Escherichia coli

Biochimie, 1987 Sep, 69(9), 939 - 48
Interaction of ribosomal proteins L25 from yeast and EL23 from E . coli with yeast 26S and mouse 28S rRNA; el-Baradi TT et al.; The interaction of ribosomal protein EL23 from E . coli and L25 from yeast with yeast 26S rRNA was analysed by nitrocellulose filter binding and RNase protection experiments using both intact rRNA and various fragments prepared by in vitro transcription of cloned yeast rDNA regions in the SP6 system . The results show that EL23 efficiently and specifically interacts with the region of 26S rRNA previously identified as the binding site for the yeast ribosomal protein L25 . A comparison of the oligonucleotides resulting from limited RNase T1 digestion of the heterologous EL23/26S rRNA complex with those obtained by the same treatment of the homologous L25/26S rRNA complex showed that the molecular details of the two r-protein/rRNA interactions are highly similar if not identical . Using the synthetic 26S rRNA fragments we could demonstrate that all information for the formation of a biologically active binding site is located within the region of the rRNA delimited by the sequences protected by L25 against RNase T1 digestion . Part of the sequence at the 3' end of the 5'-distal protected region, however, was found not to be essential for r-protein binding although it does enhance the efficiency of this binding . Binding experiments using synthetic mouse 28S rRNA fragments showed that neither EL23 nor L25 interact with the structural equivalent of their respective cognate binding sites present in this mammalian rRNA . We argue that the structure of the expansion sequence present in this region of mouse 28S rRNA is a major cause of this failure.

Mol Microbiol, 1987 Sep, 1(2), 195 - 201
An E . coli promoter induced by the cessation of growth; Connell N et al.; The production of the bacterial DNA replication inhibitor Microcin B17 is induced as cultures enter stationary phase . Using S1 nuclease protection assays we have shown that this induction is the result of increased levels of transcription initiation from a promoter located upstream from mcbA, the structural gene for Microcin B17 . Upstream from the start site of transcription there is a rather typical -35 region . However, there is no good homology to the consensus -10 region . While most of the cell's transcription is shut off as a result of the cessation of growth, transcription from the mcbA promoter continues for several hours in stationary phase . A single-copy gene fusion between mcbA and lacZ was used to monitor the response of the promoter to different nutritional conditions and in different host backgrounds altered in metabolic regulatory loci . Starvation for nitrogen, phosphate or carbon sources all induced transcription from the promoter . Levels of transcription were reduced in ompR backgrounds . In contrast, mutations in other global regulatory loci, fnr, relA and cya had little or no effect.

Mol Gen Mikrobiol Virusol, 1987 Sep, (9), 10 - 6
{Weakening of type I restriction in E . coli: the effect of dam mutation}; Belogurov AA et al.; The host-controlled EcoK-restriction of unmodified phages lambda.0 and T7ocr . is 100-fold alleviated in dam- mutants of E . coli . In addition the EcoK modification activity is considerably decreased in dam- strains . The I and III types restriction (EcoB, EcoD, EcoK and EcoP1) were relieved in dam- mutants, but no alleviation of EcoRI restriction occurred in dam- strains . We interpret the alleviation of the I type restriction in dam- mutants as consequence of induction of the function, which interferes with the I type restriction systems.

FEBS Lett, 1987 Aug 17, 220(2), 347 - 52
Tryptophan 54 and phenylalanine 60 are involved synergistically in the binding of E . coli SSB protein to single-stranded polynucleotides; Casas-Finet JR et al.; The binding of both wild-type and point-mutated E . coli single-stranded DNA-binding (SSB) protein to poly(deoxythymidylic acid) has been studied by fluorescence and optical detection of triplet state magnetic resonance spectroscopy . Involvement of tryptophan residues 40 and 54 in stacking interactions with nucleotide bases has been inferred earlier from such studies . Investigation of a point mutation in the E . coli SSB gene product obtained by site specific oligonucleotide mutagenesis in which Phe-60 is replaced by alanine strongly suggests the participation of Phe-60 in the binding process, possibly by the formation of an extended stacking structure by Trp-54, thymine and Phe-60 . This hypothesis is supported by results on the point mutations in which His-55 is replaced by either leucine or tyrosine.

FEBS Lett, 1987 Aug 17, 220(2), 283 - 7
Similarities between a predicted secondary structure for the M1 RNA ribozyme and the tRNA binding center of 16 S rRNA from E . coli; Boehm S; We propose a new model for the secondary structure of the M1 RNA component of E . coli RNase P which is based on significant sequence homologies with parts of the E . coli 16 S rRNA . A large domain of the new model resembles closely the secondary structure of the tRNA binding center of 16 S rRNA . We suggest that this domain of M1 RNA when functioning as a ribozyme binds the mature part of the precursor tRNA.

FEBS Lett, 1987 Aug 10, 220(1), 167 - 76
The GATATC-modification enzyme EcoRV is closely related to the GATC-recognizing methyltransferases DpnII and dam from E . coli and phage T4; Lauster R et al.; The amino acid sequence of EcoRV DNA methyltransferase which methylates the amino group of the 5'-adenine residue of the target sequence GATATC has been found to be closely related to that of three other adenine methyltransferases, DpnII, dam and damT4, the target sequence of which is GATC . Despite large differences on the DNA level, the four sequences show four blocks of homologies . One of these blocks has the sequence DVYXDPPY and is found with little modification in numerous other DNA methyltransferases . It is speculated that it could be the binding site of the methyl donor, S-adenosylmethionine . On the other hand, the identification of a DNA-binding region is more tenuous . As expected, no analogies with (dimeric) repressors and cro proteins which have the characteristic helix-turn-helix motif have been observed.

FEBS Lett, 1987 Aug 10, 220(1), 136 - 42
Selectivity for maltose and maltodextrins of maltoporin, a pore-forming protein of E . coli outer membrane; Dargent B et al.; Homogenous maltoporin (lamB protein), an Escherichia coli outer membrane spanning protein, was incorporated in phospholipid planar bilayers . It generates aqueous channels distinct from those formed by the non-specific porin (OmpF) or by phosphoporin (phoE protein) . The single conductance, 150 pS in 1 M NaCl, is much smaller than that of the porins . The channels, which are poorly selective for cations and voltage independent, are specifically inhibited by maltose and maltodextrins . This inhibition, observed in the absence of maltose binding protein, demonstrates that the selectivity of maltoporin for maltose and maltodextrins is an intrinsic property of the protein.

Mutat Res, 1987 Aug, 179(2), 143 - 9
Thermal resistance to photoreactivation of ultraviolet light induced mutations in the lacI gene of E . coli ung; Fix DF et al.; Ultraviolet light (UV) induced mutations in the lacI gene of Escherichia coli are thought to be targeted by DNA photoproducts . A number of reports suggest that both cyclobutyl pyrimidine dimers and pyrimidine (6-4) pyrimidone photoproducts may be involved . To investigate the potential contribution of each of these DNA photoproducts to mutagenesis in the lacI gene, we held UV-irradiated cells at a temperature of 44 degrees C for 75 min and then exposed them to photoreactivating light (PR) . This protocol is expected to preferentially deaminate specifically those cytosines that are contained in cyclobutyl dimers and subsequently monomerize the dimers to yield uracils in the DNA . In a strain deficient for uracil-DNA glycosylase (Ung-), these uracils would not be removed and a G:C----A:T transition would result at the site of the dimer . This protocol resulted in the enhancement of amber nonsense mutations that result from transitions at potential cytosine-containing dimer sites . The enhanced mutation frequencies resulting from this procedure were used to estimate the probability of dimer formation at the individual sites . A comparison of the dimer distribution with the mutation frequencies following UV alone suggests that both cyclobutyl dimers and (6-4) photoproducts contribute to UV-mutagenesis in the lacI gene . In addition, we conclude that the frequency of mutation at any particular site not only reflects the occurrence of DNA damage, but also the action of metabolic processes that are responsible for DNA repair and mutagenesis.

Biochem Biophys Res Commun, 1987 Jul 31, 146(2), 470 - 7
Expression of cDNA encoding human basic fibroblast growth factor in E . coli; Iwane M et al.; The cDNA encoding human basic fibroblast growth factor was expressed in E . coli under the control of trp promoter . Bacterially synthesized hbFGF was highly purified using a heparin affinity HPLC column . By this chromatography, hbFGF was eluted as four distinct forms, which were indistinguishable by SDS polyacrylamide gel electrophoresis, amino acid composition, and partial terminal sequence analysis . These molecules stimulated the growth of fibroblasts and endothelial cells although their specific activities varied . The angiogenesis activity of these molecules was also confirmed.

Cell, 1987 Jul 31, 50(3), 485 - 94
A bacterial gene involved in transcription antitermination: regulation at a rho-independent terminator in the bgl operon of E . coli; Mahadevan S et al.; We have investigated the mechanism of regulation of the bgl operon in Escherichia coli K-12 . A regulatory region has been located downstream of the bgl promoter, revealing a 130 base leader containing a sequence from +64 to +112 characteristic of a rho-independent terminator . In vitro, over 90% of the transcripts initiated at the bgl promoter terminate within the leader, at the 3' end of the terminator . Transcriptional fusions containing the terminator require the bglC gene in trans for expression; fusions deleted for the sequence show bglC-independent expression . A mutation resulting in partially constitutive expression of the fusion maps within the terminator . We propose that the bglC gene product mediates positive regulation of the bgl operon by functioning as an antiterminator at the rho-independent terminator located within the leader.

Cell, 1987 Jul 31, 50(3), 495 - 508
The physical map of the whole E . coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library; Kohara Y et al.; Thirty-four hundred lambda phage clones containing segments of the E . coli chromosome were isolated and used to construct a 4700 kb long integrated restriction map for eight six-base-recognizing enzymes by a rapid mass-analysis method . Our strategy was to measure the sizes of partial restriction enzyme digests by hybridization with a vector probe in a manner analogous to nucleotide sequencing . The data were sorted into groups by a computer program and the boundary clones were further correlated with each other using a mass hybridization method . These clones can be exploited for the isolation of any desired E . coli genes if their map positions are known . Also, the strategy is applicable to analyses of the genomes of other organisms.

Cell, 1987 Jul 17, 50(2), 259 - 65
ATP activates dnaA protein in initiating replication of plasmids bearing the origin of the E . coli chromosome; Sekimizu K et al.; ATP is bound to dnaA protein with high affinity (KD = 0.03 microM) and hydrolyzed slowly to ADP in the presence of DNA . ADP is also bound tightly to dnaA protein and exchanges with ATP very slowly . The ATP form is active in replication; the ADP form is not . A unique conformation of oriC, formed in an early initiation stage, depends on dnaA protein being in the ATP form . The subsequent entry of dnaB protein to form a prepriming complex also requires ATP binding and is blocked by bound ADP . Inasmuch as hydrolysis of ATP is far slower than these initiation reactions and since the poorly hydrolyzable analogue ATP gamma S can replace ATP, the ATP function appears to be allosteric . The extraordinary affinity of ATP for dnaA protein, its slow hydrolysis to ADP, the profound inhibition of dnaA functions by ADP, and the very slow exchange of ADP all point to a possible regulatory role for these nucleotides in the cell cycle.

Nucleic Acids Res, 1987 Jul 10, 15(13), 5241 - 50
Specific and cooperative binding of E . coli single-stranded DNA binding protein to mRNA; Shimamoto N et al.; Fluorometric titration of E . coli single-stranded DNA binding protein with various RNAs showed that the protein specifically and cooperatively binds to its own mRNA . The binding inhibited in vitro expression of ssb and bla but not nusA . This inhibition takes place at a physiological concentration of SSB . The function of the protein in gene regulation is discussed.

Bioorg Khim, 1987 Jul, 13(7), 992 - 5
{Localization of a histidine residue in the binding site for the initiating substrate of E . coli RNA-polymerase}; Grachev MA et al.; E . coli RNA polymerase was selectively labelled in the presence of promoters at a histidine residue of the beta-subunit by treatment with GDP beta-imidazolide and then with {alpha-32P}UTP (or {alpha-33P}UTP) . Partial cyanogen bromide cleavage of the labelled polypeptide afforded a series of "single-hit" labelled peptides, the electrophoretic pattern of which suggested that the labelling site was His1237 . This conclusion was confirmed by a similar pattern obtained with products of the cyanogen bromide cleavage of a radioactive peptide obtained by the limited trypsinolysis (C-terminal peptide consisting of 423 amino acid residues) . Interpretation of our earlier results in favour of His1116 as the labelling point (Dokl . Acad . nauk SSSR, 1985, v . 281, p . 723) was incorrect due to the electrophoretic "compression" of three labelled peptide bands.

Biofizika, 1987 Jul-Aug, 32(4), 647 - 51
{Theoretical analysis of H+/O stoichiometry during aerobic oxidation in E . coli in the stationary state}; Drozdov-Tikhomirov LN et al.; A general scheme of E . coli respiratory chain under aerobic oxidation with NAD.H2 is considered . The ratio H+/O is calculated by the currents method for the respiratory chain in a stationary state . The maximal possible stoichiometry is shown to equal 8 . The origin of different H+/O values in the respiratory chains is discussed.

Prikl Biokhim Mikrobiol, 1987 Jul-Aug, 23(4), 530 - 5
{Behavior of the large fragment of DNA polymerase I (the Klenow fragment) during fractionation of a cell-free extract of E . coli MRE-600}; Khomov VV et al.; Distribution of the DNA polymerase I large fragment (Klenow fragment) was studied during fractionation of the E . coli MRE-600 cell-free extract with polyethylenimine . On the basis of the results obtained a simple procedure is proposed that enables the Klenow fragment to be obtained as a coproduct of DNA polymerase I, RNA polymerase, polynucleotide phosphorylase, nucleotide kinases with acetokinase and nucleoside deoxy-ribosyltransferase in the framework of a combined technological scheme.

Acta Physiol Scand, 1987 Jul, 130(3), 359 - 66
The role of prostanoids in the feline intestinal vascular and central haemodynamic responses to i.v . infusion of live E . coli; Schutzer KM et al.; Bacterial infusion in the cat, causing experimental septic shock, induces an early vascular response mainly characterized by pulmonary hypertension and intestinal vasoconstriction . Prostanoids are held to be important mediators of the pulmonary vascular reaction . This study was performed to explore the involvement of prostanoids in the central haemodynamics and the small intestinal vascular reactions in experimental septic shock . Aortic blood pressure was continuously monitored, as were aortic blood flow, the pressure in a . pulmonalis and the small intestinal venous outflow . All cats (n = 24) were given live E . coli (10(10) ml-1) as a continuous intravenous infusion . One series was pretreated with indomethacin, another with UK-38,485, a specific thromboxane A2 synthetase inhibitor, and a third series served as untreated control . The pulmonary hypertensive response was clearly attenuated in the two pretreated series, in fact abolished in the one given UK-38,485 . The early intestinal vasoconstriction was eliminated in the two pretreated series . Later during bacteraemia, when untreated and indomethacin-pretreated cats showed intestinal vasoconstriction, UK-38-485-pretreated animals kept intestinal blood flow within the preseptic range . These data suggest that in the cat, thromboxane A2 is the prostanoid mediating the vascular reactions, not only in the lung but also in the small intestine.

Nucleic Acids Res, 1987 Jun 25, 15(12), 4973 - 85
A common structural feature in promoter sequences of E . coli; Tung CS et al.; We have searched promoter regions of E . coli, structural genes of the same organism, and computer-generated random sequence DNA for the occurrence of common structural features . This is done by converting the base sequence to a series of numbers representing the sequence of helix twist angles and examining these numerical sequences statistically . Common structural features are shared by the promoter regions with a much higher frequency than are found in structural genes or in random sequences . These structures appear to be scattered randomly throughout the promoters, both in terms of the number of such structures per promoter and in terms of location within each promoter . One particular structure consisting of five successive helix twist angles is reported, along with a list of 60 different hexanucleotide sequences that share this structure . The locations of these structural elements in 61 E . coli promoters are also tabulated.

J Biol Chem, 1987 Jun 25, 262(18), 8574 - 83
Optically detected magnetic resonance of tryptophan residues in Escherichia coli ssb gene product and E . coli plasmid-encoded single-stranded DNA-binding proteins and their complexes with poly(deoxythymidylic) acid; Casas-Finet JR et al.; Optically detected magnetic resonance (ODMR) spectroscopy has been applied to several single-stranded DNA-binding (SSB) proteins encoded by conjugative plasmids of enteric bacteria . Fluorimetric equilibrium binding isotherms confirm their preferential binding to single-stranded DNA and polynucleotides and reveal a limited protein solubility at low ionic strength . The plasmid SSB-like proteins show the highest affinity for polydeoxythymidylic acid; these complexes are the least sensitive to disruption by salt . ODMR data on these complexes suggest the existence of stacking interactions between tryptophan residue(s) and thymine bases, as evidenced by spectral red shifts of the tryptophan phosphorescence 0,0 band, reduction of the magnitude of D zero field splitting parameter, and a dramatic reversal of the polarity of the ODMR signals . Wavelength-selected ODMR results point to the existence of two distinct tryptophan sites in these complexes . The triplet state properties of the red-shifted site are drastically altered by its interaction with the thymine bases . The chromosomal Escherichia coli SSB protein-poly(dT) complex shows an additional tryptophan site with zero field splitting parameters similar to those of the free protein . This site can be attributed to Trp-135, which is missing in each of the other plasmid SSB proteins, suggesting that this particular residue is not involved in the interaction with polynucleotides.

Biosci Rep, 1987 Jun, 7(6), 517 - 23
Effect of E . coli endotoxin on temperature, oxygen consumption and brown adipose tissue thermogenesis in rats and mice; Jennings G et al.; The effects of E . coli endotoxin 0127 B8 on oxygen consumption, temperature, and on the activity of the proton conductance pathway in brown adipose tissue (BAT) were investigated in rats and mice . In rats an increase was observed in rectal and skin temperature, whole body oxygen consumption and GDP binding in BAT . In mice only the rise in rectal and skin temperature were significantly changed by endotoxin administration . These findings suggest that in some species BAT is involved in the production of endotoxin induced fever and increased energy expenditure.

Prostaglandins, 1987 Jun, 33(6), 879 - 902
Dose-dependent effects of a pyridoquinazoline thromboxane synthetase inhibitor on arachidonic acid metabolites and hemodynamics during E . coli endotoxemia in anesthetized sheep; Morel DR et al.; We investigated the effects of a new pyridoquinazoline thromboxane synthetase inhibitor infused before administering Escherichia Coli endotoxin into 18 anesthetized sheep with lung lymph fistulas . In normal sheep increasing plasma Ro 23-3423 concentrations were associated with increased plasma levels of 6-keto-PGF1 alpha, a reduced systemic vascular resistance (SVR, r = -0.80) and systemic arterial pressure (SAP, r = -0.92), the mean SAP falling from 80 to 50 mm Hg at the 20 and 30 mg/kg doses . Endotoxin infused into normal sheep caused transient pulmonary vasoconstriction associated with increased TxB2 and 6-keto-PGF1 alpha levels while vasoconstriction and TxB2 increase were significantly inhibited by pretreatment with Ro 23-3423 in a dose-dependent manner . When compared to controls, plasma and lymph levels of 6-keto-PGF1 alpha, PGF2 alpha and PGE2 after endotoxin infusion were increased several-fold by administering Ro 23-3423 up to plasma levels of 10 micrograms/ml . Doses over 30 mg/kg with blood levels above 10 micrograms/ml reduced plasma and lymph levels of 6-keto-PGF1 alpha, PGF2 alpha and PGE2, suggesting cyclooxygenase blockade at this dose . The peak 6-keto-PGF1 alpha levels at 60 min after endotoxin infusion in sheep with Ro-23-3423 levels below 10 micrograms/ml were associated with the greatest systemic hypotension due to a reduced SVR (r = -0.86) . After endotoxin infusion the leukotrienes B4, C4, D4 and E4 in lung lymph were assayed by radioimmunoassay and high pressure liquid chromatography and remained at baseline values.

Vet Immunol Immunopathol, 1987 Jun, 15(3), 223 - 37
Bovine monoclonal antibodies to the F5 (K99) pilus antigen of E . coli, produced by murine/bovine hybridomas; Anderson DV et al.; Lymph node cells from calves immunized with purified pilus antigen of K99+ enterotoxigenic E . coli (ETEC) were fused with mouse myeloma (NSO) cells, and with non-Ig producing mouse/calf hybridomas or with a bovine Ig-producing mouse/calf/calf secondary hybridoma . Lines secreting bovine monoclonal IgG1 specific for K99 pilus antigen in an ELISA were obtained in each case . The two lines derived from xenohybridoma fusion partners have been secreting anti-K99 bovine monoclonal antibody for over one year in continual passage . None of the antibodies cross-reacted with other pilus types including K88, CFAI, CFAII, 987P or CP; they all inhibited agglutination of horse RBC (which have a K99 receptor) in the presence of K99 antigen; they showed positive fluorescence in an indirect binding assay on K99+ ETEC and inhibited K99+ ETEC adhesion to piglet enterocytes . These antibodies have potential prophylactic and therapeutic use in control and treatment of diarrhoea.

Biochem Int, 1987 Jun, 14(6), 1073 - 7
Altered localisation of the precursor of a secreted protein in E . coli by a carboxyl-deletion; Burns DM et al.; The effect on protein localisation of a carboxy-terminal deletion of periplasmic UDP-glucose hydrolase (5'-nucleotidase) has been determined in vivo using immunoprecipitation . The processed form of the truncated protein was found in the periplasm; however, in contrast to the situation with the normal protein, the preprotein form of the truncated protein was also found in the periplasm . This result confirms previous semi-in vitro data and supports the suggestion that a conformational change in a membrane-bound intermediate is a normal part of the secretory pathway.

FEBS Lett, 1987 May 11, 215(2), 269 - 73
Localization of the cellular-fibronectin-specific epitope recognized by the monoclonal antibody IST-9 using fusion proteins expressed in E . coli; Carnemolla B et al.; Here we report on a monoclonal antibody (IST-9) which distinguishes between human cellular and plasma fibronectin . Using beta-galactosidase-fibronectin fusion proteins expressed in E . coli we have demonstrated that this monoclonal antibody is specific for a fibronectin segment (ED) which can be included or omitted from the molecule depending on the pattern of splicing of the mRNA precursors . Furthermore, using the same fusion proteins we have been able to localize precisely the epitopes of two other monoclonal antibodies (IST-1 and IST-2), specific for the heparin-binding domain 5 of fibronectin.

J Biochem (Tokyo), 1987 May, 101(5), 1199 - 208
Characterization of E . coli-derived recombinant human interferon-beta as compared with fibroblast human interferon-beta; Utsumi J et al.; Homogeneous E . coli-derived recombinant human interferon-beta (E . coli-rHuIFN-beta) was characterized in order to elucidate its physicochemical properties, as compared with those of fibroblast human interferon-beta (fibroblast HuIFN-beta) . Purified E . coli-rHuIFN-beta and fibroblast HuIFN-beta exhibited a single band of Mr 19,000 and 23,000, respectively, on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) . The primary structure of E . coli-rHuIFN-beta was identical to the prediction from the cDNA sequence . Furthermore, both the circular dichroism (CD) spectra and the 1H nuclear magnetic resonance (NMR) spectra of E . coli-rHuIFN-beta and fibroblast HuIFN-beta at pH 6.8 were closely similar to each other . On the other hand, on reverse-phase high-performance liquid chromatography (HPLC) using a C18 column, the retention time of E . coli-rHuIFN-beta was longer than that of fibroblast HuIFN-beta . Moreover, although the isoelectric point of E . coli-rHuIFN-beta was pH 8.9, purified fibroblast HuIFN-beta exhibited multiple isoelectric points, probably due to heterogeneity of the carbohydrate moiety . These results indicate that the E . coli-rHuIFN-beta polypeptide folds similarly to fibroblast HuIFN-beta, and the carbohydrate moiety of natural HuIFN-beta has little influence on higher-order structure but does influence the hydrophobic and the electrostatic properties of the molecule.

Biofizika, 1987 May-Jun, 32(3), 477 - 81
{Protein damage after treatment with ozone of protoplasts and isolated E . coli membranes}; Matus VK et al.; The features of ozone-induced damage of E . coli plasma membrane proteins are investigated . A conclusion is made that protein fluorescence quenching is connected with modification of amino acid residues in the vicinity of tryptophane residues . Such modification may be a consequence of reaction with either ozone itself or products of its interaction with membrane lipids and/or proteins . The suggestion of Goldstein and McDonagh that ozone has a predilection for more hydrophilical membrane domains is confirmed . The data obtained are in agreement with a supposition about the leading role of proteins in deleterious action of ozone on cells.

Prikl Biokhim Mikrobiol, 1987 May-Jun, 23(3), 303 - 8
{Isolation and properties of immobilized alkaline phosphatase from E . coli}; Zagrebel'nyi SN et al.; Preparations of alkaline phosphatase from E . coli, immobilized on Sepharose, with a specific activity of 40-60 U/g wet weight were obtained . The immobilized enzyme was stable up to 50 degrees C; at higher temperatures it was inactivated . At 70 degrees most of the activity was lost for 1 h . The substrate (AMP) stabilized the enzyme . In the temperature range from 30 to 40 degrees C activation of the enzyme was observed, especially pronounced in the presence of the substrate . The pH optimum of the immobilized enzyme activity (7.8-8.2) is shifted towards the acid region, as compared to the soluble enzyme (8.0-8.6) . The kinetic parameters for inhibition by the reaction product were determined using the integral Michaelis-Menten equation . KmAMP was found to be higher in case of the immobilized enzyme as compared to the soluble one (5.02 X 10(-4) M and 1.85 X 10(-5) M, respectively), which seems to be associated with diffusion limitations.

Bioorg Khim, 1987 May, 13(5), 599 - 605
{Functionally important lysine residues in inorganic pyrophosphatase from E . coli . II . Isolation and characteristics of modified tryptic peptide and analysis of the functional role of lysine residues controlling enzyme activity}; Komissarov AA et al.; Inactivation of inorganic pyrophosphatase from E . coli by pyridoxal-5'-phosphate is due to the modification of a lysine residue located in the tryptic peptide with the Asp-Leu-Pro-Glu N-terminal sequence . In course of the enzymatic process this lysine-residue appears to be in the protonated state and either operators as the proton donor for the product of the enzymatic reaction or is involved in stabilization of the transition state.

Bioorg Khim, 1987 May, 13(5), 592 - 8
{Functionally important lysine residues in inorganic pyrophosphatase from E . coli . I . Interaction of inorganic pyrophosphatase with pyridoxal-5'-phosphate}; Komissarov AA et al.; Interaction of inorganic pyrophosphatase from E . coli with pyridoxal-5'-phosphate includes binding of the reagent at the active site through the phosphate group and then a reversible modification of one lysine residue in each of the enzyme's subunit . In the equilibrium state the protein's molecules contain both inactive modified and native subunits . A stable secondary amine is formed upon the sodium borohydride reduction of the modified protein.

Mol Gen Mikrobiol Virusol, 1987 May, (5), 34 - 6
{Homology between the ribosomal and RNA-polymerase genes of E . coli and vaccine strain E of Rickettsia prowazekii}; Artem'ev MI et al.; The pIB52 plasmid contains the ribosomal rp1A, J, K, L and RNA-polymerase genes rpo C, B of Escherichia coli . No homology has been found between the plasmid used as a molecular probe and the chromosomal DNA from Rickettsia provazekii in the blot hybridization experiments.

Mol Gen Mikrobiol Virusol, 1987 May, (5), 19 - 22
{Preservation of the beta-galactosidase activity in E . coli cells containing the recombinant pUC19 plasmid}; Paton EB et al.; Two BglII fragments of pJC703 cosmid were inserted into the plasmid PUC19 . E . coli cells containing the recombinant PUC19/A plasmid acquired rifampicin resistance due to inserted rpoB gene but still expressed the Lac+ phenotype.

Biochimie, 1987 May, 69(5), 539 - 41
The effect of dam methylation on the expression of glnS in E . coli; Plumbridge J et al.; The wild type glnS promoter contains a dam methylation site . In dam strains, the expression of glnS is enhanced 2.6-fold . A mutated form of the promoter has been isolated in which the dam methylation site is lost . Expression of this promoter is insensitive to dam methylation.

Biochem Int, 1987 May, 14(5), 911 - 9
Endonucleolytic cleavage of E . coli and pBR 322 DNAs by a placental DNA-binding protein; Premeela T et al.; A 34,000 dalton DNA-binding protein (DBP) has been purified from human placenta . The purified protein possesses endonuclease activities capable of cleaving plasmid pBR 322 and chromosomal DNAs from E . coli . Maximum endonuclease activity was observed in the pH range of 6-9 and at 30 degrees C . The nuclease activity of the DBP was completely lost at 50 degrees C . Nitrocellulose filter binding assays indicate preferential binding of the DBP to ss DNA . The protein did not bind to apurinic DNA and UV-irradiated ds DNA . Consistent with the lack of binding of the DBP to apurinic DNA, this substrate was not cleaved by the DBP . However, native and UV-irradiated E . coli DNAs which showed poor binding were also cleaved by the DBP.

Somat Cell Mol Genet, 1987 May, 13(3), 253 - 65
Histochemical staining of clonal mammalian cell lines expressing E . coli beta galactosidase indicates heterogeneous expression of the bacterial gene; MacGregor GR et al.; An evaluation has been made of the E . coli beta-galactosidase (beta-gal) gene for use as a reporter gene in mammalian cells in culture . We have adopted a histochemical procedure which enables identification of those cells within a population that express the introduced bacterial gene . Data is presented concerning the sensitivity of the histochemical method relative to an immunological method of detection . It has been found that several clonal cell lines generated after transfection of human 293 cells with a Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter-beta-gal construction are mosaic for expression of the introduced mini-gene . Furthermore, after treatment of these clonal cell lines with the nucleoside analog 5-aza-cytidine (5-aza-C), an increase in production of beta-gal under control of this promoter element was observed.

