia in the population studied: 1) generally showed an acute presentation with "typical" characteristics, carrying a high mortality rate (22%), 2) is of bacterial etiology, with S . pneumoniae and H . influenzae being the most frequently isolated microorganisms, 3) the use of ATP in community-acquired pneumonia offers a high diagnostic effectiveness, good tolerance and low risk of complications.

Soz Praventivmed, 1994, 39(1), 56 - 62
{Vaccination coverage of 2-year-old children in Geneva}; Bouvier P et al.; OBJECTIVE: To measure the immunization uptake among 2 year-old children living in Geneva . METHODS: Review of the vaccination cards, systematically checked because of the compulsory vaccination against diphtheria, during the year in 1991 . RESULTS: 3937 immunization cards were reviewed, ie . 93.6% of the children in the given age group . Immunization uptake rates were, for diphtheria and tetanus (3 doses) 96.8%; pertussis (3 doses) 96.1%; poliomyelitis (3 doses) 96.6% . For measles, mumps and rubella vaccine (MMR) (1 dose), 78.4% . For the Haemophilus influenzae b vaccine, recently introduced: 68.5% . The uptake rate for MMR was lower among children of swiss origin (75.5%) than among children of other nationalities (84.6%, p < 0.0001) . The highest rates were found among children coming from southern Europe and Latin America . CONCLUSIONS: From the point of view of the community risk, immunization uptake rates for diphtheria, tetanus, pertussis and poliomyelitis can be considered satisfactory . For MMR vaccine, the rate was higher than 2 years earlier, but still insufficient, compared to the level which could block the transmission of the target diseases in the population . The persistence of such a low rate of immunization uptake will not prevent the occurrence of epidemics in the population.

Eur Respir J, 1994 Jan, 7(1), 94 - 101
The intrabronchial microbial flora in chronic bronchitis patients: a target for N-acetylcysteine therapy?
Riise GC, Larsson S, Larsson P, Jeansson S, Andersson BA.
Chronic bronchitis is common among smokers, often together with recurrent infectious exacerbations . Streptococcus pneumoniae and Haemophilus influenzae are the pathogens traditionally considered most important . N-acetylcysteine (NAC) treatment has been shown to reduce the number of infectious exacerbations in patients with chronic bronchitis . The mechanism behind this is unknown . We attempted to characterize the intrabronchial bacterial flora in patients with chronic bronchitis in an infection-free interval, and to determine whether pharmacological and immunological factors effected the bacterial occurrence . Twenty two smokers with non-obstructive chronic bronchitis, 19 smokers with chronic bronchitis and chronic obstructive pulmonary disease (COPD) and 14 healthy nonsmokers underwent bronchoscopy . To obtain uncontaminated intrabronchial samples, a protected specimen brush was used . Quantitative bacterial cultures and virus isolations were performed . Significantly positive bacterial cultures (> 1,000 colony-forming units (cfu).ml-1) were found only in the patients . S . pneumoniae and H . influenzae were found in five patients, and only in the patients without NAC treatment . The most common bacterium was alpha-haemolytic streptococcus . Negative cultures were more common in the healthy controls . Of the various factors examined, only NAC medication had an influence on bacterial numbers . Significantly fewer patients with NAC medication had positive cultures (3 out of 16) than in the group of patients without NAC therapy (15 out of 21) . Our results confirm that chronic bronchitis in smokers leads to increased intrabronchial bacterial colonization . We could also confirm that 1,000 cfu.ml-1 is an adequate cut-off level for significant bacterial growth when using the protected specimen brush . NAC medication was associated with low bacterial numbers.

Eur Respir J, 1994 Jan, 7(1), 102 - 4
Two family outbreaks of Chlamydia pneumoniae infection; Blasi F et al.; During autumn 1992, we observed two unrelated family outbreaks of Chlamydia pneumoniae infection . Family A consisted of grandmother (aged 77 yrs), father (aged 41 yrs), mother (aged 38 yrs), daughter (aged 10 yrs), and two sons (aged 6 yrs and 3 months, respectively) . The grandmother and daughter suffered from pneumonia, father from pharyngitis and bronchitis and the older son from mild bronchitis . No symptoms were recorded in the mother and younger son . Symptomatic subjects showed a fourfold increase in immunoglobulin G (IgG) titre for Chlamydia pneumoniae, determined by a microimmunofluorescence test with specific antigen (TW-183) . Other serological studies against Mycoplasma pneumonia, Legionella pneumophila, influenza virus type A and B, adenovirus and respiratory syncytial virus (RSV) were negative . Sputum culture gave a positive result for Haemophilus influenzae, colony forming units (cfu) = 10(4).ml-1 in the grandmother . No serum positivity was recorded in the mother and younger son, who remained asymptomatic . All symptomatic patients were successfully treated with macrolides . Family B consisted of mother (aged 63 yrs) and daughter (aged 36 yrs) . Both suffered from Chlamydia pneumoniae pneumonia . Diagnosis was made by means of serological microimmunofluorescence test, and direct identification using an indirect immunofluorescence test on pharyngeal swab . Sputum culture and other serological tests remained negative . Both patients were successfully treated with macrolides . These observations emphasize the relevance of Chlamydia pneumoniae in family cluster respiratory infections.

Arch Pediatr Adolesc Med, 1994 Jan, 148(1), 51 - 6
Eradication of Haemophilus influenzae type b disease in southern California . Kaiser-UCLA Vaccine Study Group; Vadheim CM et al.; OBJECTIVE: To assess the effects of Haemophilus influenzae vaccination of infants . RESEARCH DESIGN: We evaluated H influenzae type b (Hib) disease rates in Los Angeles County, California (population, 9 million; 1983 through 1992), and in the Southern California Kaiser Health Plan (2.5 million enrollees; 1988 through 1992) during the past decade . Cases were obtained through active and passive disease surveillance in the two populations . The following vaccines were used during the study period (1983 through 1992): (1) Hib polysaccharide vaccine (polyribosyl ribitol phosphate) (used from 1985 through 1987 for children 24 through 60 months of age); (2) Hib polysaccharide-diphtheria toxoid conjugate, Hib polysaccharide CRM197 mutant diphtheria toxoid conjugate vaccine, and Hib polysaccharide outer-membrane protein of group B meningococcus conjugate vaccine in older children (1988 through 1990; ages 15 through 60 months); and (3) Hib polysaccharide CRM197 mutant diphtheria toxoid conjugate vaccine and Hib polysaccharide outer-membrane protein of group B meningococcus conjugate vaccine used in infants (1991 through 1992) . MEASUREMENTS AND RESULTS: Between 1983 and 1988, the Hib disease incidence in Los Angeles County was unchanged (32.7 to 42.5/100,000 person-years in children younger than 5 years) . In 1989 through 1990, before Hib conjugate licensure for infant use, Hib disease rates in all age groups declined . After licensure of Hib vaccines for infants in 1990, there was a further fivefold decrease in infants . More dramatic decreases occurred in the better-immunized Kaiser Health Plan children aged 0 through 60 months (53 cases in 1989, only two cases in 1992) . CONCLUSIONS: The Hib disease has been nearly eradicated in a fully immunized population (Kaiser Health Plan), and significant reductions have also occurred in Los Angeles County.

Arch Pediatr Adolesc Med, 1994 Jan, 148(1), 47 - 50
Epiglottitis in children, 1979 through 1992 . Effects of Haemophilus influenzae type b immunization; Gorelick MH et al.; OBJECTIVE: To examine secular trends in the epidemiology, bacteriology, and clinical presentation of acute epiglottitis in children in the years surrounding the introduction of vaccine against Haemophilus influenzae type b . DESIGN: Retrospective chart review of patient series . SETTING: Large, urban, tertiary care pediatric hospital . SUBJECTS: One hundred forty-two children with epiglottitis admitted during a 14-year period (1979 through 1992) . MAIN RESULTS: The average annual incidence of epiglottitis declined from 10.9 per 10,000 admissions before 1990 to 1.8 per 10,000 admissions from 1990 through 1992 . The median age increased from 35.5 months in the earlier period to 80.5 months (P = .007) . Overall, H influenzae type b was identified as the causative organism in 76% of patients, but in only 25% of the cases since 1990 (P = .004) . Of the eight cases from 1990 through 1992, three had group A beta-hemolytic streptococcus isolated from a surface culture of the epiglottis; three other cases of group A beta-hemolytic streptococcus were identified earlier . These patients were significantly older than those with H influenzae type b disease (117.5 vs 35 months, P = .004) . No important differences were found in any of a number of clinical characteristics based on causative organism or year of diagnosis . CONCLUSION: Acute epiglottitis has diminished in frequency since 1990 . Patients whose conditions have been diagnosed since then tend to be older and to have disease caused by organisms other than H influenzae type b (particularly group A beta-hemolytic streptococcus) . However, the clinical presentation appears to be similar to that seen previously.

Sex Transm Dis, 1994 Jan-Feb, 21(1), 36 - 42
Enzyme immunoassays (EIAs) for the detection of anti-Haemophilus ducreyi serum IgA, IgG, and IgM antibodies; Roggen EL et al.; BACKGROUND AND OBJECTIVES: Chancroid is a risk factor for heterosexually acquiring HIV . Controlling its spread may reduce HIV transmission . GOAL OF THE STUDY: To develop EIAs for assessing antibody levels and for seroepidemiologic studies . STUDY DESIGN: Anti-Haemophilus ducreyi IgA, IgG and IgM EIAs were standardized using a crude cocktail antigen . Evaluation was on sera from Kenya, Rwanda, Thailand and The Gambia . The two-tailed student's t test was used to compare results . RESULTS: The specificity of IgA was 97% (95% confidence interval (CI): 95-99%), of IgG was 92% (95% CI: 89-95%), and of IgM was 99% (95% CI: 98-100%) . The sensitivity of IgA was 88% (95% CI: 83-93%), of IgG was 93% (95% CI:89-97%), and of IgM was 78% (95% CI:71-85%) in patients having an ulceration for more than eight days . Thus, 95% (95% CI:92-98%) of the chancroid patients were seropositive for at least one antibody type . The IgG and IgA EIAs were more sensitive in patients older than 24 years of age . Higher IgG rates were found in HIV infected chancroid patients . CONCLUSION: The EIAs should be useful for studying the kinetics of antibody levels and the epidemiology of H . ducreyi infectionPIP: In Belgium, the Department of Infection and Immunity of the Institute of Tropical Medicine in Antwerp modified an experimental enzyme immunoassay (EIA) for the detection of serum IgG to Hemophilus ducreyi to develop EIAs for detection of anti-H . ducreyi IgA and IgM antibodies . They tested the modified EIA on sera from people in Nairobi, Kenya; Kigali, Rwanda; Banjul, The Gambia; and Bangkok, Thailand, who had a sexually transmitted disease . The EIA was able to identify correctly those who did not have anti-H ducreyi IgA, IgG, and IgM antibodies in 97%, 92%, and 99% of cases, respectively . Among people with a genital ulceration for more than 8 days, it was able to identify correctly those who had IgA, IgG, and IgM antibodies in 88%, 93%, and 78% of cases, respectively . 95% of all culture-proven chancroid patients tested seropositive for at least 1 antibody type . The sensitivity of IgG and IgA EIAs was significantly enhanced in patients with culture-proven chancroid who were older than 24 years old (p .01) . HIV seropositive people from Kigali who had culture-proven chancroid had higher anti-H . ducreyi IgG seropositivity rates (but not IgA and IgM seropositivity rates), than did HIV seronegative chancroid people from Kigali (p .05) . The increased IgG seropositivity rate was not related to higher antibody titers, however, suggesting that HIV infection modifies the response to H . ducreyi . These results show that the 3 EIAs hold promise as a means to study the kinetics of antibodies and the epidemiology of chancroid .

Sex Transm Dis, 1994 Jan-Feb, 21(1), 13 - 23
Development of a polymerase chain reaction assay for the detection of Haemophilus ducreyi; Johnson SR et al.; BACKGROUND AND OBJECTIVES: Haemophilus ducreyi, the causative agent of chancroid is a fastidious organism difficult to culture and identify . Consequently, culture is an insensitive method for diagnosis . The polymerase chain reaction (PCR) offers a sensitive and specific nonculture method for the detection of bacterial pathogens . STUDY DESIGN: A polymerase chain reaction (PCR) assay was developed to detect the presence of Haemophilus ducreyi . A pair of primers was selected from sequences of an anonymous fragment of DNA cloned from H . ducreyi . The primers were tested in amplification reactions with both purified DNA and lysed organisms for their ability to detect H . ducreyi, and with DNA from a variety of different bacteria for their specificity . The utility of the primers for the detection of H . ducreyi in samples taken from genital ulcers was also tested and compared with culture . RESULTS: PCR was positive for 62% of the specimens that were culture-positive, however, PCR was also positive for 49% of the culture-negative specimens . Comparison of specimens that were dark field positive for T . pallidum and PCR-positive with those that were culture-positive for herpes simplex virus and PCR positive suggested that PCR was giving true and not random positive results . Additional studies demonstrated that the failure of PCR to detect H . ducreyi in all of the culture-positive specimens probably resulted from inhibitors of the Taq DNA polymerase that were present in the nucleic acids extracted from the clinical specimen . CONCLUSION: PCR should be a useful method for the detection of H . ducreyi in genital lesions, especially where culture sensitivity is poor . However, the presence of unidentified Taq polymerase inhibitors in some ulcers specimens require the development of improved methods for specimen handling.

West J Med, 1994 Jan, 160(1), 31 - 7
The new macrolides . Azithromycin and clarithromycin; Kanatani MS et al.; Clarithromycin and azithromycin are among the new generation of macrolides that have recently been approved for use . Compared with currently available antibiotics, these agents may be given less frequently and, in the case of azithromycin, for a shorter duration . In vitro data suggest an antimicrobial advantage of both clarithromycin and azithromycin against atypical mycobacterial and toxoplasmal species and possibly Haemophilus influenzae . The cost of both these agents is substantially higher than that of erythromycin and doxycycline, although the convenience of single-dose azithromycin is appealing compared with a 7-day course of doxycycline for chlamydial urethritis and cervicitis . These agents appear to offer advantages over erythromycin in the treatment of Mycobacterium avium-intracellulare . Additional data are needed to establish their role in other bacterial infections.

J Clin Microbiol, 1994 Jan, 32(1), 187 - 9
Evaluation of API NH, a new 2-hour system for identification of Neisseria and Haemophilus species and Moraxella catarrhalis in a routine clinical laboratory; Barbe G et al.; API NH is a new 2-h system (bioMerieux, La Balme-les-Grottes, France) for the identification of most Neisseria and Haemophilus spp . of clinical significance and of Moraxella catarrhalis and for the detection of penicillinase production . Furthermore, this system allows the biotyping of Haemophilus influenzae and Haemophilus parainfluenzae . Three hundred eighteen strains belonging to these species, previously identified by conventional methods, were tested . Among the 305 strains belonging to species included in the data base, 225 (73.8%) were identified without additional tests, 79 (25.9%) were correctly identified after extra tests, and 1 strain (0.3%) was misidentified . For 131 (90.3%) of the 145 H . influenzae and H . parainfluenzae strains, results of biotyping were in agreement with results of standard methods . API NH is an accurate and reliable method for the routine identification of these bacteria in a clinical laboratory, for biotyping of Haemophilus spp., and for the detection of penicillinase-producing strains . The system is ready to use and time saving; inoculation of the system and reading of results are easy.

Jpn J Antibiot, 1994 Jan, 47(1), 11 - 21
{In vitro antimicrobial susceptibilities and beta-lactamase production of clinical isolates . beta-Lactamase Study Group in Chubu-area}; Ito Y et al.; Antimicrobial susceptibilities and beta-lactamase production of clinical isolates from 1986 to 1991 except 1988 were determined . beta-Lactamase was detected frequently in Escherichia coli (84.7%), Klebsiella pneumoniae (65.4%), Staphylococcus aureus (62.3%), and not frequently in Haemophilus influenzae (22.4%) . Methicillin-resistant S . aureus was also resistant to many antimicrobials except to arbekacin and minocycline, and imipenem showed markedly high activity against methicillin-sensitive S . aureus . Susceptibilities of E . coli and K . pneumoniae to cefuzonam, imipenem and ofloxacin were quite high and that of H . influenzae to ofloxacin and cefuzonam was also very high.

Pediatr Pulmonol, 1994 Jan, 17(1), 6 - 10
C-reactive protein is not a useful indicator of intermittent bacterial colonization in early lung disease of patients with cystic fibrosis; Watkin SL et al.; C-reactive protein (CRP) is a general marker of the systemic inflammatory response to bacterial infection . Serial measurement of CRP is useful in monitoring respiratory exacerbations in patients with cystic fibrosis (CF) and chronic infection with Pseudomonas aeruginosa . We hypothesized that regular monitoring of CRP in young children with CF prior to colonization with P . aeruginosa might provide an objective guide to the need for antibiotic treatment . Twenty-two children were studied prospectively over a 6 month period . We measured CRP every 2 months and at the beginning and end of respiratory exacerbations . In samples taken when the children were well, median CRP was 0.45 microgram/mL compared with 1.92 micrograms/mL when they were symptomatic with positive culture results (P < 0.05) . Despite this difference there was considerable overlap between CRP levels for infected and noninfected patients . A CRP value of > 1.82 micrograms/mL (the upper 95% confidence interval for a control group of well children without CF) had a sensitivity of 49% and a specificity of 83% in determining a symptomatic exacerbation . We conclude that in this group of patients CRP measurements were of little value in monitoring respiratory exacerbations in patients who become intermittently infected with either Haemophilus influenzae or Staphylococcus aureus.

Przegl Epidemiol, 1994, 48(1-2), 39 - 44
{Polysaccharide vaccines against Haemophilus influenzae type B}; Wysokinska T et al.; Epidemiological situation of Haemophilus influenzae infection was described . Conjugated polysaccharide vaccines used all over the world and available in Poland were discussed according to their efficacy and safety.

Scand J Infect Dis Suppl, 1994, 93, 33 - 9
Bacterial resistance in eastern Europe--selected problems; Hryniewicz W; The profile of infection and pattern of bacterial resistance in Eastern Europe is distinct from that observed in other parts of the world . Several Polish investigations have reported that environmental pollution may increase the risk of respiratory disease . Studies from Hungary and Romania have documented a dramatic increase in the proportion of Streptococcus pneumoniae strains resistant to antibiotics . In comparison, resistance to these agents amongst Polish pneumococci isolates is lower, although these pathogens and Streptococcus pyogenes have displayed increasing tetracycline resistance . 20% of Polish Haemophilus influenzae isolates and a high percentage of Moraxella catarrhalis strains exhibit ampicillin resistance . Methicillin-resistant Staphylococcus aureus (MRSA) has been found to constitute 22% of Polish S . aureus strains . Two major clones of MRSA have been identified in Poland which differ in their degree of antimicrobial resistance . The pattern of antimicrobial resistance amongst Polish respiratory pathogens is undoubtedly a reflection of management policies and the use of these drugs . It is hoped that the economic and political changes taking place within Eastern Europe will provide the information and resources to establish more efficient infection control and antibiotic policy and thus delay and limit the appearance of bacterial resistance.

Scand J Infect Dis Suppl, 1994, 93, 20 - 32
Microbiology and management of otitis media; Brook I et al.; Otitis media is a complex and multifactorial condition with four defined stages: myringitis, acute otitis media, secretory (serous) otitis media and chronic otitis media . Drugs utilized in its treatment are antihistamines, decongestants, mucolytic agents, non-steroidal anti-inflammatory agents, corticosteroids, vaccine therapy and antibiotics . The rationale for using antibiotics is that inflammation has been associated with the presence of virulent bacteria in all types of otitis media . In acute otitis media the major organisms, present are Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis . In chronic otitis media these organisms, plus Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa and anaerobic bacteria are all prevalent . The microbiological flora of the middle ear in secretory otitis media is almost identical with that in acute otitis media . Empirical therapy can be given in most instances of acute and serous otitis media . However, in cases of failure, in the immunocompromised and in instances of chronic otitis media, establishing the individual microbiology of the inflamed middle ear is very helpful . The growing resistance of H . influenzae and M . catarrhalis to amoxycillin, due to beta-lactamase production, increases the risk of treatment failure of acute and serous otitis media . By adding a beta-lactamase inhibitor (clavulanic acid) to amoxycillin, or using second-generation cephalosporins, clearance can be achieved . Management of chronic otitis media requires surgical correction, drainage and coverage of anaerobic bacteria with agents such as amoxycillin plus clavulanic acid, or clindamycin plus antimicrobials against other pathogens such as Pseudomonas spp . where present.

Scand J Infect Dis, 1994, 26(2), 141 - 7
Interferon-gamma in cerebrospinal fluid from patients with viral and bacterial meningitis; Glimaker M et al.; Interferon (IFN)-gamma was analysed immunologically in cerebrospinal fluid (CSF) sampled in the acute phase from 27 patients (15-66 years) with viral meningitis and from 18 patients (0.5-90 years) with bacterial meningitis . Increased CSF concentrations were observed in 19/27 viral and in 13/18 bacterial cases . CSF-IFN-gamma did not distinguish between viral and bacterial meningitis . Five of 8 patients with meningitis due to herpes simplex virus type 2 (HSV-2) had CSF-IFN-gamma levels above the highest found in enteroviral meningitis . Thus, a markedly increased CSF-IFN-gamma value in patients with suspected viral meningitis ought to indicate HSV-2 etiology . The patients with Streptococcus pneumoniae meningitis (6 adults and 1 child) had significantly higher levels than the 7 children with Haemophilus influenzae meningitis . This may indicate that S . pneumoniae induces more IFN-gamma secretion than H . influenzae, and/or that during meningitis, adults are more apt to react with IFN-gamma production, than are children.

Diagn Microbiol Infect Dis, 1994 Jan, 18(1), 41 - 7
In vivo therapeutic efficacy of cefdinir (FK482), a new oral cephalosporin, against Staphylococcus aureus and Haemophilus influenzae in mouse infection models; Cohen MA et al.; Cefdinir (FK482), a new oral cephalosporin, displayed potent oral activity versus induced infections in mice . In studies using beta-lactamase-nonproducing (beta LAC-) and -producing (beta LAC+) Staphylococcus aureus strains, respective PD50s (in mg/kg) were 11 and 24 for preventing subcutaneous abscess and 2.7 and 2.3 for preventing lethal systemic infection . In studies using beta LAC- and beta LAC+ Haemophilus influenzae, respective PD50s were 5.8 and 3.1 for preventing lethal systemic infection . Time-kill studies versus H . influenzae showed that 6- to 12-mg/kg dosing was effective in reducing viable counts of these strains in blood by > or = 100-fold by 24 h after challenge . This in vivo performance was comparable to or exceeded values generated by cefaclor, cefpodoxime proxetil, and ampicillin.

Am J Nephrol, 1994, 14(1), 67 - 71
Concurrent presentation of hemolytic uremic syndrome in two adult siblings: effects of plasma therapy on hemolysis and renal function; von Gameren II et al.; We describe 2 sisters who presented with the hemolytic uremic syndrome (HUS) almost simultaneously . In both patients an upper airway infection with Haemophilus influenzae immediately preceding HUS may have been the environmental trigger . Fresh plasma infusion had only minor therapeutic effects but plasma exchange was followed by hematological remissions . One patient stayed dialysis dependent, the other had slow recovery of renal function on prolonged plasma exchange . These case histories suggest that in genetically predisposed patients HUS can be triggered by an infection with H . influenzae . Furthermore, when there is a poor response to plasma infusion recovery may be accelerated by plasma exchange.

Zh Mikrobiol Epidemiol Immunobiol, 1994 Jan-Feb, (2), 49 - 53
{Respiratory chlamydial infection in children with a complicated course of acute respiratory viral infections}; Kvetnaia AS et al.; The role and influence of Chlamydia trachomatis on the development and course of acute respiratory virus infections (ARVI) in 130 children admitted to the hospital of the Research Institute of Children's Infections (St . Petersburg) was studied . The occurrence of respiratory Chlamydia infections in ARVI patients with an unfavorable premorbid background was 35-36% . The disease took its course simultaneously with the mixed infection of the respiratory tract with viruses, pneumococci and their associations with staphylococci and Haemophilus influenzae . Chlamydia infection in children had no influence on the character of the clinical manifestation of ARVI with the exception of the obstruction syndrome which was constantly observed in children with ARVI (p < 0.001).

Bull Soc Pathol Exot, 1994, 87(1), 22 - 7
{Importance of culture media choice in the isolation of Haemophilus ducreyi . Experience in Senegal}; Dieng Sarr A et al.; Genital ulcerations typify one of the major reasons clients seek STD consultation in developing countries . The usual etiologies are syphilis, chancroid and herpes . The ideal diagnostic approach is to undertake complete laboratory examination that are rarely possible in structure destitute of laboratory analysis possibilities which is the case for most of the STD transmission agents . Chancroid is caused by Haemophilus ducreyi, a short Gram negative bacteria . The bacteriological diagnosis is based on direct examination, isolation and identification of the bacteria . The nutritive exigence of the bacteria required 3 medium of isolation (PPLO base Pasteur), GC base (GIBCO) and Muller Hinton base (Becton & Dickinson, with "chocolate" agar) have been tested from the chancre samples of 108 male patients who had a median age of 31 years . Direct exams were positive in 66 cases (61%) and culture exams positive in 53 cases (49%) . The Muller Hinton base with "chocolate" agar produced the best results and seems to be the medium of choice for isolated strains in Senegal . The culture mediums currently used in Europe are apparently inappropriate for the germ culture in Senegal . We have also observed that all the isolated strains were producers of beta-lactamase . Antibiotic treatment before the sample swab is taken seems to have an inhibiting effect on the culture . Direct examination with a sensibility of 94.3% and a specificity of 70.9% remains sufficient in routine presumptive diagnosis in endemic areas.

Ann Fr Anesth Reanim, 1994, 13(3), 280 - 4
{Comparison of amoxicillin and cefamandole in the prevention of bronchopulmonary infections in pulmonary surgery . A randomized double-blind study}; Train M et al.; Antibiotic prophylaxis is currently recommended in clean-contamined surgery (type II of Altemeier classification) . Pulmonary surgery belongs to this type . This prospective randomized and controlled study was designed to compare amoxicillin and cefamandole for prevention of pleural and bronchopulmonary infections after pulmonary resections . It included 256 patients, admitted between October 1st 1989 and July 1st 1991, for elective thoracotomy and probable pulmonary resection . The patients were allocated into two groups, group A (amoxicillin) and group C (cefamandole) . The first intravenous antibiotic injection took place immediately after induction of anaesthesia (1 g of amoxicillin or 1.5 g of cefamandole) . Postoperative injections were performed every 6 hours during 36 hours (i.e . a total of 6 injections) . Infection was defined by the association of general signs including hyperthermia (> 38 degrees C), hyperleucocytosis (> 12,000/mm3), and local signs such as bronchitis (B), pneumonia (P), empyema (E), wound sepsis (W) and non thoracic infection (S) . Follow-up included the hospital stay and a period of eight months after surgery for possible rehospitalisation for infection . Respiratory infections (bronchitis n = 35, pneumonia n = 5, empyema n = 2) occurred in 18% of the total population . No difference was seen between the two groups concerning the type of infection and the repartition of infection in relation to the type of pulmonary surgery . The causative bacterial organisms were Haemophilus influenzae (n = 4), Streptococcus pneumoniae (n = 2), Escherichia coli (n = 1), anaerobic bacteria (n = 1) . Multiple bacteria were found in one case . The empyema and wound sepsis occurred in the amoxicillin group.(ABSTRACT TRUNCATED AT 250 WORDS)

Ann Dermatol Venereol, 1994, 121(2), 127 - 30
{Chancroid in Yaounde . Apropos of 42 cases}; Koueke P et al.; In Yaounde, chancroid occurs frequently among adolescents and young men (95 p . 100 of the cases) who have sexual contacts regularly with prostitutes . Apart of classical clinical forms complicated in 2/3 of cases by inguinal adenopathies, we have observed furuncular chancroid which is quite characteristic of the disease . Giemsa stain represents for us a simple and reliable diagnostic method for this disease because in 1/3 of smears, typical cultural aspects of Haemophilus ducreyi were seen.

Acta Neurochir Suppl (Wien), 1994, 60, 45 - 7
Diffuse astrocytic swelling and increased second messenger activity following acute Haemophilus influenzae meningitis--evidence from a rat model; Maxwell WL et al.; Despite numerous epidemiological analyses of bacterial meningitis there is very little pathological data concerning the acute glial and neuronal responses to the disease . We have developed a safe, easily used rat model for Haemophilus influenzae type b meningitis . We measured cerebral blood flow, glucose utilisation and second messenger activity in this model, and carried out parallel light and ultrastructural analysis of glial and neuronal responses . Only protein kinase C activity was changed from control values . We obtained evidence for massive astrocytic swelling and neuronal degeneration . We posit that cytotoxic mechanisms may contribute to the pathology of meningitis.

Med Dosw Mikrobiol, 1994, 46(1-2 Suppl), 59 - 66
{Bacterial flora of respiratory tract infections}; Bialecka A et al.; In this paper the bacterial flora of respiratory tract diseases of children and adults was described . Significant differences in the frequency of isolation of various species of bacteria in connection with the age and the clinical form of disease were observed . Haemophilus influenzae was isolated from the accessory sinuses of the nose of children with significantly higher frequency than from adults . This microorganism occurred as the only etiological agent in more than 50% of cases.

Pathobiology, 1994, 62(2), 109 - 12
Destruction of human microvascular endothelial cell capillary-like microtubules by Brazilian purpuric fever-associated Haemophilus influenzae biogroup aegyptius; Quinn FD et al.; When grown in the presence of Matrigel, monolayers of an immortalized human microvascular cell line (HMEC-1) form capillary-like microtubule networks . Previous work, using HMEC-1 monolayers, demonstrated a significant difference in in vitro cytotoxicity between Brazilian purpuric fever (BPF)-associated Haemophilus influenzae biogroup aegyptius (HAE) strains and non-BPF-associated HAE strains . The present study demonstrates that BPF-related cytotoxic differences can also be observed in HMEC-1 microtubule networks . At a multiplicity of infection (MOI) of 2 x 10(-2) bacteria/tissue culture cell, BPF-associated strain F3031 disrupted the microtubule network, producing random clumps of rounded cells at 48 h of incubation . Infection with non-BPF-associated strain F1947 at the same MOI produced no observable microtubule disruption . The ability of HMEC-1 microtubule model to differentiate virulent and avirulent HAE in vitro will further aid in the study of BPF pathogenesis . In addition, the fact that the HMEC-1 cells can be induced to form microtubules make it an excellent model system for the general study of many of the agents of vascular purpura.

Lancet, 1994 Jan 1, 343(8888), 12 - 6
Haemophilus parainfluenzae antigen and antibody in renal biopsy samples and serum of patients with IgA nephropathy; Suzuki S et al.; IgA nephropathy may be associated with colonisation with Haemophilus parainfluenzae . In patients with glomerular diseases, we examined renal-biopsy specimens for presence of bacterial antigen by immunofluorescence microscopy with rabbit antiserum against H parainfluenzae, and by enzyme-linked immunosorbent assay looked for IgA antibody against H parainfluenzae in patient sera . The rabbit antiserum recognised by immunoblotting four components of H parainfluenzae outer membranes (OMHP) of molecular weights 19.5, 30, 33, and 40.5 kDa . All 44 patients with IgA nephropathy and 2 of 39 patients with other glomerular diseases showed mesangial deposition of OMHP antigens (p < 0.001) . Patients with IgA nephropathy had significantly more IgA antibody against H parainfluenzae than did patients with other glomerular diseases . IgA antibody in the sera of patients with IgA nephropathy recognised by immunoblotting the same four components of OMHP as recognised by rabbit antiserum . Glomerular deposition of OMHP antigens and the presence of IgA antibody against OMHP in patients with IgA nephropathy suggest that H parainfluenzae has a role in the aetiology of this disease.

J Med Microbiol, 1994 Jan, 40(1), 48 - 54
The role of HSV-induced Fc- and C3b (i)-receptors in bacterial adherence; De Graaf-Miltenburg LA et al.; Herpes simplex virus type-1 (HSV-1) induces Fc- and C3b(i)-receptors on infected cells . The role of these receptors in bacterial superinfection was studied by comparing the adherence of non-opsonised and opsonised bacteria to HSV-infected and non-infected HEp-2 cells . A flow cytometric adherence assay, based on the fluorescent quantitation of FITC-labelled bacteria, was developed . Opsonisation of Staphylococcus epidermidis with human serum, resulted in a marked increase in adherence to HSV-infected cells and revealed a role for C3b(i)R- and FcR-mediated adhesion . However, the enhanced adherence never exceeded the level of attachment to non-infected cells . Increased adherence of other pathogenic bacteria, including Escherichia coli, Streptococcus pneumoniae, Haemophilus influenzae and Pseudomonas aeruginosa was not observed, indicating that the HSV-receptors play a minor role in secondary infections . Bacterial adhesion factors such as the fimbriae of E . coli played a more dominant role in the adherence of bacteria to HSV-infected cells.

Probl Tuberk, 1994, (5), 19 - 21
{Role of immunologic studies in the diagnosis of tuberculosis in adolescents}; Firsova VA et al.; Tuberculous antigens and antibodies, antigens and antibodies to pneumococcus, haemophilus bacteria . Klebsiella pneumonia, proteus bacteria were determined in 100 adolescents (87 with tuberculosis and 13 with nonspecific lung diseases) . Specific antigens and antibodies were detected in 62% of tuberculous and 7.7% of nontuberculous patients . The most pronounced immune response to M . tuberculosis antigens and antibodies as well as to nonspecific flora was registered in patients with long-term and disseminated processes . Immunological investigations are thought an important tool in diagnosis, differential diagnosis of tuberculosis and planning combined treatment policy.

Rev Elev Med Vet Pays Trop, 1994, 47(2), 177 - 9
A clinical note on Haemophilus aegyptius infection in sheep in Nigeria; Akpavie SO et al.; An outbreak of Haemophilus aegyptius infection in a livestock farm located in Maya, Oyo State, Nigeria is reported . Diagnosis was based on clinical signs of central nervous system disturbance, histopathological findings of meningoencephalomyelitis, acute multifocal necrotising purulent hepatitis and the isolation of Haemophilus aegyptius from the spinal cord . Other diseases that can cause nervous disturbance are discussed.

