Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Molecular Microbiology. 50(2):609-621, October 2003

Heat and  DNA damage induction of the  LexA -like regulator  HdiR  from Lactococcus lactis  is mediated by  RecA and  ClpP

Kirsi Savijoki, Hanne Ingmer, Dorte Frees, Finn K. Vogensen, Airi Palva and Pekka Varmanen

SUMMARY

The SOS response is a paradigm for bacterial cells response to DNA damage. Yet some bacteria lack a homologue of the SOS regulator, LexA, including the Gram-positive, Lactococcus lactis. In this organism we have identified a negative transcriptional regulator, HdiR that induces target gene expression both upon DNA damage and heat shock. Gel mobility shift assays revealed that the binding site for HdiR is located within an inverted repeat structure. HdiR is able to carry out a self-cleavage reaction in vitro at high pHs, while in vivo it undergoes RecA-dependent self-cleavage in the presence of a DNA-damaging agent. Intriguingly, the N-terminal cleavage product of HdiR retains DNA binding activity, and only when degraded by the Clp protease, is gene expression induced. Thus, the activity of HdiR in response to DNA damage is controlled by sequential proteolysis, involving self-cleavage and Clp-dependent degradation of HdiR. During heat-stress, limited self-cleavage occurs; however, recA and clpP are still required for full induction of target gene expression. Thus, our data show that common elements are involved in both the DNA damage and the heat-mediated induction of the HdiR regulon.

INTRODUCTION

The ability to repair DNA is a basic feature of all living organisms. DNA fdamage induces the expression of genes involved in DNA replication, repair and mutagenesis (reviewed in Friedberg et al., 1995), and while the error-free pathway repairs most lesions, the elimination of some lesions is inherently mutagenic (SOS mutagenesis) (reviewed in Walker et al., 2000; Woodgate, 2001). Extensive studies of the Gram-negative bacterium Escherichia coli have established the current paradigm of the SOS response. Under physiological conditions, the SOS regulon is repressed by the LexA bound to its consensus binding sites located in the promoter regions of target genes including lexA itself, recA and the umuDC operon (Friedberg et al., 1995; Fernandez de Henestrosa et al., 2000; Courcelle et al., 2001). Upon DNA damage, RecA binds to single-stranded DNA regions generated by replication blocks, which leads to the formation of a nucleoprotein filament (RecA*) (Kowalczykowski, 1991). The activated RecA* possesses recombinase and co-protease activities (Kowalczykowski et al., 1994), the latter being required for self-cleavage of LexA, the SOS mutagenesis protein UmuD and several phage repressor proteins (Little, 1984; 1991; Kim and Little, 1993). The RecA*-promoted self-cleavage occurs between the Ala84 and Gly85 residues of LexA resulting in inactivation of the repressor activity and induction of the SOS regulon (Little, 1984) . In the absence of RecA*, LexA is cleaved at high pH demonstrating that the protein is truly able to perform self-cleavage (Little, 1991; Smith et al., 1991).

Most of the SOS mutagenesis is caused by the DNA polymerase V encoded by the umuDC operon(Tang et al., 1998; 1999; Reuven et al., 1999). When the replication fork encounters a lesion that cannot be repaired, error-prone replication across the replication block is required and DNA PolV performs the translesion synthesis (Pham et al., 2001). The PolV complex consists of one molecule of UmuC together with two molecules of activated UmuD (UmuD') that arises from self-cleavage of the native UmuD in a reaction resembling the self-cleavage of LexA (Burckhardt et al., 1988). Because the activity of the PolV is mutagenic, elaborate mechanisms are employed to keep the level of the Umu proteins to a minimum (Woodgate and Levine, 1996; Smith and Walker, 1998). At the transcriptional level, expression of the umuDC operon is tightly regulated by the LexA, while at the post-translational level the amount of the mutagenically inactive and active forms of the UmuD are controlled by the Lon and ClpXP proteases, respectively (Frank et al., 1996; Gonzalez et al., 1998; 2000) . The ClpXP complex, which consists of a proteolytic subunit, ClpP, associated with the ClpX ATPase, is also involved in the degradation of the self-cleaved fragments of LexA (Flynn et al., 2003). In a very recent report, the degradation of the N-terminal fragment of LexA by the ClpXP has been shown to be important for survival of E. coli during DNA damage, which was suggested to be a result of retention of some repressor activity (Neher et al., 2003)

In organisms other than E. coli, the induction and regulation of the SOS response pathways are less well understood. SOS-like responses have been detected in several bacteria and the LexA homologues characterized to date appear to be functionally conserved (reviewed in Eisen and Hanawalt, 1999). However, the composition, as well as the regulation of the LexA regulon, exhibits great diversity (reviewed in Eisen and Hanawalt, 1999; Campoy et al., 2002). In the Gram-positive Bacillus subtilis, the induction of the SOS response occurs basically in a manner analogous to E. coli (Raymond-Denise and Guillen, 1991; 1992), but during competence development ComK can alleviate LexA repression of recA gene expression without displacing LexA (Haijema et al., 1996; Hamoen et al., 2001). This process is controlled by proteolysis of ComK by the ATP-dependent proteolytic complex ClpCP complex, which consists of the ATPase ClpC and ClpP (Turgay et al., 1998). The ClpCP protease also degrades the heat shock regulator CtsR in B. subtilis (Krüger et al., 2001). Besides the LexA in E. coli, the regulators such as the cell-cycle regulator protein CtrA in Caulobacter crescentus (Jenal and Fuchs, 1998) and the transcriptional activator PopR in Streptomyces lividans (Viala and Mazodier, 2002) have also been shown to be substrates for ClpP. However, less is known about the ClpP-mediated degradation in terms of gene regulation in other prokaryotes.

In the present study, we have identified a novel LexA-like repressor, HdiR, from the Gram-positive bacterium, Lactococcus lactis that co-operates the response to both DNA damage and heat shock in a single regulatory molecule.