Nucleic Acids Res, 1987 Apr 24, 15(8), 3411 - 20
Isolation of a human genomic fragment, co-amplified with c-Ki-ras, that affects plasmid supercoiling in E . coli; Heighway J et al.; Amplification of cellular proto-oncogenes has been implicated in the development of human malignancies . A library was constructed from genomic DNA extracted from a lung tumour, previously shown to carry an amplified c-Ki-ras 2 gene . Using a v-Ki-ras probe, a fragment with ras homology was isolated and shown to be amplified in the original tumour DNA to the same level as c-Ki-ras . Studies with human hamster hybrids demonstrated that it is normally located on human chromosome 12 (as is c-Ki-ras) . The restriction map of the fragment is different from that of the known Ha, Ki or N-ras genes and its sequence shows evolutionary conservation, as demonstrated by hybridisation to the genomic DNA of several mammalian species . A pUC19 subclone (pK42), carrying a 1.3kb insert, shows supercoil heterogeneity in plasmid preparations, as does a second compatible plasmid introduced into the same bacterial host with pK42 . It appears therefore that the subclone is encoding a product that affects DNA topoisomerase activity in E . coli.

Cell, 1987 Apr 24, 49(2), 241 - 51
Biogenesis of E . coli Pap pili: papH, a minor pilin subunit involved in cell anchoring and length modulation; Baga M et al.; The biogenesis of Escherichia coli Pap pili, encoded by the pap gene cluster, was studied . A novel gene, papH, was identified and found to encode a weakly expressed pilin-like protein . PapH was dispensable for digalactoside-specific binding and for formation of Pap pili . However, in papH deletion mutants 50%-70% of total pilus antigen was found free of the cells . We present evidence showing coregulation of papH and the adjacent gene, papA, which encodes the major pilin subunit . A decrease in the PapA to PapH ratio resulted in a large fraction of cells producing shortened pili, whereas overproduction of PapA relative to PapH resulted in cells with lengthened pili . The data show that PapH has roles in anchoring the pilus to the cell and in modulating pilus length.

Biochem Biophys Res Commun, 1987 Apr 14, 144(1), 447 - 53
Methyl iodide, a potent inducer of the adaptive response without appreciable mutagenicity in E . coli; Takahashi K et al.; Methyl iodide (MeI), a very weak mutagen, induced the adaptive response in E . coli to a similar extent to those induced by potently mutagenic methylating agents . MeI potentiated the mutagenicity of a methylating mutagen, N-methyl-N-nitrosourea, by its co-treatment . These results might give indication that MeI directly methylates O6-methylguanine-DNA methyltransferase resulting in induction of the adaptive response and depletion of the repair capacity of enzyme.

Biochem Biophys Res Commun, 1987 Apr 14, 144(1), 375 - 81
3-13C-methionine-labelled E . coli alkaline phosphatase; Hines D et al.; 3-13C-methionine has been biosynthetically incorporated into E . coli alkaline phosphatase using strain CW3747 which is auxotrophic for Met . 13C NMR of the dimeric native enzyme labelled at the eight methionine residues of the primary structure shows a dispersion of resonance signals permitting resolution of at least five methionine environments, none of which coincide with the chemical shift position of free methionine . At acid pH, 13C signal intensity is shifted to a chemical shift consistent with solvent exposure . However, three discrete resonances are observed, suggesting a retention of defined structure . The labelled protein thus can serve as a probe of conformational alterations of the enzyme.

DNA, 1987 Apr, 6(2), 119 - 28
Chemical mutagenesis of human interferon-beta: construction, expression in E . coli, and biological activity of sodium bisulfite-induced mutations; Stewart AG et al.; A series of modified human interferon-beta (IFN-beta) genes was produced by sodium bisulfite treatment of the IFN-beta gene cloned in M13 . A library of mutated sequences was generated from which subgenomic fragments containing one or a small number of coding alterations were isolated and substituted into the IFN-beta gene in an E . coli expression vector . A number of modified genes and their expression products were evaluated . In several instances levels of expression and biological activity profiles are altered compared to the parental gene product . A number of key amino acids can be identified, whose substitutions have marked effects on biological activity of IFN-beta.

Bioorg Khim, 1987 Apr, 13(4), 565 - 7
{Highly selective affinity labeling of a promoter in a complex with E . coli RNA-polymerase by alkylating derivatives of initiating substrates}; Grachev MA et al.; The complex {promoter A2 X E . coli RNA polymerase} was treated with phosphoamides, derivatives of 4-{N-methyl, N-(2-chloroethyl)}-aminobenzylamine and guanosine-5'-mono-, di-, and triphosphates with the alkylating group attached to the terminal phosphates . After this, {alpha-32P}CTP was added . Residues of the affinity reagents bound covalently at the first stage were elongated by radioactive -pC residues due to the catalytic action of the active centre of RNA polymerase . Affinity labelled were beta-and sigma-subunits of the enzyme, and the promoter . The affinity label was localized on -pGpC residues . A guanine residue was alkylated in the promoter as suggested by radioactivity elimination kinetics . As the data obtained and the previously known length of the reagent (maximum distance between the alpha-phosphorus atom of the reagent and the point of alkylation is less than 0.6 nm) indicate, there is a direct rather than protein-mediated contact between the template and the substrate within the complex {promoter X RNA polymerase}.

J Clin Pharm Ther, 1987 Apr, 12(2), 107 - 15
The effect of pH and concentration on the rates of kill of benzoic acid solutions against E . coli; Hurwitz SJ et al.; Mathematical models were developed which related benzoic acid concentrations to their D-values at room temperature . Linear regression was used to determine D-values (i.e . the time required for a particular concentration of preservative at specified pH, temperature and medium to cause a 90% reduction in the number of viable organisms, e.g . Escherichia coli . A number of concentrations of benzoic acid at either pH 3 or pH 4 were used . Linear regression of the log D-values versus the log of the concentration was used to derive power curves (a minimum of four points per pH were examined) . Concentration exponents, eta-values (the logarithmic values relating changes in rates of kill to specified changes in concentrations) and A-values (extrapolated D-values at 1% concentration), were determined . The effect of pH on the eta and A-values of benzoic acid on E . coli was investigated . Benzoic acid was found to be more sensitive to pH changes than was anticipated from the Henderson-Hasselbalch equation which relates dissociated and undissociated fractions at the two pH levels investigated . However, the sensitivity of preservative activity to dilution at both pH values (3 and 4), as given by the eta-value, remained similar.

Bioorg Khim, 1987 Apr, 13(4), 552 - 5
{Localization of lysine residues in the site of initiating substrate binding of E . coli RNA-polymerase}; Grachev MA et al.; Superselective affinity labelling of E . coli RNA polymerase in a complex with the promoter-containing fragment of T7 DNA by treatment with orto-formylphenyl ester of GMP followed by addition of {alpha-33P}UTP resulted in covalent binding of the residue--pGpU (p-radioactive phosphate) with one of lysine residues of the beta-subunit, Lys1048, Lys1051, Lys1057, Lys1065 . The amino acid sequence of this region of the beta-subunit of E . coli RNA polymerase has a high extent of homology with that deduced for a region of tobacco chloroplast RNA polymerase on the basis of the nucleotide sequence of the chloroplast rpoB-like gene.

Z Naturforsch {C}, 1987 Apr, 42(4), 394 - 400
E . coli maltodextrin phosphorylase: primary structure and deletion mapping of the C-terminal site; Palm D et al.; The complete 796 residue amino acid sequence of maltodextrin phosphorylase was deduced from the E . coli malP nucleotide sequence . The calculated molecular weight of 90,500, including pyridoxal phosphate, is significantly larger than experimentally determined values . Enzymatically active and inactive mutants following deletion or exchange of up to 8 codons (7 amino acids) at the 3' end (C-terminus) confirm the size of the mature native enzyme and disclose the essential functional or structural role of the highly conserved C-terminal region of phosphorylases.

Nucleic Acids Res, 1987 Mar 25, 15(6), 2627 - 38
The effect of codon usage on the oligonucleotide composition of the E . coli genome and identification of over- and underrepresented sequences by Markov chain analysis; Phillips GJ et al.; As shown in the accompanying paper (5), the oligonucleotide composition of the E . coli genome is highly asymmetric for sequences up to 6 bp in length when ranked from highest to lowest abundance . We show here that this largely reflects codon usage because heavily used codons were found in the highly abundant oligomers whereas rarely used codons, with some exceptions, occurred in sequences in low abundance . Furthermore, linear regression analysis revealed a strong correlation between the frequencies of each trinucleotide and its usage as a codon . Dinucleotides are also not randomly distributed across each codon position and the dinucleotide composition of genes that are transcribed but not translated (rRNA and tRNA genes) was highly related to that seen in genes encoding polypeptides . However, 45 tetra-, 8 penta-, and 6 hexanucleotides were significantly over- or underabundant by Markov chain analysis and could not be accounted for by codon usage . Of these underrepresented sequences, many were palindromes, including the Dam methylation site.

FEBS Lett, 1987 Mar 23, 213(2), 297 - 300
dam methylase from E . coli . Circular dichroism investigations of the secondary structure and influence of S-adenosylmethionine; Kriebardis A et al.; The enzyme dam methylase which recognizes and methylates the adenine in the palindromic sequence GATC in DNA was isolated and the secondary structure was determined by CD spectroscopy and various predicting methods from the amino acid sequence . The interaction of dam methylase with S-adenosylmethionine was studied by CD spectroscopy indicating a decrease of the percentage of alpha-helix as the amount of S-adenosylmethionine bound to the enzyme was increased.

FEBS Lett, 1987 Mar 23, 213(2), 261 - 4
Expression of the cell-binding domain of human fibronectin in E . coli . Identification of sequences promoting full to minimal adhesive function; Obara M et al.; Two cDNA subfragments containing the cell-attachment site of human fibronectin (FN) were expressed as beta-galactosidase fusion proteins in E . coli . The products were purified to homogeneity by monoclonal antibody affinity chromatography and assayed for activity in a standard cell-adhesion assay . A fusion protein containing an 80 kDa fragment of human FN appeared functionally equivalent to intact FN purified from human plasma, whereas a truncated fusion protein of 33 kDa still containing a previously postulated cell-attachment site was approx . 50-fold less active . Our study establishes a system for analyzing adhesive protein function by DNA manipulation, rules out any major role for eukaryotic post-translational modifications in FN adhesive function, and localizes additional functional activity to a 1.3 kb region.

Nucleic Acids Res, 1987 Mar 11, 15(5), 2343 - 61
Analysis of E . coli promoter sequences; Harley CB et al.; We have compiled and analyzed 263 promoters with known transcriptional start points for E . coli genes . Promoter elements (-35 hexamer, -10 hexamer, and spacing between these regions) were aligned by a program which selects the arrangement consistent with the start point and statistically most homologous to a reference list of promoters . The initial reference list was that of Hawley and McClure (Nucl . Acids Res . 11, 2237-2255, 1983) . Alignment of the complete list was used for reference until successive analyses did not alter the structure of the list . In the final compilation, all bases in the -35 (TTGACA) and -10 (TATAAT) hexamers were highly conserved, 92% of promoters had inter-region spacing of 17 +/- 1 bp, and 75% of the uniquely defined start points initiated 7 +/- 1 bases downstream of the -10 region . The consensus sequence of promoters with inter-region spacing of 16, 17 or 18 bp did not differ . This compilation and analysis should be useful for studies of promoter structure and function and for programs which identify potential promoter sequences.

FEBS Lett, 1987 Mar 9, 213(1), 155 - 8
Spacer alterations which increase the expression of porcine growth hormone in E . coli; Vize PD et al.; Full-length porcine growth hormone (PGH) cDNA clones were isolated from a porcine pituitary cDNA library . When the coding portion of the PGH gene was cloned into an E . coli expression vector downstream from the powerful trc promoter, high levels of mRNA, but no protein were detected . Mutation directed by an oligodeoxynucleotide primer altered 5'-non-coding sequences and raised the level of PGH produced from undetectable to 15% of the total cellular protein . Alteration of four codons infrequently used by E . coli in the 5'-end of the gene produced no further increases.

J Appl Physiol, 1987 Mar, 62(3), 1141 - 9
Pulmonary pressor responses in sheep to chemically defined precursors of E . coli endotoxin; Burhop KE et al.; The toxicity of various monosaccharide and disaccharide endotoxin precursors has now been studied in sheep . We measured the early pulmonary arterial pressure responses after injections of the monosaccharides lipid X (2,3-diacylglucosamine 1-phosphate) and MAGP (2-monoacylglucosamine 1-phosphate), of the tetraacyl disaccharide diphosphate precursor of lipid A, IV-A (Federation Proc . 43: 1567, 1984), and of Escherichia coli bacterial endotoxin (lipopolysaccharide) . We also measured the response of lipid X after prior administration of indomethacin and MAGP . Lipid X, at a total cumulative dose of 40 micrograms/kg, produced an immediate, but transient dose-dependent pulmonary arterial vasoconstrictive response . MAGP, at a total dose of 40 micrograms/kg, had no pulmonary pressure activity but did increase extravascular lung water and produce some histological changes in the lung . Disaccharide precursor IV-A, at a total dose of 40 micrograms/kg, produced an immediate dose-dependent pulmonary arterial vasoconstrictive response that was prolonged for greater than 2 h . E . coli endotoxin caused a delayed (15-min) increase in the pulmonary arterial pressure but one that also persisted for greater than 2 h . Prior administration of indomethacin blocked the pulmonary pressor activity of lipid X, whereas prior administration of MAGP increased both the magnitude and the duration of the pulmonary pressure response of lipid X . We conclude that the initial pulmonary hypertension seen after lipid X injection may involve cyclooxygenase-dependent formation of prostaglandins and that the genesis of this pulmonary pressor activity is at least in part dependent on the ester-linked hydroxymyristoyl moiety at position 3 of the lipid X molecule.(ABSTRACT TRUNCATED AT 250 WORDS)

Mutat Res, 1987 Mar, 183(2), 123 - 7
Proteolytic processing of the Ada protein that repairs DNA O6-methylguanine residues in E . coli; Teo IA; In extracts of E . coli treated with an adapting regime of MNNG, the induced 39kd Ada protein having O6-MeG-DNA methyltransferase activity is processed to a 19kd active domain corresponding to the C-terminal half of the intact protein . This proteolytic processing has been followed on Western immunoblots using antisera raised against the 19kd fragment . Initial processing at 25 degrees C or 37 degrees C mainly generates a fragment of mol . wt . 24kd which then undergoes a slower second cleavage to generate the 19kd active domain . Preceding this second cleavage site is a sequence of amino acids Thr- -Gly-Met-Thr- -Lys that also occurs at another site in the N-terminal half of the 39kd methyltransferase . It is proposed that this sequence is a recognition site for proteolytic activity . On the basis of cleavage of the Ada protein at either one or both of these sites, fragments may be generated of mol . wt . 24kd and 19kd containing the active site for O6-methylguanine and O4-methylthymine repair, and 15kd and 20kd, containing the active site for methylphosphotriester repair . These observations explain previous reports by others on the existence in cell extracts of multiple methyltransferase activities of different sizes recognizing O-methyl lesions in DNA . The cellular protease involved is resistant to a wide range of protease inhibitors.

Bioorg Khim, 1987 Mar, 13(3), 344 - 9
{Effectiveness of substituting E . coli DNA-polymerase for DNA-polymerase A in oligonucleotide-directed mutagenesis}; Petrenko VA et al.; The possibility to use the E . coli intact DNA polymerase I in the oligonucleotide-directed site-specific mutagenesis of DNA has been studied . Optimal conditions of the extension activity of this enzyme were found . We have shown that the substitution of the Klenow fragment of the E . coli DNA polymerase by the intact DNA polymerase I did not decrease the efficiency and fidelity of the oligonucleotide-directed mutagenesis.

Biochimie, 1987 Mar, 69(3), 215 - 21
The structure of the promoter and amino terminal region of the pH 2.5 acid phosphatase structural gene (appA) of E . coli: a negative control of transcription mediated by cyclic AMP; Touati E et al.; The regulatory and promoter regions of the gene for acid phosphatase of optimum pH 2.5 (appA) of Escherichia coli has been characterized by constructing appA-lacZ protein fusions . Monitoring of beta-galactosidase activity showed that the cloned fragment harbored a region that was responsible for a negative control of transcription mediated by the cAMP-cAMP receptor (CAP) complex . The nucleotide sequence of the segment was determined . A region containing a putative CAP binding site, overlapping the -10 region of the promoter was found . Deletion analysis around the promoter region, using appA-lacZ protein fusions substantiated the hypothesis for a role of the 'consensus' sequence in the negative control mediated by cyclic AMP . In addition, the coding sequence revealed the likely existence of a signal peptide similar to the one found for other exported proteins, upstream from the phosphatase protein sequence.

Biull Eksp Biol Med, 1987 Mar, 103(3), 332 - 4
{Functional properties of E . coli SSB-proteins in vivo}; Aizenberg OA et al.; An essential function of single-stranded DNA-binding (SSB) proteins--a defense from nuclease action, determined by their first and second domains, is realized in conditions of normal cell metabolism . With the inhibition of the replicative furcula growth and total protein synthesis (imbalance state), the SSB protein function associated with the third domain and responsible for certain modifications in DNA polymerase II activity is realized . This causes DNA degeneration and increases radiosensitivity of cells.

Genes Dev, 1987 Mar, 1(1), 57 - 64
Induction of the heat shock response of E . coli through stabilization of sigma 32 by the phage lambda cIII protein; Bahl H et al.; The cIII protein of phage lambda favors the lysogenic response to infection by inhibiting the degradation of the lambda cII protein, which exerts the primary control on the developmental decision for lysis or lysogeny . To study the mechanism and scope of cIII-mediated regulation, we have used plasmid systems to examine the specific effect of cIII overproduction on the growth of Escherichia coli and the synthesis of bacterial proteins . We have found that maximal production of cIII prolongs the heat-induced synthesis of E . coli heat shock proteins and provokes elevated production of heat shock proteins even at low temperature . The overproduction of heat shock proteins is correlated with a rapid inhibition of cell growth, as judged by measurements of optical density . We suggest that an overactive heat shock response inhibits bacterial growth, either because excessive production of one or more of the proteins is highly deleterious or because only heat shock promoters are transcribed efficiently . To examine the effect of cIII on sigma 32, the specificity factor for the heat shock response, we have studied the stability of sigma 32 in cells carrying both cIII- and sigma 32-producing plasmids; the half-life of sigma 32 is increased fourfold in the presence of cIII . We conclude that overproduction of cIII provokes the heat shock response by increasing the steady-state level of active sigma 32 . These studies also support the concept that the rate of expression of heat shock proteins is directly correlated with the amount of active sigma 32 and that regulation of the stability of sigma 32 may be an important factor for control of the heat shock response.

Z Naturforsch {C}, 1987 Mar, 42(3), 288 - 96
Acyclonucleoside analogues consisting of 5- and 5,6-substituted uracils and different acyclic chains: inhibitory properties vs purified E . coli uridine phosphorylase; Drabikowska AK et al.; Synthetic procedures are described for the preparation of a variety of pyrimidine acyclonucleoside analogues, in which the aglycones are 5- and 5,6-substituted uracils, and the ribose moiety is replaced by different acyclic chains . These were examined as potential inhibitors of purified E . coli uridine phosphorylase . None of the compounds was a substrate for uridine phosphorylase, or either a substrate or inhibitor of E . coli thymidine phosphorylase . Kinetic measurements were employed to determine inhibition constants, Ki, for inhibition of uridine phosphorylase . One of the more effective of these was 1-(1',3'-dihydroxy-2'-propoxy)methyl-5,6-tetramethyleneuracil, with Ki = 2.7 microM . The same compound was a reasonably good inhibitor of the reverse, synthetic, reaction, with Ki values of 19 microM vs uracil as the variable substrate, and 15 microM vs alpha-D-ribose-1-phosphate as the variable substrate . For one of the analogues, which was a racemate, 1-(2',3'-dihydroxypropyl)-5,6-tetramethyleneuracil, it was shown that only one of the enantiomers (R) was an inhibitor, the (S) enantiomer being totally inactive . For several of the analogues, the corresponding isomeric N(3)-acyclonucleosides were inactive as inhibitors . The results for several of the good inhibitors were compared with those of other observers for inhibition of uridine phosphorylase from mammalian sources . Preliminary measurements with several of our analogues demonstrated that some of them were indeed one to two orders of magnitude more effective against the enzyme from mammalian sources.

FEBS Lett, 1987 Feb 23, 212(2), 233 - 6
trp operon induction during the expression in E . coli of two IFN-gamma sequences; Sverdlov ED et al.; Two nucleotide sequences coding for mature human immune interferon (IFN-gamma) and differing from each other by nine N-terminal nucleotides were expressed in E . coli under the control of a trp promoter . The longer gene variant after the ATG initiatory codon contained a TGT TAC TGC sequence, which was absent in the shorter gene . When expressed in E . coli under the direction of identical transcription and translation regulatory elements, these genes showed different susceptibility to induction.

Biochem Biophys Res Commun, 1987 Feb 13, 142(3), 964 - 71
Characterization of the guanosine-3'-diphosphate-5'-diphosphate binding site on E . coli RNA polymerase using a photoprobe, 8-azidoguanosine-3'-5'-bisphosphate; Owens JR et al.; Nucleotide binding sites on DNA-dependent RNA polymerase from E . coli have been studied by photoaffinity labeling with a GTP analog {gamma-32P}-8-AzidoGTP and a guanosine-3'-diphosphate-5'-diphosphate analog, 8-Azidoguanosine-3'-phosphate-5'-85'-32P}phosphate . The guanosine diphosphate photoprobe labeled the beta, beta', and sigma subunits with the sigma subunit being most heavily labeled . The GTP photoprobe also labeled the beta, beta', sigma subunits but the beta' subunit was most heavily labeled . In competition experiments guanosine-3'-diphosphate-5'-diphosphate decreased photolabeling by 8-Azidoguanosine-3'-phosphate-5'-{5'-32P}phosphate better than GTP, while the opposite was true for photolabeling with {gamma-32P}8- AzidoGTP . The guanosine diphosphate photoprobe inhibited transcription on E . coli DNA with Ki of ca . 150 microM . Present studies suggest a unique ppGpp binding site distinct from substrate binding site(s) and this photoprobe may be used to localize this binding site(s).

Nucleic Acids Res, 1987 Feb 11, 15(3), 1109 - 20
Binding of E . coli DNA photolyase to a defined substrate containing a single T mean value of T dimer; Husain I et al.; The E . coli DNA photolyase is a flavoprotein that catalyzes the photoreversal of pyrimidine dimers . The enzyme binds to DNA containing pyrimidine dimers in a light-independent step and repairs the dimer upon absorbing a photon in the 300-600 nm range . The rate and equilibrium constants for the light-independent reaction were determined before, using randomly modified substrates that contained T mean value of T, T mean value of C and C mean value of C dimers in random sequence surrounding . In this paper we have determined these constants for a defined substrate (a 43 bp oligomer containing a T mean value of T dimer) using the gel retardation assay . We find that: the equilibrium constant and the off rate obtained with this substrate by this technique are similar to those obtained with randomly modified DNA using filter binding and flash photolysis techniques . the off rate with the defined substrate is heterogeneous indicating heterogeneity in the enzyme population or in the enzyme-substrate complexes, and the enzyme has 7.5 X 10(4)-fold higher affinity for pyrimidine dimer compared to non-dimer DNA nucleotides.

DNA, 1987 Feb, 6(1), 41 - 6
Expression of an interferon-alpha gene variant in E . coli using tandemly repeated synthetic ribosomal binding sites; Grundstrom T et al.; A human interferon-alpha 2 gene variant was expressed in Escherichia coli under the control of the tryptophan operon promoter and of a series of synthetic partially overlapping ribosomal binding sites, which control initiation of translation . Variation in the distance between the start codon and such a set of ribosomal binding sites affected the level of interferon expression much less than previously described for single ribosomal binding sites.

Cell, 1987 Jan 30, 48(2), 281 - 7
Stimulation of a Chlamydomonas chloroplast promoter by novobiocin in situ and in E . coli implies regulation by torsional stress in the chloroplast DNA; Thompson RJ et al.; We have characterized regulation of a complex Chlamydomonas reinhardtii chloroplast (PA) whose activity is stimulated by the DNA gyrase inhibitor novobiocin, both in the alga itself and in a heterologous Escherichia coli plasmid system . Since novobiocin is known to reduce torsional stress in E . coli DNA, we interpret our results to mean that PA is regulated by torsional stress in the chloroplast DNA . In E . coli, where we could readily manipulate PA, we found that this regulation depends on sequences upstream of PA . These sequences contain at least two different kinds of silencing elements that inhibit PA in the absence of novobiocin . Novobiocin stimulates PA only when the promoter-distal silencing element is present.

Biochem Biophys Res Commun, 1987 Jan 30, 142(2), 302 - 8
P-chlorophenylalanine does not inhibit production of recombinant human phenylalanine hydroxylase in NIH3T3 cells or E . coli; Ledley FD et al.; P-chlorophenylalanine is an irreversible inhibitor of rat phenylalanine hydroxylase in vivo and in rat hepatoma cells and is frequently administered to rodents to create an animal model for phenylketonuria . We investigated the effect of p-chlorophenylalanine on production of human phenylalanine hydroxylase in human hepatoma cells and cells transformed with the recombinant human phenylalanine hydroxylase gene . P-chlorophenylalanine inhibited production of the human enzyme in human hepatoma cells and transformed mouse hepatoma cells but had no effect on the production of the enzyme in transformed NIH3T3 cells or in E . coli . Thus, phenylalanine hydroxylase inhibition does not result from a simple interaction between the drug and enzyme.

Nucleic Acids Res, 1987 Jan 26, 15(2), 785 - 96
Sequence distributions associated with DNA curvature are found upstream of strong E . coli promoters; Plaskon RR et al.; The regions upstream from forty-three procaryotic promoters were examined for nucleotide distributions which have been associated with DNA curvature . The analysis procedure assigned a DNA curvature score based on the phasing of the 5' and 3' ends of An and Tn tracts, n greater than or equal to 3 . The weighting scheme for the curvature score was based on recent studies which showed that tracts of An and Tn periodically phased with the helix repeat cause DNA curvature . Results show that promoters which have high transcription initiation rates in vivo tend to have high curvature scores in their upstream regions . Regions downstream from the transcription start-point do not have sequences correlated with DNA curvature . Four promoters which have been shown to have upstream activation regions have curvature scores above 1.5 in their -40 to -150 regions . The correlations observed lend support to the hypothesis that DNA curvature is associated with upstream activation of transcription.

Nucleic Acids Res, 1987 Jan 26, 15(2), 575 - 94
Dynamic and structural characterisation of multiple steps during complex formation between E . coli RNA polymerase and the tetR promoter from pSC101; Duval-Valentin G et al.; Kinetic, functional and structural studies of the recognition of the tetR promoter from pSC101 by E . coli RNA polymerase allowed the characterization of several steps in the specific complex formation and transcription initiation process . First, enzyme and DNA enter in a short life-time complex . An isomerization will convert this unstable complex into a closed stable one where RNA polymerase is tightly attached without establishing stable chemical contacts with the bases . In the next step, stable close contacts appear between both macromolecules involving mainly the downstream part of the promoter . A further isomerization will lead to an open complex where DNA is locally melted and the system is able to initiate transcription . This latter process is accompanied by changes in the upstream part of the promoter . Finally, in vitro transcription assays showed that the position of the major transcription start sites depends on temperature . From the reported results, it appears that the recognition event is a sequential process where different structural elements of the promoter, that can be located apart in the sequence, are involved in a concerted manner in each stage.

FEBS Lett, 1987 Jan 26, 211(2), 155 - 9
Role of tryptophan 54 in the binding of E . coli single-stranded DNA-binding protein to single-stranded polynucleotides; Khamis MI et al.; Fluorescence and optical detection of triplet state magnetic resonance spectroscopy have been employed to study the complexes formed by single-stranded polynucleotides with both E . coli single-stranded DNA-binding protein and an E . coli ssb gene product in which Trp-54 is replaced by phenylalanine using site specific oligonucleotide mutagenesis . Our results strongly suggest the involvement of Trp-54 in stabilizing the protein-nucleic acid complexes via stacking interactions of the aromatic residue with the nucleotide bases.

Nucleic Acids Res, 1987 Jan 26, 15(2), 771 - 84
DNA sequence of the E . coli gyrB gene: application of a new sequencing strategy; Adachi T et al.; We have determined the sequence of the E . coli gyrB gene, using a new sequencing approach in which transposition from a mini-Mu plasmid into the DNA provides random start points for dideoxynucleotide sequence analysis . The gyrB sequence corresponds to a protein 804 amino acids long; a previously isolated protein fragment with partial enzymatic activity has been identified as the C-terminal half-molecule . A plausible terminator of gyrB transcription is located just beyond the structural gene.

FEBS Lett, 1987 Jan 19, 211(1), 49 - 52
Loss of transforming activity of plasmid DNA (pBR322) in E . coli caused by singlet molecular oxygen; Wefers H et al.; Plasmid DNA pBR322 in aqueous solution was exposed to singlet molecular oxygen (1O2) generated by microwave discharge . DNA damage was detected as loss of transforming activity of pBR322 in E . coli (CMK) dependent on the time of exposure . DNA damage was effectively decreased by singlet-oxygen quenchers such as sodium azide and methionine . Replacement of water in the incubation buffer by D2O led to an increase in DNA damage . 9,10-Bis(2-ethylene)anthracene disulfate was used as a chemical trap for 1O2 quantitation by HPLC analysis of the endoperoxide formed.

Nature, 1987 Jan 15-21, 325(6101), 281 - 4
Initiation of translation is impaired in E . coli cells deficient in 4.5S RNA; Bourgaize DB et al.; The 4.5S RNA of Escherichia coli is a small, stable RNA that is essential for cell growth but its function is not yet known . Its biosynthesis is stringently controlled, and it is processed by RNase P, a transfer RNA processing enzyme . To identify the biological role of the 4.5S species, we have characterized the physiological changes that occur when the bacterial cell is depleted of this RNA . We used a strain of E . coli in which synthesis of the 4.5S RNA can be turned off by removing an inducer of the Iac operon, resulting in cell death . We report here that an early consequence of depriving the cell of 4.5S RNA is the accumulation of translationally-defective ribosomes, which maintain their ability to elongate polypeptide chains, but can no longer participate in the initiation of protein synthesis.

