|
|
|
|
|
| Microbios, 1982, 34(135), 31 - 40 Inhibitors of Neisseria gonorrhoeae produced in liquid medium by Bacteroides fragilis and Eubacterium limosum; Morin A et al.; Indigenous micro-organisms of the urogenital flora including anaerobes can inhibit the in vitro growth of Neisseria gonorrhoeae . Bacteroides fragilis and Eubacterium limosum strains known to inhibit the gonococcal growth on solid medium have been shown to produce their antigonococcal activities in liquid medium . Concentrations of individual short-chain fatty acids produced by E . limosum strains were lower than the inhibitory concentrations reported for N . gonorrhoeae . B . fragilis strains produced propionic acids in amounts known to be inhibitory to the gonococcus . Furthermore, studies with E . limosum (Ps11A) cultures incubated at 29 degrees C (200 ml, 50 l) and at 37 degrees C (200 ml) have shown that short-chain fatty acids were not the inhibitors since no correlation between the short-chain fatty acids and the antigonococcal activity was found throughout the growth of the cultures . Moreover, the observed inhibitory activity of E . limosum was not due to pH change or to nutrient depletion of the medium . These observations coupled with the specificity of the antigonoccal activity produced by E . limosum suggest that it is different from previously reported gonococcal inhibitors of bacterial origin. Arch Gynecol, 1982, 231(3), 247 - 52 Vaginal organisms in prepubertal children with and without vulvovaginitis . A vaginoscopic study; Gerstner GJ et al.; In a prospective clinical and microbiological study covering 67 prepubertal children the vaginal flora of 31 asymptomatic children was compared to 36 children suffering from abnormal vaginal discharge and/or vulvovaginitis . Vaginoscopy was employed to obtain bacteriological specimens without contamination . Swabs were inoculated into prereduced transportmedia (PORT A CUL, BBL) and cultured aerobically and anaerobically . The most prevalent aerobic organisms were Staphylococcus epidermidis . Enterococci and Escherichia coli; the predominant anaerobic bacteria were Peptococcus and Peptostreptococcus, Veillonella parvula, Eubacteria, Propionibacterium and Bacteroides species . A similar microbiological pattern was found in both groups, although anaerobes, like Peptococci and Peptostreptococci and Bacteroides species, as well as yeasts, like Candida albicans were significantly more frequent in the group with signs and symptoms . Lactobacilli were less common in this group. Am J Obstet Gynecol, 1981 Dec 15, 141(8), 1065 - 71 Infectious complications of cervical cerclage; Charles D et al.; A study of 115 gravid patients who required cervical cerclage indicated that the optimum time to perform the surgical procedure was between the fourteenth and eighteenth weeks . If the operation is delayed until later in the second trimester, the incidence of chorioamnionitis is increased 2.6-fold, and premature rupture of the membranes prior to the thirty-second week of gestation is trebled . Amniocentesis performed in nine patients with chorioamnionitis and intact membranes after cerclage demonstrated the polymicrobial nature of the amniotic fluid infection . The isolation of such organisms at Bacteroides bivius, Eubacterium lentum, and Staphylococcus epidermidis indicates their potential importance in chorioamnionitis . Early recourse to amniocentesis is recommended when chorioamnionitis is suspected, and, moreover, prophylactic antibiotics should be used when cerclage is performed after the eighteenth week of pregnancy. Biochim Biophys Acta, 1981 Nov 30, 671(1), 16 - 24 Primary structure of an acidic ribosomal protein YPA1 from Saccharomyces cerevisiae . Isolation and characterization of peptides and the complete amino acid sequence; Itoh T; The complete primary structure of an acidic ribosomal protein YPA1 from Saccharomyces cerevisiae has been determined . YPA1 is composed of 110 amino acid residues and has the composition: Asp7, Asn2, Thr2, Ser9, Glu15, Gln2, Pro3, Gly15, Ala21, Val6, Met2, Ile4, Leu9, Tyr2, Phe3, Lys7 and Arg1 . The molecular weight of YPA1 is 11,020 . The amino acid sequence was determined by 4-N,N-dimethylaminoazobenzene 4'-isothiocyanate degradation of the peptides obtained by digestions with trypsins, chymotrypsin, thermolysin, pepsin and Staphylococcus aureus protease of intact protein . A comparison of protein YPA1 from yeast with eL12 from Artemia salina shows a high sequence similarity . A considerable