Scand J Infect Dis, 1994, 26(5), 611 - 4
Cost-benefit analysis of general vaccination against Haemophilus influenzae type b in Sweden; Trollfors B; A cost-benefit analysis of general vaccination of infants with a conjugated Haemophilus influenzae type b (HIB) vaccine was performed . Information on incidence and prognosis of HIB meningitis and acute epiglottitis in children was obtained from nation-wide retrospective studies covering the years 1981-83, when the birth rate was approximately 93,000 per year . The annual cost for hospitalization, neurologic and auditory sequelae and parents' absence from work amounted to 54 million Swedish crowns (SEK) . A mean of 6 children died every year . Inclusion of value of lives lost added SEK 72 million to the cost of disease . With vaccine prices (approximately SEK 125/dose) and birth rate (approximately 120,000 per year) prevailing in 1993, vaccine costs would be SEK 45 million, provided that 3 doses are sufficient to offer protection close to 100% . Other costs for vaccination, e.g . physicians' and nurses' time, needles and syringes, are negligible, since the vaccine can be given at the same time as other infant vaccinations at already existing Child Health Centres . In conclusion, general vaccination of infants against HIB is cost-effective, saves lives and reduces human suffering.

Chemotherapy, 1994, 40(6), 399 - 403
Susceptibility of clinically significant Haemophilus influenzae strains to oral antimicrobial agents used in Saudi Arabia; Shibl AM et al.; The incidence of beta-lactamase production by Haemophilus influenzae strains and their susceptibility to commonly used oral antimicrobial agents were evaluated . From 1990 to 1992, 600 significant isolates of H . influenzae obtained from various hospitals throughout Saudi Arabia were identified, serotyped and tested for beta-lactamase production using cefinase discs and susceptibility to various antibiotics using the agar dilution method . The study revealed that 17% of the strains produced beta-lactamase; 21% of them were type b . The overall level of resistance was 30% to erythromycin, 28% to tetracycline, 14.3% to co-trimoxazole, 6.6% to chloramphenicol, 1.8% to amoxicillin-clavulanate and 1.5% to cefaclor . About 1.3% of the strains that did not produce beta-lactamase were resistant to ampicillin . Resistance of H . influenzae to antibiotics is increasing and in several parts of the world resistance to ampicillin has reached substantial levels particularly in type b strains . Information on resistance is needed for the appropriate selection of initial empiric therapy among patients in whom H . influenzae is a suspected pathogen.

Rev Pneumol Clin, 1994, 50(2), 63 - 7
{Treatment of community-acquired pneumonia by pristinamycin (Pyostacine 500) . Results of a non comparative open study}; Petitpretz P et al.; Activity of natural streptogramin (NSG) appears well adapted to pathogens responsible for CAP . The goal of this multicenter pilot study was to bring first data about efficacy of NSG in treatment of CAP . PATIENTS METHOD: Ten days of a NSG (1 gr b.i.d . or t.i.d.) regimen was administered to 46 hospitalized adult patients for CAP defined with fever > 38 degrees C, respiratory symptoms and X-ray opacity . Severely ill patients were excluded . A broncho-pulmonar sample (expectoration or trantracheal aspiration or protected distal sample) was performed in all patients . RESULTS: two patients were excluded because of pulmonary embolism (n = 1) or tuberculosis (n = 1) and 44 patients were analyzed . 50% of them had associated disease, 20% had failure of prior antibiotherapy . At inclusion, mean fever was 39.2 +/- 0.7 degrees C, respiratory rate was 22 +/- 5/mn, PaO2 was 74 +/- 10 mmHg, chest X-ray showed bilateral opacity in 16%, unilateral in 84% and pleural fluid level in 6 cases . Etiological diagnosis was determined in 70% of cases . Streptococcus pneumoniae (n = 14), Haemophilus influenzae (n = 5), Legionella pneumophila (n = 2), Mycoplasma pneumoniae (n = 2) and Chlamydia psittaci (n = 1) were the most frequent isolated pathogens . 40 patients (91%) were cured with NSG and delay to obtain apyrexia was 4.4 +/- 3.9 days . NSG was stopped in 4 patients: 1 clinical and bacteriological failure (Klebsiella pneumoniae), 2 clinical failures (1 pneumococcus with purulent pleurisy, 1 pneumococcus with worsening of respiratory status), 1 patient with resistant H . influenzae strain in spite of favourable clinical evolution . NSG was well tolerated in 86% of patients . CONCLUSION: these data invite to carry on evaluation of first line therapy of CAP with NSG.

Ann Trop Paediatr, 1994, 14(3), 183 - 8
The immunogenicity and safety of Haemophilus influenzae type b-tetanus toxoid conjugate vaccine in Gambian infants; Mulholland EK et al.; In developing countries, Haemophilus influenzae type b is a major cause of meningitis and pneumonia in the 1st year of life . The safety and immunogenicity of a Haemophilus influenzae type b polysaccharide-tetanus toxoid conjugate vaccine (PRP-T) were evaluated in two studies of Gambian infants . In the first study, 131 infants were recruited and randomized into three groups to receive PRP-T at 1 and 3 months (group A), PRP-T at 2 and 4 months (group B) or no PRP-T (group C) . The liquid form of PRP-T was used . The geometric mean titre (GMT) of anti-PRP antibody 1 month after the second dose was 0.26 microgram/ml in group A and 0.41 microgram/ml in group B . In the second study, 66 infants were given PRP-T in the lyophilized form at 2, 3 and 4 months of age . The GMT 1 month after the first dose was 0.09 microgram/ml, after the second 0.74 microgram/ml and after the third 2.32 micrograms/ml . After the third dose, 72% of children had antibody levels greater than 1.0 microgram/ml and 93% greater than 0.15 microgram/ml . No serious side-effects were observed and the rate of adverse reactions was consistent with the concurrent administration of diphtheria-tetanus-pertussis (DPT) vaccinePIP: In Sukuta, Gambia, in 1989, 128 newborns were randomly allocated to receive the liquid form of the Haemophilus influenzae type b (Hib) polysaccharide-tetanus toxoid (PRP-T) vaccine at 1 and 3 months (group A), 2 and 4 months (group B), or not to receive the vaccine (group C) . All these children also received the oral polio vaccine and the diphtheria-pertussis-tetanus (DPT) vaccine . In 1990, in Bakau, Gambia, 66 infants received the lyophilized form of the PRP-T vaccine at the same time as they received DPT vaccine: 2, 3, and 4 months . The investigators aimed to determine the safety and immunogenicity of PRP-T as a forerunner to the upcoming PRP-T efficacy trial in Gambia . In the 1989 study, the geometric mean titer (GMT) of anti-PRP antibody 1 month after the second dose was higher in group B than in group A (0.41 vs . 0.26 mcg/ml) . In the 1990 study, the GMT of anti-PRP antibody was 0.09 mcg/ml after the first dose, 0.74 mcg/ml after the second dose, and 2.32 mcg/ml after the third dose . One month after the final dose, the lyophilized PRP-T vaccine yielded higher antibody levels than the liquid form . For example, 72% of infants in the lyophilized group had an antibody level greater than 1 mcg/ml compared with 18% for the liquid group . 93% of all infants in groups A and B had antibody levels above 0.15 mcg/ml, the level considered to provide immediate protection, compared with 53% for the liquid group . Serious side effects were not observed . The rate of adverse reactions correlated with the concurrent delivery of DPT vaccine . Advantages of the PRP-T vaccine include: it mixes well with DPT; if administered in a three-dose schedule to Gambian infants, it is safe and elicits a protective antibody response in most infants; and it also protects against Hib infection, a major cause of meningitis and pneumonia in infants and an important cause of major childhood-acquired disability in developing countries .

Scand J Infect Dis, 1994, 26(5), 545 - 51
Children with persistent cough--outcome with treatment and role of Moraxella catarrhalis?
Gottfarb P, Brauner A.
52 children with severe cough persisting for more than 10 days were randomized to treatment with amoxycillin/clavulanic acid or placebo in a prospective double-blinded study . Clinically suspected cases of pertussis were excluded, yet 12 (23%) of the children had laboratory verified pertussis infection . The nasopharyngeal colonization showed a predominance of Moraxella catarrhalis which was isolated in 37 (71%) children . Streptococcus pneumoniae and Haemophilus influenzae were isolated in 11 (20%) and 16 (30%) children, respectively . The antibiotic-treated group had a significantly better recovery in both the pediatrician's estimation (p = 0.02) and the independent parental judgement (p = 0.002) . These findings are consistent with the view that Moraxella catarrhalis could be directly involved in the pathogenesis of persistent cough in children.

Ann Trop Paediatr, 1994, 14(2), 97 - 103
Epidemiology of invasive Haemophilus influenzae infections in Cape Town, South Africa; Hussey G et al.; The full spectrum of invasive Haemophilus influenzae disease has not been documented previously in Africa . This 1-year prospective study was designed to determine the epidemiology of invasive Haemophilus influenzae disease in Cape Town children . During this period, 142 children with invasive disease were hospitalized; 85 (59.9%) presented with meningitis, 35 (24.6%) with pneumonia and 22 (15.5%) with other diseases . No cases of epiglottitis were seen . Sixty per cent of cases were male and 40% female . The median age of the children was 9 months, with a range of 1-144 months, and 65.5% were aged < 12 months . Neurological dysfunction was noted in 40% and 18% of children with meningitis on admission and discharge, respectively . The overall case fatality rate (95% confidence intervals) was 9.2% (4.9-15.7), and for meningitis, pneumonia and septicaemia it was 4.7% (1.2-16.4), 14.3% (4.6-31.8) and 40% (8-78.1), respectively . Serotype b accounted for 86.5% of all cases, 97.3% of cases of meningitis, 71.4% of cases of pneumonia, 50% of cases of septicaemia, all cases of arthritis and cellulitis and none of mastoiditis . The incidence rates (95% confidence intervals) for all invasive type b infections were 169 (122-198) and 47 (39-57) per 100,000 population for children < 1 and < 5 years, respectively . For meningitis the rates were 112 (84-148) and 34 (25-40) per 100,000, respectively . Rates for mixed race and white children were similar, but those for black children were more than double those rates.(ABSTRACT TRUNCATED AT 250 WORDS)

J Clin Microbiol, 1994 Jan, 32(1), 54 - 8
Utility of gram stain in evaluation of sputa from patients with cystic fibrosis; Sadeghi E et al.; The utility of sputum Gram stain in assessing salivary contamination and in predicting the presence of pathogens on the basis of morphology was investigated in 287 respiratory specimens from patients with cystic fibrosis . Where acceptability for culture was defined as a leukocyte/squamous epithelial cell ratio of > 5, 76.6% (220 of 287) of respiratory specimens received in the laboratory were considered acceptable . Unacceptable specimens were more common in younger patients . The positive predictive value of the Gram stain for growth from acceptable sputum samples was 98% for Pseudomonas aeruginosa, 84.4% for Pseudomonas cepacia, 86.3% for Staphylococcus aureus, and 100% for Haemophilus influenzae . In cystic fibrosis patients, as has been reported for respiratory specimens in general, Gram stain of respiratory specimens in helpful for interpreting culture results.

Clin Diagn Lab Immunol, 1994 Jan, 1(1), 21 - 5
Antibody response to polyribosyl-ribitol phosphate antigen of Haemophilus influenzae in Ecuadorian and German children; Brussow H et al.; Serum samples from 1,221 Ecuadorian children 0 to 5 years of age and from 236 German subjects were tested by enzyme-linked immunosorbent assay for class-specific antibodies to the capsular polysaccharide of Haemophilus influenzae type b (PRP antigen) . A gradual prevalence increase of and mean titer increase in immunoglobulin M (IgM) antibody was seen in Ecuadorian but not in German children older than 6 months . At the end of the first year of life, about 50% of the Ecuadorian children showed IgM and IgG antibody to PRP . Seroepidemiological analysis revealed that living at a low altitude and lower calorie intake (a proxy measure of breast-feeding) were factors associated with earlier acquisition of PRP antibody . Children from low-altitude areas of Ecuador also experienced significantly more episodes of significant respiratory infections . The acquisition of PRP-reactive antibodies in Ecuadorian children might thus reflect exposure to encapsulated H . influenzae type b in lower respiratory tract infections.

Gene, 1993 Dec 22, 136(1-2), 35 - 40
The sequence of the Haemophilus influenzae mutB gene indicates it encodes a DNA helicase II-like protein; Walter RB et al.; A 6.2-kb Haemophilus influenzae genomic DNA fragment which partially complemented both the mutator and ultraviolet light sensitive (UVs) phenotypes of the H . influenzae mutB1 mutant was isolated . This fragment was also able to complement the UVs phenotype of Escherichia coli uvrD mutant hosts . The uvrD+ gene complemented the mutator phenotype of mutB1 hosts . The nucleotide (nt) sequence of the 6.2-kb fragment revealed an open reading frame (ORF) of 2184 bp . This ORF shows similarity at both the nt and amino acid (aa) levels with the uvrD gene of E . coli . Comparison of the sequences revealed eight regions of aa conservation in addition to seven previously identified helicase superfamily domains . The nt sequence 5' to the mutB ORF contains several potential regulatory motifs, including a LexA-binding site . Based upon these observations, we are confident that the mutB gene of H . influenzae encodes an ATP-dependent DNA helicase-like activity.

Gene, 1993 Dec 22, 136(1-2), 281 - 6
The Haemophilus influenzae dnaG sequence and conserved bacterial primase motifs; Versalovic J et al.; The dnaG gene encodes primase which synthesizes the primer RNA essential for Escherichia coli chromosomal DNA replication . The nucleotide sequence was determined for the Haemophilus influenzae dnaG gene and used in the molecular evolutionary analysis of primases from six bacterial species . The predicted amino acid (aa) sequence of H . influenzae DnaG contains 593 residues and shares 56% identity with E . coli DnaG . The N-terminal 60% of six aligned bacterial primases contains all 71 absolutely conserved aa residues and several conserved motifs . All six bacterial primases which were sequenced contained a conserved CPFHXEKTPSF(T/S/A)VXXXKQX(F/Y)HCFGC zinc finger (zf) in the N terminus . A basic region in the N-terminal half of the primases contains a conserved motif, G(R/K)X(V/I/L)X(F/Y) (G/S/A)(G/S/A)RX(V/I/L)XXXXP, termed 'RNAP-basic', which is shared only with RNA polymerase (RNAP) large subunits . This conserved sequence represents the first motif common and specific to primases and RNAP subunits . The consensus sequence, PKYLNSPET, lies adjacent to this basic region in bacterial primases and may represent a signature sequence for bacterial DnaG . The C-terminal regions of these primases do not appear to share primary sequence similarities . These findings support our hypothesis that the primase active site of DnaG is located in the N-terminal 60% of the enzyme.

Pharmacoeconomics, 1994, 5(Suppl 2), 34 - 9
Choosing between the new cephalosporin antibiotics: a pharmacodynamic approach; Nicolau DP et al.; The use of pharmacodynamic properties when formulating antibacterial administration guidelines can maximise the potential for efficacy while minimising the risk of toxicity . Aminoglycosides and quinolones demonstrate concentration-dependent bactericidal killing, which is maximised when their concentrations appreciably exceed their minimum inhibitory concentration (MIC) for an organism . beta-Lactams demonstrate time-dependent or concentration-independent bactericidal killing, which is maximised when the time that concentrations exceed the MIC is prolonged, regardless of the absolute levels attained . Methods of prolonging the time beta-lactam concentrations exceed the MIC include the following: interfering with excretion (e.g . probenecid); decreasing the dosage interval; increasing the dose; infusing continuously rather than by bolus; and choosing an agent with a prolonged elimination half-life . The optimal duration for exceeding the MIC varies with the infecting organism, site of infection, inoculum effect, and the immunocompetence of the host . Integration of the microbiological activity and pharmacokinetic properties enables estimation of the time that serum concentrations of various cephalosporins will exceed the MIC of a given organism, consequently allowing estimation of the relative potential for clinical success . Cefixime, a third generation oral cephalosporin with a long plasma elimination half-life, allowing once-daily administration, achieves serum concentrations that exceed the MIC of Haemophilus influenzae, Moraxella catarrhalis, Escherichia coli, and Group A streptococci for greater than 90% of the dosage interval, and the MIC of Streptococcus pneumoniae for 50 to 90% of the dosage interval.

Med J Aust, 1993 Dec 6-20, 159(11-12), 766 - 72
The outcome of childhood Haemophilus influenzae meningitis . A population based study; McIntyre P et al.; OBJECTIVE: To determine the morbidity and mortality from childhood Haemophilus influenzae type b (Hib) meningitis in a well defined population . DESIGN: Retrospective survey 1985-1987 and prospective surveillance of hospital laboratories 1989-1990 . Information on outcome of meningitis was obtained from hospital records and attending physicians and, in 1989-1990, from a survey of the children's parents . SETTING: Sydney Statistical Division, which had a population of children aged 0-4 years of 229,165 in 1986 and 263,758 in 1990 . PATIENTS: Eligible children were aged from one month to four years and had clinical and microbiological evidence of Hib meningitis on standard criteria . RESULTS: There were 229 eligible children . Twelve were excluded (seven died and five had pre-existing neurological deficits) . A neurological deficit was detected at the time of hospital discharge in 45 patients (21%) and persisted for 12 months or longer in 29 patients (13%) . Follow-up information was available for 165 (96%) children who were normal at the time of hospital discharge and persistent deficits were recorded in 12 (7%) of these children . Forty-one children (19%) had readily recognisable neurological or hearing problems: nine (4%) had persistent severe neurological deficits and seven (3%) had severe hearing loss requiring hearing aids or a cochlear implant . Age had a significant influence on outcome . The youngest children were significantly more likely to be admitted to intensive care . Severe neurological deficits showed a significant negative trend with increasing age (P = 0.03) . Severe unilateral or bilateral sensorineural loss (odds ratio {OR} 8.0, 95% confidence interval {CI} 1.5-81) and ataxia at discharge (OR 13.3, 95% CI 2.8-128) were noticeably more common in children over two years of age, with a significant positive trend (P < or = 0.001) with increasing age . Patients requiring intensive care were much more likely to have an adverse outcome, particularly if positive pressure ventilation was needed . CONCLUSIONS: These data provide population-based estimates of the minimum incidence of adverse outcomes from Hib meningitis in an urban community with good access to medical services . This is important in assessing the impact of Hib vaccination, as meningitis is responsible for most of the long-term morbidity from childhood invasive Hib disease . Determination of the relationship between morbidity and age is important for assessing alternative vaccine strategies.

J Mol Biol, 1993 Dec 5, 234(3), 579 - 93
Characterization of the Neisseria Iga beta-core . The essential unit for outer membrane targeting and extracellular protein secretion; Klauser T et al.; Extracellular transport of Neisseria IgA proteases across the bacterial outer membrane is accomplished by the translocation function contained within the C-terminal Iga beta domain of IgA protease precursor proteins . Recently, we reported that Iga beta from N . gonorrhoeae MS11 (Val1097 to Phe1505), fused to a periplasmic passenger protein, facilitated its transport across the outer membrane, leading to surface exposure of the passenger . In the present work we show, by systematic N-terminal truncation of Iga beta, that the functional and structural unit, termed Iga beta-core, corresponds to the C-terminal approximately 274 amino acid residues (Ser1231 to Phe1505) . This minimal region retains all the essential features necessary for the translocation of an N-terminally attached passenger across the outer membrane of Escherichia coli, and for its own correct integration into the outer membrane, even in the absence of a passenger protein . The membrane-integrated Iga beta-core constitutes a conserved entity found in the C-terminal regions of Iga beta domains of different N . gonorrhoeae, N . meningitidis and Haemophilus influenzae strains . In contrast, the surface-exposed N termini of the Iga beta domains vary in size and sequence . Based on secondary structure predictions, the key structural feature of the core is a beta-barrel (amphipathic, antiparallel transmembrane beta-strands, interspersed by hairpin turns and loops) which is common to many integral outer membrane proteins of Gram-negative bacteria . We propose that the core has been conserved in evolution, to provide a selective outer membrane export channel for covalently attached polypeptides.

Clin Otolaryngol, 1993 Dec, 18(6), 512 - 6
Effect of pre-operative antibiotic treatment on the bacterial content of the tonsil; Cafferkey MT et al.; The impact of 7 days pre-tonsillectomy antibiotics on the aerobic bacterial content of the tonsil was studied in 70 consecutive patients . One group received no antibiotic, one group received pre-operative amoxycillin and the final group, pre-operative cefaclor . The qualitative bacteriology was similar in the three groups Haemophilus influenzae was the predominant isolate present in the centre ('core') of the resected tonsil . Similar numbers of beta-lactamase producers including H . influenzae and Straphylococcus aureus were found in all three groups . Quantitative bacteriology of the tonsil core demonstrated that there was a significant reduction in core tonsil pathogens associated with antibiotic therapy . The most statistically significant difference was between the untreated control group and the cefaclor treated group . We conclude that in patients with established recurrent acute tonsillitis, oral antibiotics penetrate the diseased tonsil and influence the predominant core aerobic microflora.

Ear Nose Throat J, 1993 Dec, 72(12), 804 - 10
Efficacy of clarithromycin vs . amoxicillin/clavulanate in the treatment of acute maxillary sinusitis; Dubois J et al.; A new macrolide drug, clarithromycin (Biaxin) was compared with amoxicillin/clavulanate (Augmentin) in a single-blind (investigator-blind), randomized, multicenter study of 497 outpatients with acute maxillary sinusitis; treatment was 500 mg clarithromycin bid (n = 246) or 500 mg amoxicillin/clavulanate tid (n = 251) . Pathogens included Streptococcus pneumoniae in 22% of patients, Staphylococcus aureus in 16%, Haemophilus influenzae in 10%, and Moraxella catarrhalis in 7% . For evaluable patients, clinical success (cure or improvement) was noted for 97% (128/132) of clarithromycin recipients and 93% (119/128) amoxicillin/clavulanate recipients . Clinically significant improvement in signs and symptoms was comparable between groups . Bacteriologic cure rates were 87% (115/132) and 90% (115/128), respectively . Respective pathogen eradication rates were 87% (125/143) and 90% (125/139) . Adverse events not due to concurrent conditions occurred in 41% of the former and 46% of the latter group; most were mild to moderate gastrointestinal upsets (21% and 38%, respectively; P < 0.001) . We conclude that clarithromycin appears to be as effective as amoxicillin/clavulanate in acute maxillary sinusitis and may cause fewer gastrointestinal upsets.

Thorax, 1993 Dec, 48(12), 1227 - 9
Value of bacterial antigen detection in the diagnostic yield of transthoracic needle aspiration in severe community acquired pneumonia; Bella F et al.; BACKGROUND--Transthoracic needle aspiration (TNA) with an ultrathin needle is a safe and highly specific procedure for obtaining a diagnosis in bacterial pneumonias, but its sensitivity is at best 70% . A study was performed to assess whether Streptococcus pneumoniae and Haemophilus influenzae type b antigen detection by latex agglutination from the TNA sample enhanced the diagnostic yield . METHODS--Blood cultures, TNA with an ultrathin needle (culture, Gram stain, and latex agglutination), serological tests, and pneumococcal antigen detection in the urine by counterimmunoelectrophoresis were performed in samples from 18 of 23 consecutive patients with severe community acquired pneumonia . RESULTS--The causative organism was identified in 16 cases (88%): S pneumoniae (10 cases), S pneumoniae plus H influenzae (two cases), Legionella pneumophila (three cases), and Mycoplasma pneumoniae (one case) . The investigation of antigens by latex agglutination in the pulmonary aspirate increased the diagnostic yield of TNA from 50% to 78% and provided a rapid diagnosis (in less than two hours) with therapeutic implications in seven cases . Its effectiveness was not modified by prior antibiotic therapy . CONCLUSIONS--A latex agglutination test on the pulmonary aspirate enhances the diagnostic yield of TNA in severe community acquired pneumonia.

Pediatr Infect Dis J, 1993 Dec, 12(12 Suppl 3), S99 - 105
Extent and spectrum of the antimicrobial activity of clarithromycin; Hardy DJ; Clarithromycin, a new semisynthetic macrolide, is lipophilic and achieves concentrations in tissue that are generally 10 times greater than concentrations achieved in serum . Its binding to serum proteins is low and reversible . Clarithromycin has in vitro and in vivo activity against a variety of Gram-positive and Gram-negative bacteria, Mycoplasma, Chlamydia and mycobacteria . 14-Hydroxyclarithromycin, the major metabolite of clarithromycin in humans, is generally as active as clarithromycin against these organisms but is more active in vitro and in vivo than clarithromycin against Haemophilus influenzae . Organisms resistant to erythromycin by plasmid or transposon-encoded methylase, macrolide-lincosamide-streptogramin resistance, are also resistant to clarithromycin . Unlike older macrolides, however, clarithromycin has in vitro and in vivo activity against atypical mycobacteria . The antimicrobial activities of clarithromycin and 14-hydroxyclarithromycin are reviewed in this article.

Pediatr Infect Dis J, 1993 Dec, 12(12 Suppl 3), S148 - 51
Clarithromycin: where do we go from here?
Klein JO.
Clarithromycin is a new macrolide with a broad spectrum of activity against Gram-positive cocci, Haemophilus influenzae, Moraxella catarrhalis, Mycoplasma, Chlamydia and selected Mycobacteria, Legionella and protozoa . The drug has a half-life of more than 4 hours and thus can be administered in a twice daily schedule . Clarithromycin is well-tolerated in children and adults and produces fewer gastrointestinal side effects than erythromycin . High concentrations of the drug are achieved in plasma and in cells and tissues including tonsil, lung and middle ear fluids . Clinical efficacy has been demonstrated in randomized multicenter trials of infants and children with acute otitis media, streptococcal pharyngitis and infections of skin and skin structures . Results of these comparative trials with randomized patients receiving clarithromycin or standard drugs identified equivalent clinical and bacteriologic outcomes . A higher rate of eradication of group A Streptococcus from the pharynx was achieved with clarithromycin than with penicillin VK . The potential advantages provided by high concentrations of clarithromycin in cells and tissues such as more rapid clinical improvement or shortened dosage schedules are still to be identified.

Pediatr Infect Dis J, 1993 Dec, 12(12 Suppl 3), S118 - 21
Clarithromycin vs . amoxicillin suspensions in the treatment of pediatric patients with acute otitis media; Pukander JS et al.; Clarithromycin is a new macrolide antibiotic that is active in vitro against a variety of organisms that are responsible for acute otitis media in children . The parent compound is metabolized to microbiologically active 14-hydroxy clarithromycin, which is especially active against Haemophilus influenzae . The safety and efficacy of clarithromycin and amoxicillin suspensions were compared in the treatment of acute otitis media in children 1 to 12 years of age inclusive . This was a Phase III, single blind (investigator-blind), randomized, multicenter clinical trial . Clarithromycin oral suspension was given in a dose of 7.5 mg/kg (maximum, 500 mg) twice daily, and amoxicillin suspension in a dose of 20 mg/kg (maximum, 750 mg) was given twice daily for 7 to 10 days in a 1:1 ratio . Clinical evaluations were performed pretreatment, within 48 hours posttreatment and 10 to 14 days posttreatment . Myringotomy was performed in every child to obtain a microbiologic sample pretreatment and at subsequent visits as clinically indicated . A total of 79 children were enrolled, 39 in the clarithromycin and 40 in the amoxicillin treatment group . Thirty-two children were excluded from the efficacy analysis for various reasons . Clinical success (cure and improvement) rates at 0 to 4 days posttreatment were 93% for clarithromycin and 90% for amoxicillin (P > 0.999) . Altogether 17 children (10 receiving clarithromycin, 7 receiving amoxicillin) experienced some adverse event, with gastrointestinal disorders being the most common complaint . No clinically significant differences in laboratory tests were found between the groups.(ABSTRACT TRUNCATED AT 250 WORDS)

Scand J Dent Res, 1993 Dec, 101(6), 350 - 6
Polymorphonuclear leukocyte chemiluminescence induced by Actinobacillus actinomycetemcomitans and Haemophilus aphrophilus in serum and saliva; Holm A et al.; The ability of different strains of Actinobacillus actinomycetemcomitans (A.a.) and Haemophilus aphrophilus (H.a.) to trigger activation of an oxidative burst in human polymorphonuclear leukocytes (PMNL) was examined by measuring the luminol-amplified light emission--chemiluminescence (CL)--from these cells . Bacterial cells were incubated with PMNL from one healthy subject, in the presence of either active serum, heat-inactivated serum, saliva, or saliva and active serum . In the presence of active serum, all five H.a . strains and two out of five A.a . strains triggered a CL response . The CL induced in the presence of heat-inactivated serum was considerably less than that achieved with fresh serum . In the presence of only saliva, all strains induced considerably weaker CL responses than those induced in the presence of saliva with active serum . In the presence of serum, intracellular reactions appeared to be the main source of CL, while addition of saliva and active serum increased the extracellular CL . The results indicate that strain-dependent differences exist among A.a . strains in their ability to trigger the oxygen-dependent bactericidal mechanisms of human PNML . In contrast, the CL patterns of H.a . strains were equivalent . Various factors in the environment, such as activated complement and salivary compounds, affect the interaction of these species with neutrophils.

J Bacteriol, 1993 Dec, 175(24), 8018 - 23
Cloning, sequencing, expression, and complementation analysis of the Escherichia coli K1 kps region 1 gene, kpsE, and identification of an upstream open reading frame encoding a protein with homology to GutQ; Cieslewicz MJ et al.; The kps locus for polysialic acid capsule expression in Escherichia coli K1 is composed of a central group of biosynthetic neu genes, designated region 2, flanked on either side by region 1 or region 3 kps genes with poorly defined functions . Chromosomal mutagenesis with MudJ and subsequent complementation analysis, maxicell and in vitro protein expression studies, and nucleotide sequencing identified the region 1 gene, kpsE, which encodes a 39-kDa polypeptide . Polarity of the kpsE::lacZ mutation suggests an operonic structure for region 1 . KpsE is homologous to putative polysaccharide-translocation components previously identified in Haemophilus influenzae type b and Neisseria meningitidis group B . An open reading frame upstream of kpsE encodes a 35-kDa polypeptide with homology to GutQ, a putative ATP-binding protein of unknown function encoded by gutQ of the glucitol utilization operon . Whether expression of the gutQ homolog as the potential first gene of region 1 is required for polysialic acid synthesis or localization is presently unknown.

Mol Immunol, 1993 Dec, 30(17), 1601 - 16
Molecular characterization of human antibodies to bacterial antigens: utilization of the less frequently expressed VH2 and VH6 heavy chain variable region gene families; Andris JS et al.; Structural analysis of the human immunoglobulin repertoire holds promise for determining the basis of variable region gene usage in response to a variety of auto and exogenous antigens . Here we report the nucleotide sequences of the heavy and light chain variable regions expressed by three human monoclonal antibodies specific for two clinically relevant bacterial pathogens, Bordetella pertussis and Haemophilus influenzae type b . The cell lines were derived by in vitro stimulation of lymphocytes from spleen or tonsillar tissue, respectively, and bind to different antigens from the two organisms . The single B . pertussis antibody is of the IgM lambda isotype and utilizes the single VH6 gene segment in combination with a V lambda 2 gene and demonstrates limited somatic mutation, yet is highly indicative of an antigen-driven immune response . One H . influenzae antibody is of the IgG2 lambda isotype and expresses a VH3 gene segment with a V lambda 1 gene, while the second cell line produces an IgG3 lambda antibody expressing a combination of VH2/V lambda 3 . Both molecules show evidence of somatic mutation . The D gene segments of the heavy chains vary in length and display limited sequence homology with known germline D segments . As demonstrated previously, JH4 predominates (two JH4 and one JH3) and all three utilize the J lambda 3 gene segment . In addition, we have isolated and sequenced a number of germline VH2 gene segments in an attempt to better understand the nature of the VH2 germline repertoire . In addition to contributing to the understanding of the human antibody repertoire, such clinically relevant molecules may prove to be a source of passive immunotherapy for those at risk to developing disease.

Pediatrics, 1993 Dec, 92(6), 827 - 32
Safety and immunogenicity of a combined diphtheria, tetanus, pertussis and Haemophilus influenzae type b vaccine in young infants; Paradiso PR et al.; OBJECTIVE . To study the safety and immunogenicity of a combined diphtheria-tetanus-pertussis (DTP)-Haemophilus influenzae type b (HbOC) vaccine (TETRAMUNE) in infants as young as 2 months of age as compared to separate administration of DTP and HbOC . METHODS . Two-month-old infants were randomized to receive three doses 2 months apart of either DTP-HbOC as a single 0.5-mL injection or to receive 0.5 mL of DTP and HbOC concurrently in separate legs . Local and systemic adverse reactions were monitored within 72 hours of each immunization, and immunogenicity of each of the four vaccine components was measured . RESULTS . The incidence of both local and systemic adverse events following the tetravalent vaccine was similar to the incidence following separate vaccine administration . After three doses of vaccine, the response to each of the vaccine components was higher in the combined vaccine when compared to separate administration . In the case of the Haemophilus influenzae type b component, this enhancement was also seen after two doses . The response to the combined vaccine was consistent among the three lots tested as was the enhancement over separate administration . CONCLUSIONS . The DTP-HbOC vaccine was safe and immunogenic in young infants and was generally more immunogenic than separate vaccination with DTP and HbOC . The use of such a combined vaccine reduces the number of injections given to young infants by half and is an important step toward improving vaccine delivery.

Infect Immun, 1993 Dec, 61(12), 5345 - 50
Comparison of naturally acquired and vaccine-induced antibodies to Haemophilus influenzae type b capsular polysaccharide; Jelonek MT et al.; The objective of this study was to assess qualitative differences in the types of Haemophilus influenzae type B (Hib) capsular polysaccharide (polyribosylribitol phosphate {PRP}) antibodies induced in children 15 to 27 months of age by (i) natural exposure, (ii) PRP vaccine, and by (iii) PRP-diphtheria toxoid conjugate vaccine, (iv) PRP-group B Neisseria meningitidis outer membrane vesicle conjugate vaccine, and (v) Haemophilus type B oligosaccharide conjugate vaccine (HbOC) . The highest levels of total Hib-PRP antibody measured by radioimmunoassay and immunoglobulin G (IgG) measured by enzyme-linked immunosorbent assay were seen after HbOC immunization . IgG1 Hib-PRP antibodies predominated in all groups, and there were no differences between the groups in the proportion of IgG and IgA Hib-PRP antibodies . However, the proportions of IgM differed significantly by group . The highest proportions of IgM occurred in naturally acquired antibody and after PRP vaccine, and the lowest proportion occurred after HbOC vaccine . IgG light-chain V kappa type alpha PRP antibody was present in all groups, and the level correlated with the total IgG Hib-PRP antibody level . Therefore, HbOC induced the highest concentrations of V kappa II type alpha PRP antibody, and the naturally acquired antibody group had the lowest levels . IgG light-chain V kappa III antibody levels were also highest in the HbOC group, but there was no correlation between V kappa III antibody levels and total amount of IgG Hib-PRP antibody . These data demonstrate qualitative differences in the antibody repertoires induced by natural exposure, the Hib-PRP vaccine, and each of the different Hib conjugate vaccines . We doubt that there are major differences in the protection afforded by these different antibody repertoires, because these differences do not appear to correlate with differences in protective efficacy in older children.

