Antimicrobial Agents and Chemotherapy, November 2004, p . 4435-4437, Vol . 48, No . 11

Community-Onset Disease Caused by Citrobacter freundii Producing a Novel CTX-M ß-Lactamase, CTX-M-30, in Canada

Baha Abdalhamid,¹ Johann D . D . Pitout,² Ellen S . Moland,¹ and Nancy D . Hanson^1*

Department of Medical Microbiology and Immunology, Center for Research in Antiinfectives & Biotechnology, Creighton University School of Medicine, Omaha, Nebraska,¹ Division of Microbiology, Calgary Laboratory Services, and Department of Pathology & Laboratory Medicine, University of Calgary, Calgary, Alberta, Canada²

Received 12 March 2004/ Returned for modification 23 May 2004/ Accepted 15 July 2004

Five strains of C . freundii intermediate to cefotaxime (CTX) were isolated from the urine samples of four different patients over a 2-month period during 2002 . The strains were designated Cf 12, Cf 27, Cf 28, Cf 29, and Cf 30 . Strain identification was initially achieved using Vitek (Vitek AMS; BioMérieux Vitek Systems Inc., Hazelwood, Mo.) and API 20E strips (BioMérieux Inc.) and confirmed by 16S rRNA sequencing using a MicroSeq 500 16S rDNA bacterial sequencing kit (Applied Biosystems; Foster City, CA) . The resulting sequences were analyzed with MicroSeq analysis software (Applied Biosystems) . The 16S rDNA analysis confirmed that the strains were C . freundii .

DNA templates for PCR were prepared as previously described using annealing temperatures of 55°C for primers CTX-M1F (GCAGCACCAGTAAAGTGATGG) and CTX-M1R (GCTGGGTGAAGTAAGTGACC) (accession number X92506) and 46°C to obtain the full-length amplified product by use of primers CTX-M3FLF (CGTCTCTTCCAGAATAAGG) and CTX-M-3FLR (GTTTCCCCATTCCGTTTCCGC) (accession number AF550415) (15) . Sequencing using an ABI Prism 3100-Avant genetic analyzer was carried out by automated-cycle sequencing .

The full-length PCR product was cloned into pXL-Topo and transformed into Escherichia coli Top10 (Invitrogen) as recommended by the manufacturer . The resulting transformant was designated tCf 29 .

Sequencing data revealed that all strains had identical nucleotide sequences . Computer-generated amino acid analysis using the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/BLAST.cgi) identified a unique combination of four amino acid substitutions (Thr16Ala, Asn117Asp, Gly242Asp, and Asn289Asp) which had not been previously described . Therefore, this new CTX-M ß-lactamase was designated CTX-M-30 . The gene bla_CTX-M-30 had 11 separate nucleotide changes positioned randomly throughout the gene compared to bla_CTX-M-3 . Two nucleotide changes resulted in two amino acid substitutions, Thr16Ala and Asn117Asp . In addition, bla_CTX-M-30 had seven separate nucleotide changes positioned randomly throughout the gene compared to bla_CTX-M-29 . Two of these nucleotide changes resulted in two additional amino acid substitutions, Gly242Asp and Asn289Asp . Conjugation and transformation experiments were performed as previously described (4, 9) . The gene bla_CTX-M-30 was found not to be self-transmissible; therefore, Southern analysis was performed to determine the location of bla_CTX-M-30 .

Plasmid DNA was extracted by alkaline lysis from strains Cf 12, Cf 27, Cf 28, Cf 29, and Cf 30 as previously described (15), and one-half of each plasmid sample was treated with plasmid-safe DNase (Epicentre Technologies) to remove contaminating chromosomal DNA . The plasmids were separated by electrophoresis in a 0.6% agarose gel . Plasmid profile gels were stained with ethidium bromide (10 mg/ml) and visualized by ultra-violet light with a Kodak EDAS 290 system . Southern analysis was performed as described by the manufacturer (Boehringer Mannheim, Indianapolis, Ind.) . The bla_CTX-M-30-specific probe was synthesized using PCR by incorporating digoxigenin-11-dUTP into the product by use of primers CTX-M-1F and CTX-M-1 R .

Plasmid profiles revealed that all the clinical strains had the same three plasmids (3, 6, and 16 kb) (data not shown) . Southern analysis indicated that bla_CTX-M-30 was encoded on a 3-kb plasmid and was not chromosomally encoded (data not shown) . The gene bla_CTX-M-30 was also detected on the pXL-Topo plasmid transformed into tCf 29 .