similarity is also shown with HL20 from Halobacterium cutirubrum . On the other hand, there is very little apparent sequence similarity between YPA1 and the eubacterial acidic protein L12 either from E . coli or B . subtilis. Nucleic Acids Res, 1981 Sep 11, 9(17), 4387 - 90 The nucleotide sequence of the tRNAMMet from the archaebacterium Thermoplasma acidophilum; Kilpatrick MW et al.; Using in vitro labelling techniques, a tRNAMMet from Thermoplasma acidophilum, a member of the Archaebacteriae, has been shown to have the sequence: pGCCGGG Gs4UGGCUCANCUGGAGGAGC m2(2)GCCGGACmUCAUt6AAUCCGGAGGUCUCGGG psi psi CmGAUCCCCGAUCCCGGCACCAOH . Despite the small genome size of this non-parasitic organism, eight modified nucleosides are present, one of which is typically eubacterial, one of which is typically eukaryotic and some of which appear to be unique to the archaebacteria . There is no close sequence homology between this tRNA and that of any other methionine tRNA so far sequenced (less than 70%) but it has almost 90% homology with the nucleotide sequence proposed by Eigen and Oswatitsch for the ancestral quasi-species. J Lipid Res, 1981 Aug, 22(6), 891 - 8 Cofactor requiremets for 7 alpha-dehydroxylation of cholic and chenodeoxycholic acid in cell extracts of the intestinal anaerobic bacterium, Eubacterium species V.P.I . 13708; White BA et al.; The characteristics of 7 alpha-dehydroxylase, a bile acid-biotransforming enzyme, were determined using dialyzed cell extracts of Eubacterium sp . V.P.I . 12708 . 7 alpha-Dehydroxylase was induced by cholic acid in this organism . Induction by cholic acid resulted in the differential synthesis of at least five new polypeptides with molecular weights of 77,000, two at 56,000, 27,000 and 23,500, as determined by both one and two-dimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis . The relative molecular weight of 7 alphs-dehydroxylase activity was estimated by anaerobic Bio-Gel A 1.5 M gel filtration chromatography to be 114,000 . NAD+ was the only cofactor to consistently stimulate 7 alpha-dehydroxylase activity in dialyzed cell extracts . The specific activity increased 4- to 6-fold with either cholic or chenodeoxycholic acid as a substrate in the presence of NAD+ . NAD+ was also required for the reduction of the delta 6-intermediate to deoxycholic acid . Other pyridine or flavin nucleotides were ineffective cofactors when added alone . Saturation kinetics for NAD+ with cholic or chenodeoxycholic acid as substrates were hyperbolic, and Lineweaver-Burk plots yielded apparent Km values of 0.13 mM and 0.006 mM, respectively . Similar kinetics were obtained with cholic acid giving an apparent Km of 25 microM . The substrate saturation curve for chenodeoxycholic acid 7 alpha-dehydroxylation indicated substrate inhibition at high concentrations of chenodeoxycholic acid (greater than 50 microM) . These studies show that 7 alpha-dehydroxylase is an inducible enzyme and requires NAD+ as a cofactor in this bacterium. J Hyg (Lond), 1981 Aug, 87(1), 25 - 33 Antibodies to Eubacterium and Peptostreptococcus species and the estimated probability of Crohn's disease; Van de Merwe JP et al.; Anaerobic coccoid rods belonging to species of Eubacterium and Peptostreptococcus agglutinate more frequently with sera from patients with Crohn's disease than with sera from patients suffering from other diseases and from healthy subjects . Results of agglutination test with four strains of coccoid anaerobes were used to estimate the probability that a patient suffers from Crohn's disease . The data on healthy subjects and patients with Crohn's disease were subjected to logistic discriminant analysis . With the methods and interpretation described, 52% of the patients with Crohn's disease were recognized as 'definite' or 'probable' Crohn's disease and 14% as 'suspected' . Only 1% of the healthy subjects were classified as 'suspected' and non as 'definite' or 'probable' Crohn's disease. J Hyg (Lond), 1981 Aug, 87(1), 13 - 24 Serum agglutinins to Eubacterium and Peptostreptococcus species in Crohn's and other diseases; Wensinck F et al.; Sera from patients suffering from Crohn's and other diseases and from healthy subjects were tested for agglutinins to anaerobic, gram-positive coccoid rods belonging to species of Eubacterium and Peptostreptococcus . Four strains labelled Eubacterium contortum (two strains), Eubacterium rectale and Peptostreptococcus productus were agglutinated by a higher percentage of sera from patients with Crohn's