J Chemother, 1993 Dec, 5(6), 435 - 43
In vitro brodimoprim activity on bacterial strains; Benoit-Lemercier C et al.; The antibacterial activity of brodimoprim (BDP) was compared to that of trimethoprim (TMP) and to 4 other antibiotics (3 beta-lactams and one macrolide) . The 237 tested strains were selected predominantly among bacteria isolated from respiratory tract infections: 133 Gram-negative bacilli and 98 Gram-positive cocci . The study included: determination of minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) of all antibiotics of the study for all isolates; kinetics of bactericidal activities for selected susceptible strains; correlation between MICs and inhibition zones (standard agar diffusion technique) of BDP (regression line) . The results of the study showed: {1} no significant difference between in vitro activities of BDP and TMP against all tested strains; {2} low MICs of both drugs for Haemophilus influenzae, Legionella pneumophila, Staphylococcus aureus (methi-S and methi-R), Streptococcus pneumoniae (peni-S), streptococci and enterococci; {3} kinetics of bactericidal activities indicating 4 log decrease of inoculum size with BDP for Staph . aureus, S . pneumoniae, H . influenzae, within 7 hours; {4} correlation was established between inhibition zones and MICs of BDP, with a coefficient of correlation r = 0.88 for 182 strains . In conclusion, BDP exhibited in vitro antibacterial and bactericidal activities at least equal to that of reference drugs against most respiratory pathogens; BDP was superior to comparators against methi-R staphylococci and enterococci.

Minerva Chir, 1993 Dec, 48(23-24), 1379 - 85
{Endoscopic monitoring in lung transplantation . Transplantation Group of the Maggiore Policlinico Hospital of Milan}; Zannini P et al.; During the period March 1991-June 1992 5 single lung transplantations were successfully performed at the Ospedale Maggiore Policlinico in Milan . All patients underwent regular fibrobronchoscopies within the context of a complex follow-up programme in order to monitor the resolution of the bronchial anastomosis and identify the onset of intercurrent lung infections and rejections using bronchioalveolar lavage (BAL) and transbronchial biopsies (TBB) . Forty-four fibrobronchoscopies were performed of which 24 for anastomotic follow-up, BAL and TBB, and 20 for the simple monitoring of the anastomosis . Fibrobronchoscopies confirmed the optimal resolution of bronchial anastomosis in 4 patients, whereas one patient showed a granulomatous anastomotic reaction which was successfully treated using local steroid injections . Although recovery was normal in one patient, kinking appeared in the bronchus of the receiving lung which was successfully treated by the insertion of Gianturco prosthesis . BAL enabled the identification of 2 CMV infections, one Pseudomonas aeruginosa, one Haemophilus influenzae and one Pneumocystis carinii infection . TBB allowed 3 cases of CMW lung infection and 7 episodes of rejection to be diagnosed . The authors' personal experience confirms the decisive role played by bronchoscopy in the follow-up of lung transplant patients . This procedure allowed bronchial anastomosis to be closely monitored and was of vital importance in the diagnosis of lung infections and rejection.

Behring Inst Mitt, 1993 Dec, (93), 148 - 64
Interaction of the capsular polysaccharide of Haemophilus influenzae type B with C1q; Bunse R et al.; The Gram-negative pleomorphic bacterium Haemophilus influenza type b (Hib) is the most common cause of bacterial meningitis in children below the age of 2 . Virtually all infants between 3 and 18 month of age lack anticapsular antibodies . This is typical for the response to a T-cell-independent antigen . 3-5% of this group harbour Hib in the nasopharynx, but the incidence of disease is 1000-fold less . This implicates other factors in host susceptibility in addition to the absence of such antibodies . Under physiological conditions the purified complement subcomponent C1q interacts with polyribosylribitolphosphate (PRP), the capsular polysaccharide of Hib . The complex formation of C1q, the most basic serum protein, with this polyanion was demonstrated by several methods: agarose gel electrophoresis followed by immunoprecipitation in the gel and Coomassie staining; western blot analysis of C1q-PRP complexes; complex formation in electrophoretic separation of PRP; retardation of electrophoretic mobility of PRP was checked by blotting of this polysaccharide . These results were confirmed by time- and dose-dependent alteration of antigenetic properties detected by C1q-Sandwich-ELISA after coincubation with PRP . Preincubation of serum treated Hib with C1q significantly enhanced the O2-metabolism of polymorphonuclear leucocytes in chemiluminescence assay . Infants of the susceptible age group develop antibodies to several Hib outer membrane proteins (OMP) and lipooligosaccharides (LOS) in response to infection . The complement activation by immune complexes might be inhibited by the formation of C1q-PRP complexes . Our results do not support the thesis that C1q can be activated by the interaction with PRP as shown before for other polyanions . Differing C1q to PRP ratios could be a possible explanation for different host susceptibilities.

West Indian Med J, 1993 Dec, 42(4), 161 - 3
Acute purulent pericarditis in children caused by haemophilus influenzae; St John MA et al.; Acute purulent pericarditis caused by Haemophilus influenzae is an unusual condition, especially in childhood . In most cases, respiratory symptoms are the presenting features, and children aged less than 4 years are most often affected . A high index of suspicion and aggressive microbiological and cardiological evaluation are often warranted to make an early diagnosis . We herein report two cases of pericarditis caused by H . influenzae in children aged less than two years . Pericardiocentesis was performed in each case . Early recognition, rapid diagnosis and aggressive medical and surgical therapy are paramount in the successful treatment of this condition.

Oral Microbiol Immunol, 1993 Dec, 8(6), 383 - 5
Electron microscopy of phages in serotypes of Actinobacillus actinomycetemcomitans; Olsen I et al.; Actinobacillus actinomycetemcomitans, Actinobacillus ureae, Haemophilus aphrophilus, Haemophilus paraphrophilus, Haemophilus influenzae, Haemophilus parainfluenzae, Pasteurella haemolytica and Pasteurella multocida strains were examined by transmission electron microscopy for the presence of bacteriophages . Phages were detected in serotype a (SUNY 75) and e (UOH 1705) and in the fresh clinical isolates UOH Q1243 and UOH Q1247 of A . actinomycetemcomitans . Phages were not found in serotype b, c and d strains of A . actinomycetemcomitans, in the fresh clinical isolate UOH Q1244 of this species or in old strains (including reference strains) of related species from the Actinobacillus-Haemophilus-Pasteurella group.

J Antimicrob Chemother, 1993 Dec, 32(6), 853 - 9
The pharmacokinetics, tissue penetration and in-vitro activity of loracarbef, a beta-lactam antibiotic of the carbacephem class; Lees AS et al.; The pharmacokinetics of loracarbef in plasma and a mild inflammatory exudate were studied in human volunteers . After a single oral dose of 400 mg, a mean maximum drug concentration (Cmax) of 17.8 mg/L was achieved in the plasma at 1.2 h (mean Tmax) . The mean plasma elimination half-life (T1/2) was 1.3 h . In the inflammatory exudate the mean Cmax was 8.9 mg/L at a mean Tmax of 2.0 h and with a mean T1/2 of 1.7 h . The mean penetration into the inflammatory exudate was 90.1% . The in-vitro activity of loracarbef was determined against Haemophilus influenzae and Moraxella catarrhalis (MIC90s of 4 mg/L and 1 mg/L respectively, regardless of beta-lactamase production), as well as Streptococcus pneumoniae (MIC90 of 2 mg/L) . Loracarbef was also active against Escherichia coli, Proteus mirabilis and Klebsiella pneumoniae (MIC90s of < or = 2 mg/L) . The in-vitro activity and pharmacokinetics of loracarbef suggest that it would be efficative therapy for patients with community-acquired respiratory and urinary tract infections caused by the most frequently-encountered bacterial pathogens.

Enferm Infecc Microbiol Clin, 1993 Dec, 11(10), 552 - 4
{Multiple antibiotic resistance in Haemophilus influenzae related to serogroup B}; Campos J et al.; AIM: To study the association between multiply antibiotic resistance in Haemophilus influenzae and H . influenzae type B, and to describe levels and patterns of antibiotic resistance . METHODS: Statistical analysis and susceptibility of 231 H . influenzae strains (52 type B and 179 non-typable ) isolated consecutively from pediatric patients . RESULTS: Resistance levels for type B and non-typable strains were: Ampicillin, 55.3% vs 28.8%; Chloramphenicol, 44.7% vs 9.2%; Ampicillin plus chloramphenicol, 40.4% vs 7.6%; cotrimoxazole, 89.3% vs 67.4%; resistance to six or more antibiotics, 36.0% vs 3.8% . CONCLUSION: Multiply antibiotic resistance in H . influenzae is strongly associated with type B strains, with age of 4 or younger, and with isolation from CSF or blood . Resistance is sustained over long periods of time.

Bioessays, 1993 Dec, 15(12), 799 - 805
The secretion pathway of IgA protease-type proteins in gram-negative bacteria; Klauser T et al.; The pathogenic, Gram-negative bacteria, Neisseria gonorrhoeae, Neisseria meningitidis and Haemophilus influenzae, secrete immunoglobulin A1 proteases into their extracellular surroundings . An extraordinary feature in the secretory pathway of these putative virulence factors is a self-directed outer membrane transport step allowing the proteins to be secreted autonomously, even from foreign Gram-negative host cells like Escherichia coli . Here we summarize recent achievements in the understanding of IgA protease outer membrane translocation.

J Epidemiol Community Health, 1993 Dec, 47(6), 485 - 90
Cost benefit analysis of Haemophilus influenzae type b vaccination programme in Israel; Ginsberg GM et al.; STUDY OBJECTIVE--The recent availability of Haemophilus influenzae type b (HIB) conjugate vaccines prompted an examination of the costs and benefits of four and three dose HIB prevention programmes targeting all newborns in Israel . MEASUREMENTS AND MAIN RESULTS--A four dose programme would reduce the number of childhood (aged 0-13) HIB cases from 184.2 to 31.3 per year, yielding a benefit ($1.03 million) to cost ($3.55 million) ratio of just 0.29/l for health services only, based on a vaccine price of $7.74 per dose . When benefits resulting from a reduction in mild handicaps and severe neurological sequelae are included, the benefit ($4.48 million) to cost ratio rises to 1.26/l and it reaches 1.45/l when the $0.66 million indirect benefits of reduced work absences and mortality are also included . Break even vaccine costs are $2.24 when health service benefits only are considered and $11.21 when all the benefits are included . CONCLUSION--In the absence of other projects with higher benefit to cost ratios, Israel should start to provide a nationwide HIB vaccination programme since the monetary benefits to society of such a programme will exceed the costs to society . A barrier to implementation may occur, however, because the costs of the programme exceed the benefits to the health services alone.

Pediatr Infect Dis J, 1993 Dec, 12(12), 981 - 5
Safety of combined oligosaccharide conjugate Haemophilus influenzae type b (HbOC) and whole cell diphtheria-tetanus toxoids-pertussis vaccine in infancy . The Kaiser Permanente Pediatric Vaccine Study Group; Black SB et al.; The safety of the combined oligosaccharide conjugate Haemophilus influenzae (Hib) type b (HbOC) and whole cell diphtheria-tetanus toxoids-pertussis (DTP) vaccine (Tetramune, HbOC-DTP; Lederle) in infancy was evaluated in 6644 recipients of this vaccine and compared with 3914 recipients of separate injections of whole cell DTP and HbOC vaccines when given as a three dose regimen to infants at 2, 4 and 6 months of age in each group . Of the total number of infants in the study, a subset of 1435 were enrolled into the study and then randomly assigned to receive either the Hib-DPT combined vaccine or the separate components . This subset was used to assess local and systemic side effects which were evaluated utilizing telephone interviews 48 to 72 hours after vaccine . The remaining children in the study population were enrolled in a nonrandomized manner . For these children parents were offered the experimental Hib-DPT vaccine and refusers were given HbOC and DTP . Both of these groups of children as well as the randomized subset described above were used to assess rates of episodes of hospitalization, emergency room utilization and sudden infant death syndrome in HbOC-DTP recipients and children who received HbOC and DTP separately . Immunogenicity was evaluated in 123 children by collection of a single serum sample 30 days after the third dose of HbOC-DTP . The observed immunogenicity was comparable to that observed in other recent studies for HbOC and DTP component antigens . The profile of local and systemic side effects observed was virtually identical to that observed after DTP plus HbOC given separately.(ABSTRACT TRUNCATED AT 250 WORDS)

Jpn J Antibiot, 1993 Dec, 46(12), 1122 - 44
{Basic and clinical studies on S-1108 in pediatric field}; Motohiro T et al.; S-1108 is a new oral esterified cephem antibiotic . Its active form, S-1006, has a broad antimicrobial spectrum against both Gram-positive and Gram-negative bacteria . Furthermore, S-1006 is extremely stable against beta-lactamases with some exceptions . In the present study, we conducted laboratory and clinical evaluations of S-1108 granules in pediatrics . The obtained results are summarized as follows . 1 . A drug sensitivity test revealed that MIC80 of the drug against 456 clinical isolates of Staphylococcus aureus that had been kept in our laboratory was 6.25 micrograms/ml, similar to those of cefaclor (CCL) and methicillin (DMPPC) . The most frequent MIC was 1.56 micrograms/ml against 20 strains of S . aureus isolated from patients who received this drug, and this value was similar to those for CCL, amoxicillin (AMPC) and DMPPC . As regards to Streptococcus pyogenes, MIC of S-1006 was < or = 0.025 microgram/ml against 449 clinical isolates in our culture collection and 7 strains obtained from patients who received this drug, and these MICs are similar to those of cefteram (CFTM) . MICs of S-1006 against 5 strains of Streptococcus pneumoniae obtained from patients who received this drug were < or = 0.025 microgram/ml, 0.10 microgram/ml or 0.39 microgram/ml which are similar to those of CFTM . MICs of S-1006 against 4 strains of Haemophilus influenzae obtained from patients who received this drug were 0.05 or 0.10 microgram/ml which are similar to those of CFTM . 2 . When S-1108 granule preparation was administered to 1 patient at 4.0 mg/kg, the peak plasma concentration of S-1006 was 1.25 microgram/ml . S-1108 granule preparation was also administered to 2 patients at 6.0 mg/kg, and the peak plasma concentrations were 2.43 micrograms/ml and 2.23 micrograms/ml . Plasma half-lives were 1.11 hours after 4.0 mg/kg and 1.28 hours in both patients given 6.0 micrograms/ml . AUCs were 4.06, 8.37 and 7.73 micrograms.hr/ml, respectively . A dose-response relationship was observed between the two doses . 3 . Urinary concentration was the highest during the 4-6-hour period for a patient given 4.0 mg/kg, and during the 0-2-hour or 4-6-hour period for 2 patients given 6.0 mg/kg . The peak concentrations were 258.0, 602.0 and 500.0 micrograms/ml, respectively, and urinary recovery rates during the 0-8-hour period were 38.9, 38.3 and 23.1%, respectively . 4 . Clinical effects were excellent or good in 88 of 93 patients, showing a very high efficacy rate of 94.6%.(ABSTRACT TRUNCATED AT 400 WORDS)

Jpn J Antibiot, 1993 Dec, 46(12), 1102 - 6
{Clinical study of S-1108 fine granule in the pediatric field}; Ishikawa J et al.; S-1108 in a fine granular form was administered in 14 children and its safety and efficacy in bacterial infections were evaluated . Among them, 2 cases of cystitis and 1 case of pneumonia were considered unevaluable for the efficacy . The results obtained are summarized as follows . 1 . The overall clinical efficacy rate was 81.8% in the eleven evaluable cases treated with S-1108 fine granules including 5 cases of pharyngitis, 2 cases each of tonsillitis, pertussis and cystitis . 2 . Bacteriological efficacy of 100% was achieved against pathogens identified in 5 children including 1 case each of Staphylococcus aureus, Streptococcus pyogenes and Haemophilus influenzae and 2 cases of Escherichia coli . 3 . The only abnormal laboratory test results observed were eosinophilia and leukocytopenia in one case each . Diarrhea was recorded in 1 case . Judging from the above results, it appears that S-1108 in the fine granular form is an effective, useful and safe antibiotic of first choice for the treatment of infections in the pediatric field.

Jpn J Antibiot, 1993 Dec, 46(12), 1096 - 101
{Clinical experience with S-1108 on bacterial infection in the pediatric field}; Takeda E et al.; The effects of S-1108, an orally active cephem antibiotic newly synthesized by Shionogi Res . Lab., on pediatric bacterial infections was studied . S-1108 was administered orally at a daily dose between 9.3 and 12.4 mg/kg in three divided doses (after each meal) for 5 to 11 days to patients with pharyngitis (2), tonsillitis (1), bronchitis (3), pneumonia (1), lymphadenitis (1), enteritis (1) and cystitis (1) . The clinical efficacy rate was 100% with excellent responses in 3, good in 6 and undetermined in 1 . Bacteriological effects observed indicated that one strain each of Streptococcus pneumoniae, Streptococcus pyogenes, Klebsiella pneumoniae and two strains of Haemophilus influenzae were eradicated by the treatment . No clinical side effects and laboratory test abnormalities were observed at all in this study . These results suggested that S-1108 would be a useful antibiotic for the treatment of bacterial infections in the pediatric field.

Arch Fr Pediatr, 1993 Dec, 50(10), 863 - 6
{Immunogenicity and tolerability of Haemophilus b-tetanus protein conjugate (PRP-T) in children with sickle cell anemia}; de Montalembert M et al.; BACKGROUND . Infants and young children with sickle cell anemia are at increased risk of infection with Haemophilus influenzae type b . This report describes the immunogenicity and safety of Haemophilus b conjugate vaccine in such children . POPULATION AND METHODS . One hundred and eleven children aged 6 months-11 years (mean: 3.7 years) were studied . They belonged to a cohort of over 600 children in the Paris area that have sickle cell anemia . After parental consent, they were given one injection (intramuscularly or subcutaneously) of Haemophilus influenzae type b-tetanus toxoid conjugate vaccine (0.5 ml) . Any adverse reactions during the following 3 days were noted . Titers of specific antibodies were measured just before injection, one month, and one year later . RESULTS . The vaccine was well tolerated, with only local reactions: erythematous reactions in 5 children and pain in 30 . In the children aged 6 months-3 years, the mean antibody titers increased from 0.09 to 20.6 micrograms/ml, 1 month after the vaccination; in those aged 3-11 years, the mean titer increased from 0.44 to 56.86 micrograms/ml . One year after vaccination, the titers measured in 61 children were over 1 microgram/ml in 92% of children aged 6 months-3 years and in 100% of the older children . CONCLUSION . This type of vaccine is immunogenic and well tolerated . Thus the vaccination schedule recommended for children with sickle cell anemia aged over 6 months is the same as that for normal children.

Semin Respir Infect, 1993 Dec, 8(4), 243 - 53
Pro: antibiotics for chronic bronchitis with exacerbations; Isada CM; Over the years, there has emerged a considerable body of evidence supporting the importance of antimicrobial therapy in exacerbations of chronic bronchitis . The following lines of evidence suggest that most acute exacerbations are caused by bacterial infection: (1) the individual with chronic bronchitis is susceptible to bacterial infection as a consequence of local damage from prolonged cigarette smoking; (2) subtle defects in the local immune system can be shown, including impaired particle transport, defective immunoglobulin A production, chronic mucous impaction, and defective neutrophil phagocytosis; (3) acute bronchitic exacerbations are associated with a proliferation of pathogenic bacteria in the lower respiratory tract, based on quantitative culture data obtained by bronchoscopy with a protected specimen brush; (4) viral respiratory infections, which were once linked to over 50% of purulent exacerbations, probably account for only a minority of bronchitic exacerbations; (5) some "culture negative" exacerbations may be caused by bacteria susceptible to antibiotics such as Mycoplasma pneumoniae or Chlamydia pneumoniae . There are also secondary effects of bacteria that are potentially amenable to antibiotic therapy . Bacteria that colonize the respiratory tract of chronic bronchitics cause direct damage to the respiratory epithelium . Lipooligosaccharide, a major component of the outer membrane of Haemophilus influenzae, is an endotoxin-like mediator of respiratory cell damage . The host inflammatory response to bacterial proliferation is ineffective and may be potentially harmful; the enzyme neutrophil elastase is released by the host during phagocytosis of bacteria and may lead to progressive airway damage . In addition, bacterial superinfections may complicate viral exacerbations of chronic bronchitis . Clinical trials examining the efficacy of antibiotic therapy in mild to moderate exacerbations of chronic bronchitis have yielded conflicting results, caused in part to fundamental differences in study design . The major double-blinded and placebo-controlled studies suggest a trend in favor of antimicrobial therapy, although the effect is modest . For the individual patient, the risks of antimicrobial therapy are small compared with the potential benefits of returning to work earlier and avoiding the rare case of respiratory decompensation.

Infect Immun, 1993 Dec, 61(12), 5157 - 63
Outer membrane protein binding sites of complement component 3 during opsonization of Haemophilus influenzae; Hetherington SV et al.; Complement component 3 (C3) binding to Haemophilus influenzae type b (Hib) is an important step in host defense against invasive disease, but the details of this process remain poorly understood . We have shown that the P1 and P2 outer membrane proteins (OMPs) serve as binding sites for C3 on serum-opsonized Hib . Whole-cell lysates of opsonized Hib were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the resolved proteins were transferred to nitrocellulose . Immunoblot analysis with monoclonal antibodies (MAbs) to the 49-kDa P1 and 39-kDa P2 OMPs demonstrated high-molecular-weight bands that were not present when the bacteria were opsonized with heat-inactivated or methylamine-treated serum . Immunoblot analysis with MAbs to the 98- or 16-kDa (P6) OMPs did not reveal additional bands . An unencapsulated Hib mutant still lacked C3 bound to the 98-kDa or P6 OMP, indicating that the absence of C3 binding to these proteins was not the result of epitope masking by the capsule . Studies with MAbs to C3 fragments confirmed that the anti-P1- and anti-P2-reactive bands were C3 fragments bound to these OMPs . The molecular weights of proteins reactive to anti-OMP and anti-C3 antibodies indicated that multiple C3 fragments may be bound to P1 or that C3 may be bound to P2 multimers . Finally, the presence of other anti-C3-reactive proteins indicated that several other proteins serve as C3 targets during the opsonization of Hib.

Oral Microbiol Immunol, 1993 Dec, 8(6), 327 - 36
Recent approaches to the chemotaxonomy of the Actinobacillus-Haemophilus-Pasteurella group (family Pasteurellaceae); Olsen I; Many members of the Actinobacillus-Haemophilus-Pasteurella group (family Pasteurellaceae) have been misclassified . This article reviews the chemotaxonomic characters that recently have been provided to improve the taxonomy of Pasteurellaceae . These include fatty acids of whole cells, of lipopolysaccharides and of single colonies, together with sugar contents of whole cells, of whole defatted cells, of lipopolysaccharides and of single colonies . This article also reviews taxonomy aided by distribution of proteins in whole cells and outer membranes, distribution of enzymes in outer membrane vesicles and in whole cells, bacteriolysis induced by ethylenediaminetetraacetic acid and hen eggwhite lysozyme and the distribution of respiratory quinones . Furthermore, an overview of characters obtained through studies on genetic transformation, restriction enzyme analysis, restriction fragment length polymorphism, DNA-DNA hybridization, DNA-rRNA hybridization, and 16S rRNA sequencing is given.

Infect Immun, 1993 Nov, 61(11), 4682 - 8
Three contiguous lipoprotein genes in Pasteurella haemolytica A1 which are homologous to a lipoprotein gene in Haemophilus influenzae type b; Cooney BJ et al.; An Escherichia coli clone carrying the recombinant plasmid pPH24 has been found to express highly immunoreactive antigens of Pasteurella haemolytica A1 . Two or three antigens of approximately 30 kDa were located to both the inner and outer membranes of the E . coli clone and in P . haemolytica A1 . From the insert DNA of 8.2 kbp on pPH24, a fragment of 4.6 kbp was found to code for these antigens . Nucleotide sequence analysis of the 4.6-kbp DNA identified three genes (designated plpA, -B, and -C) arranged in tandem which code for three proteins, Plp1, -2, and -3, with predicted molecular masses of 30.1, 30.3, and 29.0 kDa, respectively . Comparison of the nucleic acid sequence of plpA, -B, and -C with GenBank sequences showed extensive homology with a Haemophilus influenzae 28-kDa lipoprotein gene . {14C}palmitate labelling coupled with glybomycin inhibition experiments showed that Plp1, -2, and -3 are also lipoproteins . In addition, plpA, -B, and -C were found to be present only in A biotypes of P . haemolytica by Southern blot analysis . Since Plp1, -2, and -3 were found to be antigenic components in a culture supernatant vaccine, they could be candidates for further investigation as vaccine components.

Infect Immun, 1993 Nov, 61(11), 4575 - 81
Antigenic variation of immunoglobulin A1 proteases among sequential isolates of Haemophilus influenzae from healthy children and patients with chronic obstructive pulmonary disease; Lomholt H et al.; Considerable antigenic heterogeneity has been identified among Haemophilus influenzae immunoglobulin A1 (IgA1) proteases, and this study increases the number of antigenic types to more than 30 . To address the role played in vivo by this polymorphism, sequential H . influenzae isolates from three healthy children and three patients with chronic obstructive pulmonary disease (COPD) were examined . Healthy children showed a frequent clonal exchange, with each replacing clone expressing an antigenic type of IgA1 protease not previously encountered . In contrast, COPD patients were colonized by a single clone for a significantly longer period . In one COPD clone, a change occurred in IgA1 protease cleavage specificity and antigenic properties . In conclusion, frequent exchange of clones expressing antigenically different IgA1 proteases seems to be the principal mechanism by which H . influenzae evades the immune response of healthy children against IgA1 protease . The results support the view that IgA1 protease activity is important for successful colonization of H . influenzae on mucosal membranes.

Jpn J Antibiot, 1993 Nov, 46(11), 991 - 1002
{Pharmacokinetic and clinical studies of S-1108 in the pediatric field}; Toyonaga Y et al.; Pharmacokinetic and clinical studies on S-1108, a new oral cephem antibiotic, were performed in the field pediatrics . The following results were obtained . 1) Antibacterial activities Antibacterial activities of S-1006, the active form of S-1108, were studied against clinically isolated strains of (Staphylococcus aureus (n = 5), Streptococcus pneumoniae (n = 6), Streptococcus pyogenes (n = 3), Haemophilus influenzae (n = 8), Branhamella catarrhalis (n = 5) and Haemophilus parainfluenzae (n = 2) . MIC values ranged < or = 0.025-1.56 for GPC and < or = 0.025-0.78 microgram/ml for GNR . 2) Absorption and excretion Blood concentrations and urinary excretion rates of S-1108 were measured upon administration of S-1108 after meal at dose of 3 mg/kg (n = 4), 4 mg/kg (n = 1) and 6 mg/kg (n = 1) . The peak blood concentrations of S-1006 at a dose of 3 mg/kg (n = 4), ranged from 0.57 to 1.82 micrograms/ml at 1, 2 and 4 hours after dosing . Mean pharmacokinetic parameters T1/2 and AUC were 1.29 +/- 0.69 hours and 4.47 +/- 2.25 micrograms.hr/ml, respectively . At a dose of 4 mg/kg and 6 mg/kg, peak concentrations were 1.79 and 1.27 micrograms/ml at 2 and 3 hours after treatment . T1/2 and AUC were 1.34 and 1.11 hours, and 8.19 and 5.65 micrograms.hr/ml, respectively . Urinary recovery rates ranged from 13.0 to 37.2% for the first 8 hours after administration . 3) Clinical studies Clinical efficacies were examined in 32 cases of various pediatric infections including 5 cases of acute pneumonia, 11 cases of bronchitis, 2 cases of scarlet fever, 8 cases of tonsillitis, 1 case of pharyngitis, 2 cases of otitis media and 3 cases of UTI . Clinical efficacy rate was 96.9% (31/32) and bacteriological eradication rate was 87.1% (27/31) . There were no side effects and abnormal laboratory test values except 1 case (Eosino . 2-->10%) in the 32 cases.

Jpn J Antibiot, 1993 Nov, 46(11), 967 - 77
{Laboratory and clinical studies on S-1108 in the pediatric field}; Akita H et al.; Laboratory and Clinical Studies on S-1108, a new oral cephem antibiotic, were carried out to evaluate its usefulness at a dose between 2 and 4 mg/kg a day for 7 to 14 days in the pediatric field . 1) Pharmacokinetic studies S-1108 at a dose of 2 mg/kg was administered to evaluate the pharmacokinetic parameters in 1 subject . Cmax, T1/2 and AUC were 0.69 hour, 1.42 hours and 2.15 micrograms.hr/ml, respectively . 2) Antimicrobial activities MICs against various clinically isolated organisms (Staphylococcus aureus, Streptococcus pyogenes, Streptococcus pneumoniae, Branhamella catarrhalis, Escherichia coli and Haemophilus influenzae) were determined . The MIC values of S-1006 were similar to those of cefteram, the MICs against S . pyogenes, and H . influenzae were < or = 0.025 and 0.10 microgram/ml, respectively . 3) Clinical studies S-1108 was administered to patients with various pediatrics infections in 34 cases (upper respiratory tract infections: 12 cases, lower respiratory tract infections: 5 cases, urinary tract infections: 9 cases, skin and soft tissue infection: 6 cases, otitis media: 2 cases) . Clinical efficacy rate was evaluated according to "Standard of clinical evaluation in pediatrics field" . The responses were all good or excellent . 4) Side reactions There were no serious adverse reactions in any cases . The above results suggest that S-1108 is potent effective and safe agent in the pediatric field at a dose between 2-4 mg/kg (t.i.d.) a day.

Jpn J Antibiot, 1993 Nov, 46(11), 959 - 66
{Clinical evaluation of S-1108 in children}; Meguro H et al.; A new oral cephem antibiotic, S-1108, was evaluated for its clinical efficacy and safety in children . S-1108 was effective in 95% of the 59 examined cases of respiratory, middle ear, skin and urinary tract infections . S-1108 was highly effective in infections of Streptococcus pyogenes, Haemophilus influenzae and Escherichia coli, but was less effective in penicillin-resistant Streptococcus pneumoniae and Staphylococcus aureus infections . The serum half-life was 1.26 +/- 0.36 hours upon after meal administration of 4 mg/kg . No severe adverse reaction was encountered . From these data, S-1108 appears to be safe and effective in children with susceptible bacterial infections.

Jpn J Antibiot, 1993 Nov, 46(11), 1035 - 9
{Clinical evaluation of S-1108 in pediatric field}; Nishimura T et al.; Nine pediatric patients with bacterial infections (5 cases of tonsillitis, 3 cases of impetigo and 1 case of UTI) were treated with S-1108, and the efficacy and the safety were evaluated . The clinical responses to S-1108 treatment were excellent in 7 cases and good in 2 . The efficacy rate was 100% . Bacteriologically, the causative organisms (Streptococcus pyogenes, Staphylococcus aureus, Haemophilus parainfluenzae and Escherichia coli) were eradicated . No clinical side effects were observed . Elevation of CK in 2 cases and eosinophilia in 1 case were noted.

Jpn J Antibiot, 1993 Nov, 46(11), 1003 - 16
{Laboratory and clinical evaluation of S-1108 in pediatric field}; Nakamura H et al.; We performed laboratory and clinical evaluation of S-1108 granules, a new oral cephalosporin antibiotic, in the pediatric field . 1 . Pharmacokinetics of S-1108 was examined with 6 patients, at a dose of 4 mg/kg that was orally ingested 30 minutes after meal . Mean plasma concentrations at 30 minutes, 1, 2, 4, 6 and 8 hours after dose were 0.35, 0.63, 0.86, 0.75, 0.37 and 0.09 microgram/ml, respectively, with a half life of 1.14 hours . The urinary recovery rate in the first 8 hours was 25.5% . 2 . The clinical efficacy of S-1108 was evaluated in 31 patients with various infectious diseases . S-1108 was administered at doses ranging 2 to 4.2 mg/kg/dosage, 3 times a day for 1/3 to 10 days . Clinical effects were excellent in 19, good in 12, with an efficacy rate of 100% . Bacteriologically, all causative organisms except two of Staphylococcus aureus and Haemophilus influenzae were eradicated, with an eradication rate of 80% . As an adverse reaction, mild diarrhea was noted in 2 patients . Slight elevations of GOT and/or GPT were noted in 2 patients . Only 1 child had difficulty ingesting the antibiotic preparation . From the above results, we have concluded that S-1108 is a highly effective and safe for patients with various infectious diseases in the pediatric fields.

Health Bull (Edinb), 1993 Nov, 51(6), 385 - 93
The epidemiology of Haemophilus influenzae invasive disease in Scotland prior to immunisation; Brewster D; Immunisation against Haemophilus influenzae b (Hib) was added to the UK childhood vaccination schedule on 1 October 1992 . Based on reports of laboratory isolations from blood and/or CSF, the epidemiology of Haemophilus influenzae invasive disease in Scotland during the last full year before immunisation (1991) is reviewed . In children aged under five years the estimated incidence of infection (25.5 per 100,000) is higher than that previously reported from Scotland, but lower than estimates from Glasgow and other UK studies . However, the age-sex and seasonal distribution is consistent with previous surveys . As in England and Wales, there appears to be regional variation in incidence within Scotland, although this may simply reflect differences in the completeness of laboratory reporting . In addition to 113 laboratory reports of H . influenzae invasive infection, a retrospective search of hospital discharge data and death registrations identified a further 51 and two cases respectively, some of whom may be genuine . In spite of reservations about hospital discharge data, this raises the possibility that there may be an element of under-reporting by laboratories . With the advent of record linkage of hospital discharge data, it would be prudent to monitor the impact of the Hib vaccine programme using this data source in addition to laboratory reports and death registrations.

