|
|
|
|
|
|
Scientific
Publications - Work Done by Microbiology Reader
Molecular Microbiology, November 2002, Volume 46 Issue 3, Page 623-635 A family of autocrine growth factors in Mycobacterium tuberculosisGalina V. Mukamolova, Obolbek A. Turapov, Danielle I. Young, Arseny S.
Kaprelyants, Douglas B. Kell and Michael Young SUMMARY Mycobacterium tuberculosis and its close relative, Mycobacterium bovis (BCG) contain five genes whose predicted products resemble Rpf from Micrococcus luteus. Rpf is a secreted growth factor, active at picomolar concentrations, which is required for the growth of vegetative cells in minimal media at very low inoculum densities, as well as the resuscitation of dormant cells. We show here that the five cognate proteins from M. tuberculosis have very similar characteristics and properties to those of Rpf. They too stimulate bacterial growth at picomolar (and in some cases, subpicomolar) concentrations. Several lines of evidence indicate that they exert their activity from an extra-cytoplasmic location, suggesting that they are also involved in intercellular signalling. The five M. tuberculosis proteins show cross-species activity against M. luteus, Mycobacterium smegmatis and M. bovis (BCG). Actively growing cells of M. bovis (BCG) do not respond to these proteins, whereas bacteria exposed to a prolonged stationary phase do. Affinity-purified antibodies inhibit bacterial growth in vitro, suggesting that sequestration of these proteins at the cell surface might provide a means to limit or even prevent bacterial multiplication in vivo. The Rpf family of bacterial growth factors may therefore provide novel opportunities for preventing and controlling mycobacterial infections.
INTRODUCTION Intercellular communication between bacteria has been well documented over the last decade (Kaiser and Losick, 1993; Kell et al., 1995; Salmond et al., 1995; Fuqua and Greenberg, 1998). N-acyl-l-homoserine lactones are generally used for cell density-dependent signalling in Gram-negative organisms (Fuqua et al., 1994; 1996). Peptides are more commonly, though not exclusively (Horinouchi and Beppu, 1994; Ohnishi et al., 1999), used for intercellular signalling in Gram-positive organisms (Kleerebezem et al., 1997; Lazazzera and Grossman, 1998). Examples of processes in which peptide-mediated signalling occurs include conjugation in enterococci (Clewell, 1993) and development of competence for genetic transformation and endospore formation in Bacillus subtilis (Kaiser and Losick, 1993; Lazazzera and Grossman, 1998). Individual bacteria are normally considered autonomous, because their growth and multiplication does not apparently depend on the presence of any specific exogenous peptidic or proteinaceous growth factors (Kaprelyants et al., 1994a; Votyakova et al., 1994; Kaprelyants and Kell, 1996; Kell and Young, 2000). This conventional view has been challenged by the recent discovery of a protein called Rpf (resuscitation-promoting factor) that is secreted by growing cells of Micrococcus luteus (Mukamolova et al., 1998). Rpf was required at picomolar concentrations for the resuscitation of dormant, 'non-culturable' cells of M. luteus and for the growth of small inocula in minimal media. Moreover, extensive washing of actively growing cells of M. luteus rendered their further growth dependent on exogenously added Rpf (Mukamolova et al., 1998). It has recently been shown that rpf is an essential gene in M. luteus (Mukamolova et al., 2002). Rpf therefore has the properties of a proteinaceous bacterial growth factor or cytokine (Callard and Gearing, 1994). Genes resembling M. luteus rpf are widespread throughout the high G + C Gram-positive bacteria, which includes streptomycetes, corynebacteria and mycobacteria (Kell and Young, 2000). The DNA sequence databases currently contain more than 30 members of the rpf gene family and most organisms contain several representatives. For example, Mycobacterium tuberculosis and its close relative (Behr et al., 1999) Mycobacterium bovis contain five rpf-like genes. Tuberculosis, caused by M. tuberculosis, now kills more people in the world than any other single bacterial infection and globally, one in three people are believed to harbour a persistent (latent) infection (Bloom and Murray, 1992; Dye et al., 1999). The phenomenon of persistence has long been recognised (McDermott, 1958; Wayne, 1960; McCune et al., 1966), but it remains poorly understood (Young and Duncan, 1995; Parrish et al., 1998; Wayne and Sohaskey, 2001). It is generally agreed that the immune system plays an important role in preventing net bacterial multiplication (Flynn and Chan, 2001), but other aspects of the biology of the persisting organisms remain controversial. Some evidence suggests that they may be metabolic ally active ( reviewed by Hφner zu Bentrup and Russell, 2001) whereas there is also evidence that they have become dormant, or have lost culturability (Wayne, 1960, 1994). The presence of rpf-like genes in these mycobacteria raises the possibility that (a lack of) their products may be involved in controlling bacterial growth in vivo. Persisting organisms in the latent state may require one or more of these proteins in order to re-activate. To illuminate these suggestions, we have isolated recombinant forms of the five rpf-like proteins of M. tuberculosis and tested their activities using several different organisms.
