Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Molecular Microbiology, 2000, Aug, 37(3), 595-605

Loss of  Cmk1  Ca²⁺-calmodulin-dependent protein kinase  in yeast results in constitutive weak organic acid resistance,  associated with a post-transcriptional activation  of the  Pdr12 ATP-binding  cassette transporter

Caroline D. Holyoak, Suzanne Thompson, Claudia Ortiz Calderon, Kostas Hatzixanthis, Bettina Bauer, Karl Kuchler, Peter W. Piper and Peter J. Coote

ABSTRACT

Yeast cells display an adaptive stress response when exposed to weak organic acids at low pH. This adaptation is important in the spoilage of preserved foods, as it allows growth in the presence of weak acid food preservatives. In Saccharomyces cerevisiae, this stress response leads to strong induction of the Pdr12 ATP-binding cassette (ABC) transporter, which catalyses the active efflux of weak acid anions from the cytosol of adapted cells. S. cerevisiae cells lacking the Cmk1 isoform of Ca²⁺-calmodulin-dependent protein kinase are intrinsically resistant to weak acid stress, in that they do not need to spend a long adaptive period in lag phase before resuming growth after exposure to this stress. This resistance of the cmk1 mutant is Pdr12 dependent and, unlike with wild-type S. cerevisiae, cmk1 cells are capable of performing Pdr12-specific functions such as energy-dependent cellular extrusion of fluorescein and benzoate. However, they have neither higher PDR12 gene promoter activity nor higher Pdr12 protein levels. The increased Pdr12 activity in cmk1 cells is therefore caused by Cmk1 exerting a negative post-transcriptional influence over the activity of the Pdr12 ABC transporter, a transporter protein that is constitutively expressed in low-pH yeast cultures. This is the first preliminary evidence that shows a protein kinase, either directly or indirectly, regulating the activity of a yeast ABC transporter.

INTRODUCTION

Stress responses are important in the adaptation events that allow pathogenic and spoilage organisms to survive and grow in many food materials. One such response enables spoilage yeasts to adapt and grow in the presence of the highest levels of weak organic acids currently allowed in food preservation. In Saccharomyces cerevisiae, this weak acid adaptation involves the induction of the Pdr12 ATP-binding cassette (ABC) transporter(Piper et al., 1998), a plasma membrane pump that catalyses active efflux of weak organic acid anions from the cytosol (Holyoak et al., 1999). Pdr12 is essential for growth in the presence of weak organic acid stress, a pdr12 mutant being severely compromised in its ability to grow at low pH in the presence of millimolar levels of sorbic, benzoic or acetic acid (Piper et al., 1998). This ABC transporter also mediates broad resistance to other water-soluble weak acids, including monocarboxylic acids of aliphatic chain length from C1 to C7. However, it does not provide resistance to more lipophilic carboxylic acids of longer aliphatic chain length (Holyoak et al., 1999). Pdr12 is also the transporter that specifically catalyses the energy-dependent extrusion of fluorescein from the yeast cytosol, a property that has allowed the direct measurement and visualization of its activity in vivo. Sorbic and benzoic acids competitively inhibit this Pdr12- and energy-dependent efflux of fluorescein from weak acid-adapted S. cerevisiae, providing further evidence that sorbate and benzoate anions are actively transported out of the cell by Pdr12 (Holyoak et al., 1999).

Fluctuations in intracellular Ca²⁺ levels are known to initiate responses to environmental stimuli in a wide variety of cell types. One of the principal mediators of this Ca²⁺ signal in eukaryotic cells is calmodulin, a small Ca²⁺-binding protein. Upon binding Ca²⁺, calmodulin changes its conformation, forming the Ca²⁺-calmodulin complex that controls the activity of several key regulatory enzymes. In mammalian cells, this Ca²⁺-calmodulin complex provides the essential ability to decode Ca²⁺ signals, acting to modulate the activities of a large number of protein kinases, the protein phosphatase calcineurin, nucleotide cyclases and phosphodiesterases, Ca²⁺ transporters and nitric oxide synthases (Dupont and Goldbeter, 1998; Van Eldik and Watterson, 1998). In S. cerevisiae, calmodulin is an essential protein, yet this essential function can still be performed by mutant proteins that do not bind Ca²⁺ (Geiser et al., 1993). The yeast Ca²⁺-calmodulin complex is therefore dispensable for viability, even though it normally functions as an activator of a number of regulatory proteins. Notable Ca²⁺-calmodulin targets are calcineurin and the type II Ca²⁺-calmodulin-activated protein kinases (CaMKs) (Ohya et al., 1991; Pausch et al., 1991; Melcher and Thorner, 1996). Calcineurin is important as a regulator of cation homeostasis in yeast (for a review, see Matheos et al., 1997). Its loss causes defects in the adaptation to osmostress (Garrett-Engele et al., 1995; Danielsson et al., 1996), attributable in part to a failure to activate genes for the ENA1/PMR2A-encoded plasma membrane sodium ion efflux pump and, to a lesser extent, the TRK1-encoded potassium ion uptake system (Mendoza et al., 1994).