Int J STD AIDS, 1993 Nov-Dec, 4(6), 317 - 21
Haemophilus ducreyi; Jonasson JA; Genital ulcer disease as a risk factor for HIV transmission has become apparent in the fight against AIDS . In poor communities in developing countries with people living under low hygienic conditions chancroid is often reported to be the most common form of genital ulcer . It is caused by Haemophilus ducreyi; a fastidious bacterium, notoriously difficult to grow in the laboratory . Apart from a few small micro-epidemics from time to time the disease, which has interesting immunological aspects, is now rare and almost forgotten in most industrialized countries . This may be part of the reason why there is no simple and inexpensive diagnostic test available yet that would be useful in the low-resource settings where chancroid is prevalent . The present review focuses on the diagnosis and pathogenesis of chancroid.

J Pediatr Surg, 1993 Nov, 28(11), 1441 - 4; discussion 1444-5
Efficacy of passive immunotherapy in experimental postsplenectomy sepsis due to Haemophilus influenzae type B; Camel JE et al.; In an effort to develop a more effective therapy for postsplenectomy sepsis, ceftriaxone and human intravenous immunoglobulin (IVIG), alone and in combination, were evaluated for their efficacy against experimental Haemophilus influenzae type B (Hib) bacteremia in splenectomized and sham-operated infant rats . Five-day-old animals had either a splenectomy or sham operation . At 12 days of age, they were challenged intraperitoneally with Hib . Fifteen hours later blood specimens were obtained for quantitative bacterial cultures, and immediately thereafter therapy was started with ceftriaxone, IVIG, combination of ceftriaxone and IVIG, or albumin (control) . Quantitative blood cultures were repeated 24 and 48 hours after the treatment . Prior to the treatments, splenectomized animals had significantly higher bacterial counts in blood when compared with sham-operated animals (P < .001) . Splenectomized animals receiving IVIG, ceftriaxone, or the combination of IVIG and ceftriaxone had significantly increased bacterial clearance from blood when compared with the controls (P < .01) . In addition, animals treated with ceftriaxone or the combination of IVIG and ceftriaxone had significantly increased bacterial clearance compared with the IVIG alone treatment group (P < .01) . Overall, the mortality was significantly higher in splenectomized animals compared with the sham-operated animals (P < .05) . The control animals had significantly higher mortality compared with the IVIG, ceftriaxone, and combined ceftriaxone and IVIG treatment groups (P < .05) . There were no detrimental effects of combining IVIG and ceftriaxone together.

Clin Infect Dis, 1993 Nov, 17(5), 894 - 6
Epidemiology and etiology of pneumonia in children in Hong Kong; Sung RY et al.; The epidemiologic and etiologic features of cases of pneumonia among 1,740 children admitted to a teaching hospital in Hong Kong over a 3-year period were studied . Of the patients, 23% were < 1 year old and 69% were < 5 years old . The incidence of pneumonia requiring admission to the hospital was 6.4 episodes per 1,000 children per year for those < 5 years of age . The overall case fatality rate was 0.15% among patients who did not have severe underlying disease before contracting pneumonia . A bacterial etiology was confirmed by blood culture for only 2% of patients . However, culture of sputum or nasopharyngeal aspirates yielded predominant or pure growth of one bacterial agent in 17% of cases . Haemophilus influenzae was the bacterial agent most frequently isolated from nasopharyngeal aspirates or sputum, followed by Streptococcus pneumoniae and Staphylococcus aureus . Of the H . influenzae isolates, 38% were resistant to ampicillin . A viral etiology was proven in 9.1% of cases, and evidence of mycoplasmal infection was found in 3.8% of cases . Respiratory syncytial virus was the most frequently identified viral agent, followed by adenovirus and influenza A virus.

Antimicrob Agents Chemother, 1993 Nov, 37(11), 2298 - 306
Double-blind, comparative study of rufloxacin once daily versus amoxicillin three times a day in treatment of outpatients with exacerbations of chronic bronchitis; Klietmann W et al.; In a double-blind, randomized, multicenter study, the efficacy and safety of two dosage schedules of rufloxacin once daily were compared with those of amoxicillin three times a day in the treatment of 192 outpatients with exacerbations of chronic bronchitis . Rufloxacin was given as a single oral dose of 400 mg on day 1 and single daily doses of 200 mg on the subsequent 9 days (n = 64) or as 300 mg on day 1 and then 150 mg daily for 9 days (n = 63); amoxicillin was given as 500 mg orally three times a day for 10 days (n = 65) . Clinical and bacteriological assessments were carried out before treatment, between study days 3 and 5, and at days 1 and 8 after treatment . Pretreatment cultures were positive for 139 patients, the most frequently isolated pathogens being Streptococcus pneumoniae, Moraxella catarrhalis, and Haemophilus influenzae . Clinical success rates were comparable in the three groups (94, 95, and 98%, respectively), as were bacteriological success rates at the end of treatment (93, 95, and 91%, respectively) and at follow-up (88, 95, and 98%, respectively) . The power to detect a significant 15% difference in cure rates was 74.9% . Follow-up bacteriological failures from pneumococcal infection were 18% in both rufloxacin groups combined and 5% in the amoxicillin group . The 200-mg dose regimen achieved average steady-state concentrations in plasma higher than did the 150-mg dose regimen (3.75 versus 2.72 micrograms/ml) . Adverse events occurred in 11 and 13 patients, respectively, on rufloxacin and 8 on amoxicillin . This study shows that rufloxacin once daily ay be a possible option for the treatment of acute exacerbations of chronic bronchitis . The 200-mg daily oral dose preceeded by a loading dose of 400 mg displays a better pharmacokinetic profile than the lower dose.

Pediatr Nurs, 1993 Nov-Dec, 19(6), 600 - 5
Update: new guidelines for the treatment of infants with sickle cell disease . Agency for Health Care Policy and Research; Selekman J; These clinical practice guidelines set forth a comprehensive program for identifying, diagnosing, and treating newborns and infants with sickle cell disease and recommend education and counseling strategies for their parents . Sickle cell disease comprises a group of genetic disorders characterized by the production of hemoglobin S, anemia, and acute and chronic tissue damage secondary to the blockage of blood flow by abnormally shaped red cells . Sickle cell anemia is the most common form of the disease, and it affects approximately 1 in 375 African-American infants . Although in the United States sickle cell disease is most commonly found in persons of African ancestry, it also affects other populations . The panel recommends screening of all newborns for sickle cell disease, since targeting specific groups will miss some infected infants . Samples of dried blood on filter paper or liquid blood samples should be used for hemoglobinopathy screening . Hemoglobin electrophoresis, isoelectric focusing, and high performance liquid chromatography are acceptable, reliable, and accurate testing methods . Infants identified on initial screening must be retested to establish a definitive diagnosis . Affected infants must be given twice-daily oral penicillin beginning at 2 months of age to reduce pneumococcal, conjugated Haemophilus influenzae, and hepatitis B vaccines . Infants with sickle cell disease require the same well-child care as infants without the disease . Education and nondirective genetic counseling should be offered to all parents of infants with sickle cell disease . The guidelines stress the need for a comprehensive and fully integrated approach to reduce morbidity and mortality from sickle cell disease.(ABSTRACT TRUNCATED AT 250 WORDS)

J Clin Microbiol, 1993 Nov, 31(11), 2981 - 7
Polymerase chain reaction-based strain characterization of noncapsulate Haemophilus influenzae; Jordens JZ et al.; A polymerase chain reaction-based typing method for noncapsulate Haemophilus influenzae was developed . Randomly amplified polymorphic DNA fingerprints were generated from boiled supernatants prepared directly from bacterial colonies without the need for DNA extraction . The technique was applied to isolates obtained during putative outbreaks of chest infection and validated by comparison with sodium dodecyl sulfatepolyacrylamide gel electrophoresis analysis of outer membrane protein-enriched preparations and rRNA gene restriction analysis . There was complete concordance between the three techniques . The results show that randomly amplified polymorphic DNA analysis provides a highly discriminatory method of characterizing strains of noncapsulate H . influenzae which is eminently suitable as an epidemiological tool for the rapid investigation of outbreaks of infection.

Scand J Immunol, 1993 Nov, 38(5), 496 - 8
Bacterial lysates and ribosomes as inducers of specific immune responses: a comparative study; Bene MC et al.; A bacterial lysate (OM-85 BV), a preparation of purified bacterial ribosomes (D53) and a placebo were tested for ability to induce the local appearance of specific antibody-containing cells . The three compounds were given orally to 90 children who required tonsillectomy . Surgery was carried out after 1 month of therapy . Frozen-cut sections of each tonsil were tested in indirect immunofluorescence . Cells containing antibodies directed to Streptococcus pneumoniae, Streptococcus pyogenes, Haemophilus influenzae or Klebsiella pneumoniae were enumerated . Lowest values were noted in the placebo group . Slightly higher numbers were observed after treatment with OM-85 BV, but significant increases were noted only for the elevated numbers of specific antibody-containing cells observed after D53 therapy . Bacterial ribosomal preparations thus contribute efficient induction of specific local immune responses in man.

J Pediatr, 1993 Nov, 123(5), 791 - 4
Response to Haemophilus influenzae type b conjugate vaccine in chronically ill premature infants; Washburn LK et al.; Twenty-two premature infants with chronic lung disease (median gestational age 28 weeks) received polyribosylribitol phosphate-outer membrane protein conjugate Haemophilus vaccine at 2 and 4 months of chronologic age . The proportions with antibodies to polyribosylribitol phosphate at levels > 1 microgram/ml after doses 1 and 2 were 27% and 55%; geometric mean titers were 0.43 and 0.73 microgram/ml, significantly lower than values for term infants.

J Bacteriol, 1993 Nov, 175(22), 7269 - 81
Structural organization, nucleotide sequence, and regulation of the Haemophilus influenzae rec-1+ gene; Zulty JJ et al.; The Haemophilus influenzae rec-1+ protein plays a central role in DNA metabolism, participating in general homologous recombination, recombinational (postreplication) DNA repair, and prophage induction . Although many H . influenzae rec-1 mutants have been phenotypically characterized, little is known about the rec-1+ gene at the molecular level . In this study, we present the genetic organization of the rec-1+ locus, the DNA sequence of rec-1+, and studies of the transcriptional regulation of rec-1+ during cellular assault by DNA-damaging agents and during the induction of competence for genetic transformation . Although little is known about promoter structure in H . influenzae, we identified a potential rec-1+ promoter that is identical in 11 of 12 positions to the bacterial sigma 70-dependent promoter consensus sequence . Results from a primer extension analysis revealed that the start site of rec-1+ transcription is centered 6 nucleotides downstream of this promoter . We identified potential DNA binding sites in the rec-1+ gene for LexA, integration host factor, and cyclic AMP receptor protein . We obtained evidence that at least one of the proposed cyclic AMP receptor protein binding sites is active in modulating rec-1+ transcription . This finding makes rec-1+ control circuitry novel among recA+ homologs . Two H . influenzae DNA uptake sequences that may function as a transcription termination signal were identified in inverted orientations at the end of the rec-1+ coding sequence . In addition, we report the first use of the Escherichia coli lacZ operon fusion technique in H . influenzae to study the transcriptional control of rec-1+ . Our results indicate that rec-1+ is transcriptionally induced about threefold during DNA-damaging events . Furthermore, we show that rec-1+ can substitute for recA+ in E . coli to modulate SOS induction of dinB1 expression . Surprisingly, although 5% of the H . influenzae genome is in the form of single-stranded DNA during competence for genetic transformation, an event that could be a potent SOS-inducing signal, we failed to detect significant changes in rec-1+ transcription during the induction of genetic competence.

J Bacteriol, 1993 Nov, 175(22), 7142 - 9
The Haemophilus influenzae adenylate cyclase gene: cloning, sequence, and essential role in competence; Dorocicz IR et al.; Competence for transformation in Haemophilus influenzae is stimulated by cyclic AMP (cAMP) and requires the cAMP-dependent catabolite regulatory protein CRP . Thus, understanding the control of competence will require understanding how cAMP levels are regulated . As a first step, we have cloned the H . influenzae adenylate cyclase gene (cya) by complementing the Lac- phenotype of delta cya Escherichia coli . Its sequence specifies an 843-amino-acid protein which has significant identity to other known bacterial adenylate cyclases (41 to 43% and 61% identical to the cya genes of enteric bacteria and of Pasteurella multocida, respectively) . As seen in other bacterial cya genes, there is evidence for regulation similar to that demonstrated for E . coli: the presence of a strong consensus CRP binding site within the promoter of the gene may provide feedback control of cAMP levels by repressing cya transcription, and translation may be limited by the weak ribosome binding site and by initiation of protein synthesis with GUG rather than AUG or the UUG used in other bacterial cya genes . We confirmed the essential role of cAMP in competence by constructing and characterizing H . influenzae cya mutants . This strain failed to develop competence either spontaneously or after transfer to a competence-inducing medium . However, it became as competent as its wild-type parent in the presence of exogenous cAMP . This result suggests that the failure of exogenously added cAMP to induce optimum competence in wild-type cells is not due to a limitation to the entry of cAMP into the cells . Rather, it strongly favors models in which competence induction requires both an increase in intracellular cAMP and a second as yet unidentified regulatory event . H . influenzae strains mutant in cya or crp were unable to ferment xylose or ribose . This confirms that influenzae, like E . coli, uses cAMP and CRP to regulate nutrient uptake and utilization and lends increasing support to the hypothesis that DNA uptake is mechanism of nutrient acquisition.

Chemotherapy, 1993 Nov-Dec, 39(6), 443 - 52
Efficacy and tolerance of erythromycin acistrate in the treatment of acute exacerbations of chronic bronchitis in the elderly; Forsen KO et al.; This randomized, investigator-blind, parallel-group trial compared erythromycin acistrate (EA) and erythromycin base (EB) in the treatment of elderly patients with acute exacerbations of chronic bronchitis . In total, 57 hospitalized patients were included, of whom 28 received EA 400 mg three times daily, and 29 EB 500 mg three times daily for 10-21 days . The mean age of the patients was 70 and 68 years in the EA and EB groups, respectively . The patients underwent medical examination before the onset of the study, at the 7th day during the treatment and 3-5 days after termination of the treatment . The efficacy assessment was based on clinical signs and symptoms of infection as well as on bacteriological culture from sputum samples . 55% of the patients in the EA group and 61% in the EB group were totally cured, 23 and 29%, respectively, had only mild symptoms at the end of the therapy and 14 versus 11% of the patients did not respond at all . The predominant pathogens isolated from sputum were Haemophilus influenzae, Branhamella catarrhalis and Streptococcus pneumoniae . 60% of the patients in the EA group and 46% in the EB group from whom a sample was taken had normal flora in the posttreatment culture . In the EA group, 8 patients and in the EB group 7 patients complained of gastrointestinal side effects and 4 and 1, respectively, discontinued the treatment prematurely . Slight, reversible elevations of one or more liver parenchymal enzyme activities during and after treatment were seen at the same frequency in both treatment groups . The results show that EA is as effective and well tolerated as EB in the treatment of exacerbations of chronic bronchitis in elderly patients.

Chest, 1993 Nov, 104(5), 1607 - 9
Fatal Haemophilus influenzae septicemia following bronchoscopy in a splenectomized patient; Gillis S et al.; We describe a 46-year-old splenectomized patient who died of Haemophilus influenzae septicemia 16 h following bronchoscopy . Although rare, postsplenectomy overwhelming sepsis is always a danger in splenectomized patients undergoing invasive procedures . Chemoprophylaxis should be considered in asplenic patients peribronchoscopy.

Chest, 1993 Nov, 104(5), 1400 - 7
Etiology of community-acquired pneumonia . Evaluation by transtracheal aspiration, blood culture, or serology; Ostergaard L et al.; In a 5-year period, 254 patients with community-acquired pneumonia were attended to . Transtracheal aspiration (TTA) could be performed on 119 patients, blood cultures were performed on 201 patients, and 74 patients underwent serologic examinations . By use of these procedures, an etiologic diagnosis was established in 93 cases . Streptococcus pneumoniae was the most common pathogen as it was found in 35 cases . Eleven of these 35 patients (31.4 percent) had pneumococcemia, and the mortality in this group was 27.3 percent . None of the patients with pneumococcal pneumonia and negative blood culture died . Haemophilus influenzae was the only isolated pathogen from transtracheal aspirated sputum in 16 cases and accounted for 17.5 percent of pneumonias in previous healthy individuals under 50 years of age . Mycoplasma pneumonia infections, Legionella pneumophila infections, and Chlamydia infections were found in ten, eight, and three cases, respectively . The overall agreement between microscopy and culture of respiratory secretions obtained by TTA was 58.8 percent, and microscopy can be a guide when choosing the initial antibiotic treatment . No statistically significant difference in the rate of isolating bacteria among patients treated with antibiotics prior to TTA and patients not previously treated with antibiotics was seen . When contraindications were respected, we found TTA to be a safe procedure.

Chest, 1993 Nov, 104(5), 1393 - 9
Efficacy and safety of clarithromycin compared to cefixime as outpatient treatment of lower respiratory tract infections; Neu HC et al.; BACKGROUND: Clarithromycin is a new acid-stable, 14-membered macrolide active against many of the organisms responsible for lower respiratory tract infections . It has been administered to over 5,000 patients worldwide and has been shown to be a safe and effective treatment for acute bacterial exacerbations of chronic bronchitis and bacterial pneumonia when given twice daily (250 to 500 mg) . Cefixime is an amino-thiazolyl cephalosporin with an extended spectrum of antibacterial activity inhibiting beta-lactamase-producing respiratory pathogens . It has a long half-life, allowing once-daily administration . METHODS: This randomized, double-blind multicenter study compared clarithromycin and cefixime as treatment for patients with community-acquired lower respiratory tract infections (n = 213) . Patients had bacterial pneumonia (clarithromycin, 19 percent; cefixime, 21 percent) or acute bacterial exacerbation of chronic bronchitis or asthmatic bronchitis (clarithromycin, 81 percent; cefixime, 79 percent) . Patients received 500 mg of clarithromycin twice daily (n = 103) or 400 mg of cefixime once daily (n = 110) for 7 to 14 days . RESULTS: Clinical cure or improvement occurred in 86 percent of the clarithromycin-treated patients and 88 percent of the cefixime-treated patients . When only patients with identified infections with Haemophilus influenzae, Moraxella catarrhalis, or Streptococcus pneumoniae were considered, clinical success rates were 97 percent for clarithromycin and 96 percent for cefixime; the rate of bacteriologic eradication was 91 percent for clarithromycin and 90 percent for cefixime . Adverse events occurred in 29 percent of the clarithromycin-treated patients and 23 percent of the cefixime-treated patients . CONCLUSIONS: This study demonstrates that clarithromycin and cefixime are effective treatments for pneumonia and acute bacterial exacerbations of bronchitis of mild to moderate severity caused by the most common infecting organisms.

Chest, 1993 Nov, 104(5), 1387 - 92
A comparison of cefpodoxime proxetil and cefaclor in the treatment of acute exacerbation of COPD in adults; Phillips H et al.; In this multicenter, observer-blinded study, 301 patients with signs and symptoms of acute bacterial exacerbation of COPD were randomized (2:1) to receive either cefpodoxime proxetil (200 mg, bid) or cefaclor (250 mg, tid) for 10 days . Clinical and microbiologic evaluations were performed before treatment, during therapy (study days 3 to 5), at the end of therapy (3 to 7 days posttreatment), and at long-term follow-up (4 weeks posttreatment) . The most common pretreatment isolates were Haemophilus influenzae, Haemophilus parainfluenzae, and Streptococcus pneumoniae . Significantly (p < 0.001) more bacterial isolates were susceptible in vitro to cefpodoxime (233 of 256, 91 percent) than to cefaclor (215 of 255, 84 percent) . There were no statistically significant differences between the two drug regimens in eradication of the initial pathogen (cefpodoxime, 116 of 128, 91 percent; cefaclor, 59 of 64, 92 percent) or end-of-therapy clinical response (cure + proved; cefpodoxime, 99 of 100, 99 percent; cefaclor, 45 of 49, 92 percent) rates for evaluable patients . Both drug treatments were well-tolerated, with a similar incidence of drug-related adverse events (cefpodoxime 11 percent, cefaclor 12 percent) . Cefpodoxime (bid) was as safe and effective as cefaclor (tid) in the treatment of acute exacerbation of COPD . The less frequent dosing regimen of cefpodoxime may improve patient compliance compared to those antibiotics that require three or four daily doses.

Bull Acad Natl Med, 1993 Nov, 177(8), 1381 - 7; discussion 1388-90
{Haemophilus influenzae vaccines}; Begue P; The haemophilus vaccines are made of the type b capsular polysaccharide of haemophilus influenzae, polyribosylribitol phosphate (PRP), which is responsive of pathogenic power . However the responsiveness of children to PRP vaccine was found to be very poor in infants . The concept of conjugating carbohydrate with a carrier protein increasing immunogenicity of the PRP led to 4 PRP--protein conjugate vaccines: PRP-diphtheria toxoid conjugated vaccine (PRP-D), outer-membrane protein of Neisseria meningitidis conjugated (PRP-OMP), cross-reacting mutant diphtheria protein (PRP-HbOC) and tetanus-Toxoid conjugated vaccine (PRP-T) . The antibody response to PRP is enhanced and a good booster response is obtained in infants as soon as two months of age . However the 4 vaccines differ markedly in ability to stimulate antibody production . PRP-D is less immunogenic and must be given in children older than 12 months . Antibodies are significantly higher after 3 injections of PRP-T or PRC-HbOC than PRP-OMP . Only PRP-OMP produces a clinically pertinent elevation of antibodies after 2 injections . The coadministration of PRP-OMP, PRP HbOC, PRP-T with diphtheria-tetanus-pertussis vaccines does not alter the antibody PRP response . The polio antibodies are lower if injectable polio vaccine is mixed with PRP-OMP, but the level is the same with PRP-T vaccine . The others antibodies (D, T, Coq), are at same levels . The field trials have shown a high efficacy of all those 4 vaccines . However PRP-D vaccine gave less good result in infants before 6 months . The safety of these vaccines is good and not altered by combination with investigation by diphtheria-tetanus-pertussis vaccines.(ABSTRACT TRUNCATED AT 250 WORDS)

J Antimicrob Chemother, 1993 Nov, 32 Suppl B, 165 - 73
A comparative study of cefepime and ceftazidime in the treatment of community-acquired lower respiratory tract infections; Leophonte P et al.; Antibiotic treatment for community-acquired pneumonia must target Gram-positive pathogens, especially frequently isolated organisms such as Streptococcus pneumoniae . The severity of community-acquired pneumonia is often related to underlying factors . Occasionally it may be complicated by staphylococcal or Gram-negative bacillary infection . We have compared the safety and efficacy of cefepime 1 g bd with ceftazidime 1 g tds as empirical treatment in adults with community-acquired lower respiratory tract infections (LRTIs) . One hundred and thirty-one patients with moderate to severe LRTIs were randomized to two treatment groups: 87 received cefepime and 44 received ceftazidime . The treatment groups were comparable with regard to sex, age and treatment duration . Of the 116 pathogens isolated, 57 were Gram-positive (46 strains of S . pneumoniae) and 59 were Gram-negative (33 strains of Haemophilus influenzae) . Of the 111 patients evaluated, clinical cure rates were 87% (65/75) in the cefepime group and 86% (31/36) in the ceftazidime group . Pathogen eradication rates were 95% (74/78 and 36/37, respectively) in both groups . Both drugs were well tolerated and the incidence of adverse events in each group was comparable . Cefepime 2 g per day (1 g bd) was as safe and effective as ceftazidime 3 g per day (1 g tds) in the treatment of community-acquired LRTIs.

Vet Microbiol, 1993 Nov, 37(3-4), 353 - 68
Immunogens of Pasteurella; Confer AW; The family Pasteurellaceae Pohl contains Gram-negative, facultatively anaerobic and fermentative bacteria of the genera Pasteurella, Haemophilus, and Actinobacillus . Approximately 20 different species of the genus Pasteurella have been identified using phenotypic and genetic analyses . Of these species, P . multocida and P . haemolytica are the most prominent pathogens in domestic animals causing severe diseases and major economic losses in the cattle, swine, sheep, and poultry industries . Mechanisms of immunity to these bacteria have been difficult to determine, and efficacious vaccines have been a challenge to develop and evaluate . Pasteurella multocida of serogroups A and D are mainly responsible for disease in North American poultry and pigs and to a lesser extent in cattle . Fowl cholera in chickens and turkeys is caused by various serotypes of P . multocida serogroup A and characterized by acute septicemia and fibrinous pneumonia or chronic fibrinopurulent inflammation of various tissues . Current biologicals in use are live P . multocida vaccines and bacterins . Potency tests for avian P . multocida biologicals are a bacterial colony count for vaccines and vaccination and challenge of birds for bacterins . Somatic antigens, particularly lipopolysaccharide (LPS), appear to be of major importance in immunity . In North American cattle, P . multocida serogroup A is associated mainly with bronchopneumonia (enzootic pneumonia) in young calves; however, it is occasionally isolated from fibrinous pleuropneumonia of feedlot cattle (shipping fever) . Biologicals currently available are modified-live vaccines and bacterins . The potency test for vaccines is bacterial colony counts . The test for bacterin potency is vaccination and challenge of mice . Important immunogens have not been well characterized for P . multocida infection in cattle . In swine, P . multocida infection is sometimes associated with pneumonia; however, its major importance is in atrophic rhinitis . A protein toxin (dermonecrotic toxin), produced by toxigenic strains of P . multocida types A and D, and concurrent infection with Bordetella bronchiseptica appear to be the major factors in development of atrophic rhinitis . Currently available biologicals are bacterins and inactivated toxins (toxoids) . The toxin appears to be the major immunogen for preventing atrophic rhinitis . There are, however, no standardized requirements for potency testing of P . multocida type D toxoid . Various serotypes of P . haemolytica biotype A are responsible for severe fibrinous pleuropneumonia of cattle and sheep, occasionally septicemia of lambs, and mastitis in ewes . Several serotypes of P . haemolytica biotype T are isolated from acute septicemia of lambs . The currently available P . haemolytica biologicals are modified-live vaccines, bacterins, bacterial surface extracts, and culture supernates that contain an exotoxin (leukotoxin).(ABSTRACT TRUNCATED AT 400 WORDS)

Kinderarztl Prax, 1993 Nov, 61(9), 309 - 15
{Croup syndrome}; Lindemann H; Common causes of acute laryngotracheobronchitis (LTB) are viral infections . More rarely, bacterial germs, unspecific irritants, foreign bodies, rachitic laryngospasm, mild malformation, tumours, C1 esterase inhibitor deficiency, bilateral vocal cord paralysis, and psychogenic laryngospasm may be responsible for croup . Symptoms similar to epiglottitis may occur in pharyngitis based on common bacterial tonsillitis or infectious mononucleosis and peritonsillar abscess . It is decisively important to establish a precise diagnosis to provide for an appropriate therapy . Viral croup of mild degree is often sufficiently treated by cold and moistened air and--if necessary--prednisolone . In serious disease, oxygen insufflation and adrenaline (epinephrine) are useful . Recurrent croup is due to an unspecific hyperreactivity of tracheobronchial mucosa . It often leads to asthma . Consequently, preventive measures have to be considered similar to patients with bronchial hyperreactivity . Vaccination with haemophilus influenzae type b vaccine has proved effective and safe . The disease has therefore become impressively less frequent.

Infect Immun, 1993 Nov, 61(11), 4546 - 52
Limited diversity of the protein D gene (hpd) among encapsulated and nonencapsulated Haemophilus influenzae strains; Janson H et al.; Protein D is a surface-exposed lipoprotein of the gram-negative bacterium Haemophilus influenzae with affinity for human immunoglobulin D myeloma protein . The gene encoding protein D (hpd) in a serotype b strain of H . influenzae was cloned . Escherichia coli carrying the hpd gene bound human myeloma immunoglobulin D . Nucleotide sequence analysis identified an 1,092-bp open reading frame that was more than 99% identical to the hpd gene from a nontypeable H . influenzae strain . In the deduced amino acid sequences for protein D, only 2 of 364 amino acid residues differed . The restriction fragment length polymorphism of the hpd region in different strains was analyzed by Southern blot analyses of PstI- or EcoRI-digested genomic DNA from 100 H . influenzae strains . The analysis was performed by using isolated fragments of the cloned hpd gene, originating from the nontypeable H . influenzae 772, as probes . All strains tested had DNA sequences with a high degree of homology to the hpd probes . The analysis also showed that restriction endonuclease sites within the gene were more conserved than sites adjacent to the hpd gene . An interesting difference between type b strains and unencapsulated strains was observed . The majority of type b strains seem to have a 1.4-kbp DNA fragment upstream of the hpd gene that is absent in nontypeable strains . On the basis of the high degree of conservation of the hpd gene among H . influenzae strains, we conclude that protein D is a possible vaccine candidate.

Mol Microbiol, 1993 Nov, 10(4), 839 - 48
Molecular and genetic characterization of superoxide dismutase in Haemophilus influenzae type b; Kroll JS et al.; Oxygen free radicals present a serious potential threat to microbial survival, through their ability to inflict indiscriminate damage on proteins and DNA . Superoxide dismutase (SOD, EC 1.15.1.1), among other oxygen-metabolizing enzymes, is essential to prevent these toxic molecules from accumulating in the bacterial cytosol during aerobic metabolism . The gene sodA, encoding manganese-containing SOD ({Mn}-SOD), has been cloned from a virulent strain of Haemophilus influenzae type b using degenerate oligonucleotides encoding regions of the gene conserved across different bacterial species . The gene product has been identified as {MN}-SOD by its similarity at key amino acid residues to known examples of the enzyme, by expression of enzymatically active protein from cloned DNA expressed in Escherichia coli, and by demonstration that an in-frame deletion in the gene abolishes this activity . In contrast to the situation in E . coli, this {Mn}-SOD is the only active SOD detected in H . influenzae . In further contrast to E . coli, {Mn}-SOD gene expression in H . influenzae has been found to be only partially repressed under anaerobic conditions . When expressed in E . coli the gene is regulated by Fur and Fnr, and the promoter region, identified experimentally, has been found to contain nucleotide sequence motifs similar to the Fur- and Fnr-binding sequences of E . coli, suggesting the involvement of analogues of these aerobiosis-responsive activators in H . influenzae gene expression.

J Infect Dis, 1993 Nov, 168(5), 1186 - 93
Dexamethasone attenuation of cytokine-mediated articular cartilage degradation in experimental lapine Haemophilus arthritis; Jafari HS et al.; The role of cytokines in the regulation of articular inflammation and cartilage degradation was evaluated in the rabbit model of Haemophilus influenzae type b arthritis . At 6 and 12 h after intraarticular infection, treatment with IB4 monoclonal antibody to the CD18 leukocyte receptor alone or in combination with dexamethasone resulted in significant reduction of synovial fluid (SF) neutrophil concentration . Treatment with dexamethasone alone was associated with lower SF concentrations of interleukin-1 (IL-1), tumor necrosis factor-alpha, and stromelysin than in other groups . At 24 h after infection, increased cartilage degradation was detected in untreated controls and in animals treated with IB4 alone or in combination with dexamethasone compared with those treated with dexamethasone alone . Multiple regression analyses indicated SF concentration of IL-1 and stromelysin as the significant predictors of cartilage degradation . These data suggest that IL-1 mediates cartilage degradation by regulation of metalloproteinases, such as stromelysin, during acute experimental bacterial arthritis.

South Med J, 1993 Nov, 86(11), 1225 - 8
Gram's stain and culture of sputum in the routine management of pulmonary infection; Minocha A et al.; Gram's stain (GS) and culture of sputum are used routinely for diagnosis of lung infection . We prospectively studied physicians' use of sputum GS and culture for management of lung infection, the correlation between GS and culture in 224 adequate sputum specimens from patients admitted to our hospital over a 15-month period, and its impact on the antibiotic used . GS correlated with sputum culture in one third of the cases in the most predictive group . Gram-negative rods including Haemophilus influenzae formed the majority of the positive cultures and were also the most poorly predicted by GS . Physicians used broad spectrum antibiotics empirically in most cases . These choices were not altered by the culture results in most instances . It may be reasonable to use broad spectrum antibiotics empirically for lung infection . Sputum GS and culture may be helpful in patients at risk for high morbidity and mortality.

J Immunol, 1993 Oct 15, 151(8), 4352 - 61
Clonal characterization of the human IgG antibody repertoire to Haemophilus influenzae type b polysaccharide . V . In vivo expression of individual antibody clones is dependent on Ig CH haplotypes and the categories of antigen; Chung GH et al.; Antibodies (Ab) to the polysaccharide capsule of Haemophilus influenzae type b (Hib-PS) provide protection against Haemophilus influenzae type b disease in children, and Hib-PS vaccines with different immunologic properties are widely used clinically . The repertoire of human anti-Hib-PS Ab induced by these vaccines is relatively restricted and can be divided into two types by the structure of the light chain V region . Ab using A2-V kappa II gene product, which account for the majority of anti-Hib-PS Ab response in most patients, show little somatic mutations . In contrast, non-Ab using A2-V kappa II gene product use VL genes from the V kappa I, V kappa II, V kappa III, V kappa IV, and V lambda subgroups, are variably expressed among patients, and contain somatic mutations . To further study the expression of these two types of anti-Hib-PS Ab, we have produced KB13, a mAb specific for V kappa II subgroup, and used mAb specific for various other VL subgroups to develop immunoassays specific for anti-Hib-PS Ab of each VL subgroup . When Ig allotypes were studied for the effect on the Ab repertoire, A2-V kappa II (A2) Ab were found to be expressed less in patients expressing fb or zag CH haplotypes (p < 0.05) . When the T cell-independent Hib-PS carbohydrate vaccine was compared to two T cell-dependent Hib-PS protein conjugate vaccines for their effect on Ab repertoire, Ab using V kappa III VL were found to be more often elicited with the conjugate vaccines than with the Hib-PS carbohydrate vaccine (p < 0.01) . Thus, individual members of the anti-Hib-PS Ab repertoire differ not only in their V region structure but also in the control of their expression.