FEBS Lett, 1987 Jan 5, 210(2), 147 - 52
The expression in E . coli of a polymeric gene coding for an esterase mimic catalyzing the hydrolysis of p-nitrophenyl esters; Bulow L et al.; We have prepared a hybrid protein consisting of seven esterase units, Glu-Ala-His-Ala-Ser-Phe-Phe-Phe, fused to the N-terminal of galactokinase (E . coli) . The structural gene for this bifunctional protein was obtained by cloning a polymer made up of three chemically synthesized oligonucleotides to which the galactokinase gene was fused in frame . The hybrid protein was purified to homogeneity with the aid of the galactokinase moiety and showed an Mr of 51,000-53,000 . The preparation could catalyze the hydrolysis of p-nitrophenyl esters and, due to the inbuilt hydrophobic spacers, Phe-Phe-Phe, improved catalysis of more hydrophobic substrates was obtained.

Biomed Biochim Acta, 1987, 46(1), 59 - 66
{In vitro effects of E . coli endotoxin on the membrane permeability and substrate transport of isolated rat liver mitochondria}; Kopprasch S et al.; Incubation of freshly isolated rat liver mitochondria with E . coli endotoxin resulted in an increased inner membrane permeability for K+ and Cl- ions . This effect was not prevented by addition of the synthetic antioxidant butylated hydroxytoluene . The carrier-mediated transport rates of phosphate, pyruvate, citrate and reducing equivalents via the malate-aspartate shuttle were not altered significantly by endotoxin . Therefore, the endotoxin-mediated impairment of mitochondrial respiration and oxidative phosphorylation could not be attributed to a decrease in transport capacities through the inner mitochondrial membrane.

Circ Shock, 1987, 21(1), 59 - 64
Protein and energy metabolism in liver tissue following intravenous infusion of live E . coli bacteria in rats; Pedersen P et al.; In the present study protein synthesis and energy level in liver tissue were studied in bacteremic rats following intravenous infusion of 8 +/- 4 X 10(9) live E . coli bacteria and in control animals receiving a corresponding infusion of sterile saline . For the study of protein synthesis, liver slices were incubated in a medium containing 14C-leucine and incorporation rate of amino acid into protein was determined . Hepatic concentrations of ATP, ADP, and AMP were measured and energy charge (EC) was calculated . Twenty-four hours after infusion of E . coli, hepatic protein synthesis rate was 55% higher than in control animals . Liver weight and hepatic protein content were also increased in bacteremic animals . There were no significant differences in adenine nucleotide levels or EC in liver tissue between control and bacteremic animals . Since impairment of various other liver functions has been reported during sepsis, the present results suggest that hepatic protein synthesis has high priority in this condition.

Mutat Res, 1987 Jan, 183(1), 39 - 44
Effect of pKM101 plasmid on lethal and mutagenic damage in UV-irradiated E . coli strains; Nunoshiba T et al.; Introduction of the R-factor plasmid pKM101 increased resistance to UV-killing in uvr lexA(Ind-) recA+ strains of E . coli K12 as well as B, while their UV mutability was not affected . Similar effects were also observed in those strains when the 18-B plasmid (a pBR322 derivative carrying the region (about 5 kb) of the 35.4 kb pKM101 plasmid) was introduced . The muc genes which are considered to be involved in error-prone repair are contained in 18-B . These results suggest the possibility that the pKM101 effect requires the host recA gene and a common genetic region, including the muc genes, in both plasmids and is associated with some unmutable repair systems.

Mutat Res, 1987 Jan, 183(1), 21 - 9
Further characterization of an E . coli strain resistant to the toxic and mutagenic action of cis-diamminedichloroplatinum(II); Villani G et al.; An increased resistance to the toxic and mutagenic activity of the antitumor drug cis-diamminedichloroplatinum(II) (cis-DDP) in the E . coli strain BS21 compared to its wild-type parent, F26, has been reported . This resistance was neither due to different binding of cis-DDP to DNA nor to adaptive DNA repair (Germanier et al., 1984) . In the present work, we found that mutation of the uvrA, recA and polA genes did not abolish the resistance of BS21 to the toxic action of cis-DDP . The lower mutability of BS21 was not influenced by the polA mutation, while uvrA greatly reduced and recA eliminated the mutagenic activity of cis-DDP in both strains . Treatment of BS21 and F26 with equal doses of cis-DDP produced the same initial number of platinum-DNA lesions . Little excision repair was detected in vivo in either strain during 6-h post-treatment incubation, the F26 strain being the most efficient of the two for this process . In contrast, F26 and BS21 were transformed identically by pBR322 DNA which had been treated with cis-DDP in vitro . Analysis of the platinum-DNA adducts which were formed between cis-DDP and salmon sperm DNA in the buffer conditions of this experiment suggests that plasmid DNA contains 80% monofunctional adducts and 20% bifunctional bis-guanine adducts . These data indicate that the selective toxicity and mutagenicity of these two strains in vivo are neither a result of different numbers of Pt-DNA lesions nor of their repair . The selectivity disappeared when the two bacterial strains were transformed by pBR322 DNA containing identical platinum-DNA lesions, suggesting that the biochemical events which process platinum-DNA lesions are the same in both strains . Hence, it appears that cis-DDP may form qualitatively different platinum-DNA adducts in the BS21 and F26 strains which are responsible for the different toxicity and mutagenicity.

Viral Immunol, 1987, 1(2), 97 - 109
Expression and characterization of hepatitis B virus precore-core antigen in E . coli; Lanford RE et al.; The hepatitis B virus core antigen, including the precore sequence (HBcAg-p25), was expressed at very high levels in bacteria . Three expression vectors were constructed in which the synthesis of HBcAg-p25 was controlled by the tac promoter, and the number of nucleotides between the bacterial ribosome binding site and the precore initiation codon was varied in order to maximize HBcAg-p25 synthesis . The relative amount of HBcAg-p25 polypeptide expressed by the different vectors was estimated by SDS-polyacrylamide gel electrophoresis and immunoblot . HBcAg-p25 was associated with an insoluble fraction of bacterial extracts and required ionic detergents for solubilization . Comparison by ELISA of the immunoreactivity of HBcAg with and without the precore sequence suggested that human anti-HBcAg IgG preferentially recognizes HBcAg lacking the precore sequence.

Curr Genet, 1987, 12(4), 241 - 6
Functional in vivo verification in E . coli of promoter activities from the rDNA/tDNA(Val)(GAC) leader region of Zea mays chloroplasts; Delp G et al.; Restriction fragments containing upstream sequences of the rRNA operon from Zea mays chloroplasts were tested for promoter activity in vivo by insertion into an E . coli promoter-probe vector . The expression of this vector's reporter gene, which codes for alkaline phosphatase, was stimulated more than 1,500-fold upon linkage with the chloroplast rRNA promoter . Site specific mutagenesis of the invariant T of the -10 sequence of this promoter reduced the expression of the reporter gene to 2% of the wild type . This indicates that the chloroplast rRNA promoter, which directs transcriptional initiation 117 bp upstream of the 16S rRNA gene, is also active in the bacterial system . A restriction fragment further upstream containing the gene for tRNA(Val) (GAC) also showed strong promoter activity (29% as compared with the rRNA promoter) . This promoter activity probably reflects the chloroplast promoter directing the synthesis of the tRNA(Val) (GAC) primary transcript . Surprisingly, this restriction fragment also displayed promoter activity (13% compared with the rRNA promoter) in reverse orientation.

Proteins, 1987, 2(1), 42 - 53
Subunit assembly and metabolic stability of E . coli RNA polymerase; Ishihama A et al.; Immunological cross-reaction was employed for identification of proteolytic fragments of E . coli RNA polymerase generated both in vitro and in vivo . Several species of partially denatured but assembled RNA polymerase were isolated, which were composed of fragments of the two large subunits, beta and beta', and the two small and intact subunits, alpha and sigma . Comparison of the rate and pathway of proteolytic cleavage in vitro of unassembled subunits, subassemblies, and intact enzymes indicated that the susceptibility of RNA polymerase subunits to proteolytic degradation was dependent on the assembly state . Using this method, degradation in vivo was found for some, but not all, of the amber fragments of beta subunit in merodiploid cells carrying both wild-type and mutant rpoB genes . Although the RNA polymerase is a metabolically stable component in exponentially growing cells of E . coli, degradation of the full-sized subunits was found in two cases, i.e., several temperature-sensitive E . coli mutants with a defect in the assembly of RNA polymerase and the stationary-phase cells of a wild-type E . coli . The in vivo degradation of RNA polymerase was indicated to be initiated by alteration of the enzyme structure.

Padiatr Padol, 1987, 22(3), 293 - 303
{E . coli dyspepsia}; Lachmann D; The incidence of EPEC infections has decreased dramatically in industrialized countries since the 1960s, 1970s, but EPEC remains an important of acute gastroenteritis in developing countries.

CRC Crit Rev Biochem, 1987, 22(3), 181 - 219
Structure and function of E . coli promoter DNA; Travers AA; The process of transcription initiation requires both the recognition of a promoter site by RNA polymerase and the melting of a short stretch of DNA . In this review I discuss the properties of promoters that are relevant to sequence recognition and to the ability of the polymerase to act as a melting protein . The regulation of promoter activity is thus dependent on both factors interacting with RNA polymerase and so altering its affinity for promoter sites and also modulations of DNA structure.

Int Urol Nephrol, 1987, 19(1), 27 - 32
The effect of E . coli infection on the prostaglandin synthesizing capacity of postobstructive rat kidney; Sallai J et al.; The PGE2, PGI2, PGF2 alpha and TxA2 synthesizing activities were studied in an isolated microsomal fraction of rat kidney after temporary, unilateral ureter obstruction and E . coli infection . In the early phase of regeneration the synthesis of vasodilatory PGI2 was increased, whereas that of vasoconstrictory PGF2 alpha was decreased . An increased PGE2 synthesizing activity was observed when renal obstruction was associated with infection . The role of these changes in regenerating the haemodynamics and function of postobstructive kidney is discussed.

Nahrung, 1987, 31(5-6), 625 - 9
{Intestinal beta-galactosidase in gnotobiotic animals following monoassociation with various E . coli strains}; Schulze J et al.; Germ-free rats were monoassociated by E . coli germs not utilizing (L-) or utilizing lactose (L+) on endo-medium . There was no influence of germ status on the beta-galactosidase activity in the mucosa of the small and large intestine . With standard food, beta-galactosidase activity were to be measured in the chymus of all intestinal segments and in the faeces of germ-free as well as of monoassociated rats . In the chymus of caecum and colon and in the faeces of E . coli(L+)-animals, only, the short-time (12-16 days) application of lactose containing food resulted in an increase of the enzyme activity . Compared with the E . coli(L-)-animals, the lactose content in the chymus of all intestinal segments of this test group was decreased.

Int J Biochem, 1987, 19(1), 47 - 52
The inactivation of beta-galactosidase (E . coli) by the carbodiimide reaction; Gaunt MT et al.; When beta-galactosidase reacted with 1-ethyl-3(3-dimethylaminopropyl)-carbodiimide (EDC), activity was lost . The inhibitor, isopropyl-beta-D-galactopyranoside (IPTG), decreased inactivation . Of 3 nucleophiles tested, incorporation was only decreased in the protected (IPTG added) enzyme when sulfanilic acid was the nucleophile but HPLC profiles of tryptic peptides were identical in protected and unprotected enzyme (except for magnitude) . There were also no differences (except for magnitude) of HPLC profiles after 10 and 90 min of reaction and between active (soluble) and inactive (precipitated) enzyme . The data indicate that inactivation is not caused by reaction with a specific active site group . Inactivation probably occurs when a combination of groups are reacted.

FEBS Lett, 1987 Jan 1, 210(1), 56 - 60
Chemical synthesis and expression in E . coli of a human Val8-calcitonin gene by fusion to a synthetic human interferon-gamma gene; Ivanov I et al.; A gene coding for human Val8-calcitonin (Val8-hCT) was synthesized by the solid-phase phosphite approach and fused to a synthetic human immune interferon-gamma (IFN-gamma) gene . The IFN gene was previously shown to be expressed at a very high level in E . coli {(1986) Gene, in press} due to the control of a strong synthetic promoter and strong ribosome binding site . The cells harboring the fused gene produced 100-150 micrograms per l of bacterial suspension of immunoreactive calcitonin in the form of hybrid IFN-gamma-Val8-hCT protein consisting of 140 amino acids . The Val8-hCT can be released from this protein by CNBr treatment.

Biull Eksp Biol Med, 1987 Jan, 103(1), 80 - 3
{Characteristics of the B subunit of a thermolabile Escherichia coli enterotoxin produced by the A-B+ E . coli strain}; Voronov SE et al.; The preparation and identification of B subunit of thermolabile enterotoxin produced by A-B+ gene-containing strain are described . The E . coli strain studied is shown to produce protein identical in its molecular properties and antigenic specificity to B subunit obtained from the whole thermolabile enterotoxin . Partial antigenic affinity between B subunits of thermolabile enterotoxin obtained from different sources and B subunit from cholera enterotoxin has been established in immunochemical studies . Electrophoretic and immunochemical analysis has confirmed the absence of A-subunit admixtures in B-subunit preparation obtained from /A-B+/E . coli strain.

Circ Shock, 1987, 21(1), 23 - 9
Effects of E . coli endotoxin on rat plasma angiotensin converting enzyme activity in vitro and in vivo; Deitz DM et al.; Angiotensin converting enzyme (ACE), a glycoprotein, is found in high concentration in pulmonary capillary endothelial cells . Several investigators have studied the relationship between various direct and indirect pulmonary insults and ACE activity and in some cases have found conflict . In an attempt to clarify this relationship we have examined the effect of endotoxin on rat plasma ACE activity in vitro and in vivo . We used the synthetic ACE substrate 3H-BPAP and the assay described by Catravas and Gillis {J Pharmacol Exp Ther 217:263-270, 1981} . In vitro, a statistically significant concentration-dependent reduction in ACE activity was demonstrated (p less than .005) . In vivo an intravenous dose of endotoxin (20 mg/kg) alone resulted in no significant change in plasma ACE activity . However, the combination of intravenous endotoxin (20mg/kg) and mild hemorrhage (5-10% of blood volume) caused a statistically significant reduction in plasma ACE activity by 15 min as compared to control rats with hemorrhage only (39% vs . 66%, p less than .005) . This reduction persisted at 30 and 60 min . However, by 180 min ACE activity was no longer statistically different from control values . We have demonstrated an acute reduction of plasma ACE activity in the endotoxemic rat that appears to be dependent on the amount of circulating endotoxin and the presence of mild blood loss.

FEBS Lett, 1987 Jan 1, 210(1), 11 - 6
cDNA cloning and expression in E . coli of a plasminogen activator inhibitor (PAI) related to a PAI produced by Hep G2 hepatoma cell; Wun TC et al.; The human hepatoma line Hep G2 produces an acid- and SDS-sensitive plasminogen activator inhibitor (PAI) . This protein has been previously purified and used to raise polyclonal antibodies . This antiserum has been used to isolate cDNA clones from a human placental lambda gt11 cDNA library . The immunologically positive clones were screened for expression of recombinant proteins which inhibit urokinase activity and form an inhibitor-enzyme complex with 125I-urokinase . Two positives (lambda PAI 11.1 and lambda PAI 14.1) have been obtained . The cDNA insert of the longer isolate (lambda PAI 14.1) consists of 1962 base pairs encoding the entire mature Hep G2 PAI and a 3'-noncoding region of 801 base pairs . The clone apparently lacks portions of 5'- and 3'-untranslated sequences . The translated amino acid sequence matches the sequence obtained for the mature Hep G2 PAI and consists of 379 amino acids with a molecular mass of 42 770 Da . Interestingly, this PAI clone is quite different from the placental-type PAI-2 sequence as expected, but matches the sequence of the endothelial-type PAI (PAI-1) reported to be acid-insensitive and SDS-enhancible.

Z Naturforsch {C}, 1987 Jan-Feb, 42(1-2), 129 - 33
Evolution of E . coli tRNA(Ile): evidence of derivation from other tRNAs; Staves MP et al.; Two E . coli tRNA(Ile) sequences were compared against those of 36 other E . coli tRNAs . tRNA(Ile) 1 was found to bear high similarity with tRNA(Val) 1 (E = 1.11 X 10(-18} while tRNA(Ile) 2 had the greatest match (E = 3.40 X 10(-19} with tRNA(Lysl) (E is the expected number of such matches, per search, based on coincidence) . These matches, which we consider to represent homologies, extend from base 7 to base 67 in the former and base 7 to the end (76) in the latter pair . These results coupled with others on the lower activity of isoleucine in reactions postulated to be important in primitive protein synthesis (i.e., esterification reactions and non-enzymatic activation by ATP {1-3}) lead us to propose that isoleucine was included among the proteinaceous amino acids, and received its anticodonic assignment, relatively late in evolution through mutation of tRNAs previously employed for other amino acids.

Oncogene Res, 1987, 2(1), 95 - 101
Expression in E . coli of erg: a novel gene in humans related to the ets oncogene; Rao VN et al.; We have recently cloned a novel human gene named erg related to the ets oncogene . In this report we describe the expression of the erg gene product in E . coli under the control of the tightly-regulated phage lambda PL promoter . Two expression vectors were utilized for the synthesis of the cII-erg and erg-fusion proteins . All these products were recognized by peptide antibodies prepared against the predicted amino acid sequences of erg and the Hu-ets-2 domain which shares homology with erg.

Biol Cell, 1987, 61(1-2), 1 - 4
Inclusion bodies in recombinant E . coli producing human calcitonin tetramer, as visualized by immuno-gold electron microscopy; Petrov P et al.; Inclusion bodies are described in recombinant E . coli cells harboring plasmid for the expression of a synthetic gene coding for human calcitonin tetramer . The inclusion bodies are visualized by electron microscopy and the protein is identified by immuno-gold technique, using antibodies against synthetic human calcitonin . The diameter of the inclusion bodies is 1 micron on the average.

Arch Virol, 1987, 97(3-4), 365 - 72
Expression of an early Epstein-Barr virus antigen (EA-D) in E . coli . Brief report; Roeckel D et al.; The 1.34 kb BcII-BgIII-fragment of the BamHI-M region of Epstein-Barr virus genome, comprising the complete BMRF1 open reading frame, was cloned into the tryptophan regulated E . coli expression vector pATH1 . The resulting fusion protein, having a molecular weight of 80 kd, is recognized not only by anti-early antigen (EA)-positive human sera but also by the monoclonal antibody R3 directed against the diffuse component of EA (EA-D) . A possible use for this fusion protein as an indicator protein in diagnosis of IgA antibodies against EA-D is presented.

Vet Med Nauki, 1987, 24(6), 19 - 24
{Phenotypic characteristics of a new modification-restriction system in E . coli}; Popovski B; It has been demonstrated phenotypically that there exists a new modificational-and-restrictional system as synthesized by the recombinant Escherichia coli tF strain . A series of passages of the T3 and T7 phages and their mutants in E . coli tF has made it possible to ascertain a specific modification of the phage DNA, with was shown to be induced by the host strain . The high level of adsorption of these phages on the cell surface of E . coli tF has ruled out the possibility of existing of a 'nonclassical' modification and restriction of DNA . In view of the further characterizing of this modificational-and-restrictional system of E . coli tF it has been comparatively studied with the already known modificational-and-restrictional systems isolated from various Escherichia coli strains . Results have shown that no identity exists between the tested systems and the one in E . coli tF . It is stated that the new modificational-and-restrictional system of E . coli tF belongs to none of the three known types of restrictional endonucleases.

Biochem Biophys Res Commun, 1986 Dec 30, 141(3), 1138 - 44
Inhibition of E . coli adenylate cyclase activity by inorganic orthophosphate is dependent on IIIglc of the phosphoenolpyruvate:glycose phosphotransferase system; Liberman E et al.; The relationship of adenylate cyclase, inorganic orthophosphate and the proteins of the phosphoenolpyruvate:glycose phosphotransferase system (PTS) was studied . A strain deleted for the genes for Enzyme I and IIIglc of the PTS was transformed with plasmids expressing either Enzyme I and HPr, IIIglc or all three proteins . The fully reconstituted strain showed a Pi-dependent stimulation of adenylate cyclase activity; in contrast, the strain expressing only IIIglc showed a Pi-dependent inhibition of adenylate cyclase activity.

Cell, 1986 Dec 26, 47(6), 995 - 1005
The DNA binding domain and bending angle of E . coli CAP protein; Liu-Johnson HN et al.; We use a new gel electrophoretic analysis to map the thermodynamically defined DNA binding domain of Escherichia coli CAP protein in the lac promoter . Strong binding interactions span a 28-30 bp duplex DNA region, substantially larger than that found for typical repressors . Sequence changes outside the central 28 bp of the binding site are found to affect the electrophoretically observed extent of bending . We also report a study of the DNA bending induced at a symmetrized CAP binding site, compared with the wild-type site; binding and bending are stronger at the upstream than at the downstream half of the wild-type site . Bends of the estimated 90 degrees - 180 degrees magnitude could play a vital regulatory role by producing tertiary structure in a local DNA domain, and by storing elastic energy for subsequent use in transcription or replication.

Carbohydr Res, 1986 Dec 15, 158, 91 - 9
Synthesis of 2,6-anhydro-S-{ethylmercury(II)}-1-thio-D-glycero-L-manno-heptitol+ ++ and bis(2,6-anhydro-1-thio-D-glycero-L-manno-heptitol)mercury(II), and the study of their interaction with beta-D-galactosidase from E . coli; John C et al.; Two competitive inhibitors of beta-D-galactosidase activity, namely, 2,6-anhydro-S-{ethylmercury(II)}-1-thio-D-glycero-L-manno-heptitol (4) and bis(2,6-anhydro-1-thio-D-glycero-L-manno-heptitol)mercury(II) (6), with inhibition constants of 8.0 X 10(-4) M and 1.9 X 10(-4) M, were synthesized . Compound 6 was incorporated into the crystalline enzyme by cocrystallization . The stoichiometry of the enzyme-inhibitor complex was 1:4, corresponding to one molecule of inhibitor per active site of the enzyme . Compound 4 was found to be unstable against X-ray irradiation, whereas compound 6 was submitted to X-rays for several days without any radiation damage.

Biochem Biophys Res Commun, 1986 Dec 15, 141(2), 804 - 11
Expression of human interleukin-2 receptor cDNA in E . coli; Chanda PK et al.; cDNAs for human interleukin-2 receptor were recently cloned and sequenced (Leonard et al., 1984, Nature 311, 626-631; Nikaido et al., 1984, Nature 311, 631-635; Cosman et al., Nature 312, 768-771) . In the studies reported here, we describe the expression of a cDNA clone for the human interleukin-2 receptor in E . coli using an "open reading frame" expression vector pMR100 . The inserted cDNA was expressed in E . coli transformants as a tripartite fusion polypeptide fused to the lambda cI protein at its amino terminus and to beta-galactosidase at its carboxy terminus . We demonstrate that the bacterially produced IL-2 receptor protein can bind to IL-2.

FEBS Lett, 1986 Dec 15, 209(2), 325 - 9
Absence of a unique relationship between active transport of lactose and protonmotive force in E . coli; Ghazi A et al.; The relationship between active transport of lactose via the lactose permease and the protonmotive force has been determined in E . coli cells using either the respiratory chain inhibitor cyanide or protonophores to decrease the protonmotive force progressively . In contradiction with the prediction of the delocalized chemiosmotic theory, two different relationships were obtained depending on the method used.

Science, 1986 Dec 12, 234(4782), 1392 - 5
HTLV-III/LAV-neutralizing antibodies to an E . coli-produced fragment of the virus envelope; Putney SD et al.; Immunization with either an Escherichia coli recombinant segment of the human T-cell lymphotropic virus (HTLV-III/LAV) envelope protein (gp 120) or with deglycosylated gp 120 envelope protein produced antibodies that neutralize HTLV-III/LAV infection in vitro . Virus neutralization titers of these antisera were equivalent to those obtained with purified native gp120 as immunogen . This localizes at least one class of neutralizing epitopes to the carboxyl-terminal half of the molecule . In addition, native gp120 prevented HTLV-III/LAV--mediated cell fusion, whereas the recombinant gp120 fragment did not . This shows that although glycosylation is not required for induction of neutralizing antibodies, it may be important for interaction with CD4, the virus receptor . A segment of the HTLV-III/LAV envelope produced in E . coli may be an important ingredient of a vaccine for acquired immune deficiency syndrome.

J Clin Lab Immunol, 1986 Dec, 21(4), 177 - 81
Effect of intravenous immunoglobulin on E . coli opsonization in multiple myeloma; Hertler AA et al.; Infections are a major source of morbidity in multiple myeloma; E . coli is now the leading pathogen . Intravenous IgG may be a modality which could ameliorate the opsinopathy of multiple myeloma . We infused 6 patients with multiple myeloma with IgG (100 mg/kg) and compared E . coli opsonophagocytosis pre- and post-IgG infusions . Log phase, broth grown E . coli K12 (5 X 10(6)/ml) and normal, dextran-sedimented human neutrophils (5 X 10(6)/ml) were combined in 10% heat inactivated, pre- or post-IgG infusion multiple myeloma serum with 5% agammaglobulinemic serum as a complement source and incubated at 37 degrees C for 30 min . Phagocytosis was quantified as percentage survival of the inoculum . Control survival in heat inactivated normal serum + complement + neutrophils was 1.7 +/- 0.8% . Pre- and post-IgG infusion sera were equally abnormal opsonin sources with 14.3 +/- 6.5% and 17.5 +/- 3.0% survivals . Individually, patients with poor opsonophagocytosis improved with IgG (e.g., pre = 45.2 +/- 3.7%; post = 29.5 +/- 2.3% survival), whereas patients with good opsonophagocytosis showed a deleterious effect (e.g., pre = 2.3 +/- 0.9%; post 23.3 +/- 6.3% survival) . To explain these data, we measured deposited IgM and IgG on E . coli by pre- and post-IgG infusion sera in a fluorescence immunoassay . Pre- and post-IgG infusion sera had equally depressed IgM deposition (pre = 13.7 +/- 2.1%; post = 14.5 +/- 2.6% of normal serum), and also equal IgG deposition (pre = 96.8 +/- 6.5%; post = 94.6 +/- 4.8% of normal serum).(ABSTRACT TRUNCATED AT 250 WORDS)

Bioorg Khim, 1986 Dec, 12(12), 1678 - 81
{Affinity modification of E . coli RNA-polymerase in a complex with the promoter by phosphorylating derivatives of primer oligonucleotides}; Grachev MA et al.; Oligonucleotides 2 to 7 nucleotide residues long, complementary to the codogenic strand of T7 promoter A2, have been synthesized; all of them contained a ribo-unit at the 3'-end . They were converted into 5'-(N-methyl)phosphoimidazolides, and the affinity reagents obtained were allowed to bind covalently to RNA polymerase in the presence of a promoter . Some of the nucleotide residues covalently attached occupied proper positions relative to the active centre of the phosphodiester bond synthesis and on addition of {alpha-32P}UTP were elongated, so that highly selective affinity labelling occurred . With oligonucleotides of various lengths, different distribution of the label between beta, beta' and sigma subunits of RNA polymerase took place . Most efficient was labelling of beta-subunit by the residue--pCpGpCpU, and of sigma-subunit by the residue--pApApApTp-CpGpCpU (p--radioactive phosphorus atom) . In both cases, the amino acid residues labelled were histidines.

Zentralbl Bakteriol Mikrobiol Hyg {B}, 1986 Dec, 183(1), 58 - 66
{Estimating the biological effect of detrimental substances on E . coli with flow microcalorimetry . III . Studies using m-cresol in glucose phosphate buffer}; Hartung J; Investigations are carried out to characterize the influence of the phenolic compound m-cresol on the heat production of glucose-respiring E . coli cells suspended in glucose phosphate buffer in a flow microcalorimeter according to the method of Perry et al . (5) The results are usually obtained within one hour . When testing m-cresol by this method thermic irritations occurred . A modified test procedure which largely avoids these troubles is described . The height (Q = heat flow) of the power-time-curves is evaluated 30 min and 60 min after the addition of the test substance . These values are compared to the values obtained from control-curves without any test substance . The 60 min-values seem less variable than the 30 min-values . The minimum effective m-cresol concentrations come to 7.50 mmol/l after 30 min and to 9.37 mmol/l after 60 min . The coefficients of variation are distinctly lower than +/- 10% at concentrations of less than 11.25 mmol/l . The coefficients of variation from 3 to 5 tests can extend +/- 20% both for the 30 min-values and the 60 min-values at higher concentrations (e.g . 15 mmol/l) . Under the influence of increasing m-cresol concentrations the germ content in the solution and the heat flow decrease in a similar way . The results indicate that the used flow microcalorimetric technique is suitable to check the effect of a test substance on a test culture within only one hour's time . Possibly, the method can be helpful for pretesting disinfectants . The gathering of further experience with this system seems advisable.

EMBO J, 1986 Dec 1, 5(12), 3219 - 25
A synthetic operon containing 14 bovine pancreatic trypsin inhibitor genes is expressed in E . coli; von Wilcken-Bergmann B et al.; A synthetic gene encoding the protein sequence of mature bovine pancreatic trypsin inhibitor (BPTI) has been cloned into a novel E . coli expression vector . After in vitro gene amplification by successive DNA duplications, more than 600 000 mostly inactive inhibitor molecules may be recovered from a single cell . After purification the inhibitory activity can be reconstituted almost completely . The specificity of BPTI for trypsin is abolished by a single amino acid exchange from lysine to isoleucine at position 15 . The altered protein is shown to be an efficient inhibitor of human leukocyte elastase.