Four genes in the S. cerevisiae genome encode homologues of mammalian CaMKs, which are responsible for decoding intracellular Ca²⁺ ion fluctuation in terms of a Ca²⁺-mediated physiological response (Dupont and Goldbeter, 1998). These are CMK1, CMK2 (Ohya et al., 1991; Pausch et al., 1991) and the more recently described CLK1(CMK3) and RCK1 (Melcher and Thorner, 1996). Cmk1 has a rather broad substrate specificity in vitro, its activity being greatly stimulated by Ca²⁺-calmodulin (Ohya et al., 1991; Pausch et al., 1991). In contrast, Clk1 does not appear to be Ca²⁺-calmodulin dependent in vitro, even though it shares sequence homology with CaMKs andcan phosphorylate a substrate in vitro (yeast EF2 protein) not recognized by Cmk1 (Melcher and Thorner, 1996). Initial studies failed to identify any phenotype associated with the loss of either CMK1 or CMK2 (Ohya et al., 1991; Pausch et al., 1991). Also, a yeast strain lacking all four putative CaMK genes ( cmk1, cmk2, clk1, rck1) has no apparent deleterious phenotype under standard conditions of yeast growth (Melcher and Thorner, 1996). However, Cmk1 has been shown to be required for cells to adapt to heat stress (Iida et al., 1995).

The signal transduction systems that detect weak acid stress and lead to the induction of Pdr12 still remain to be identified. This stress is associated with a dramatic increase in energy consumption and a decline in ATP levels (Piper et al., 1997), which may lead to an energy crisis for the cell. Normal maintenance of a low cytosolic Ca²⁺ level relies upon energy-dependent systems for pumping Ca²⁺ from the cytosol. We have therefore investigated whether yeast mutants defective in Ca²⁺ signalling have altered weak acid resistance. In this study, we show that yeast strains lacking Cmk1, but not those lacking Cmk2, display a constitutive resistance to the growth inhibitory effects of these acids. This reinforces the evidence that Cmk1 is an important determinant of yeast stress resistances. This constitutive weak acid-resistant phenotype of cmk1 strains is dependent on a functional PDR12 gene and associated with increased activity, although not increased levels, of the Pdr12 ABC transporter.

RESULTS

Loss of CMK1 causes constitutive resistance to sorbic acid and benzoic acid

In agreement with earlier studies (Ohya et al., 1991; Pausch et al., 1991; Melcher and Thorner, 1996), we found that the loss of either CMK1 or CMK2 has relatively little effect on the normal growth of S. cerevisiae, even at low pH [pH 3.8 (data not shown) and pH 4.5; Fig. 1A]. From our previous work (Holyoak et al., 1996; 1999; Piper et al., 1997; 1998), we would expect the application of subinhibitory levels of weak acid stress to vegetative cells (0.9 mM sorbic acid at pH 4.5) to cause strong growth inhibition, followed by the recommencement of growth after a long (at least 7-10 h) adaptive lag period. This was indeed observed when unadapted cmk2 and wild-type cells were inoculated at low cell density (see Experimental procedures) into medium containing this amount of sorbate (Fig. 1B). However, the same level of sorbic acid had very little inhibitory effect on the Bioscreen growth of pH 4.5 or pH 3.8 (data not shown) cmk1 or cmk1, cmk2 cultures, which displayed growth profiles very similar to those of control cells not treated with sorbate (Fig. 1B). The same cmk1 and cmk1, cmk2 strains also displayed a constitutive resistance to the growth-inhibitory effects of 0.9 mM benzoic acid at pH 4.5, whereas a high resistance to sorbate and benzoate was also displayed by cells that lack all isoforms of CaMK (strain JT-YMM20, Table 1; data not shown). It is apparent, therefore, that cmk1 cells do not display the normal long growth arrest after the application of weak acid stress. Thus, lack of Cmk1 is clearly resulting in constitutive resistance to the inhibitory effects of weak acids.