RESULTS

Identification of HdiR from Lactococcus lactis ssp. cremoris MG1363

In search of substrate proteins for the L. lactis Clp protease, we examined whether the L. lactis ssp. cremoris MG1363 genome encodes a homologue of UmuD. Western blot analysis using a polyclonal antibody raised against E. coli UmuD showed that L. lactis MG1363 does not encode a close homologue of UmuD (data not shown). Furthermore, a search of the L. lactis ssp. lactis IL1403 genome sequence failed to reveal an umuD gene, although genetic evidence has established that UmuC is present in L. lactis IL1403 (Bolotin et al., 2001). However, when we did the search using an UmuD-like protein encoded by the Tn5252 transposon element present in the Streptococcus pneumoniae genome (Munoz-Najar and Vijayakumar, 1999), we retrieved a protein (YnaB) with 32% identity (Bolotin et al., 2001). The region of the highest similarity is centred on the three conserved domains typical of the LexA-family of proteins, including LexA, UmuD, MucA, RumA and cI-like phage repressors (Little, 1984; Perry et al., 1985; Kulaeva et al., 1995). The amino acids Ala84, Gly85, Ser119 and Lys156 involved in the RecA-dependent self-cleavage of the E. coli LexA (Little, 1984; Slilaty and Little, 1987) are also conserved in the IL1403 YnaB (Ala126, Gly127, Ser160, Lys200) (data not shown). Distinct from the transposon UmuD, YnaB carries a putative N-terminal helix-turn-helix motif (HTH) and is therefore classified as a putative transcription regulator (Bolotin et al., 2001). Thus, based on the sequence analysis YnaB has resemblance to both LexA and UmuD. Notably, a blast search against the IL1403 genome suggests that L. lactis is devoid of conserved LexA (data not shown).

In order to characterize YnaB further, we sequenced the gene encoding the YnaB orthologue from MG1363, and based on our subsequent studies, it was named as a heat shock and DNA-damage induced regulator (hdiR). The hdiR gene encodes a protein of 252-amino-acid residues with a calculated molecular mass of 28.7 kDa. The deduced amino acid sequence of HdiR shares 90% identity with the YnaB from IL1403 and homologues are present in species of Streptococcus and Staphylococcus (data not shown). Although, these uncharacterized proteins share only 26-32% overall amino acid identity with the HdiR, the amino acids, flanking the residues typical for self-cleavage of LexA proteins, are conserved and they all contain an N-terminal HTH motif. Multiple alignments of HdiR homologues and LexA proteins are presented as Supplementary material (Fig. S1).

In L. lactis MG1363, the hdiR gene is preceded by a putative conserved prokaryotic vegetative promoter, a ribosome binding site (S.D.), as well as two inverted repeats (Fig. 1A). The more distant inverted repeat 2 (IR2) resembles a typical rho-independent type transcription terminator that presumably terminates expression of the upstream located ynaC (Fig. 1A). The proximal inverted repeat 1 (IR1) is located two nucleotides upstream of the putative 35 region. No apparent transcription terminator structures were identified immediately downstream of hdiR, suggesting that hdiR forms a dicistronic operon together with the downstream located ynaA gene (data not shown).

hdiR expression is regulated by heat and DNA damage in L. lactis MG1363

In E. coli, autoregulated expression of LexA is induced by DNA damaging conditions (Brent, 1982). Because HdiR resembles LexA, we examined whether the DNA cross-linking agent, mitomycin C (MMC), induces HdiR expression. Northern blot analysis of the L. lactis MG1363 revealed a single hdiR-specific transcript of 1.0 kb, indicating that hdiR (756 bp) forms a dicistronic operon with the ynaA gene (200 bp) that locates downstream of hdiR (data not shown). Furthermore, hdiR expression in MG1363 was induced 15-fold by 20 min exposure to MMC (Fig. 2A).

We also examined if hdiR is induced by other environmental conditions, such as heat shock at 38.5°C, cold shock at 10°C, low pH (pH 4.0) or sodium chloride (1.5%) and observed that only heat-shock affected hdiR expression (data not shown). While the optimum of hdiR expression in the presence of MMC is reached between 15 and 30 min (data not shown), an 15-fold induction was already reached 5 min after shifting the cells to elevated temperature (Fig. 2B). Curiously, prolonged incubation at an elevated temperature showed that hdiR expression was re-repressed back to the level prior to induction already after 20 min. In the presence of MMC, however, the level of hdiR expression was still six times the un-induced level after 60 min (Fig. 2A and B).

HdiR is a DNA-binding protein that regulates its own expression

In order to determine if hdiR expression is autoregulated, we constructed a mutant strain (PV114) that expresses a derivative of HdiR (HdiR') lacking the HTH motif potentially involved in DNA binding. Northern blot analysis revealed that in the absence of DNA damage, hdiR' expression was increased 20-fold compared with the level in wild-type (wt) cells, and it was unaffected by DNA damage (Fig. 2A). As these results suggested that hdiR expression is autoregulated, we used a mobility shift assay to examine if HdiR is able to bind to its promoter region. To this end, we purified HdiR from E. coli cells expressing a histidine-tagged derivative of HdiR (data not shown). When HdiR was incubated with a DNA fragment covering 221 to +5 relative to the hdiR start codon, we found that increasing amounts of HdiR retarded the mobility of the fragment (Fig. 3A, lanes 1-3). When we performed the assay with a fragment covering the region 372 to 82 relative to the translation start site, HdiR binding was completely abolished (data not shown), indicating that HdiR binds a site located between IR2 and the hdiR start codon. Following cloning of IR1 and IR2 sequences as 22 bp fragments into pBluescript-II SK+, we observed that only the IR1 containing DNA was retarded by HdiR (Fig. 3B). Thus, IR1 contains the target sequence of HdiR.

HdiR regulates the expression of UmuC in L. lactis

With the aim of identifying genes in the HdiR regulon, we used a proteomic approach to find proteins, whose expression was changed in PV114 compared with those expressed in MG1363. However, we were unable to detect any changes in the overall protein patterns between the wt and the PV114 mutant strains when cells were grown in a chemically defined media at 30°C and pulse labelled with [³⁵S]-methionine followed by separation of proteins by two-dimensional protein gel electrophoresis (data not shown). Alternatively, we searched the IL1403 genome sequence databank ( http://spock.jouy.inra.fr/ ) with the IR1 core motif (ATCAGW₅CTGAT) and found an almost identical sequence that partially overlaps the putative 10 region of the umuC gene (Fig. 1B). Southern analysis of MG1363 with a probe derived from the IL1403 umuC gene indicated that MG1363 is devoid of an umuC homologue (K. Savijoki, unpubl. data). Therefore, we examined if HdiR binds to the umuC promoter region amplified from the IL1403 genome. In gel retardation experiments, HdiR, indeed, retarded the 252 bp fragment carrying the IL1403 umuC promoter (Fig. 3A, lanes 7-9). To confirm that HdiR regulates umuC expression in vivo, we introduced a plasmid carrying the IL1403 umuC structural gene and its putative promoter region (pKS50) into wt (MG1363) and PV114 cells to obtain PV121 and PV122 respectively. When PV121 and PV122 were treated with MMC, Northern blot analysis revealed two umuC-specific transcripts (2.4 kb and 1.4 kb), which both were induced by MMC in wt cells (PV121) and only marginally (<1.5-fold) in the strain encoding HdiR' (PV122) (Fig. 2C). However, in the absence of MMC, the expression of both umuC transcripts were 4.4-fold higher in PV122 compared with PV121, showing that HdiR regulates the expression of umuC from IL1403.