Immunology, 1986 Dec, 59(4), 541 - 8
Induction of inflammatory mediators from human polymorphonuclear granulocytes and rat mast cells by haemolysin-positive and -negative E . coli strains with different adhesins; Scheffer J et al.; We investigated the role of various E . coli strains that expressed different adhesins and/or generated haemolysin with regard to the induction of inflammatory mediators, e.g . histamine release from rat mast cells as well as the chemiluminescence response and the release of lipoxygenase transformation products from human polymorphonuclear neutrophils . Our data show that the degree of haemagglutination did not parallel the induction of the chemiluminescence response . Haemolysin-negative bacteria with different adhesins induced more 5-hydroxyeicosatetraenoic acid as compared to haemolysin-positive bacteria, which generated more leukotriene B4 as compared to 5-hydroxyeicosatetraenoic acid . Among the leukotrienes, more leukotriene B4 as compared to leukotriene C4 was released from peripheral leucocytes . Studies with rat mast cells showed that histamine release was dependent on the haemolysin activity expressed by washed bacteria or present within the bacterial culture supernatant . Histamine release was markedly diminished when haemolysin activity decayed . Several haemolysin-negative bacteria with defined adhesins also released histamine, suggesting that, in addition to haemolysin, other factors contribute to mediator release . Thus, various properties of bacteria (e.g . adhesins, haemolysin) may participate to varying degrees in the induction of inflammatory mediators, e.g . oxygen radicals, lipoxygenase transformation products, leucotrienes and histamine.

FEBS Lett, 1986 Nov 24, 208(2), 211 - 6
Sequence-imposed structural constraints in the TonB protein of E . coli; Evans JS et al.; The solution conformation of a 33-residue peptide segment, derived from the TonB protein which is implicated in bacterial membrane transport processes, has been investigated using high-resolution proton magnetic resonance techniques . This proline-rich peptide possesses sequence-imposed sections of elongated secondary structure that must be retained in the native protein configuration . These structural constraints provide elements of stiffness that imply a purely structural role for TonB and are relevant to the subcellular location and biological role of the protein . On the basis of these data we suggest that this protein spans the periplasmic space, linking the inner and outer membrane components of TonB-dependent transport systems.

Eur J Biochem, 1986 Nov 3, 160(3), 441 - 9
Substitution of uridine in vivo by the intrinsic photoactivable probe 4-thiouridine in Escherichia coli RNA . Its use for E . coli ribosome structural analysis; Favre A et al.; In vivo incorporation of the uridine-photoactivable analogue, 4-thiouridine, into the ribosomal RNA of an Escherichia coli pyrD strain has been demonstrated . It is highly dependent on the exogenous uridine and 4-thiouridine concentrations as well as on temperature . We have defined conditions allowing the substitution of 13 +/- 2% of the uridine residues in bulk RNA by 4-thiouridine . On a high-Mg2+ sucrose gradient, 33 +/- 3% of ribonucleic particles sediment as 70S ribosomes, the remaining being in the form of non-associated 50S and 30S particles containing immature rRNA . The thiolated 70S ribosomes tolerate a 4-5% substitution level (40 thiouridine molecules/particle) . Surprisingly, 3-4% of ribosomal proteins, about two protein molecules/particle, were spontaneously covalently bound to 4-thiouridine-substituted rRNA . Specific 366-nm photoactivation increased this proportion to 10-12%, i.e . up to six or seven ribosomal protein molecules/particle . The photochemical cross-linking proceeds with apparent first-order kinetics with a quantum yield close to 5 X 10(-3) . Although extensive photodynamic breakage of rRNA occurs under aerobic conditions, both the kinetics and yield of ribosomal protein cross-linking were independent of oxygenation conditions . The thiolated (4.5%) 70S ribosomes allowed the poly(U)-directed poly(Phe)synthesis at 48% the control rate . Photoactivation decreased this activity to 28% and 10% when performed under nitrogen and in aerated conditions, respectively.

J Urol, 1986 Nov, 136(5), 1117 - 22
Immunology of pyelonephritis . VIII . E . coli causes granulocytic aggregation and renal ischemia; Kaack MB et al.; We studied renal venous blood after renal infection for its concentrations of leukocytes, complement and renin . In addition, we evaluated this blood for granulocytic aggregation and chemiluminescence of granulocytes . We found that very rapid activation of serum complement occurred with associated granulocytic aggregation and evident vascular occlusion and ischemia since renin rose rapidly . It appears that this early sequence of events will cause renal damage by ischemic change, as well as that known to occur from the inflammatory reaction.

Proteins, 1986 Nov, 1(3), 247 - 55
Kinetic characterization of early intermediates in the folding of E . coli tryptophan-synthase beta 2 subunit; Blond S et al.; This report describes the use of fluorescence energy transfer between an intrinsic energy donor (tryptophan 177) and two chemically added acceptors to study intermediates in the folding of the beta 2 subunit of E . coli tryptophan-synthase . Two early folding steps are thus identified and characterized . One is very rapid (its rate constant at 12 degrees C is 0.02 sec-1) and corresponds to the folding of the N-terminal domain into a structure whose overall features approximate well those of the native domain . The second step is somewhat slower (its rate constant at 12 degrees C is 0.008 sec-1) and involves a conformational rearrangement of the N-terminal domain brought about by the interactions between the N- and C-terminal domains within a monomeric beta chain . This brings to five the number of intermediates which have been identified and ordered on the folding pathway of the dimeric beta 2 subunit.

Int J Radiat Biol Relat Stud Phys Chem Med, 1986 Nov, 50(5), 861 - 9
Radiation protection of E . coli strains by cysteamine in the presence of oxygen; Hulsewede JW et al.; The survival of various E . coli K12 strains with defects in the rec system have been measured after gamma-irradiation in air in the presence (0.1 mol dm-3) or in the absence of cysteamine . The results confirm those of Bresler et al . (1978) indicating that the protection by cysteamine in the presence of oxygen is due to an influence on enzymatic repair . The low protection by cysteamine of wild-type cells pretreated with chloramphenicol which prevents protein synthesis, supports the above conclusion . The reason for the absence of a protective effect by OH radical scavenging and H-atom donation is discussed . It is proposed that DNA peroxyl radicals are formed during irradiation in the presence of oxygen and that they are transformed into hydroperoxides by H-atom donation from the intracellular glutathione and the added cysteamine . These hydroperoxides are still dangerous for the cell as indicated by the protective action of glutathione peroxidase observed by Marklund et al . (1984).

Mutat Res, 1986 Nov, 166(3), 299 - 42
Mutagenesis and repair of DNA damage caused by nitrogen mustard, N,N'-bis(2-chloroethyl)-N-nitrosourea (BCNU), streptozotocin, and mitomycin C in E . coli; Fram RJ et al.; Cytotoxicity and mutagenesis by streptozotocin, BCNU, nitrogen mustard, and mitomycin C were evaluated in E . coli mutants deficient in SOS repair, SOS-mediated mutagenesis, the adaptive response, and mutants that engage in aberrant mismatch repair . The results demonstrate that premutagenic lesions are caused by nitrogen mustard, BCNU and streptozotocin that are not repaired by ada or recognized by umuDC . Further, recA mutants were hypomutable after exposure to nitrogen mustard, BCNU, and streptozotocin compared to wild type . With the exception of the monofunctional nitrosourea, streptozotocin, both recA and uvrA gene products contribute to the repair of DNA damage caused by the alkylating agents tested . In the case of streptozotocin, although recA mutants were more sensitive than wild type, uvrA mutants were not . Moreover, while ada and alkA E . coli mutants showed increased sensitivity to streptozotocin, they were not more sensitive to the other alkylating agents evaluated.

Mutat Res, 1986 Nov, 166(3), 243 - 54
Cytotoxicity and SOS-inducing ability of ethidium and photoactivable analogs on E . coli ethidium-bromide-sensitive (Ebs) strains; Lambert B et al.; In a recently-characterized ethidium-bromide-sensitive E . coli strain, DNA appears to be much more accessible to DNA-binding agents . This strain therefore appears to be of interest for studying the mutagenic properties of chemicals . For this purpose, a series of ethidium-sensitive E . coli strains (Ebs) with normal and defective DNA-repair capacity was constructed and made lysogenic for lambda (sfiA::lacZ) . These strains were used to study the cytotoxicity and SOS-inducing ability of ethidium and its two photoactivable analogs 8-azido- and 3,8-diazido-ethidium . When non-covalent DNA complexes are formed, these dyes elicit only a bacteriostatic effect in the Ebs strains, which is almost independent of the strain's DNA-repair capacity . The SOS system is not induced . When covalent DNA adducts are formed after photoactivation of ethidium azido analogs, the effects are quite different . The formation of about 5 DNA monoadducts per cell induces a lethal hit in the Ebs uvrB recA strain and measurable SOS induction in the Ebs uvrB (lambda (sfiA::lacZ) strain . The formation of more than 1000 DNA adducts in the Ebs strain with normal DNA-repair capacity does not induce any measurable cytotoxic effect.

Nucleic Acids Res, 1986 Oct 24, 14(20), 7851 - 60
High level production and rapid purification of the E . coli trp repressor; Paluh JL et al.; Two small, multicopy, expression plasmids were constructed that permit convenient insertion of trpR, the structural gene for the trp repressor of Escherichia coli, with its natural ribosome binding site or adjacent to the ribosome binding site for the trp leader peptide . In these plasmids trpR is positioned between the strong regulated tac promoter and the rpoC transcription terminator . IPTG induction of lacIq strains bearing these plasmids results in the production of 25-50% of the soluble cell protein as trp repressor . Mutant and wild type repressors overproduced in this manner have been purified by simple procedures.

Nucleic Acids Res, 1986 Oct 10, 14(19), 7529 - 39
The proofreading of hydroxy analogues of leucine and isoleucine by leucyl-tRNA synthetases from E . coli and yeast; Englisch S et al.; Three analogues each of leucine and isoleucine carrying hydroxy groups in gamma- or delta- or gamma- and delta-position have been synthesized, and tested in the aminoacylation by leucyl-tRNA synthetases from E . coli and yeast . Hydrolytic proofreading, as proposed in the chemical proofreading model, of these analogues and of homocysteine should result in a lactonisation of these compounds and therefore provide information regarding the proofreading mechanism of the two leucyl-tRNA synthetases . Leucyl-tRNA synthetase from E . coli shows a high initial substrate discrimination . Only two analogues, gamma-hydroxyleucine and homocysteine are activated and transferred to tRNALeu where a post-transfer proofreading occurs . Lactonisation of gamma-hydroxyleucine and homocysteine could be detected . Leucyl-tRNA synthetase from yeast has a relatively poor initial discrimination of these substrates, which is compensated by a very effective pre-transfer proofreading on the aminoacyl-adenylate level . No lactonisation nor mischarged tRNALeu is detectable.

Nucleic Acids Res, 1986 Oct 10, 14(19), 7705 - 11
Nucleotide sequences of the gal E gene and the gal T gene of E . coli; Lemaire HG et al.; The nucleotide sequences of the gal E gene coding for UDP-galactose-4-epimerase and the gal T gene coding for galactose-1-P uridyltransferase of Escherichia coli have been determined . UDP-galactose-4-epimerase and galactose-1-P uridyltransferase are predicted to consist of 338 and 347 residues, respectively, NH2-terminal methionines included.

FEBS Lett, 1986 Oct 6, 206(2), 323 - 8
Palindromic units from E . coli as binding sites for a chromoid-associated protein; Gilson E et al.; Several hundred copies of a highly conserved extragenic palindromic sequence, 20-40 nucleotides long, exist along the chromosome of E . coli and S . typhimurium . These have been defined as palindromic units (PU) or repetitive extragenic palindromes (REP) . No general function for PUs has been identified . In the present work, we provide data showing that a protein associated with a chromoid extract of E . coli protects PU DNA against exonuclease III digestion . This provides the first experimental evidence that PU constitutes binding sites for a chromoid-associated protein . This result supports the hypothesis that PUs could play a role in the structure of the bacterial chromoid.

J Biomol Struct Dyn, 1986 Oct, 4(2), 291 - 307
Distribution and evolution of sequence characteristics in the E . coli genome; Blake RD et al.; The mean (G + C) composition (51.0%) and standard deviation (+/- 3.8%) of published DNA sequences accounting for 10% of the E . coli genome is in excellent agreement with the principal overall distribution determined by high resolution melting . While differences in base and neighbor characteristics are small and uniform throughout all regions of the genome, it is found that the (G + C) content of sequences varies in segmented fashion within boundaries corresponding to coding (53% G + C) and noncoding (46% G + C) regions; with variances in the latter being six-fold greater than in coding regions . The variance in different regions shows a strong negative dependence on (G + C) content of the region, reflecting the condition that A-T and G-C base pairs are preferred neighbors of A-T and C-G pairs, respectively; with the bias increasing with decreasing (G + C) content . Neighbor analysis indicates the most extreme positive biases occur in AA, TT, GC and CG throughout all regions, but particularly in noncoding regions . Extraordinary numbers of oligomeric strings of (A)n, etc., are the further consequence of this bias . These and other characteristics point to the existence of inherent biases in neighbor frequencies levied during replication or repair, and which reflect, in turn, neighbor influences during mutation . The bias in codon usage noted by Grantham and others is seen here as due, in part, to the adaptation of coding sequences to this microenvironment through selection among synonymous codons so as to preserve inherent neighbor biases.

J Biomol Struct Dyn, 1986 Oct, 4(2), 193 - 203
Studies on anticodon-anticodon interactions: hemi-protonation of cytosines induces self-pairing through the GCC anticodon of E . coli tRNA-Gly; Romby P et al.; The temperature-jump method was used to compare the stability of anticodon-anticodon duplexes formed by the self-association of two tRNAs: yeast tRNA-Asp and Escherichia coli tRNA-Gly . Yeast tRNA-Asp duplexes contain a U/U mismatch while E . coli tRNA-Gly dimers have a C/C mismatch in the middle position of their quasi self-complementary anticodons GUC and GCC, respectively . At neutral pH, it is found that only tRNA-Asp duplexes exist whereas at pH 5.0 only tRNA-Gly duplexes are formed . This reflects the hemiprotonation of the N3 of the cytosines at pH 5.0 which induces a pairing between the two middle residues of the anticodon GCC in E . coli tRNA-Gly . This is the first evidence that a protonated C-C(+) base pair is compatible with the formation of a double helix with antiparallel strands in a natural RNA molecule.

Nucleic Acids Res, 1986 Sep 25, 14(18), 7227 - 35
Cloning and expression of a cDNA encoding a maize glutathione-S-transferase in E . coli; Moore RE et al.; The isolation and characterization of a family of maize glutathione-S-transferases (GST's) has been described previously . These enzymes are designated GSTs I, II and III based on size, substrate specificity and responsiveness to safeners . GST III has been shown to act on the herbicide alachlor as well as the commonly used substrate 1-chloro-2,4-dinitrobenzene (CDNB) . Clones were isolated from a maize cDNA library in lambda gt10 . Three clones contained the entire coding region for GST III . The sequences of these clones were consistent with the known amino terminal GST III protein sequence . Moreover, expression of one of these clones in E . coli resulted in a GST activity as measured with both CDNB and alachlor, proving that at least one of the clones encodes an active GST III species . With the enzyme expressed in E . coli it will become possible to study enzyme structure-function relationships ex planta . While a number of different GST proteins are present in maize tissue the GST III gene is present in single or low copy in the genome.

Nucleic Acids Res, 1986 Sep 25, 14(18), 7473 - 85
Does 5S RNA from E . coli have a pseudoknotted structure?
Goringer HU, Wagner R.
Chemical modification and limited enzymatic hydrolysis on isolated E . coli 5S RNA have provided informations on the secondary- and tertiary structure compatible with pseudoknotted structures for the A- and B-conformers of the molecule . Changes in the accessibility and reactivity of nucleotides in loop C and at the stem of helix IV in two different 5S RNA conformers are highly suggestive for interactions between bases C35 to C37 with G105 to G107 for the A-form and C38 to U40 and A94 to G96 with additional interactions of C35, C37 with G98 and G100 for the B-form . In both cases the molecules are folded forming pseudoknots and two quasi--continuous double stranded helices with coaxial stacking . The two structures are in perfect agreement with the biochemical data concerning the stability of the molecule and the chemical reactivities of individual nucleotides of the 5S RNA A- and B-conformers.

Cell, 1986 Sep 12, 46(6), 921 - 8
Correlation of competence for export with lack of tertiary structure of the mature species: a study in vivo of maltose-binding protein in E . coli; Randall LL et al.; Sensitivity to proteolytic degradation was used to monitor folding of polypeptides in vivo . A correlation between competence for export and lack of stable tertiary structure was established by comparing the kinetics of folding of mutated precursor maltose-binding protein that carries a defective leader peptide with the kinetics of folding of wild-type precursor that is competent for export . It is proposed that during export a kinetic competition exists between productive translocation and folding of precursor intracellularly into a stable conformation that is not compatible with transfer.

Nucleic Acids Res, 1986 Sep 11, 14(17), 6929 - 44
Chemical and functional characterization of an altered form of ribosomal protein S4 derived from a strain of E . coli defective in auto-regulation of the alpha operon; Changchien LM et al.; We have isolated a mutant form of Escherichia coli ribosomal protein S4 . This mutant is temperature sensitive and apparently fails to autogenously regulate the gene products of the alpha operon, which consists of the genes for proteins S13, S11, S4, L17, and the alpha subunit of RNA polymerase (1) . We have shown that this mutation results in the production of an S4 protein with a molecular weight approximately 4,000 daltons less than the wild-type protein . Our chemical analyses demonstrate that the mutant protein is missing its C-terminal section consisting of residues 170-203 . However, our studies to determine the capacity of this mutant protein to bind 16S RNA show that this protein is unimpaired in RNA binding function . This observation suggests that the functional domain of protein S4 responsible for translational regulation of the S4 gene products requires more of the protein than the 16S RNA binding domain.

Biochim Biophys Acta, 1986 Sep 5, 873(1), 53 - 61
Effect of N-alkyl and C-alkylputrescines on the activity of ornithine decarboxylase from rat liver and E . coli; Ruiz O et al.; N-Methyl-, N-ethyl-, N-propyl-, N-butyl-, N,N-dimethyl- and N,N'-dimethylputrescines were assayed as inhibitors of ornithine decarboxylase (EC 4.1.1.17) from rat liver and from Escherichia coli . They were found to be poor inhibitors, with the exception of N-propylputrescine and N,N-dimethylputrescine, which were inhibitory at 25 mM . A homologous series of 1-alkylputrescines ranging from 1-methylputrescine (1,4-diaminopentane) to 1-heptylputrescine (1,4-diaminoundecane) was assayed for effect on the activity of ornithine decarboxylase from the same sources . 1-Methylputrescine (5 mM) inhibited the mammalian enzyme, while the higher homologues showed significantly less inhibitory activity . When assayed on the bacterial enzyme, 1-methylputrescine (5 mM) was not inhibitory, while the higher homologues showed inhibitory effects . At higher concentrations, 1-methylputrescine and 1-heptylputrescine were the best inhibitors of these series of rat liver ornithine decarboxylase . When 1-methylputrescine, 2-methylputrescine, 1,2-dimethylputrescine, 1,3-dimethylputrescine and 1,4-dimethylputrescine were assayed as inhibitors of the decarboxylase, 2-methylputrescine was found to be the best inhibitor of the rat liver enzyme, while 1,3-dimethylputrescine was the best inhibitor of the bacterial enzyme . 1,4-Dimethylputrescine (2,5-diaminohexane) did not inhibit the enzyme from either source . Both, 2-methylputrescine and 1-methylputrescine, as well as the 1,2- and 1,3-dimethylputrescines were competitive inhibitors of the enzyme, and a Ki of 1 mM was obtained for 2-methylputrescine when the rat liver decarboxylase was used . N-Methyl, 1-methyl and 2-methylputrescines were found to inhibit in vivo the activity of rat liver ornithine decarboxylase which had been previously induced by thioacetamide treatment . 2-Methylputrescine (50 mumol/100 g body weight) was found to be the best in vivo inhibitor (93% inhibition), while putrescine under similar conditions inhibited 56% of the enzymatic activity.

Mutat Res, 1986 Sep, 166(2), 135 - 41
Transfer of the E . coli O6-methylguanine methyltransferase gene into repair-deficient human cells and restoration of cellular resistance to N-methyl-N'-nitro-N-nitrosoguanidine; Ishizaki K et al.; We have constructed a plasmid on which the E . coli O6-methylguanine-DNA methyltransferase (MT) gene (ada gene) was linked with an SV40 promoter sequence and a poly(A) site . After transferring this plasmid into Mer- HeLa MR cells by DNA transfection, effective expression of E . coli MT was observed . Isolated stable transformant clones showed higher resistance to N-methyl-N'-nitro-N-nitrosoguanidine in colony formation and sister-chromatid exchange induction than HeLa MR cells.

Zentralbl Bakteriol Mikrobiol Hyg {A}, 1986 Sep, 262(3), 304 - 12
{The tenacity of bacteria in the airborne state . IV: Experimental studies on the viability of airborne E . coli 0:78 under the influence of different temperature and humidity}; Muller W et al.; In a static aerosol chamber the tenacity of airborne E . coli 0:78 was determined at a permanent temperature of 22 degrees C and different relative humidities (10, 15-20, 30, 75 and 85%) and also at a permanent humidity of 30-40% and different temperatures (22, 28, 30, 34 and 40 degrees C) . The greatest viability of the bacteria with a half-life-time of 390 min was found at 22 degrees C and 85% humidity . At 10% humidity the half-life-time was only 55 min . At a humidity of 30-40% the tenacity decreased from 37 to 14 min half-life-time, when the temperature increased from 22 to 40 degrees C . In preliminary examinations it could be shown that the method of cultivation and age of the bacterial suspension had an influence on the tenacity in the airborne state.

Radiobiologiia, 1986 Sep-Oct, 26(5), 611 - 5
{Spectrum of formation of photo- and non-photoreactivated damage in E . coli cells irradiated with UV light (250-334 nm)}; Malinova IV et al.; A relative contribution of photoreactivated (modified by visible light) and non-photoreactivated (modified by temperature) damages to UV-irradiated (250-334 nm) E . coli B cells was estimated . The contribution of damages modified by temperature to a lethal effect of UV-radiation was invariable within the range from 250 to 334 nm . The photoreactivation of E . coli B cells was also independent of lambda-inactivating UV-light within 250-313 nm, and its value exceeded that of the wild-type E . coli WP2 which did not vary by the mode of UV-damages repair . Moreover, in contrast to E . coli B . cells, the value of the photoreactivation of E . coli WP2 decreased, as lambda-inactivating UV-light increased from 250 to 313 nm.

Mol Gen Genet, 1986 Sep, 204(3), 457 - 62
Mutation probe of gene structure in E . coli: suppressor mutations in the seven-tRNA operon; Bockrath R et al.; Cells defective in uracil-DNA glycosylase (ung::Tn10) were used in two ways to reveal differences in select point mutations (GC to AT transitions) within the seven-tRNA operon of E . coli . The mutations were indicated as de novo or converted glutamine tRNA suppressor mutations in the genes glnU and/or glnV: the kinetics of photoenzymatic monomerization of pyrimidine dimers quantitated by ung-dependent UV mutagenesis indicated more rapid repair of dimers at sites for converted suppressor mutation than of dimers at sites for de novo suppressor mutation, and spontaneous deamination of cytosine was considerably more frequent at sites for converted suppressor mutation than at sites for de novo suppressor mutation . To explain these results we suggest the physical structure of the DNA in vivo is different at different sites in the seven-tRNA operon . The non-transcribed strand including specifically the anticodon region of the site for converted suppressor mutation may frequently be looped out in a single strand so that a T = C dimer is more accessible to DNA photolyase or a free cytosine residue of non-irradiated DNA is in an aqueous environment conducive to deamination . In addition, we analysed the spontaneous de novo suppressor mutation data to determine an estimate for the in vivo rate of cytosine deamination in double strand DNA of 3.2 X 10(-13)/sec.

Mol Gen Genet, 1986 Sep, 204(3), 452 - 6
Thermal resistance of UV-mutagenesis to photoreactivation in E . coli B/r uvrA ung: estimate of activation energy and further analysis; Fix DF; Ultraviolet light (UV) induced mutations in the glnU and glnVa tRNA genes in Escherichia coli are thought to be targeted by UV photoproducts . In a previous study with a uracil-DNA glycosylase deficient strain, UV-induced glnU0 and glnV0 tRNA suppressor mutations became resistant to photoreactivation (PR) following thermal treatment . It was proposed that deamination of cytosine in the cytosine-containing cyclobutyl dimers at the sites of these suppressor mutations produced uracil residues in sequence upon PR . In the absence of glycosylase, the C----U conversion yielded the requisite G:C----A:T transitions . In the present study, this thermal resistance of UV-mutagenesis to PR is characterized . It is dependent on the initial UV-fluence and temperature of holding but not on the UmuC+ gene product . The data obtained yield an estimate of an activation energy of 17 +/- 3 kcal/mol for the deamination of cytosines contained in dimers . This compares to 29 kcal/mol for unaffected cytosines in DNA . In addition, an estimate of the probability of cyclobutyl dimer formation at the target sites for glnU0 and glnV0 suppressor mutations indicate that these lesions can not entirely account for the mutation frequencies recovered in the absence of PR . This is interpreted as an indication that, in addition to thymine-cytosine cyclobutyl dimers, other UV-induced lesions, possibly Thy(6-4)Cyt photoproducts, may also target glnU0 and glnV0 suppressor mutations.

Immunology, 1986 Sep, 59(1), 139 - 45
Does complement kill E . coli by producing transmural pores?
Born J, Bhakdi S.
Three lines of evidence are presented to indicate that C5b-9 kills serum-sensitive E . coli K 12 cells by generating functional pores across the outer and inner bacterial membrane . First, viable cells carrying C5b-8 complexes are impermeable to o-nitrophenyl-beta-D-galactoside (ONPG), but lose viability and become permeable to this marker upon post-treatment with purified C9 in the absence of lysozyme . Cells killed with colicin E1 or gentamicin are also impermeable to ONPG but take up the marker if they are post-treated with lysozyme-free serum . Second, killing by C5b-9 is highly effective, deposition of only a small number of complexes being lethal . This has been demonstrated in experiments where viable cells carrying 2000-4000 C5b-7 complexes per CFU were permitted to multiply in broth culture, and the daughter generations subsequently treated with purified C8 and C9 . Fifty percent killing was observed in the fifth to sixth generation, corresponding to a dilution of C5b-7 complexes to 50-100 molecules/CFU . In the presence of 2 mM EDTA, further dilution of C5b-7 down to 8-30 complexes/CFU still caused 50% killing of daughter cells . Third, treatment of C5b-7 cells with purified CC8 and C9 results in the release of intracellular K+, which commences immediately after addition of C8/C9 . This was shown in experiments where C5b-7 cells were packed to high density in saline, post-treated with C8 + C9, and K+ directly measured in the cell supernatants . Based on these results, we propose that C5b-9 pores deposited in the outer bacterial membrane periodically fuse with the inner membrane, the transmural pores thus generated permitting rapid K+ efflux, with cell death ensuing through the collapse of membrane potential.

Biochimie, 1986 Sep, 68(9), 1129 - 34
Single-strand binding proteins from phage T4 and E . coli form higher order structures with poly(dT); Boidot-Forget M et al.; Complexes of poly(dT) with gene 32 protein from phage T4 or E . coli single-strand binding protein were digested by nuclease P1 from Penicillum citrinum . Protected fragments were analyzed by gel electrophoresis . In both cases, a series of bands was obtained corresponding to multiples of a repeat unit whose size was about 80 nucleotides . Such protected fragments could not be detected under the same experimental conditions when poly(dA) was used instead of poly(dT) . The formation of nucleosome-like structures is discussed in relation to the higher affinity exhibited by single-strand binding proteins towards poly(dT).

Exp Cell Res, 1986 Sep, 166(1), 63 - 76
A polyoma-derived plasmid vector maintained episomally in both E . coli and mouse hepatoma cells; Mevel-Ninio M et al.; We describe a recombinant plasmid, pBBPY1, containing polyoma virus sequences which persists episomally in mouse hepatoma (MH) cells and can be shuttled between these cells and bacteria . This plasmid is composed of a subgenomic fragment of a polyoma virus mutant that includes two origins of replication; sequences of plasmid pML2; the xanthine-guanine phosphoribosyltransferase gene of Escherichia coli (Ecogpt) under the control of SV40 early-region promoter and RNA processing signals, providing a dominant selectable marker for mammalian transfection . MH cells from colonies growing in HAT medium (hypoxanthine, aminopterin and thymidine) were found to contain vector DNA molecules in an episomal state, the majority of them unrearranged . When HAT-selective pressure was applied for only 3 days, the resulting cells contained up to 50-100 copies of intact plasmid, i.e . 20-fold more than cells grown under standard selection conditions with continuous HAT-selective pressure . Contrary to standard conditions, transient selection does not alter the epithelial morphology nor ability of transfected hepatoma cells to produce albumin.

Mol Gen Genet, 1986 Sep, 204(3), 410 - 6
Derepression of single-stranded DNA-binding protein genes on plasmids derepressed for conjugation, and complementation of an E . coli ssb- mutation by these genes; Golub EI et al.; Plasmid single-stranded DNA-binding protein genes complement the E . coli ssb-1 mutation, and partially restore capacity for DNA synthesis, DNA repair (direct role as well as role in SOS induction) and general recombination . Plasmid mutants derepressed for fertility derived from R1, R64 and R222 show a higher level of complementation compared to the parental repressed plasmids . Derepressed mutants of R222 synthesize more RNA which hybridizes with the ssb gene of the F factor than does the original R222 plasmid . This indicates that plasmid ssb genes are regulated coordinately with fertility genes.