disease than from healthy subjects and from patients with liver and intestinal diseases (including ulcerative colitis), ankylosing spondylitis, granulomatous diseases, diseases of immunity and malignancies . The agglutinins were of the IgG and IgM classes and strain-specific; the titres were low . The results obtained with sera from patients with Crohn's disease and healthy people were subjected to discriminant analysis to estimate the probability, based on the combined results with the four strains, that a patient suffers from Crohn's disease . When sera giving an a posteriori probability greater than or equal to 0.95 (a priori probability = 0.5) were considered positive, the test with four strains had a sensitivity of 54% and a specificity of nearly 100% . The results with sera submitted for diagnosis showed that positive reactions in patients with a diagnosis apparently incompatible with Crohn's disease were within acceptable limits. Scand J Dent Res, 1981 Aug, 89(4), 321 - 8 Bacteriologic evaluation of the efficacy of mechanical root canal instrumentation in endodontic therapy; Bystrom A et al.; The presence of bacteria in 17 single-rooted teeth, with periapical lesions, was studied throughout a whole period of treatment . The root canals were irrigated with physiologic saline solution during instrumentation . No antibacterial solutions or dressings were used . Bacteria were found in all initial specimens from the teeth (median number of bacterial cells 4 x 10(5), range 10(2) - 10(7)) and the number of strains in the specimens ranged from 1 to 10.88% of the strains were anaerobic . The most commonly isolated species were: Peptostreptococcus micros, Peptostreptococcus anaerobius, Fusobacterium nucleatum, Bacteroides oralis, Bacteroides melaninogenicus subsp intermedius and Eubacterium alactolyticum . Mechanical instrumentation reduced the number of bacteria considerably . Specimens taken at the beginning of each appointment usually contained 10(4) - 10(6) bacterial cells and at the end 10(2) - 10(3) fewer . Bacteria were eliminated from the root canals of eight teeth during the treatment . In seven root canals bacteria persisted despite treatment on five successive occasions . There was no evidence that specific microorganisms were implicated in these persistent infections . Teeth where the infection persisted despite being treated five times were those with a high number of bacteria in the initial sample. J Periodontol, 1981 Jul, 52(7), 374 - 9 Eubacterium saburreum and Veillonella parvula: a symbiotic association or oral strains; Mashimo PA et al.; A cocci-filament association was discovered in bacterial cultural studies of a subgingival plaque sample . Components were isolated and identified as Veillonella parvula and Eubacterium saburreum . A E . saburreum cell-associated material consisting of approximately 25% glucose and 70% protein was found which may play a role in the adherence of V . parvula to this filament . Acid end product analysis via gas liquid chromatography showed an uptake of lactic and succinic acids by V . parvula resulting in increased levels of acetic, propionic and n-butyric acids in mixed culture of the E . saburreum and the V . parvula strains . The ability of E . saburreum to adhere to nichrome wire and to glass surfaces as well as the secondary plaque forming ability of V . parvula indicates that these organisms may play a role in the maturation of human dental plaque. Appl Environ Microbiol, 1981 Jul, 42(1), 12 - 9 Features of rumen and sewage sludge strains of Eubacterium limosum, a methanol- and H2-CO2-utilizing species; Genthner BR et al.; Eubacterium limosum was isolated as the most numerous methanol-utilizing bacterium in the rumen fluid of sheep fed a diet in which molasses was a major component (mean most probable number of 6.3 X 10(8) viable cells per ml) . It was also isolated from sewage sludge at 9.5 X 10(4) cells per ml . It was not detected in the rumen fluid of a steer on a normal hay-grain diet, although Methanosarcina, as expected, was found at 9.5 X 10(5) cells per ml . The doubling time of E . limosum in basal medium (5% rumen fluid) with methanol as the energy source (37 degree C) was 7 h . Acetate, cysteine, carbon dioxide, and the vitamins biotin, calcium-D-pantothenate, and lipoic acid were required for growth on a chemically defined methanol medium . Acetate, butyrate, and caproate were produced from methanol . Ammonia or each of several amino acids served as the main nitrogen source . Other energy sources included adonitol, arabitol, erythritol, fructose, glucose, isoleucine, lactate, mannitol, ribose, valine, and H2-CO2 . The doubling time for growth on H2-CO2 (5% rumen fluid, 37 degree C) was 14 h as compared with 5.2 h for isoleucine and 3.5 h for glucose . The vitamin requirements for growth on H2-CO2 were the same as those for methanol; however, acetate was not required for growth on H2-CO2, although it was necessary for growth on valine, isoleucine, and lactate and was stimulatory to growth on glucose . Acetate and butyrate were formed during growth on H2-CO2, whereas branched-chain fatty acids and ammonia were fermentation products from the amino acids . Heat tolerance was detected, but spores were not observed . The type strain of E . limosum (ATCC 8486) and strain L34, which was isolated from the rumen of a young calf, grew on methanol, H2-CO2, valine, and isoleucine and showed the same requirements for acetate as the freshly isolated strains. Onderstepoort J Vet Res, 1981 Jun, 48(2), 123 - 6 Isolation and significance of anaerobic bacteria isolated from cases of bovine mastitis; Du Preez JH et al.; The role of obligate anaerobic bacteria in the aetiology of mastitis of lactating dairy cows was investigated . Anaerobes were isolated from 12% of lactating mastitic cows, which were representative of 50% of the 10 dairy herds examined . Bacteroides fragilis was the most frequently isolated organism of (50%), followed by Peptococcus indolicus (33%), Eubacterium lentum (33%), E . aerofaciens (17%), Propionibacterium granulosum (17%) and an anaerobic Streptococcus sp . (17%) . These obligate anaerobes were always isolated together with organisms classically involved in mastitis . It was possible to induce overt clinical mastitis in healthy lactating udders within 24 hours by infection with single pure cultures of anaerobes via the teat canal . All B . fragilis strains were resistant to penicillin G and tetracycline . In addition, one strain was also resistant to ampicillin, cephalothin and amoxicillin . Anaerobic gram positive cocci and bacilli were sensitive to most antibiotics . These findings imply an important role for anaerobes in the aetiology of mastitis. Appl Environ Microbiol, 1981 Apr, 41(4), 950 - 5 Characterization of the cecal bacteria of normal pigs; Robinson IM et al.; One hundred ninety-two isolates from cecal contents of three normal weaned pigs were obtained by means of anaerobic roll tube methods and were characterized . Seventy-eight percent of the isolates were gram-negative . The most numerous species isolated from each of the pigs was Bacteroides ruminicola . This species accounted for 35% of the isolates that were characterized, and Selenomonas ruminantium accounted for 21% of the isolates . Other gram-negative bacteria isolated from all three pigs were Butyrivibrio fibrisolvens (6.0%) and Bacteroides uniformis (3.0%); predominant gram-positive isolates were Lactobacillus acidophilus (7.6%), Peptostreptococcus productus (3.0%), and Eubacterium aerofaciens (2.5%) . The other 42 isolates were placed in 14 other species, and 5 additional isolates that did not fit well into existing species were not placed taxonomically . Fifteen of the isolates (representing nine species) produced urease. Proc Natl Acad Sci U S A, 1981 Apr, 78(4), 2150 - 4 Secondary structure of eukaryotic cytoplasmic 5S ribosomal RNA; Luehrsen KR et al.; A five-helix secondary structural model is proposed for eukaryotic cytoplasmic 5S rRNA . All available sequence data are consistent with this model including those from Chlorella 5S rRNA whose sequence is revised by data included here . Various architectural features of eukaryotic 5S rRNA are summarized in terms of this secondary structural model . It is observed that previous failures to identify universal models for 5S rRNA secondary structure stem from significant differences in architecture between eukaryotic cytoplasmic and eubacterial 5S rRNAs . The usual four-helix model for eubacterial 5S rRNA secondary structure nevertheless does share several structural features with the five-helix model presented here for cytoplasmic 5S rRNA . It is thus likely that these two classes of 5S rRNA are the result of evolutionary divergence rather than convergence. Nucleic Acids Res, 1981 Feb 25, 9(4), 965 - 70 The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum; Luehrsen KR et al.; The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined . The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH . The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous . Examination of the potential for forming secondary structure is revealing . T . acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs . Instead this 5S rRNA has a mixture of the characteristic features of each . On the whole this 5S rRNA does however appear more eucaryotic than eubacterial . These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization. J Anim Sci, 1981 Feb, 52(2), 418 - 26 Effects of lasalocid or monensin on lactate-producing or -using rumen bacteria; Dennis SM et al.; Lasalocid or monensin inhibited most of the lactate-producing rumen bacteria (Butyrivibrio fibrisolvens, Eubacterium cellulosolvens, E . ruminantium, Lachnospira multiparus, Lactobacillus ruminis, L . vitulinus, Ruminococcus albus, R . flavefaciens, Streptococcus bovis) . Minimum inhibitory concentrations ranged from .38 to 3.0 micrograms/ml . Among the lactate producers, those that produce succinate as a major end product (Bacteroides, Selenomonas, Succinimonas, Succinivibrio) were not inhibited by lasalocid or monensin . Also, none of the major lactate fermenters (Anaerovibrio, Megasphaera, Selenomonas) was inhibited by lasalocid or monensin . Veillonella alcalescens was inhibited by 24 micrograms/ml of lasalocid but was resistant to monensin . Hence, the reported increase in propionate in lasalocid- or monensin-fed cattle may result from selection for succinate producers and lactate fermenters . Lasalocid and monensin appeared to inhibit selectively the production of L(+), but not D(-) lactic acid . The inhibition of major lactate-producing bacteria (Streptococcus and Lactobacillus) suggests that lasalocid or monensin may be used to prevent lactic acidosis in ruminants. Infect Immun, 1981 Feb, 31(2), 592 - 7 Animal model for anaerobic lung abscess; Kannangara DW et al.; There are no satisfactory animal models for the study of anaerobic lung abscess . Aspiration of food, gastric mucin, or hydrochloric acid, or any combination of these, along with oropharyngeal bacteria, is commonly believed to cause aspiration pneumonia and lung abscess . In the animal model described, none of the adjuvants was effective in producing anaerobic lung abscesses . Anaerobic bacteria derived from dental scrapings of a healthy adult (Peptococcus morbillorum, Fusobacterium nucleatum, Eubacterium lentum, and Bacteroides fragilis), when inoculated transtracheally without any adjuvants into New Zealand male white rabbits, consistently produced lung abscesses . Neither B fragilis by itself nor a mixture of P . morbillorum, F . nucleatum, and E . lentum without the addition of B . fragilis produced lung abscesses . The bacterial isolates used in this study were stored in prereduced chopped-meat-glucose medium and subcultured several times and were found effective in reproducing anaerobic lung abscesses repeatedly . This animal model is suitable for the study of pathogenesis, diagnosis, and treatment of B . fragilis-associated anaerobic lung abscess. Biosystems, 1981, 14(3-4), 305 - 12 Cytoskeletal elements in mycoplasmas and other prokaryotes; Maniloff J; This paper reviews the relationship of mycoplasmas to eubacteria, the question of whether mycoplasmas and eubacteria have a cytoskeleton, and whether the unique ultrastructural features of certain mycoplasmas function as a mitotic-like apparatus . Although cytochalasins have inhibitory effects on some mycoplasmas and eubacteria, there are no data indicating that eubacteria have an actin-like protein or other cytoskeletal element . However, the situation for the mycoplasmas remain confusing . While mycoplasma may not contain actin, the data do suggest the presence of other cytoskeletal elements. Nature, 1981 Jan 1, 289(5793), 95 - 6 Are archaebacteria merely derived 'prokaryotes'? Woese CR, Gupta R. The archaebacteria are a group of prokaryotes which seem as distinct from the true bacteria (eubacteria) as they are from eukaryotes . The evidence on which this conclusion rests is of two types: genotypic (quantitative)--that is, comparative sequence studies, and phenotypic (qualitative)--that is, differences in various organismal characteristics . The differences between archaebacteria and true bacteria are so great, both quantitatively and qualitatively, that the two bacterial groups should be considered as representing separate primary lines of descent, each tracing directly back to the universal ancestor . Furthermore, this ancestor itself seems not