MICs were determined using broth microdilution and E-tests (AB Biodisk, Solna, Sweden) as recommended by the manufacturers . E . coli ATCC 25922 was used as the quality control strain . Throughout this study, results were interpreted using National Committee for Clinical Laboratory Standards (NCCLS) criteria for broth dilution (12) . The presence of an ESBL was evaluated using the modified double disk test (MDDT) (14) . Cefotaxime MICs were 32 µg/ml for Cf 29, 16 µg/ml for tCf 29, and 0.12 µg/ml for E . coli Top 10 . The ceftazidime MICs were 1 µg/ml for Cf 29, 0.5 µg/ml for tCf 29, and 0.25 µg/ml for E . coli Top 10 (Table 1) . The ceftazidime and cefotaxime MICs for E . coli 25922 were within the NCCLS values . All the clinical strains were positive for ESBL production, as determined by the MDDT (14) .

 
Sonicates of both Cf 29 and tCf 29 were subjected to analytical isoelectric focusing (IEF) as previously described (1, 16) . Analytical IEF revealed the presence of a cefotaxime-hydrolyzing ß-lactamase with a pI of 8.0 for both the clinical isolate, Cf 29, and the transformant, tCf 29 . This band was inhibited by clavulanic acid but not by cloxacillin . In addition, IEF analysis revealed two additional bands in the clinical strain Cf 29 . One band correlated with a pI of 5.4 and was inhibited by clavulanic acid but not cloxacillin . This band most likely represented TEM-1 . The other band correlated with a pI of 8.9 and was inhibited by cloxacillin but not by clavulanic acid . This band most likely represented the chromosomal AmpC of C . freundii (data not shown) . No bands were detectable when extract from E . coli Top 10 was used .

The relative hydrolysis rates were determined spectrophotometrically by using a 100 µM concentration of each antibiotic, with the exception of ceftazidime, for which the concentration used was 50 µM (15) . The enzyme preparations from both Cf 29 and tCf 29 hydrolyzed cefotaxime (Table 2) . Considering the hydrolysis rate of cephaloridin as 100%, the relative hydrolysis rates for the enzymes prepared from the clinical strain Cf 29 and the E . coli transformant, tCf 29, were comparable, with the highest level of hydrolysis observed for cefotaxime and no hydrolysis detected for ceftazidime . Interestingly, the AmpC ß-lactamase of Cf 29 was not inducible (data not shown) and cefoxitin MICs were 4 µg/ml (Table 1); therefore, hydrolysis due to AmpC of any of the ß-lactams tested would be negligible . This is reflected by the relative rates of hydrolysis observed for the transformant, tCf29, in which CTX-M-30 was the only ß-lactamase present .

 
The plasmid encoding bla_CTX-M-30 most likely does not encode the genes required to transfer the plasmid, due to the small size of the plasmid . Self-transmissible plasmids encode tra genes as well as other genes required for transfer which require at least 15 kb of coding region (6, 8) . These data, taken together with all the nucleotide changes (both those silent and those leading to amino acid changes), suggest the emergence of a novel CTX-M in Canada and not simply the transfer of established CTX-M genes from other countries .

The worldwide expansion of CTX-M-producing strains is a major concern . Therefore, it is important for clinical microbiologists to use both ceftazidime and cefotaxime for detecting ESBL-producing organisms . The use of ceftazidime alone may result in false-negative detection of organisms producing CTX-M ß-lactamases and the unidentified spread of those ESBL producers .

Nucleotide sequence accession number. The bla_-CTX-M-30 gene nucleotide sequence was deposited in the GenBank database with accession number AY292654 .