The effects of higher concentrations of sorbic and benzoic acid were also studied. In accordance with our observations on other S. cerevisiae strains (Holyoak et al., 1996; 1999; Piper et al., 1997; 1998), the growth of wild-type and cmk2 cells at pH 4.5 was significantly inhibited by concentrations of sorbic acid above 1.8 mM. However, growth of cmk1 and cmk1, cmk2 cells was virtually unaffected by sorbic acid levels up to 4.5 mM (Fig. 2A). Interestingly, prior adaptation of all four strains to weak acid stress, by extended growth at pH 4.5 in the presence of 1.8 mM sorbic acid followed by inoculation into medium containing different levels of sorbic acid, resulted in a total absence of any Cmk1 influence over the capacity for subsequent growth (Fig. 2B). All four adapted strains were equally resistant and displayed similar capacities for growth in the presence of concentrations of sorbic acid up to 6.75 mM (Fig. 2B). Identical results were also obtained upon exposure of these adapted strains to equivalent increasing concentrations of benzoic acid (data not shown). Therefore, although Cmk1 loss eliminates the need for a period of adaptation to weak acid stress (Figs 1B and 2A), it has no influence on the acid resistance of cells that have been grown for a long period in the presence of this stress (Fig. 2B).

To confirm further that Cmk1 loss causes constitutive resistance to weak acids, 1.57 mM sorbic acid was added to mid-exponential phase pH 4.5 flask cultures of strains YOJ211-9A, -9B, -9C and -9D (Table 1), and its effects on subsequent growth were measured relative to untreated control cultures (Fig. 3A and B). Sorbic acid addition again strongly inhibited the growth of the wild-type and cmk2 strains. However, the same acid addition caused only a minor inhibition of the growth of the cmk1 and cmk1, cmk2 cells (Fig. 3A and B). This confirms that Cmk1 loss results in constitutive resistance to weak acids, such that cmk1 cells can grow in the presence of this stress without any requirement for a considerable adaptive period in lag phase (Figs 1-3).

The weak acid resistance with loss of Cmk1 is dependent on the activity of the Pdr12 ABC transporter

To determine whether the constitutive weak acid resistance of cmk1 cells is dependent on the Pdr12 transporter, we investigated whether this resistance was also displayed by a cmk1, pdr12 strain. The pdr12 strains PP817 and PP813, isogenic but for the loss of Cmk1 in the former (Table 1), were indistinguishable as regards their sensitivity to various weak acids. The cmk1, pdr12 strain did not display the constitutive resistance to sorbic acid shown by the cmk1 deleted strain (Fig. 3C). Similar results were obtained when the same cells were exposed to benzoic acid at pH 4.5 (data not shown). Thus, the constitutive weak acid resistance of cmk1 cells is dependent on a functional Pdr12 transporter.

We have shown previously that the Pdr12 ABC transporter confers resistance to the inhibitory effects of water-soluble, monocarboxylic acids with aliphatic carbon chain lengths from C1 to C7 (Holyoak et al., 1999). To identify whether the deletion of CMK1 would confer a similar profile of resistance to carboxylic acids, we exposed strains YOJ211-9A, -9B, -9C and -9D (Table 1) to monocarboxylic acids of differing aliphatic carbon chain lengths. Compared with the wild-type and cmk2 strains, the cmk1 and cmk1, cmk2 cells were considerably more resistant over a period of 100 h to the inhibitory effects of 40 mM formic (C1), 50 mM acetic (C2), 40 mM propionic (C3), 30 mM butyric (C4), 5 mM valeric (C5), 1 mM caproic (C6) and 1 mM heptanoic (C7) acids (Fig. 4). However, all four strains were similar in their sensitivities to even longer chain length fatty acids. For example, 0.025 mM caprylic (C8) acid and 0.025 mM nonanoic (C9) acid inhibited the growth of all the strains for approximately 70 and 80 h respectively (Fig. 4). The constitutive weak acid resistance with Cmk1 loss is therefore to the more water-soluble monocarboxylic acids of carbon chain length C1-C7, and not to more lipophilic, longer chain monocarboxylic acids. It is noteworthy that this profile of resistances to various weak acids conferred by Cmk1 loss is essentially identical to the profile of resistances conferred by the Pdr12 ABC transporter (Holyoak et al., 1999).

Loss of Cmk1 leads to a constitutive capacity for Pdr12-catalysed extrusion of fluorescein from the yeast cytosol

During weak acid adaptation, S. cerevisiae cells induce the Pdr12 ABC transporter to a high level in the plasma membrane (Piper et al., 1998). We recently developed an in vivo assay for Pdr12 activity, based on the finding that this is the transporter that specifically catalyses the energy-dependent efflux of fluorescein from the yeast cytosol (Holyoak et al., 1999). Using this assay, we tested whether cells lacking Cmk1, pregrown in the absence of weak acid, constitutively express an activity that can efflux fluorescein upon the addition of an energy source (glucose). This would also indicate whether the constitutive resistance phenotype of these strains is associated with high Pdr12 transporter activity.