CMAJ, 1993 Oct 15, 149(8), 1105 - 12
Can Haemophilus influenzae type b-tetanus toxoid conjugate vaccine be combined with diphtheria toxoid-pertussis vaccine-tetanus toxoid?
Scheifele D, Barreto L, Meekison W, Guasparini R, Friesen B.
OBJECTIVE: To assess the side effects and immune responses after three serial doses of PRP-T vaccine (a Haemophilus influenzae type b {Hib}-tetanus toxoid conjugate vaccine) given concurrently or mixed with adsorbed DPT vaccine (diphtheria toxoid-pertussis vaccine-tetanus toxoid) . DESIGN: Multicentre randomized controlled trial . SETTING: Four public health units in western Canada . PARTICIPANTS: Healthy infants 8 to 15 weeks old at entry who were able to receive routine primary vaccinations . Of 444 infants enrolled, 433 (98%) completed the study . INTERVENTIONS: All infants received PRP-T and DPT vaccines at 2, 4 and 6 months of age: half received them mixed in one injection and the others as separate, bilateral injections . MAIN OUTCOME MEASURES: Side-effects 24 and 48 hours after each dose and serologic responses to each vaccine component . RESULTS: Follow-up was obtained after all 1312 vaccinations . Fever was infrequent in the two treatment groups . Local adverse effects of the PRP-T vaccine were infrequent and mild (e.g., redness was noted in 5.9% of cases and the area of redness was more than 2.5 cm in diameter in 0.8%) . The incidence rate of local effects of the DPT-containing vaccines was the same in the two groups except for tenderness, which was more frequent in the group given the mixed vaccine (26.6% v . 17.9%, p < 0.001) . Serologic data were available for 97% of the subjects . After the three doses 98.1% of the subjects had a PRP antibody level of 0.15 micrograms/mL or more, and 87.9% had a level of 1.0 micrograms/mL or more, both levels compatible with protection against Hib . Responses to PRP-T were comparable between the treatment groups as were responses to the diphtheria and tetanus toxoids . Pertussis agglutinin titres were reduced after administration of one of two PRP-T lots mixed with DPT vaccine, but responses to four other pertussis antigens were not impaired . CONCLUSION: PRP-T vaccine is well tolerated and immunogenic . Combined PRP-T and DPT vaccines performed satisfactorily and may be the preferred method of administration.

Postgrad Med, 1993 Oct, 94(5), 39 - 40, 43-6, 51
Pneumonia in the elderly . Special considerations in a special population; McCue JD; Bacterial infections of the lower respiratory tract in the elderly may not be as atypical in presentation as traditional wisdom once held . Recent studies indicate that more than one in three elderly patients have fever, cough, and leukocytosis; nevertheless, some elderly patients present with none of the features typically associated with pneumonia . An important and consistent clinical difference between younger and older patients is the broader range of bacterial respiratory pathogens found in the elderly, including gram-negative bacilli such as Haemophilus influenzae, Proteus mirabilis, and Moraxella catarrhalis . Little is gained by the initial use of narrow-spectrum antibiotic therapy, and much may be lost . Parenteral third-generation cephalosporins and oral fluoroquinolones are active against the major pathogens and can be used for empirical broad-spectrum therapy . Recent trials indicate that results are equally good with agents of either type . Perhaps a third of elderly patients with pneumonia do not require or benefit from hospitalization . The availability of excellent new broad-spectrum oral antimicrobial agents makes treatment at home or in a nursing home an attractive way to avoid the costs and many complications of hospitalization for acute care of these frail patients.

Mol Immunol, 1993 Oct, 30(14), 1243 - 8
Post-infectious human serum antibodies inhibit IgA1 proteinases by interaction with the cleavage site specificity determinant; Devenyi AG et al.; Bacterial pathogens of the genera Neisseria and Haemophilus secrete IgA1 proteinases which cleave human IgA1 in the heavy chain hinge region . The exact peptide bond cleaved is strain-dependent, but remains invariant despite repeated subculture . Haemophilus influenzae and Neisseria meningitidis produce proteinases of two cleavage site specificities (type 1 and type 2) . We examined serial acute and convalescent sera from patients recovering from meningitis due to N . meningitidis or H . influenzae, and found a significant rise in serum titer of inhibitory antibodies against these enzymes . In each case the proteinase from the infecting organism was more susceptible to inhibition than were proteinases from that genus that had different cleavage specificity . Inhibition of sixteen type 1-type 2 hybrid H . influenzae IgA1 proteinases revealed complete concordance between inhibitory titer and cleavage site specificity . Inhibition of hybrid proteinases differing in a 123 amino acid segment known to determine cleavage site specificity (termed the CSD) further localized the site of antibody action to this site . These results from a limited number of patients with natural infections suggest that inhibiting antibody recognizes epitopes within the CSD . Alternatively, antibody may bind to epitopes outside the CSD and inhibit via steric hindrance.

J Med Microbiol, 1993 Oct, 39(4), 262 - 7
The production of porphyrins from delta-aminolaevulinic acid by Haemophilus parainfluenzae; Luppa P et al.; Porphyrin production by the haemin-independent Haemophilus parainfluenzae in the diagnostic porphyrin test, which determines the X-factor requirement in Haemophilus spp., was analysed quantitatively by applying modern high-performance liquid chromatographic (HPLC) methods . Ion-pair reversed-phase HPLC enabled the simultaneous separation of all porphyrin intermediates and their isomers of haem biosynthesis produced by the bacteria . The pH-dependence of porphyrin production and the respective composition of the porphyrins within the bacterial cells and in the supernate were investigated . A pH optimum of 6.9-8.0 for the production of porphyrins was found and there were marked differences in the porphyrin profiles at different pH values.

J Am Geriatr Soc, 1993 Oct, 41(10), 1071 - 4
The use of intramuscular cefoperazone versus intramuscular ceftriaxone in patients with nursing home-acquired pneumonia; Phillips SL et al.; OBJECTIVE: To compare the efficacy and safety of intramuscular cefoperazone and intramuscular ceftriaxone in the treatment of nursing home-acquired pneumonia in the nursing home setting . DESIGN: A randomized clinical trial . SETTING: Skilled nursing wards at the Veterans Home of California . PATIENTS: 104 residents of skilled nursing wards, aged 65 years or older . INTERVENTIONS: Intramuscular administration of either cefoperazone or ceftriaxone . MEASUREMENTS: The variables analyzed for baseline comparability were demographics (age, sex), clinical variables (duration in nursing home; presence of sputum, fever, cough, or leukocyte count), and clinical symptoms and signs . Efficacy was assessed by days of therapy, final maximum temperature, and clinical and bacteriological response . RESULTS: Fifty residents received cefoperazone, 1 gm every 12 hours, intramuscularly . Fifty-four residents received ceftriaxone, 1 gm every 24 hours, intramuscularly . The total duration of treatment was scheduled for 10 days . Clinical cure was seen in 45 (90%) of the cefoperazone treatment group and 51 (94%) of the ceftriaxone treatment group, with a mean duration of therapy of 10.30 and 9.90 days, respectively . Satisfactory sputum specimens were collected in 71% of the treated residents; the most common isolate was Streptococcus pneumoniae, followed by Haemophilus influenzae and Staphylococcus aureus, respectively . The overall mortality was 4.5% at long-term follow-up . Both agents were well tolerated and no therapy was discontinued due to intramuscular pain or abnormal laboratory values . CONCLUSIONS: Intramuscular cefoperazone and intramuscular ceftriaxone are safe and effective in the treatment of nursing home-acquired pneumonia . The clinical outcomes in both treatment groups support their use within this select population without the need for transferring the patient to an acute care hospital . Clinical studies are needed to evaluate the impact of such therapy on the control of health care expenditures within the nursing home facility.

Infect Immun, 1993 Oct, 61(10), 4033 - 7
Expression of the Haemophilus influenzae transferrin receptor is repressible by hemin but not elemental iron alone; Morton DJ et al.; The absolute requirement for elemental iron and the porphyrin nucleus for growth of Haemophilus influenzae led us to investigate the role of iron and hemin in regulation of expression of the H . influenzae transferrin receptor . H . influenzae type b strain H1689 was grown in brain heart infusion broth supplemented with beta-NAD and either 10 or 0.1 microgram of hemin ml-1 . Transferrin-binding ability was determined with a dot blot assay using human transferrin-horseradish peroxidase conjugate . Cells grown in media with 0.1 microgram of hemin ml-1 bound transferrin, but organisms grown in media with 10 micrograms ml-1 did not . In hemin-restricted media, transferrin binding occurred despite addition of up to 10 mM ferric nitrate, ferric citrate, or ferric PPi, whereas addition of 10 micrograms of hemoglobin ml-1 repressed expression . The breadth of species distribution of this mode of regulation was determined with strains previously characterized by multilocus enzyme electrophoresis . When grown in hemin-restricted media, 24 of 28 type b strains and 52 of 57 serologically nontypeable strains exhibited transferrin binding, although none did so in hemin- and iron-sufficient media . Strain H1689 and serologically nontypeable strain HI1423 grown in heat-inactivated pooled normal human serum, human cerebrospinal fluid, or human breast milk exhibited transferrin binding . Growth in these fluids with 10 micrograms of added hemin ml-1 abolished transferrin binding, whereas addition of 10 mM ferric nitrate did not . These data suggest that the transferrin receptor of H . influenzae is regulated by levels of hemin but not elemental iron alone and that this property is widely distributed among several major cloned families in the species.

Chest, 1993 Oct, 104(4), 1230 - 5
Impact of previous antimicrobial therapy on the etiology and outcome of ventilator-associated pneumonia; Rello J et al.; OBJECTIVE: To define the influence of prior antibiotic use on the etiology and mortality of ventilator-associated pneumonia (VAP) . SETTING: A university hospital medical-surgical ICU . DESIGN: Prospective clinical study . METHODS: Over a 35-month period, we prospectively studied 129 consecutive episodes of VAP . Etiologic diagnosis was established using a protected specimen brush and quantitative culture techniques . We examined prognostic factors by univariate and multivariate analyses using a statistical software package (SPSS) . RESULTS: The rate of VAP caused by Gram-positive cocci or Haemophilus influenzae was statistically lower (p < 0.05) in the patients who had received antibiotics previously, while the rate of VAP caused by Pseudomonas aeruginosa was statistically higher (p < 0.01) . Patients died of causes directly related to the infection in 18 (14.0 percent) episodes, P aeruginosa being isolated in 9 of these fatal cases . Indeed, we found that 27.7 percent (15/54) of patients who had received prior antimicrobial therapy before the onset of pneumonia died, compared with only 4.0 percent (3/75) of those who did not . In the univariate analysis, the variables significantly associated with attributable mortality were age older than 45 years, use of corticosteroids, presence of shock, hospital day of VAP over 9, antecedent COPD, and a prior antibiotic use . A step-forward logistic regression analysis defined only prior antibiotic use (p < 0.0001, OR = 9.2) as significantly influencing the risk of death from VAP . The same result was obtained when severity was included in the model . However, prior antibiotic use entirely dropped out as a significant risk factor when the etiologic agent was included in the regression equation . CONCLUSIONS: Distribution of infecting microorganisms responsible for VAP differs in patients who received prior antimicrobial therapy, and this factor determines a higher mortality rate . We suggest a restrictive antibiotic policy in mechanically ventilated patients with the purpose of reducing the risk of death from VAP.

Microb Pathog, 1993 Oct, 15(4), 319 - 26
Expression of an immunoreactive 72 kDa protein in strains of Haemophilus influenzae biogroup aegyptius associated with Brazilian purpuric fever; Lesse AJ et al.; Brazilian purpuric fever (BPF) is a newly described pediatric syndrome that results in significant morbidity and mortality . BPF is caused by specific phenotypic strains of Haemophilus influenzae biogroup aegyptius that are capable of intravascular survival . Immunoblotting of outer membrane proteins of H . influenzae biogroup aegyptius with normal human serum showed that most virulent strains of H . influenzae biogroup aegyptius associated with BPF expressed an immunologically prominent protein at 72 kDa . A corresponding protein in avirulent isolates migrated at 79 kDa . Although a minor component on SDS-PAGE analysis of the outer membrane, specific antibody against this protein is present in high concentrations in normal human serum.

J Vet Med Sci, 1993 Oct, 55(5), 871 - 3
Secondary antibody response to Haemophilus somnus antigen in breeding Japanese black cattle fed selenium-deficient and alpha-tocopherol-fortified diets; Makimura S et al.; The cattle with adequate alpha-tocopherol (Vit E) and marginally deficient selenium (Se) status manifested significantly lower anti-Haemophilus somnus antibody titer than the cattle supplemented with Se in the later stage of an 8-week trial . However, in the early stage no difference was observed in magnitude of anti-H . somnus antibody development between them . These results suggested that Se may contribute to anti-H . somnus antibody production, and that Vit E can make up for Se deficiency to a certain degree.

Pediatr Infect Dis J, 1993 Oct, 12(10), 824 - 30
Use of nasopharyngeal isolates of Streptococcus pneumoniae and Haemophilus influenzae from children in Pakistan for surveillance for antimicrobial resistance; Mastro TD et al.; Antimicrobial resistance of Streptococcus pneumoniae and Haemophilus influenzae presents a challenge to clinical case management, particularly in programs for acute respiratory tract infection (ARI), including pneumonia, in developing countries . To determine whether nasopharyngeal isolates of S . pneumoniae and H . influenzae from a clinically defined group of children could be used to predict the prevalence of antimicrobial resistance of strains that cause disease, 601 urban children with ARI, 133 healthy urban children and 285 rural children were evaluated in Pakistan . Of the urban children with ARI, 216 (35.9%) were bacteremic, predominantly with S . pneumoniae (108 children) and H . influenzae (100 children) . Overall 631 (61.9%) children carried S . pneumoniae and 381 (37.4%) carried H . influenzae . The proportions of nasopharyngeal isolates of both organisms from urban children with ARI resistant to penicillin or ampicillin, trimethoprim/sulfamethoxazole, chloramphenicol and erythromycin were similar to the proportions of resistant blood isolates . Nasopharyngeal isolates from rural children had lower rates of resistance to some antimicrobial agents . These findings suggest that nasopharyngeal isolates of S . pneumoniae and H . influenzae from children with ARI can be used to conduct surveillance for antimicrobial resistance in a defined geographic area . Such surveillance would aid programs in developing countries in making a rational choice of antimicrobial agents for use in clinical management of bacterial diseases, including pneumonia.

Pediatr Infect Dis J, 1993 Oct, 12(10), 812 - 5
Antibody response of Navajo children primed with PRP-OMP vaccine to booster doses of PRP-OMP vs . HbOC vaccine; Reid R et al.; We compared in 12- to 15-month-old American Indian infants the safety and immunogenicity of two licensed Haemophilus influenzae type b (Hib) conjugate vaccines, PRP-OMP (PedvaxHib) and HbOC (HibTITER), administered as booster vaccinations . All infants previously received PRP-OMP for their primary Hib vaccinations at 2 and 4 months of age . The geometric mean Hib antibody concentrations (microgram/ml) measured by radioactive antigen-binding assay for those receiving PRP-OMP (n = 17) or HbOC (n = 18) were 0.593 and 0.449, respectively, before boosting (P not significant) and 7.46 and 29.5 micrograms/ml, respectively, after boosting (P < 0.05) . PRP-OMP recipients also had lower geometric mean IgG anti-Hib antibody concentrations than HbOC recipients (7.21 vs 28 micrograms/ml, P = 0.003) and lower bactericidal titers (3.18 vs . 15.4, not significant) . We conclude that HbOC vaccine produced a significantly greater booster response than PRP-OMP vaccine when given at 12 to 15 months of age to children primed with two doses of PRP-OMP vaccine at 2 and 4 months of age.

Aust Fam Physician, 1993 Oct, 22(10), 1782 - 4, 1788-9
Invasive Haemophilus influenzae type b disease; McIntyre P; In this overview, the characteristics of Haemophilus influenzae type b (Hib) as an organism and the important clinical and diagnostic features of the diseases it causes are discussed . Important developments in vaccination and in the treatment and prevention of Hib disease are outlined.

Can J Vet Res, 1993 Oct, 57(4), 247 - 54
Epidemiological study of enzootic pneumonia in dairy calves in Saskatchewan; Van Donkersgoed J et al.; A field study involving 325 calves from 17 dairy herds in Saskatchewan was conducted to determine the risk of enzootic pneumonia and to assess its association with a number of factors . Two different case definitions of pneumonia were used in the analyses: the first was based on producers' treatment risk (CASE1) and the second was based on semimonthly clinical examinations of calves by the research veterinarian (CASE2) . The risk of pneumonia based on CASE1 was 39% and on CASE2 was 29% . The measure of agreement between CASE1 and CASE2 at the calf level of analysis was poor (kappa = 0.24, SE = 0.02) and at the herd level of analysis was moderate (kappa = 0.40, SE = 0.12) . The mortality risk from pneumonia was 1.8% and a variety of infectious organisms were isolated from pneumonic lungs . Twenty-seven percent of the calves had inadequate (total IgG < or = 800 mg/dL) levels of passively acquired antibodies as measured by radial immunodiffusion . The proportion of seropositive titers in calves within the first two weeks of age was 94% to parainfluenza 3 virus (PI3V) and bovine respiratory syncytial virus (BRSV), 73% to Pasteurella haemolytica (Ph), 68% to bovine viral diarrhea virus (BVDV), 67% to infectious bovine rhinotracheitis virus (IBRV), 46% to Mycoplasma dispar (Md), 44% to Haemophilus somnus (Hs), and 21% to Mycoplasma bovis (Mb) . At the calf level of analysis and after adjusting for clustering, there was a negative association (p = 0.10) between the diagnosis of pneumonia based on CASE2 and total IgG levels and Ph titers (rPh).(ABSTRACT TRUNCATED AT 250 WORDS)

Clin Infect Dis, 1993 Oct, 17(4), 686 - 90
Endophthalmitis caused by unusual gram-negative bacilli: three case reports and review; Schmidt ME et al.; Endophthalmitis due to gram-negative bacilli has been associated with a high degree of vision loss . We report three cases due to the nonenteric gram-negative bacilli Moraxella nonliquefaciens, Haemophilus paraphrophilus, and multidrug-resistant Haemophilus influenzae . The features of these cases are compared with those of other reported cases of endophthalmitis due to unusual nonenteric gram-negative bacilli . Fifty-eight percent of patients had no vision in the affected eye after treatment . Early surgical intervention with vitrectomy and intravitreous antibiotics in addition to parenteral antibiotics should be included in the treatment of endophthalmitis due to gram-negative bacilli.

Antimicrob Agents Chemother, 1993 Oct, 37(10), 2112 - 8
Antimicrobial activity of DV-7751a, a new fluoroquinolone; Tanaka M et al.; We compared the in vitro antibacterial activity of DV-7751a against gram-positive and -negative bacteria with those of quinolones currently available . MICs for 90% of the strains tested (MIC90s) against clinical isolates of methicillin-susceptible and -resistant Staphylococcus aureus and Staphylococcus epidermidis were 0.20, 0.39, 0.20, and 0.78 micrograms/ml, respectively . Moreover, MIC50s for DV-7751a against ofloxacin-resistant methicillin-resistant S . aureus were 4-, 8-, 16-, 32-, and 64-fold lower than those for tosufloxacin and sparfloxacin, levofloxacin, ofloxacin and fleroxacin, ciprofloxacin, and lomefloxacin, respectively . DV-7751a inhibited the growth of all strains of Streptococcus pneumoniae, Streptococcus pyogenes, and Peptostreptococcus spp . at 0.39, 0.39, and 0.78 micrograms/ml, respectively, and was 4- to > 16-fold more active against enterococci at the MIC90 level than the other quinolones tested . The activity of DV-7751a against Pseudomonas aeruginosa was roughly comparable to those of levofloxacin and sparfloxacin at the MIC90 level and was two- to fourfold less than that of ciprofloxacin . DV-7751a showed activity comparable to those of levofloxacin and ciprofloxacin against the other glucose-nonfermenting bacteria Haemophilus influenzae, Neisseria gonorrhoeae, and Moraxella catarrhalis (MIC90s of 0.025, 0.20, and 0.10 micrograms/ml, respectively) . DV-7751a activity was not affected by medium, inoculum size, or the addition of human serum but was decreased under acidic conditions and in human urine, as were the other quinolones tested . Time-kill curve studies demonstrated the rapid bactericidal action of DV-7751a against S . aureus, S . pneumoniae, Escherichia coli, and P . aeruginosa . The frequency of spontaneous resistance to DV-7751a was less than or equal to those of the reference drugs . DV-7751a inhibited the supercoiling activity of DNA gyrases from S . aureus, E . coli, and P . aeruginosa at concentrations comparable to those of levofloxacin and sparfloxacin.

Kansenshogaku Zasshi, 1993 Oct, 67(10), 1023 - 30
{A clinical study of chronic lower respiratory tract infections with Pseudomonas aeruginosa by transtracheal aspiration}; Maeda K et al.; We investigated the yearly changes of the incidence of Pseudomonas aeruginosa (P . aeruginosa) isolated from chronic lower respiratory tract infections (CLRTI), and also performed a clinical study on CLRTI with P . aeruginosa by transtracheal aspiration (TTA) to clarify the recent trend of P . aeruginosa infection in CLRTI and the predisposing clinical factors to the acute exacerbation . The isolation rate of P . aeruginosa among the total isolated bacteria in CLRTI between December 1978 and March 1983 was 8.4%, but it increased to 23.1% between April 1988 and March 1993 . In 69 episodes (40 cases) of P . aeruginosa isolated from CLRTI between April 1983 and March 1993, monomicrobial infections of P . aeruginosa were 42 episodes (60.9%) and polymicrobial infections were 27 episodes (39.1%) . When the diseases were classified into acute exacerbated and non-exacerbated phases, polymicrobial infections were seen more in the former phase, and the principal organisms detected with P . aeruginosa were Haemophilus influenzae and Streptococcus pneumoniae . In the acute exacerbated cases, predisposing conditions concerning the exacerbation were divided into four patterns: 1 . polymicrobial infections with H . influenzae or S . pneumoniae, 2 . after acute upper respiratory tract infections due to viral superinfection, 3 . early phase from bacterial replacement by P . aeruginosa, 4 . immunocompromised states such as adrenal corticosteroid administration or systemic underlying diseases . These results suggest that the importance of P . aeruginosa in CLRTI is increasing year by year and we must pay attention to the fact that P . aeruginosa alone may also cause acute exacerbation in the latter 2 patterns of the condition.

J Clin Microbiol, 1993 Oct, 31(10), 2674 - 8
Prevalence of bacterial respiratory pathogens in the nasopharynx in breast-fed versus formula-fed infants; Kaleida PH et al.; In several studies, breast-feeding has been associated with decreased frequency or duration of otitis media episodes . If a causal relationship exists, the mechanism of protection of breast-feeding has not been established . We hypothesized that infants who are breast-fed, compared with infants who are formula-fed, have a lower prevalence of nasopharyngeal colonization with the bacterial respiratory pathogens (Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Streptococcus pyogenes) commonly isolated from the middle ear effusions of children with acute otitis media . In two private pediatric practices, we obtained specimens from the nasopharynx for culture from 211 infants at 1 month of age and from 173 of these infants at 2 months of age . A swab was left in place in the nasopharynx for 45 s and was then immediately transferred onto appropriate culture media . Exclusively breast-fed (n = 84) and exclusively formula-fed (n = 76) infants were similar regarding the number of persons in the household, the number of children in the household, the number of siblings in day care, and the proportion with a recent upper respiratory tract infection . The two groups did not differ significantly in the proportions found to have one or more respiratory pathogens at 1 month of age (10.7 versus 18.4%; P = 0.12) or 2 months of age (34.8 versus 35.1%; P = 0.57) . We conclude that during the first 2 months after birth, the exclusive receipt of breast milk appears not to substantially influence the prevalence of nasopharyngeal colonization with common bacterial respiratory pathogens.

Acta Paediatr, 1993 Oct, 82(10), 843 - 8
Prevalence of potential respiratory disease bacteria in children in Ethiopia . Antimicrobial susceptibility of the pathogens and use of antibiotics among the children; Ringertz S et al.; Acute respiratory infections are primary causes of morbidity and mortality in children in developing countries . This project was designed to investigate antimicrobial susceptibility of respiratory tract pathogens isolated from children in rural and city areas, and to contribute to the rational choice of antibiotics for respiratory tract infections in children in Ethiopia . Nasopharynx and throat cultures were taken from all children under five years of age in three study areas representing different levels of contact with health care and accessibility to modern drugs, such as antibiotics . In all, 1126 children were cultured . Haemophilus influenzae and Streptococcus pneumoniae were both found in 85-90% of the children, and beta-haemolytic streptococci group A in 12% . The level of antimicrobial resistance was low . None of the 954 strains of H . influenzae were beta-lactamase producers . Pneumococci were susceptible to penicillin . The use of antibiotics was also low; 11 of 1126 children had antibiotics on the day of culture or the day before . The choice of antibiotics was not limited by resistance, and emphasis could be put on low cost, minimizing adverse drug reactions and ecological impact.

Int J Syst Bacteriol, 1993 Oct, 43(4), 799 - 804
Growth characteristics of V factor-independent transformants of Haemophilus influenzae; Windsor HM et al.; Haemophilus influenzae is a V factor-dependent species . A plasmid conferring V factor independence in Haemophilus parainfluenzae and Haemophilus ducreyi was transferred to plasmid-free H . influenzae Rd by DNA transformation . The growth characteristics of the transformants in a complex and a chemically defined medium were compared, and the ability of several exogenous pyridine nucleotides and precursors to support growth was examined . Although the transformants appeared to be V factor independent in a complex medium, in a chemically defined medium they exhibited both V factor-dependent and nicotinamide-dependent growth . Because of the inability of the plasmid-free H . influenzae Rd to utilize nicotinamide for growth, it was concluded that the genes conferring this function were plasmid linked . Our results indicate that the V factor requirement, as it is presently defined, is not suitable to serve as a definitive taxonomic criterion for species determination in the family Pasteurellaceae.

Infect Agents Dis, 1993 Oct, 2(5), 324 - 32
Impact of Haemophilus influenzae type b vaccines on the epidemiology of bacterial meningitis; Wenger JD; Haemophilus influenzae type b (Hib) was the most common cause of bacterial meningitis in the United States in the 1980s . Although introduction of Hib polysaccharide vaccines had little impact on disease incidence, development and use of Hib polysaccharide-protein conjugate vaccines dramatically reduced Hib meningitis rates . With widespread use of the new Hib conjugate vaccine, elimination of Hib meningitis in the United States may be achieved . Development of similar vaccines for other bacterial agents of meningitis are in progress.

Avian Dis, 1993 Oct-Dec, 37(4), 970 - 6
Isolation and characterization of a Haemophilus paragallinarum mutant that lacks a hemagglutinating antigen; Yamaguchi T et al.; In an in vivo cross-protection test with Haemophilus paragallinarum strains of serovars B and C, we isolated and characterized a mutant strain, S1M, which lacked a hemagglutinating (HA) antigen when compared biologically and immunologically with isogenic strain S1 . Unlike the isogenic strain S1, the mutant strain S1M lacked HA activity against formaldehyde-fixed chicken erythrocytes, even after hyaluronidase treatment, and it did not stimulate hemagglutination-inhibition antibody in chickens immunized with bacterial cells . Dot-blot testing and immunoelectron microscopy with monoclonal antibodies against serovar C-specific HA antigens showed that strain S1M did not react with these monoclonal antibodies . Furthermore, strain S1M was found to be both non-pathogenic and non-immunogenic . In contrast, the isogenic strain S1 reacted with these monoclonal antibodies and was pathogenic and immunogenic . These results suggest that the HA antigen of H . paragallinarum serovar C . strain plays an important role in pathogenicity and immunogenicity.

Med Trop (Mars), 1993 Oct-Dec, 53(4), 537 - 8
{Materno-fetal infection caused by Haemophilus influenzae}; Barguellil F et al.; Neonatal infection due to Haemophilus influenzae is a rare cause of neonatal infection . The authors report a case associated with premature membrane rupture.

Diagn Microbiol Infect Dis, 1993 Oct, 17(3), 225 - 32
Interlaboratory variations of fluoroquinolone susceptibility testing . An international study to validate the quality of microbiology results reported during the fleroxacin clinical trials; Jones RN et al.; Fleroxacin, a newer fluoroquinolone, has been investigated extensively in worldwide clinical trials by laboratories using a variety of in vitro susceptibility testing methods . These methods differ in their technical details, leading to applied interpretive criteria that can also differ from nation to nation and from method to method . This retrospective three-phase investigation was designed to assess the disk diffusion and minimum inhibitory concentration (MIC) result variations produced by European laboratories participating in fleroxacin clinical trials as compared with the results of a reference laboratory performing National Committee for Clinical Laboratory Standards (NCCLS) tests . In "phase I," 105 clinical trial strains (1988-1989) from six European investigators were processed by the reference laboratory . In comparison of participant and reference laboratory zone diameters, absolute qualitative agreement was 88.7% for the approved NCCLS interpretive criteria and 94.8% for the criteria used in the fleroxacin urinary tract infection clinical trials . Only three false-susceptible results (3.1%) were reported by the investigators . In the remaining phases of this study (unknown challenge strains and contemporary clinical isolates), the investigator laboratory zone diameters and MICs were within limits of acceptable test variation, that is, +/- 4 mm by disk diffusion and +/- 1 log2 dilution step by the MIC method . For laboratories using the German (DIN) and French (SFM) methods, however, a trend toward larger zones was observed . The greatest variation between participant and NCCLS results was produced when fastidious isolates such as Haemophilus influenzae (significantly smaller zone diameters) were tested . In general, the European fleroxacin clinical trial laboratory results (organism identification and susceptibility tests) could be considered comparable to data produced with NCCLS reference methods, indicating that clinical trial results from wider sources could be used for drug registry by the US Food and Drug Administration (FDA) or by other national agencies.(ABSTRACT TRUNCATED AT 250 WORDS)

Diagn Microbiol Infect Dis, 1993 Oct, 17(3), 213 - 7
Comparison of susceptibility test methods to detect penicillin-resistant Streptococcus pneumoniae; Clark RB et al.; The detection of penicillin-resistant Streptococcus pneumoniae was assessed by six different methods: agar dilution, oxacillin screen by disk diffusion, E-test, and three overnight microdilution test methods that included commercial panels from MicroScan and Micro Media and in-house-made conventional panels using a commercial Haemophilus test medium (HTM) broth . Of the 52 pneumococcal isolates tested, 12 were resistant, 16 were relatively resistant, and 24 were susceptible to penicillin as defined by the reference agar dilution method . The oxacillin screen detected as resistant all 28 resistant and relatively resistant strains . The percentage of penicillin-resistant isolates detected by each minimum inhibitory concentration (MIC) test method was as follows: E-test (100%), Micro Media (75%), MicroScan (0%), and HTM (0%) . With the relatively resistant isolates, the detection percentage was as follows: E-test (88%), Micro Media (94%), MicroScan (69%), and HTM (69%) . In conclusion, the E-test and Micro Media MIC tests are acceptable confirmatory tests for detecting penicillin resistance among S . pneumoniae isolates.

Infect Immun, 1993 Oct, 61(10), 4112 - 8
Adherence to human cells of a cryptic Haemophilus genospecies responsible for genital and neonatal infections; Rosenau A et al.; Haemophilus strains usually identified as Haemophilus influenzae biotype IV belonging to a cryptic genospecies are responsible for genital and neonatal infections . As a first approach to identifying the bacterial factors involved in the pathogenesis of these unusual diseases, we studied the piliation, adherence, and invasion properties of 17 strains assigned to this cryptic genospecies . Twelve strains spontaneously displayed abundant peritrichous piliation, and two strains expressed peritrichous pili after enrichment procedures . For virtually all strains, piliation correlated with adhesion to cultured HeLa cells of genital origin and to a lesser extent with adhesion to HEp-2 cells of laryngeal origin . A variation in the adherence properties of the various strains was observed: all piliated strains except one adhered to 50 to 100% of HeLa cells, with a mean number of bacteria per cell varying from 4 to 50 . Adherence was not dependent on the state of growth for most strains, was more pronounced with HeLa cells than with HEp-2 cells for 10 of the 12 highly adherent strains, was time and inoculum dependent, and was not followed by significant invasion of cells . Most of the strains belonging to this unusual Haemophilus clone possess adhesins that do not recognize erythrocyte receptors, since agglutination of human erythrocytes was observed with only 3 of the 14 piliated strains.

Mol Microbiol, 1993 Oct, 10(2), 361 - 9
Cloning and molecular analysis of the galE gene of Neisseria meningitidis and its role in lipopolysaccharide biosynthesis; Jennings MP et al.; The galE gene from Haemophilus influenzae was used as a hybridization probe for the galE gene of Neisseria meningitidis Group B, identifying two different homologous loci . Each of the loci was cloned and nucleotide sequence analysis revealed that both loci contained sequences similar to galE . One contained a functional galE gene and mapped to the capsule biosynthetic locus . The second contained only a partial galE-coding sequence, which did not express a functional gene product . A galE mutant meningococcal strain was constructed by transformation with an inactivated galE gene . Analysis of the LPS from the galE mutant strain revealed an apparent reduction in molecular weight and a loss of reactivity with monoclonal antibodies specific for structures known to contain galactose . These results are consistent with an essential role for galE in the incorporation of galactose into meningococcal lipopolysaccharide.

J Formos Med Assoc, 1993 Oct, 92(10), 884 - 8
Bacterial meningitis in infants and children in southern Taiwan: emphasis on Haemophilus influenzae type B infection; Liu CC et al.; During a four-year period from November 1988 to October 1992, 41 cases of bacterial meningitis with a positive cerebrospinal fluid (CSF) culture and/or CSF antigen test were collected at the National Cheng Kung University Hospital . The ages of the subjects ranged from 32 days to 13 years, with a median of seven months . The male to female ratio was 2.4:1 . The most common causative agent was Haemophilus influenzae type b (Hib, 29.3%), followed by group B beta-hemolytic streptococci (GBS, 24.4%), Streptococcus pneumoniae (22.0%), Escherichia coli (4.9%), Neisseria meningitidis (4.9%), Salmonella species (4.9%), Klebsiella pneumoniae (4.9%), Pseudomonas aeruginosa (2.6%), and viridans streptococci (2.6%) . The onset of GBS meningitis was always prior to four months of age . Of the 41 cases studied, 27 (65.9%) were aged from two months to five years; 12 (44.4%) of these had meningitis caused by Hib . Most of the cases (90.2%) had a fever as the first clinical manifestation . Ampicillin combined with a third-generation cephalosporin was effective against most of the causative pathogens . The most frequently encountered short-term sequelae were seizures (64.7%), subdural effusion (55.9%) and ventriculomegaly (44.1%) . Observations on long-term sequelae are ongoing . While the case-fatality rate was as high as 33.3% in S . pneumoniae, and 25% in Hib-infected patients, the overall mortality rate was 17.1% . There is a need for greater emphasis on prevention through the use of available vaccines, including the newly introduced conjugate vaccines against Hib which are capable of eliciting immune responses in infants as young as two months.

