|








| |
Applied and Environmental Microbiology, November 2003, p . 6495-6499, Vol . 69, No . 11
Modification of the Monomer Composition of Polyhydroxyalkanoate Synthesized in Saccharomyces cerevisiae Expressing Variants of the ß-Oxidation-Associated Multifunctional Enzyme
Silvia Marchesini,1 Nadine Erard,1 Tuomo Glumoff,2 J . Kalervo Hiltunen,2 and Yves Poirier1*
Laboratoire de Biotechnologie Végétale, Département de Biologie Moléculaire Végétale, Université de Lausanne, CH-1015 Lausanne, Switzerland,1
Biocenter Oulu and Department of Biochemistry, University of Oulu, FIN-90570 Oulu, Finland2
Received 28 April 2003/
Accepted 1 August 2003
Expression by Saccharomyces cerevisiae of a polyhydroxyalkanoate (PHA) synthase modified at the carboxy end by the addition of a peroxisome targeting signal derived from the last 34 amino acids of the Brassica napus isocitrate lyase (ICL) and containing the terminal tripeptide Ser-Arg-Met resulted in the synthesis of PHA . The ability of the terminal peptide Ser-Arg-Met and of the 34-amino-acid peptide from the B . napus ICL to target foreign proteins to the peroxisome of S . cerevisiae was demonstrated with green fluorescent protein fusions . PHA synthesis was found to be dependent on the presence of both the enzymes generating the ß-oxidation intermediate 3-hydroxyacyl-coenzyme A (3-hydroxyacyl-[CoA]) and the peroxin-encoding PEX5 gene, demonstrating the requirement for a functional peroxisome and a ß-oxidation cycle for PHA synthesis . Using a variant of the S . cerevisiae ß-oxidation multifunctional enzyme with a mutation inactivating the B domain of the R-3-hydroxyacyl-CoA dehydrogenase, it was possible to modify the PHA monomer composition through an increase in the proportion of the short-chain monomers of five and six carbons .
Polyhydroxyalkanoates (PHAs) represent a family of polyesters having thermoplastic and elastomeric properties that are naturally synthesized as intracellular inclusions by a wide variety of bacteria (1, 19, 22, 23) . Over 100 different hydroxy acid monomers have been shown to be included in PHAs, with the most common being R-3-hydroxyalkanoic acids (24) . PHAs can be defined into two main classes based on their monomer compositions . Short-chain-length PHAs are composed mainly of hydroxy acids ranging from 3 to 5 carbons and have properties of plastics, while medium-chain-length PHAs (MCL-PHAs) contain hydroxy acid monomers ranging from 6 to 16 carbons and have properties of elastomers (3, 4) .
The main limitation for commercial exploitation of bacterial PHA is the high production cost relative to that for petroleum-derived commodity plastics such as polyethylene . It is in this perspective that synthesis of PHAs in genetically engineered plants has been seen as a promising approach for the production of biodegradable polymers on a large scale and at a low cost (16, 19) . Synthesis of MCL-PHA in plants has been demonstrated in Arabidopsis thaliana, which expresses PHA synthase from Pseudomonas aeruginosa modified by the addition of a peroxisome targeting signal 1 (PTS1) at the carboxy end of the protein (14) . In this system, the 3-hydroxyacyl-coenzyme A (3-hydroxyacyl-[CoA]) intermediates generated by the degradation of fatty acids through the ß-oxidation cycle within the peroxisomes are used to synthesize MCL-PHA . Synthesis of MCL-PHA in Saccharomyces cerevisiae and Pichia pastoris has recently been demonstrated through the expression of the same PTS1-modified P . aeruginosa PHA synthase (17, 18) . The S . cerevisiae model is regarded as a powerful system from which to learn how metabolic pathways can be modified to synthesize PHA in eukaryotes, including plants .