1. Bauernfeind, A., H . Grimm, and S . Schweighart. 1990 . A new plasmidic cefotaximase in a clinical isolate of Escherichia coli . Infection 18:294-298.
2. Bonnet, R. 2004 . Growing group of extended-spectrum ß-lactamases: the CTX-M enzymes . Antimicrob . Agents Chemother . 48:1-14.
3. Bonnet, R., C . Recule, R . Baraduc, C . Chanal, D . Sirot, C . De Champs, and J . Sirot. 2003 . Effect of D240G substitution in a novel ESBL CTX-M-27 . J . Antimicrob . Chemother . 52:29-35.
4. Bonnet, R., J . L . Sampaio, R . Labia, C . De Champs, D . Sirot, C . Chanal, and J . Sirot. 2000 . A novel CTX-M ß-lactamase (CTX-M-8) in cefotaxime-resistant Enterobacteriaceae isolated in Brazil . Antimicrob . Agents Chemother . 44:1936-1942.
5. Brenwald, N . P., G . Jevons, J . M . Andrews, J . H . Xiong, P . M . Hawkey, and R . Wise. 2003 . An outbreak of a CTX-M-type beta-lactamase-producing Klebsiella pneumoniae: the importance of using cefpodoxime to detect extended-spectrum beta-lactamases . J . Antimicrob . Chemother . 51:195-196.
6. Chatfield, L . K., and B . M . Wilkins. 1984 . Conjugative transfer of IncI1 plasmid DNA primase . Mol . Gen . Genet . 197:461-466.
7. Dutour, C., R . Bonnet, H . Marchandin, M . Boyer, C . Chanal, D . Sirot, and J . Sirot. 2002 . CTX-M-1, CTX-M-3, and CTX-M-14 ß-lactamases from Enterobacteriaceae isolated in France . Antimicrob . Agents Chemother . 46:534-537.
8. Haase, J., R . Lurz, A . M . Grahn, D . H . Bamford, and E . Lanka. 1995 . Bacterial conjugation mediated by plasmid RP4: RSF1010 mobilization, donor-specific phage propagation, and pilus production require the same Tra2 core components of a proposed DNA transport complex . J . Bacteriol . 177:4779-4791.
9. Hanahan, D. 1983 . Studies on transformation of Escherichia coli with plasmids . J . Mol . Biol . 166:557-580.
10. Humeniuk, C., G . Arlet, V . Gautier, P . Grimont, R . Labia, and A . Philippon. 2002 . ß-Lactamases of Kluyvera ascorbata, probable progenitors of some plasmid-encoded CTX-M types . Antimicrob . Agents Chemother . 46:3045-3049.
11. Moland, E . S., J . A . Black, A . Hossain, N . D . Hanson, K . S . Thomson, and S . Pottumarthy. 2003 . Discovery of CTX-M-like extended-spectrum ß-lactamases in Escherichia coli isolates from five U.S . states . Antimicrob . Agents Chemother . 47:2382-2383.
12. National Committee for Clinical Laboratory Standards. 2004 . Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically: Approved Standard M7-A4 . National Committee for Clinical Laboratory Standards, Wayne, Pa.
13. Pitout, J . D., N . D . Hanson, D . L . Church, and K . B . Laupland. 2004 . Population-based laboratory surveillance for Escherichia coli-producing extended-spectrum ß-lactamases: importance of community isolates with bla_CTX-M genes . Clin . Infect . Dis . 38:1737-1741.
14. Pitout, J . D., M . D . Reisbig, E . C . Venter, D . L . Church, and N . D . Hanson. 2003 . Modification of the double-disk test for detection of Enterobacteriaceae producing extended-spectrum and AmpC ß-lactamases . J . Clin . Microbiol . 41:3933-3935.
15. Pitout, J . D., K . S . Thomson, N . D . Hanson, A . F . Ehrhardt, E . S . Moland, and C . C . Sanders. 1998 . ß-Lactamases responsible for resistance to expanded-spectrum cephalosporins in Klebsiella pneumoniae, Escherichia coli, and Proteus mirabilis isolates recovered in South Africa . Antimicrob . Agents Chemother . 42:1350-1354.
16. Sanders, C . C., W . E . Sanders, Jr., and E . S . Moland. 1986 . Characterization of ß-lactamases in situ on polyacrylamide gels . Antimicrob . Agents Chemother . 30:951-952.
17. Tzouvelekis, L . S., E . Tzelepi, P . T . Tassios, and N . J . Legakis. 2000 . CTX-M-type beta-lactamases: an emerging group of extended-spectrum enzymes . Int . J . Antimicrob . Agents 14:137-142.
18. Yamasaki, K., M . Komatsu, T . Yamashita, K . Shimakawa, T . Ura, H . Nishio, K . Satoh, R . Washidu, S . Kinoshita, and M . Aihara. 2003 . Production of CTX-M-3 extended-spectrum beta-lactamase and IMP-1 metallo beta-lactamase by five Gram-negative bacilli: survey of clinical isolates from seven laboratories collected in 1998 and 2000, in the Kinki region of Japan . J . Antimicrob . Chemother . 51:631-638.

Free Online Full-text Article

What Is Fermentation?, What Is Antibiotic?, What Is Nitrification?, What Is Yeast?, What Is Listeria Monocytogenes?, i, Bacterium, c, Microbes, e, Microbe, s, Bacteria, r, Bacteriology, o, Neisseria, e, Bacillus, o, Yeasts, n, Escherichia coli, n, Bacillus anthracis, e, Antimicrobial, o, Antimicrobial, n, Antimicrobials, c, Staphylococcus aureus, o, Gram negative, e, Bacteria, a, Culture medium, a, Botulism, c, Fermentations, i, Prokaryotes, s, Bactericidal, a, Antimicrobial, o, Yeasts, s, Culture medium, r, Cell cultures, i, Escherichia coli




 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005