Infect Immun, 1993 Oct, 61(10), 4153 - 7
Characterization of an immunoreactive 17.5-kilodalton outer membrane protein of Haemophilus somnus by using a monoclonal antibody; Tagawa Y et al.; A single outer membrane protein (OMP) of Haemophilus somnus, with an apparent molecular mass of 17.5 kDa, was identified in the sodium dodecyl sulfate (SDS)-insoluble fraction after extraction with 1% SDS-0.5 M NaCl-0.1% beta-mercaptoethanol . A hybridoma derived from mice immunized with H . somnus OMP fractions produced a monoclonal antibody (MAb), designated 20-3-5, that bound to the 17.5-kDa OMP of H . somnus . The MAb 20-3-5 epitope was present on 45 of 45 strains of H . somnus tested . MAb 20-3-5 cross-reacted with Haemophilus agni, Histophilus ovis, and Haemophilus haemoglobinophilus but not with 13 other species and subspecies of gram-negative bacteria . Immunoelectron-microscopic and antibody absorption studies revealed that the MAb 20-3-5 epitope is exposed on the surface of bacteria . In an immunoblot analysis, convalescent-phase sera obtained from calves with experimental H . somnus pneumonia contained antibodies to the 17.5-kDa OMP of H . somnus . Future studies will be directed toward examining the role of the 17.5-kDa OMP in immunity to H . somnus infections.

Monatsschr Kinderheilkd, 1993 Oct, 141(10), 770 - 6; quiz 777, 812-3
{Immunological principles of polysaccharide-protein conjugate vaccination}; Meyer M et al.; Haemophilus influenzae and Streptococcus pneumoniae are bacteria with a polysaccharide capsule . The production of specific antibodies against capsular polysaccharide plays a pivotal role in the defence against these organisms . However, children under the age of two years do not at all or only poorly respond to an infection with encapsulated bacteria or after vaccination with purified capsular polysaccharide antigen . In contrast, protein antigens, e.g . tetanus- and diphtheriae-toxoid, are good immunogens in this age group . The difference between polysaccharide antigen and protein antigen is that the former are T-dependent antigens whereas the latter are T-independent . The reason for this age dependent "immunodeficiency" is not clear . A functional immaturity of a B-cell population seems to be the reason for the unresponsiveness of young children against Ti-2 antigens . The Haemophilus conjugate vaccine contains the capsular polysaccharide chemically conjugated to a carrier protein . This results in an immune response against the polysaccharide with characteristics of a T dependent antigen, giving high immunogenicity even in children under the age of two years, resulting in high antibody-production and the induction of immunological memory.

MMWR Recomm Rep, 1993 Sep 17, 42(RR-13), 1 - 15
Recommendations for use of Haemophilus b conjugate vaccines and a combined diphtheria, tetanus, pertussis, and Haemophilus b vaccine . Recommendations of the advisory Committee on Immunization Practices (ACIP).
{The PRP-D vaccination of Danish children . A study of immunogenicity of a Haemophilus influenzae type b vaccine coadministered with Di-Te-Pol to Danish children}
Konradsen HB, Ejlertsen T, Henrichsen J.

Sektor for mikrobiologisk diagnostik, Statens Seruminstitut, KobenhavnThe aim of this study was to examine the immunogenicity of a Haemophilus influenzae type b (Hib) vaccine (PRP-D) in Danish children younger than 18 months of age, given at the same time as a diphtheria-, tetanus- and polio-vaccine at the age of five, six and 15 months . The study was carried out as a multicentre study, where 21 children were vaccinated by their general practitioners . Blood samples were drawn just before and four weeks after each of the three vaccinations and the concentration of Hib-antibodies were determined using an ELISA-technique . Before the first vaccination none of the 21 children had antibody levels above 1 microgram/ml, which is believed to be the level which provides long-lasting protection, whereas after the first, second and third vaccination respectively 24, 48 and 100% of the children had antibody levels above 1 microgram/ml . There were only mild and short-lived side effects . The PRP-D vaccine given at the same time as Di-Te-Pol is safe, without serious side-effects and immunogenic in Danish children.

Dtsch Med Wochenschr, 1993 Sep 10, 118(36), 1269 - 75
{The epidemiology of septicemia causative agents . A blood culture study of the Paul Ehrlich Society for Chemotherapy e . V.}; Rosenthal EJ; From August 1991 to July 1992 11 microbiological institutes in the Federal Republic of Germany and two in Austria registered 4380 episodes of septicaemia with 4603 microorganisms isolated . The results regarding sex, age, type of hospital, type of referring specialty, type of hospital unit and the spectrum of causative organisms were compared with similar data collected 7 years previously over a period of 2 years for 8500 septicaemia episodes involving 8999 microorganisms by 13 German and two Austrian institutes . The spectrum of causative organisms differed between the two studies: a doubling in the incidence of pneumococci from 2.5 to 5%, an increase of enteritis Salmonella from 1.1 to 1.8%, and a decrease of Haemophilus influenzae from 0.9 to 0.5% . Among newborns in the first 3 weeks of life the incidence of B-streptococci increased from 14.2 to 21.5%, while that of A-streptococci among medical patients increased from 20.6 to 38.3% . An analysis of clinical data revealed nonhemolytic streptococci as the most frequent causative organism in endocarditis (32.5%); pneumococci and staphylococci (26.6 and 22.1%, respectively) in pulmonary infections; gram-negative rods in urinary tract infections (77.9%); gram-negative rods and coagulase-negative staphylococci in leukaemia (46.9 and 18%); and staphylococci with 61% in septicaemia due to intravascular foreign bodies.

Gene, 1993 Sep 6, 131(1), 125 - 8
Sequence of the ompH gene from the deep-sea bacterium Photobacterium SS9; Bartlett DH et al.; In contrast to studies of many other extremophiles, the molecular characterization of the barophilic or high-pressure-adapted bacteria of the deep ocean is virtually nonexistent . One exception is the discovery that the moderate barophile Photobacterium SS9 preferentially synthesizes a 37-kDa outer membrane protein, designated OmpH, in response to elevated hydrostatic pressure . We report here on the molecular characterization of the ompH gene . The deduced amino acid sequence of mature OmpH is similar to a number of porin proteins, including significant similarity to porin protein P2 from Haemophilus influenzae . It appears likely that OmpH is a unique porin whose synthesis is responsive to changes in the pressure regime of the deep-sea bacterium.

Pediatr Infect Dis J, 1993 Sep, 12(9), 739 - 43
Early onset Haemophilus influenzae sepsis in the newborn infant; Kinney JS et al.; Neonatal sepsis caused by Haemophilus influenzae is characterized by an early onset syndrome associated with pneumonia, shock and neutropenia . Over a 30-month period 13 infants referred to this hospital had early onset H . influenzae sepsis . Obstetric complications included preterm labor (92%), prolonged rupture of membranes > 12 hours (63%), maternal fever (64%), chorioamnionitis (43%), vaginal discharge (44%) and premature rupture of membranes (15%) . All 13 infants were symptomatic at delivery and 7 required immediate intubation . Pneumonia and respiratory distress were the prominent clinical findings . H . influenzae was isolated from infant blood, maternal blood, placenta and genital tract . Isolates were predominantly non-type b, beta-lactamase-negative . A study to determine the prevalence of H . influenzae colonization of the genital tract among women attending clinic at the hospital with the most cases showed a rate of 0.3% . Perinatal risk factors and clinical findings in the infants are similar to disease caused by other organisms associated with early onset sepsis.

J Hered, 1993 Sep-Oct, 84(5), 400 - 4
Genes for breakfast: the have-your-cake-and-eat-it-too of bacterial transformation; Redfield RJ; Bacterial transformation, in which cells take up and recombine free strands of DNA, is the simplest process thought to have evolved for genetic exchange, i.e., because of the potential benefits of producing progeny with recombinant genotypes . However, two other functions are equally plausible: acquisition of intact DNA strands to use for recombinational repair of DNA damage, and acquisition of the nutrients contained in DNA molecules . Although the recombinant progeny produced by transformation can be beneficial, the success of genes causing transformation is limited by other factors, especially by the genetic quality of DNA derived from dead cells . Our recent experiments in the naturally transformable bacteria Haemophilus influenzae and Bacillus subtilis suggest that the DNA-repair hypothesis is unlikely to be correct . In H . influenzae, transformation does not detectably increase the cells' ability to survive DNA damage . More importantly, we have found that, although competence (the ability to take up DNA) is induced by nutritional limitation in both H . influenzae and B . subtilis, it is not induced by DNA damage in either . Thus we favor the hypothesis that transformation evolved as a nutrient-uptake system, especially because unrelated DNA is abundant in the environments of many naturally transformable bacteria.

J Clin Microbiol, 1993 Sep, 31(9), 2538 - 40
Quality control guidelines for cefdinir, cefepime, cefetamet, cefmetazole, cefpodoxime, cefprozil, and clinafloxacin (CI-960) for various National Committee for Clinical Laboratory Standards susceptibility testing methods . Quality Control Study Group; Bale MJ et al.; Several multilaboratory studies to determine quality control (QC) ranges for a variety of National Committee for Clinical Laboratory Standards (NCCLS) susceptibility tests are summarized . Replicate testing used multiple lots of media and antimicrobial disks in accordance with NCCLS recommendations, including the appropriate medium modifications for tests with Haemophilus spp . and Neisseria gonorrhoeae . QC ranges for MIC and disk diffusion testing of N . gonorrhoeae ATCC 49226 were proposed for cefepime, cefetamet, cefmetazole, and cefpodoxime . Disk diffusion QC ranges for Haemophilus influenzae ATCC 49247 or ATCC 49766 were recommended with cefepime, cefetamet (10- and 30-microgram disks), cefmetazole, cefpodoxime, and cefprozil . Disk diffusion QC ranges for Staphylococcus aureus ATCC 25923 and Escherichia coli ATCC 25922 with cefdinir and clinafloxacin and those for Pseudomonas aeruginosa ATCC 27853 with clinafloxacin were also proposed.

J Clin Microbiol, 1993 Sep, 31(9), 2375 - 80
Tentative criteria for confirming the in vitro susceptibilities of Haemophilus influenzae and Neisseria gonorrhoeae to two fluoroquinolones (sparfloxacin and levofloxacin), including quality control parameters; Barry AL et al.; Sparfloxacin and levofloxacin were evaluated against 150 Haemophilus influenzae isolates and 149 Neisseria gonorrhoeae isolates in order to define susceptibility testing parameters . Sparfloxacin-susceptible H . influenzae strains were defined as those for which the MICs were < or = 0.25 microgram/ml and the zones were > or = 30 mm, and N . gonorrhoeae susceptible strains were those for which the MICs were < or = 0.03 microgram/ml and the zones were > or = 39 mm (5-micrograms disks) . Levofloxacin-susceptible strains of H . influenzae included those for which the MICs were < or = 0.12 microgram/ml and the zones were > or = 32 mm and N . gonorrhoeae susceptible strains were those for which the MICs were < or = 0.12 microgram/ml and the zones were > or = 37 mm (5-micrograms disks) . Criteria for a resistant category cannot yet be defined for either quinolone . In multilaboratory studies with different lots of Haemophilus Test Medium, replicate tests with the standard control strain of H . influenzae (ATCC 49247) were evaluated . For sparfloxacin disk tests, the proposed zone size limits were 33 to 42 mm and broth microdilution MIC limits were 0.004 to 0.016 microgram/ml, whereas for levofloxacin tests, zone size limits were 32 to 41 mm and broth microdilution MIC limits were 0.008 to 0.03 microgram/ml . Other multilaboratory studies evaluated tests with supplemented GC agar and N . gonorrhoeae ATCC 49226; for both drugs, zone size limits were 44 to 52 mm and agar dilution MIC limits were 0.004 to 0.016 microgram/ml.

J Bacteriol, 1993 Sep, 175(18), 5978 - 83
Molecular analysis of region 1 of the Escherichia coli K5 antigen gene cluster: a region encoding proteins involved in cell surface expression of capsular polysaccharide; Pazzani C et al.; The nucleotide sequence of region 1 of the K5 antigen gene cluster of Escherichia coli was determined . This region is postulated to encode functions which, at least in part, participate in translocation of polysaccharide across the periplasmic space and onto the cell surface . Analysis of the nucleotide sequence revealed five genes that encode proteins with predicted molecular masses of 75.7, 60.5, 44, 43, and 27 kDa . The 27-kDa protein was 70.7% homologous to the CMP-2-keto-3-deoxyoctulosonic acid synthetase enzyme encoded by the E . coli kdsB gene, indicating the presence of a structural gene for a similar enzyme within the region 1 operon . The 43-kDa protein was homologous to both the Ctrb and BexC proteins encoded by the Neisseria meningitidis and Haemophilus influenzae capsule gene clusters, respectively, indicating common stages in the expression of capsules in these gram-negative bacteria . However, no homology was detected between the 75.7, 60.5-, and 44-kDa proteins and any of the proteins so far described for the H . influenzae and N . meningitidis capsule gene clusters.

J Med Microbiol, 1993 Sep, 39(3), 218 - 24
Transferrin-binding ability of invasive and commensal isolates of Haemophilus spp; Hardie KR et al.; Haemophilus influenzae type b expresses an inducible siderophore-independent iron-acquisition system that depends on a direct interaction between human transferrin and specific iron-regulated transferrin-binding outer-membrane proteins . To evaluate the importance of this iron-acquisition system amongst haemophili, 156 isolates of Haemophilus spp . (78 commensal isolates and 78 isolates from invasive infections) were examined for their ability to bind transferrin . Of the 78 invasive isolates, all of which were H . influenzae type b, 71 (91%) were capable of binding transferrin, with 57 (73%) binding transferrin constitutively (i.e., even when grown in an iron-sufficient medium) . In contrast, only 11 (14%) of the commensal isolates bound transferrin constitutively, with a further 16 (21%) binding transferrin only after growth in an iron-deficient medium . Of the 27 commensal strains that were capable of binding transferrin, 12 were H . parainfluenzae biotype III, 14 were non-typable H . influenzae, and one was H . parahaemolyticus . None of the H . influenzae type b invasive or commensal isolates showed evidence of siderophore production, but 50 (66%) of the remaining 76 commensal isolates appeared to produce an iron chelator . Thus, while not a universal characteristic, detectable transferrin-binding was associated strongly with H . influenzae type b isolates from invasive infections, and was also recognised for the first time in isolates of H . parainfluenzae and H . parahaemolyticus.

Infect Immun, 1993 Sep, 61(9), 4017 - 20
Molecular cloning and sequence of the gene for outer membrane protein P5 of Haemophilus influenzae; Munson RS Jr et al.; The gene for outer membrane protein P5 of Haemophilus influenzae was identified by immunological screening of a genomic lambda EMBL3 library of the serotype b strain 1613 . The gene was subcloned, and plasmid clones expressing P5 were identified by immunologic screening . The gene for outer membrane protein P5 was sequenced . The mature protein has a molecular weight of 35,628 . The protein is 50% identical and 65% similar to the OmpA protein of Escherichia coli.

Am J Epidemiol, 1993 Sep 1, 138(5), 333 - 40
Day care attendance and other risk factors for invasive Haemophilus influenzae type b disease; Arnold C et al.; Two hundred and ninety-five of 373 (79%) children with reported cases of invasive Haemophilus influenzae type b (Hib) occurring in the state of Oklahoma from January 1, 1986, through December 31, 1987, were matched according to birth date with two controls each . Conditional logistic regression was used to assess the independent roles of day care attendance, number of young children in the home, crowding, passive smoking, maternal education, household income, and race in Hib disease . Statistically significant odds ratios (ORs) were found for day care attendance (OR = 2.9), the presence of two or more children in the home under 6 years of age (OR = 2.4), crowding (ratio of number of people in the home to number of bedrooms > or = 2) (OR = 2.0), and exposure to cigarette smoking in the home (OR = 1.4) . Household income was independently associated with Hib disease . African Americans were at increased risk even after adjustment for income and crowding (OR = 4.1) . Although there were no important differences in risk for other factors by type of Hib disease, there was a large and statistically significant difference in risk for day care attendance between meningitis (adjusted OR = 5.1, 95% confidence interval (CI) 3.1-8.2) and other types of Hib disease (combining nonmeningitis cases, adjusted OR = 1.6, 95% CI 0.9-2.7) . Increasing numbers of hours per week of day care attendance and children per room were associated with increasing risk of Hib meningitis in a dose-response pattern . The highest day care ORs for meningitis were observed in the youngest (< 6 months) and oldest (> or = 24 months) children . The adjusted OR for exposure to breast feeding was 0.5 (95% CI 0.3-0.8) . A protective effect for Hib polysaccharide vaccination among children aged > or = 18 months was suggested but did not reach statistical significance (OR = 0.4, 95% CI 0.2-1.1).

Am J Epidemiol, 1993 Sep 1, 138(5), 326 - 32
The bacterial etiology of conjunctivitis in early infancy . Eye Prophylaxis Study Group; Krohn MA et al.; The authors conducted this study to determine the etiologic agents of conjunctivitis in early infancy . From 1985 to 1990, 630 infants enrolled in a randomized, controlled, double-masked study of eye prophylaxis were observed for 60 days after delivery for signs of conjunctivitis . The following isolates were categorized as pathogens: Haemophilus influenzae, Streptococcus pneumoniae, Neisseria cinerea, Klebsiella pneumoniae, and Chlamydia trachomatis . Using conditional logistic regression for analysis of 97 infant pairs, the authors identified isolates categorized as pathogens almost exclusively among cases (odds ratio (OR) = 18.0, 95% confidence interval (CI) 2.3-128) . Among the microorganisms which have not usually been regarded as pathogens in the etiology of infant conjunctivitis, Streptococcus mitis was the only microorganism associated with an increased risk of conjunctivitis (OR = 5.3, 95% CI 1.8-15.0) . The findings concerning the species of bacteria most often associated with conjunctivitis, as well as the finding that method of delivery is unimportant, suggest that bacteria were transmitted to the infants' eyes after birth and not from the birth canal.

J Infect Dis, 1993 Sep, 168(3), 663 - 71
Induction of immunologic memory in infants primed with Haemophilus influenzae type b conjugate vaccines; Granoff DM et al.; The ability of different Haemophilus influenzae type b conjugate vaccines to induce immunologic memory was compared in 381 infants who were vaccinated with one of three conjugate vaccines beginning at 2 months of age . All infants were vaccinated with unconjugated type b capsular polysaccharide, polyribosylribitol phosphate (PRP), at 12 months . In each group, high antibody responses were detected by 6-9 days after vaccination . One month after receiving PRP, infants primed with PRP conjugated to the outer membrane protein of Neisseria meningitidis or PRP oligomers conjugated to the cross-reactive mutant diphtheria protein, CRM197, had twofold higher total anti-PRP antibody concentrations than did infants primed with PRP conjugated to tetanus toxoid (P < .005) . After the conjugate and the PRP boost, notable differences were present among vaccine groups with respect to the magnitude of the IgG anti-PRP antibody concentrations and light chain variable region usage as determined by idiotypic analysis . Thus, each of the conjugate vaccines primed infants for the ability to evoke memory antibody responses to PRP, but qualitative and quantitative differences in priming induced by different vaccines may affect their ability to confer protection against disease.

J Pediatr Surg, 1993 Sep, 28(9), 1140 - 3
Giant hydatid lung cysts in the Canadian northwest: outcome of conservative treatment in three children; Lamy AL et al.; Hydatid lung disease due to Echinococcus granulosus in the Canadian northwest and Alaska is often asymptomatic and usually benign . We reviewed the course and outcome of three children with giant hydatid lung cyst seen over a 2-year period . All were North American Indian children aged 9 to 12 years who presented with cough, fever, and chest pain . One had a rash . There was a history of exposure to domestic dogs who had been fed moose entrails in each case . Chest x-rays showed solitary lung cysts with air-fluid levels, from 6 cm to 12 cm in diameter . Aspiration of each cyst demonstrated Echinococcus hooklets and protoscolices . Serology was unhelpful, being negative in two cases . Transient pneumonitis and pneumothorax were seen as complications of needle aspiration . Two cysts gradually resolved over the following 6 months . One child returned after 9 months with a lung abscess due to superimposed infection of the cyst remnant with Haemophilus influenzae, and eventually required lobectomy . The existence of an endemic benign variant of E granulosus in Canada is not widely known, and it is important to distinguish it from the more aggressive pastoral form of the disease seen in immigrants from sheep-rearing countries . The native Canadian disease usually resolves spontaneously, does not cause anaphylaxis, and does not implant daughter cysts if spilled . Surgical treatment should be avoided except for complications such as secondary bacterial infection.

Vet Microbiol, 1993 Sep, 36(3-4), 261 - 71
Optimalization of the detection of NAD dependent Pasteurellaceae from the respiratory tract of slaughterhouse pigs; Moller K et al.; NAD dependent members of the family Pasteurellaceae were cultured from the nasal cavity, surface and cut surface of the tonsils, and from the apical and caudal lobes of the lungs of 303 slaughterhouse pigs from 5 different herds in order to obtain information on the ecology of these bacteria . The specimens were plated on two different selective agar media using a special dilution technique that resulted in a good separation of individual colonies . Bacteriological results were compared with serological and pathological findings . The bacteriological examination demonstrated that NAD dependent Pasteurellaceae belonging to the taxa previously described could be isolated from the surface and cut surface of the tonsils, and from lungs with and without gross pathologic lesions . Haemophilus parasuis was detected mainly from the nasal cavity, and Actinobacillus pleuropneumoniae mainly from the surface and cut surface of the tonsils (42%) . From two herds, 19% and 24% respectively of the animals without antibodies against A . pleuropneumoniae serotypes 1 and 2 harboured the bacteria mainly in the tonsils . This may reflect a very recent infection or may suggest that A . pleuropneumoniae can colonize the tonsils without inducing a serologic reaction . Serological and bacteriological evidence of more than one serotype in the same herd indicates that natural infection with one serotype does not necessarily protect against another.

Microb Pathog, 1993 Sep, 15(3), 159 - 68
Proportion of protein A bindable molecules in human IgM and IgA antibodies to seven antigens; Ibrahim S et al.; Human IgM or IgA antibodies to seven antigens (tetanus and diphtheria toxoids, and five bacterial polysaccharides) were studied by determining what proportion of these antibodies were bound by staphylococcal protein A . This alternative binding is a marker of VH genes of family 3 . Each response was studied in an average of nine individuals . The binding proportion of antibodies to the two toxoids resembled that of total serum immunoglobulins; 13-14% of IgA and 40% of IgM antibodies were bound by protein A . All anti-polysaccharide antibodies had higher proportions of protein A bindable molecules than serum IgM or IgA indicating a bias for VH genes . This excess was high in antibodies to Haemophilus influenzae type b (Hib) and pneumococcal type 14 polysaccharides (> two-fold) . It was moderate but statistically significant in antibodies to pneumococcal types 18C and 3 capsular polysaccharides and to C polysaccharide . All vaccinated Finns exhibited the VH3-preference in antibodies to Hib and type 14 polysaccharide.

Acta Otolaryngol, 1993 Sep, 113(5), 668 - 72
Quantitative bacterial culture from adenoid lymphatic tissue with special reference to Haemophilus {corrected}; Forsgren J et al.; Homogenized adenoid tissue from 55 children (28-153 months) undergoing adenoidectomy because of nasopharyngeal obstruction was investigated by means of quantitative aerobic bacterial culture . The children were divided into two groups, the hypertrophy alone group--AH (n = 29)--and the hypertrophy with longstanding secretory otitis media group--SOM (n = 26) . A nasopharyngeal culture was obtained preoperatively from 38 of the cases . Non-typeable H . influenzae (NTHI) was found in twice as many cases in the AH group as in the SOM group, 21/29 (72%) compared to 11/26 (42%) (p < 0.05) and in a significantly higher mean concentrations, 5.7 x 10(5) CFU/g compared to 1.9 x 10(5) CFU/g (p = 0.02) . For the other aerobic potentially pathogenic bacteria no such difference was found . The bulk of the NTHI-positive cases and the cases with the highest concentrations were found in the children below the age of 6 years . In the nasopharyngeal cultures NTHI alone or together with S . pneumoniae and/or B . catarrhalis was found in 29% of the cases in both the AH group and SOM group . NTHI was found in only 50% of the nasopharyngeal cultures corresponding to a positive quantitative culture (10/20) . These findings suggest that NTHI is harboured within the adenoid and could thereby chronically stimulate the local immune defense . However, the present study indicates that there is no aerobic bacterial overload in the adenoid tissue in children with SOM compared to children without middle-ear disease.

Pathol Biol (Paris), 1993 Sep, 41(7), 641 - 6
{Evaluation of in vitro activity of pristinamycin against Haemophilus influenzae}; Dabernat H; The activity of pristinamycin against H . influenzae was evaluated using various in vitro tests . Minimal inhibitory concentrations (MICs) were determined by an agar dilution method . The range of MICs was from 0.25 mg/l to 8 mg/l . MIC 50 was 2 mg/l; MIC 90 was 4 mg/l . The activity of component pristinamycin II (PII) is similar to that of pristinamycin and superior to that of component pristinamycin I (PI) . Minimal bactericidal concentrations (MBCs) were equal to or two times higher than MICs . Killing curves showed a bactericidal activity obtained after 6 hours at MIC x 2 and MIC x 4 of pristinamycin . Component PII exhibited a bactericidal activity at MIC x 4 . The post-antibiotic effect was high with pristinamycin: after two hours of contact with the antibiotic, PAEs were 2 hours with 1 mg/l, from 4 to 6.8 hours with 2 mg/l, and 6.7 hours with 4 mg/l . The PAEs with component PII were from 1 hour to 2 hours at concentrations of 1, 2, or 4 mg/l . Antibiotic resistance to various antibiotics did not influence the antibacterial activity of pristinamycin . At a breakpoint < or = 2 mg/l, more than 85% of the strains were sensitive to pristinamycin . The unimodal distribution of the strains showed the lack of acquired resistance to pristinamycin in these bacterial species.

Pathol Biol (Paris), 1993 Sep, 41(7), 596 - 603
{Study of susceptibility of Haemophilus influenzae to antibiotics (other than beta-lactams) by using HTM gelose (Haemophilus test medium)}; Dabernat H et al.; HTM agar was used for in vitro study for antibiotics activity (other than beta-lactams) on H . influenzae . Tested strains belong to various phenotypes . The zone-size breakpoints were determined according to breakpoints concentrations, distribution of bacterial populations and mechanism of resistance . The following zone-size breakpoints could be suggested: chloramphenicol (30 micrograms) > or = 28 and < 24 mm; kanamycin (30 UI) > or = 18 and < 15 mm; gentamicin (10 UI) > or = 16 and < 14 mm; tetracycline (30 UI) > or = 23 and < 18 mm; doxycycline (30 UI) > or = 20 and < 14 mm; minocycline (30 UI) > or = 20 mm; rifampicin (30 micrograms) > or = 24 and < 20 mm; pristinamycin (15 micrograms) > or = 20 mm; erythromycin (15 UI) > or = 22 and < 18 mm; ciprofloxacin (5 micrograms) > or = 30 mm; trimethoprim and co-trimoxazole > or = 24 and < 20 mm.

Pathol Biol (Paris), 1993 Sep, 41(7), 589 - 95
{Study of susceptibility of Haemophilus influenzae to beta-lactams by using HTM gelose (Haemophilus test medium)}; Dabernat H et al.; HTM agar was used for in vitro study of beta-lactam antibiotics activity on H . influenzae . Tested strains belong to the three ampicillin phenotypes: sensitive, betalactamase production and ampicillin resistance without production of betalactamase . Using 2 micrograms ampicillin disk, diameters > or = 20 mm and < 20 mm separate ampicillin sensitive and resistant strains . The following zone-size breakpoints could be suggested: ampicillin (10 micrograms) > or = 25 and < 22 mm; amoxicillin (25 micrograms) > or = 26 mm and < 23 mm; ampicillin/sulbactam (10/10 micrograms) > or = 25 mm and < 22 mm; amoxicillin/clavulanic acid (20/10 micrograms) > or = 26 mm and < 23 mm; cefaclor (30 micrograms) > or = 25 mm and < 20 mm; cefuroxime (10 micrograms) > or = 22 mm and < 19 mm; cefixime (10 micrograms) and cefpodoxime (10 micrograms) > or = 26 mm; cefotaxime (30 micrograms) et ceftriaxone (30 micrograms) > or = 30 mm . The zone-size breakpoints concentrations, distribution of bacterial populations, mechanisms of resistance . In vitro study may screen for ampicillin resistance mechanisms.

Pharmacotherapy, 1993 Sep-Oct, 13(5), 415 - 39
Neglected pathogens: bacterial infections in persons with human immunodeficiency virus infection . A review of the literature (1); Fish DN et al.; Bacterial infections, including those that cause infection in the healthy host as well as those that are more opportunistic, occur very commonly among persons infected with the human immunodeficiency virus (HIV) . Bacterial infections are a direct result of the severe humoral and cellular immune defects found in these patients . Epidemiologic factors such as intravenous drug use and stage of HIV infection may also play important roles . Pulmonary, bloodstream, gastrointestinal, central nervous system, skin and soft tissue, and catheter-related infections are common, as are endocarditis, prostatitis, and others . Frequently reported pathogens are common organisms such as Staphylococcus aureus, Haemophilus influenzae, Streptococcus pneumoniae, and enteric gram-negative pathogens, as well as less typical ones such as Listeria monocytogenes and Nocardia sp . The frequency of infection is specific to organ system and pathogen, often being many times higher than in immunocompetent hosts . Prompt recognition and aggressive therapy are required to reduce morbidity and mortality due to these infections.

Orthop Rev, 1993 Sep, 22(9), 1027 - 32
Acute transphyseal hematogenous osteomyelitis caused by Haemophilus influenzae with 5-year follow-up; Cramer KE et al.; Acute hematogenous osteomyelitis is a well-recognized entity in infants and children . Over 90% of cases are caused by coagulase-positive Staphylococcus aureus, with other organisms only rarely implicated . Transepiphyseal osteomyelitis, because of the presence of infection on either side of the physis, usually results in growth arrest . The authors report the case of a 4-month-old child who had a transphyseal acute hematogenous osteomyelitis caused by Haemophilus influenzae and document complete resolution of the infection at 5-year follow-up with no clinical or radiographic evidence of growth arrest.

J Gen Microbiol, 1993 Sep, 139 ( Pt 9), 2135 - 43
Molecular analysis of a gene encoding a serum-resistance-associated 76 kDa surface antigen of Haemophilus somnus; Cole SP et al.; Haemophilus somnus is a Gram-negative bacterial bovine pathogen which can cause disease or be carried asymptomatically . We previously showed that four serum-sensitive isolates from asymptomatic carriers lacked a 13.4 kb sequence of chromosomal DNA that was present in two virulent serum-resistant strains . We have since sequenced 5 kb of the 13.4 kb fragment from a serum-resistant strain, which contained an open reading frame (ORF) of at least 4.5 kb . From Western blot analysis, the ORF was shown to encode a 76 kDa protein (p76) that co-migrated with a 76 kDa H . somnus surface protein . Both the recombinant and natural p76 reacted with convalescent-phase serum from a cow in an experimental H . somnus abortion study . The translational start site for p76 was identified by deletion analysis of subclones of the 5 kb cloned sequence . The 4.5 kb ORF contained 1.2 kb tandem direct repeats (DRs), with 65% identity between the two repeats at the protein level . The 5' DR (DR1) included the start site for the 76 kDa protein, and DR2 had a flanking inverted repeat, suggestive of an insertion-sequence-like element.

Acta Paediatr, 1993 Sep, 82(9), 744 - 7
Hereditary properdin deficiency in three families of Tunisian Jews; Schlesinger M et al.; Hereditary properdin deficiency is a rare genetic disorder of the complement system . Three propositi and six additional family members with properdin deficiency have been found following analysis of the hemolytic activity of the classical (CH50) and the alternative (AP50) complement pathways in the sera of 101 survivors of meningococcal infections and 59 survivors of severe pneumococcal and Haemophilus influenza infections . All the properdin-deficient individuals had undetectable levels of properdin by radial immunodiffusion and by Western blotting . They belonged to three non-related families of Tunisian Jews who came from different parts of Tunisia . Two patients had a meningococcal infection at 15 and 16 years of age, respectively, and one had Haemophilus influenza meningitis at 1.5 years of age . In contrast to the fulminant and fatal course of meningococcal infection which was previously described in some properdin-deficient patients, our patients had a relatively mild disease . Properdin deficiency may not be as rare as previously thought . Analysis of AP50, in addition to CH50, in sera of patients who had meningococcal infection, will probably disclose many more cases of hereditary properdin deficiency . In addition, our findings indicate that, as in other complement abnormalities, hereditary properdin deficiency may also be associated with the ethnic origin of the patient.

Am J Perinatol, 1993 Sep, 10(5), 378 - 80
Three cases of Haemophilus influenzae amnionitis; Ault KA et al.; Haemophilus influenzae is an uncommon cause of obstetric and neonatal infections . Three cases of amnionitis caused by H . influenzae are presented . These cases occurred in three maternal transports to our tertiary level hospital within an 11-day period . The organisms were analyzed for biotypes, penicillinase status, and composition of membrane fatty acids.

Antimicrob Agents Chemother, 1993 Sep, 37(9), 1986 - 8
Comparison of the in vitro activities of various parenteral and oral antimicrobial agents against endemic Haemophilus ducreyi; Aldridge KE et al.; The in vitro susceptibilities to various antimicrobial agents of 100 strains of beta-lactamase-producing Haemophilus ducreyi recently isolated from patients in New Orleans, La., were determined by an agar dilution method . All strains were highly susceptible to ceftizoxime, ceftriaxone, ceftazidime, azithromycin, erythromycin, ciprofloxacin, and sparfloxacin . beta-Lactam-beta-lactamase inhibitor combinations were less active, but all strains were susceptible to them . Doxycycline exhibited the poorest activity, and the rate of resistance to doxycycline varied depending on the time after inoculation that the MIC was determined.