In many bacteria, LexA regulates the expression of recA (Friedberg et al., 1995). Therefore, we investigated if HdiR binds to the recA promoter region of IL1403. However, we were unable to detect such a binding (Fig. 3A, lanes 4-6). Furthermore, Northern blot analysis showed that expression of recA was identical in MG1363 and PV114 indicating that HdiR is not a repressor of recA expression (data not shown).

Cleavage of HdiR is stimulated by RecA

A cardinal feature of the members of the LexA protein family is their ability to perform self-cleavage in vivo requiring an activated form of RecA, while self-cleavage occurs spontaneously in vitro at high pH (Little, 1991). To investigate if HdiR undergoes pH-dependent self-cleavage, we incubated the purified His₆-HdiR protein at various pHs and observed that self-cleavage of His₆-HdiR proceeded spontaneously at pH 8.0-10, resulting in two products of 14 and 16 kDa respectively. After raising polyclonal antibodies against His₆-HdiR protein, we analysed the cleavage products by Western blot analysis and did not detect any additional protein bands (Fig. 4B). N-terminal sequence analysis of the smaller C-terminal cleavage product revealed a sequence, Gly-Phe-Gln-Thr-Ala-Asn, showing that the cleavage had occurred between the Ala126 and Gly127 residues.

Next, we examined if RecA stimulates HdiR self-cleavage in vivo. However, the chromosomally expressed HdiR was not detectable by Western blot analysis, either in the presence or absence of heat or MMC (data not shown). Therefore, we facilitated the detection by overexpressing HdiR from a plasmid carrying the hdiR gene inserted behind a constitutive promoter. The resulting plasmid, pKS49, was transferred into wt and the recA mutant VEL1122 (Duwat et al., 1995a) to obtain the strains KS78 and KS80 respectively. Subsequently, we examined the stability of HdiR under DNA damaging conditions by exposing both strains to MMC followed by inhibition of protein synthesis by chloramphenicol (CAM). At the time points indicated, protein extracts were analysed by Western blot analysis (Fig. 5A). The result revealed that in the strain lacking RecA (KS80), the amount of HdiR remained unaltered 45 min after the addition of CAM, whereas HdiR was rapidly cleaved in the presence of RecA, leaving essentially no unprocessed HdiR 30 min after blocking the protein synthesis. These results show that the self-cleavage of HdiR in vivo is dependent on the RecA.

Because hdiR is induced by heat, we next investigated if RecA-mediated self-cleavage of HdiR occurs also under heat-stress conditions. When the in vivo stability of HdiR was analysed as described above, we found that the amount of intact HdiR in the wt (KS78) cells decreased, albeit slowly, after the addition of CAM, whereas HdiR remained stable in the recA mutant cells (KS80) (Fig. 5C). Furthermore, we were unable to detect the cleavage products in recA mutant cells, whereas a small amount of 14 kDa fragment appeared in samples obtained from the wt cells (Fig. 5C), indicating that self-cleavage of HdiR occurs also under heat-shock conditions. However, because only a low level of self-cleavage appears to take place during heat-stress, we wished to determine if recA plays a role in inducing hdiR expression under these conditions. When we examined hdiR expression in the recA mutant cells, we found, as expected, that induction by MMC was eliminated in the absence of RecA (see Fig. 7C). We also observed that induction by heat was completely abolished in cells lacking RecA, demonstrating that RecA, indeed, is required for heat induction of hdiR.

ClpP modulates HdiR activity

According to several independent Northern analyses the maximum induction level of hdiR expression is reached between 15 and 30 min after addition of MMC (data not shown). When comparing the relatively slow induction of hdiR expression in response to MMC (Fig. 2A) with the rapid self-cleavage of overexpressed HdiR under the same conditions (Fig. 5A), the results suggested that cleavage of HdiR might not be sufficient to induce expression. Therefore, we examined the DNA binding activity of self-cleaved HdiR. Interestingly, HdiR incubated overnight at pH 10 was still capable of retarding the hdiR and umuC promoter fragments in the gel-shift assay (Fig. 6A and B, lanes 4 and 5), where the migration of the DNA-protein complex was faster compared with the reactions containing equal amounts of HdiR incubated at pH 7 (Fig. 6A and B, lanes 2 and 3). These results show that HdiR cleavage products are still able to bind the target sequence.

When observing self-cleavage of HdiR in vivo, we had noted that only the 14.5 kDa N-terminal cleavage product was visible and that this product also appeared unstable (Fig. 5A). Given the resemblance of HdiR to LexA and UmuD, which both, after processing, are targets of the Clp proteolytic complex, we examined HdiR stability in a strain lacking ClpP (Frees and Ingmer, 1999). After MMC addition, we found that the half-life of unprocessed HdiR was increased 30% in the absence of ClpP compared with the wt cells (Fig. 5A). Furthermore, in the clpP mutant, both of the HdiR cleavage products were visible (Fig. 5A and B), and while the half-life of the 14.5 kDa fragment in the wt cells was 22 min ± 2min (determined between 15 and 60 min), this fragment was not degraded in the clpP mutant cells (Fig. 5B). These results show that both of the HdiR cleavage products are targets of the Clp protease.

Next, we studied the effect of ClpP on HdiR stability after heat shock and saw that while the amount of the HdiR decreased in the wt cells, no significant change was detected in cells lacking ClpP (Fig. 5C). Additionally, a faint band at 14 kDa could be detected in all the time points of the wt cells, while in the clpP mutant strain it was only detected in the sample withdrawn 45 min after the addition of CAM.

In order to confirm that ClpP modulates the activity of the HdiR in vivo, we analysed hdiR expression by Northern analysis of the wt and clpP mutant strains. The result demonstrates that in the absence of ClpP the induction of the hdiR expression in response to MMC (Fig. 7A) and heat (Fig. 7B) was reduced fourfold compared with the induction obtained in the wt cells. Thus, cells lacking ClpP are restricted in their ability to induce the HdiR regulon demonstrating that ClpP modulates its activity in vivo.