to be a prokaryote; rather it was a far simpler type of organism, one properly called a progenote . If this is true, the discovery of archaebacteria marks a major advance in the biologist's attempts to understand the basis for the evolution of the cell. Appl Environ Microbiol, 1980 Dec, 40(6), 1130 - 2 Growth of cholesterol-reducing Eubacterium on cholesterol-brain agar; Brinkley AW et al.; An agar medium containing 5% cholesterol has been developed for the isolation, enumeration, and characterization of cholesterol-reducing strains of Eubacterium. Appl Environ Microbiol, 1980 Dec, 40(6), 1017 - 22 Biochemical characterization of cholesterol-reducing Eubacterium; Mott GE et al.; We characterized two isolates of cholesterol-reducing Eubacterium by conducting conventional biochemical tests and by testing various sterols and glycerolipids as potential growth factors . In media containing cholesterol and plasmenylethanolamine, the tests for nitrate reduction, indole production, and gelatin and starch hydrolyses were negative, and no acid was produced from any of 22 carbohydrates . Both isolates hydrolyzed esculin to esculetin, indicating beta-glycosidase activity . In addition to plasmenylethanolamine, five other lipids which contain an alkenyl ether residue supported growth of Eubacterium strain 403 in a lecithin-cholesterol base medium . Of six steroids tested, cholesterol, cholest-4-en-3-one, cholest-4-en-3 beta-ol (allocholesterol), and androst-5-en-3 beta-ol-17-one supported growth of Eubacterium strain 403 . All four steroids were reduced to the 3 beta-ol, 5 beta-H products . The delta 5 steroids cholest-5-en-3 alpha-ol (epicholesterol) and 22,23-bisnor-5-cholenic acid-3-beta-ol were not reduced and did not support growth of the Eubacterium strain. J Bacteriol, 1980 Dec, 144(3), 991 - 8 Methylation patterns of mycoplasma transfer and ribosomal ribonucleic acid; Hsuchen CC et al.; The methylation patterns of transfer and ribosomal ribonucleic acid (RNA) from two mycoplasmas, Mycoplasma capricolum and Acholeplasma laidlawii, have been examined . The transfer RNA from the two mycoplasmas resembled that of other procaryotes in degree of methylation and general diversity of methylated nucleotides, and bore particular resemblance to Bacillus subtilis transfer RNA . The only unusual feature was the absence of m5U from M . capricolum transfer RNA . The methylation patterns of the mycoplasma 16S RNAs were also typically procaryotic, retaining the methylated residues previously shown to be highly conserved among eubacterial 16S RNAs . The mycoplasma 23S RNA methylation patterns were, on the other hand, quite unusual . M . capricolum 23S RNA contained only four methylated residues in stoichiometric amounts, all of which were ribose methylated . A . laidlawii 23S RNA contained the same ribose-methylated residues, plus in addition approximately six m5U residues . These findings are discussed in relation to the phylogenetic status of mycoplasma, as well as the possible role of RNA methylation. Am J Clin Nutr, 1980 Nov, 33(11 Suppl), 2507 - 10 7 alpha-Dehydroxylation of cholic acid by cell extracts of Eubacterium species V.P.I . 12708; Hylemon PB et al.; NADH:flavin oxidoreductase and 7 alpha-dehydroxylase were induced 5- and 90-fold, respectively, by cholic acid in cultures of Eubacterium species V.P.I . 12708 . Assays of 7 alpha-dehydroxylase activity in the presence of various cofactors revealed that optimal activity was obtained in the presence of NAD+ plus FADH2 . The pH optima of 7 alpha-dehydroxylase activity in whole cells and cell extracts were 7.0 . The similar induction pattern of these two enzymes and the apparent cofactor requirements for 7 alpha-dehydroxylation suggest a relationship between 7 alpha-dehydroxylase and NADH:flavin oxidoreductase. JAMA, 1980 Oct 10, 244(15), 1696 - 8 Surface vs core-tonsillar aerobic and anaerobic flora in recurrent tonsillitis; Brook I et al.; Specimens from both the surface and the core of tonsils from 23 children with recurrent tonsillitis were cultured for aerobic and anaerobic microorganisms . Mixed aerobic and anaerobic flora were obtained from all patients . The predominant anaerobic isolates were Bacteroides sp, Fusobacterium nucleatum, anaerobic Gram-positive cocci, and Eubacterium sp . The predominant aerobic isolates were alpha-hemolytic streptococci, Staphylococcus aureus, beta-hemolytic streptococci, and Haemophilus sp . beta-Lactamase production was noted in 49 isolates from 19 patients (83%) . Seventy