|
|
|
Scientific
Publications - Work Done by Microbiology Reader
International
Journal of Food Microbiology, Volume 53, Issues 2-3 , 15 December 1999,
Pages 141-152 Occurrence of nisin Z production in Lactococcus lactis BFE 1500 isolated from wara, a traditional Nigerian cheese productN. A. Olasupoa, U. Schillingerb, A. Narbadc, H. Doddc and W. H. Holzapfelb a Department of Botany and Microbiology, Faculty of Science, Lagos State University Ojo, P.M.B. 1087 Apapa, Lagos, Nigeria b Institute of Hygiene and Toxicology, Federal Research Centre for Nutrition, Haid und Neustr. 9, D-76131 Karlsruhe, Germany c BBSRC Institute of Food Research, Norwich Research Park, Colney, Norwich NR4 7UA, UK Received 24 February 1999; revised 5 July 1999; accepted 4 September 1999. Available online 6 December 1999. ABSTRACT Screening for bacteriocin production of 500 strains of lactic acid bacteria
(LAB) from various African fermented foods resulted in the detection of a
bacteriocin producing Lactococcus lactis (BFE 1500) isolated from a dairy
product called wara. The bacteriocin inhibited not only the closely
related LAB, but also strains of Listeria monocytogenes, Listeria
innocua, Clostridium butyricum, Clostridium perfringens,
Bacillus cereus and Staphylococcus aureus. It was heat stable even at
autoclaving temperature (121°C for 15 min) and was active over a wide pH range
(2–10), but highest activity was observed in the lower pH range. The bacteriocin
was inactivated by
Author Keywords: Nisin Z; Lactococcus lactis; Wara; African fermented food
1. INTRODUCTION Fermented foods constitute a substantial part of the diet in many African countries and are considered an important means of preserving and introducing variety into the diet, consisting of staple foods such as milk, cassava, fish and cereals (Odunfa, 1985). Despite the state of science and technology in Africa, the production of fermented foods is still largely a traditional art associated with poor hygiene, inconsistent quality presentation and short shelflife ( Onyekwere et al., 1989). The preparation of these indigenous foods generally depends on a spontaneous or chance inoculation by naturally occurring LAB and the use of starter cultures is rare. Hence, as a means of improving the quality and safety of these foods, the use of bacteriocinogenic LAB in fermentation was suggested ( Olasupo et al., 1995) in view of increased attention to their possible role in food preservation and safety. LAB have for centuries been responsible for the fermentative processing and preservation of many foods including dairy, meat, vegetable and bakery products (Breidt and Fleming, 1997). They have been a subject of interest with respect to the production of growth inhibition compounds, including bacteriocins ( Klaenhammer, 1993). Bacteriocins are antimicrobial proteinaceous compounds that are generally inhibitory towards related bacterial strains ( Tagg and Nes). The use of bacteriocins has attracted increased attention as potential biopreservatives, and as a possible substitute for chemical preservation ( Abee et al., 1995) since nisin was accepted by the U.S. Food and Drug Administration in 1987 as a generally recognised safe food additive in dairy products. Today nisin is a permitted preservative in at least 48 countries, in which it is used in a variety of products, including cheese, canned foods and cured meat ( Delves-Broughton, 1990). Nisin is a bacteriocin produced by certain strains of Lactococcus lactis and is a member of a class of antimicrobial peptides called lantibiotics, because they contain the unusual amino acid lanthionine (Schnell and Jung). Nisin is active against a wide range of gram-positive bacteria and is also effective against gram-negative bacteria if used in combination with agents destabilizing the outer membrane ( Stevens et al., 1992). It is not inhibitory against fungi. Although information on nisin in the literature is extensive, it has all been limited to nisin producing strains isolated from foods obtained in the industrialised countries. No such information has emerged regarding foods of African origin or from any other developing countries. Our present study reports the detection and characterization of a nisin Z producing Lc. lactis strain (BFE 1500) isolated from a Nigerian cheese product wara. This may be the first such report of its kind in the context of traditional foods in the developing world.