Int J Radiat Biol Relat Stud Phys Chem Med, 1986 Sep, 50(3), 507 - 25
Study of several factors in RNA-protein cross-link formation induced by ionizing radiations within 70S ribosomes of E . coli MRE 600; Ekert B et al.; The induction of RNA-protein crosslinks in E . coli 70S ribosomes by gamma-irradiation was studied by measuring the dependence of cross-link formation on ribosome concentration . The inverse dependence of cross-link percentage upon concentration up to at least 20 A260 nm units ml-1 indicate that indirect effects seem to play a more major part than direct effects for these ribosome concentrations . The effect of various gases and free radical scavengers was used to determine the roles of the radicals H., CO2-., OH . and e-aq and to estimate their relative efficiencies for cross-links . They were found to be: 7.2(H.), 6(CO2-.), 2(OH.) and 1(e-aq) . The extent of RNA-protein cross-link production in 70S ribosomes induced by gamma-rays and neutrons in the presence and absence of oxygen was also investigated . Cross-link formation was estimated by separation of linked and unlinked material on nitrocellulose filters or after separation by SDS-sucrose gradient centrifugation under dissociating conditions . Oxygen inhibited cross-link formation by both neutrons and gamma-rays . However, very few cross-links were formed in de-aerated solutions by exposure to neutrons, compared to those produced by gamma-rays under the same conditions . This suggests that molecular oxygen generated along the secondary particle track can reduce the formation of RNA-protein cross-links.

Cell, 1986 Aug 29, 46(5), 763 - 71
RNA terminating within the E . coli origin of replication: stringent regulation and control by DnaA protein; Rokeach LA et al.; RNA entering the E . coli replication origin, oriC, in the counterclockwise direction terminates at several sites throughout the origin sequence . The significant finding was that nine clusters of these termination sites are found at the nine clusters of RNA to DNA transitions in oriC . The majority of these transcripts terminates with cytosine . Termination sites are associated with 9 of the 11 GATC sites and all DnaA protein-binding sites . Chloramphenicol-treated cells contain an increased amount of this RNA species, while cells starved for isoleucine have greatly reduced levels, indicating that synthesis of these transcripts is stringently regulated . Both decreased and increased intracellular levels of DnaA protein decrease the fraction of transcription that enters oriC.

Nucleic Acids Res, 1986 Aug 26, 14(16), 6591 - 602
Guanine and adenine analogues as tools in the investigation of the mechanisms of mismatch repair in E . coli; Wood SG et al.; The efficiency of in vivo correction of five "mismatch analogues", incorporated into M13mp9 DNA, was studied in an attempt to elucidate the structural determinants required for mismatch recognition by the repair machinery of E . coli . Inosine was efficiently removed from an I/T mismatch, presumably by the action of hypoxanthine glycosylase . The mismatch analogues DI/T (DI = 7-deazainosine), Tu/C (Tu = tubercidin), N/C (N = nebularine) and DN/C (DN = 7-deazanebularine) were left largely unrepaired, giving rise to high yields of mutant phenotype . The efficiency of correction of these mismatch analogues could be correlated with their structure within the base-pair.

Nucleic Acids Res, 1986 Aug 26, 14(16), 6745 - 63
Sigma factors from E . coli, B . subtilis, phage SP01, and phage T4 are homologous proteins; Gribskov M et al.; We show, using dot matrix comparisons and statistical analysis of sequence alignments, that seven sequenced sigma factors, E . coli sigma-70 and sigma-32, B . subtilis sigma-43 and sigma-29, phage SP01 gene products 28 and 34, and phage T4 gene product 55, comprise a homologous family of proteins . Sigma-70, sigma-32, and sigma-43 each have two copies of a sequence similar to the helix-turn-helix DNA binding motif seen in CRP, and lambda repressor and cro proteins . B . subtilis sigma-29, SP01 gp28, and SP01 gp34 have at least one copy similar to this sequence . We propose that a second sequence, conserved in all seven proteins is the core RNA polymerase binding site . A third region, present only in sigma-70 and sigma-43, may also be involved in interaction with core . Available mutational evidence supports our model for sigma factor structure.

FEBS Lett, 1986 Aug 18, 204(2), 331 - 5
The C-terminal, 23 kDa peptide of E . coli haemolysin 2001 contains all the information necessary for its secretion by the haemolysin (Hly) export machinery; Nicaud JM et al.; In this paper we show the construction of a plasmid pLG609 which carries the 3'-end of the haemolysin structural gene, hlyA under tac promoter control . Expression of pLG609 in an E . coli strain carrying the haemolysin export genes hlyB and hlyD led to the efficient secretion of the C-terminal, 23 kDa peptide of haemolysin . The discovery of a C-terminal topogenic sequence, which appears to be all that is required for secretion of the whole toxin, is so far quite unique in protein export.

FEBS Lett, 1986 Aug 11, 204(1), 89 - 95
The importance of individual nucleotides for the structure and function of rRNA molecules in E . coli . A mutagenesis study; Meier N et al.; Methods of in vitro mutagenesis were employed to determine the importance of individual nucleotides within the ribosomal RNAs for the structure and function of E . coli ribosomes . A series of defined nucleotides in the genes for the 5 S and 16 S RNA were altered by transition and transversion mutations using either oligonucleotide-directed or bisulfite-catalyzed mutation procedures . Plasmids harbouring the mutated rRNA genes were expressed and the ribosomes containing such altered RNAs were investigated for impairments in RNA-protein interaction assembly and mRNA-coded tRNA binding.

Eur J Pharmacol, 1986 Aug 7, 127(1-2), 121 - 4
Vascular alpha-adrenoceptor blockade by E . coli endotoxin in the rat; Auclair MC et al.; It has been previously shown that Escherichia coli endotoxin (ENDO) reduces the pressor effect of phenylephrine . This work attempted to define precisely the involvement of vascular alpha-adrenoceptors in this action . The dose-response curves of three alpha-agonists noradrenaline, St 587 and B-HT 933 in pithed rats were shifted rightwards by pretreatment (i.v . injection of 10 and 100 micrograms/kg) with ENDO . ENDO 10 and 30 micrograms shifted the dose-response curve of noradrenaline in perfused rat kidney . It can be suggested that ENDO has a potent blocking action on vascular alpha-adrenoceptors without evident discrimination between alpha 1 and alpha 2 subtypes.

Arzneimittelforschung, 1986 Aug, 36(8), 1216 - 20
{Existence of an anabolically acting principle in an extract of E . coli}; Schole J et al.; Colibiogen, extracted from E . coli (in the following called coli extract) was examined for factors with anabolic efficiency, especially for anabolically efficient bases of nucleic acids and for peptides . The results obtained are the following: Tests for nucleotides, nucleosides and bases of nucleic acids by thin-layer chromatography technique turned out negative . To test anabolically efficient substances the so-called glutathione state test in the rat liver was used . In this test intraportal dosages of 200 micrograms coli extract and also 200 micrograms of the enzymatically decomposed muscle proteins (Pepton resp . Lab Lemco) gave rise to positive effects within 2 min . Contrary to peptides from the culture medium the efficiency of coli extract was considerably increased by previous tryptic fission (efficient concentration 6 micrograms) . The quantities applied were related on microgram peptide . A coli extract preparation the phase of growth of which had been shortened to 12 h was separated into 4 fractions . The fourth fraction (lowest molecular weight) showed anabolic efficiency with 6 micrograms peptide in the state test . Before the denaturative extraction took place, the coli extract was separated by centrifugation in a third test series into coli extract bacteria mass and coli extract supernatant . Nothing but the supernatant showed anabolic properties . Two fractions, obtained by the separation of the bacteria mass, did not show any activity in the glutathione state test . It is discussed that E . coli-specific peptides with anabolic efficiency are candidates for the coli extract effects.

Bioorg Khim, 1986 Aug, 12(8), 1023 - 9
{Localization of binding sites of E . coli DNA-dependent RNA-polymerase with photosensitive template analogs}; Skiba NP et al.; The photoinduced covalent binding of E . coli RNA polymerase with decathymidylic templates containing 5-bromouracil residue has been carried out . Peptides from beta and beta' subunits of the core-enzyme, situated in the DNA-template binding site of the RNA polymerase active center have been localized.

EMBO J, 1986 Aug, 5(8), 2023 - 9
Mechanism of postsegregational killing by the hok gene product of the parB system of plasmid R1 and its homology with the relF gene product of the E . coli relB operon; Gerdes K et al.; The parB region of plasmid R1 encodes two genes, hok and sok, which are required for the plasmid-stabilizing activity exerted by parB . The hok gene encodes a potent cell-killing factor, and it is regulated by the sok gene product such that cells losing a parB-carrying plasmid during cell division are rapidly killed . Coinciding with death of the host cell, a characteristic change in morphology is observed . Here we show that the killing factor encoded by the hok gene is a membrane-associated polypeptide of 52 amino acids . A gene located in the Escherichia coli relB operon, designated relF, is shown to be homologous to the hok gene . The relF gene codes for a polypeptide of 51 amino acids, which is 40% homologous to the hok gene product . Induced overexpression of the hok and relF gene products results in the same phenomena: loss of cell membrane potential, arrest of respiration, death of the host cell and change in cell morphology . The parB region and the relB genes were cloned into unstably inherited oriC minichromosomes . Whereas the parB region also conferred a high degree of genetic stability to an oriC minichromosome, the relB operon (with relF) did not; therefore the latter does not appear to 'stabilize' its replicon (the chromosome) . The function of the relF gene is not known.

Microb Pathog, 1986 Aug, 1(4), 335 - 47
Fimbrial phase variation and systemic E . coli infection studied in the mouse peritonitis model; Nowicki B et al.; Mouse peritonitis induced by intraperitoneal injection of a virulent (LD50 4 x 10(5) E . coli 018:K1:H7 strain isolated from neonatal meningitis was studied . These bacteria are capable of producing both type 1 and S fimbriae, binding to mannose or sialic acid containing glycoconjugates, respectively; the production of both fimbrial types is subject to phase variation . A broth culture of the bacteria was fractionated into subpopulations containing either type 1 or S fimbriae or neither (nonfimbriated cells), and each fraction, grown in broth to logarithmic growth phase, was used to infect groups of mice . The type 1 fraction was associated with decreased virulence as the fraction was eliminated rapidly without causing a progressive infection even at 10(6) bacteria/mouse, whereas both S and nonfimbriated cells started rapid multiplication in the peritoneal cavity and spread to the blood . In nonfibriated cells, however, S fimbriae production was induced at the same time so that at 1 h after injection, 60-70% of the bacteria in the peritoneal cavity and in the blood of the mice had S fimbriae . The injected S-fimbriated fraction remained completely S-fimbriated . Rapid induction of S fimbriae also took place in vitro when the nonfimbriated bacteria were grown in mouse serum or peritoneal fluid . Anti-S serum protected the mice from a lethal dose of S-fimbriated bacteria.

J Immunol Methods, 1986 Jul 24, 91(2), 213 - 24
Immunoassay for the detection of E . coli proteins in recombinant DNA derived human growth hormone; Anicetti VR et al.; An enzyme-linked immunosorbent assay (ELISA) has been developed for the quantitation of part-per-million levels of the most probable E . coli polypeptide (ECP) contaminants of E . coli produced biosynthetic human growth hormone (hGH) . The antibody preparation, used for both coat and conjugate in this ELISA, was demonstrated to be reactive with the reference ECPs (a collection of the most probable protein contaminants) by both affinity chromatography and immunoblot analysis . Affinity purification of this antibody preparation using immobilized reference ECPs resulted in an assay with a higher signal-to-noise ratio and also 'normalized' the antibody population to approach stoichiometric equivalence with the immobilized ECPs . Reference ECPs, size fractionated by gel filtration, were quantitated in agreement with their absorbance at 280 nm . The assay was demonstrated to be specific for ECPs obtained from the hGH purification process . Since the purification of each recombinant DNA derived protein from E . coli requires its own unique process, this means that no generic ECP assay can be developed . It is felt that the criteria established for this assay provide a comprehensive approach to the development of quantitative multiple antigen immunoassays.

Cell, 1986 Jul 18, 46(2), 245 - 51
The stability of E . coli gene transcripts is dependent on determinants localized to specific mRNA segments; Belasco JG et al.; To map the structural features responsible for the 5-fold difference in stability of the E . coli ompA and bla gene transcripts, we have constructed gene fusions that encode chimeric ompA/bla transcripts and a deletion that eliminates a large internal segment of bla mRNA . Shortening of bla transcripts by internal deletion or replacement of the 3' end with the corresponding segment of the ompA transcript had little effect on bla mRNA stability . However, fusion of a 5'-terminal 147 nucleotide segment of the ompA message 5' to full-length or truncated bla transcripts increased the half-life of the bla segments 3- to 5-fold . These and other findings indicate that E . coli transcripts contain discrete structural determinants of stability and instability that can influence the decay rate of linked mRNA segments derived from other genes.

J Immunol, 1986 Jul 15, 137(2), 669 - 73
Reactivity of E . coli-derived trans-activating protein of human T lymphotropic virus type III with sera from patients with acquired immune deficiency syndrome; Barone AD et al.; Randomly sheared DNA fragments from HTLV-III proviral DNA were cloned into an E . coli open reading frame (ORF) expression vector . The inserted ORF DNA was expressed in E . coli transformants as a polypeptide fused to the lambda CI protein at the amino terminus and to beta-galactosidase at the carboxyl terminus . The reactivity of the recombinant peptides with antibodies from sera of AIDS patients was determined by the Western blot technique . The coordinates of the DNA inserts of the immunoreactive clones were then determined by DNA sequencing . A clone, ORF 628, was found to contain a short DNA segment located between the sor and env genes (nucleotide positions 5367 to 5597), a region previously thought to be noncoding . Inspection of the DNA sequences of this clone and of other HTLV-III isolates revealed the presence of a small ORF located between nucleotide position 5411 and 5625, capable of encoding a polypeptide of 72 amino acids . The biosynthesis of the polypeptide of ORF 628 initiates from an ATG codon within the HTLV-III insert . The fusion protein of ORF 628 was partially purified by affinity chromatography on CH Sepharose 4B coupled to a beta-galactosidase ligand, and tested against a panel of sera from AIDS patients by Western blot analysis . Approximately 35% of the sera from patients with AIDS or ARC contained antibodies reactive with the peptide . The DNA region spanned by ORF 628 is now thought to be the major functional element of the trans-activator gene, tat.

FEBS Lett, 1986 Jul 14, 203(1), 44 - 8
Activation of guanylate cyclase by E . coli heat-stable enterotoxin (STa) . Modulation by NAD and pertussis toxin; Epstein SA et al.; The heat-stable enterotoxin (STa) of E . coli activates intestinal guanylate cyclase and leads to increased cGMP levels by an as yet undetermined mechanism . In comparing this cGMP system to other known toxin-mediated alterations in cAMP metabolism, we observed that pertussis toxin caused lower levels of intestinal cGMP synthesis in response to purified STa . Another participant in ADP-ribosylation reactions, NAD, enhanced the ability of STa to activate guanylate cyclase, yet had no effect on basal enzyme activity . Niacinamide and isoniacinamide also had no effect on basal activity, but attenuated the STa activation . These results are discussed in relation to current models of hormone/toxin-sensitive adenylate cyclase, and may suggest an involvement of guanine-nucleotide-binding proteins in intestinal cGMP metabolism.

FEBS Lett, 1986 Jul 7, 202(2), 349 - 52
Circular dichroism studies on the signal sequence of E . coli alkaline phosphatase indicate the presence of both alpha-helix and beta-structure in hydrophobic environments; Laxma Reddy G et al.; The conformations of a synthetic peptide corresponding to the signal sequence of E . coli alkaline phosphatase, Lys-Gln-Ser-Thr-Ile-Ala-Leu-Ala-Leu-Leu-Pro-Leu-Leu-Phe-Thr-Pro-Val-Thr- Lys- Ala-OCH3, have been examined in different environments by circular dichroism spectroscopy . In trifluoroethanol, methanol and aqueous mixtures of these solvents, the signal peptide has largely random conformation (approximately 80%) with small amounts of alpha-helix and beta-structure . However, in micellar environment, there is a significant increase in ordered conformation with both alpha-helix and beta-structure being present, unlike in other signal sequences reported in the literature, where only the alpha-helical conformation has been observed . Hence, an alpha-helical conformation may not be as stringent a requirement as overall hydrophobicity for recognition of signal sequences by the cell's export machinery.

FEBS Lett, 1986 Jul 7, 202(2), 373 - 7
Expression, secretion and processing of hirudin in E . coli using the alkaline phosphatase signal sequence; Dodt J et al.; A DNA fragment coding for the E . coli phoA signal peptide was synthesized and inserted into the expression vector pKK223-3 . A single HindIII restriction site is located just at the end of the signal sequence . A gene coding for the proteinase inhibitor hirudin, which has previously been synthesized, was inserted into this HindIII site . The hybrid protein was expressed under control of the tac-promoter and secreted into the periplasm of E . coli . From the periplasmic fraction two processed proteins were isolated . One of these was identical with desulfatohirudin and also had similar biological properties.

Vopr Virusol, 1986 Jul-Aug, 31(4), 489 - 93
{Generation of HTLV-III-specific polypeptides in E . coli cells}; Bukrinskii MI et al.; Cloning and expression in E . coli cells of a fragment of the env gene of HTLV-III virus is described . This fragment coding for from 294 to 757 aminoacid residue of virus protein was cloned in plasmid pUC 18 . Conditions are described contributing to the regulated functioning of Lac-promoter allowing the expression of proteins toxic for E . coli . Solid-phase enzyme-immunoassay demonstrated a specific reaction of polypeptides synthesized in E . coli with an AIDS patient's serum . The sizes of these polypeptides were determined by the Western-blot method . They were found to be 18, 24, and 32 kilodaltons . The polypeptides synthesized in E . coli may apparently be used for preparation of test-systems for AIDS diagnosis.

Vet Microbiol, 1986 Jul, 12(2), 119 - 33
Development of intestinal antibodies against Escherichia coli antigens in piglets with experimental neonatal E . coli diarrhoea; Olsson E et al.; Intestinal immune responses to Escherichia coli antigens were studied in conventionally reared piglets orally infected on the first day of life with a virulent enterotoxigenic E . coli (O149: K88) . During the first week of life intestinal antibodies were produced against the homologous lipopolysaccharide (LPS) as well as against the K88 antigen and the heat-labile enterotoxin (LT) . On Day 7, anti-LPS antibodies of the IgA and IgG classes were detected in most piglets, whereas anti-K88 antibodies of the IgG and IgM classes predominated; antibodies against the enterotoxin were usually of the IgG class . In 21-day-old piglets antibodies of all immunoglobulin classes had usually been produced . In most cases, the levels of intestinal antibodies were substantially higher on Day 21 compared to Day 7, but the levels varied considerably both between and within litters . The intestinal immune responses did not correlate with the severity of clinical symptoms . One-, 7- and 21-day-old piglets reared in a specific-pathogen-free (SPF) herd lacked significant intestinal antibodies to the antigens examined . The oral challenge did not stimulate systemic immune responses . After colostral intake, all piglets had high antibody levels in the circulation . These levels decreased continuously during the 3-week study period . The possibility that high amounts of antibodies in colostrum could interfere with this early intestinal antibody formation should be considered when planning vaccination programmes against E . coli diarrhoea in piglets.

Mol Gen Genet, 1986 Jul, 204(1), 85 - 9
Replication of pSC101: effects of mutations in the E . coli DNA binding protein IHF; Gamas P et al.; We have shown that the plasmid pSC101 is unable to be maintained in strains of E . coli carrying deletions in the genes himA and hip which specify the pleitropic heterodimeric DNA binding protein, IHF . We show that this effect is not due to a modulation of the expression of the pSC101 RepA protein, required for replication of the plasmid . Inspection of the DNA sequence of the essential replication region of pSC101 reveals the presence of a site, located between the DnaA binding-site and that of RepA, which shows extensive homology with the consensus IHF binding site . The proximity of the sites suggests that these three proteins, IHF, DnaA, and RepA may interact in generating a specific DNA structure required for initiation of pSC101 replication.

Mutat Res, 1986 Jul, 171(1), 1 - 10
Potassium chromate potentiates frameshift mutagenesis in E . coli and S . typhimurium; LaVelle JM; Possible comutagenic effects of chromate on frameshift mutagenesis were studied in bacterial assays . In these experiments, cells were treated with potassium chromate and 9-aminoacridine either singly or in combination . Results were analyzed to detect synergistic, additive and antagonistic responses . Data from these investigations show a clear potentiation of 9-aminoacridine-induced mutagenesis in the presence of chromate in S . typhimurium strain TA1537 . Results from cell viability assays shows that the effect is not due to a toxicity artifact . Similar results are obtained in E . coli strains 343/358 (repair-proficient parental strain), 343/415 (recA-deficient), and 343/435 (mismatch-repair-deficient) . These data indicate the neither induction of recA-protein nor inhibition of mismatch repair is involved in the action of chromate . In E . coli strain 343/447 (DNA polymerase I deficient), the potentiation was observed at lower concentrations of chromate . This finding suggests that polymerase I functions in recovery of cells from 9-aminoacridine-induced DNA damage and that its absence allows some of this damage to be dealt with in a manner which promotes mutagenesis in the presence of chromate . One possible explanation of these findings is that chromate and 9-aminoacridine react chemically to produce a unique mutagen and that damage caused by this mutagen is repaired via some excision process . However, no reaction between chromate and 9-aminoacridine could be detected by TLC under conditions similar to those in the bacterial assays, even at very high concentrations of both agents . Thus, it seems most likely that the potentiation is due to some action of chromate on repair and/or replication at sites of 9-aminoacridine intercalation . Chromate appears, then, to have significant comutagenic actions in bacterial systems.

Biokhimiia, 1986 Jul, 51(7), 1085 - 92
{Isolation of the hexameric form of purine nucleoside phosphorylase from E . coli . Comparative study of trimeric and hexameric forms of the enzyme}; Bezirdzhian KhO et al.; The presence of two forms (high and low molecular weight ones) of purine nucleoside phosphorylase II (purine nucleoside: orthophosphate ribosyltransferase, EC 2.4.2.1) was demonstrated . The high molecular weight form of the enzyme was purified, and the properties of both forms were compared . The enzyme forms were shown to differ in their quaternary structure (trimeric and hexameric), molecular weight of the native enzyme and its subunits (85,000 and 28,000 for the trimer, 150,000 and 25,000 for the hexamer, respectively) as well as substrate specificity (the trimer is specific for all major purine nucleosides, while the hexamer does not cleave adenine nucleosides) . Adenosine is a competitive inhibitor of the hexameric form with respect to deoxyguanosine (Ki = 1.16 X 10(-3) M); the Km value for deoxyguanosine is 9.85 X 10(-5) M . The isoelectric point for the both forms of the enzyme in the presence of 9 M urea is about 5.5 . Both forms have a pH optimum of phosphorolytic activity between 6.5 and 7.0.

Bioorg Khim, 1986 Jul, 12(7), 902 - 5
{Monomeric form of E . coli pyrophosphatase . Regulatory properties, stability and interaction with affinity inhibitors}; Borshchik IB et al.; A comparative study on the E . coli inorganic pyrophosphatase subunit and native oligomer disclosed that the quaternary structure is not an essential prerequisite for exhibiting by the enzyme its regulatory properties . However, association of the subunits enhances the stability of the protein molecule and is obligatory for irreversible affinity inhibition.

Vopr Virusol, 1986 Jul-Aug, 31(4), 485 - 9
{Cloning and gene expression of the surface protein gene of the HTLV-III virus in E . coli}; Kovgan AA et al.; A system has been developed for expression of surface protein (SP) of the virus of acquired immune deficiency syndrome (AIDS) in E . coli . For this purpose, cloning and substitution of a fragment of SP gene of HTLV-III virus under control of PL-promoter of phage lambda was carried out using pre-modified plasmid vector pPL-lambda . In the constructed plasmid pL2 1950 paranucleotides, the PvuII fragment of HTLV-III virus DNA is built-in in such a way that the frames of transcription of phage lambda protein N and SP of HTLV-III virus correspond to each other . As a result, plasmid pL2 codes for synthesis of a hybrid polypeptide consisting of phage lambda protein N (59 aminoacid residues--a . r.) and SP of HTLV-III (569 a . r.) . The presence of the hybrid polypeptide in lysates of E . coli strains (K-12 delta H1 delta trp/pL2, M 5219/pL2, N 4830/pL2) was determined by solid-phase enzyme-immunoassay.

Biofizika, 1986 Jul-Aug, 31(4), 626 - 30
{Accumulation of K+ in E . coli grown in aerobic conditions}; Martirosov SM et al.; The character of K+ accumulation in E . coli grown aerobilcally in the salt medium with succinate was studied . K+ uptake via the Trk system has Km 3.4 mM and Vmax 0.45 mM X g+1 X min-1 . The initial rates of K+ uptake were not changes at different pH from 6.0 to 8.3 and temperature 17-37 degrees C . DCC did not block, protonophores and arsenate blocked the operation of Trk system . Valinomycin increased (or had no effect) K+ accumulation . K+ distribution is in good conformity with the measured membrane potential . The Trk system works at the utilization of lactic acid and glucose as well as of succinate . The Trk system is described . K+ ionophore by using the membrane potential and ATP regulates functioning of this system.

Cell, 1986 Jun 20, 45(6), 785 - 92
Transcription of glnA in E . coli is stimulated by activator bound to sites far from the promoter; Reitzer LJ et al.; Transcription of the Escherichia coli glnALG operon, whose products are glutamine synthetase and the regulatory proteins NRII and NRI, is activated by nitrogen deprivation . Initiation of transcription at the nitrogen-regulated promoter glnAp2 requires sigma 60, the product of rpoN (glnF, ntrA), and NRI, the product of glnG (ntrC) . We have now shown that the ability of this promoter to be activated by a low intracellular concentration of NRI depends on two binding sites for NRI located approximately 110 and 140 bp, respectively, upstream of the start of transcription . Moving these binding sites more than 1000 bp does not diminish the ability of NRI to stimulate transcription at glnAp2 . Thus, the NRI binding sites resemble enhancers in eukaryotic cells.

Nucleic Acids Res, 1986 Jun 11, 14(11), 4659 - 72
Fluorine-19 nuclear magnetic resonance study of codon-anticodon interaction in 5-fluorouracil-substituted E . coli transfer RNAs; Gollnick P et al.; Codon-anticodon interaction was investigated in fully active 5-fluorouracil-substituted E . coli tRNAVal1 (anticodon FAC) by 19F NMR spectroscopy . Binding of the codon GpUpA results in the upfield shift of a 19F resonance at 3.9 ppm in the central region of the 19F NMR spectrum, whereas trinucleotides not complementary to the anticodon have no effect . The same 19F resonance shifts upfield upon formation of an anticodon-anticodon dimer between the 19F-labeled tRNA and E . coli tRNATyr2 (anticodon QUA) . These results permit assignment of the peak at 3.9 ppm to the 5-fluorouracil at position 34 in the anticodon of fluorouracil-substituted tRNAVal1 . The methionine codon ApUpG also causes a sequence-specific upfield shift of a peak in the central part of the 19F NMR spectrum of fluorinated E . coli tRNAMetm . However, ApUpG has no effect on the 19F spectrum of 19F-labeled E . coli tRNAMetf, indicating possible conformational differences between the anticodon loop of initiator and chain-elongating methionine tRNAs . 19F NMR experiments detect no binding of CpGpApA to the complementary FpFpCpG (replaces Tp psi pCpG) in the T-loop of 5-fluorouracil-substituted tRNAVal1, in the presence or absence of codon, suggesting that the tertiary interactions between the T- and D-loops are not disrupted by codon-anticodon interactions.

Nucleic Acids Res, 1986 Jun 11, 14(11), 4577 - 89
Structure and gene expression of the E . coli Mn-superoxide dismutase gene; Takeda Y et al.; Superoxide dismutase is an enzyme which converts superoxide O2- to hydrogen peroxide . Using a single synthetic oligonucleotide 33mer, we screened the E . coli DNA library and isolated a clone containing the E . coli manganese-superoxide dismutase gene . We determined the DNA sequence . The analysis of the DNA sequence and in vivo as well as in vitro transcription has shown the following . The DNA sequence suggests two possible promoters . However, only one of them seems active during normal aerobic growth . Purified RNA polymerase initiates in vitro transcription from the same promoter . It is not clear whether the second promoter is functional . It is possible that this promoter could be activated under different growth conditions . There is an inverted repeat sequence which could form a stem-loop structure downstream of the translation stop codon TAA of the Mn-SOD gene . The results of the analysis of in vivo and in vitro RNA have shown that this is the transcription termination signal . Thus, the Mn-SOD gene constitutes a single gene operon . There is an almost perfect 19 base palindrome at the -35 region . The position and the size of the palindrome suggest that this could be a regulatory site.

Dig Dis Sci, 1986 Jun, 31(6), 651 - 6
Hepatic damage in neonatal rat due to E . coli endotoxin; Young RS et al.; Liver from neonatal rats injected with LD50 E . coli endotoxin was studied by light and electron microscopy . By 2 hr, there was margination and migration of polymorphonuclear leukocytes . Single cell necrosis was seen after 8 hr . At 16 hr, there were numerous necrotic foci in the mid-zonal region of hepatic lobules, as well as accumulation of microvesicular fat . Necrosis and fatty change of hepatocytes were more extensive at 24 hr . Microvesicular fat accumulation may be related to alterations in fatty acid or oxidative metabolism . However, the pattern of mid-zonal damage in these animals is not typical of failure of oxidative metabolism and suggests that other mechanisms are involved.

Biochem Int, 1986 Jun, 12(6), 889 - 96
A rapid and inexpensive method for preparing E . coli plasmid-DNA; Monstein HJ et al.; A simple, rapid and inexpensive scaled up miniprep procedure for preparing pure E . coli plasmid DNA is described . Bacterial cells were subjected to the boiling procedure and high molecular weight RNA was removed by LiCl-precipitation . Residual RNA and proteins were removed by subsequent treatment with RNase A and proteinase K/SDS respectively, followed by Sephadex G-50 and Sepharose 6B-Cl chromatography . The average yield from a 100 ml over-night bacterial suspension was 100 to 150 micrograms for pBR-322 DNA, and 250-500 micrograms for SP-6 derived recombinant plasmids . In addition, the described "scaled up" preparation does not require CsCl-ethidium bromide centrifugation; pure plasmid DNA can be prepared within 1 to 2 days.