RESULTS Comparison of the five rpf-like genes of M. tuberculosis The predicted products of the five rpf-like genes of M.
tuberculosis share with Rpf a conserved
The various rpf-like genes (Fig. 1B), are scattered about the M. tuberculosis genome (Cole et al., 1998). The rpfA and rpfE genes appear to comprise monocistronic operons, the former lying within a cluster of genes concerned with molybdopteroate biosynthesis. There is a 25 bp overlap between the 3' end of rpfB and ksgA, which is predicted to encode a dimethyadenosine transferase. The rpfD gene lies downstream from a gene of unknown function in what may be a bicistronic operon. It is located between hemN and nirA, which probably encode proteins involved in coproporphyrinogen III decarboxylation and nitrate reduction respectively. Finally, rpfC is the third gene in a seven-gene operon containing a mycolyltransferase (fbpB) upstream and a probable dehydrogenase (Rv 1882c), lipoprotein (Rv 1881c) and cytochrome P450 (Rv 1880c) downstream. The widely differing contexts of the five genes provide no clear evidence for a common biological function. Biological activities of the recombinant proteins To investigate their biological functions, the five Rpf-like proteins encoded by the M. tuberculosis genome were obtained in reagent quantities as polyhistidine-tagged derivatives, lacking their predicted signal sequences/membrane anchors (see Fig. 1A), as indicated in the Experimental procedures. They were assayed by incorporating them into the growth medium of M. luteus and M. smegmatis. We have previously shown that when these fast growing organisms are inoculated at low cell density into a minimal medium, their apparent lag phase (time to detectable turbidity) is reduced in response to Rpf addition (Mukamolova et al., 1998). All four M. tuberculosis proteins tested also reduced the apparent lag phase of M. luteus (Fig. 2A). RpfA and RpfC were the most potent. The former showed activity at fM concentrations, whereas the latter caused the greatest reduction in apparent lag phase (from 216 h to 80 h). Similarly, all four proteins were active in reducing the apparent lag phase of M. smegmatis (Fig. 2B). At optimally active concentrations, all four proteins reduced the apparent lag phase to the same extent and for RpfA, RpfC and RpfE, maximal activity was observed at subpicomolar concentrations (Fig. 2B). Complete activity profiles were obtained for RpfD against both organisms and for RpfA and RpfC against M. luteus. These profiles indicate that there is an optimal concentration range for activity, above and below which there is reduced activity or no activity at all. Indeed, the only protein for which there is no evidence of reduced activity at elevated (΅M) concentrations, was RpfE, when tested using M. luteus. The four proteins show different potency profiles when tested using these two fast-growing organisms. RpfA was active at subpicomolar concentrations against both M. smegmatis and M. luteus. On the other hand, the potency of RpfE was high when tested against M. smegmatis, but comparatively low when tested against M. luteus. Freshly purified samples were always used for experiments, because these proteins lose biological activity during storage (Experimental procedures). Nevertheless, we cannot rule out the possibility that differences in the proportion of biologically active molecules in different protein samples could account, at least in part, for the different potencies of the four proteins. However, this cannot explain the different potency of RpfA when tested with the two different organisms, because the assays were done at the same time with the same protein preparation. Mycobacterium bovis (BCG) was chosen as a representative of the slow-growing mycobacteria (Wayne, 1984) with which to test the biological activities of the Rpf-like proteins of M. tuberculosis. Mycobacterium bovis (BCG) is closely related to M. tuberculosis (Behr et al., 1999) and contains five rpf homologues that are very similar indeed to those of M. tuberculosis (Kell and Young, 2000). The response of M. bovis (BCG) to the five proteins depended on the age of the inoculum. When actively growing cells were used, none of the proteins stimulated bacterial growth (representative data are shown for RpfC in Fig. 3F). However, in common with cells of both the virulent and the avirulent strains of M. tuberculosis (Sun and Zhang, 1999; Zhang et al., 2001; Shleeva et al., 2002), those of M. bovis (BCG) lose culturability during extended stationary phase. The activities of the five Rpf-like proteins of M. bovis (BCG) were therefore monitored using late stationary phase cells. As indicated in Fig. 3A-E, all five proteins were active; growth usually occurred after an appreciable lag, and was dependent on the provision of pM concentrations of any one of these five proteins. RpfA only showed activity at the lowest concentration tested (1.6 pM) (Fig. 3A), whereas the other proteins were active over the entire concentration range tested. The data summarized in Fig. 2A-B and Fig. 3A-E establish that the rpf-like genes of M. tuberculosis encode a family of growth factors with activities similar to that of M. luteus Rpf (Mukamolova et al., 1998). Rpf expression in M. smegmatis stimulates bacterial growth To circumvent potential problems arising from the fact that the recombinant
proteins are unstable and the proportion of biologically active molecules in
different preparations of recombinant proteins is not known (see above), we
examined the effect of Rpf expression in vivo. Plasmid pAGM0 (Mukamolova
et al. 2002), expressing rpf under the control of the M.