Over the past decade, progress has been made on optimizing the yield and monomer composition of PHA produced in various natural or genetically engineered microorganisms (11) . Monomer composition is a key factor influencing the physical properties of the polymer (3, 25) . In bacteria, control over PHA monomer composition can be largely obtained through manipulation of the growth medium . For example, Pseudomonas oleovorans grown on dodecanoic acid gives a PHA composed of 3-hydroxydodecanoic acid, 3-hydroxydecanoic acid, 3-hydroxyoctanoic acid, and 3-hydroxyhexanoic acid, while the same bacteria grown on octanoic acid yields a PHA containing only 3-hydroxyoctanoic and 3-hydroxyhexanoic acid (10) . In contrast to that for bacterial fermentation, control over the monomer composition of PHA produced in crop plants must be obtained through the control of metabolic pathways that supply in situ the appropriate 3-hydroxyacyl-CoAs to the PHA synthase . For example, increases in the proportion of saturated 3-hydroxyacid monomers of 6 to 10 carbons to that of longer unsaturated monomers have been achieved through the expression of a caproyl-acyl carrier protein thioesterase in the plastid of A . thaliana along with the P . aeruginosa PHA synthase in the peroxisomes (13, 20) .
In the present work, we were interested in modifying the monomer composition of MCL-PHA produced in S . cerevisiae peroxisomes through the manipulation of the enzymes of the core ß-oxidation cycle . This result was sought by using variants of peroxisomal multifunctional enzyme 2 (MFE-2) having different R-3-hydroxyacyl-CoA dehydrogenase activities .
Strains and culture conditions.
The S . cerevisiae mutants fox1 0 (YGL205W::kanMX4), fox2 0 (YKR009C::kanMX4), fox3 0 (YIL160C::kanMX4), and pex5 0 (YDR244W::kanMX4) in the BY4742 background (MAT his3 1 leu2 0 lys2 0 ura3 0) were obtained from EUROSCARF (http://www.uni-frankfurt.de/fb15/mikro/euroscarf/index.html) . S . cerevisiae harboring various plasmids were maintained in either leucine-deficient, uracil-deficient, or leucine- and uracil-deficient selective medium (0.67% yeast nitrogen base without amino acids [Difco, Detroit, Mich.], 0.5% ammonium sulfate, 2% glucose, and 0.67 g of the appropriate amino acid dropout supplements [Clontech, Palo Alto, Calif.] per liter) . For PHA production, a stationary-phase culture of cells grown in selective medium with 2% glucose was harvested by centrifugation and the cells were washed once in water and suspended at a dilution of 1:10 or 1:30 (vol/vol) in fresh selective medium containing 2% Pluronic-127 and 0.1% (vol/vol) fatty acids supplemented with either 0.1% glucose or 3% raffinose . The cells were grown for an additional 3 to 4 days before they were harvested for PHA analysis .
DNA constructs.
The structure of the PHAC1 gene from P . aeruginosa modified at the 3' end for peroxisomal targeting by the addition of the last 34 amino acids of the Brassica napus isocitrate lyase (ICL) has been previously described (14) .
The plasmid yEGFP-SRM was constructed by linearizing the plasmid pUG36 (http://mips.gsf.de/proj/yeast/info/tools/hegemann/gfp.html), which contains a yeast-enhanced green fluorescent protein (yEGFP) (2), by BamHI and EcoRI and ligating a short linker composed from the annealed oligonucleotides GATCCAGAATGTAAGAGCTCG and AATTCGAGCTCTTACATTCTG, resulting in the creation of a yEGFP with the terminal tripeptide Ser-Arg-Met . The plasmid yEGFP-ICL was constructed in a similar manner, by ligating a PCR fragment containing the 3' end of the coding region of the B . napus ICL gene into the plasmid pUG36 linearized by BamHI and EcoRI, resulting in the creation of the yEGFP fusion protein containing the last 34 amino acids of the ICL at the carboxy end .
To construct the plasmid CTA-PHA, the cassette containing the S . cerevisiae catalase A (CTA1) promoter, the PHAC1 synthase, and the CTA1 terminator was excised from YIplac128-PHA and cloned into the replicative shuttle plasmid YIplac111 (6) . The plasmid GPD-PHA, containing the PHAC1 gene under the control of the glycerol-3-phosphate dehydrogenase promoter, was constructed by first excising the PHA synthase and the CTA1 terminator from the CTA-PHA plasmid with EcoRI and blunt-ending with Klenow DNA polymerase . The fragment was then subcloned into the vector p415-GPD (15) at the SmaI site . The plasmid pYE352::ScMFE-2, containing the intact multifunctional enzyme gene from S . cerevisiae, and the plasmids pYE352::ScMFE-2(a ) and pYE352::ScMFE-2(b ), containing the mutated variants of the MFE-2 protein, have been previously described (21) . All MFE-2 gene constructs were expressed in the vector pYE352, placing the genes under the control of the CTA1 promoter and terminator (21) .