percent of the aerobic isolates were recovered in both core and surface specimens, compared with 57% of the anaerobic isolates . Ten percent of aerobes were recovered only in the core, compared with 33% of the anaerobes, and 20% of the aerobes in the surface only, compared wtih 10% of the anaerobes . These data demonstrate the discrepancies between surface and core cultures in the isolation of anaerobic bacteria, and raise the question whether surface cultures can accurately predict the presence of beta-lactamase-producing organisms or other pathogens in the recurrently infected tonsil. Eur J Biochem, 1980 Aug, 109(1), 115 - 8 Biosynthesis of vitamin B12 . Experiments with the anaerobe Eubacterium limosum and some labelled substrates; Lamm L et al.; 1 . The anaerobic microorganism Eubacterium limosum (DSM 20 402), grown in the presence of L-{methyl-14C}methionine, produces vitamin B12 not only labeled in the corrin ring, but also in the 5,6-dimethylbenzimidazole moiety . The vitamin B12 obtained in a similar experiment with L-{methyl-13C}methionine showed nine signals in the 13CV NMR spectrum . Seven of these signals are due to the seven 'extra' methyl groups of the corrin ring, two signals originate from the two methyl groups of the 5,6-dimethylbenzimidazole moiety . This result is in contrast to previous experiments with aerobic and aerotolerant organisms, where L-methionine is only the precursor of the seven corrin methyl groups, and the 5,6-dimethylbenzimidazole is formed from riboflavin . 2 . E . limosum transforms exogenously added benzimidazole into benzimidazolylcobamide, but with {2-14C}benzimidazole it was shown that benzimidazole is not a precursor of the 5,6-dimethylbenzimidazole moiety of vitamin B12 . 3 . Radioactivity from {2-14C}glycine is almost exclusively incorporated into the 5,6-dimethylbenzimidazole moiety of vitamin B12, but not into the corrin moiety . This demonstrates that in E . limosum delta-aminolevulinic acid, the precursor of the corrin moiety, is not formed as in many other organisms from succinyl-CoA and glycine. Carbohydr Res, 1980 Aug 1, 83(1), 129 - 34 Isolation and identification of 3,6-dideoxy-3-(L-glyceroyl-amino)-D-glucose . a constituent of the antigenic polysaccharide of Eubacterium saburreum, strain V5; Kondo W et al.; 3,6-Dideoxy-3-(L-glyceroylamino)-D-glucose has been identified, for the first time, as a sugar component of the antigenic polysaccharide of Eubacterium saburreum strain V5, principally by n.m.r . and mass spectrometry. J Lipid Res, 1980 Jul, 21(5), 585 - 93 Characterization of a corticosteroid 21-dehydroxylase from the intestinal anaerobic bacterium, Eubacterium lentum; Feighner SD et al.; An oxygen-sensitive corticosteroid 21-dehydroxylase has been characterized in cell extracts of Eubacterium lentum . The enzyme was highly specific for corticosteroids containing and alpha-ketol structure and required FMNH2 or reduced benzyl viologen for activity . The enzyme used deoxycorticosterone, deoxycortisol, dehydrocorticosterone, and corticosterone as substrates . Substrate saturation kinetics using {3H}corticosterone yielded an apparent Km of 7.35 microM and a Vmax of 15.4 nmol (11 beta-{3H}hydroxyprogesterone) formed per hr x mg protein-1 . 21-Dehydroxylase activity was inhibited by both water-soluble and lipophilic metal ion chelators . NADH: flavin oxidoreductase and 21-dehydroxylase activities were separated by anaerobic DEAE-cellulose and Sepharose 6B chromatography . 21-Dehydroxylase had a relative weight of 582,000 as determined by Sepharose 6B chromatography . There was a 7-fold increase in the rate of 21-dehydroxylation of {3H}deoxycorticosterone in whole cell suspensions of E . lentum sparged with H2 as compared to argon gas. Infect Immun, 1980 Jun, 28(3), 766 - 70 In vitro inhibition of Neisseria gonorrhoeae growth by strict anaerobes; Morin A et al.; Thirty two anaerobic bacterial strains were screened for their in vitro inhibitory activity toward 21 Neisseria gonorrhoeae strains, including two penicillin-resistant strains . From this screening, six anaerobic bacteria belonging to the genera Bacteroides, Peptostreptococcus, and Eubacterium were selected for their large antigonococcal spectrum of activity . The inhibitory activity of these six strains appears to be specific to the gonococcus as a variety of anaerobes and aerobes were not generally inhibited by these strains . The antigonococcal effect was not due to pH change or nutrient depletion of the media. Nucleic Acids