smegmatis amidase promoter (Pami) (Parish et al., 1997)
was introduced into M. smegmatis. Using reverse transcriptase-polymerase
chain reaction (RT-PCR), we verified that rpf is expressed soon after
inoculation of the pAGM0-containing strain into fresh growth medium (data not
shown). The appearance of Rpf in the culture supernatant was also demonstrable
by Western blotting of samples taken when the cultures were in exponential phase
(OD600 = 0.6). Using an inoculum grown to stationary phase overnight
in NBE, bacteria were subjected to nutritional shift-down by inoculation at
three different densities into Sauton's medium. At low inoculum densities (103
and 104 colony-forming units (cfu) ml
Expression of the five rpf-like genes of M. tuberculosis and M. bovis (BCG) Messenger RNA corresponding to all five rpf-like genes was detected by RT-PCR using RNA isolated from cells of M. tuberculosis H37Rv and M. bovis (BCG) growing actively in vitro (Fig. 5A and B). Although only weak signals were obtained for RpfD (Rv2389c) in M. bovis (BCG) and RpfE (Rv2450c) in both organisms, expression of both genes has been detected by others in microarray experiments (Manganelli et al., 2001; Sherman et al., 2001). In contrast, we were unable to detect mRNA corresponding to any of these genes in RNA extracted from M. bovis (BCG) during stationary phase, nor from cells that had been starved for 5 months (data not shown). All five rpf-like genes are expressed in actively growing cells, whereas non-growing cells express them either at levels that are below the limit of detection, or not at all. To monitor protein production, antibodies were raised against a
histidine-tagged, truncated form of Rpf comprising residues A42-L118,
i.e. the conserved 'Rpf domain' that is shared by all family members (Kell and
Young, 2000), and purified by affinity chromatography (Experimental procedures).
These antibodies reacted with recombinant versions of all five of the Rpf-like
proteins of M. tuberculosis (Fig. 6C). They detected two bands in concentrated
samples of supernatant obtained from exponentially growing cultures of M. bovis
(BCG) (Fig. 6A) and M. tuberculosis (data not shown). Several bands were also
detected in concentrated samples of supernatant obtained from exponentially
growing cultures of M. smegmatis (Fig. 6B). Only the uppermost band was seen
(and its apparent size was slightly reduced) if protease inhibitors were not
present during isolation (see Experimental procedures). According to the
available genome sequence information (
http://www.ncbi.nlm.nih.gov/cgi-bin/Entrez/genom_table_cgi ) , this organism
potentially produces four Rpf-like proteins. These experiments confirm that
Rpf-like proteins are detectable in the sup Using confocal microscopy of M. bovis BCG that had been incubated with anti-truncated Rpf antibodies and a secondary, FITC-labelled antibody, Rpf-like protein(s) were detected on the bacterial cell surface. About 30% of the M. bovis (BCG) cells in early logarithmic phase cultures (8 days post inoculation) showed detectable fluorescence and some of them were much more strongly fluorescent than others (Fig. 6D and E). Fluorescence was abolished if recombinant Rpf was added to the bacteria at the same time as the primary anti-Rpf antibody. None of the cells in stationary phase cultures (6 weeks post inoculation) showed visible fluorescence (data not shown). Anti-Rpf antibodies inhibit bacterial growth Given the accumulated evidence that members of the Rpf protein family stimulate bacterial growth from an extra-cytoplasmic location, we determined the effect of adding anti-Rpf antibodies to the culture medium. Immunoglobulins purified from immune serum partially inhibited the growth of the avirulent Academia strain of M. tuberculosis, whereas immunoglobulins purified from preimmune serum were without effect (Fig. 7A). Moreover, the inhibitory effect of immunoglobulins in the immune serum was overcome by the addition of Rpf. Similar growth inhibition of M. bovis (BCG) was observed using affinity-purified anti-Rpf antibodies. Inhibition was transient, resulting in delayed bacterial growth when using a large inoculum of late logarithmic cells (Fig. 7B). This was probably not a result of antibody degradation during the long incubation period, as anti-Rpf antibodies were detectable in the culture medium by Western blotting throughout the experiment (data not shown). There was more pronounced growth inhibition using a small inoculum of aged cells of M. bovis (BCG) (Fig. 7C). In all of these experiments, the addition of Rpf overcame the growth-inhibitory effect of the anti-Rpf antibodies. Indeed, in Fig. 7C the provision of Rpf abolished the short lag phase seen in the control.
FIGURES
DISCUSSION Information from the published genome sequence (Cole et al., 1998) suggested that the rpf-like genes of M. tuberculosis encode a family of surface-located or secreted proteins. This was confirmed by the results reported here. One or more of these proteins was detected on the surface of actively growing bacteria and in concentrated samples of supernatants obtained from cultures of M. tuberculosis, the closely related organism, M. bovis (BCG), and M. smegmatis (Fig. 6A and B). Moreover, growth of M. bovis BCG was stimulated by recombinant versions of these Rpf-like proteins (Figs 2 and 3), and inhibited when anti-Rpf antibodies were incorporated into the culture medium (Fig. 7). The Rpf-like proteins of M. tuberculosis stimulated bacterial growth in laboratory culture at very low (pM) concentrations, which effectively excludes the possibility that they were simply being used as nutrients. The most potent proteins were active at concentrations equivalent to just a few molecules per cell (Fig. 2), consistent with the view that they act as growth factors. As was previously noted when M. luteus Rpf was tested against a panel of different organisms, the Rpf-like proteins of M. tuberculosis show cross-species activity. They stimulated the growth of the closely related, slow-growing organism, M. bovis (BCG) (Fig. 3) as well as that of two fast-growing organisms, M. smegmatis and M. luteus (Fig. 2). Moreover, expression of rpf in M. smegmatis also stimulated the growth of this organism in a minimal medium (Fig. 7), confirming the results obtained with exogenously added recombinant proteins. It is noteworthy that this represents the first demonstration of Rpf-mediated growth stimulation on a solid medium; when