Nucleic Acids Res, 1986 May 27, 14(10), 4325 - 42
Nucleotide sequence and transcriptional analysis of the E . coli ushA gene, encoding periplasmic UDP-sugar hydrolase (5'-nucleotidase): regulation of the ushA gene, and the signal sequence of its encoded protein product; Burns DM et al.; The DNA sequence of the ushA gene, encoding UDP-sugar hydrolase (5'-nucleotidase), has been determined . The amino-terminal sequence encodes a signal peptide whose predicted processing site is confirmed by N-terminal amino acid analysis of purified mature UshA protein . The signal sequence contains a concentration of rare codons in comparison with the mature sequence . The origins of transcription from the ushA promoter have been determined, using primer extension . Three transcripts, originating within a 6 bp region, were identified and might be related to three overlapping potential -10 hexamers in the ushA promoter region . There was a discernable change in the relative proportion of these transcripts during growth-phase regulation of the ushA gene.

Nucleic Acids Res, 1986 May 27, 14(10), 4147 - 58
RecBC, sbcB independent, (AT)n-mediated deletion of sequences flanking a Xenopus laevis beta globin gene on propagation in E . coli; Greaves DR et al.; Plasmids containing sequences 3' of the adult beta 1 globin gene of Xenopus laevis are unstable on propagation in a range of E . coli host strains . Up to 300 bp of Xenopus DNA are lost by rec A independent recombination between (AT)37 and (AT)17 sequences . Additionally, smaller deletions occurring in or around the (AT)37 sequence are observed . Deletion of these potential cruciform structures occurs in the absence of exonuclease I, exonuclease V and exonuclease VIII as the same pattern of deletion events is observed in recA recBC sbcB and recBC sbcA recE strains.

J Biol Chem, 1986 May 25, 261(15), 6643 - 6
Internal structural features of E . coli glycyl-tRNA synthetase examined by subunit polypeptide chain fusions; Toth MJ et al.; In contrast to most aminoacyl-tRNA synthetases which are monomers or oligomers of a single polypeptide, Escherichia coli glycyl-tRNA synthetase has an alpha-2, beta-2 structure . The enzyme requires both subunits for catalysis of either adenylate or aminoacyl-tRNA synthesis . The head-to-tail arrangement of the alpha- and beta-chain coding regions in the genome suggests that the two-subunit protein may be tantamount to a single chain . We fused the carboxyl terminus of the alpha-chain to the amino terminus of the beta-chain, through a short peptide linker . Five different amino acid substitutions were placed in the linker . In all instances, the fusion polypeptide is stable in maxicell extracts . In a glyS null strain, a gene encoding any of the fusion proteins substitutes for the wild-type gene . Assays confirm that, in vitro, the engineered polypeptide fusion is active to within 2- to 3-fold of the wild-type, unfused chains . Oligomers of the fusion protein are observed and may be required for activity . Because the creation and limited manipulation of the artificial peptide linker region does not destroy the activity, we also conclude that the C-terminal part of the alpha-chain and the amino-terminal part of the beta-chain are not important for activity.

Nature, 1986 May 15-21, 321(6067), 253 - 6
Peptide chemotaxis in E . coli involves the Tap signal transducer and the dipeptide permease; Manson MD et al.; Bacterial chemotaxis provides a simple model system for the more complex sensory responses of multicellular eukaryotic organisms . In Escherichia coli, methylation and demethylation of four related membrane proteins, the methyl-accepting chemotaxis proteins (or MCPs), is central to chemotactic sensing and signal transduction . Three of these proteins, Tar, Tsr and Trg, have been assigned specific roles in chemotaxis . However, the role of the fourth MCP, Tap, has remained obscure . We demonstrate here that Tap functions as a conventional signal transducer, enabling the cell to respond chemotactically to dipeptides . This provides the first evidence of specific bacterial chemotaxis towards peptides . Peptide taxis requires the function of a periplasmic component of the dipeptide permease . This protein represents the first example of a periplasmic chemoreceptor that does not have a sugar substrate.

FEBS Lett, 1986 May 12, 200(2), 291 - 7
Physico-chemical study of complex formation of DNA with wild-type and mutant E . coli RNA polymerases . Recognition properties of beta-subunit; Ozoline ON et al.; Complex formation of T7 DNA with RNA polymerase from E . coli B/r WU-36-10-11-12 (E . coli W12) and its rifampicin-resistant mutant rpoB409 was studied . The rpoB409 mutant possesses a highly pleiotropic effect due to alteration in the RNA polymerase beta-subunit structure . The two RNA polymerases have been previously shown to differ in gene selection during RNA synthesis on T7 DNA . In this study it was found that the change in selective properties of the mutant RNA polymerase occurs during its interaction with DNA, the general ability of the enzyme to melt DNA being unaffected.

Cell, 1986 May 9, 45(3), 453 - 9
The E . coli dnaY gene encodes an arginine transfer RNA; Garcia GM et al.; The E . coli dnaY gene product is an arginine tRNA . Its 77 nucleotide sequence can be folded into a typical cloverleaf structure with a UCU anticodon corresponding to the rare arginine codon AGA . A dnaY+ plasmid confers overproduction of at least one arginine-accepting minor species of tRNAArg . The dnaY promoter was identified by run-off transcription studies, and the initiating nucleotide was identified by sequencing the 5' end of the in vitro transcript . The primary products in vitro are RNAs of 180 and 190 nucleotides, which presumably are processed in vivo to generate the mature form . Transcription is terminated in vitro, and presumably in vivo, by a rho-dependent process.

FEBS Lett, 1986 May 5, 200(1), 87 - 90
A tobacco chloroplast DNA sequence possibly coding for a polypeptide similar to E . coli RNA polymerase beta-subunit; Ohme M et al.; DNA sequencing has revealed a long open reading frame (ORF) in the large single-copy region of tobacco chloroplast DNA . This ORF consists of 1070 codons and its deduced amino acid sequence shows about 39% homology to that of the beta-subunit of E . coli RNA polymerase . This finding raises a possibility that some of the chloroplast RNA polymerase subunits are coded for by the chloroplast genome.

Vet Rec, 1986 May 3, 118(18), 507 - 9
A review of teat factors in bovine E coli mastitis; Jones TO; Escherichia coli mastitis was first reproduced in 1903 by sticking the organism to teat orifices . E coli is very common in the environment of housed dairy cows and mastitis can easily be reproduced experimentally by the introduction of as few as 20 organisms into the teat cistern via the teat duct . It is generally accepted that this is the route of natural infection but the processes by which the organisms traverse the teat duct remain unclear . The literature is reviewed and the facts and hypotheses are considered.

Ann Inst Pasteur Immunol, 1986 May-Jun, 137C(3), 273 - 81
Hapten-specific unresponsiveness in mice . IV.--Significance of anti-hapten antibody responses elicited by E . coli lipopolysaccharides in tolerant mice; Huchet R; The antibody response to lipopolysaccharide (LPS) and trinitrophenol-LPS (TNP-LPS) was investigated in mice after tolerance induction to chemically reactive hapten 2-4-6-trinitrobenzene sulphonic acid . The depression of the anti-TNP IgM response elicided by LPS was moderate and lasted 1 week . Depression of the response to TNP-LPS was severe and lasted 5 weeks . Tolerant mice given LPS 7 days after tolerance induction, at a time when it elicited a normal response, and challenged with TNP-LPS 2 weeks later, exhibited the same depression of their anti-TNP response as tolerant mice not given LPS . Furthermore, the anti-TNP IgM elicided by TNP-LPS in normal mice was of higher avidity than that observed with LPS . These results suggest that the anti-TNP response elicided by LPS cannot account for the overall immune status of tolerant mice.

Carcinogenesis, 1986 May, 7(5), 727 - 32
Ascorbate enhances u.v.-mutagenesis in E . coli but inhibits it in Chinese hamster cells; Rossman TG et al.; Ascorbic acid (vitamin C) causes an increase in the mutation frequency of u.v.-irradiated Escherichia coli WP2 . The enhancement occurs at all u.v . fluences, and is dependent upon the ascorbate concentration in the medium . A maximum effect (approximately 8- to 13-fold) is seen at 100-150 micrograms/ml, although some enhancement can be seen even at 10 micrograms/ml . The comutagenic effect of ascorbate with u.v . in E . coli is dependent upon peptone, a constituent of nutrient broth . The enhancement of u.v.-mutagenesis by ascorbate is absent in strains WP2s (uvrA) and WP6 (polA), suggesting that ascorbate affects the repair of pyrimidine dimers . The opposite results are observed for u.v.-mutagenesis in Chinese hamster V79 cells . The presence of ascorbate (50 micrograms/ml) during u.v . irradiation does not enhance the u.v . effect, but rather decreases it approximately 30% . These results are discussed with regard to differences in the mechanism of u.v.-mutagenesis and DNA repair in bacterial and mammalian cells.

J Biochem (Tokyo), 1986 May, 99(5), 1533 - 5
Conformations of fibroblast and E . coli-derived recombinant human interferon-beta s as studied by nuclear magnetic resonance and circular dichroism; Utsumi J et al.; The conformations of fibroblast and E . coli-derived recombinant human interferon-beta s were studied by circular dichroism and nuclear magnetic resonance spectroscopy in the acidic pH region of 4.6 to 1.6 . Both interferons have very similar conformations with high alpha-helix contents (approximately 70%) . These results suggest that glycosylation does not appreciably change the conformation of human interferon-beta . Moreover, a slow conformational change is observed below pH 2.0, which induces the disruption of beta-sheets.

Int J Radiat Biol Relat Stud Phys Chem Med, 1986 May, 49(5), 799 - 808
Mechanism of radiosensitizing effect of chloride ion on E . coli; Shih-Chen SJ et al.; Cells of E . coli capable of repairing DNA damage are sensitized to radiation in the presence of NaCl . However, the enhanced radiolethality was suppressed by the addition of compounds such as an amino acid to the irradiation buffer . The protective efficiencies of these compounds depend on their reactivities with Cl-.2 or OH. . ATP synthesis in the cells irradiated in the presence of NaCl was severely inhibited depending on the dose of irradiation . This reduced rate of ATP synthesis can account for the inhibition of protein, RNA and DNA synthesis in the irradiated cells with NaCl.

Biofizika, 1986 May-Jun, 31(3), 464 - 8
{Interaction of H+ and K+ transport systems in E . coli growing under anaerobic and aerobic conditions}; Martirosov SM et al.; The interaction of H+-ATPase complex F1 X F0 with the Trk system of K+ accumulation in E . coli grown quasi-anaerobically in pepton media with glucose (anaerobia) and aerobically in the salt medium with succinate (aerobia) treated with cyanide was studied . The ratio of H+ fluxes via F1 X F0 and K+ fluxes via the Trk system is stable and equals 2 in anaerobia and is changed from 0.5 to 5.0 in aerobia treated with cyanide in response to pH variation, K+ activity and temperature variations . Q10 is about 2.8 both for F1 X F0 and the Trk system in anaerobia, but 2.4 and 1.0 respectively in aerobia . K+ distribution in anaerobia reaches high values, K+ equilibrium potential is much higher than the measured membrane potential . K+ distribution in aerobia is smaller, which is in conformity with the measured membrane potential . Structural association of F1 X F0 and the Trk system with the formation of H+--K+-pump is assumed to take place in anaerobia, and separate operation of these systems occurs in aerobia, transfer of K+ via Trk system being energized by the electric field on the membrane.

Biochimie, 1986 May, 68(5), 697 - 703
Interaction between initiator Met-tRNAfMet and elongation factor EF-Tu from E . coli; Hansen PK et al.; It has recently been shown that the non-formylated initiator Met-tRNAfMet from E . coli can form a stable ternary complex with the elongation factor EF-Tu and GTP . Using the protection of EF-Tu:GTP against spontaneous hydrolysis of the aminoacylester bond of Met-tRNAfMet, we confirm these results, and show that the protection is specific for the non-formylated form of the initiator tRNA . The ternary complex Met-tRNAfMet:EF-Tu:GTP can be isolated by column chromatography in a way similar to that demonstrated previously with EF-Tu complexed to the elongator Met-tRNAmMet . 32P-labeled Met-tRNAfMet within the ternary complex was analyzed by the footprinting technique . The pattern of initiator tRNA protection by EF-Tu against ribonuclease digestion is not significantly different from the one found previously for elongator tRNAs . These results lead us to suggest that the initiator tRNAfMet, under growth conditions which do not permit formylation, may to some extent function as an elongator tRNA.

Bioorg Khim, 1986 May, 12(5), 708 - 10
{1-(3-C-methyl-beta-D-ribofuranosyl)uracil-5'-phosphate--a terminator of RNA synthesis catalyzed by RNA polymerase from E . coli}; Aivazashvili VA et al.; It is shown that 1-(3'-C-methyl-beta-D-ribofuranosyl)uracil 5'-triphosphate is a terminator of RNA synthesis and may be used for nucleic acid sequencing with DNA-dependent RNA polymerase from E . coli.

Nucleic Acids Res, 1986 Apr 25, 14(8), 3181 - 95
The gene for Spirodela oligorhiza chloroplast ribosomal protein homologous to E . coli ribosomal protein L16 is split by a large intron near its 5' end: structure and expression; Posno M et al.; The nucleotide sequence of a Spirodela chloroplast DNA fragment, which directs the synthesis of a approximately 15 kD chloroplast ribosomal protein in an E . coli cell free system, has been determined . The deduced aminoacid sequence of the open reading frame shows extensive homology with E . coli ribosomal protein L16 . Primer extension analysis, S1 nuclease mapping and nucleotide sequence analysis indicate that the chloroplast L16 gene (rpl16) is interrupted by a 1411 bp intron, which separates a short 5' exon from a large 3' exon . The shorter in vitro synthesized ribosomal protein results from an artificial initiation event at an internal ATG codon in the 3' exon . The sequences at the 5' and 3' splice sites of the intron are similar to consensus sequences described for other, class II intron containing, protein coding chloroplast genes . Northern hybridization experiments reveal 6 stable transcripts of rpl16 ranging from 500 b to greater than 4000 b . As determined by S1 nuclease mapping, the 3'-end of the smallest transcript maps exactly after the stem of a proposed termination signal . Finally, the implications of the finding of a cluster of several chloroplast ribosomal protein genes and possible polycistronic transcription of this chloroplast DNA region, are discussed in relation to the organization and expression of ribosomal protein genes found in the S10 operon of E . coli.

Cell, 1986 Apr 25, 45(2), 315 - 24
The intracellular signal for induction of resistance to alkylating agents in E . coli; Teo I et al.; The E . coli ada gene positively controls its own expression and that of other genes (alkA, alkB, aidB) involved in repair of DNA alkylation damage . The cloned ada and alkA genes and purified Ada protein have been used in cell-free systems to identify the inducing signal . Self-methylation of the Ada protein by transfer of a methyl group from a phosphotriester in alkylated DNA to a cysteine residue in the protein converts it to an activator of transcription . The covalently modified Ada protein binds specifically to promoter regions containing the sequence d(AAANNAAAGCGCA) immediately upstream of the RNA polymerase binding sites . This is apparently the first example of conversion of a regulatory gene product to a transcriptional activator by a posttranslational modification event.

J Immunol, 1986 Apr 15, 136(8), 2924 - 9
Immunologic activity of lipopolysaccharides released from macrophages after the uptake of intact E . coli in vitro; Duncan RL Jr et al.; Lipopolysaccharides (LPS) have been isolated from culture supernatants and from cell lysates after the in vitro phagocytosis of E . coli by murine macrophages . By using E . coli radiolabeled specifically in the LPS component with {3H}galactose, our studies have shown that the macrophage-"processed" LPS is enhanced with respect to its immunostimulatory activity in comparison with control phenol-water-extracted LPS . As assessed by its ability to induce interleukin 1 production in naive macrophages or proliferation in cultures of murine splenocytes, the macrophage-processed LPS is between 10- and 100-fold greater in specific activity . Evidence is presented for both structural and chemical alterations in the LPS macromolecule.

Biochem Biophys Res Commun, 1986 Apr 14, 136(1), 404 - 10
Binding of recA protein from E . coli to double-stranded DNA: influence of the degree of superhelicity; Chabbert M et al.; The binding of the recA protein from E . coli to supercoiled double-stranded DNA is strongly dependent upon the superhelical density of the DNA molecule . A threshold of superhelical density is required for strong binding in the presence of ATP . This finding is consistent with a model in which recA protein first binds to unpaired regions and then polymerises on the contiguous double-stranded lattice.

Nucleic Acids Res, 1986 Apr 11, 14(7), 2921 - 38
Solutions of RNA polymerase plus linear wild type E . coli lac DNA fragments contain a mixture of stable P1 and P2 promoter complexes; Lorimer DD et al.; The lac promoter is known to have overlapping, mutually exclusive, binding sites for RNA polymerase . A number of techniques have been used to probe solutions of polymerase and linear lac DNA fragments, including gel electrophoresis binding assays, transcription experiments, and exonuclease III digestions . The data indicate that mixing RNA polymerase with the wild type lac promoter leads to formation of more than one kind of complex; a typical solution contains enzyme in heparin resistant, "open" complexes at the P2 site, while other DNA molecules have polymerase bound in a heparin sensitive, "closed" complex at P1 . There may be other rather stable complexes as well . The presence of more than one type of complex has obvious implications for in vitro physical studies of this system . The data suggest that using truncated DNA fragments which eliminate the P2 site may allow isolation and study of P1 closed complexes . Quantitative analysis of the fractions of polymerase found at P1 and P2 implies that P2 can have only a limited effect on lac transcription in the cell.

Acta Pathol Microbiol Immunol Scand {B}, 1986 Apr, 94(2), 75 - 83
Morphological study of the in vitro cytotoxic effect of alpha-hemolytic E . coli bacteria and culture supernatants on human blood granulocytes and monocytes; Gadeberg OV et al.; The morphological changes of human blood granulocytes and monocytes caused in vitro by alpha-hemolytic strains of E . coli and bacteria-free culture supernatants of these bacteria were studied by light- and transmission electron microscopy . The following sequence of cellular alterations were observed: Cessation of intracellular cytoplasmic streaming and cellular movements succeeded by extension of cytoplasmic pseudopodia, degranulation and development of cytoplasmic and nuclear edema . Within two hours the leukocytes appeared as empty sacks . Finally, long straight filaments were formed between the cells . The changes induced by alpha-hemolytic bacteria and culture supernatants containing free alpha-hemolysin appeared to be identical . The cytotoxic effect became more pronounced as the numbers of bacteria, the hemolytic activity of growth supernatants or the period of incubation were increased . A beta-hemolytic and a nonhemolytic E . coli strain were not cytotoxic.

Environ Health Perspect, 1986 Apr, 66, 159 - 65
An overview of species differences in the effects of a water extract of cotton bract on isolated airway smooth muscle, and effects of E . coli lipopolysaccharide; Fedan JS et al.; Our laboratory has been comparing the activity of a water extract of cotton bract (CBE) with the isolated trachealis smooth muscle of the dog, guinea pig, and cat . CBE induced contractions that were not mediated by 5-hydroxytryptamine (5-HT), histamine, or muscarinic receptors . The active agent(s) in CBE was dialyzable (less than 14,000 molecular weight), and substantial activity was retained after low-temperature ashing . CBE potentiated contractions of dog trachealis to histamine and 5-HT and relaxation responses to isoproterenol, whereas it had no effect on responses to methacholine and KCl . In the guinea pig trachealis, CBE reduced responsiveness to KCl, potentiated relaxations to adenosine and ATP, and did not alter the responses to the remaining agents . Responses of cat trachealis to KCl and isoproterenol were potentiated by CBE, while those to 5-HT were unaffected . Neurogenic cholinergic contractile responses were potentiated by CBE in the trachealis of the dog, but not of the guinea pig, while neurogenic relaxations were potentiated by CBE in guinea pig trachealis but not in the dog trachealis . There are thus marked species differences in the acute effects of CBE on airway smooth muscle . Due to recent interest in the possible involvement of bacterial endotoxins in the etiology of byssinosis, we examined the effects of E . coli lipopolysaccharide (LPS) in guinea pig trachealis . An initial examination revealed that LPS potentiated responses to histamine, but not those to methacholine and isoproterenol . This effect vanished upon a second appraisal with a different batch of LPS . The effect of LPS in airway smooth muscle is thus, at present, equivocal.

Biochem Int, 1986 Apr, 12(4), 593 - 602
Stimulation in vitro of expression of the amp gene of pBR322 by soluble protein fractions isolated from E . coli; Kuriki Y; Two soluble protein fractions isolated from E . coli were found to be required for efficient expression of the amp gene of pBR322 in an in vitro coupled transcription-translation system consisting of unwashed ribosomes and a polyethylene glycol-treated S30 extract from E . coli . Both fractions stimulated the pBR322-directed synthesis of the amp gene product, pre-beta-lactamase, in the in vitro system . However, pBR322-directed RNA synthesis was stimulated only by one fraction . It is therefore likely that one fraction enhances the transcription of the amp gene and the other is involved mainly in stimulation of the translation of pre-beta-lactamase mRNA.

Nucleic Acids Res, 1986 Mar 25, 14(6), 2637 - 50
Sequences of the E . coli uvrB gene and protein; Arikan E et al.; The UvrB protein is one of the three subunits of the E . coli ABC excinuclease . We have reported the sequences of the other two subunits, the UvrA and UvrC proteins . In this paper the sequence of the UvrB protein is presented . The protein sequence was determined from the DNA sequence of the uvrB gene and was confirmed by sequencing the NH2-terminus of the UvrB protein and analyzing its overall amino acid composition . The coding region of uvrB is 2019 basepairs, specifying a protein of 672 amino acids and Mr of 76,118 . The sequence of the UvrB protein shows a moderate level of homology to that of the UvrC protein and to the ATP binding site of the UvrA protein . During purification of UvrB protein a proteolytic product, UvrB, is produced in high quantities . We find that UvrB results from removal of about 40 amino acids from the COOH-terminus of the UvrB protein . The uvrB gene has complex regulatory features . On the 5' side, the coding region is preceded by 3 promoters, a DnaA box and an SOS box . On the 3' side the gene is followed by an REP (Repetitive Extragenic Palindrome) sequence which has been implicated in gene regulation by an unknown mechanism.

Nucleic Acids Res, 1986 Mar 25, 14(6), 2763 - 77
Examination of the internal promoter, PE, in the ilvGMEDA operon of E . coli K-12; Wek RC et al.; The ilvGMEDA operon of Escherichia coli K-12 contains an internal promoter, PE, in the distal portion of the ilvM gene immediately upstream from the ilvE gene . The location of this promoter was determined using S1 nuclease protection analyses of in vivo and in vitro transcripts . The transcriptional activity of the internal promoter was compared to the transcriptional activity of the operon-proximal promoter P1P2 using transcriptional fusion vectors and plasmid copy number determinations . These measurements showed that the P1P2 promoter is 52-fold stronger than the internal PE promoter . Estimates of the transcriptional role of the internal promoter on ilvE gene expression during growth conditions in excess and limiting branch chain amino acids is presented.

FEBS Lett, 1986 Mar 17, 198(1), 16 - 20
Direct immunological identification of full-length cDNA clones for plant protein without gene fusion to E . coli protein; Nakamura K et al.; By immunological screening of a cDNA library constructed from potato tuber poly(A)+ RNA and Escherichia coli expression vector pUC8 by the vector-primer and linker procedure of Okayama and Berg {(1982) Mol . Cell Biol . 2, 161-170}, nearly full-length cDNA clones for patatin, a major protein of potato tuber, were identified . The cDNA carrying part of the 5'-noncoding region of the patatin mRNA, in addition to entire coding and 3'-noncoding regions, expressed prepatatin in E . coli cells by translational initiation inside cDNA . These results suggest that nearly full-length cDNA clones with entire coding region can be identified directly by immunological screening without gene fusion to E . coli proteins at least for some plant mRNAs.

Biochem J, 1986 Mar 15, 234(3), 593 - 604
The cloning and sequence analysis of the aspC and tyrB genes from Escherichia coli K12 . Comparison of the primary structures of the aspartate aminotransferase and aromatic aminotransferase of E . coli with those of the pig aspartate aminotransferase isoenzymes; Fotheringham IG et al.; In this paper we describe the cloning and sequence analysis of the tyrB and aspC genes from Escherichia coli K12, which encode the aromatic aminotransferase and aspartate aminotransferase respectively . The tyrB gene was isolated from a cosmid carrying the nearby dnaB gene, identified by its ability to complement a dnaB lesion . Deletion and linker insertion analysis located the tyrB gene to a 1.7-kilobase NruI-HindIII-digest fragment . Sequence analysis revealed a gene encoding a 43 000 Da polypeptide . The gene starts with a GTG codon and is closely followed by a structure resembling a rho independent terminator . The aspC gene was cloned by screening gene banks, prepared from a prototrophic E . coli K12 strain, for plasmids able to complement the aspC tyrB lesions in the aminotransferase-deficient strain HW225 . Sub-cloning and deletion analysis located the aspC gene on a 1.8-kilobase HincII-StuI-digest fragment . Sequence analysis revealed the presence of a gene encoding a 43 000 Da protein, the sequence of which is identical with that previously obtained for the aspartate aminotransferase from E . coli B . Considerable overproduction of the two enzymes was demonstrated . We compared the deduced protein sequences with those of the pig mitochondrial and cytoplasmic aspartate aminotransferases . From the extensive homology observed we are able to propose that the two E . coli enzymes possess subunit structures, subunit interactions and coenzyme-binding and substrate-binding sites that are very similar both to each other and to those of the mammalian enzymes and therefore must also have very similar catalytic mechanisms . Comparison of the aspC and tyrB gene sequences reveals that they appear to have diverged as much as is possible within the constraints of functionality and codon usage.

Biochem Biophys Res Commun, 1986 Mar 13, 135(2), 411 - 8
The effect of nalidixic acid on expression from related E . coli promoters; Herrin GL Jr et al.; The effect of the DNA gyrase inhibitor, nalidixic acid, on expression from E . coli promoters was studied using the pKO-1, galactokinase expression vector system . Expression from a series of related hybrid promoters, tet promoter variants and the trp promoter flanked by oligonucleotide blocks was measured after incubation with nalidixic acid . Expression from the pBR322 tet promoter and tet promoter mutants within the -10 region was reduced after the drug treatment . The lacUV5, trp, and tettrp promoters were essentially unaffected while the trplac and the trptet promoters were stimulated . Studies of the trp promoter flanked by upstream or downstream oligonucleotide blocks revealed similar responses to the trp promoter parent control plasmids.

Nucleic Acids Res, 1986 Mar 11, 14(5), 1967 - 83
Interaction between E . coli RNA polymerase and the tetR promoter from pSC101: homologies and differences with other E . coli promoter systems from close contact point studies; Duval-Valentin G et al.; The interaction between E . coli RNA polymerase and the tetR promoter from pSC101, was studied by protection and premodification experiments, using dimethyl sulfate, methylation of single stranded cytosines, and DNAase I footprinting . Whereas qualitative and quantitative results from the chemical approach conform to patterns already displayed by other promoter systems, hypersensitive sites to DNAase I attack differ from those of other promoters . Distribution and nature of the contacts suggest that regions of the promoter sequence participates differently in complex formation . The involvement of major and minor grooves of the double helix in the complex with the enzyme, differs along the promoter . After a comparison of the results from seven different promoters, a pattern of conserved contacts seem to appear . Comparison of temperature dependence of local unwinding around the transcription start site (detected by the appearance of single stranded cytosines), and DNAase I footprinting, reveals that the process leading to stable complex formation can be achieved without disruption of base-pairing.

Nucleic Acids Res, 1986 Mar 11, 14(5), 2215 - 28
Nucleotide sequence of the CytR regulatory gene of E . coli K-12; Valentin-Hansen P et al.; We have determined the nucleotide sequence of the cytR gene, which codes for the Cyt repressor (CytR) . The coding region consists of 1023 or 1029 bp . The subunits of CytR are thus predicted to consist of 341 or 343 residues . It is shown that the N-terminal segment of the polypeptide is structurally similar to the DNA-binding region of known DNA-binding proteins . In addition, there exists an exceptionally high amino acid sequence homology between CytR and the Gal repressor, indicating a common origin of evolution.

FEBS Lett, 1986 Mar 3, 197(1-2), 199 - 203
The N-terminal 21 amino acids of a 70 kDa protein of the yeast mitochondrial outer membrane direct E . coli beta-galactosidase into the mitochondrial matrix space in yeast cells; Hase T et al.; The intracellular location of fusion proteins was investigated in yeast cells . They consisted of the N-terminal 21, 61 or 292 amino acids of the 70 kDa protein of the yeast mitochondrial outer membrane and an enzymatically active E . coli beta-galactosidase . The hybrids containing 61 or 292 residues of the 70 kDa protein, as well as the original 70 kDa protein, were localized on the outer membrane in a tightly membrane-bound form . In contrast, the other hybrid was exclusively localized in the mitochondrial matrix space as a soluble protein.

Radiobiologiia, 1986 Mar-Apr, 26(2), 153 - 7
{Modification of the radiosensitivity of E . coli cells by factors affecting the yield of photoreactivated damage}; Seleva NG; A study was made of the influence of irradiation conditions on the yield of the photoreactivable damages in radiosensitive mutants of E . coli cells (E . coli WP2) . Pyrimidine dimers were shown to occur in exrA- and recA- mutants irradiated under anoxic conditions, the survival of these mutants being modified depending on cell genotype . The processes of direct excitation of the molecules were involved in the formation of the damages observed . It can be assumed that the lesser oxygen effect observed in exrA- and partially in recA- mutants of E . coli WP2 cells is associated with a contribution of the photoreactivable damages to a lethal effect of ionizing radiation.