2. MATERIALS AND METHODS 2.1. Isolation of organisms, media and cultivation conditionsLactic acid bacteria (LAB) were isolated from different traditional fermented foods in Africa as listed in Table 1. Samples (10 g) of foods were homogenised with 90 ml of 0.85% (w/v) sterile physiological saline and serially diluted in the same diluent. The LAB were selectively isolated on MRS (De Man et al., 1960) agar plates incubated both aerobically and anaerobically at 30°C for 2–3 days. The predominant LAB were obtained from MRS plates with the highest sample dilution (10−5 or 10−6). Colonies were either selected randomly or all colonies were sampled if the plate contained less than 10 colonies, according to Leisner et al. (1997). The purity of the isolates was checked by repeated streaking on fresh MRS agar plates, followed by microscopic examination. Initial characterization of isolates included colony and cell morphology and Gram, catalase and oxidase reactions. Gram-positive, catalase-negative, oxidase-negative non-motile cells were presumptively identified as LAB. Strains of LAB were maintained in MRS broth with 20% glycerol at −80°C.
Table 1. Number of lactic acid bacteria strains obtained from fermented foods
in Africa (FFA) and their ability to produce bacteriocin (BA)
Unless otherwise stated, all cultures were incubated at 30°C under aerobic conditions, with the exception of Lactobacillus helveticus CH-I which was incubated at 42°C. All LAB isolates and indicator strains were grown in MRS broth and the pathogenic organisms in Standard One Nutrient broth (Merck, Darmstadt, Germany). 2.2. Bacteriocin screening assayThe LAB were screened for antagonistic potential by the agar spot test method described by Uhlman et al. (1992), using the bacteriocin screening medium (BSM) of Tichaczek et al. (1992). Isolates with antagonistic activity were selected for identification and further experimentation. The indicator strains used for bacteriocin screening included: Lactobacillus sakei DSM 20017, Leuconostoc mesenteroides DSM 20343, Pediococcus acidilactici DSM 20333, Carnobacterium divergens L66, Listeria innocua WS 2257 and Listeria monocytogenes WS 2250. 2.3. Speciation of the bacteriocin producing isolateOnly one of the presumptively identified LAB as described above was found positive for bacteriocin production. The isolate was tested for the ability to ferment carbohydrates using the API 50 CHL system (bioMerieux, Nürtingen, Germany). In addition, it was further identified phenotypically using criteria such as gas production from glucose, growth at different temperatures (10, 15 and 45°C) and pH (3.9 and 9.6) and in varying concentrations of NaCl (4 and 6.5%), arginine hydrolysis, presence of diaminopimelic acid in the cell wall and lactic acid configuration as described by Schillinger and Lücke (1987). In order to confirm the identity of the strain, homology of DNA with reference strains (including Enterococcus faecalis DSM 20477, Enterococcus faecium DSM 20478 and Lc. lactis DSM 20729) was determined. Chromosomal DNA was isolated and purified according to a modification of the method described by Marmur (1961). The %G+C of the DNA was determined spectrophotometrically with a Gilford response spectrophotometer. The degree of DNA homology with reference strains was determined from renaturation rates by spectrophotometric analysis using the modified optical method of De Ley et al. (1970). 2.4. Concentration of the culture supernatantThe culture supernatant was concentrated 10-fold by ultra-filtration with a 3000 Mr exclusion membrane (Amicon, Beverley, CA, USA) and the critical dilution method (Schillinger et al., 1993) was used to quantify bacteriocin activity in both the retentate and the filtrate. 2.5. Determination of antimicrobial spectrum and activity assayCell-free neutralised and unneutralised supernatants were used to determine
the antimicrobial spectrum of activity. The cell-free supernatant was obtained
by growing the bacteriocin producing isolate in MRS broth for 24 h at 30°C after
which the cultured broth was centrifuged at 14,000 rpm for 10 min. The
supernatant was neutralised by adjusting the pH to 6.5 with 5 M NaOH and heat
treated at 100°C for 5 min to inactivate any remaining living cells. The
spectrum of activity was tested against a wide range of indicator strains
comprising LAB and food-borne pathogens (for list, see Table 2) by spotting 10
Table 2. Comparison of antimicrobial activity of the bacteriocin produced by
Lactococcus lactis BFE 1500 (isolated from wara) with that of
commercial nisin against pathogensa
Bacteriocin activity assays were determined using the critical dilution method described by Schillinger et al. (1993). One arbitrary activity unit (AU) was defined as the reciprocal of the highest dilution yielding a clear inhibition zone on the indicator strain and was multiplied by a factor of 100 to obtain the AU ml −1 of the original sample. Unless stated otherwise, P. acidilactici DSM 20333 was used as indicator in the bacteriocin activity assays. 2.6. Effect of heat, enzymes and pH on antimicrobial activityTo determine the effect of heat on bacteriocin activity, culture supernatant
was heated at 100°C for 5, 30 and 60 min and at 121°C for 15 min. The effect of
enzymes was monitored by using the following enzymes at a final concentration of
1 mg ml−1:
To evaluate the effect of pH on bacteriocin activity, the supernatant was adjusted to pH levels between 2.0 and 10.0 using 5 M HCl or NaOH. Supernatant was then allowed to stand at room temperature and at 4°C for 24 h before assaying for activity using the same method as stated above. As a control, to correct for inhibition due to pH, samples treated with proteinase K before pH adjustment were tested against the same indicator. 2.7. Growth inhibition of selected pathogenic organismsThe effect of Lc. lactis BFE 1500 bacteriocin and other Lc. lactis
(as listed before) bacteriocins (1:20 diluted supernatant) on growth of L.