recombinant proteins are incorporated into molten agar or spread on the surface of agar plates they are not active (Kaprelyants et al., 1994; Mukamolova et al., 2002). Reverse transcriptase-polymerase chain reaction showed that actively growing cells of both M. tuberculosis H37Rv and M. bovis (BCG) express allfive of their rpf-like genes (Fig. 5) and Western blotting indicated that Rpf-like proteins are detectable in the culture medium (Fig. 6A). Continued cellular multiplication is assured by endogenous protein production; hence, the provision of extra molecules in the culture medium has little effect on bacterial growth (Fig. 3F and unpublished data). Moreover, some organisms appear to produce sufficient amounts of these growth factors to render them relatively insensitive to the growth-inhibitory effect of anti-Rpf antibodies (Fig. 7B) and to permit their detection on the cell surface (Fig. 6D-E). Non-growing bacteria do not produce these growth factors. As they remain in stationary phase, previously synthesized molecules gradually decay, and the bacteria become increasingly dependent on an exogenous supply in order to resume growth (Fig. 3A-E). A growth factor requirement is also detectable in cells of the avirulent Academia strain of M. tuberculosis that have persisted for several days within murine macrophages (Biketov et al., 2000). Mycobacteria inoculated from late stationary phase, or even older cultures, either fail to grow, or grow only very slowly after an extended lag phase (Dubos and Davis, 1946; Aldovini et al., 1993; Yuan et al., 1996; Lim et al., 1999; Sun and Zhang, 1999). The addition of Rpf-like growth factors to such cultures should aid the resumption of normal growth, which could potentially improve the diagnosis and quantification of mycobacterial infections. To obtain 'non-culturable', Rpf-responsive cells of M. bovis (BCG) (see Fig. 3), bacteria were incubated in Sauton's medium in prolonged stationary phase, without exposure to the laboratory atmosphere. These conditions (except for oxygen depletion) were similar to those used previously to elicit dormancy in M. luteus (Mukamolova et al., 1995). The avirulent H37Ra strain of M. tuberculosis can also enter a 'non-culturable' state after prolonged stationary phase, from which it can be resuscitated using culture supernatants (Sun and Zhang, 1999). Using an indirect, fluorescence-based assay that correlated with resuscitation, the authors initially reported that the active agent was a small MW, heat-stable compound that accumulated in early stationary phase. Subsequently (Zhang et al., 2001), activity in early stationary phase supernatants was associated with phospholipids and an 8 kDa protein (Rv1174c). Three synthetic peptides representing different segments of this protein were active when added to bacteria at micromolar concentrations. In our experiments, in which minute (picomolar) concentrations of Rpf-like proteins permitted the growth of organisms that were otherwise non-culturable (Fig. 3A-E), we can effectively exclude any non-specific growth stimulation potentially arising from utilization of these molecules as nutrients. A growth factor requirement can be artificially induced in growing cells of M. luteus by repeatedly washing them and inoculating them at low cell density (Mukamolova et al., 1998; 1999). Rpf has a LysM lysin domain at its C-terminus, which is probably a peptidoglycan-binding module (Bateman and Bycroft, 2000). Washing presumably removes secreted Rpf molecules associated with the cell envelope. Attempts to induce a similar growth factor requirement in M. tuberculosis and M. bovis (BCG) by washing have proved unsuccessful (unpublished data). This is consistent with the observation that one or more of the Rpf-like proteins elaborated by these organisms, which tend to form extensive clumps, cords and pellicles, is probably membrane-bound (e.g. RpfB). We suspect that the five different Rpf-like proteins of M. tuberculosis and M. bovis (BCG) fulfil subtly different, overlapping, biological functions. They may all act as autocrine signalling molecules, effectively stimulating the growth and multiplication of the cells that produce them. Free-living (planktonic) cells may use secreted proteins (e.g. RpfA) for paracrine, density dependent signalling (quorum sensing) (Fuqua et al., 1996), whereas cells growing in close proximity may use envelope-associated proteins for juxtacrine signalling (Kaprelyants et al., 1999). Dormant or injured cells (defined in Kell et al., 1998) require an exogenous source of these proteins for their resuscitation (Mukamolova et al., 1998; Biketov et al., 2000). Further insights into their precise biological roles will require the construction and analysis of mutants harbouring null mutations. The growth-promoting effects of these proteins appear to result from their specific interaction with a component of the bacterial cell envelope. Two lines of evidence suggest that they bind to specific receptors. One is their extreme potency. The other is that they have an optimum concentration for biological activity, above which they are either inactive or even inhibitory (Mukamolova et al., 1998; 2002). Evidence of this nature has previously been adduced in studies of hormone-receptor and ligand-receptor interactions (Franklin, 1980; Gero, 1983). When mycobacteria experience an extended stationary phase in vitro they oftenlose culturability (Sun and Zhang, 1999; Zhang et al., 2001; Shleeva et al., 2002). They may possibly enter a state of Rpf-responsive dormancy, akin to that observed when M. luteus experiences prolonged stationary phase (Kaprelyants and Kell, 1993; Kaprelyants et al., 1993). Cells that have been starved in vitro may be physiologically similar to bacteria that persist in vivo, in patients harbouring a latent M. tuberculosis infection (Parrish et al., 1998). Persisting organisms are detectable (de Wit et al., 1995; Hernandez-Pando et al., 2000; Pai et al., 2000), but cannot be cultured using conventional methods (plating or inoculation into liquid media) (Wayne, 1960, 1994;McCune et al., 1966; de Wit et al., 1995). It is consequently possible that (a lack of) Rpf-like growth factors contributes a microbiological component to the phenomenon of mycobacterial persistence in latent infections. The results reported here indicate that the Rpf family of growth factors may provide interesting opportunities for preventing and treating mycobacterial infections.