Mutat Res, 1986 Mar, 165(2), 81 - 8
Repair in E . coli of transforming plasmid DNA damaged by psoralen plus near-ultraviolet irradiation; Roberts RJ et al.; Treatment of DNA with psoralen plus near-ultraviolet irradiation gives rise to both monoadducts and cross-links . We have examined the repair of plasmid NTP16 DNA treated in this way in vitro and then used to transform E . coli . Monoadducts are found to be potentially lethal, and can be repaired by uvr-dependent and recA-dependent pathways . The presence of a related resident plasmid in the transformed cells can enhance the survival of the incoming damaged NTP16 DNA . This effect is not recA-dependent, and a similar effect (designated "resident enhanced repair") has been observed previously with UV-irradiated plasmids of this particular incompatibility group . Removal of unbound psoralen from the plasmid DNA and exposure to further NUV is known to increase the ratio of cross-links to monoadducts, and we demonstrate that such cross-linked plasmid DNA is not readily repaired following transformation . However in the presence of homologous DNA (related resident plasmid) there is evidence for the repair, and hence uptake by the cell, of cross-linked DNA.

Bioorg Khim, 1986 Mar, 12(3), 327 - 31
{Preparation of an insulin conjugate with beta-galactosidase from E . coli for immunoenzyme assay}; Markarian AN et al.; A modified procedure has been worked out for preparing a conjugate of porcine insulin with E . coli beta-galactosidase employing a heterobifunctional reagent, N-hydroxysuccinimidyl m-maleimidobenzoate . Optimal conditions for insulin acylation and subsequent coupling with beta-galactosidase were selected that afforded the conjugate in a high yield . The ability of the modified antigen to react with antibody was evaluated in the reaction of conjugate binding with immobilized monoclonal antibody to insulin . The conjugate almost completely retained the enzymatic activity and reacted with high specificity with the antibody to insulin . The conjugate can be used in competitive ELISA of insulin.

Cell, 1986 Feb 28, 44(4), 521 - 33
Universal code equivalent of a yeast mitochondrial intron reading frame is expressed into E . coli as a specific double strand endonuclease; Colleaux L et al.; The intron of the mitochondrial 21S rRNA gene of Saccharomyces cerevisiae (r1 intron) possesses a 235 codon long internal open reading frame (r1 ORF) whose translation product determines the duplicative transposition of that intron during crosses between intron-plus strains (omega+) and intron-minus ones (omega-) . Using site-directed mutagenesis, we have constructed a universal code equivalent of the r1 ORF that, under appropriate promoter control, allows the overexpression in E . coli of a protein identical to the mitochondrial intron encoded "transposase" . This protein exhibits a double strand endonuclease activity specific for the omega- site . This finding demonstrates, for the first time, the enzymatic activity of an intron encoded protein whose function is to promote the spreading of that intron by generating double strand breaks at a specific sequence within a gene.

Biochim Biophys Acta, 1986 Feb 24, 866(1), 37 - 43
The role of upstream sequences in determining the strength of an rRNA promoter of E . coli; Petho A et al.; In vitro transcription experiments were carried out with recombinant plasmids containing the promoters of the rrnB gene of Escherichia coli, and with deletion mutants lacking various lengths of the AT-rich sequence upstream from the P1 promoter of that gene . The main conclusions are as follows: The in vitro transcriptional activity of the P1 and P2 promoters of the rrnB gene are an order of magnitude higher on closed-circular (supercoiled) templates than on linear DNA; the strong P1 and P2 promoters are heparin-sensitive on linear templates, and on circular DNA only P2 is heparin-resistant; removal of the upstream AT-rich region did not decrease the apparent in vitro strength of the P1 promoter under standard conditions (50 mM KCl, high RNA polymerase/DNA ratio); at higher salt concentrations, or with a lower RNA polymerase/DNA ratio, the deletion mutants displayed much lower in vitro transcriptional activity than the wild-type, and the apparent weakening of the P1 promoter was roughly proportional to the length of the deleted AT-rich sequence . The implications of these findings for the possible in vivo role of the AT-rich region are discussed.

FEBS Lett, 1986 Feb 17, 196(2), 284 - 90
Dimeric enzyme IImtl of the E . coli phosphoenolpyruvate-dependent phosphotransferase system . Cross-linking studies with bifunctional sulfhydryl reagents; Roossien FF et al.; The occurrence of intermolecular dithiols on EIImtl has been studied with a number of thiol-specific cross-linking reagents . The reaction of EIImtl with bifunctional maleimide derivatives inactivates the enzyme . At the same time the enzyme is irreversibly cross-linked to a dimeric species . Under optimal conditions 50% of the protein is cross-linked upon reaction with the dimaleimides . The enzyme is also cross-linked under oxidizing conditions in the presence of CuCl2, presumably by oxidizing an intermolecular dithiol to a disulfide . This oxidation can be reversed by the addition of the reducing agent dithiothreitol . The reaction of phosphorylated EIImtl with the same sulfhydryl-specific bifunctional reagents does not lead to any cross-linked product . The results are discussed in terms of the association state of the purified protein and the distribution of its thiol groups.

FEBS Lett, 1986 Feb 3, 196(1), 9 - 13
Direct evidence for a coupling between synthesis and export of PhoS in E . coli; Anba J et al.; The accumulation of pre-PhoS under conditions of PhoS overproduction has been previously described . It is now demonstrated that during the induction of PhoS, a delay in the completion of polypeptide chain elongation can be detected . This delay is related to the extent of jamming of export sites by pre-PhoS or by other exported proteins . These results suggest that a component required for completion of pre-PhoS polypeptide becomes limiting, being titrated by the excess of nascent chains bearing signal peptides . This component thus probably acts at an early step in the export pathway.

Psychol Med, 1986 Feb, 16(1), 209 - 11
E . coli antibodies in schizophrenia; Kroll J; The present investigation demonstrates relatively high antibody titres against an E . coli O-antigen in sera from somatically healthy male schizophrenic patients . This observation supports the suggestion that abnormal portasystemic collaterals are relevant to the manifestation of schizophrenia.

Bioorg Khim, 1986 Feb, 12(2), 293 - 6
{Ribosomal protein S1 in the complex of E . coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene}; Boni IV et al.; The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method . The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056 . This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene . The possible spatial proximity between these two regions is discussed.

Mol Gen Genet, 1986 Feb, 202(2), 246 - 50
DNA methylation differentially enhances the expression of one of the two E . coli dnaA promoters in vivo and in vitro; Braun RE et al.; The promoter/regulatory region of the dnaA gene, whose gene product is required for the initiation of DNA replication in Escherichia coli K-12, contains an unusually large number of Dam methylation sites . In this paper we report that the expression of the dnaA gene is decreased in Dam- strains of E . coli . The decrease in the expression of dnaA was measured in vivo using a dnaA-lacZ gene fusion . In vivo S1 nuclease mapping demonstrated that the decrease was due to a differential decrease in expression from the more proximal of the two dnaA promoters, dnaA2P . Comparison of the strengths of the two dnaA promoters in an in vitro transcription system using methylated and unmethylated DNA templates suggests that the effect of methylation on dnaA2P is probably at the level of RNA polymerase/DNA interaction . We suggest that this effect of methylation may be important in controlling the expression of dnaA during the E . coli cell cycle.

Bioorg Khim, 1986 Feb, 12(2), 200 - 5
{Phosphorylation as a method of regulating inorganic pyrophosphatase activity in E . coli . II . Identification of the types of chemical bonds between phosphate and the enzyme}; Vener AV et al.; A bond formed by phosphate with Pi-phosphorylated pyrophosphatase from E . coli was found to be labile in acidic and alkaline media and to be rapidly cleaved by hydroxylamine at neutral pH . N-Methylhydroxylamine modifies also activated carboxyl groups of the enzyme . Interaction of inorganic pyrophosphatase with ATP produces an alkali-resistant phosphoamide bond . A phosphorylated amino acid, identified as phosphohistidine, was isolated from the alkaline hydrolyzate of the ATP-phosphorylated pyrophosphatase.

Bioorg Khim, 1986 Feb, 12(2), 195 - 9
{Phosphorylation as a method of regulating inorganic pyrophosphatase activity in E . coli . I . Phosphorylation and enzyme activation induced by ATP}; Vener AV et al.; ATP phosphorylates the regulatory center of E . coli inorganic pyrophosphatase with the resultant 1,5-fold increase in the activity of the enzyme . The maximal incorporation of the ATP gamma-group into pyrophosphatase is 3 moles per mole of the protein . Pi likewise phosphorylates the enzyme regulatory center and lowers the pyrophosphatase activity by 10-15% . The ATP- and Pi-mediated phosphorylation processes are interrelated; ATP prevents phosphorylation by Pi and brings about rapid dephosphorylation of Pi-modified protein.

Cell, 1986 Jan 17, 44(1), 117 - 24
Insertion of an R1 plasmid into the origin of replication of the E . coli chromosome: random timing of replication of the hybrid chromosome; Koppes L et al.; A 16 bp BgI II fragment was deleted in vitro from the minimal origin of replication of the Escherichia coli chromosome, oriC, and was replaced by a 10 kb R1 miniplasmid, pKN1562, containing the basic R1 replicon and a kanamycin resistance gene . The deletion-insertion was transferred by homologous recombination into the chromosome of a dnaA(ts) strain . P1 transduction separated the origin "mutation" from the dnaA46 allele . Integration of mini-R1 into oriC was verified by Southern blotting and by analysis of the R1 incompatibility phenotype . It was possible to isolate normal R1 miniplasmids from the integrated R1 . Chromosome replication was initiated at random times after a short delay . The constructed strains grew 20%-30% slower than the wild type and showed more heterogeneous cell sizes.

Cell, 1986 Jan 17, 44(1), 197 - 205
DNA determinants of rRNA synthesis in E . coli: growth rate dependent regulation, feedback inhibition, upstream activation, antitermination; Gourse RL et al.; We have examined the DNA regions required for rRNA synthesis in E . coli using promoter-lacZ and lambda PL-rrnB operon fusions . Sequences between -51 and -20 with respect to the P1 promoter transcription initiation site contain the critical information for growth rate dependent control . The region essential for growth rate regulation is the same as that necessary for feedback inhibition . A separate upstream region, between -51 and -88, increases rRNA transcription at least 15-fold and appears to have an abnormal conformation . The box A sequence downstream of promoter P2, but not DNA between P2 and box A, is required for efficient rRNA chain elongation . These results indicate that neither upstream activation nor antitermination determines growth rate dependence . Rather, growth rate regulation takes place at the target site for the negative feedback system, the P1 promoter itself . We propose that negative feedback regulation is responsible for the growth rate dependence of rRNA synthesis in E . coli.

FEBS Lett, 1986 Jan 6, 194(2), 343 - 6
Expression of the human apolipoprotein AI gene fused to the E . coli gene for beta-galactosidase; Lorenzetti R et al.; The human apoAI gene was expressed in E . coli by in-frame fusion to a modified beta-galactosidase gene present in plasmid pUR291 . The fused beta-galactosidase-apoAI gene product was expressed at a high level and was recognized by an anti-human apoAI antiserum . Besides the fused protein, at least one degradation product having an Mr similar to that of beta-galactosidase was present in high amounts in bacterial extracts . These results and those of a pulse-chase experiment indicate that degradation took place only in the apoAI moiety of the chimeric protein.

Enzyme, 1986, 36(4), 261 - 5
Chemical modification of tryptophanase from E . coli with polyethylene glycol to reduce its immunoreactivity towards anti-tryptophanase antibodies; Yoshimoto T et al.; Escherichia coli tryptophanase was modified with 2,4-bis(O-methoxypolyethylene glycol)-6-chloro-s-triazine (activated PEG2, MW 5,000 x 2) . The modified tryptophanase, in which approximately 43% of the total 120 amino groups and 38% of the total 16 sulfhydryl groups in the molecule were coupled, completely lost the immunoreactivity towards anti-tryptophanase serum from rabbit . Approximately 10% of the enzymic activity was retained . The modified enzyme showed the same physicochemical properties as the native enzyme: Km value for L-tryptophan (0.3 mmol/l), optimum pH (8.0) and optimum temperature (50 degrees C) . The modified enzyme was more resistant than the native counterpart against proteolytic digestion with trypsin.

Nucleic Acids Symp Ser, 1986, (17), 191 - 4
A new method for DNA surface-property display and its application to E . coli promoter sequences; Fujino S et al.; A personal computer program to visualize and compare the property of double-stranded DNA surface has been developed . Comparison of the surface property between Watson-Crick base-pairs in B-form DNA has elucidated that the base-pair replacement between a "degenerated base-pairs" conserves the pattern of potential hydrogen-bonding sites in both major and minor grooves . The idea of the "degenerated base-pairs" was applied for the problem of the base-sequence variation from the consensus sequence in the -35 region of E . coli promoter . The sequence variation is found to have tendency to occur among the degenerated base-pairs.

Urol Res, 1986, 14(5), 265 - 6
Acute vesiculitis and its prostatic complications caused by E . coli in the rat; Maglione M et al.; Injection of solutions of E . coli leads to vesiculitis which regresses spontaneously, and to interstitial prostatitis . Castration preceding experimental injection of a bacterial solution modifies the progression of the vesiculitis which then becomes chronic . Infection does not seem to diffuse via the lympathic system, even after castration.

Dev Biol Stand, 1986, 63, 79 - 87
Synthesis and antigenic activity of E . coli ST and its analogues; Bhatnagar PK et al.; Several enterotoxigenic E . coli (ETEC) are common causes of diarrhea in man and animals . These strains of E . coli produce two types of enterotoxins: heat-stable (ST) and heat-labile (LT) . These toxins are peptides of molecular weight 2000 and 90,000 daltons, respectively . It is proposed that the synthetic analogues of these toxins could be effectively used as the vaccines against enterotoxigenic activity of E . coli . In this paper we report the isolation and chemical characterization of a heat-stable toxin STa . We also report the synthesis of this toxin and its analogues and their biochemical and immunological characterization.

Basic Life Sci, 1986, 38, 287 - 94
The involvement of an E . coli multiprotein complex in the complete repair of UV-damaged DNA; Grossman L et al.; The bimodal nature of the E . coli uvrABC catalyzed incision reaction of UV irradiated DNA leads to potential excision of a 12-13 base long damaged fragment . However, the oligonucleotide fragment containing the UV-induced pyrimidine dimer is not released under non-denaturing in vitro reaction conditions . The uvrABC proteins, also, are stably bound to the incised DNA and do not turn over following the incision event . In this communication it is shown that damaged fragment release from the parental uvrABC incised DNA is dependent on either chelating conditions or upon the simultaneous addition of the uvrD gene product (helicase II) and the polA gene product (DNA polymerase I) when catalyzing concommitant polymerization of deoxynucleoside triphosphate substrates . The product of this multiprotein catalyzed series of reactions serves as a substrate for polynucleotide ligase which results in the restoration of the integrity of the strands of DNA . The addition of the uvrD protein to the incised DNA-uvrABC complex also results in turnover of only the uvrC protein . It is suggested that the repair processes of incision, excision, resynthesis and ligation are coordinately catalyzed by a protective complex of proteins in a 'repairosome' type of configuration.

Jpn J Physiol, 1986, 36(2), 267 - 75
Baroreflex participation of cardiovascular response to E . coli endotoxin; Koyama S et al.; The purpose of this experiment was to evaluate the effects of the arterial baroreceptor buffering capacity on cardiovascular parameters during hypotension caused by E . coli endotoxin in anesthetized dogs . In the control group, mean blood pressure and cardiac output fell significantly from 104 +/- 10 mmHg to 63 +/- 7 mmHg and 1.17 +/- 0.16 l/min to 0.67 +/- 0.08 l/min, respectively, 60 min after intravenous injection of endotoxin (1 mg/kg) . Central venous pressure also decreased significantly after the injection . Total peripheral resistance and portal vein pressure increased significantly immediately after the injection, and then returned toward baseline levels . The time course of changes in these five cardiovascular parameters after the injection of endotoxin was the same as that in dogs with sino-aortic denervation . Following the injection of endotoxin, stroke volume and left ventricular dP/dt fell significantly in both control and denervated dogs; however, these decreases in the denervated group were significantly greater . These findings suggest that the arterial baroreceptors may play a role in the poor compensatory response to hypotension induced by endotoxin, at least, in the cases of mean blood pressure, cardiac output, total peripheral resistance, central venous pressure, and portal vein pressure.

Circ Shock, 1986, 19(3), 301 - 8
Changes of plasma gastrointestinal glucagon concentrations following lethal infusions of E . coli; Ishida K et al.; We have determined the effect of lethal E . coli infusions in dogs on plasma concentrations of pancreatic and gastrointestinal-derived glucagon and have explored the contributions of each source of glucagon during the early and recovery phases of shock . We examined 18 adult dogs in three protocols: group I received LD100 E . coli alone, group II received LD100 E . coli + tobramycin (TOB), and group III received LD100 E . coli + TOB + methylprednisolone sodium succinate (MPSS) . E . coli organisms were infused intravenously during a 1-hour period and each animal was monitored for 6 hours and observed for a 7-day recovery period . Plasma concentrations of pancreatic and gastrointestinal glucagon were determined by specific RIAs . The survival percentages (greater than 7 days) were 0% in group I, 17% in group II, and 83% in group III . Early progressive increases in plasma concentrations of pancreatic and gastrointestinal-derived glucagon, reaching statistical significance by 6 hours following the onset of E . coli administration, were seen in the three groups . The increase in gastrointestinal-derived glucagon was of a greater magnitude than that from the pancreas . Attenuation of the increase appeared to be achieved by corticosteroid infusion during its time of administration (6 hours) . Recovery from shock was characterized by an exceptionally slow return (greater than or equal to 7 days) to control levels of glucagon in all recovering animals.

Genetics, 1986 Jan, 112(1), 135 - 56
A two-locus neutrality test: applications to humans, E . coli and lodgepole pine; Hedrick PW et al.; The expected disequilibrium between two loci with k alleles at one locus and l alleles at the other is given for a sample of size n drawn from a population under neutrality equilibrium . Three different measures of disequilibrium with 95% intervals are tabulated for combinations of n, k, l and 4Nc, where N is the effective population size and c is the amount of recombination between the loci . The extent and pattern of disequilibrium are strongly dependent upon 4Nc and are somewhat dependent on n, k and l . The 95% intervals are large, particularly for low numbers of alleles and low values of 4Nc . As examples, observed disequilibrium from histocompatibility loci in humans (HLA) and electrophoretic data in E . coli and lodgepole pine were compared to these theoretical values . Using information about recombination rates, the HLA data showed more disequilibrium than neutrality expectations, whereas electrophoretic data from E . coli and lodgepole pine had somewhat less disequilibrium than neutrality expectations.

Circ Shock, 1986, 18(1), 53 - 63
Biventricular function during volume loading in porcine E . coli septic shock, with emphasis on right ventricular function; Schneider AJ et al.; In 14 anesthesized pigs, the effect of E . coli (2 X 10(8)/kg) and volume loading on hemodynamics and right and left ventricular performance were studied . Autologous red cells were labeled in vitro with 99mTC (15-20 mCi) . Gated blood pool studies and hemodynamics were performed simultaneously . E . coli infusion resulted in an abrupt increase in pulmonary artery pressure, whereas systemic blood pressure fell gradually . Gated studies showed a transient increase in right ventricular end-diastolic volume (RVEDV) after 1 hour; left ventricular end-diastolic volume (LVEDV) declined gradually during sepsis . During volume loading, RVEDV and LVEDV both increased . As estimated from the altered Frank Starling relation between preload and SW, a depressed performance of both left and right ventricle was found . We conclude that volume expansion in porcine E . coli septic shock results in a uniform increase of left and right preload despite a substantial increase in pulmonary vascular resistance.

Am J Pathol, 1986 Jan, 122(1), 140 - 51
Direct effects of E coli endotoxin on structure and permeability of pulmonary endothelial monolayers and the endothelial layer of intimal explants; Meyrick BO et al.; The direct structural, metabolic, and physiologic effects of Escherichia coli endotoxin on bovine pulmonary endothelial monolayers and on the intact endothelial layer of bovine pulmonary artery intimal explants were examined . Endothelial monolayers exposed to E coli endotoxin (0.001, 0.01, 0.1, 1.0, and 10 micrograms/ml) for 24 hours in the absence of bovine fetal calf serum (FCS) showed a dose-dependent response, as demonstrated by number of pyknotic cells and lactate dehydrogenase release that was enhanced by addition of FCS . Prostacyclin production was increased only in the presence of FCS . Endotoxin also caused an increase in permeability . Endothelial cells on nitrocellulose filters placed in chemotaxis chambers with radioactive tracers in the upper well showed a significant 25% increase in rate of equilibration (counts in lower well/counts in upper well) of 3H-water after 2 and 3 hours' incubation with endotoxin (3 hours' endotoxin = 0.89 +/- 0.03 m +/- SE; no endotoxin = 0.69 +/- 0.05) and a 40% increase in equilibration of 125I-albumin at three hours (3 hours' endotoxin = 0.40 +/- 0.03; no endotoxin = 0.27 +/- 0.02) . An increase in hydraulic conductance was also seen at 1 hour . Electron microscopy of the endothelial layer of intimal explants showed dilatations in the intercellular junctions and cellular changes representing contraction--increased prominence of cytoplasmic filaments, nuclear crenation, and cytoplasmic protrusions--at 30 and 60 minutes . From 2 hours evidence of cell death was found . Thus, endotoxin causes structural and metabolic changes in pulmonary endothelial cells and an increase in permeability of the endothelial layer . The injury occurs in the absence of FCS but is enhanced by its addition.

Microbiol Sci, 1986 Jan, 3(1), 28 - 31
Expression of heterologous genes in E . coli; Harris TJ et al.; The strategies for the expression of cloned foreign genes in E . coli are described, and some of the tactics that can be employed to ensure high levels of expression are identified . More fundamental problems associated with scale-up, such as plasmid stability and protein processing, are also addressed.

Nucleic Acids Symp Ser, 1986, (17), 131 - 4
The expression of human tumor necrosis factor in E . coli; Nobuhara M et al.; cDNA of human natural TNF (n-TNF) obtained by stimulating human leukemic B cell line (Ball-1) with Sendai virus was cloned . Valine-started-TNF (V-TNF) gene was constructed from the cDNA and expressed in E.coli HB101 under the control of a trp promoter by the induction of 3-indoleacrylic acid . The expression level of V-TNF clone was about 10% of the total E.coli protein . On the other hand, the expression level of glutamine started-TNF (Q-TNF) gene having the same SD-ATG sequence which was constructed from V-TNF gene was as low as about 1/20 of that of V-TNF . The nucleotide sequence around ATG (-4 approximately +12) of Q-TNF gene was randomly changed without modifying the coded amino acid sequence, resulting to obtain high expression clones as similar TNF protein yield as that of V-TNF . These clones possessed A residue rich sequence around the initiation codon ATG . These results show that some correlation might exist between the high expression rate and A residue rich sequence around the initiation codon.

Basic Life Sci, 1986, 38, 265 - 71
Differential expression of SOS genes in an E . coli mutant producing unstable lexA protein enhances excision repair but inhibits mutagenesis; Peterson KR et al.; The lexA41 mutant of E . coli is a UV-resistant derivative of another mutant, lexA3, which produces a repressor that is not cleaved following inducing treatments . lexA41 carried an additional mutation which changed amino acid 132 in the LexA protein from Ala to Thr . The resultant protein was unstable and was degraded both before and after an inducing treatment . This instability was greater at 42 degrees than at 30 degrees . The protein was more stable in Lon- mutants at both temperatures . lac operon fusions to most of the genes in the SOS regulon were used to show that the various damage-inducible genes were derepressed to different extents . uvrA, B, and D were almost fully derepressed . Consistant with this finding, the rate of removal of T4 endonuclease V-sensitive sites was more rapid in the UV-irradiated lexA41 mutant than in normal cells, suggesting a more active excision repair system . We propose that the instability of the LexA41 protein reduces the intracellular concentration of repressor to a level that allows a high level of excision repair . The additional observation that SOS mutagenesis was only weakly induced in a lexA41 uvrA- mutant implies that the mutant protein partially represses one or more genes whose products promote SOS mutagenesis.

Mutat Res, 1986 Jan, 165(1), 1 - 7
The role of the (6-4) photoproduct in ultraviolet light-induced transition mutations in E . coli; Franklin WA et al.; Available evidence rules out the possibility that cyclobutane dimers are the major premutagenic lesions responsible for point mutations at sites of adjacent pyrimidine residues in the experiment systems examined to date in sufficient detail, that is, UV-induced mutations in chromosome loci in E . coli and UV-induced mutations in the cI gene of phage lambda . However, it is likely that the major cytotoxic effects of UV irradiation can be attributed to the cyclobutane pyrimidine dimer, as these lesions occur at 10 times the frequency of other UV-induced photoproducts in the dose range of 0.1-100 J/m2 . The evidence also suggests that cyclobutane pyrimidine dimers are the major lesions responsible for induction of the SOS response and that as such they play an important, though indirect role, in the formation of mutations in irradiated DNA . Cyclobutane dimers may also be the major lesions responsible for other types of UV-light-induced mutations such as deletions . None of the available evidence rules out (6-4) photoproducts as a major premutagenic lesion induced by UV irradiation using these experimental systems . On the contrary, the mutation spectrum induced both in the lacI gene and the cI gene of phage lambda is that predicted for mutations induced by (6-4) photoproducts . The observation that neither the premutagenic lesions nor the (6-4) photoproduct is subject to enzymatic photoreactivation also implies that the (6-4) photoproducts are premutagenic . As reviewed above, neither the photosensitization experiments nor the action spectrum of the (6-4) photoproducts rules out such a role . Might a lesion other than the (6-4) photoproduct be the major premutagenic lesion responsible for point mutations in these experimental systems? It cannot be ruled out that another as yet undefined minor photoproduct that occurs with the same sequence distribution specificity as that of the (6-4) photoproduct and that is also not subject to the reactivating treatments is more mutagenic than the (6-4) photoproduct itself . Candidates for such a lesion might include a photohydrate of the (6-4) photoproduct itself or as yet undefined photoproducts . However, we believe these alternative possibilities to be remote.(ABSTRACT TRUNCATED AT 400 WORDS)

Curr Genet, 1986, 10(5), 421 - 3
Tobacco chloroplast gene coding for subunit I of proton-translocating ATPase: comparison with the wheat subunit I and E . coli subunit b; Shinozaki K et al.; The tobacco chloroplast gene for subunit I of proton-translocating ATPase is located 405 bp down-stream from the gene for subunit III and 58 bp upstream from the gene for subunit alpha in the same DNA strand . This gene is interrupted by a 695 bp intron . The coding region contains 552 bp (184 codons) and its deduced amino acid sequence shows 78% homology with that of the wheat gene for subunit I.

J Gen Microbiol, 1986 Jan, 132 ( Pt 1), 71 - 7
Fimbriation and P-antigen recognition of Escherichia coli strains harbouring mutated recombinant plasmids encoding fimbrial adhesins of the uropathogenic E . coli strain KS71; Rhen M et al.; Deletion mutants of recombinant plasmids encoding the KS71B fimbrial antigens of the uropathogenic Escherichia coli strain KS71 (O4:K12) were constructed . The effects of these mutations were tested by transforming the mutated plasmids into non-fimbriated E . coli HB101 cells and testing the transformants for fimbriation and haemagglutination . A deletion transcriptionally upstream from the fimbrial subunit gene increased the expression of KS71B fimbriae . Deletion of the fimbrial subunit gene resulted in non-fimbriated but haemagglutinating transformants, whereas a deletion 6 kb transcriptionally downstream from the subunit gene resulted in non-haemagglutinating but fimbriate transformants, indicating that fimbriation and haemagglutination were genetically separable . We also present evidence suggesting that the fimbrillin and haemagglutinin are physically associated in the wild-type KS71 strain.

Free Radic Res Commun, 1986, 1(3), 189 - 99
Comparison of pharmacokinetic and cell binding properties of turkey Cu-SOD and E . coli Mn-SOD; Spasic M et al.; The pharmacokinetics in rats and cell fixation properties of coli Mn-SOD are compared with those of Cu-SODs extracted from turkey blood . Despite similarities in molecular weight and pl the different enzymes show different characteristics . The results are discussed with respect to the mechanism of anti-inflammatory activity of superoxide dismutase.

Acta Microbiol Pol, 1986, 35(3-4), 175 - 89
An approach to analyzing UV mutagenesis in E . coli; Clark AJ et al.; UV mutagenesis of single-strand DNA phage can be divided into three types: induced untargeted; induced targeted; and uninduced targeted . We report the development of new tools to determine the number of processes which contribute to these types of mutagenesis . An E . coli tRNA gene, glyU, has been cloned using M13 derivatives mp8 and mp9 as vectors . The nucleotide sequence of glyU and its flanking regions is presented . In this paper, phage glyU anticodon mutants are detected by their ability to suppress GAA and GAT missense mutations in trpA . We used phage carrying GAG and CTC at the anticodon position and found results consistent with the hypothesis that two processes act to produce the transition to GAA suppression: an uninduced regionally targeted process; and an induced locally targeted process with some untargeted activity . The transversion frequency to GAT suppression on the other hand responded as if only an uninduced locally targeted process was involved . Thus, we hypothesize that the new tools have discriminated three different processes of mutagenesis and we discuss further work designed to test this hypothesis.

EMBO J, 1985 Dec 30, 4(13B), 3641 - 8
Mutational analysis of the maize chloroplast ATPase-beta subunit gene promoter: the isolation of promoter mutants in E . coli and their characterization in a chloroplast in vitro transcription system; Bradley D et al.; This paper describes the use of Escherichia coli to isolate Bal31 deletion mutants and single-base substitution mutants that functionally define the promoter of the maize chloroplast beta-ATPase gene (atpB) . Promoter function in E . coli and in a chloroplast in vitro transcription system was determined by S1 nuclease protection experiments using RNA products from each mutant . The results show that in vitro the chloroplast RNA polymerase responds to the promoter point mutations in a quantitatively similar fashion to the E . coli RNA polymerase . Deletion analysis demonstrates that sequences 5' of the -35 region are not necessary for chloroplast promoter function in vitro and that the presence of an adjacent promoter drastically decreases the transcriptional activity of the atpB promoter in E . coli.