Clin Infect Dis, 1993 Sep, 17(3), 389 - 96
Invasive Haemophilus influenzae infections in older children and adults in Seattle; Kostman JR et al.; We recently saw two unusual manifestations of Haemophilus influenzae infection in adults in the Seattle area: fulminant sepsis in an otherwise-healthy man and three episodes of bacteremia in a woman with chronic liver disease . We retrospectively identified 79 bacteremic and 40 non-bacteremic cases of invasive H . influenzae infection developing in patients > or = 9 years of age between 1 January 1980 and 31 December 1990 . The most common clinical presentations among patients with bacteremia included pneumonia (52%), septicemia (27%), meningitis (8%), gynecologic infection (5%), and epiglottitis (5%) . Underlying illnesses were common in these patients, and overall mortality was 35.5% . Factors associated with mortality included underlying neurological disease, polymicrobial bacteremia, and advanced age . The clinical presentations of the 40 patients without bacteremia included soft-tissue abscesses (45%), lung abscesses (18%), peritonitis (13%), meningitis (8%), gynecologic infection (8%), epididymitis (5%), mastoiditis (3%), and osteomyelitis (3%) . Thus H . influenzae disease has a variety of presentations and is associated with significant mortality in older children and adults . Further study is required to determine whether widespread administration of H . influenzae type b conjugate vaccine to infants will alter the development of subsequent disease in later life.

J Infect Dis, 1993 Sep, 168(3), 672 - 80
Relationship between colony morphology and the life cycle of Haemophilus influenzae: the contribution of lipopolysaccharide phase variation to pathogenesis; Weiser JN; Colonies of Haemophilus influenzae are heterogeneous in appearance because of phase variation in opacity . The only cell surface component found to have structural variation correlating with differences in opacity was the lipopolysaccharide (LPS) . Changes in LPS structure, seen as migration patterns on tricine-SDS-PAGE, appeared to be independent of a previously described mechanism for generating LPS phase variation . The more transparent variants expressing a higher-molecular-weight LPS were serum sensitive and could efficiently colonize the infant rat nasopharynx after intranasal inoculation . In contrast, the fully opaque variant expressing a smaller-molecular-weight LPS was serum resistant, unable to colonize the nasopharynx, and more virulent when intraperitoneally administered . Organisms disseminating into the blood-stream from the nasopharynx changed phenotype from transparent to opaque . These findings demonstrate the potential importance of LPS structures that determine opacity in pathogenesis and colonization of mucosal surfaces.

P N G Med J, 1993 Sep, 36(3), 234 - 42
The epidemiology of bacterial meningitis occurring in a Pacific Island population; Carroll K et al.; During a 36-month period 83 cases of bacterial meningitis were seen, giving an overall annual incidence rate of 134 per 10(5) population . The highest incidence was seen in infants (930 per 10(5) infants) and 59% of the patients were 0-5 years of age (incidence rate 207 per 10(5) children) . Pathogens were successfully identified in 80% of the cases, by employing a combination of microscopy and antigen detection using a commercially available latex agglutination kit . Neisseria meningitidis was identified in 58%, Streptococcus pneumoniae in 29%, Haemophilus influenzae type b in 11% and dual infection with H . influenzae type b and S . pneumoniae in 3% of the cases . Serogrouping was successfully performed on cerebrospinal fluid (CSF) deposits from 8 cases of meningococcal meningitis; 7 belonged to serogroup C and 1 to serogroup Y . There was a significant difference in the geometric mean age of meningitis caused by the three organisms . There was no seasonal or geographical clustering of cases caused by N . meningitidis . Although admissions for severe pneumonia in children less than 5 years of age peaked during the cold dry season (July-October), this was not associated with a similar peak in meningitis admissions caused by H . influenzae or S . pneumoniae . The overall case fatality rate was 15.7%, and the highest case fatality rate was found in infants (28%) . Meningitis caused by H . influenzae was associated with the highest case fatality rate (29%) and N . meningitidis with the lowest (8%), but the difference was not statistically significant.(ABSTRACT TRUNCATED AT 250 WORDS)

Cent Afr J Med, 1993 Sep, 39(9), 188 - 92
Adult response to initial treatment with ampicillin in community acquired pneumonia in Yaoundé, Cameroon; Koulla-Shiro S et al.; A prospective study was conducted to evaluate the efficacy of ampicillin as an initial therapy in 60 adult patients with community acquired pneumonia . Bacteriological etiology was obtained only in 24 (40pc) patients by microscopic examination, culture and antigen detection . Streptococcus pneumoniae was the leading causative agent identified in 15 cases . Other etiologies were Klebsiella pneumoniae (3), Streptococcus pyogenes (2) Staphylococcus aureus (2), Haemophilus influenzae (1) and Moraxella catarrhails (1) . Patients were started on ampicillin one gram twice daily, empirically, and treated for 10 days . There were 52(86.7pc) patients cured, two(3.3pc) patients improved and six (10pc) were therapeutic failures . The causative agents in patients with failures were: Klebsiella pneumoniae (1), Staphylococcus aureus (1), Streptococcus pneumoniae (1) and unknown in three cases . Only six of 60 patients still febrile after three days were switched to amoxycillin/clavulanic acid or cefaclor according to culture results and susceptibilities or to roxythromycin because no organisms were isolated . Side effects were observed in only one (1.7pc) patient who developed a mild skin rash . Due to its low cost and its high efficacy, ampicillin still appears to be the drug of choice in adult community acquired pneumonia in our region.

Onderstepoort J Vet Res, 1993 Sep, 60(3), 181 - 7
Monoclonal antibody characterization of South African field isolates of Haemophilus paragallinarum; Bragg RR et al.; A total of 27 different isolates of Haemophilus paragallinarum were made from chickens between June 1991 and December 1992 . All of these isolates were examined by ELISA, by means of a locally produced panel of three monoclonal antibodies (denoted F1, V1 and VF3) . The isolates were all of the F1 antigenic type . Three of them showed a weak reaction with the F1 monoclonal antibody, while three other isolates reacted strongly with the F1 as well as with the VF3 Mab . A selection of stored Haemophilus isolates, dating from 1984 to 1985, were also examined with the Mabs and found to be of the F1 antigenic type . Fifteen isolates were collected before 1974, i.e . before the use of Haemophilus vaccines in this country . The majority of them were of the F1 antigenic grouping . Some showed a weak reaction with the F1 Mab; others showed a strong reaction with both the F1 and VF3 Mabs; and a few showed no significant reaction with any of the Mabs used . Strains used for the production of infectious coryza vaccine were also examined with the Mabs . Strain 0083 showed a stronger reaction with the V1 Mab than with the F1 Mab, whereas strain 0222 showed no reaction with any of the Mabs . None of the SA field isolates collected since the use of vaccines exhibits the V1 antigenicity, which is the prevalent antigen of strain 0083 . Most (80%) of the SA field isolates showed a stronger reaction with the F1 Mab than did strain 0083 . Antigenically silent isolates similar to 0222 (Page's serotype B) were isolated before the use of vaccines, but not since.

Drugs, 1993 Sep, 46(3), 378 - 83
Rational use of Haemophilus influenzae type b vaccine; Campbell H et al.; Haemophilus influenzae type b (Hib) is a major cause of serious bacterial infection in early childhood . In many developed countries it is the commonest cause of bacterial meningitis in children under 5 years of age . Serum antibodies to the polyribosylribitol phosphate (PRP) capsule, the main virulence factor of Hib, are protective, but the early vaccines containing purified PRP were poorly immunogenic in young children . However, 'second generation' protein conjugate vaccines have been shown to be immunogenic, effective and safe in young children . No serious adverse reactions to Hib vaccine have been reported to date . Clinically, the vaccine is indicated in the first few months of life and can be given at the same time as a primary course of diphtheria, pertussis and tetanus (DPT) immunisation . The vaccine should be given by deep subcutaneous or intramuscular injection . The only specific contraindication is a history of severe local reaction or a general reaction to previous Hib vaccination . Routine immunisation of infants under 6 months of age against Hib has become part of the regular primary schedule in many countries . In Finland this has resulted in a dramatic decline in Hib meningitis.

Monatsschr Kinderheilkd, 1993 Sep, 141(9), 732 - 5
{Value of dexamethasone therapy in bacterial meningitis}; van Wees J et al.; Due to growing understanding of pathophysiological mechanisms in acute inflammation new strategies for treatment of bacterial meningitis have been developed . The use of dexamethasone as adjunctive therapy for bacterial meningitis during the first 4 days (0.15 mg per kilogram body weight every six hours 30 min before antibiotic treatment for four days) showed a significantly reduce of neurologic sequelae in four clinical studies . A reduction of case fatality rate in more severe cases down to 50% was observed . In regard of these results the American academy of infectious diseases recommends since 1991 for children from the age of 3 month with Haemophilus influenzae meningitis a therapy regime as above.

Infect Immun, 1993 Sep, 61(9), 3966 - 75
Reconstitution of a porin-deficient mutant of Haemophilus influenzae type b with a porin gene from nontypeable H . influenzae; Sanders JD et al.; The major outer membrane protein (OmpP2) of nontypeable Haemophilus influenzae (NTHI) has been shown to vary markedly with respect to both size and the presence of specific surface-exposed epitopes among strains of this unencapsulated pathogen . In contrast, the OmpP2 proteins of H . influenzae type b (Hib) strains are well conserved at the level of primary protein structure and have in common several surface-exposed antigenic determinants that have not been detected in NTHI strains . The availability of an isogenic, avirulent Hib ompP2 mutant made it possible to investigate whether an NTHI OmpP2 protein could function properly in the Hib outer membrane . A plasmid shuttle vector (pGJB103) was used to clone the ompP2 gene from NTHI TN106 into a recombination-deficient H . influenzae strain in which expression of the NTHI OmpP2 protein was detected by means of an NTHI TN106 OmpP2-specific monoclonal antibody . The amino acid sequence of this NTHI OmpP2 protein, as deduced from the nucleotide sequence of the NTHI TN106 ompP2 gene, was determined to be 83% identical to that of the Hib OmpP2 protein . Transformation of this cloned NTHI ompP2 gene into the Hib ompP2 mutant yielded a Hib transformant strain that expressed the NTHI OmpP2 protein . Expression of this NTHI OmpP2 protein allowed the Hib ompP2 mutant, which normally grows poorly in vitro, to grow in a manner indistinguishable from that of the wild-type Hib strain . More importantly, the introduction of this functional NTHI ompP2 gene into the avirulent Hib ompP2 mutant restored the virulence of this strain to wild-type levels . These results indicate that an NTHI OmpP2 protein can be expressed and function properly in the Hib outer membrane.

Mol Microbiol, 1993 Sep, 9(6), 1275 - 82
The role of a repetitive DNA motif (5'-CAAT-3') in the variable expression of the Haemophilus influenzae lipopolysaccharide epitope alpha Gal(1-4)beta Gal; High NJ et al.; Haemophilus influenzae lipopolysaccharide (LPS) contains structures, defined by monoclonal antibodies, which undergo phase variation . This investigation reports the nucleotide sequence of lic2A, which is required for the expression of at least three phase-variable LPS epitopes, one of which has the structure alpha Gal(1-4)beta Gal . lic2A contains multiple tandem repeats of the tetramer 5'-CAAT-3' . Previous studies have correlated changes in the number of 5'-CAAT-3' repeats with the phase-variable expression of the alpha Gal(1-4)beta Gal epitope . To obtain direct evidence for this, the 5'-CAAT-3' repeat region from lic2A was amplified directly from immunostained colonies and sequenced . This demonstrated that the variable expression of LPS epitopes, including alpha Gal(1-4)beta Gal, is in part directly dependent upon the number of copies of 5'-CAAT-3' within lic2A.

Carbohydr Res, 1993 Aug 17, 246, 319 - 30
Structural studies of the saccharide part of the cell envelope lipopolysaccharide from Haemophilus influenzae strain AH1-3 (lic3+); Schweda EK et al.; The structure of the saccharide part of the lipopolysaccharide from Haemophilus influenzae strain AH1-3 (lic3+) has been investigated . The saccharide was obtained from the lipopolysaccharide by mild acid hydrolysis followed by high-performance anion-exchange chromatography, and isolated fractions were studied by methylation analysis, NMR spectroscopy, and FAB mass spectrometry . The major saccharide is a heptasaccharide with the following structure, {formula: see text} in which Kdo is 3-deoxy-D-manno-oct-2-ulosonic acid and PEA is 2-aminoethyl phosphate . Hep is identified as L-glycero-D-manno-heptose . The absolute configuration of the phosphorylated heptose is tentative only.

Pediatr Infect Dis J, 1993 Aug, 12(8), 638 - 43
Haemophilus influenzae type b polysaccharide-tetanus protein conjugate vaccine does not depress serologic responses to diphtheria, tetanus or pertussis antigens when coadministered in the same syringe with diphtheria-tetanus-pertussis vaccine at two, four and six months of age; Avendano A et al.; The safety and immunogenicity of a vaccine against Haemophilus influenzae type b consisting of purified polyribosylribitol phosphate conjugated to tetanus toxoid (PRP-T) were evaluated in 277 Chilean infants who were randomly assigned to one of three treatment groups: Group A, PRP-T mixed with diphtheria-tetanus-pertussis (DTP) vaccine in a single syringe and given as a single inoculation in one arm and placebo in the other arm; Group B, PRP-T given in one arm and DTP in the other arm; Group C, DTP given in one arm and placebo in the other . Infants were immunized at 2, 4 and 6 months of age and examined daily for 4 days after each immunization . Serum PRP antibodies; tetanus, diphtheria and pertussis antitoxin; pertussis agglutinins; and antibodies to Bordetella pertussis filamentous hemagglutinin were measured at baseline and 2 months after each dose . PRP-T was well-tolerated . After three doses of PRP-T vaccine 100% of infants attained PRP antibody concentrations > or = 0.15 micrograms/ml and 96 to 99% achieved high anti-PRP concentrations (> or = 1.0 micrograms/ml) . The post-third dose anti-PRP geometric mean titer was high (6.94 micrograms/ml) in infants who were given PRP-T combined with DTP, although it was somewhat lower than the geometric mean titer of the group who received PRP-T in a separate arm (9.93 micrograms/ml) (P not significant).(ABSTRACT TRUNCATED AT 250 WORDS)

Pediatr Infect Dis J, 1993 Aug, 12(8), 632 - 7
Safety and immunogenicity of Haemophilus influenzae type B-Neisseria meningitidis group B outer membrane protein complex conjugate vaccine mixed in the syringe with diphtheria-tetanus-pertussis vaccine in young Gambian infants; Mulholland EK et al.; To ensure compliance and to reduce costs it is important, especially in less developed countries, that programs of child immunization should require as few clinic attendances and as few injections as possible . Therefore we have investigated whether a Haemophilus influenzae type b conjugate vaccine could be given safely and effectively with diphtheria-tetanus-pertussis vaccine (DTP) . One hundred twenty-six Gambian infants were given both polyribosylribitol phosphate (PRP)-outer membrane protein complex (PedvaxHIB) and DTP on the same day at 8, 12 and 16 weeks of age; 60 were given the vaccines mixed in the syringe and 66 were given the vaccines separately . To minimize the injection volume the dose of PRP-OMPC used in both groups was 7.5 micrograms, which is half the usual dose . There were no significant differences in anti-PRP antibody titers between the groups after 1, 2 or 3 doses . The geometric mean titers of antibody for the two groups combined were 0.29 micrograms/ml 1 month after the first dose, 1.03 micrograms/ml after the second dose and 1.11 micrograms/ml after the third dose . Concentrations of antibodies to diphtheria, tetanus and pertussis 1 month after the third dose were not significantly different between the two groups . Systemic side effects were reported with equal frequency in the two groups and were similar to those reported elsewhere for DTP . Tenderness at the injection site was more common where the combined injection (0.75 ml) had been given than where DTP alone (0.5 ml) had been given . The main drawback to the use of these 2 vaccines together is the complexity of the mixing procedure used in this clinical trial.

Kinderarztl Prax, 1993 Aug, 61(6), 189 - 91
{Hemophilus influenzae infection and their prevention by vaccination}; Scholz H et al.; Encapsulated and non-encapsulated strains of haemophilus influenzae are known to exist . The encapsulated ones, especially those of type B (HiB), are highly invasive . Hib may cause, among other diseases, purulent meningitis, epiglottitis, septic arthritis/osteomyelitis and pneumonia . These diseases can be prevented by timely vaccination . The non-encapsulated haemophilus ionfluenzae strains often produce colonisation of the nasopharyngeal space and inflammation of the mucosa of the airways . They are often pathogens of otitis media, sinusitis, bronchitis and pneumonia . These diseases cannot be prevented by HiB vaccination.

J Dairy Sci, 1993 Aug, 76(8), 2418 - 36
Recent advances in bovine vaccine technology; Yancey RJ Jr; A description of new commercial and experimental vaccines for viral and bacterial diseases of cattle can be broadly divided into those used for both beef and dairy cows and those used predominantly in dairy cattle . For both types of cattle, newer and experimental vaccines are directed against several of the important viral (e.g., bovine herpesvirus 1, bovine viral diarrhea virus, bovine respiratory syncytial virus, parainfluenza type 3, and foot-and-mouth disease virus) and bacterial pathogens (e.g., Pasteurella spp., Haemophilus somnus) . The viral vaccines include gene-deleted, modified live, subunit, and peptide antigens . Newer bacterial vaccines, particularly those for Pasteurella spp., are composed of either modified-live vaccines or bacterins supplemented with toxoid or surface antigens . Haemophilus somnus vaccine research has concentrated mainly on defining unique surface antigens . Novel dairy cow vaccines would include the lipopolysaccharide-core (J5) antigen approach, which has been used for successful immunization against coliform mastitis . Core antigen vaccines also have reduced calf mortality from Gram-negative pathogens . Staphylococcal mastitis vaccines that contain capsular antigens, toxoids, or the staphylococcal fibronectin receptor are of active research interest . Vaccines against mastitis induced by Streptococcus agalactiae and Streptococcus uberis also are areas of intensive research . Delivery of multiple subunit antigens with optimal immune response induction has led to the investigation of attenuated heterologous viral and bacterial expression vectors such as bovine herpesvirus 1, vaccinia, and Salmonella spp . This discussion also demonstrates that molecular biology is being used to advance bovine vaccine technology.

Clin Infect Dis, 1993 Aug, 17 Suppl 1, S250 - 3
Unique susceptibility of patients with antibody deficiency to mycoplasma infection; Gelfand EW; Patients with congenital or acquired disorders of antibody production suffer from a wide variety of infections . They are most often bacterial and due to Haemophilus influenzae or Streptococcus pneumoniae . Chronic pulmonary disease accounts for most of the deaths . While non-urogenital tract infections due to Ureaplasma urealyticum or other mycoplasmas are unusual in individuals with normal resistance, patients with antibody deficiency demonstrate a unique susceptibility . With increasing frequency, patients with impaired humoral immunity have been shown to have a mycoplasmal infection that results in pneumonitis, sinusitis, cystitis, arthritis, osteomyelitis, or cellulitis . The mycoplasmas may be responsible for chronic sinopulmonary disease in a majority of such patients . Awareness of the role these organisms play in causing infection in antibody-deficient patients and the institution of appropriate antibiotic therapy will contribute to an improvement in clinical outcome.

J Bacteriol, 1993 Aug, 175(16), 5265 - 7
Cloning and characterization of the Haemophilus influenzae mutB gene; Stuy JH et al.; The Haemophilus influenzae mutB+ gene complements Escherichia coli uvrD mutants . The E . coli uvrD+ gene complements H . influenzae mutB1 mutants.

Am J Obstet Gynecol, 1993 Aug, 169(2 Pt 2), 474 - 8
Historical review of the treatment of bacterial vaginosis; Ledger WJ; The review of the treatment of bacterial vaginosis parallels the history of this syndrome . Before the syndrome was defined, treatment was local and nonspecific . Gardner and Dukes defined nonspecific vaginitis in 1955 as an infection caused by Haemophilus vaginalis . Therapy was directed toward this aerobic "pathogen" and included oral tetracycline and a triple sulfa vaginal cream . Subsequent studies indicated success with this regimen as well as with ampicillin, a drug with good aerobic activity . Since 1977, studies have shown the importance of anaerobes in this clinical syndrome . Both metronidazole and clindamycin have been found to have clinical success . The clinical definition of the disease makes evaluation of treatment difficult, because it includes women without symptoms.

Am J Dis Child, 1993 Aug, 147(8), 832 - 6
Immunogenicity of Haemophilus influenzae type b polysaccharide-tetanus toxoid conjugate vaccine in infants; Holmes SJ et al.; OBJECTIVE--To compare the safety and immunogenicity of three investigational lots of Haemophilus influenzae type b polysaccharide-tetanus toxoid (PRP-T) conjugate vaccine in infants . DESIGN--A multicenter, randomized immunogenicity trial . Infants were vaccinated at 2, 4, and 6 months of age with one of three lots of PRP-T . A control group received H influenzae type b oligomers conjugated to CRM197 (HbOC) . Serum was obtained before each injection and 1 month after the third dose, and assayed blindly for antibody in one laboratory . SUBJECTS--Four hundred eighty-four infants from private pediatric practices located in five geographic areas . MEASUREMENTS AND RESULTS--There were no significant differences in the number of adverse events reported for infants receiving PRP-T or HbOC, and the rates did not exceed those observed previously in infants given diphtheria-tetanus-pertussis vaccine alone . Total serum anti-PRP antibody responses were analyzed in 336 infants who met strict inclusion criteria . After one, two, or three doses, the respective antibody responses to each of the three lots of PRP-T and to HbOC vaccine were similar . The only exception was one lot of PRP-T, which after one or two injections elicited significantly higher geometric mean antibody responses than the other two lots or the HbOC vaccine . After a third injection, there were no significant lot differences . Combining the data from the different lots, there were no significant differences in the geometric mean antibody concentration after three doses of PRP-T or HbOC (8.3 vs 7.7 micrograms/mL), and 95% and 91%, respectively, of infants had greater than 1.0 microgram/mL of antibody . There were no significant differences in the magnitudes of the respective IgG1-, IgG2-, and IgM-specific antibody concentrations between infants given PRP-T or HbOC . CONCLUSIONS--The three investigational lots of PRP-T tested were safe and were as immunogenic as or more so than the licensed HbOC conjugate vaccine.

J Bacteriol, 1993 Aug, 175(16), 5273 - 5
The outer membranes of Brucella spp . are not barriers to hydrophobic permeants; Martinez de Tejada G et al.; The patterns of susceptibility to hydrophobic and hydrophilic drugs and the uptake of the fluorescent probe N-phenyl-naphthylamine in Brucella spp., Haemophilus influenzae, Escherichia coli, and deep rough Salmonella minnesota mutants were compared . The results show that the outer membranes of smooth and naturally rough Brucella spp . do not represent barriers to hydrophobic permeants and that this absence of a barrier relates at least in part to the properties of Brucella lipopolysaccharide.

Epidemiol Infect, 1993 Aug, 111(1), 89 - 98
An analysis of the diversity of Haemophilus parainfluenzae in the adult human respiratory tract by genomic DNA fingerprinting; Kerr GR et al.; A method for typing Haemophilus species is described, based on the analysis of genomic DNA from Haemophilus parainfluenzae . The DNA was extracted by a rapid method and digested with the restriction enzyme BamHI to provide a characteristic 'fingerprint' . The pattern of fragments in the ranges 1-1.6 kb, 1.6-2 kb and 2-3 kb were used to produce a numerical profile of each isolate . In total 97 isolates were examined; 88 from throat swab material isolated from the 15 members of a British Antarctic Survey base and 9 type strains . Seventy-two of the 88 antarctic isolates were H . parainfluenzae and were found to be very diverse, comprising 41 identifiable strains with up to 5 strains being isolated from a single throat swab sample . There was evidence for both carriage and transmission within the isolated community . The technique provided a highly discriminatory method for characterizing Haemophilus strains which is suitable for epidemiological studies.

Clin Exp Immunol, 1993 Aug, 93(2), 157 - 64
The acquisition of anti-pneumococcal capsular polysaccharide Haemophilus influenzae type b and tetanus toxoid antibodies, with age, in the UK; Hazlewood M et al.; Antibody levels specific for capsular polysaccharides of Streptococcus pneumoniae and Haemophilus influenzae type b (Hib) and to tetanus toxoid (TT), were measured in serum samples of 750 age-stratified subjects from the UK . The study subjects comprised healthy adult volunteers and hospitalized children undergoing elective surgery, excluding those with a history of infection or under investigation for immunological or haematological disorders . These antibody levels were calibrated by comparison with serum pool obtained from healthy adult volunteers, who were immunized with Hib polyribose-phosphate vaccine (Merieux) . The data are intended to provide reference ranges to assist in the interpretation of specific antibody measurements in the clinical setting . Maternal IgG pneumococcal capsular polysaccharide (PCP) specific antibody levels, geometric-mean titre (GMT) 1/22, were lost by 6 months of age (GMT of 1/9) . They remained low until 3-5 years (GMT of 1/20), and consisted principally of IgG1 . Thereafter, IgG anti-PCP antibody titres increased steadily to adult levels (GMT of 1/275), of which 80% was IgG2 . Anti-PCP antibody titres of the IgM isotype rose steadily from a GMT 1/21 (0-6 months) to 1/420 (3-5 years), a level which was maintained until adulthood . Anti-Hib antibody concentrations, determined by RABA, again demonstrated the decline in maternal antibody, from 0.18 micrograms/ml in the 0-6 month age cohort, to 0.09 microgram/ml between 6 and 12 months . Geometric-mean antibody concentrations remained below 0.2 micrograms/ml until 3-5 years, then increased with age, attaining the mean adult level of 1.02 micrograms/ml . Anti-TT antibody concentrations were measured in the same sera, by ELISA . Two peaks in anti-TT antibody levels were seen in children of 0.059 IU/ml and 0.166 IU/ml corresponding to the schedule of routine childhood immunization in the first year and at 5 years of age.

Arch Otolaryngol Head Neck Surg, 1993 Aug, 119(8), 821 - 9
Bacteriology and immunology of normal and diseased adenoids in children; Brodsky L et al.; Adenoid physiology as reflected in the qualitative and quantitative bacteriology and immune cell distribution was correlated with clinical presentation in 69 children (16 to 130 months of age) undergoing adenoidectomy for obstructive adenoid hyperplasia (n = 38) or chronic adenoid infection (n = 31) and in 16 adenoid core biopsy specimens from 16 nondiseased controls . In the control adenoids, few potentially pathogenic bacteria were found as the dominant bacteria in the adenoid core (25%), and significantly greater concentrations of nonpathogens (commensals) were isolated (P < .01) . Potential pathogens as the dominant bacteria were found twice as often in obstructive adenoid hyperplasia (62%) and in chronic adenoid infection (55%) (P < .05) . Haemophilus influenzae was most common in the diseased adenoids, 53% in obstructive adenoid hyperplasia and 48% in chronic adenoid infection, compared with only 19% in the controls (P < .05) . No significant differences in lymphocyte density, B and T cells, as well as T-helper subsets, were found between clinical classifications . However, T-suppressor cells, monocytes-macrophages, and natural killer cells were significantly increased in chronic adenoid infection only (P < .05) . The findings in this study support roles for both alterations in bacterial homeostasis and an altered immune profile in the etiology of chronic adenoid disease in children.

Pediatrics, 1993 Aug, 92(2), 272 - 9
Effectiveness and safety of an Haemophilus influenzae type b conjugate vaccine (PRP-T) in young infants . Kaiser-UCLA Vaccine Study Group; Vadheim CM et al.; OBJECTIVE . To study the safety, immunogenicity, and protective efficacy of the Haemophilus influenzae capsular polysaccharide tetanus conjugate vaccine (PRP-T) . DESIGN . Randomized, double-blind, controlled clinical trial . SETTING . Southern California Kaiser-Permanente Health Plan . PARTICIPANTS . 10,317 infants 6 to 15 weeks of age, with no known immune dysfunction, exposure to hepatitis B, or contraindication to diphtheria-tetanus-pertussis (DTP) vaccination were enrolled between August 1989 and September 1990 . INTERVENTION . Infants were randomized to receive either PRP-T or a recombinant hepatitis B control vaccine (in addition to DTP) at approximately 2, 4, and 6 months of age . OUTCOME MEASURES . Adverse reactions occurring during the first 72 hours and between doses (including hospitalizations and outpatient visits) were measured using parental reporting/interviews and review of records . Invasive disease caused by H influenzae was ascertained from the time of enrollment until December 31, 1990 . RESULTS . In October 1990, the study was prematurely terminated because of licensure of other H influenzae vaccines recommended for routine infant use . The rates of systemic and local reactions occurring within 72 hours of each vaccine dose were generally similar for infants given PRP-T and hepatitis B, but some reaction rates (local reactions, fever > or = 102 degrees F, irritability, crying) were significantly higher in the PRP-T group . In the month following receipt of vaccine, PRP-T-vaccinated infants experienced five definite seizures compared with three in the hepatitis B control group . Within 48 hours of vaccination, three seizures (two definite and one possible), which were thought to be related to vaccination, occurred in the PRP-T group, compared with none in the control group (P < .13) . Overall morbidity, mortality, and hospitalization rates were similar in the two vaccine groups . Three cases of invasive disease caused by H influenzae occurred in the control group; none occurred in the PRP-T group . CONCLUSIONS . The PRP-T vaccine is safe and appears to be effective in preventing invasive disease caused by H influenzae type b.

J Immunol, 1993 Aug 1, 151(3), 1463 - 72
Phagocytosis of Staphylococcus aureus and Haemophilus influenzae type B opsonized with polyclonal human IgG1 and IgG2 antibodies . Functional hFc gamma RIIa polymorphism to IgG2; Bredius RG et al.; To assess the function of IgG subclass antibodies we studied the opsonization of Staphylococcus aureus (STAW) and Haemophilus influenzae type b (Hib) by natural IgG1 and IgG2 antibodies from five healthy individuals . Phagocytosis by polymorphonuclear leukocytes (PMN) was analyzed using FITC-labeled bacteria and flow cytometry . All PMN donors were typed for the High- and Low-Responder phenotype of the human Fc gamma receptor (hFc gamma) type IIa (CD32) and the NA1/NA2 allotype of the hFc gamma RIIIb (CD16) . When PMN were used that were heterozygous for hFc gamma RIIa and hFc gamma RIIIb, phagocytosis of STAW opsonized with IgG1 antibodies was similar to that with IgG2, both in the presence and absence of a source of complement (agammaglobulinemic serum) . Phagocytosis of Hib opsonized with IgG2 anti-Hib proved significantly lower (p < 0.05) than with IgG1 anti-Hib using preparations from 4 of the 5 individuals tested . IgG2 anti-Hib from one donor, however, proved more effective than IgG1 anti-Hib . The properties of PMN with hFc gamma RIIaLR,LR and hFc gamma RIIaHR,HR were compared, using hFc gamma RIIIb NA1/NA2-matched PMN . hFc gamma RIIaHR,HR PMN were virtually incapable of phagocytosing STAW and Hib opsonized with IgG2 anti-bodies without complement, in contrast to hFc gamma RIIaLR,LR PMN . Phagocytosis of IgG2-oposonized bacteria by hFc gamma RIIaLR,LR PMN was effectively inhibited by mAb against hFc gamma RIIa (IV.3) . IgG1-mediated phagocytosis was blocked by mAb against hFc gamma RIIIb (CLB/FcRGran 1) to a greater extent than by anti-hFc gamma RIIa mAb . Inhibition studies with mAb against CR3 (B2.12) and hFc gamma RIIa showed that both receptors cooperated in phagocytosis . We conclude that PMN phagocytosis can be effectively mediated by antibacterial IgG2 anti-STAW and anti-Hib . Thus, IgG2 may have a critical role in the immune defense against these bacteria . However, the role of antibacterial IgG2 in opsonization and phagocytosis may be limited in individuals homozygous for hFc gamma RIIaHR.

Zentralbl Veterinarmed B, 1993 Aug, 40(6), 423 - 9
{Aerogenous immunostimulation of weaner swine against experimentally induced respiratory infections with Pasteurella multocida}; Muller G et al.; The clearance of Pasteurella, Bordetella and Haemophilus from the lung of weaners was increased by aerogenous immunostimulations using a lysate mixture consisting of 12 strains of 8 bacterial species, as well as live and inactivated temperature sensitive mutants of Pasteurella multocida . The severity of experimental pneumonias caused by Pasteurella has also been decreased by this treatment . The effect of the lysate was shown to be unspecific and short, as antibody production against Pasteurella was not induced and no booster effect of subsequent aerogenous immunizations with Pasteurella antigens could be detected.

Singapore Med J, 1993 Aug, 34(4), 329 - 34
Prospective study of the aetiology of adult community acquired bacterial pneumonia needing hospitalisation in Singapore; Hui KP et al.; A prospective survey of 96 consecutive adult patients with community acquired pneumonia requiring hospitalisation was carried out at National University Hospital, Singapore . Causative pathogens were identified in 58% of patients . Mycobacterium tuberculosis was the most common pathogen (21%), followed by Streptococcus pneumoniae (12%), Haemophilus influenzae (5.2%), Mycoplasma pneumoniae (5.2%) and Staphylococcus aureus (4.2%) . Gram-negative organisms (apart from Haemophilus influenzae) were found in 10% of pneumonia patients . More than half of the patients had pre-existing illness, the most common was diabetes mellitus (21%).

Int J Pediatr Otorhinolaryngol, 1993 Aug, 27(2), 119 - 26
Detection of Haemophilus influenzae in middle ear of otitis media with effusion by polymerase chain reaction; Hotomi M et al.; Otitis media with effusion (OME) is one of the major causes of hearing loss in childhood . The pathogenesis still remains unclear, though it is closely related to acute otitis media with bacterial infections . It is known that Haemophilus influenzae is one of the most common bacteria isolated from middle ear effusions (MEEs) . Recently, in vitro DNA amplification by polymerase chain reaction (PCR) is a new technology that has considerable implication for diagnosis of viral and bacterial infections because of its potentially precise specificity and sensitivity . In the present experiment polymerase chain reaction (PCR) was applied to the detection of DNA genome of H . influenzae contained in middle ear effusions . By Southern blot hybridization, two characteristic bands for H . influenzae DNA were detected at 273 b.p . and 550 b.p . position in 15 of 27 MEEs . However, no organism was cultured by conventional methods . Our results indicate the PCR technique is more specific and sensitive in detection of bacteria in middle ear effusion of OME, compared with conventional methods . It strongly suggests more involvement of the bacteria, especially H . influenzae, in OME onset.