EXPERIMENTAL PROCEDURES Organisms and media Micrococcus luteus NCIMB 13267 ('Fleming strain 2665') was grown in LMM (Kaprelyants and Kell, 1993) at 30°C in conical flasks on an orbital shaker. Mycobacterium bovis (BCG) was obtained from the Central Institute for Scientific Research on Tuberculosis, Moscow, Russia. Cultures (3 ml) were grown at 37°C in 10 ml tubes with tightly fitting screw caps without shaking in Sauton's medium supplemented with ADC (Connell, 1994) and 0.05% Tween 80. Mycobacterium smegmatis mc2155 was grown aerobically at 37°C in Sauton's medium. Cell viability by plating Dilutions in LMM (M. luteus) and Sauton's medium (M. smegmatis) were plated in triplicate on agar-solidified plates containing nutrient broth E (NBE - LabM) and incubated for 3 days at 30°C for M. luteus, or 37°C for M. smegmatis. Dilutions of M. bovis (BCG) were made in Sauton's medium supplemented with 0.05% Tween 80, spread on agar-solidified Sauton's medium supplemented with ADC (Connell, 1994) and incubated at 37°C for 3-4 weeks. Suspensions of all organisms were passed 10 times through a 23-gauge needle to break up loose cell aggregates before dilution. Bacterial growth kinetics For the experiment shown in Fig. 4A, M. smegmatis strains containing
pAGH or pAGM0 were grown overnight to stationary phase in NBE containing 20 ΅g
hygromycin ml
Production of recombinant proteins Recombinant Rpf was obtained as previously described (Mukamolova et al.,
1998). The five rpf-like genes from M. tuberculosis were amplified
from H37Rv DNA using the following primer pairs (EcoRI, NcoI,
NdeI and BamHI restriction sites introduced for cloning purposes are
in italics): Rv0867F (CCAGAATTCATATGGCTCAGGCGACCGCGGCCACC) +Rv0867R (TGGCGGATCCTATCAGCCGATGACGTACGCT
G); Rv1009F (5'-GTGGCCATGGGCATATGGCAAGCAAAAC
GGTGACGTTGA3') + Rv1009R (5'CAGCCGGATCCTCAGC GCGCACCCGCT-3'); Rv1884F
(5'-TCCTGAATTCATATGGG TCCCAGCCCGAACTGG-3') + Rv1884R (5'-CATGGGATC CGTCAGCGCGGAATACTTG-3');
Rv2389F (5'-ATCAGAAT TCATATGGACGACATCGATTGGGACGC-3') + Rv2389R (5'-CGCAGGATCCCCTCAATCGTCCCTGCTCC-3');
Rv2450F (5'-TGGAGA ATTCATATGGACGACGCGGGCTTGGA-3') + Rv2450R (5'-TCTTGGATCCTATCAGCCGCGGCGGCCGC
A-3'). Amplification produced derivatives of each gene lacking their 5' ends,
predicted to encode signal sequences or N-terminal trans-membrane
helices/anchors ( Activity assay Growth of M. luteus and M. smegmatis was monitored in a
Bioscreen C growth analyser (Labsystems, Finland) using a 600 nm filter. Freshly
prepared recombinant proteins diluted 1 : 100 in the appropriate growth medium
were sterilised by filtration (0.22 ΅m, Gelman) and then serially diluted in
growth medium either 30- or 10-fold, for assays with M. luteus and M.
smegmatis respectively. After breaking up aggregates (see above), late log
cultures (OD600 = 3.5-4.0 for M. luteus; OD600 = 3.0-3.5
for M. smegmatis) were serially diluted using growth medium. Samples
(5 ΅l) of each dilution (five to ten replicates) were added to wells containing
medium (200 ΅l), together with serially diluted protein. Incubation was at 30°C
(M. luteus) or 37°C (M. smegmatis) with continuous shaking on the
high setting. Measurements were taken hourly for 240 h. Mycobacterium bovis
(BCG) bioassays were in tubes (see above) inoculated with cells (102
Antibody purification and Western blotting Rabbits were immunized three times at 3-week intervals by subcutaneous
injection with 1 ml of a 50% (v/v) mixture of Rpf (1 mg ml
For Western blotting, 1 ml of a 3-week-old culture of M. bovis (BCG)
Russian strain, grown in Sauton's medium supplemented with ADC and 0.05%
Tween-80, was washed twice with Sauton's medium to remove traces of ADC and
inoculated into 100 ml Sauton's medium in a 500 ml flask. Growth was for 3 weeks
at 37°C without shaking. For M. smegmatis, growth was for 16 h
(overnight) with shaking in Sauton's medium (lacking ADC and Tween-80). A
protease inhibitor cocktail was added to the cultures 30 min before harvesting
and incorporated into all buffer solutions, according to the manufacturer's
instructions (Roche). After centrifugation, culture supernatants were filtered
(0.22΅m) and proteins present were concentrated using DEAE-Sepharose 6B and CM
cellulose column chromatography. The DEAE-Sepharose 6B fast flow column,
equilibrated with buffer A (20 mM TrisHCl, pH 7.5; 20 mM KCl, 1 mM EDTA, 1 mM