monocytogenes WS 2250 and B. cereus DSM 2301 was studied in an
automated turbidometer, BIOSCREEN C (Labsystems, Helsinki, Finland), as
described by Holck et al. (1996). The pathogens were grown in Standard One broth
(STD 1) (Merck) for 18 h at 30°C. Each culture was diluted 10-fold and 10
2.8. Determination of nisin concentration and sucrose metabolism assayDetermination of nisin production was based on the plate diffusion assay
(Tramer and Fowler, 1964) and performed as previously described by Dodd et al.
(1996). Lc. lactis MG1614 (Gasson, 1983), P. acidilactici DSM 20333 and
Lb. helveticus CH-I (Christian Hansen Laboratories A/S, Copenhagen,
Denmark) were used as nisin sensitive indicator strains. A 0.5 ml sample of an
overnight culture, grown in MRS medium, was used to seed 50 ml of MRS agar (pH
6.0) containing 1 ml of Tween 20–Ringer’s solution (50:50). The wells were
loaded with 100
The ability of the bacteriocin producing strains to metabolize sucrose was examined using McKay’s indicator plates (McKay et al., 1972) where sucrose (0.5% w/v) was used in place of lactose. 2.9. Polymerase chain reaction (PCR)The polymerase chain reaction analysis was carried out using a modification
of the procedure described by Horn et al. (1991). The PCR conditions consisted
of 30 cycles of 92°C for 2 min, 55°C for 2 min and 72°C for 2 min for nisA and
nisB genes. For the nisC gene similar PCR conditions were employed except that
an annealing temperature of 42°C was used. The PCR reactions (in 50
NisA, p3(5-′CGGCTCTGATTAAATTCTGAAG) and p2(5-CGGTTGAGCTTTAAATGAAC); NisB, p4(5-AGAGAAGTTATTTACGATCAAC) and p5(5-ATCTGACAACAAATCTTTTTGT); NisC, p6(5-TTCAGAGCAATATGAGG) and p7(5-TATTAAGGCCACAATAAG). The primers were made on an Applied Biosystems DNA synthesizer (Model 381A). The phosphoramidite method of oligonucleotide synthesis was followed using the manufacturer’s instructions and reagents. These primers were designed from the DNA sequence of the nisin operon located within the chromosome of nisin A producing strain Lc. lactis FI5876. 2.10. DNA sequencingAn approximately 1.1 kb fragment of nisin operon corresponding to the nisin structural gene and the upstream nisA promoter region was first amplified by PCR with the primers p1 and p2 using the conditions described for amplification of the nisA gene. The nucleotide sequence of primer p1 was 5-CTAGTTCCTGAATAATATAGAG. The resulting PCR product was purified using the Wizard DNA clean up kit (Promega, UK) and subsequently used as template in the DNA sequencing reactions. Automated fluorescent sequencing by the Sanger dideoxyl termination method (Sanger et al., 1977) was carried out using an Applied Biosystems DNA sequencer (Model 373, Perkin-Elmer) together with the manufacturer’s Taq DyeDeoxyl Terminator Cycle sequencing kit (PE Applied Biosystems, Warrington, UK) and used according to the manufacturer’s instructions. Oligos p1 and p3 were employed as the sequencing primers. 2.11. ConjugationFilter matings were carried out using a modification of the method described by Rauch and De Vos (1992) on GM17 agar with a donor/recipient ratio of 1:10 and conjugation time of 2 h. The plasmid-free, non-nisin producing, non-sucrose metabolizing, rifampicin and streptomycin resistant Lc. lactis MG1614 was used as the recipient while sucrose metabolizing, rifampicin and streptomycin sensitive, nisin producing strain BFE 1500 was used as the donor. The transconjugants were initially selected for their antibiotic (streptomycin and rifampicin) resistance, and the identity of putative transconjugants was confirmed by comparing their sensitivities to streptomycin and rifampicin, plasmid profile and ability to ferment sucrose with those of donor and recipient strains. 2.12. Plasmid isolationPlasmid DNA was isolated by the sodium dodecylsulfate alkaline lysis method (Maniatis et al., 1982). Electrophoresis was performed using 0.8% agarose gels in TBE buffer at 100 V ( Sambrook et al., 1989). For estimation of plasmid size, supercoiled DNA ladder (Life Science Technologies, UK) with 11 plasmids of known molecular weights (ranging from 2.0 to 16.0 kb) was used as the marker.