Plasmids were transferred into the various S . cerevisiae strains by the lithium acetate procedure (5), and transformants were recovered on the appropriate selective medium .
Analysis of PHA.
PHA was analyzed as previously described (18) . Briefly, cells were harvested by centrifugation, washed with water, and lyophilized in a glass tube . The dried material was washed with warm methanol (65°C) in order to remove free fatty acids, lipids, and acyl-CoAs, and the remaining PHA was transesterified at 94°C for 4 h with 1 ml of methanol-chloroform mixture (1:1) containing 3% sulfuric acid . One milliliter of 0.9% NaCl was added to the cooled mixture, which was vortexed vigorously and centrifuged at 5,000 x g for 5 min . The chloroform phase containing the methyl esters of 3-hydroxyacids was then analyzed and quantified by gas chromatography-mass spectrometry by using a Hewlett-Packard 5890 gas chromatograph (HP-5MS column) coupled to a Hewlett-Packard 5972 mass spectrophotometer, as previously described (13, 14) . The quantity and composition of PHA produced in the various strains were analyzed using a one-factor analysis of variance with a level of significance of 0.05 and a Duncan's multiple range test .
Fluorescence microscopy.
The intact yEGFP protein and the fusion proteins yEGFP-SRM and yEGFP-ICL were expressed in wild-type BY4742 cells and the pex5 0 mutant . Cells grown in selective medium containing 0.1% glucose and 0.1% oleic acid for 24 h were observed under epifluorescence microscopy .
Preparation of organellar pellet and immunoblot analysis.
The intracellular content of yeast cells grown for 24 h in medium containing 0.1% glucose and 0.1% oleic acid was separated into an organellar pellet containing peroxisomes and a postorganellar supernatant containing mainly proteins from the cytoplasm and broken organelles, as previously described (9) . Proteins present in the organellar pellet and postorganellar fraction were separated by sodium dodecyl sulfate-12% polyacrylamide (wt/vol) gel electrophoresis, blotted onto nitrocellulose membranes, and analyzed by Western blotting using rabbit antibodies against the P . aeruginosa PHA synthase or the S . cerevisiae 3-ketothiolase .
The Ser-Arg-Met terminal tripeptide targets proteins to the peroxisomes.
Although the terminal tripeptide Ser-Arg-Met has been shown to target foreign proteins to the peroxisome in plants and mammals (7, 8, 14, 26), its effectiveness as a PTS1 in S . cerevisiae has, to our knowledge, not yet been demonstrated . The localization of a fusion protein containing yEGFP modified at the carboxy end by the addition of only the terminal tripeptide Ser-Arg-Met (yEGFP-SRM construct) or the complete 34-amino-acid terminal peptide from the plant ICL (yEGFP-ICL construct) was examined in both wild-type cells and the mutant pex5 0 deficient in the peroxisomal import of proteins with PTS1 . Figure 1A and C show that expression of the fusion proteins yEGFP-SRM and yEGFP-ICL by wild-type cells leads to a punctate pattern of fluorescence expected for a peroxisomal matrix protein . In contrast, expression of the same constructs by the pex5 0 mutant leads to diffuse fluorescence in the cytoplasm (Fig . 1B and D) . The dependence of the punctate pattern of fluorescence on PEX5 is in accordance with the localization of the modified green fluorescent protein in peroxisomes, thus demonstrating that the terminal tripeptide Ser-Arg-Met, as well as the complete 34-amino-acid terminal peptide from the plant ICL, can target foreign proteins to the peroxisomes of S . cerevisiae .
|
FIG . 1 . The terminal tripeptide Ser-Arg-Met acts as a peroxisomal targeting signal in S . cerevisiae . Wild-type BY4742 (A and C) and pex5 0 mutant (B and D) cells transformed with the yEGFP-SRM construct (A and B) or the yEGFP-ICL construct (C and D) were grown for 24 h in medium containing oleic acid and examined by epifluorescence microscopy.
|
|
The intracellular location of the modified PHA synthase was analyzed through fractionation of lysates of cells grown in oleic acid medium into an organellar fraction containing peroxisomes and a postorganellar fraction containing proteins from the cytoplasm and broken organelles . Analysis of the fractions by immunoblot revealed that the peroxisomal 3-ketothiolase is predominantly found in the organellar pellet (Fig . 2A) . Analysis of the same fractions with an anti-PHA synthase antibody revealed that approximately half of the protein is in the organellar pellet and the other half is in the postorganellar fraction (Fig . 2B) . These results indicate that although PTS1-modified PHA synthase is targeted to the peroxisomes of S . cerevisiae, the targeting appears to be less efficient than with native yeast peroxisomal proteins .