Nucleic Acids Res, 1985 Dec 20, 13(24), 8843 - 52
Complete nucleotide sequence of the E . coli N-acetylneuraminate lyase; Ohta Y et al.; The nucleotide sequence of the cloned DNA, 1,243 bp in length coding for N-acetylneuraminate lyase (N-acetylneuraminate pyruvate lyase; NPL) of Escherichia coli has been determined . Nucleotide sequence and amino acid analysis have assigned the open reading frame for NPL, starting with the ATG near its 5'terminus . The molecular weight calculated from the predicted amino acid sequence was 32,640 daltons, being in good agreement with that of a NPL subunit estimated by the SDS-PAGE method and amino acid composition . Several signal sequences conserved in the promoter regions of E . coli were found in the npl gene . They were the Shine-Dalgarno sequence, the Pribnow box and the sequence coserved in the "-35 region" and they were separated to each other with preferable spacing for an efficient transcription . Downstream from the termination codon, the inverted repeat sequence was present, followed by 4 successive T's.

Nucleic Acids Res, 1985 Dec 20, 13(24), 8797 - 811
Site-directed mutagenesis of the Escherichia coli chromosome near oriC: identification and characterization of asnC, a regulatory element in E . coli asparagine metabolism; de Wind N et al.; We developed a new method for the specific mutagenization of the E . coli chromosome . This method takes advantage of the fact that a pBR322 plasmid containing chromosomal sequences is mobilizable during an Hfr-mediated conjugational transfer, due to an homologous recombination between the E . coli Hfr chromosome and the pBR322 derivative . Transconjugants are screened with a simple selection procedure for integration of mutant sequences in the chromosome and loss of pBR322 sequences . Using this method we specifically inactivated several genes near the E . coli replication origin oriC . We found that a gene coding for asparagine synthetase A . This regulatory mechanism was investigated in detail by determining in vivo regulation of asnA promoter activity by the 17kD protein under different growth conditions . Results obtained also suggest a general regulatory role of the 17kD protein in E . coli asparagine metabolism . Therefore the 17kD gene is proposed to be renamed asnC.

J Immunol Methods, 1985 Dec 17, 85(1), 169 - 82
Detection of E . coli colonies expressing the v-sis oncogene product with monoclonal antibodies made against synthetic peptides; Kennett RH et al.; A method for immunodetection of individual epitopes on eukaryotic proteins synthesized in E . coli colonies is described . The system is developed using monoclonal antibodies produced against the Ha-ras protein produced in E . coli JM103 . Monoclonal antibodies made against a synthetic peptide from the v-sis oncogene sequence are then used to identify bacterial colonies in which the v-sis protein is being produced . Production of the v-sis protein by these E . coli colonies was confirmed by immunoblot analysis . The assay utilizes peroxidase conjugated anti-mouse immunoglobulin and 4-chloro-1-naphthol to detect the positive colonies and can detect on the order of 200 pg antigen per E . coli colony.

Nucleic Acids Res, 1985 Dec 9, 13(23), 8631 - 43
Point mutations in the 3' minor domain of 16S rRNA of E.coli; Jemiolo DK et al.; Point mutations were produced near the 3' end of E . coli 16S rRNA by bisulfite mutagenesis in a 121 base loop-out (1385 to 1505) in a heteroduplex of wild type (pKK3535) and deletion mutant plasmids . Two highly conserved, single stranded regions flank an irregular helix (1409-1491) in the area studied . Only a single mutation was isolated in the flanking regions, a transition at C1402, (normally methylated on the base and ribose in rRNA) . Mutations occurred throughout the irregular helix . All mutant rRNAs were processed and assembled into 30S subunits capable of interacting with 50S subunits . Growth rates ranged from faster to significantly slower than cells with the wild type transcript . In particular, mutations at C1467 or C1469 cause slow growth . These two transitions (in a bulge region within the helix) reduced the bulge by additional base pairing.

J Biomol Struct Dyn, 1985 Dec, 3(3), 495 - 514
RNA structural dynamics: pre-melting and melting transitions in E . coli 5S rRNA; Pieler T et al.; The temperature dependent transition from duplex to a single strand in E . coli 5S ribosomal RNA is a multistep process, and it involves intermediate states . We have analyzed these structural dynamics by chemical modification of cytidines and by single strand specific nuclease digestions . This combined approach led to the characterization of premelting and melting transitions within individual structural segments of the native macromolecule, which we feel may find general application to the structure of biological polyribonucleotides: 1) G-C base pairs at the termini of helices are relatively unstable and they readily undergo premelting transition . 2) Internal G-U/A-U rich stretches of helices exhibit dynamic premelting properties . 3) Hairpin loops have a relatively stronger destabilizing effect than internal loops . 4) Bulge loops destabilize the neighbouring base pairs . 5) Melting of helical segments occurs starting from the destabilizing structures listed above, preferentially from the helix termini . E . coli 5S rRNA has been shown to adopt different conformations . The presence of urea leads to induction of enhancement in the sensitivity for nuclease S1 at several nucleotide positions . The possibility of structural rearrangements will be discussed.

Mol Gen Mikrobiol Virusol, 1985 Dec, (12), 12 - 4
{Cloning of the hemagglutinin gene of influenza virus of subtype H3 in E . coli}; Rozinov MN et al.; dsDNA of the influenza virus subtype A/Leningrad/385/80/R (H3N2)-recombinant A/Leningrad/385/80 (H3N2) and RR/8/34 (H1N1) has been synthesized using polyadenylated viral RNA as a template . This dsDNA has been cloned on plasmid pUC19 . A clone has been selected harbouring the plasmid with included proximal fragment of hemagglutinin gene that contains the main antigenic determinants . The hybrid plasmid is hybridizable with RNA of the hemagglutinin gene and with oligonucleotide CATGCAAAACCTTCCC that is complementing the sequence coding for the proximal fragment of the mature hemagglutinin.

Nippon Geka Gakkai Zasshi, 1985 Dec, 86(12), 1584 - 9
{Studies of plasma gastrointestinal glucagon after LD100 E . coli infusion}; Ishida K et al.; We postulate that high plasma concentrations of gastrointestinal-derived glucagon may be used to identify severe sepsis and correlate with the effect of therapy . Eighteen adult dogs were separated into three groups: Group I-LD100 E . coli alone, group II-LD100 E . coli + tobramycin (TOB) and group III-LD100 E . coli + TOB + methylprednisolone sodium succinate (MPSS) . E . coli was infused intravenously for one hour . Each animal was monitored for six hours and observed for a 7-day recovery period . Percent survival (greater than 7 days): I = 0%, II = 17% and III = 83% . Concentrations of gastrointestinal glucagon were 3417 pg/ml in group I, 5167 pg/ml in group II and 1081 pg/ml in group III at six hours after E . coli infusion . In group III these concentration returned to control values by 7 days after E . coli infusion . Increases in gastrointestinal glucagon were more readily induced by E . coli infusion than those of pancreatic glucagon . Gastrointestinal glucagon concentrations were related to the severity of E . coli induced shock and the beneficial effects of MPSS/TOB therapy . Therefore, plasma gastrointestinal glucagon concentrations may be useful in recognizing the presence of severe sepsis and directly related to the beneficial effects of therapy.

Mutat Res, 1985 Dec, 158(3), 135 - 9
Arginine reversion and lambda induction in E . coli with benzothiadiazine diuretics irradiated with near-ultraviolet light; Fujita H; Photoinduced genotoxicity of benzothiadiazine diuretics was studied with regard to mutagenic and lambda prophage-inducing activities in E . coli . Irradiation of E . coli with near-ultraviolet light in the presence of hydrochlorothiazide or methyclothiazide caused mutations of strain Hs30R argF(Am) to the prototrophic phenotype and induction of lambda from the lysogenic bacteria AB1157(lambda) . Both drugs showed nearly the same amount of activity . Penfluzide showed much less mutagenic and much less prophage-inducing activity than did hydrochlorothiazide and methyclothiazide.

Cell, 1985 Dec, 43(2 Pt 1), 449 - 59
Intermediates in transcription initiation from the E . coli lac UV5 promoter; Straney DC et al.; We have used nondenaturing polyacrylamide gel electrophoresis to separate intermediates in transcription initiation that result from action of E . coli RNA polymerase on the lac UV5 promoter . The resolved gel complexes are characterized by DNAase I footprinting, protein subunit content, RNA content, and transcription ability . There are two "open" complexes, whose equilibrium ratio is a function of temperature; they differ in their ability to escape abortive cycling, but not in their DNAase I footprints . We find three "initiated" complexes, containing RNA chains at least 11 nucleotides long, and lacking the sigma subunit of RNA polymerase . These experiments provide a detailed view of the early initiation steps and their thermal regulation at the E . coli lac promoter.

Nucleic Acids Res, 1985 Nov 25, 13(22), 7979 - 92
Stimulation of intermolecular ligation with E . coli DNA ligase by high concentrations of monovalent cations in polyethylene glycol solutions; Hayashi K et al.; In the presence of high concentrations of the nonspecific polymer polyethylene glycol (PEG), intermolecular cohesive-end ligation with the DNA ligase from Escherichia coli was stimulated by high salt concentrations: 200 mM NaCl or 300 mM KCl in 10% (w/v) PEG 6000 solutions, and 100-200 mM NaCl or 150-300 mM KCl in 15% PEG 6000 solutions . Intermolecular blunt-end ligation with this ligase was also stimulated at 100-150 mM NaCl or 150-250 mM KCl in 15% PEG 6000 solutions . The extent of such intermolecular ligation increased and the salt concentrations at which ligation was stimulated extended to lower concentrations when we raised the temperature from 10 to 37 degrees C.

Biochem Biophys Res Commun, 1985 Nov 15, 132(3), 915 - 21
Site-directed mutagenesis of aspartate aminotransferase from E . coli; Malcolm BA et al.; The gene for aspartate aminotransferase from E . coli (aspC) was subcloned into M13 phage and sequenced using the Sanger dideoxy method with synthetic oligonucleotide primers . A mutant gene was constructed using site-directed mutagenesis techniques in which the codon for the lysine that forms the Schiffs base with pyridoxal phosphate was replaced with one coding for alanine . The mutant gene was expressed under control of the Tac promoter to overproduce a mutant protein lacking enzymatic activity.

Experientia, 1985 Nov 15, 41(11), 1488 - 90
An economical large scale procedure to purify E . coli amplifiable plasmids for DNA sequencing, in vitro transcription and in vitro mutagenesis; Wu GJ et al.; A reproducible and economical procedure for obtaining a large and quantitative yield of highly purified covalently closed circular plasmid DNA is described . The procedure departs in several ways from more commonly used methods . These are a) avoidance of the use of CsCl, ethidium bromide and ultracentrifuge, b) enrichment of the plasmid DNA by selective denaturation of chromosomal DNA with an alkaline-SDS solution, c) enrichment of covalently closed circular plasmid DNA by extraction with acid-phenol, and d) removal of small degraded RNA fragments by molecular sieve chromatography after digestion with RNase A . The plasmid DNA prepared by this new procedure is free of contaminants and has been used for DNA sequencing, in vitro transcription, transformation and in vitro mutagenesis.

Nucleic Acids Res, 1985 Nov 11, 13(21), 7647 - 61
Promoter selectivity of E . coli RNA polymerase: analysis of the promoter system of convergently-transcribed dnaQ-rnh genes; Nomura T et al.; Promoter properties were analyzed for the convergently-overlapped E . coli genes coding for the DNA polymerase III epsilon subunit (dnaQ) and the ribonuclease H (rnh) . The rates of open complex formation for a single promoter of the rnh gene and two tandem promoters of the dnaQ gene were constant whether they are located on a single DNA fragment or separated into individual fragments . The relative expression levels of these three promoters, as measured using an in vitro mixed transcription system, varied differentially depending on the concentration of RNA polymerase . At low enzyme concentrations, the downstream promoter (P2) of the dnaQ gene was utilized preferentially, but the upstream promoter (P1) was utilized as well when the enzyme concentration was increased . This indicates different physiological roles between the two dnaQ promoters . The level of rnh transcription was as low as that of dnaQ-1 RNA synthesis but the rnh promoter was utilized as well as the dnaQ P2 promoter when it was separated from the dnaQ promoters . This implies a promoter interference between the convergently transcribed genes.

Mutat Res, 1985 Nov-Dec, 152(2-3), 157 - 9
recA-independent mutagenicity induced by chloroethylene oxide in E . coli; Barbin A et al.; The mechanism of mutagenicity of chloroethylene oxide (CEO), an ultimate carcinogenic metabolite of vinyl chloride, was investigated in 3 Escherichia coli strains (E . coli "multitest") . In this system, the mutagenicity of CEO was found to be mainly SOS-independent . CEO did not induce recombinational events at a detection level of about 10(-2) recombinants/survivor . Our results indicate that CEO- (or vinyl chloride-) induced bacterial mutagenesis arises mainly from miscoding DNA adducts.

Mutat Res, 1985 Nov-Dec, 152(2-3), 147 - 56
Induction of specific base-pair substitutions in E . coli trpA mutants by chloroethylene oxide, a carcinogenic vinyl chloride metabolite; Barbin A et al.; Chloroethylene oxide (CEO), an ultimate carcinogenic metabolite of vinyl chloride, induces base-pair substitution mutations but not frameshift mutations in bacteria . The mutational specificity of CEO was investigated in Escherichia coli, using the trpA mutants developed by Yanofsky . Reversion frequencies to tryptophan prototrophy were analysed, and CEO was found to induce more GC----AT transitions than AT----TA transversions, in addition to a low frequency of other types of substitution . This specificity indicates that CEO is mutagenic through a miscoding DNA adduct . The results are discussed in relation to the various CEO-DNA adducts formed and to their reported or expected mispairing properties.

EMBO J, 1985 Nov, 4(11), 3025 - 30
E . coli recA protein possesses a strand separating activity on short duplex DNAs; Bianchi M et al.; RecA protein was found to catalyze the dissociation of the strands of a DNA substrate consisting of a 20-nucleotide primer annealed to circular single-stranded M13mp DNA . The strand separation reaction requires ATP hydrolysis and the presence of single-stranded DNA flanking the duplex DNA region to be unwound . RecA-catalyzed strand separation is effective only for very short duplexes, not exceeding 30 bp, and is not stimulated by single-stranded DNA-binding protein . These results are consistent with the ability of recA protein to disrupt regions of secondary structure in single-stranded DNA and to incorporate large non-homologies into heteroduplex DNA.

J Exp Med, 1985 Nov 1, 162(5), 1720 - 5
Influenza virus subtype-specific cytotoxic T lymphocytes lyse target cells coated with a protein produced in E . coli; Yamada A et al.; We have tested the ability of the c13 protein, which is a hybrid protein of the first 81 amino acids of the viral nonstructural protein (NS1) and the HA2 subunit of viral hemagglutination produced in E . coli, to render target cells susceptible to the lytic activity of influenza virus-specific cytotoxic T lymphocytes (CTL) . The results showed that P815 cells coated with c13 protein were lysed by PR8 virus-induced secondary CTL derived from BALB/c mice . Cold-target inhibition tests clearly demonstrated that c13 protein-coated P815 cells were recognized by an H1 subtype-specific CTL population . Furthermore, PR8 virus-induced CTL derived from C3H mice did not lyse c13 protein-coated P815 cells, suggesting that c13 protein was recognized by CTL in conjunction with H-2d products . These findings suggest that this protein interacts with the cellular plasma membrane and makes target cells recognizable by H-2-restricted, influenza virus subtype-specific CTL.

J Immunol, 1985 Nov, 135(5), 3398 - 402
Expression of polypeptide segments of the human complement component C3 in E . coli: genetic and immunological characterization of cDNA clones specific for the alpha-chain of C3; Ma D et al.; The third component of complement C3 and its fragments have a central role in a variety of host defense mechanisms . The identification of functionally relevant C3 domains is important because of the marked functional versatility of the C3 molecule . Several human C3 cDNA clones from a human liver cDNA library were isolated and characterized . A bacterial expression vector system was used to express cDNA clones that were identified by an immunological screening procedure . The C3 cDNA clones produced in E . coli the hybrid proteins consisting of cro-beta-galactosidase and polypeptide segments of human C3, as revealed by Western blotting with antisera to human C3 . The C3 moiety of the hybrid proteins had a m.w . of up to 46.000 . Polyclonal antibodies against the C3 segments expressed by one of the C3 cDNA clones (ReC3-1) have been raised in mice and rabbit, and in addition, a monoclonal antibody was produced . The antisera and the monoclonal antibody reacted in Western blotting analysis selectively with the alpha-chain, but not the beta-chain of human C3 . Restriction mapping of the different cDNA clones was performed, and revealed that the different clones were partially overlapping . The ReC3-1 cDNA clone included a 0.7 kb noncoding region at the 3' terminal end of the C3 cDNA . One of the restriction sites (Hind III) identified in the ReC3-1 cDNA clone was not present in the recently published sequence of human C3 cDNA . This difference in nucleotide sequence provides direct evidence for C3 polymorphism at the DNA level . The combination of immunologic procedures with recombinant DNA methodology should facilitate additional analysis of the structure-function relationship of the C3 molecule.

Eur J Cell Biol, 1985 Nov, 39(1), 56 - 61
Identification of the collar-like structure of the 30S ribosomal subunit from E . coli by dark field electron microscopy; Korn AP et al.; We have used dark field electron microscopy to study a fragment of the small (30S) subunit of the E . coli ribosome . This fragment is almost the same size as the parent particle but RNA sequencing studies have shown it to lack, as a major constituent, a 150-nucleotide stretch at the 3' end of the rRNA, and two minor sections constituting 20 nucleotides from the 5' end and the 15 nucleotides of the sequence 687-701 . The protein composition of the fragment was essentially unchanged . Samples of this material, and controls, were examined in the electron microscope after treatment with a buffered uranyl acetate solution for positive staining . Careful comparison revealed the following differences . The structural feature that we call the "collar" was missing in the fragment . Of the three parallel uranyl-staining bands that we have observed in micrographs of whole 30S subunits, the fragment consistently lacked the uppermost band . These observations identify the top uranyl-adsorbing band as being the 3' end of the ribosomal RNA and show that it can be equated with the collar-like structure.

J Pharm Pharmacol, 1985 Nov, 37(11), 781 - 6
Detection of host-derived contaminants in products of recombinant DNA technology in E . coli: a comparison of silver-staining and immunoblotting; Gooding RP et al.; Contamination of medicines produced in E . coli by recombinant DNA methodology with host-cell proteins is considered a potential problem with this type of method . In this report techniques for the detection of trace quantities of host-cell proteins in SDS-gel electrophoretograms were examined . Detection of E . coli proteins by immunoblotting, using antisera raised in rabbits to lysates of E . coli, was compared with detection using the ultrasensitive silver stain . Silver staining detected a larger number of E . coli proteins in a one-dimensional electrophoresis system than did immunoblotting . Proteins that were markedly antigenic in the rabbit were detected at a greater sensitivity by the immunoblotting approach . Both techniques detected contaminant proteins in a preparation of methionyl human growth hormone produced in E . coli known to be contaminated with host-cell proteins . No contaminating proteins were seen by either technique in more rigorously purified preparations of growth hormone . A combination of these two approaches would provide useful evidence of purity of medicines produced by recombinant DNA technology, and is potentially applicable to a wide range of host-vector systems.

J Oral Pathol, 1985 Nov, 14(10), 833 - 43
Modulation of HLA-DR antigens in the gingival epithelium in vitro by heat-killed Fusobacterium nucleatum and E . coli lipopolysaccharide; Walsh LJ et al.; The in vitro influence of the periodontopathic organism Fusobacterium nucleatum (FN) on gingival tissue was examined using an organ culture system . Treatment of gingival explants obtained from periodontally diseased sites with suspensions of FN, stimulated the expression of HLA-DR antigens by Langerhans cells (LC) in a dose-dependent fashion, and produced a maintenance of the LC markers T6 and ATPase . Similar effects were seen when E . coli lipopolysaccharide (LPS) was substituted for suspensions of FN . With both FN and LPS the expression of HLA-DR by gingival keratinocytes was maintained throughout the 72-h culture period, despite the cytotoxic effects of these agents . Using a variety of immunohistological techniques and a monoclonal antibody specific for the strain of FN used, it was possible to demonstrate the uptake of FN antigens by LC within the gingival epithelium.

Nucleic Acids Res, 1985 Oct 25, 13(20), 7483 - 98
The catabolite activator protein stabilizes its binding site in the E . coli lactose promoter; DeGrazia H et al.; The effect of catabolite activator protein, CAP, on the thermal stability of DNA was examined . Site specific binding was studied with a 62 bp DNA restriction fragment containing the primary CAP site of the E . coli lactose (lac) promoter . A 144 bp DNA containing the lac promoter region and a 234 bp DNA from the pBR322 plasmid provided other DNA sites . Thermal denaturation of protein-DNA complexes was carried out in a low ionic strength solvent with 40% dimethyl sulfoxide, DMSO . In this solvent free DNA denatured below the denaturation temperature of CAP . The temperature stability of CAP for site specific binding was monitored using an acrylamide gel electrophoresis assay . Results show that both specific and non-specific CAP binding stabilize duplex DNA . Site specific binding to the 62 bp DNA produced a 13.3 degrees C increase in the transition under conditions where non-specific binding stabilized this DNA by 2-3 degrees C.

FEBS Lett, 1985 Oct 7, 190(1), 125 - 8
Modification of the amino acid acceptor stem of E . coli tRNAMetf by ligation of chemically synthesized ribooligonucleotides; Doi T et al.; The single-stranded region of the amino acid acceptor stem corresponding to the 3'-end of E . coli tRNAMetf was replaced by ligation of chemically synthesized ribooligonucleotides, in order to change the length of the single-stranded CCA terminus . The chemically synthesized ribooligomers, CCA, ACCA, AACCA and CAACCA, were ligated to nuclease-treated E . coli tRNAMetf, which lacked the ACCA sequence at the 3'-end . The methionine acceptor activities of these modified tRNAs were examined using E . coli methionyl-tRNA synthetase . Ligation of the chemically synthesized pentamer (AACCA) to the acceptor terminus restored the methionine acceptor activity, whereas ligation of the hexamer (CAACCA) or trimer (CCA) to the acceptor terminus did not Modification of the acceptor terminus had no effect on the formylation of accepted methionine.

Mol Gen Mikrobiol Virusol, 1985 Oct, (10), 25 - 8
{The role of outer membrane proteins of E . coli K12 in the cell wall permeability for plasmid DNA}; Kim AA et al.; The Escherichia coli K12 mutant having the increased efficiency for plasmid DNA transformation has been shown to possess the different protein composition of the outer membrane of the cellular wall, as compared with that of the wild type strain . Correlation between the level of calcium-dependent plasmid transformation and the portion of infections DNA bound with cytoplasmic membranes is demonstrated for the Escherichia coli cells mutant for outer membrane structure and ability to be transformed by plasmid DNA.

J Hyg (Lond), 1985 Oct, 95(2), 363 - 74
Acquisition of genes from an O18:K1:H7 ColV+ strain of Escherichia coli renders intracranially-inoculated E . coli K12 highly virulent for chickens, ducks and guinea-pigs but not mice; Smith HW et al.; The virulence of intracranially-inoculated mutant forms of an O18ac:K1:H7 ColV+ strain of Escherichia coli (designated MW) that lacked different combinations of its O and K antigens and ColV, and of an E . coli K12 strain to which these characters had been transmitted was studied in mice, chickens, ducks and guinea-pigs . The O18+K1+ColV+ form of MW was highly virulent for chickens and mice but the corresponding form of K12 was only highly virulent for chickens; the O18-K1-ColV- forms of both strains were of low virulence for chickens and mice . K1 was more important than O18 or ColV in determining virulence for both animal species . Ducks and guinea-pigs resembled chickens, not mice, in their response to infection with the O18+K1+ColV+form of K12 . Pathogenesis studies revealed that the virulence of the forms of MW and K12 was associated with their ability to proliferate in the central nervous system; only low numbers of organisms were found in the blood and spleen of inoculated animals . The O18+K1+ColV+ form of K12 multiplied in mouse brain and in mouse blood in vitro; its multiplication in chicken blood was partially inhibited . Agglutinins to this and other forms of K12 were found in chicken serum but not in mouse serum . Large doses of mouse serum given to chickens and large doses of chicken serum given to mice did not alter the manner in which these animals responded to K12 O18+K1+ColV+ infection . Vaccination protected chickens and mice against lethal intracranial infection with the O18+K1+ColV+ forms of K12 or MW; it produced a much stronger immunity in mice against intraperitoneal challenge than against intracranial challenge.

EMBO J, 1985 Oct, 4(10), 2575 - 81
Recombinant murine GM-CSF from E . coli has biological activity and is neutralized by a specific antiserum; DeLamarter JF et al.; We report the production and characterization of a mouse granulocyte-macrophage colony stimulating factor (mGM-CSF) made in Escherichia coli . The synthesis of mGM-CSF was directed by a plasmid containing a gene isolated from the EL-4 cell line . After induction of expression and accumulation of the protein in E . coli, mGM-CSF accounted for 10% of total cellular protein . This recombinant mGM-CSF was purified to 90% homogeneity by chaotrope extraction and gel filtration . Recombinant mGM-CSF, like the native molecule, stimulates the growth of granulocyte and macrophage colonies in serum-free cultures of mouse bone marrow cells . Antibodies raised against recombinant mGM-CSF not only reacted with the recombinant protein but also neutralized the biological activity of both native and recombinant mGM-CSF . These results indicate that the functional structure of the recombinant protein is similar to that of native mGM-CSF.

Int J Radiat Biol Relat Stud Phys Chem Med, 1985 Oct, 48(4), 495 - 504
Changes in the survival curve shape of E . coli cells following irradiation in the presence of uncouplers of oxidative phosphorylation; Anderson RF et al.; Four uncouplers of oxidative phosphorylation (UOP) (carbonyl cyanide m-chlorophenylhydrazone, 2,4-dinitrophenol, 4-hydroxybenzylidenemalonitrile and N-phenylanthranilic acid) have been found to alter the shape of the radiation survival curves of several cell lines of E . coli when present during irradiation in oxia . Incubation of cells with high concentrations of UOP for 30 min before irradiation induced an increase in extrapolation number (n) in cell lines AB 1157 (wild-type), AB 1886(uvrA-) and KMBL(polA-) but not GR 501(lig-)ts, AB 2463(recA-) and AB 2480(uvrA-recA-) . In addition the UOP all effect a decrease in mean lethal dose (D0) even when tested at low concentrations or short contact times . Studies with wild-type cells correlate the increase in n with measured increased levels of ATP (above oxic control cells) produced upon incubation with UOP . The increased levels of ATP most likely arise from the UOP overstimulating glycolysis . The decrease in D0 cannot be associated with any of the repair pathways investigated and it is concluded that the highly lipophilic UOP directly or indirectly potentiate other target(s) to radiation damage as well as DNA under oxic conditions . Treatment of the cells with UOP did not result in the deleterious depletion of energy substrates, loss of non-protein thiols or the production of cytotoxins upon irradiation.

Int J Radiat Biol Relat Stud Phys Chem Med, 1985 Oct, 48(4), 485 - 94
The influence of thiols on the pre-irradiation incubation effect of nitroimidazoles in E . coli cells; Anderson RF et al.; The increase in the degree of radiosensitization of Escherichia coli cells following prolonged pre-irradiation incubation with nitroimidazoles is not correlated with the loss of intracellular non-protein thiols (NPSH) alone . The rates of reduction of the nitro compounds and the NPSH removal do not show strong dependencies on the lipophilicities of the nitroimidazoles whereas the highly lipophilic compound RGW-609 effects an increase in radiosensitization in a much shorter incubation time than the other nitroimidazoles . Exogenous dithiothreitol (DTT) increased the rate of reduction of misonidazole in the cells but did not alter the fraction converted to the amine . Added DTT (0.15 mmol dm-3) completely protected against the pre-irradiation incubation effect of misonidazole (2.5 mmol dm-3) when added at the start of the incubation but only partially protected when added before irradiation . It is suggested that NPSH can intercept metabolite(s) (or their precursors) of nitroimidazoles which can potentiate cell killing by radiation.

What Is Molecular Microbiology?, What is Food Microbiology?, What Is Staphylococcus Aureus?, What Is Water Purification?, What Is Biofilm?, e, Microbiology, e, Microbe, e, Bacteriology, a, Microbes, r, Bacterium, c, Antimicrobials, e, Yeasts, s, Vibriosis, i, S. cerevisiae, c, Campylobacter, r, Streptococci, r, Streptococcal, i, Staphylococcus, o, Streptococci, r, Petri dish, c, Escherichia coli, o, Escherichia coli, c, Microbial, s, Bacillus, s, Culture medium, s, Klebsiella, o, Streptococci, e, Staphylococcus, n, S. cerevisiae, i, Microbiological, a, Bacillus

Scientific Publications - Work Done by Microbiology Reader Bioscreen C
Agricultural Microbiology Anaerobic Microbiology Antimicrobial Susceptibility Artificial Atmosphere Bioassay of Antibiotics Biofilm Microbiology Bioreactor Technology Biotechnology Cell Biology Clinical Microbiology Environmental Microbiology Experiments with Yeast	Fermentation Food Microbiology Functional Genomics Gene Technology Growth Media Development Growth Rate and Lag Time Industrial Microbiology Medical/Pharmaceutical Field Microbiological Assay Microbiological Research Microbiology of Cosmetics go to a specific theme...	Military Microbiology Molecular Microbiology Mutagenicity and Genotoxicity Oral Microbiology Patents Postantibiotic Studies Soil Microbiology Spore Microbiology Veterinary Microbiology Waste/Wastewater Treatment Water Microbiology Wine Microbiology

� 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com

Last modified: May 25, 2005