3. RESULTS Five hundred LAB strains were isolated from different fermented foods in Africa. When the isolates were subjected to bacteriocin assay, only one isolate was found to produce bacteriocin (Table 1). The only positive isolate produced inhibition zones against the six indicator strains Lb. sakei DSM 20017, Leuc. mesenteroides DSM 20343, P. acidilactici DSM 20333, C. divergens L66, L. innocua WS 2257 and L. monocytogenes WS 2250 used in the screening test. This bacteriocin producing strain was isolated from wara, a traditional cheese product from Nigeria and was coded BFE 1500. Morphologically, the cells of strain BFE 1500 were coccoid in shape and
existed in short chains. The strain was Gram-positive, catalase- and
oxidase-negative, non-motile and did not produce gas from glucose. It hydrolysed
arginine, grew at 10, 15 and 40°C and at pH 3.9 and 9.2 and in 4.0% NaCl but did
not grow at 45°C, pH 9.6 or in 6.5% NaCl. It produced
The antimicrobial spectrum of the bacteriocin produced by Lc. lactis BFE 1500 against a wide range of indicator organisms comprising LAB and food-borne pathogens is given in Table 2. The bacteriocin exhibited a broad spectrum of antimicrobial activity similar to nisin. Comparison of the antimicrobial spectrum of this bacteriocin with that of commercial nisin A preparation, however, showed a slight difference. The bacteriocin of strain BFE 1500 inhibited Bacillus cereus DSM 2301, which pure nisin failed to inhibit. The nisin A producer, Lc. lactis FI5876, obtained from the Institute of Food Research (Norwich, UK) microbial collection, and strain BFE 1500 showed a slight difference in the degree of inhibition of some indicator strains, as reflected by a difference in the sizes of their inhibition zones. FI5876 had comparatively higher activity towards P. acidilactici DSM 20333, whereas BFE 1500 was more active towards Lb. helveticus CH-I. The effect of heat, pH and enzymes on the activity of the bacteriocin
produced by strain BFE 1500 is presented in Table 3. The bacteriocin was found
to be active over a wide pH range between 2 and 10, but higher activity was
observed at low pH. It was inactivated only by the proteolytic enzymes
proteinase K and
Table 4. Comparison of combined treatment of heat and pH on the activity of
bacteriocins produced by Lactococcus lactis BFE 1500 (from wara)
and BFE 921 (from mung bean sprouts) with that of Lactococcus lactis DSM
20729
Growth kinetic studies indicated a stronger growth inhibitory effect of the bacteriocin produced by Lc. lactis BFE 1500 and BFE 921, a strain isolated from mung bean sprouts, on B. cereus DSM 2301 (Fig. 1) and L. monocytogenes DSM 2250 (data not shown) than with nisin A from Lc. lactis DSM 20729. The bacteriocins from strains BFE 1500 and BFE 921 completely inhibited the growth of B. cereus and L. monocytogenes up to at least 36 h of incubation as indicated by no observable increase in the optical density during this period. In contrast, the supernatant from the nisin A producer was only inhibitory for 12 h of incubation against both pathogenic indicator strains.