DTT) bound all detectable Rpf-like proteins. The column was washed with 5 Confocal microscopy Cells from early logarithmic phase (OD600 = 0.25) grown in Sauton's medium supplemented with ADC and 0.05% Tween-80, were centrifuged, washed with PBS and fixed in 0.1% glutaraldehyde in PBS for 30 min at 37°C. After washing with PBS, cells were incubated in PBS containing 5% BSA for 30 min at 37°C with shaking, before treatment with sheep anti-truncated Rpf antibodies at 1 : 1000 dilution in PBS containing 2% BSA. After incubation for 1 h at 37°C with shaking, cells were washed three times with PBS, containing 0.2% Tween-80. The bacteria were then incubated in PBS, containing 2% BSA and FITC-conjugated donkey anti-sheep IgG antibodies at a 1 : 500 dilution (Sigma, cat. no. F7634). After washing (as described above) cells were examined using a BioRad MRC1024ES confocal microscope with excitation at 488 nm (100 mW argon laser). Effect of anti-Rpf antibodies on bacterial growth Mycobacterium bovis (BCG) (102 cfu from a 2-week-old culture or 106 cfu from a 6-week-old culture) and M. tuberculosis Academia strain (105 cfu from a 2-month-old culture) were inoculated into 3 ml Sauton's medium supplemented with ADC and 0.05% Tween-80. Rabbit anti-Rpf antibodies were added and growth was monitored by measuring the OD600. For the experiment shown in Fig. 7C, a 20 ml culture was established in a 100 ml conical flask without shaking and growth was monitored by plating on agar-solidified Sauton's medium supplemented with ADC. Expression of rpf in M. smegmatis The rpf gene was introduced into M. smegmatis under the control of the Pami promoter (Parish et al., 1997) in plasmid pAGM0. The construction of this plasmid and the vector, pAGH, from which it is derived, was described by (Mukamolova et al. (2002). Plasmid pAGM1 is similar to pAGM0 except that Pami generates a counter-transcript of rpf. Reverse transcriptase-PCR Specific primer pairs were designed for each of the five rpf-like
genes of M. tuberculosis (the corresponding regions of the cognate genes
in M. bovis are identical): RT0867F (5'-TATGAGTGGACGCCACCGTAA
ACKNOWLEDGEMENTS We thank R. McAdam for providing M. smegmatis strain mc2155 and DNA from M. tuberculosis H37Rv, P. Butcher and J. Mangan for M. tuberculosis RNA, S. Biketov for rabbit anti-Rpf serum, A. Apt for M. tuberculosis H37Rv culture supernatant and S. Taylor for assistance with the confocal microscopy. We thank Sarah Hardy who constructed the plasmid expressing recombinant RpfB. We are also most grateful to Mike Barer and an anonymous referee for their constructive comments on the manuscript. This work was supported by grants from the UK BBSRC, the Russian Foundation for Basic Research (grant 00-04-48691), the WHO Global Programme for Vaccines and Immunization and the Wellcome Trust. Some of the experiments were carried out when O.A.T. was in receipt of a Royal Society/NATO Fellowship.
REFERENCES Aldovini, A., Husson, R.N., and Young, R.A. (1993) The uraA locus and homologous recombination in Mycobacterium bovis BCG. J Bacteriol 175: 7282-7289. Arruda, S., Bomfim, G., Knights, R., Huimabyron, T., and Riley, L.W. (1993) Cloning of a Mycobacterium tuberculosis DNA fragment associated with entry and survival inside cells. Science 261: 1454-1457. Bateman, A., and Bycroft, M. (2000) The structure of a LysM domain from E. coli membrane-bound lytic murein transglycosylase D (MltD). J Mol Biol 299: 1113-1119. Behr, M.A., Wilson, M.A., Gill, W.P., Salamon, H., Schoolnik, G.K., Rane, S., and Small, P.M. (1999) Comparative genomics of BCG vaccines by whole-genome DNA microarray. Science 284: 1520-1523. Biketov, S., Mukamolova, G.V., Potapov, V., Gilenkov, E., Vostroknutova, G., Kell, D.B., Young, M., and Kaprelyants, A.S. (2000) Culturability of Mycobacterium tuberculosis cells isolated from murine macrophages: a bacterial growth factor promotes recovery. FEMS Immunol Med Microbiol 29: 233-240. Bloom, B.R., and Murray, C.J.L. (1992) Tuberculosis - commentary on a reemergent killer. Science 257: 1055-1064. Callard, R., and Gearing, A. (1994) The Cytokine Facts Book. London: Academic Press. Chambers, S.P., Prior, S.E., Barstow, D.A., and Minton, N.P. (1988) The pMTL nic- cloning vectors. 1. Improved pUC polylinker regions to facilitate the use of sonicated DNA for nucleotide sequencing. Gene 68: 139-149. Clewell, D.B. (1993) Bacterial sex pheromone-induced plasmid transfer. Cell 73: 9-12. Cole, S.T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., et al. (1998) Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393: 537-544. Connell, N.D. (1994) Mycobacterium: isolation, maintenance, transformation, and mutant selection. Methods Cell Biol 45: 107-125. Dubos, R.J., and Davis, B.D. (1946) Factors affecting the growth of tubercle bacilli in liquid media. J Exp Med 83: 409-423. Dye, C., Scheele, S., Dolin, P., Pathania, V., and Raviglione, R.C. (1999) Consensus statement. Global burden of tuberculosis - estimated incidence, prevalence, and mortality