|
FIG . 2 . Localization of the PTS1-modified PHA synthase in yeast . Wild-type BY4742 cells transformed with the GPD-PHA construct (lanes 1 and 2) or the p415-GPD control vector (lanes 3 and 4) were grown for 24 h in medium containing oleic acid, followed by separation of cellular lysates into an organellar fraction (lanes 1 and 3) and a postorganellar fraction (lanes 2 and 4) . Two micrograms of proteins was loaded for each lane, and Western blot analysis was performed with antibodies against S . cerevisiae 3-ketothiolase (A) and P . aeruginosa PHA synthase (B) . Molecular mass markers (in kilodaltons) are in the left margins.
|
|
Synthesis of PHA in yeast peroxisomes is dependent on the presence of a functional ß-oxidation pathway.
In order to further substantiate the implication of the peroxisomal ß-oxidation cycle in PHA synthesis by S . cerevisiae, the production of PHA was examined in mutants deficient in peroxisomal ß-oxidation . The fox1 0, fox2 0, and fox3 0 mutants are deficient in the enzymes acyl-CoA oxidase, multifunctional enzyme, and 3-ketothiolase, respectively . These enzymes form the ß-oxidation cycle and are essential for the degradation of fatty acids . As described above, the pex5 0 mutant is deficient in the import of peroxisomal proteins containing PTS1 sequences, including FOX1 and FOX2, and has abnormal peroxisomes with a nonfunctional ß-oxidation cycle . The PTS1-modified PHA synthase gene was expressed in wild-type cells and in the mutants fox1 0, fox2 0, fox3 0, and pex5 0 under the control of either the fatty acid-inducible catalase A promoter (CTA-PHA construct) or the constitutive glycerol-3-phosphate dehydrogenase promoter (GPD-PHA construct) . While wild-type cells grown in medium containing lauric acid produced PHA containing even-chain monomers of between 6 and 12 carbons, no PHA could be detected in the fox1 0, fox2 0, and pex5 0 mutants . Expression of the PTS1-modified PHA synthase by the fox3 0 mutant supplied with lauric acid gave rise to a PHA containing only the monomer 3-hydroxydodecanoic (data not shown) . This finding was expected, since the fox3 0 mutant has a truncated ß-oxidation cycle that allows the synthesis of 3-hydroxydodecanoyl-CoA only from lauric acid . Because mutants blocked in ß-oxidation cannot use fatty acid as an energy and carbon source, synthesis of PHA by the fox1 0, fox2 0, and pex5 0 mutants was examined in cells grown in medium containing raffinose as a carbon source and tridecanoic acid as a source of monomers for PHA synthesis . Raffinose was chosen because in contrast to glucose it does not repress the expression of the ß-oxidation genes in cells grown in the presence of fatty acids (12) . No PHA could be detected in fox1 0, fox2 0, and pex5 0 mutants grown on raffinose and tridecanoic acid, while wild-type cells produced PHA containing odd-chain monomers from 5 to 13 carbons (data not shown) . Together, these results demonstrated that synthesis of PHA in yeast cells expressing the PTS1-modified PHA synthase is dependent on a functional peroxisome and the ß-oxidation cycle .
Modification of the PHA monomer composition with the expression of variants of MFE-2.
Mutations in the 3-hydroxyacyl-CoA dehydrogenase A and B domains of S . cerevisiae MFE-2 encoded by the FOX2 gene have been previously described by Qin et al . (21) . Briefly, the MFE-2(a ) mutant contains a point mutation inactivating the A domain of the dehydrogenase, while the MFE-2(b ) mutant has a point mutation inactivating the B domain of the dehydrogenase . While MFE-2(a ) retains a broad activity towards short (C4)-, medium (C10)-, and long (C16)-chain R-3-hydroxyacyl-CoAs, MFE-2(b ) shows highest activity with medium- and long-chain R-3-hydroxyacyl-CoAs and does not accept short-chain R-3-hydroxyacyl-CoAs (21) . The fox2 0 mutant expressing the PHA synthase from the plasmid CTA-PHA was retransformed with the plasmid pYE352::ScMFE-2 for expression of the wild-type MFE and the plasmids pYE352::ScMFE-2(a ) and pYE352::ScMFE-2(b ) for expression of the variants MFE-2(a ) and MFE-2(b ), respectively .