HdiR is required for optimal growth of MG1363

Because our data demonstrated that HdiR activity is modulated by heat and MMC, we wished to determine if HdiR is important for viability under these conditions. Therefore, we attempted to construct a deletion mutant lacking the entire hdiR reading frame. However, our repeated attempts for creating such a strain have been unsuccessful. Alternatively, we examined the ability of the wt and PV114 mutant cells to grow in the presence and absence of MMC and at an elevated temperature (37°C), and found no difference in the colony forming ability between the two strains. However, PV114 generally required longer time of incubation to form colonies of same size as MG1363 under all conditions tested (data not shown). PV114 was complemented with a plasmid (pKS47) encoding HdiR, but not the downstream encoded YnaA, to obtain KS74. pKS47 was also introduced into MG1363 yielding KS73. The growth rates of the KS73, KS74 and their parental strains (MG1363, PV114) carrying the vector, pCI372, were measured using the Bioscreen monitoring system. The results from the growth experiments carried out at 30°C without MMC using five parallel samples revealed that while the doubling time for MG1363(pCI372) was 59.1 min (SD 1.66), it was increased in PV114(pCI372) to 78.2 min (SD 2.26). When the strains were cultivated at an elevated temperature (37°C), the PV114(pCI372) failed to initiate growth, whereas the KS74 and KS73 and MG1363(pCI372) grew exponentially with the generation times 149.8 min (SD 10.91), 138.2 min (SD 4.97) and 152.8 min (SD 4.57) respectively. These results show that when HdiR lacks the HTH domain, the strain has a growth defect, which abolishes growth at a high temperature under the conditions used.

DISCUSSION

In bacterial cells, DNA damage response relies on LexA-like transcriptional regulators, which in the absence of DNA damage bind to DNA sequences located upstream of target genes, and upon DNA damage undergo RecA-mediated self-cleavage to relieve the repression of target gene expression (Little and Mount, 1982; Little, 1984; Kim and Little, 1993). We have characterized a transcriptional regulator, HdiR, from the Gram-positive bacterium, Lactococcus lactis that possesses several LexA-like features including negative auto-regulation of its own synthesis, induction by MMC and self-cleavage between the conserved Ala and Gly residues. Prior to LexA-like self-cleavage, RecA binds to single-stranded DNA regions, while polymerizing into a nucleoprotein filament. This change enables RecA to act as co-protease in the self-cleavage reactions of LexA, UmuD and phage repressor proteins (Little and Mount, 1982; Little, 1984; Kim and Little, 1993). Thus, a similar activation of RecA is likely to precede the HdiR self-cleavage.

When the stability of the overexpressed HdiR was assessed in wt cells exposed to MMC, only the larger, N-terminal part of the two HdiR cleavage products was visible and the half-life of this fragment was 22 min. However, in the absence of clpP encoding the proteolytic subunit of the Clp protease complex (Maurizi et al., 1990), both of the cleavage products were stabilized suggesting they are targets of this protease. Curiously, we also noted that the clpP mutation essentially abolished the induction of hdiR expression by MMC, indicating that the N-terminal HdiR cleavage product carrying the HTH motif retained its DNA binding ability. This notion was confirmed by gel retardation studies, where the cleaved HdiR retarded both the hdiR and the umuC promoter fragments. The Clp proteolytic complex has previously been implicated in the degradation of self-cleavage products. The UmuD' is rapidly degraded by the ClpXP to avoid excess mutagenesis (Frank et al., 1996) and in very recent studies also the products of self-cleaved LexA are shown to be substrates for the ClpXP protease (Flynn et al., 2003; Neher et al., 2003). Thus, the Clp proteolytic complex appears to play a conserved role in turnover of self-cleaved protein products. In the case of HdiR, the Clp proteolytic complex regulates the DNA damage response, as the N-terminal cleavage product can still repress gene expression, and only when degraded by ClpP, is the response to DNA damage induced. The deleterious effect of accumulation of the LexA DNA-binding domain to cell survival after DNA damage suggests a similar regulatory mechanism in E. coli (Neher et al., 2003)

In addition to MMC, hdir expression is also induced by heat. Although HdiR was unstable (half-life 20 min) under these conditions, it was threefold more stable than in the presence of MMC. However, an 15-fold induction of hdiR expression was achieved already 5 min after applying of heat-shock, whereas 20 min were needed to reach the same level when cells were stressed with MMC, suggesting that the stability of HdiR does not play a crucial role in de-repressing the HdiR regulon under heat-stress. However, induction of hdiR expression by heat was completely eliminated in the recA mutant cells and was greatly reduced in the absence of clpP, demonstrating that both RecA and ClpP are clearly important for the heat-shock induction. Although additional proteins may be involved in this regulation, our data show that common elements are involved in both the DNA damaged induced and the heat-mediated induction of the HdiR regulon.

LexA homologues are present in a number of bacteria (Eisen and Hanawalt, 1999), particularly in those with larger genomes (Koonin et al., 2000). Curiously, Staphylococci contain both HdiR and LexA homologues (Kuroda et al., 2001), suggesting that the two proteins have separate biological functions. However, Lactococcus and Streptococcus species appear to be devoid of LexA and, thus, HdiR could be the DNA damage response regulator in these organisms. To address this issue, we made several attempts to identify HdiR target genes; however, we only identified hdiR in L. lactis MG1363, while umuC is a target for HdiR in L. lactis IL1403. In addition, we specifically examined if recA expression is repressed by HdiR, but did not detect any differences in the expression between the wt and PV114 mutant cells expressing HdiR'. Based on a recent study, where it was shown that LexA from Rhodobacter sphaeroides functions both as a repressor and as an activator of gene expression (Tapias et al., 2002), we also examined if HdiR is a positive regulator of recA expression. After exposing wt and hdiR mutant cells to MMC, we found that recA was only slightly induced (twofold), and that this induction was slightly reduced in cells carrying HdiR' lacking the HTH domain (data not shown). Thus, HdiR has only a marginal effect on recA expression.