In an attempt to determine whether the bacteriocin produced by strain BFE 1500 was nisin or not, PCR analysis using primers specific for individual nisin genes was used. The DNA amplification of Lc. lactis BFE 1500 yielded DNA products corresponding to nisin gene fragments. PCR generated bands corresponding to nisA (399 bp), nisB (457 bp) and nisC (1289 bp) were amplified from the genomic DNA of strain BFE 1500, identical to the equivalent genes of a nisin producing strain FI5876 (Fig. 2).
Further analysis of the nisin determinants of Lc. lactis BFE 1500 involved nucleotide sequencing of the DNA fragment amplified with nisA specific primers. Results (Fig. 3) indicated the presence of an open reading frame (ORF), the sequence of which was identical to that of nisA except for a C to A transversion at position 204. This resulted in an asparagine (AAT) residue at position 27 of the nisin peptide, instead of histidine (CAT). This indicates that the bacteriocin produced by strain BFE 1500 is a natural variant of nisin, called nisin Z. Upstream of the ORF two base substitutions were also observed in the same position as had been observed in the sequence of the nisin Z producing strain Lc. lactis N8 (Graeffe et al., 1991).
In order to establish whether the genetic determinants for bacteriocin production in strain BFE 1500 are located on a conjugative transposon, a conjugation experiment was carried out using BFE 1500 as the donor and a plasmid-free non-nisin producing Lactococcus as recipient. Transconjugants were selected for their resistance to streptomycin and rifampicin, a characteristic lacked by the donor. Transconjugants were able to produce nisin and to ferment sucrose. They showed immunity to their own bacteriocin as well as to that of the donor strain. Further analysis of the transconjugants showed that they were free of plasmids, indicating that the nisin determinants were transferred on a chromosomally located conjugative transposon.
4. DISCUSSION Many traditional fermented foods in Africa are typically produced at small-scale or household levels and are often associated with problems such as short shelf life and poor hygiene. The use of starter cultures is not a common practice and chance inoculation or back-slopping is usually practised. In this study a bacteriocin producing Lc. lactis (BFE 1500) from wara, a traditionally fermented dairy product from Nigeria, was identified. This antimicrobial peptide could contribute to current efforts in Africa to develop means for improving the safety and quality of African fermented foods. A novel approach to the use of bacteriocins, or their producer strains to control undesirable microflora in foods, would be to produce a fermented food that would naturally contain significant amounts of a particular bacteriocin as additional safety factor. This food might even have potential as an additive by which both spoilage and potentially pathogenic bacteria in other foods may be controlled. This strategy is less expensive than the use of commercially prepared bacteriocins or preservatives, and may serve as feasible means for improved preservation of foods in the African environment. Thereby, it might also contribute towards reduction of food-borne infections related to underprocessed fermented foods. The isolation and identification of a strain of Lc. lactis from wara, a typicalNigerian traditional cheese product, is consistent with previous reports associating the occurrence of the organism with dairy products (Harris and Teuber). While the occurrence of bacteriocin or nisin producing Lc. lactis strains is frequently reported in the literature (Graeffe; Kuipers; Uhlman; Ryan; Cai; Coventry; Franz and Yildirim), this information has thus far been limited to strains isolated from foods of the industrialised countries. The identification of the bacteriocin produced by strain BFE 1500 as a nisin was confirmed by the identification of the nisin genes A, B and C. Nisin gene clusters