Res, 1980 May 24, 8(10), 2275 - 93 Secondary structure model for bacterial 16S ribosomal RNA: phylogenetic, enzymatic and chemical evidence; Woese CR et al.; We have derived a secondary structure model for 16S ribosomal RNA on the basis of comparative sequence analysis, chemical modification studies and nuclease susceptibility data . Nucleotide sequences of the E . coli and B . brevis 16S rRNA chains, and of RNAse T1 oligomer catalogs from 16S rRNAs of over 100 species of eubacteria were used for phylogenetic comparison . Chemical modification of G by glyoxal, A by m-chloroperbenzoic acid and C by bisulfite in naked 16S rRNA, and G by kethoxal in active and inactive 30S ribosomal subunits was taken as an indication of single stranded structure . Further support for the structure was obtained from susceptibility to RNases A and T1 . These three approaches are in excellent agreement . The structure contains fifty helical elements organized into four major domains, in which 46 percent of the nucleotides of 16S rRNA are involved in base pairing . Phylogenetic comparison shows that highly conserved sequences are found principally in unpaired regions of the molecule . No knots are created by the structure. Biochim Biophys Acta, 1980 Apr 11, 612(2), 328 - 36 Characterization of a NADH:flavin oxidoreductase induced by cholic acid in a 7 alpha-dehydroxylating intestinal Eubacterium species; Lipsky RH et al.; A NADH:flavin oxidoreductase was partially purified (seven-fold) from an intestinal Eubacterium species V.P.I . 12708 using Bio-Gel A 0.5-M and DEAE-cellulose column chromatography . Enzyme activity was measured spectrophotometrically at 340 nm under anaerobic conditions . A molecular weight of 260 000 was estimated by gel filtration chromatography . The partially purified enzyme preparation exhibited single displacement kinetics with respect to the substrates NADH and FAD . The pH optimum under these conditions was 6.8 . NADH:flavin oxidoreductase showed an absolute specificity for NADH as electron donor . However, methylene blue, 2,6-dichlorophenolindophenol, K3Fe(CN)6, menadione, riboflavin, FMN and molecular oxygen served as alternate electron acceptors with varying degrees of efficiency . Acriflavin, rotenone, o-phenanthroline, p-chloromercuribenzoate, dicoumarol and 2,4-dinitrophenol inhibited enzyme activity . Surprisingly, 0.1 mM cholic acid, but not 0.1 mM deoxycholic acid, rapidly induced NADH:flavin oxidoreductase activity in growing cultures. Scand J Dent Res, 1980 Apr, 88(2), 113 - 21 Neutrophil chemotaxis induced by anaerobic bacteria isolated from necrotic dental pulps; Sundqvist G et al.; Anaerobic bacteria belonging to the species Bacteroides melaninogenicus, Bacteroides asaccharolyticus, Fusobacterium nucleatum, Peptostreptococcus anaerobius and Eubacterium alactolyticum, isolated from necrotic dental pulps, were tested for their capacity to induce neutrophil leukocyte chemotaxis . Generation of chemotactic factors in serum by whole bacterial cells and chemotaxis induced by bacterial extracts were studied in vitro by the Boyden technique . Subcutaneously implanted wound chambers in guinea pigs were used for testing leukocyte migration in vivo . All bacterial strains had a similar high capacity to induce neutrophil chemotaxis . The heavy accumulation of polymorhponuclear neutrophil leukocytes associated with clinical and experimental infections by B . melaninogenicus or B . asaccharolyticus cannot be ascribed to any extreme ability of these organisms to generate chemotactic factors. Steroids, 1980 Jan, 35(1), 103 - 9 Bile acid induction specificity of 7 alpha-dehydroxylase activity in an intestinal Eubacterium species; White BA et al.; The addition of cholic acid to growing cultures of Eubacterium species V.P.I . 12708 caused a 25 and 46-fold increase in 7 alpha-dehydroxylation activity using cell extracts or whole cell suspensions, respectively . Bile acid conversion rates using either {14C}-cholic acid or {14C}-chenodeoxycholic acid as substrates increased at approximately the same rate when either cholic or chenodeoxycholic acid was added to growing cultures as inducer . The induction of 7 alpha-dehydroxylase activity was highly specific requiring a free C-24-carboxyl group and an unhindered 7 alpha-hydroxy group on the B ring of the steroid nucleus . Unexpectedly, cholic acid also rapidly induced NADH:flavin oxidoreductase activity in growing cultures of this bacterium.
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||