When we examined the phenotype of the mutant cells expressing HdiR', we found that they were as resistant as the wt cells to MMC, but were unable to grow at high temperature. Therefore, the timely expression of a gene controlled by HdiR appears to be required for growth at high temperatures. However, to understand the physiological significance of the results we need more information on the HdiR regulon. In this paper, we have shown that the N-terminal half of HdiR remains active following self-cleavage. Interestingly, the C-terminal half of the protein was found to be highly unstable and only detected in cells lacking ClpP, indicating that it might also harbour an important biological function.

In our study, we have identified a novel type transcriptional regulator whose expression responds to both DNA damage and heat-stress. A link between the response to heat shock and DNA damage in L. lactis has previously been suggested by the findings that disruption of the L. lactis recA gene results in temperature sensitivity (Duwat et al., 1995a,b), and this sensitivity is suppressed by disruption of a gene, trmA (Duwat et al., 1999), which also suppresses the temperature sensitivity of a clpP mutation (Frees et al., 2001). Our present findings suggest that HdiR may be such a link.

FIGURES

Fig. 1. Partial nucleotide sequence of the MG1363 hdiR region.
A. DNA sequence of the putative regula...

Fig. 2. Northern analysis of hdiR and umuC expression.
A. hdiR expression in MG1363 and PV114 cells b...

Fig. 3. DNA binding of HdiR.
A. The binding of the His₆-HdiR to the putative promoter regions of the ...

Fig. 4. pH-dependent cleavage of the His₆-HdiR in the pH range of 6.0 to pH 10.
A. Visualization of th...

Fig. 5.  In vivo stability of the HdiR.
A. KS78, KS79, and KS80 cells treated with MMC (3 µM) followed b...

[Full Size]

Fig. 6. Effect of self-cleavage on DNA binding of the His₆-HdiR. Prior to gel mobility shift assay, Hi...

Fig. 7. Northern analysis of hdiR expression in MG1363 and mutant cells under DNA-damaging and heat-st...

 
Table 1. Bacterial strains and plasmids.

EXPERIMENTAL PROCEDURES

Bacterial strains, plasmids, oligonucleotides and culture conditions

Strains and plasmids used in this study are listed in Table 1. The oligonucleotides used are provided as Supplementary material (Table S1). L. lactis strains were grown in M17 medium (Terzaghi and Sandine, 1975) at 30°C supplemented with 0.5% glucose (GM17). When needed, chloramphenicol (6 µg ml ¹) or tetracycline was added in growth media. E. coli strains were cultivated at 37°C in Luria-Bertani (LB) medium (Sambrook et al., 1989) supplemented with ampicillin (50-100 µg ml ¹) and/or kanamycin (25 µg ml ¹).

Strain constructions

A replacement recombination technique was used to construct the MG1363 mutant strain carrying a 64 bp in-frame deletion in the hdiR gene to express HdiR without the putative HTH motif. For this purpose, PCR products generated with primers p15/p16 and p17/p18, respectively, were digested with XbaI/PstI and PstI/SalI, respectively, and ligated with XbaI/SalI cut pGhost8 (Maguin et al., 1996). The resulting plasmid, pKS46, encoding two additional Ala residues at the deletion site in hdiR was introduced into MG1363 followed by plasmid integration and excision as described by Biswas et al. (1993). The mutant strain carrying an in-frame deletion in hdiR was assigned as PV114.

The PV114 strain was complemented by cloning the PCR amplified hdiR gene region excluding the downstream located ynaA with primers p19 and p20 as a XbaI-SalI fragment (1 kb) on pCI372 (Hayes et al., 1991) . The resulting plasmid pKS47 was used to transform MG1363 and PV114 to obtain KS73 and KS74 respectively.

An umuC expression system in MG1363 and PV114 was created by amplifying the umuC region from IL1403 using the primer pair p33/p34 and cloning the resulting 1.78 kb PCR-product as a BamHI-EcoRI fragment on pCI372. The resulting plasmid pKS50 was used to transform MG1363 and PV114 to get PV121 and PV122 respectively.

An overexpression system for the HdiR in MG1363 and mutant derivatives was created as follows. The hdiR structural gene (0.8 kb) and the ctsR promoter without the probable CtsR-binding region (130 bp) (Varmanen et al., 2000) were generated by PCR using the primer pairs p32/p18 and p30/p31 respectively. P _ctsR and hdiR fragments were digested with EcoRI/BamHI and BamHI/SalI, respectively, ligated with EcoRI-SalI cut pCI372. The resulting plasmid pKS49 was transferred into MG1363, DF clpP (Frees et al., 2001) and VEL1122 (Duwat et al., 1995a) to get KS78, KS79 and KS80 respectively.

Molecular cloning techniques were performed essentially as described by Sambrook et al. (1989).

Identification of the hdiR gene from MG1363

The internal gene fragment of the hdiR (667 bp) was amplified from MG1363 using the primer pair p1/p2 and cloned on pCR2.1 (pKS36) in the E. coli TOP10F'strain. The 5' region of the hdiR was obtained by PCR using primer p3 designed according to the predicted protein sequence of the ynaD that locates 1.9 kb upstream of the ynaB in IL1403, and the hdiR sequence specific primer p5. The 3' region was generated using the primer p4 designed according to the predicted protein sequence of the rplJ that locates 200 bp downstream of the ynaB in IL1403, and the hdiR sequence specific primer p6. The resulting PCR fragments were sequenced using a set of sequence specific primers in reaction conditions specified by the Thermosequenase fluorescent labelled primer cycle sequencing kit (Pharmacia Biotech). Reactions were analysed using an ALFexpress DNA sequencer (Pharmacia Biotech). The gene region of hdiR has been submitted to the DDBJ/EMBL/GenBank databases under the Accession Number AJ557822.

Sequence comparisons were accomplished using the National Center for Biotechnology Information (NCBI) blast2 network server at http://www.ncbi.nlm.nih.gov/ blast.

RNA extraction and Northern blotting analyses

Total RNA was isolated from L. lactis strains grown exponentially at 25°C or 30°C to an optical density OD₆₀₀ = 0.3-0.4, where they were either heat stressed by transferring from 25°C to 38.5°C, or kept at 30°C and treated with 3 µM MMC. Cell samples were withdrawn at the time intervals of 0, 5, 20 or 45 min when incubated at 38.5°C and 0, 20, 40 and 60 min when incubated with MMC. RNA isolation, blotting and hybridization with radiolabelled probes were carried out as described elsewhere (Pelle and Murphy, 1993; Varmanen et al., 2000). The DNA probes for the clpP (366 bp) and recA (750 bp) genes from MG1363 and the umuC gene (569 bp) from IL103 were generated by PCR using the primer pairs p11/p12, p7/p8 and p9/p10 respectively. The 667 bp hdiR-specific probe was cut out from the pKS36 by EcoRI digestion. Membranes were scanned using the GS-525 Molecular Imager System (Bio-Rad) and quantified using Quantity One (Version 4.2.1, Bio-Rad). RNA amounts on the membrane were corrected by probing the membranes with a probe specific for L. lactis 16S rRNA.