by country. WHO Global Surveillance Monitoring Project JAMA 282: 677-686. Flynn, J.L., and Chan, J. (2001) Tuberculosis: latency and reactivation. Infect Immun 69: 4195-4201. Franklin, T.J. (1980) Binding energy and the activation of hormone receptors. Biochem Pharmacol 29: 853-856. Fuqua, C., and Greenberg, E.P. (1998) Self perception in bacteria: quorum sensing with acylated homoserine lactones. Curr Opin Microbiol 1: 183-189. Fuqua, W.C., Winans, S.C., and Greenberg, E.P. (1994) Quorum sensing in bacteria the LuxR-LuxI family of cell density-responsive transcriptional regulators. J Bacteriol 176: 269-275. Fuqua, C., Winans, S.C., and Greenberg, E.P. (1996) Census and consensus in bacterial ecosystems: the LuxR-LuxI family of quorum-sensing transcriptional regulators. Annu Rev Microbiol 50: 727-751. Gero, A. (1983) Desensitization, two-state receptors and pharmacological parameters. J Theoret Biol 103: 137-161. Gomez, L., Johnson, S., and Gennaro, M.L. (2000) Identification of secreted proteins of Mycobacterium tuberculosis by a bioinformatic approach. Infect Immun 68: 2323-2327. Hernandez-Pando, R., Jeyanathan, M., Mengistu, G., Aguilar, D., Orozco, H., Harboe, M., Rook, G.A.W., and Bjune, G. (2000) Persistence of DNA from Mycobacterium tuberculosis in superficially normal lung tissue during latent infection. Lancet 356: 2133-2138. Hφner zu Bentrup, K., and Russell, D.G. (2001) Mycobacterial persistence: adaptation to a changing environment. Trends Microbiol 9: 597-605. Horinouchi, S., and Beppu, T. (1994) A-factor as a microbial hormone that controls cellular differentiation and secondary metabolism in Streptomyces griseus. Mol Microbiol 12: 859-864. Kaiser, D., and Losick, R. (1993) How and why bacteria talk to each other. Cell 73: 873-885. Kaprelyants, A.S., and Kell, D.B. (1993) Dormancy in stationary-phase cultures of Micrococcus luteus: flow cytometric analysis of starvation and resuscitation. Appl Environ Microbiol 59: 3187-3196. Kaprelyants, A.S., and Kell, D.B. (1996) Do bacteria need to communicate with each other for growth? Trends Microbiol 4: 237-242. Kaprelyants, A.S., Gottschal, J.C., and Kell, D.B. (1993) Dormancy in non-sporulating bacteria. FEMS Microbiol Rev 104: 271-286. Kaprelyants, A.S., Mukamolova, G.V., and Kell, D.B. (1994) Estimation of dormant Micrococcus luteus cells by penicillin lysis and by resuscitation in cell-free spent medium at high dilution. FEMS Microbiol Lett 115: 347-352. Kaprelyants, A.S., Mukamolova, G.V., Kormer, S.S., Weichart, D.H., Young, M., and Kell, D.B. (1999) Intercellular signalling and the multiplication of prokaryotes: bacterial cytokines. Symp Soc Gen Microbiol 57: 33-69. Kell, D.B., Kaprelyants, A.S., and Grafen, A. (1995) Pheromones, social behaviour and the functions of secondary metabolism in bacteria. Trends Ecol Evol 10: 126-129. Kell, D.B., and Young, M. (2000) Bacterial dormancy and culturability: the role of autocrine growth factors. Curr Opin Microbiol 3: 238-243. Kell, D.B., Kaprelyants, A.S., Weichart, D.H., Harwood, C.L., and Barer, M.R. (1998) Viability and activity in readily culturable bacteria: a review and discussion of the practical issues. Antonie Van Leeuwenhoek 73: 169-187. Kleerebezem, M., Quadri, L.E.N., Kuipers, O.P., and de Vos, W.M. (1997) Quorum sensing by peptide pheromones and two-component signal-transduction systems in Gram-positive bacteria. Mol Microbiol 24: 895-904. Lazazzera, B.A., and Grossman, A.D. (1998) The ins and outs of peptide signaling. Trends Microbiol 6: 288-294. Lim, A., Eleuterio, M., Hutter, B., Murugasu-Oei, B., and Dick, T. (1999) Oxygen depletion-induced dormancy in Mycobacterium bovis BCG. J Bacteriol 181: 2252-2256. McCune, R.M., Feldman, F.M., Lambert, H., and McDermott, W. (1966) Microbial persistence. I. The capacity of tubercle bacilli to survive sterilization in mouse tissues. J Exp Med 123: 224-268. McDermott, W. (1958) Microbial persistence. Yale J Biol Med 30: 257. Manganelli, R., Voskuil, M.I., Schoolnik, G.K., and Smith, I. (2001) The Mycobacterium tuberculosis ECF sigma factor E: role in global gene expression and survival in macrophages. Mol Microbiol 41: 423-437. Mukamolova, G.V., Kormer, S.S., Yanopolskaya, N.D., and Kaprelyants, A.S. (1995) Properties of dormant cells in stationary-phase cultures of Micrococcus luteus during prolonged incubation. Microbiology 64: 284-288. Mukamolova, G.V., Kaprelyants, A.S., Young, D.I., Young, M., and Kell, D.B. (1998) A bacterial cytokine. Proc Natl Acad Sci USA 95: 8916-8921. Mukamolova, G.V., Kormer, S.S., Kell, D.B., and Kaprelyants, A.S. (1999) Stimulation of the multiplication of Micrococcus luteus by an autocrine growth factor. Arch