and sucrose genes are usually closely associated on the same transposon (Rauch and De Vos, 1992) and strain BFE 1500 was also able to metabolise sucrose. Furthermore, the bacteriocin from strain BFE 1500 had similar enzymatic and pH sensitivity patterns to nisin. As with nisin, the bacteriocin from strain BFE 1500 exhibited a broad spectrum of antimicrobial activity against pathogens including L. monocytogenes, L. innocua, Cl. butyricum, Cl. perfringens, S. aureus and B. cereus. However, a slight difference was observed in the inhibition of a strain of B. cereus (DSM 2301) which failed to be suppressed by a commercial nisin preparation, but was inhibited by the bacteriocin of strain BFE 1500. In addition, in a plate diffusion assay Lc. lactis BFE 1500 showed more activity towards Lactobacillus than Pediococcus indicator, whereas a nisin A producing strain (FI5876) had higher activity towards Pediococcus. A similar variation in the activity spectra of different nisin producing strains was observed by Graeffe et al. (1991). Because of these slight differences in specific activities which existed between the bacteriocins of strains BFE 1500, FI5876 and the commercial nisin A preparation, the sequence of the structural gene was determined. The substitution of asparagine for histidine at position 27 of the major nisin structure showed that the bacteriocin produced by strain BFE 1500 is a nisin variant called nisin Z. In addition to a single base substitution within the structural nisin Z gene, there were two additional base substitutions at −95 and −121 positions upstream of the nisin start codon (Graeffe et al., 1991). Comparison of the deduced primary sequence of nisin Z and its amino acid composition with nisin A strongly suggest that the N-terminal residue of nisin Z is isoleucine (Ile), suggesting that both nisin A and Z are processed at the same site and therefore have identical leader peptides. This leader peptide is proposed to be involved in the post-translational processing of nisin and other lantibiotics ( Schnell; Kaletta and Dodd). Although the occurrence of nisin Z in many strains of Lc. lactis has been reported from different origins (Graeffe; Kuipers; Mulders and Cai), this is the first time that a nisin Z producing strain has been detected in African fermented foods or foods from any developing nation. Nisin production is not known to be plasmid-borne (Graeffe; Horn and Rauch). This is in agreement with our observation on conjugal mating. The production of nisin Z in strain BFE 1500 was found to be located on a conjugative transposon residing in the chromosome. The detection of a nisin Z producing strain in an African fermented food could be of significance in the current strategies aimed at solving the perennial problem of food safety and preservation due to spoilage organisms in the African environment. Thereby it should be taken into account that nisin is the only bacteriocin to date with practical application in food processing. Nisin has been well tested and confirmed as non-toxic when consumed orally and has proved to be a safe food preservative (Delves-Broughton, 1990). The susceptibility of nisin to enzymatic degradation is an advantage for its use in food, as nisin is quickly digested and would not affect the intestinal flora or be absorbed into the blood stream ( Molitor and Sahl, 1991). On the other hand, it should be mentioned that several factors such as the presence of proteolytic enzymes, uneven distribution or binding of nisin molecules to fat particles or proteins may adversely affect the effectiveness of nisin in the food environment ( Schillinger et al., 1996). Application of this nisin Z or its producing strain BFE 1500 in food studies is necessary to determine its effectiveness in safeguarding a range of traditional or novel dairy and other fermented food products.
ACKNOWLEDGEMENTS