Characterization of the PV114 strain

Colony forming ability of the wt (MG1363) and PV114 strains, with or without MMC (0.1-3 µg ml) was studied by plating assay described by Frees et al. (2001). Comparison of the growth rates at 30°C and 37°C was carried out using the Bioscreen C-monitoring system (Transgalactic Ltd). Each well contained 300 µl growth medium inoculated with 0.1% of an overnight culture grown at +30°C.

Complementation of the PV114 strain with pKS47 was analysed using the Bioscreen C-monitoring system. Shortly, PV114 and MG1363 containing the pCI372 (control strains) and the KS74 (PV114/pKS47) and the KS73 (MG1363/pKS47) were cultivated at 30°C and at 37°C as described above.

Overexpression and purification of the HdiR

The hdiR coding region was amplified using primer pair p21/p22, digested with BamHI and SalI followed by cloning in the respective sites in pQE30 (Qiagen). His₆-HdiR was purified from E. coli M15[pREP4] carrying the pQE-6His-hdiR according to the standard procedure recommended by Qiagen. The purified His₆-HdiR was used for custom antibody production in rabbits and DNA gel mobility shift experiments.

Gel mobility shift

DNA fragments corresponding to the putative promoter regions of the hdiR (206 bp) from MG1363, umuC (252 bp) and recA (155 bp) from IL1403 were generated by PCR using primer pairs p23/p24, p26/p27 and p28/p29 respectively. The hdiR upstream region containing the IR2, but not the IR1, was amplified using primers p15 and p25. Oligonucleotide pairs 5'-CTAGTTTATCAGTTTATCTGATAAAA-3'/5'-AATTTT TTATCAGATAAACTGATAAA and 5'-CTAGAAACCACTGT T A T CAGTGGTTT-3'/5'-AATTAAACCACTGATAACAGT G GT TT-3' where annealed (overhangs are shown in italics), treated with T4 polynuclotide kinase and ligated with XbaI-EcoRI cut pBluescript-II SK+ to obtain pBluescript-IR1 and pBluescript-IR2 respectively. The M13 rev and M13 uni primers were used to amplify 230 bp fragments from pBluescript-IR1 and pBluescript-IR2 for gel mobility assay.

The reactions (15 µl) were assembled by mixing the PCR-amplified fragment (35 ng) and the His₆-HdiR (0-28 ng) in the gel shift buffer (20 mM Tris-HCl, pH 7.5, 50 mM KCl, 40 mM NaCl, 10 mM MgCl₂, 0.5 mM DTT, 10% glycerol, 0.1 mg ml ¹ BSA and 1 µg sonicated herring sperm DNA). The effect of autocleavage on DNA binding was studied using His₆-HdiR (12.5 ng and 25 ng) that had been incubated in 50 mM Tris-HCl (pH 7) or 50 mM glycine (pH 10) at room temperature for 16 h. Gel-shift reactions were incubated at 25°C for 15 min followed by electrophoresis on a 5% polyacrylamide gel. Gels were stained with ethidium bromide, scanned with a Fluor-S imager and analysed using QuantityOne-software (Bio-Rad).

Analysis of HdiR self-cleavage

Self-cleavage of the His₆-HdiR was studied in the pH range of 6.0-10 using a buffer system containing either 50 mM Bis-Tris, Tris-HCl or glycine. Briefly, each reaction containing 2 µg (10 µl) of the purified His₆-HdiR was incubated at room temperature for 16 h. The reaction products were separated in a 4-12% SDS-PAGE (Invitrogen) followed by staining with Coomassie Brilliant blue R-250, or transfer to a nitrocellulose membrane (0.45 µm, Bio-Rad) for Western blots with His₆-HdiR antibodies (1:5000) and HRP-conjugated goat anti-rabbit IgG (Bio-Rad) 1:50000. Detection was performed using the SuperSignal West Dura Extended Duration kit according to Pierce. Membranes were scanned on a GS-525 Molecular Imager System (MultiAnalyst, Bio-Rad).

N-terminal sequence analysis

The components from the His₆-HdiR self-cleavage reaction were separated by reversed phase chromatography on a 1.0  20 mm C1 (TSK-TMS250, TosoHaas) column using a linear gradient (0-100% in 60 min) of acetonitrile in 0.1% trifluoroacetic acid. The peaks were automatically collected on a SMART (Pharmacia) liquid chromatograph and subjected to N-terminal sequence analysis using a Procise 494 A sequencer (Perkin-Elmer).

Determination of HdiR stability in vivo

Stability of the HdiR in the presence of MMC was studied by cultivating L. lactis strains at 30°C to OD₆₀₀ = 0.5 followed by the addition of 3 µM MMC and CAM (50 µg ml ¹) after 1 min to block the protein synthesis. Samples were withdrawn at indicated time points and Protease Inhibitor Cocktail (PIC) (Roche) was added prior to centrifugation. HdiR stability under heat stress conditions was studied by shifting exponentially growing (OD₆₀₀ = 0.5) KS78, KS79 and KS80 cells from 25°C to 38.5°C. Protein synthesis was blocked after 5 or 15 min by CAM and samples (15 ml) were withdrawn at indicated times. Cell free extracts were obtained after homogenizing the cells (in 100 mM Tris-HCl pH 7.5, including PIC) with glass beads (Ø 10 µm) and centrifugation. Protein concentrations were determined with the Protein Assay kit (Bio-Rad). An equal amount of the protein (50 µg) was separated in a SDS-PAGE (12%) (Invitrogen) and the HdiR stability was analysed by Western blotting.

ACKNOWLEDGEMENTS

We are grateful to I. Palva for the helpful discussions and critical reading of the manuscript. We would also like to thank R. Woodgate for providing the E. coli UmuD antibodies and N. Kalkkinen for N-terminal sequencing of HdiR self-cleavage products. This work was supported by The NorFA, The Finnish Food Research Foundation, The Wihuri Foundation, The Danish Dairy Research Foundation, The Danish Food Research Programme (FØTEK-2) and The Academy of Finland.