Expression of the wild-type MFE-2 by the fox2 0 mutant (fox2 0 + ScMFE-2) allowed accumulation of MCL-PHA . PHA synthesized from oleic acid contained the even-chain monomers H14:1, H14:0, H12:0, H10:0, H8:0, and H6:0 (PHA monomers are identified with the prefix H, followed by the number of carbon atoms and the number of unsaturated bonds) (Fig . 3A) . In contrast, PHA synthesized from heptadecenoic acid (heptadec-cis-10-enoic acid) contained the odd-chain monomers H13:1, H11:0, H9:0, H7:0, and H5:0 (Fig . 4A) .
|
FIG . 4 . Synthesis of PHA by fox2 0 cells expressing wild-type or mutated S . cerevisiae MFE-2 and grown in medium containing heptadecenoic acid (heptadec-cis-10-enoic acid) . See the legend for Fig . 3 for further details.
|
|
Expression of MFE-2(a ) in fox2 0 cells [fox2 0 + ScMFE-2(a )] resulted in the synthesis of PHA with a monomer composition similar to that of fox2 0 cells expressing wild-type MFE-2, both for cells grown in oleic acid and for those grown in heptadecenoic acid (Fig . 3B and 4B) . In contrast, expression of MFE-2(b ) in fox2 0 cells [fox2 0 + ScMFE-2(b )] resulted in a substantial increase in the proportion of the short-chain 3-hydroxyacid monomers at the expense of the longer monomers (Fig . 3C and 4C) . Thus, while the H6:0 monomer represented 29 mol% in fox2 0 + ScMFE-2 and 26 mol% in fox2 0 + ScMFE-2(a ) supplied with oleic acid, the proportion of this monomer increased to 53 mol% in fox2 0 + ScMFE-2(b ) (Fig . 3) . This increase in H6:0 was counterbalanced by a twofold reduction in the proportion of the longer-chain monomers H12:0, H14:0, and H14:1 (Fig . 3) . Similarly, for cells grown on heptadecenoic acid, the H5 monomer represented approximately 6.6 and 9.4 mol% in fox2 0 + ScMFE-2 and fox2 0 + ScMFE-2(a ), respectively, while the proportion of this monomer increased to 21 mol% in fox2 0 + ScMFE-2(b ) (Fig . 4) . In this case, the increase in H5:0 was largely compensated by a decrease in the H11:0 and H13:1 monomers . Although the amount of PHA produced in cells supplied with heptadecenoic acid was consistently higher than that for cells grown with oleic acid, there were only small changes among the various strains in the amount of PHA synthesized with one fatty acid, with a small but statistically significant difference observed between fox2 0 + ScMFE-2(a ) and either fox2 0 + ScMFE-2 or fox2 0 + ScMFE-2(b ) in cells grown on heptadecenoic acid .
The shift in monomer composition observed with fox2 0 + ScMFE-2(b ) can be explained by the differences in affinity of MFE-2 mutated in the B domain for R-3-hydroxyacyl-CoAs of various lengths . In vitro measurements of the kcat value of the dehydrogenase portion of MFE-2 indicated that inactivation of the B domain resulted in undetectable dehydrogenase activity toward R-3-hydroxybutyryl-CoA, while kcat values toward R-3-hydroxydecanoyl-CoA and R-3-hydroxyhexadecanoyl-CoA were reduced by less than twofold (21) . Thus, fox2 0 + ScMFE-2(b ) cells are expected to be inefficient at using short-chain R-3-hydroxyacyl-CoAs generated by the ß-oxidation cycle, leading to higher levels of these intermediates than of longer-chain R-3-hydroxyacyl-CoAs . This model would result in making the short-chain R-3-hydroxyacyl-CoAs more available to the PHA synthase . Although the largest impact would be expected for R-3-hydroxybutyryl-CoA, the shortest R-3-hydroxyacyl-CoA accepted by the PHA synthase of P . aeruginosa expressed by S . cerevisiae has five carbons . It is thus logical that PHA produced in fox2 0 + ScMFE-2(b ) grown on oleic or heptadecenoic acid would accumulate a higher proportion of H6 and H5 monomers, respectively, than that produced in fox2 0 + ScMFE-2 .