REFERENCES Abee, T., Kröckel, L. and Hill, C., 1995. Bacteriocins: mode of action and potentials in food preservation and control of food poisoning. Int. J. Food Microbiol. 28, pp. 169-185. Breidt, F. and Fleming, H.P., 1997. Using lactic acid bacteria to improve the safety of minimally processed fruits and vegetables. Food Technol. 51, pp. 44-51. Cai, Y., Ng, L.-K. and Farber, J.M., 1997. Isolation and characterization of nisin-producing Lactococcus lactis subsp. lactis from bean sprouts. J. Appl. Microbiol. 83, pp. 499-507. Coventry, M.J., Gordon, J.B., Wilcock, A., Harmark, K., Davidson, B.E., Hickey, M.V., Hillier, A.J. and Wan, J., 1997. Detection of bacteriocins of lactic acid bacteria isolated from foods and comparison with pediocin and nisin. J. Appl. Microbiol. 83, pp. 248-258. De Ley, J., Cattoir, H. and Reynaerts, A., 1970. The quantitative measurement of DNA hybridization from renaturation rates. Eur. J. Biochem. 12, pp. 133-142. Delves-Broughton, J., 1990. Nisin and its uses as a food preservative. Food Technol. 44, pp. 100-117. De Man, J.C., Rogosa, M. and Sharpe, M.E., 1960. A medium for the cultivation of lactobacilli. J. Appl. Bacteriol. 23, pp. 130-135. Dodd, H.M., Horn, N. and Gasson, M.J., 1990. Analysis of the genetic determinant for the production of the peptide antibiotic nisin. J. Gen. Microbiol. 136, pp. 555-566. Dodd, H.M., Horn, N., Giffard, C.J. and Gasson, M.J., 1996. A gene replacement strategy for engineering nisin. Microbiology 142, pp. 47-55. Franz, C.M.A.P., Du Toit, M., von Holy, A., Schillinger, U. and Holzapfel, W.H., 1997. Production of nisin-like bacteriocins by Lactococcus lactis strains isolated from vegetables. J. Basic Microbiol. 37, pp. 187-196. Gasson, M.J., 1983. Plasmid components of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J. Bacteriol. 154, pp. 1-9. Graeffe, T., Rintala, H., Paulin, L. and Saris, P., 1991. A natural nisin variant. In: Jung, G. and Sahl, H.-G. Editors, 1991. Nisin and Novel LantibioticsProceedings of the First International Workshop on Lantibiotics, Escom, Leiden, The Netherlands, pp. 260-268. Harris, L.J., Fleming, H.P. and Klaenhammer, T.R., 1992. Developments in nisin research. Food Res. Int. 25, pp. 57-66. Holck, A., Axelsson, L. and Schillinger, U., 1996. Divergicin 750, a novel bacteriocin produced by Carnobacterium divergens 750. FEMS Microbiol. Lett. 136, pp. 163-168. Horn, N., Swindell, S., Dodd, H. and Gasson, M., 1991. Nisin biosynthesis genes are encoded by a novel conjugative transposon. Mol. Gen. Genet. 228, pp. 129-135. Jung, G., 1991. Lantibiotics: a survey. In: Jung, G. and Sahl, H.-G. Editors, 1991. Nisin and Novel LantibioticsProceedings of the First International Workshop on Lantibiotics, Escom, Leiden, The Netherlands, pp. 1-34. Kaletta, C. and Entian, K.-D., 1989. Nisin, a peptide antibiotic: cloning and sequencing of the nisA gene and post-translational processing of its peptide product. J. Bacteriol. 171, pp. 1597-1601. Klaenhammer, T.R., 1993. Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiol. Rev. 12, pp. 39-86. Kuipers, O.P., Yap, W.M.G.J., Rollema, H.S., Beerthuyzen, M.M., Seizen, R.J. and De Vos, W.M., 1991. Expression of wild-type and mutant nisin genes in Lactococcus lactis. In: Jung, G. and Sahl, H.-G. Editors, 1991. Nisin and Novel LantibioticsProceedings of the First International Workshop on Lantibiotics, Escom, Leiden, The Netherlands, pp. 250-259. Leisner, J.J., Rusul, G., Wee, B.M., Boo, H.C. and Mohammad, K., 1997. Microbiology of Chili Bo, a popular Malaysian food ingredient. J. Food Prot. 60, pp. 1235-1240. Maniatis, T., Fritsch, E.F. and Sambrook, K.J., 1982. . Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Marmur, J., 1961. A procedure for the isolation of deoxyribonucleic acid from microorganisms. J. Mol. Biol. 3, pp. 208-218. McKay, L.L., Baldwin, K.A. and Zottola, E.A., 1972. Loss of lactose metabolism in lactic streptococci. Appl. Environ. Microbiol. 23, pp. 1090-1096. Molitor, E. and Sahl, H.-G., 1991. Application of nisin: a literature survey. In: Jung, G. and Sahl, H.