SUPPLEMENTARY MATERIAL

The following material is available from
 
http://www.blackwellpublishing.com/products/journals/ −
suppmat/mmi/mmi3713/mmi3713sm.htm

Fig. S1. Multiple amino acid sequence alignments of HdiR and LexA homologues.

Table S1. Oligonucleotides used in this work.

REFERENCES

•    Biswas, I., Gruss, A., Ehrlich, S.D., and Maguin, E. (1993) High-efficiency gene inactivation and replacement system for gram-positive bacteria. J Bacteriol 0: 3628-3635.

•    Bolotin, A., Wincker, P., Mauger, S., Jaillon, O., Malarme, K., Weissenbach, J., et al. (2001) The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res 11: 731-753.

•    Brent, R. (1982) Regulation and autoregulation by LexA protein. Biochimie 64: 565-569.

•    Burckhardt, S.E., Woodgate, R., Scheuermann, R.J., and Echols, H. (1988) UmuD mutagenesis protein of Escherichia coli, overproduction, purification, and cleavage by RecA. Proc Natl Acad Sci USA 85: 1811-1815.

•    Campoy, S., Mazon, G., Fernandez de Henestrosa, A.R., Llagostera, M., Monteiro, P.B., and Barbe, J. (2002) A new regulatory DNA motif of the gamma subclass Proteobacteria, identification of the LexA protein binding site of the plant pathogen Xylella fastidiosa. Microbiology 148: 3583-3597.

•    Chopin, A., Chopin, M.-C., Moillo-Batt, A., and Langella, P. (1984) Two plasmid determined restriction and modification systems in Streptococcus lactis. Plasmid 11: 260-263.

•    Courcelle, J., Khodursky, A., Peter, B., Brown, P.O., and Hanawalt, P.C. (2001) Comparative gene expression profiles following UV exposure in wt and SOS-deficient Escherichia coli. Genetics 158: 41-64.

•    Duwat, P., Ehrlich, S.D., and Gruss, A. (1995a) The recA gene of Lactococcus lactis, characterization and involvement in oxidative and thermal stress. Mol Microbiol 17: 1121-1131.

•    Duwat, P., Sourice, S., Ehrlich, S.D., and Gruss, A. (1995b) recA gene involvement in oxidative and thermal stress in Lactococcus lactis. Dev Biol Stand 85: 455-467.

•    Duwat, P., Ehrlich, S.D., and Gruss, A. (1999) Effects of metabolic flux on stress response pathways in Lactococcus lactis. Mol Microbiol 31: 845-858.

•    Eisen, J.A., and Hanawalt, P.C. (1999) A phylogenomic study of DNA repair genes, proteins, and processes. Mutat Res 435: 171-213.

•    Fernandez de Henestrosa, A.R., Ogi, T., Aoyagi, S., Chafin, D., Hayes, J.J., Ohmori, H., and Woodgate, R. (2000) Identification of additional genes belonging to the LexA regulon in Escherichia coli. Mol Microbiol 35: 1560-1572.

•    Flynn, J.M., Neher, S.B., Kim, Y.-I., Sauer, R.T., and Baker, T.A. (2003) Proteomic discovery of cellular substrates of the ClpXP protease reveals five classes of ClpX-recognition signals. Mol Cell 11: 671-683.

•    Frank, E.G.D., Ennis, D.G., Gonzalez, M., Levine, A.S., and Woodgate, R. (1996) Regulation of SOS mutagenesis by proteolysis. Proc Natl Acad Sci USA 93: 10201-10296.

•    Frees, D., and Ingmer, H. (1999) ClpP participates in the degradation of misfolded protein in Lactococcus lactis. Mol Microbiol 31: 79-87.

•    Frees, D., Varmanen, P., and Ingmer, H. (2001) Inactivation of a gene that is highly conserved in Gram-positive bacteria stimulates degradation of non-native proteins and concomitantly increases stress tolerance in Lactococcus lactis. Mol Microbiol 41: 93-103.

•    Friedberg, E.C., Walker, G.C., and Siede, W. (1995) DNA Repair and Mutagenesis. Washington, DC: American Society for Microbiology Press.

•    Gasson, M. (1983) Plasmid complements of Streptococcus lactis NCDO712 and other lactic streptococci after protoplast-induced curing. J Bacteriol 154: 1-9.

•    Gonzalez, M., Frank, E.G., Levine, A.S., and Woodgate, R. (1998) Lon-mediated proteolysis of the Escherichia coli UmuD mutagenesis protein, in vitro degradation and identification of residues required for proteolysis. Genes Dev 12: 3889-3899.

•    Gonzalez, M., Rasulova, R., Maurizi, M.R., and Woodgate, R. (2000) Subunit-specific degradation of the UmuD/D'heterodimer by the ClpXP protease, the role transrecognition in UmuD' stability. EMBO J 19: 5251-5258.

•    Haijema, B.J., van Sinderen, D., Winterling, K., Kooistra, J., Venema, G., and Hamoen, L.W. (1996) Regulated expression of the dinR and recA genes during competence development and SOS induction in Bacillus subtilis. Mol Microbiol 22: 75-85.

•    Hamoen, L.W., Haijema, B., Bijlsma, J.J., Venema, G., and Lovett, C.M. (2001) The Bacillus subtilis competence transcription factor, ComK, overrides LexA-imposed transcriptional inhibition without physically displacing LexA. J Biol Chem 276: 42901-42907.

•    Hayes, F., Vos, P., Fitzgerald, G.F., de Vos, W.M., and Daly, C. (1991) Molecular organization of the minimal replicon of novel, narrow-host-range, lactococcal plasmid pCI305. Plasmid 25: 16-26.

•    Jenal, U., and Fuchs, T. (1998) An essential protease involved in bacterial cell-cycle control. EMBO J 17: 5658-5669.

•    Kim, B., and Little, J.W. (1993) LexA and lambda Cl repressors as enzymes, specific cleavage in an intermolecular reaction. Cell 73: 1165-1173.

•    Koonin, E.V., Aravind, L., and Galperin, M.Y. (2000) Comparative-genomic view of the microbial stress response. In Bacterial Stress Responses. Storz, G., and Hengge-Aronis, R. (eds). Washington, DC: American Society for Microbiology Press, pp. 417-444.

•    Kowalczykowski, S.C. (1991) Biochemistry of genetic recombination: energetics and mechanism of DNA strand exchange. Annu Rev Biophys Biophys Chem 20: 539-575.