Microbiol 172: 9-14. Mukamolova, G.V., Turapov, O.A., Kazaryan, K., Telkov, M., Kaprelyants, A.S., Kell, D.B., and Young, M. (2002) The rpf gene of Micrococcus luteus encodes an essential secreted growth factor. Mol Microbiol 46: 611-621. Ohnishi, Y., Kameyama, S., Onaka, H., and Horinouchi, S. (1999) The A-factor regulatory cascade leading to streptomycin biosynthesis in Streptomyces griseus: identification of a target gene of the A-factor receptor. Mol Microbiol 34: 102-111. Pai, S.R., Actor, J.K., Sepulveda, E., Hunter, R.L. Jr and Jagannath, C. (2000) Identification of viable and non-viable Mycobacterium tuberculosis in mouse organs by directed RT-PCR for antigen 85B mRNA. Microb Pathog 28: 335-342. Parish, T., Mahenthiralingam, E., Draper, P., Davis, E.O., and Colston, M.J. (1997) Regulation of the inducible acetamidase gene of Mycobacterium smegmatis. Microbiology 143: 2267-2276. Parrish, N.M., Dick, J.D., and Bishai, W.R. (1998) Mechanisms of latency in Mycobacterium tuberculosis. Trends Microbiol 6: 107-112. Salmond, G.P.C., Bycroft, B.D., Stewart, G.S.A.B., and Williams, P. (1995) The bacterial 'enigma': cracking the code of cell-cell communication. Mol Microbiol 16: 615-624. Sherman, D.R., Voskuil, M., Schnappinger, D., Liao, R., Harrell, M.I., and Schoolnik, G.K. (2001) Regulation of the M. tuberculosis hypoxic response gene alpha-crystallin. Proc Natl Acad Sci USA 98: 7534-7539. Shleeva, M.O., Bagramyan, K., Telkov, M.V., Mukamolova, G.V., Young, M., Kell, D.B., and Kaprelyants, A.S. (2002) Formation and resuscitation of 'non-culturable' cells of Rhodococcus rhodochrous and Mycobacterium tuberculosis in prolonged stationary phase. Microbiology 148: 1581-1591. Sun, Z., and Zhang, Y. (1999) Spent culture supernatant of Mycobacterium tuberculosis H37Ra improves viability of aged cultures of this strain and allows small inocula to initiate growth. J Bacteriol 181: 7626-7628. Votyakova, T.V., Kaprelyants, A.S., and Kell, D.B. (1994) Influence of viable cells on the resuscitation of dormant cells in Micrococcus luteus cultures held in extended stationary phase. The population effect. Appl Env Microbiol 60: 3284-3291. Wayne, L.G. (1960) The bacteriology of resected tuberculous pulmonary lesions. II. Observations on bacilli which are stainable but which cannot be cultured. Am Rev Resp Dis 82: 370-377. Wayne, L.G. (1984) Mycobacterial speciation. In The Mycobacteria: a Sourcebook. Kubica, G.P., and Wayne, L.G. (eds). New York: Marcel Dekker, pp. 25-65. Wayne, L.G. (1994) Dormancy of Mycobacterium tuberculosis and latency of disease. Eur J Clin Microbiol Infect Dis 13: 908-914. Wayne, L.G., and Sohaskey, C.D. (2001) Nonreplicating persistence of Mycobacterium tuberculosis. Annu Rev Microbiol 55: 139-163. de Wit, D., Wootton, M., Dhillon, J., and Mitchison, D.A. (1995) The bacterial DNA content of mouse organs in the Cornell model of dormant tuberculosis. Tuber Lung Dis 76: 555-562. Young, D.B., and Duncan, K. (1995) Prospects for new interventions in the treatment and prevention of mycobacterial disease. Annu Rev Microbiol 49: 641-673. Yuan, Y., Crane, D.D., and Barry, C.E. III (1996) Stationary phase-associated protein expression in Mycobacterium tuberculosis: function of the mycobacterial alpha-crystallin homolog. J Bacteriol 178: 4484-4492. Zhang, Y., Yang, Y., Woods, A., Cotter, R.J., and Sun, Z. (2001) Resuscitation of dormant Mycobacterium tuberculosis by phospholipids or specific peptides. Biochem Biophys Res Commun 284: 542-547.
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||
70-residue segment (Fig. 1A). Rpf is a secreted protein. Therefore the
SignalP and TMMHM servers at the Technical University of Denmark (
http://www.cbs.dtu.dk/services/SignalP/and
http://www.cbs.dtu.dk/services/TMHMM-2.0 /) were used to determine whether the
five Rpf-like proteins of M. tuberculosis are also likely to be secreted. Two of
them, RpfA (Rv0867c, 407 aa) and RpfD (Rv2389c, 154 aa) were predicted to be
secreted proteins - see also Gomez et al. (2000).
1),
the apparent lag phase was substantially reduced in the Rpf-expressing strain
compared with that of the control containing the pAGH vector (Fig. 4A). This
effect was observed in the presence of either kanamycin or hygromycin, used to
select for plasmid maintenance and also in the absence of either antibiotic
(data not shown). It was also observed in the absence of acetamide, consonant
with the report that this promoter is partially active in the absence of inducer
(Parish et al., 1997). Growth stimulation was not apparent at a higher
inoculum density (105 cfu ml
106
cells per ml) from cultures of different ages (10 days
vol
buffer A and eluted with 3 