-G. Editors, 1991. Nisin and Novel LantibioticsProceedings of the First International Workshop on Lantibiotics, Escom, Leiden, The Netherlands, pp. 434-439. Mulders, J.W.M., Boerrigter, I.J., Rollema, H.S., Siezen, R.J. and De Vos, W.M., 1991. Identification and characterization of the lantibiotic nisin Z, a natural nisin variant. Eur. J. Biochem. 201, pp. 581-584. Nes, I.F., Diep, D.B., Havarstein, L.S., Brurberg, M.B., Eijsink, V. and Holo, H., 1996. Biosynthesis of bacteriocins in lactic acid bacteria. Antonie van Leeuwenhoek 70, pp. 113-128. Odunfa, S.A., 1985. African fermented foods. In: Wood, B.J. Editor, , 1985. Microbiology of Fermented Foods Vol. 2 Elsevier, London, pp. 155-191. Olasupo, N.A., Olukoya, D.K. and Odunfa, S.A., 1995. Studies on bacteriocinogenic Lactobacillus isolates from Nigerian fermented foods. J. Basic Microbiol. 35, pp. 257-262. Onyekwere, O.O., Akinrele, I.A. and Koleoso, A.O., 1989. Industrialization of ogi fermentation. In: Steinkraus, K.H. Editor, , 1989. Industrialization of Indigenous Fermented Foods Marcel Dekker, New York, pp. 329-362. Rauch, P.J.G. and De Vos, W.M., 1992. Characterization of the novel nisin-sucrose conjugative transposon Tn 5276 and its insertion in Lactococcus lactis. J. Bacteriol. 174, pp. 1280-1287. Ryan, M.P., Rea, M.C., Hill, C. and Ross, R.P., 1996. An application in cheddar cheese manufacture for a strain of Lactococcus lactis producing a novel broad spectrum bacteriocin, lacticin 3147. Appl. Environ. Microbiol. 62, pp. 612-619. Sambrook, J., Fritsch, E.F. and Maniatis, T., 1989. . Molecular Cloning: A Laboratory Manual (2nd ed. ed.), Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Sanger, F., Nicklen, S. and Coulson, A.R., 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, pp. 5463-5467. Schillinger, U. and Lücke, F.-K., 1987. Identification of lactobacilli from meat and meat products. Food Microbiol. 4, pp. 199-208. Schillinger, U., Stiles, M.E. and Holzapfel, W.H., 1993. Bacteriocin production by Carnobacterium piscicola LV61. Int. J. Food Microbiol. 20, pp. 131-147. Schillinger, U., Geisen, R. and Holzapfel, W.H., 1996. Potential of antagonistic microorganisms and bacteriocins for the biological preservation of foods. Trends Food Sci. Technol. 7, pp. 158-164. Schleifer, K.H. and Stackebrandt, E., 1983. Molecular systematics of prokaryotes. Annu. Rev. Microbiol. 37, pp. 143-187. Schnell, N.E., Entian, K.-D., Schneider, U., Gotz, F., Zahner, H., Kellner, R. and Jung, G., 1988. Prepeptide sequence of epidermin, a ribosomally synthesized antibiotic with four sulphide-rings. Nature 333, pp. 276-278. Stevens, K.A., Klapes, N.A., Sheldon, B.W. and Klaenhammer, T.R., 1992. Antimicrobial action of nisin against Salmonella typhimurium lipopolysaccharide mutants. Appl. Environ. Microbiol. 58, pp. 1786-1788. Tagg, J.R., Dajani, A.S. and Wannamaker, L.W., 1976. Bacteriocins of Gram-positive bacteria. Bacteriol. Rev. 40, pp. 722-756. Teuber, M., 1995. The genus Lactococcus. In: Wood, B.J.B. and Holzapfel, W.H. Editors, 1995. The Genera of Lactic Acid Bacteria Blackie Academic and Professional/Chapman and Hall, pp. 173-234. Tichaczek, P.S., Nissen-Meyer, J., Nes, I.F., Vogel, R.F. and Hammes, W.P., 1992. Characterization of the bacteriocins curvacin A from Lactobacillus curvatus LTH1174 and sakacin P from Lactobacillus sake LTH673. Syst. Appl. Microbiol. 15, pp. 460-468. Tramer, J. and Fowler, G.G., 1964. Estimation of nisin in foods. J. Sci. Food Agric. 15, pp. 522-528. Uhlman, L., Schillinger, U., Rupnow, J.R. and Holzapfel, W.H., 1992. Identification and characterization of bacteriocin-producing strains of Lactococcus lactis isolated from vegetables. Int. J. Food Microbiol. 16, pp. 141-151. Yildirim, Z. and Johnson, M.G., 1998. Detection and characterization of a bacteriocin produced by Lactococcus lactis subsp cremoris R isolated from radish. Lett. Appl. Microbiol. 26, pp. 297-304.
(order Full Text from publisher)
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||