•    Kowalczykowski, S.C., Dixon, D.A., Eggleston, A.K., Lauder, S., and Rehrauer, W.M. (1994) Biochemistry of homologous recombination in Escherichia coli. Microbiol Rev 58: 401-465.

•    Krüger, E., Zuhlke, D., Witt, E., Ludwig, H., and Hecker, M. (2001) Clp-mediated proteolysis in Gram-positive bacteria is autoregulated by the stability of a repressor. EMBO J 20: 852-863.

•    Kulaeva, O.I., Wootton, J.C., Levine, A.S., and Woodgate, R. (1995) Characterization of the umu-complementing operon from R391. J Bacteriol 177: 2737-2743.

•    Kuroda, M., Ohta, T., Uchiyama, I., Baba, T., Yuzawa, H., Kobayashi, I., et al. (2001) Whole genome sequencing of meticillin-resistant Staphylococcus aureus. Lancet 357: 1225-1240.

•    Little, J.W. (1984) Autodigestion of LexA and phage lambda repressors. Proc Natl Acad Sci USA 81: 1375-1379.

•    Little, J.W. (1991) Mechanism of specific LexA cleavage, autodigestion and the role of RecA coprotease. Biochimie 73: 411-421.

•    Little, J.W., and Mount, D.W. (1982) The SOS regulatory system of Escherichia coli. Cell 29: 11-22.

•    Maguin, E., Prevost, H., Ehrlich, S.D., and Gruss, A. (1996) Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J Bacteriol 178: 931-935.

•    Maurizi, M.R., Clark, W.P., Katayama, Y., Rudikoff, S., Pumphrey, J., Bowers, B., and Gottesman, S. (1990) Sequence and structure of ClpP, the proteolytic component of the ATP-dependent Clp protease of Escherichia coli. J Biol Chem 265: 12536-12545.

•    Munoz-Najar, U., and Vijayakumar, M.N. (1999) An operon that confers UV resistance by evoking the SOS mutagenic response in streptococcal conjugative transposon Tn5252. J Bacteriol 181: 2782-2788.

•    Neher, S.B., Flynn, J.M., Sauer, R.T., and Baker, T.A. (2003) Latent ClpX-recognition signals ensure LexA destruction after DNA damage. Genes Dev 17: 1084-1089.

•    Pelle, R., and Murphy, N.B. (1993) Northern hybridization, rapid and simple electrophoretic conditions. Nucleic Acids Res 21: 2783-2784.

•    Perry, K.L., Elledge, S.J., Mitchell, B., Marsh, L., and Walker, G.C. (1985) umuDC and mucAB operons whose products are required for UV light- and chemical-induced mutagenesis. Proc Natl Acad Sci USA 82: 4331-4335.

•    Pham, P., Bertram, J.G., O'Donnell, M., Woodgate, R., and Goodman, M.F. (2001) A model for SOS-lesion-targeted mutations in Escherichia coli. Nature 409: 366-370.

•    Raymond-Denise, A., and Guillen, N. (1991) Identification of dinR, a DNA damage-inducible regulator gene of Bacillus subtilis. J Bacteriol 173: 7084-7091.

•    Raymond-Denise, A., and Guillen, N. (1992) Expression of the Bacillus subtilis dinR and recA genes after DNA damage and during competence. J Bacteriol 174: 3171-3176.

•    Reuven, N.B., Arad, G., Maor-Shoshani, A., and Livneh, Z. (1999) The mutagenesis protein UmuC is a DNA polymerase activated by UmuD', RecA, and SSB and is specialized for Translesion Replication. J Biol Chem 274: 31763-31766.

•    Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

•    Slilaty, S.N., and Little, J.W. (1987) Lysine-156 and serine-119 are required for LexA repressor cleavage, a possible mechanism. Proc Natl Acad Sci USA 84: 3987-3991.

•    Smith, B.T., and Walker, G.C. (1998) Mutagenesis and more, umuDC and the Escherichia coli SOS response. Genetics 148: 1599-1610.

•    Smith, M.H., Cavenagh, M.M., and Little, J.W. (1991) Mutant LexA proteins with an increased rate of in vivo cleavage. Proc Natl Acad Sci USA 88: 7356-7360.

•    Tang, M., Bruck, I., Eritja, R., Turner, J., Frank, E.G., Woodgate, R., et al. (1998) Biochemical basis of SOS-induced mutagenesis in Escherichia coli: Reconstitution of in vitro lesion bypass dependent on the UmuD'2C mutagenic complex and RecA protein. Biochemistry 95: 9755-9760.

•    Tang, M., Shen, X., Frank, E.G., O'Donnell, M., Woodgate, R., and Goodman, M.F. (1999) UmuD' (2)C is an error-prone DNA polymerase, Escherichia coli pol V. Proc Natl Acad Sci USA 96: 8919-8924.

•    Tapias, A., Fernández, S., Alonso, J.C., and Barbé, J. (2002) Rhodobacter sphaeroides LexA has dual activity, optimising and repressing recA gene transcription. Nucleic Acids Res 30: 1539-1546.

•    Terzaghi, B.E., and Sandine, W.E. (1975) Improved medium for lactic streptococci and their bacteriophages. Appl Microbiol 29: 807-813.

•    Turgay, K., Hahn, J., Burghoorn, J., and Dubnau, D. (1998) Competence in Bacillus subtilis is controlled by regulated proteolysis of a transcription factor. EMBO J 17: 6730-6738.

•    Varmanen, P., Ingmer, H., and Vogensen, F.K. (2000) ctsR of Lactococcus lactis encodes a negative regulator of clp gene expression. Microbiology 146: 1447-1455.

•    Viala, J., and Mazodier, P. (2002) ClpP-dependent degradation of PopR allows tightly regulated expression of the clpP3 clpP4 operon in Streptomyces lividans. Mol Microbiol 44: 633-643.

•    Walker, G.C., Smith, B.T., and Sutton, M.D. (2000) The SOS response to DNA damage. In Bacterial Stress Responses. Storz, G., and Hengge-Aronis, R. (eds). Washington, DC: American Society for Microbiology Press, pp. 131-144.

•    Woodgate, R. (2001) Evolution of the two-step model for UV-mutagenesis. Mutat Res 485: 83-92.

•    Woodgate, R., and Levine, A.S. (1996) Damage inducible mutagenesis, recent insights into the activities of the Umu family of mutagenesis proteins. Cancer Surv 28: 117-140.

(order Full Text from publisher)

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005