Microb Pathog, 1993 Aug, 15(2), 131 - 9
Antibodies directed against Haemophilus ducreyi heat shock proteins; Brown TJ et al.; The response to heat shock in Haemophilus ducreyi has been investigated by labelling newly synthesized proteins with a pulse of 35S-methionine at a range of temperatures between 30-40 degrees C . Proteins were then separated by SDS-PAGE and analysed by autoradiography of the resultant profiles . Four heat shock proteins (HSP) were identified of apparent molecular weight < 14, 58.5, 74 and 78 kDa . The three larger proteins appeared to be independently controlled and inducible in a range of H . ducreyi strains . The protein profiles were also probed by Western blot with serum from an immunized rabbit, serum from a rabbit infected intradermally with H . ducreyi, mouse monoclonal antibodies (MAb) and a pool of human sera from patients with chancroid . The rabbit sera, the human serum pool and MAb (BB11) reacted with epitopes on the HSP of 58.5 kDa, whereas only the immunized rabbit serum and another MAb (CC11) reacted with epitopes on the HSP of 78 kDa . The HSP of 58.5 kDa appears to be immunogenic and may play a part in the host response to H . ducreyi and the pathogenesis of chancroid.

An Esp Pediatr, 1993 Aug, 39(2), 111 - 5
{Invasive Haemophilus influenzae type B infections in infancy (1981-1990)}; de Juan Martin F et al.; We report the epidemiology of invasive Haemophilus influenzae type B infections . The study is based on 58 children and was carried out during the years from 1981 to 1990 . Sixty-three percent of the patients had meningitis, 10.3% had arthritis, 10.3% had epiglottitis, 8.6% had cellulitis and 6.9% had pneumonia . Thirteen percent of the cases were children who were less than 6 months old, 34.4% were less than 12 months old, 70.6% were less than 24 months of age and 93% were less than 4 years old . Among the latter, 90% of the children with epiglottis or pneumonia were 24 months or older compared with 16% of the patients with meningitis, arthritis or cellulitis (p < 0.001) . Sixty-three percent of the isolated strains of Haemophilus influenzae type B were resistant to ampicillin and 19.2% of the strains were resistant to ampicillin and chloramphenicol.

J Antimicrob Chemother, 1993 Aug, 32(2), 239 - 46
Beta-lactam susceptibility of Haemophilus influenzae strains showing reduced susceptibility to cefuroxime; James PA et al.; Minimum inhibitory concentrations of 13 beta-lactam antibiotics (ampicillin, amoxycillin, amoxycillin/clavulanate, imipenem, cefazolin, cefadroxil, cefaclor, cefuroxime, cefotaxime, cefepime, cefpirome, cefpodoxime and cefixime), were determined for 76 strains of beta-lactamase negative Haemophilus influenzae, isolated over a five year period (1985-1990) that gave reduced zones to cefuroxime on disc testing when compared to the control strain H . influenzae NCTC 11931 . MIC90 values for all antibiotics (except imipenem) were approximately ten times higher than the MIC90 values for a susceptible control group . Increased resistance was not associated with any particular biotype, although three biotype III strains were highly resistant to imipenem . More than 50% of strains with reduced susceptibility to beta-lactam antibiotics were isolated from patients with chronic respiratory disease . Published data on the sputum concentration of each antibiotic were compared to the MIC90 values obtained for the susceptible and resistant strains.

J Antimicrob Chemother, 1993 Aug, 32(2), 233 - 7
Activity of meropenem and other antimicrobial agents against uncommon gram-negative organisms; Clark RB et al.; The in-vitro activity of meropenem and other antimicrobial agents was tested by agar dilution against 113 uncommon Gram-negative pathogens . Both meropenem and ceftriaxone showed the most activity against the test isolates . The potency of meropenem was greater than imipenem against Pasteurella multocida, Eikenella corrodens, Haemophilus parainfluenzae, Moraxella spp., Kingella spp., and Actinobacillus actinomycetemcomitans . Further work is necessary to assess the in-vivo activity of meropenem against these Gram-negative isolates.

Arch Dis Child, 1993 Aug, 69(2), 225 - 8
Invasive Haemophilus influenzae type b disease in the Oxford region (1985-91); Booy R et al.; For a seven year period (1985-91) clinical and epidemiological data were prospectively collected on children aged < 10 years with microbiologically confirmed invasive Haemophilus influenzae type b infection in the Oxford region to study the epidemiology of the disease and determine the potential impact of early primary immunisation in infants . Computer records of primary immunisations given to these cases were retrospectively analysed and, where necessary, hospital and general practitioner records were searched to determine the immunisation history . Over the seven year period, 416 cases of invasive H influenzae type b disease were reported . Widescale immunisation against H influenzae type b began in 1991 as part of a regional trial . The estimated annual incidence for invasive disease between 1985 and 1990 was 35.5 cases per 100,000 children aged less than 5 years; for H influenzae type b meningitis it was 25.1 per 100,000 children aged less than 5 years . The cumulative risks for invasive disease and meningitis by the fifth birthday were one in 560 and one in 800 respectively . The majority of disease (71%) occurred in children less than 2 years of age with the peak monthly incidences at 6 and 7 months of age . The overall mortality was 4.3% and 50% of these deaths occurred suddenly . Most (91%) of the children had received at least one primary immunisation against diphtheria, tetanus, and pertussis before H influenzae type b infection and there was only one case of parental refusal of immunisation . None had received H influenzae type b immunisation . Given a vaccine uptake of 90% by 5 months of age it is estimated that at least 82% of the H influenzae type b infections could have been prevented . Extrapolated nationally, 1150 cases of infection and 50 deaths could be prevented each year by routine primary immunisation.

Mol Microbiol, 1993 Aug, 9(4), 857 - 68
Characterization of pilQ, a new gene required for the biogenesis of type 4 fimbriae in Pseudomonas aeruginosa; Martin PR et al.; Type 4 fimbriae are produced by a variety of pathogens, in which they appear to function in adhesion to epithelial cells, and in a form of surface translocation called twitching motility . Using transposon mutagenesis of Pseudomonas aeruginosa, we have identified a new locus required for fimbrial assembly . This locus contains the gene pilQ which encodes a 77 kDa protein with an N-terminal hydrophobic signal sequence characteristic of secretory proteins . pilQ mutants lack the spreading colony morphology characteristic of twitching motility, are devoid of fimbriae, and are resistant to the fimbrial-specific bacteriophage PO4 . The pilQ gene was mapped to Spel fragment 2, which is located at 0-5 minutes on the P . aeruginosa PAO1 chromosome, and thus it is not closely linked to the previously characterized pilA-D, pilS,R or pilT genes . The pilQ region also contains ponA, aroK and aroB-like genes in an organization very similar to that of corresponding genes in Escherichia coli and Haemophilus influenzae . The predicted amino acid sequence of PilQ shows homology to the PulD protein of Klebsiella oxytoca and related outer membrane proteins which have been found in association with diverse functions in other species including protein secretion, DNA uptake and assembly of filamentous phage . PilQ had the highest overall homology to an outer membrane antigen from Neisseria gonorrhoeae, encoded by omc, that may fulfil the same role in type 4 fimbrial assembly in this species.

Infect Immun, 1993 Aug, 61(8), 3375 - 81
Paradoxical effect of pilus expression on binding of antibodies by Haemophilus influenzae; Gilsdorf JR et al.; Haemophilus influenzae type b (Hib) pili are surface proteins that are associated with the ability of Hib to attach to human epithelial cells . Like pilus expression of other bacteria, expression of Hib pili undergoes phase variation . We observed that Hib in the piliated phase (Hib p+) bound monoclonal antibodies directed against six conserved, surface-exposed, nonpilus Hib outer membrane epitopes to a greater extent than Hib in the nonpiliated phase (Hib p-) . However, after extended incubation, p+ and p- cells bound these antibodies in a similar fashion . The differential in nonpilus antibody binding to p+ and p- Hib was not related to the presence of the type b capsule . In addition, Hib p+ organisms whose pilin gene was insertionally inactivated and did not produce pili and Hib in the nonpiliated phase bound the nonpilus Hib antibodies similarly . Hib p+ and p- organisms did not differ in their binding of anti-type b capsule antibody, and the binding was specific for the epitopes recognized by the antibodies . In complement-dependent bactericidal assays, the nonpilus antibodies killed Hib p+ more effectively than Hib p- . The increased binding to, and killing of, Hib p+ by a variety of nonpilus antibodies may be important for host defense against invasive Hib.

Infect Immun, 1993 Aug, 61(8), 3334 - 41
Immunological properties of recombinant porin of Haemophilus influenzae type b expressed in Bacillus subtilis; Srikumar R et al.; The major surface-located, channel-forming protein in the outer membrane of Haemophilus influenzae type b (Hib) is porin (341 amino acids; M(r), 37,782) . In order to generate Hib porin that is devoid of lipooligosaccharides and capsular polysaccharide, the Hib porin gene ompP2 was subcloned into a plasmid vector and recombinant Hib porin was expressed in Bacillus subtilis . Recombinant porin was produced in large quantities in B . subtilis and formed intracellular inclusion bodies . Recombinant porin was extracted from inclusion bodies and shown to be active in forming pores in synthetic black lipid membranes . However, these pores demonstrated different pore characteristics than wild-type Hib porin . Mouse hyperimmune sera against recombinant porin were generated and subjected to epitope scanning with a library of 336 overlapping synthetic hexapeptides that corresponded to the entire sequence of Hib porin . The epitope specificities of the anti-recombinant porin antibodies were similar to those of antibodies against Hib porin: selected regions near the amino terminus which include a buried loop in the native structure of Hib porin were more immunogenic than regions at the carboxy terminus . Although some mouse anti-recombinant porin antibodies mediated complement-dependent binding to Hib by polymorphonuclear leucocytes in opsonophagocytosis assays, the antibodies were not bactericidal, nor did they abrogate bacteremia in the infant rat model of infection . It was concluded that the native state of Hib porin is required for the generation of a protective immune response against the bacterium.

Proc Natl Acad Sci U S A, 1993 Jul 15, 90(14), 6874 - 8
Genomic mapping with I-Ceu I, an intron-encoded endonuclease specific for genes for ribosomal RNA, in Salmonella spp., Escherichia coli, and other bacteria; Liu SL et al.; Construction of physical maps of genomes by pulsed-field gel electrophoresis requires enzymes which cut the genome into an analyzable number of fragments; most produce too many fragments . The enzyme I-Ceu I, encoded by a mobile intron in the chloroplast 23S ribosomal RNA (rrl) gene of Chlamydomonas eugametos, cuts a 26-bp site in the rrl gene . This enzyme digests DNA of Salmonella typhimurium at seven sites, each corresponding to one of the rrl genes of the rrn operons, but at no other site . These seven fragments were located on the previously determined Xba I physical map, and the I-Ceu I sites, and thus the rrn genes of S . typhimurium, were mapped on the 4800-kb chromosome . Escherichia coli K-12 also yields seven fragments of sizes similar to those of S . typhimurium, indicating conservation of rrn genes and their location, and a chromosome size of 4600 kb . The sizes of the E . coli fragments are close to the size predicted from restriction maps and nucleotide sequence . The I-Ceu I maps of Salmonella enteritidis, Salmonella paratyphi A, B, C, and Salmonella typhi were deduced after digesting genomic DNA and I-Ceu I and probing with DNA of S . typhimurium; the data indicated strong conservation of rrn gene number and position and genome sizes up to 4950 kb . Digestion of DNA of other bacteria (species of Haemophilus, Neisseria, Proteus, and Pasteurella) suggested that only rrn genes are cut in all these species . I-Ceu I digestion followed by pulsed-field gel electrophoresis is a powerful tool for determining genome structure and evolution.

J Immunol, 1993 Jul 15, 151(2), 800 - 9
The human VH3b gene subfamily is highly polymorphic; Adderson EE et al.; We have previously shown that human antibody (Ab) directed against the capsular polysaccharide of the important bacterial pathogen, Haemophilus influenzae type b (Hib) is encoded by a small group of VH3 gene family members . The majority of anti-Hib PS Ab use members of the smaller VH3b subfamily . To examine directly the available human VH3 repertoire, we have used PCR to amplify and clone candidate germ-line VH3b H chain V region genes from two unrelated subjects from whom anti-Hib polysaccharide mAb had been previously obtained . A single functional VH3b germ-line gene was obtained from one subject . This gene is identical throughout the coding region to the previously identified gene 9.1 . Twelve distinct VH3b germ-line sequences, 87.6-99.8% homologous to one another, were obtained from the second subject . One of these genes, LSG1.1, is also identical to the 9.1 germ-line gene, and a second, LSG6.1, is identical to a previously reported cDNA, M85 . These germ-line VH3b genes are 82.7-94.1% homologous to rearranged anti-Hib PS VH3b segments obtained from these subjects . Our findings further demonstrate that considerable polymorphism of VH segments exists in the human population . Despite the presence of very highly homologous VH elements in the germ line, particular genes are highly conserved within the outbred human population.

Gene, 1993 Jul 15, 129(1), 155 - 6
Cloning and sequencing of the Haemophilus influenzae aroA gene; Maskell D; This study was designed to clone the aroA gene (encoding 5-enolpyruvylshikimate-3-phosphate synthase {EPSPS}) from Haemophilus influenzae using a mixed-primer polymerase chain reaction (PCR) . The mixed primers were based on a back translation of previously reported blocks of amino acid homology between different cloned EPSPS proteins . The PCR-produced probe from H . influenzae DNA was used to identify a recombinant lambda phage from which the rest of H . influenzae aroA was subcloned and sequenced . The sequence of H . influenzae aroA is highly homologous to all other aroA genes sequenced to date . The upstream sequence of aroA, when translated, results in a protein with strong homology to the purN gene product, glycinamide ribonucleotide transformylase . The stop codon of the putative H . influenzae purN gene overlaps the start codon for H . influenzae aroA, suggesting that the two genes may form an operon and that they may be translationally coupled.

Gene, 1993 Jul 15, 129(1), 107 - 11
Analysis of tandem, multiple genes encoding 30-kDa membrane proteins in Pasteurella haemolytica A1; Murphy GL et al.; A number of outer membrane proteins (OMPs), including a 30-kDa protein, may be important in eliciting immunity to Pasteurella haemolytica A1, the causative agent of bovine pneumonic pasteurellosis . To better understand the nature of the 30-kDa antigen, several genes encoding this protein were sequenced . Sequence analysis revealed that three separate genes encoding similar, yet distinct, versions of the 30-kDa protein are tandemly arranged on the P . haemolytica A1 chromosome . The genes appear to be transcribed from a single promoter . The deduced amino acid sequences of the proteins encoded by these genes are similar to a 28-kDa inner membrane lipoprotein of Escherichia coli and a 28-kDa membrane protein which may contribute to the virulence of Haemophilus influenzae type b strains.

Pediatrics, 1993 Jul, 92(1), 140 - 3
Effect of antibiotic therapy and etiologic microorganism on the risk of bacterial meningitis in children with occult bacteremia; Baraff LJ et al.; OBJECTIVE . To quantify the effect of antibiotic therapy on the probability of subsequent bacterial meningitis in children with fever without source treated as outpatients . DESIGN . Bayesian meta-analyses . REPORTS INCLUDED . All reports of the organism-specific prevalence of occult bacteremia in children with fever without source treated as outpatients, and the organism-specific prevalence of subsequent meningitis in children with occult bacteremia initially treated as outpatients stratified by type of antibiotic therapy . RESULTS . The mean probabilities of subsequent meningitis in children with occult bacteremia were 9.8%, 8.2%, and 0.3% in the no antibiotic, oral antibiotic, and parenteral antibiotic therapy groups, respectively . All cases of bacterial meningitis in children with occult bacteremia treated with oral antibiotics were due to Haemophilus influenzae . There were no cases of culture-positive bacterial meningitis in 139 bacteremic children treated with ceftriaxone (mean probability, 0.3%; 95% confidence interval, 0.0% to 1.5%) . The mean probabilities of bacterial meningitis in a child with fever without source treated as an outpatient without antibiotics were: Streptococcus pneumoniae, 0.21%; and H influenzae, 0.06% . CONCLUSIONS . Antibiotic therapy is effective in preventing meningitis in children at risk of occult bacteremia.

J Infect Dis, 1993 Jul, 168(1), 172 - 6
An ancestral mutation enhancing the fitness and increasing the virulence of Haemophilus influenzae type b; Kroll JS et al.; Capsulate Haemophilus influenzae is a major cause of septicemia and meningitis in children . Virtually all invasive strains have a type b polysaccharide capsule and belong to division I of the two phylogenetic divisions into which the H . influenzae population segregates . In this study 18 isolates, collected from all over the world and representative of the whole population of division I type b strains, have been shown to be the progeny of a common ancestor in which a founder mutation occurred, the deletion of one of two copies of the gene bexA . BexA is essential for exporting capsular polysaccharide to the bacterial surface, and a single copy of its gene lies at the center of an otherwise duplicated capsulation locus . Deletion of the other copy has had the paradoxical effect of enhancing pathogenicity, through increasing the potential for amplification of capsule biosynthetic genes and capsule production.

Infect Immun, 1993 Jul, 61(7), 3026 - 31
Protein D of Haemophilus influenzae is not a universal immunoglobulin D-binding protein; Sasaki K et al.; Haemophilus influenzae type b and nontypeable H . influenzae have been reported to bind human immunoglobulin D (IgD) . IgD myeloma sera from five patients were tested for the ability of IgD to bind to H . influenzae . Serotype b strains bound human IgD in four of the five sera tested . IgD in the fifth serum bound strongly to type b strain MinnA but poorly to other type b strains . Additionally, IgD binding was not observed when nontypeable strains were tested . The gene for protein D, the putative IgD-binding protein, was cloned from the IgD-binding H . influenzae type b strain MinnA and expressed in Escherichia coli . IgD binding to E . coli expressing protein D was not demonstrable . Recombinant protein D was purified, and antisera were generated in rabbits . Using these rabbit sera, we detected protein D in nontypeable as well as serotype b strains by Western blotting (immunoblotting) . In contrast, IgD myeloma protein 4490, which was previously reported to bind to protein D by Ruan and coworkers (M . Ruan, M . Akkoyunlu, A . Grubb, and A . Forsgren, J . Immunol . 145:3379-3384), bound strongly to both type b and nontypeable H . influenzae as well as to E . coli expressing protein D . Thus, IgD binding is a general property of H . influenzae type b strains but not a general property of nontypeable strains, although both type b and nontypeable strains produce protein D . With the exception of IgD myeloma protein 4490 binding, we have no evidence for a role of protein D in IgD binding to H . influenzae.

Infect Immun, 1993 Jul, 61(7), 2813 - 21
Cloning and sequencing of the gene encoding a 31-kilodalton antigen of Haemophilus somnus; Won J et al.; Immunoblots using bovine antibody against Haemophilus somnus as the primary antibody consistently identified 31-, 40- and 78-kDa proteins in Sarkosyl-insoluble extracts of H . somnus . A genomic library of H . somnus 8025 DNA was constructed in plasmid pUC19, and 45 recombinants expressed proteins which were recognized by bovine antiserum in Western blots (immunoblots) . Ten of the recombinants expressing a 31-kDa protein caused the lysis of bovine erythrocytes . Restriction endonuclease mapping indicated that the hemolytic recombinants shared an approximately 1.7-kb BglII fragment . Southern blot analysis using the BglII fragment as a probe revealed homology among the recombinants and the presence of an identically sized BglII fragment in the chromosome of all H . somnus isolates tested . Sequence analysis indicated the presence of an 822-bp open reading frame within the 1.7-kb BglII fragment . Deletion of this open reading frame resulted in the loss of hemolytic activity and protein expression in recombinant Escherichia coli, suggesting the possible role of the 31-kDa protein as a hemolysin . An amino acid sequence deduced from the DNA sequence shared homology with outer membrane protein A of E . coli, Salmonella typhimurium, and Shigella dysenteriae, with P6 of Haemophilus influenzae, and with PIII of Neisseria gonorrhoeae . An amino acid analysis of the recombinant 31-kDa protein agreed with the amino acid composition deduced from the DNA sequence.

Mol Microbiol, 1993 Jul, 9(1), 85 - 96
Cloning and nucleotide sequence of frpC, a second gene from Neisseria meningitidis encoding a protein similar to RTX cytotoxins; Thompson SA et al.; Neisseria meningitidis FAM20 has recently been shown to produce two Fe-regulated proteins (FrpA and FrpC) related to the RTX family of cytotoxins . Here we report the cloning and DNA sequence of the locus containing the gene encoding the larger meningococcal RTX protein FrpC . FrpC was highly similar to FrpA throughout much of the predicted protein, with two main differences . Whereas the FrpA protein had 13 copies of the nine-amino-acid repeat units typical of RTX proteins, FrpC had 43 copies . The additional copies in FrpC apparently arose from a threefold tandem amplification of a 600bp DNA fragment encoding the repeats . In addition, the frpC gene lacked good promoter consensus sequences . An open reading frame (ORF1) of unknown function was found immediately upstream of frpC, suggesting the possibility that frpC was cotranscribed with ORF1 . A probable promoter was found 300bp upstream of ORF1, and it contained a Fur protein-binding sequence found in the promoters of Fe-regulated Escherichia coli genes . DNA upstream of the ORF1/frpC promoter was homologous to IS1016-like elements surrounding capsulation loci of strains of Haemophilus influenzae . A FrpC-like protein (reactive in immunoblots with monoclonal antibody 9D4; multiple reactive bands of about 200 to 120 kDa) was found in five out of eight meningococcal strains but only in one out of 14 other Neisseria, suggesting that FrpC may participate in the pathogenesis of meningococcal disease.

Mol Microbiol, 1993 Jul, 9(1), 119 - 31
comF, a Bacillus subtilis late competence locus, encodes a protein similar to ATP-dependent RNA/DNA helicases; Londono-Vallejo JA et al.; We have sequenced and genetically characterized comF, a Bacillus subtilis competence locus, previously identified by Tn917 transposon insertion mutagenesis . Expression of the locus, in which three open reading frames (ORFs) were found, is driven by a single sigma A-like promoter in front of comFORF1 and is dependent on early regulatory competence genes and only expressed in competence medium . The predicted amino acid sequences of two of the ORFs showed similarities to known proteins in the GenBank and SwissProt databases: ComFORF1 is similar to an extensive family of ATP-dependent RNA/DNA helicases with closer similarity to the DEAD protein subfamily and to the PriA protein in Escherichia coli . The latter is a DNA translocase/helicase required for primosome assembly at the replication fork of phage phi X174 . ComFORF3 is 22% identical to Com101, a protein required for genetic competence in Haemophilus influenzae, a naturally competent Gram-negative bacterium . In-frame comFORF1 deletions were 1000-fold deficient in transformability compared to the wild-type, whereas disruptions of the other two ORFs were only five- to 10-fold lower . These observations allow us to hypothesize that the ComFORF1 late gene product plays an essential role during the binding and uptake events involved in Bacillus subtilis transformation.

J Antimicrob Chemother, 1993 Jul, 32 Suppl A, 49 - 59
Management of bacterial meningitis; Hart CA et al.; In developed countries the mortality from bacterial meningitis acquired outside the neonatal period is relatively low . In contrast, in developing countries it is often higher (20%-40%) . In developed countries despite (and perhaps because of) the introduction of increasingly potent antimicrobials, the morbidity of bacterial meningitis has remained high . For example, up to 25% of patients with Haemophilus influenzae meningitis have some form of neurological deficit . Neisseria meningitidis is the major cause of bacterial meningitis in many areas of the world . A clone of Group A meningococcus has spread from China to cause the most recent major epidemic in Sub-Saharan Africa . Group B meningococcal infections causing sporadic meningitis are increasing in parts of Europe and South America . The mortality from meningococcal disease is greatest when there is a septicaemic component to the infection . Although antimicrobial chemotherapy is of major importance some adjuncts to therapy are beneficial . High dose corticosteroid therapy has been shown to decrease mortality in pneumococcal meningitis in an uncontrolled study and to speed recovery and decrease neurological sequelae in H . influenzae meningitis . Nevertheless to prevent infection would be of greater benefit . Prevention can be achieved by either chemoprophylaxis or immunoprophylaxis . Although safe and effective vaccines are available to prevent pneumococcal, H . influenzae (Hib) and Groups A and C meningococcal meningitis; apart from the protein conjugate Hib vaccine they are less effective in children under two years of age . There is no effective vaccine to protect against group B meningococcal meningitis.

J Antimicrob Chemother, 1993 Jul, 32 Suppl A, 17 - 27
Aetiology and treatment of community-acquired pneumonia in adults: an historical perspective; Fass RJ; Community-acquired pneumonia is common . Most disease is mild but mortality among hospitalized patients is 5-20% . The most common aetiological pathogens are Streptococcus pneumoniae, Haemophilus influenzae, and the 'atypical' organisms, Mycoplasma pneumoniae, Legionella pneumophila and Chlamydia pneumoniae . Less common pathogens account for 10-30% of cases and the aetiology cannot be determined in one-third to one-half of cases . Classification by aetiology and initiation of specific antimicrobial therapy are difficult and treatment is often initiated empirically . Ampicillin (or amoxycillin) or erythromycin are inexpensive and effective for most patients, but their use in combination, the addition of a beta-lactamase inhibitor (e.g . amoxycillin/clavulanate) or the substitution of an expanded spectrum cephalosporin (e.g . cefuroxime) should be considered for patients with more serious illnesses or pathogens likely to be drug-resistant . Fluoroquinolones such as ciprofloxacin or ofloxacin would be acceptable if adequacy for treating pneumococcal infections were likely . New macrolides, such as azithromycin and clarithromycin, and new fluoroquinolones, such as temafloxacin and sparfloxacin, have theoretical advantages over previously available drugs, but superior efficacy has not yet been demonstrated satisfactorily . Pneumococcal resistance in various parts of the world is modifying traditional treatment . Currently, there is no drug of choice for the empirical treatment of community-acquired pneumonia.

Eur J Clin Microbiol Infect Dis, 1993 Jul, 12(7), 548 - 53
Haemophilus test medium versus Mueller-Hinton broth with lysed horse blood for antimicrobial susceptibility testing of four bacterial species; Barry AL et al.; Studies were undertaken to determine whether broth microdilution susceptibility tests could be standardized by using a single medium for testing fastidious respiratory pathogens . Mueller-Hinton broth with lysed horse blood and the broth version of Haemophilus Test Medium (HTM) were directly compared . Ten orally administered agents were found to give essentially identical results in both media but minor differences were noted . Because the test are easier to read when HTM broth is used, that medium is to be preferred for routine testing of Haemophilus influenzae, Streptococcus pneumoniae, Streptococcus pyogenes and Moraxella catarrhalis isolates by the microdilution procedure.

Arctic Med Res, 1993 Jul, 52(3), 118 - 26
Safety and immunogenicity of a combined hepatitis B virus-Haemophilus influenzae type B vaccine formulation in healthy adults; Bulkow LR et al.; We administered a combined preparation of hepatitis B virus (HBV) vaccine and Haemophilus influenzae type b (Hib) conjugate vaccine (meningococcal protein conjugate) to 20 healthy adult volunteers . Participants received two doses of vaccine one month apart, and had serum samples drawn each time they received the vaccine and 1 month after the second dose . In 18 of 19 persons who were positive for antibody to hepatitis B surface antigen (anti-HBs), these levels had a median fold increase of 23.4 (range 0.69 to 270) 1 month after the first dose of vaccine . Anti-HBs levels generally fell slightly one month after the second dose was given . All of the study participants initially had detectable levels of antibody to Hib capsular polysaccharide (anti-PRP), and 19 of the 20 exhibited a median fold increase of 11.2 (range 0.81 to 740) in anti-PRP 1 month after vaccination . Over half (65%) continued to demonstrate increased levels of anti-PRP with the second dose of vaccine . Most participants experienced some slight to moderate discomfort at the injection site . The results indicate that the combined Hib/HBV vaccine produces increased antibody levels in healthy adults who have previously been exposed to these two antigens.

J Bacteriol, 1993 Jul, 175(14), 4569 - 71
Protein D, a putative immunoglobulin D-binding protein produced by Haemophilus influenzae, is glycerophosphodiester phosphodiesterase; Munson RS Jr et al.; Protein D of Haemophilus influenzae is 67% identical to the periplasmic glycerophosphodiester phosphodiesterase of Escherichia coli . Extracts prepared from E . coli expressing recombinant protein D had an 8- to 22-fold-higher specific activity of glycerophosphodiester phosphodiesterase compared with extracts of E . coli not expressing protein D.

Acta Otolaryngol, 1993 Jul, 113(4), 524 - 9
Local antibody response to P6 of nontypable Haemophilus influenzae in otitis-prone and normal children; Yamanaka N et al.; The local antibody response to the outer membrane protein, P6, of nontypable H . influenzae was measured in middle ear fluids of 30 children during 46 episodes of otitis media, and in nasopharyngeal secretions from 7 children evaluated on 18 occasions . Immunoglobulin G antibody to P6 was detected in 92% of middle ear fluid compared to 70% for IgM, 78% for IgA, and 45% for secretory IgA . Antibody levels ranged from a high of 249 ng/ml for IgG to a low of 11 ng/ml for IgM . Concentrations of P6 specific IgG in the middle ear fluid was directly related to the concentration in the serum, r = 0.89, p < 0.001, and inversely related to the number of bacteria present, r = -0.62, p < 0.05 . In contrast, IgA and secretory IgA antibodies to P6 were common (96% and 95%, respectively) and in relatively high concentrations (33 ng/ml and 29 ng/ml, respectively) in nasopharyngeal secretions . There was no relationship between nasopharyngeal and serum levels of antibodies . These data suggest that antibody to P6 nontypable H . influenzae is common, diffuses into the middle ear spaces passively from the serum during otitis media, and is manufactured locally in the nasopharynx in response to colonization.

Jpn J Antibiot, 1993 Jul, 46(7), 604 - 28
{Bacteriological, pharmacokinetic and clinical studies of cefditoren pivoxil in the pediatric field}; Toyonaga Y et al.; Bacteriological, pharmacokinetic and clinical studies on cefditoren pivoxil (CDTR-PI, ME 1207) in granules, a new oral cephalosporin, were performed in the field of pediatrics . The results are summarized below . 1 . Antibacterial activities: Antibacterial activities of CDTR were studied against Staphylococcus aureus, Streptococcus pneumoniae, Streptococcus pyogenes, Haemophilus influenzae, Haemophilus parainfluenzae and Branhamella catarrhalis in comparison with those of cefteram (CFTM), cefixime (CFIX), cefaclor (CCL), cefpodoxime (CPDX) and cefotiam (CTM) . MIC80's of CDTR against S . aureus, S . pneumoniae, S . pyogenes, H . influenzae, H . parainfluenzae and B . catarrhalis were 1.56, 0.39, < or = 0.025, < or = 0.025, 0.05 and 0.20 micrograms/ml, respectively . These results showed that CDTR has high antibacterial activities against these organisms . 2 . Absorption and excretion: Serum concentrations and urinary recovery rates of CDTR-PI (administered in granules) were determined . Upon single oral doses of 3 mg/kg and 6 mg/kg, the peak serum concentrations were 0.5-2.45 micrograms/ml at 2 to 4 hours and 1.79-4.05 micrograms/ml at 1 to 4 hours, respectively, and T 1/2 was 1.07-9.67 hours and 0.99-3.00 hours, respectively . At 8 hours after dosing, serum concentrations were 0-0.87 micrograms/ml with a dose of 3 mg/kg and 0.27-0.73 micrograms/ml with 6 mg/kg . These values indicated that the drug has a dose-dependent pharmacokinetic behavior . Urinary recovery rates in the first 8 hours were 12.9-34.2% with a dose of 3 mg/kg and 11.8-26.9% with 6 mg/kg . 3 . Clinical study: Clinical efficacies were examined in a total of 81 cases consisting of 20 cases of acute bronchitis, 13 of acute pneumonia, 21 of tonsillitis, 5 of pharyngitis, 7 of scarlet fever, 2 each of impetigo, otitis media and purulent cervical lymphadenitis, 1 of pertussis and 8 of UTI . The clinical efficacy rate was 97.5% (79/81), and bacteriological eradication rate was 100% (76/76) . As for side effects, 2 cases of watery stools and 1 case of minor elevation of GPT were observed.

Jpn J Antibiot, 1993 Jul, 46(7), 589 - 95
{Pharmacokinetic, bacteriological and clinical studies on cefditoren pivoxil in children}; Tajima T et al.; Pharmacokinetic, bacteriological and clinical studies on cefditoren pivoxil (CDTR-PI, ME 1207) were performed in children . The results were as follows: 1 . A total of 18 patients (19 infections) were treated with CDTR-PI . The doses ranged 2.1-3.2 mg/kg, and it was orally administered 3 times daily, for 4-10 days . Clinical efficacies of CDTR-PI in 18 patients with 19 bacterial infections (3 with tonsillitis, 1 with bronchitis, 7 with pneumonia, 1 with acute maxillary sinusitis, 4 with otitis media, 1 with urinary tract infection, 2 with skin and soft tissue infection) were evaluated as excellent in 13 infections and as good in 6 infections with an efficacy rate of 100% . Twelve causative strains of 5 species were found in 11 patients . Streptococcus pneumoniae in 2 cases out of 3, Haemophilus influenzae in 4/4, Staphylococcus aureus in 2/2, Haemophilus parainfluenzae in 2/2 and Escherichia coli in 1/1 were eradicated . Two patients had mild diarrhea but did not need specific treatment . Severe adverse reaction was not observed in any of the 18 patients . 2 . MICs of CDTR were examined against 4 clinically isolated S . pneumoniae strains . Two strains of S . pneumoniae were relatively resistant to penicillins . 3 . Pharmacokinetic studies Peak serum CDTR concentrations in 3 patients were 2.38 micrograms/ml, 0.72 micrograms/ml and 2.25 micrograms/ml at a dose of CDTR-PI 3 mg/kg orally administered at 30-minute after meal.(ABSTRACT TRUNCATED AT 250 WORDS)






What Is Genome?, What Is Yeast?, What Is Cell Biology?, What Is Biofilter?, What Is Prokaryote?, i, Microbiology, n, Microbe, r, Bacterium, i, Microorganisms, a, Bacteria, e, Yeasts, r, Corynebacterium, o, Candida albicans, o, Escherichia coli, a, Streptococcal, e, Escherichia coli, i, Agrobacterium, o, Candida albicans, e, Escherichia coli, r, Antimicrobial, n, Bifidobacteria, i, Bacteria, n, Escherichia coli, n, Bacillus, s, Staphylococcus, e, Escherichia coli broth, s, Salmonella, r, Micrococci, c, Bacillus, c, S. cerevisiae, c, S. cerevisiae




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005