In comparison to the mutation in the B domain, the mutation in the A domain of the dehydrogenase has a smaller effect on the kcat values for R-3-hydroxyacyl-CoAs of various lengths (21) . Thus, compared to the wild type, the dehydrogenase with a mutation in the A domain shows no reduction in kcat for R-3-hydroxybutyryl-CoA and only a three- to fourfold reduction in kcat for R-3-hydroxydecanoyl-CoA and R-3-hydroxyhexadecanoyl-CoA . Although the difference in abundance of some monomers, such as the H10 monomer for cells grown on oleic acid and the H5 monomer for cells grown on heptadecenoic acid, was statistically significant between fox2 0 + ScMFE-2 and fox2 0 + ScMFE-2(a ), the amount of change was considerably smaller than that between fox2 0 + ScMFE-2 and fox2 0 + ScMFE-2(b ) . This finding indicates that the changes in kinetic properties of the mutated MFE-2(a ) protein are small enough to have little influence on the relative concentrations of various R-3-hydroxyacyl-CoAs present in the cell or their availability to the PHA synthase .
In conclusion, these experiments have demonstrated that the monomer composition of MCL-PHA produced from the intermediates of the ß-oxidation of fatty acids can be significantly modified by changing the kinetic properties of MFE-2 for 3-hydroxyacyl-CoAs of various lengths . Furthermore, this work shows that PHA synthesis in S . cerevisiae peroxisomes can be used to reveal changes in the properties of the enzymes of the ß-oxidation cycle that affect the carbon flux through this cycle .
This research was funded, in part, by grants from the Georgine Claraz Foundation (S.M.), the University of Lausanne (Y.P.), the Academy of Finland (J.K.H . and T.G.), and the Sigrid Jusélius Foundation (J.K.H . and T.G.) .
We thank J . H . Hegemann (Heinrich Heine Universitaet, Düsseldorf, Germany) for providing the pUG36 vector, W . H . Kunau (Ruhr Universitaet, Bochum, Germany) for the thiolase antibody, and Stéphane Rothen (University of Lausanne) for help with statistical analysis .
* Corresponding author . Mailing address: Laboratoire de Biotechnologie Végétale, Département de Biologie Moléculaire Végétale, Université de Lausanne, CH-1015 Lausanne, Switzerland . Phone: 41 21 692 4222 . Fax: 41 21 692 4195 . E-mail: yves.poirier{at}ie-bpv.unil.ch .
- Anderson, A . J., and E . A . Dawes. 1990 . Occurrence, metabolism, metabolic role, and industrial uses of bacterial polyhydroxyalkanoates . Microbiol . Rev . 54:450-472.
- Cormack, B . P., G . Bertram, M . Egerton, N . A . Gow, S . Falkow, and A . J . Brown. 1997 . Yeast-enhanced green fluorescent protein (yEGFP): a reporter of gene expression in Candida albicans . Microbiology 143:303-311.
- de Koning, G . J . M. 1995 . Physical properties of bacterial poly((R)-3-hydroxyalkanoates) . Can . J . Microbiol . 41(Suppl . 1):303-309.
- de Koning, G . J . M., H . M . M . Van Bilesen, P . J . Lemstra, W . Hazenberg, B . Withold, H . Preusting, J . G . Van der Galiën, A . Schirmer, and D . Jendrossek. 1994 . A biodegradable rubber by crosslinking poly(hydroxyalkanoate) from Pseudomonas oleovorans . Polymer 35:2090-2097.
- Gietz, D., A . St . Jean, R . A . Woods, and R . H . Schiestl. 1992 . Improved method for high efficiency transformation of intact yeast cells . Nucleic Acids Res . 20:1425.
- Gietz, R . D., and A . Sugino. 1988 . New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites . Gene 74:527-534.
- Gould, S . J., N . Hosken, J . Wilkinson, and S . Subramani. 1989 . A conserved tri-peptide sorts proteins to peroxisomes . J . Cell Biol . 108:1657-1664.
- Hayashi, M., M . Aoki, M . Kondo, and M . Nishimura. 1997 . Changes in targeting efficiencies of proteins to plant microbodies caused by amino acid substitutions in the carboxy-terminal tripeptide . Plant Cell Physiol . 38:759-768.
- Kragler, F., A . Langeder, J . Raupachova, M . Binder, and A . Hartig. 1993 . Two independent peroxisomal targeting signals in catalase A of Saccharomyces cerevisiae . J . Cell Biol . 120:665-673.
- Lageveen, R . G., G . W . Huisman, H . Preusting, P . Ketelaar, G . Eggink, and B . Witholt. 1988 . Formation of polyesters by Pseudomonas oleovorans: effect of substrates on formation and composition of poly-(R)-3-hydroxyalkanoates and poly-(R)-3-hydroxyalkanoates . Appl . Environ . Microbiol . 54:2924-2932.
- Lee, S . Y. 1996 . Plastic bacteria? Progress and prospects for polyhydroxyalkanoate production in bacteria . Trends Biotechnol . 14:431-438.
- Luo, Y., I . V . Karpichev, R . A . Kohanski, and G . M . Small. 1996 . Purification, identification, and properties of a Saccharomyces cerevisiae oleate-activated upstream activating sequence-binding protein that is involved in the action of POX1 . J . Biol . Chem . 271:12068-12075.
- Mittendorf, V., V . Bongcam, L . Allenbach, G . Coullerez, N . Martini, and Y . Poirier. 1999 . Polyhydroxyalkanoate synthesis in transgenic plants as a new tool to study carbon flow through ß-oxidation . Plant J . 20:45-55.
- Mittendorf, V., E . J . Robertson, R . M . Leech, N . Krüger, A . Steinbüchel, and Y . Poirier. 1998 . Synthesis of medium-chain-length polyhydroxyalkanoates in Arabidopsis thaliana using intermediates of peroxisomal fatty acid ß-oxidation . Proc . Natl . Acad . Sci . USA 95:13397-13402.
- Mumberg, D., R . Müller, and M . Funk. 1995 . Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds . Gene 156:119-122.
- Poirier, Y. 1999 . Production of new polymeric compounds in plants . Curr . Opin . Biotechnol . 10:181-185.
- Poirier, Y., N . Erard, and J . MacDonald-Comber Petétot. 2002 . Synthesis of polyhydroxyalkanoate in the peroxisome of Pichia pastoris . FEMS Microbiol . Lett . 207:97-102.
- Poirier, Y., N . Erard, and J . MacDonald-Comber Petétot. 2001 . Synthesis of polyhydroxyalkanoate in the peroxisome of Saccharomyces cerevisiae using intermediates of fatty acid ß-oxidation . Appl . Environ . Microbiol . 67:5254-5260.
- Poirier, Y., C . Nawrath, and C . Somerville. 1995 . Production of polyhydroxyalkanoates, a family of biodegradable plastics and elastomers, in bacteria and plants . Nat . Biotechnol . 13:142-150.
- Poirier, Y., G . Ventre, and D . Caldelari. 1999 . Increased flow of fatty acids toward ß-oxidation in developing seeds of Arabidopsis deficient in diacylglycerol acyltransferase activity or synthesizing medium-chain-length fatty acids . Plant Physiol . 121:1359-1366.
- Qin, Y.-M., M . S . Marttila, A . M . Haapalainen, K . M . Siivari, T . Glumoff, and J . K . Hiltunen. 1999 . Yeast peroxisomal multifunctional enzyme: (3R)-hydroxyacyl-CoA dehydrogenase domains A and B are required for optimal growth on oleic acid . J . Biol . Chem . 274:28619-28625.
- Steinbüchel, A. 1991 . Polyhydroxyalkanoic acids, p . 123-216 . In D . Byrom (ed.), Novel biomaterials from biological sources . MacMillan, New York, N.Y.
- Steinbüchel, A., and B . Füchtenbusch. 1998 . Bacterial and other biological systems for polyester production . Trends Biotechnol . 16:419-427.
- Steinbüchel, A., and H . E . Valentin. 1995 . Diversity of bacterial polyhydroxyalkanoic acids . FEMS Microbiol . Lett . 128:219-228.
- Sudesh, K., H . Abe, and Y . Doi. 2000 . Synthesis, structure and properties of polyhydroxyalkanoates: biological polyesters . Prog . Polym . Sci . 25:1503-1555.
- Trelease, R . N., M . S . Lee, A . Banjoko, and J . Bunkelmann. 1996 . C-terminal polypeptides are necessary and sufficient for in vivo targeting of transiently-expressed proteins to peroxisomes in suspension-cultured plant cells . Protoplasma 195:156-167.
Free Online Full-text Article
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
|