Strains YOJ211-9A, -9B, -9C and -9D were grown at pH 4.5 without sorbic acid, and the cells were subsequently loaded with fluorescein diacetate. Such conditions of growth do not induce sufficient Pdr12 transporter activity for the observation of appreciable energy-dependent fluorescein efflux from wild-type cells (Holyoak et al., 1999), even though the PDR12 gene is partially induced by growth at low pH, and Pdr12 protein is induced at appreciable levels in the plasma membrane of pH 4.5-grown cells (Piper et al., 1998). We were therefore not surprised to observe no efflux of fluorescein from the wild-type strain YOJ211-9A upon the addition of an energy source in the form of glucose, and only a very minor efflux of fluorescein from the cmk2 cells (Fig. 5A). However, the addition of glucose to the non-sorbate-pretreated cmk1 and cmk1, cmk2 cells resulted in four- to sixfold increases in fluorescein efflux (Fig. 5A). In agreement with earlier work (Holyoak et al., 1999), this efflux was found to be completely dependent on Pdr12, as no efflux was observed from cmk1, pdr12 cells (data not shown).

When preadapted to weak acid stress by growth in the presence of a level of sorbic acid (0.45 mM) that causes strong induction of the Pdr12 transporter (Piper et al., 1998), then loaded with fluorescein, strains YOJ211-9A, -9B, -9C and -9D showed similar rates of dye efflux in response to glucose (Fig. 5B). This is consistent with the other experiments showing that it is only unadapted cells that show any weak acid resistance effects of Cmk1 loss (Figs 1B and 2).

To visualize the energy-dependent efflux of fluorescein, strains YOJ211-9A, -9B, -9C and -9D (Table 1) were also examined by phase-contrast and fluorescence microscopy. The cells of all five strains grown at pH 4.5 without sorbic acid and then loaded with fluorescein in pH 4.5 buffer were initially highly fluorescent (data not shown). However, 1 h after glucose addition, the cmk1 and cmk1, cmk2 cells had lost considerably more fluorescence from the cytosol than the wild-type and cmk2 cells. After 2 h exposure to glucose, intracellular fluorescein had been effluxed from most of the cmk1 and cmk1, cmk2 cells, whereas the levels of fluorescein within the CMK1+ cells remained virtually the same as at the time of glucose addition (data not shown). These visual observations clearly support the quantitative measurements of fluorescein efflux in Fig. 5A.

Cmk1 loss results in a constitutive capacity for energy-dependent extrusion of benzoate

Studies using [¹⁴C]-benzoate have shown that cells adapted to growth in the presence of weak organic acids maintain lower levels of intracellular benzoate than would be expected on the basis of equilibration of this weak acid across the cell membrane, consistent with the existence of an active extrusion process (Verduyn et al., 1992; Henriques et al., 1997). This extrusion, which can be measured as an increased capacity for energy-dependent efflux of [¹⁴C]-benzoate from adapted cells, is impaired in the weak acid-sensitive pdr12 mutant (Piper et al., 1998).

We tested whether the constitutive resistance of non-weak acid-pretreated cmk1 cells was correlated with an increased capacity for active efflux of radiolabelled benzoate. Strains YOJ211-9A, -B, -C and -D (Table 1) were initially grown to mid-exponential phase at pH 4.5, either in the absence or in the presence of 0.45 mM sorbic acid (cells 'unadapted' and 'adapted' to weak acid stress respectively). They were then resuspended in pH 4.5 buffer, and [¹⁴C]-benzoate was added. This resulted in rapid uptake of the label, as the benzoate (pK _a 4.19) diffuses into the cells as undissociated acid and then accumulates inside the cells (Fig. 6). This accumulation probably occurs because the acid dissociates in the higher pH environment of the cytosol, in order to generate the acid anion. The latter, being charged, cannot readily leave the cell except by an active extrusion process. Twelve minutes after the benzoate addition, a pulse of glucose was added leading, as observed in earlier studies (Henriques et al., 1997; Piper et al., 1998), to almost immediate efflux of most of the radiolabelled benzoate from the 'adapted' cells (those pregrown with sorbate; Fig. 6B). This energy-dependent benzoate efflux by these weak acid-adapted cells results substantially from Pdr12 activity (Piper et al., 1998). However, even with 'unadapted' wild-type cells (Fig. 6A) or with cells of the pdr12 mutant (Piper et al., 1998), a more limited benzoate efflux occurs upon glucose addition, an efflux that preliminary experiments indicate may be caused in part by the activity of ABC transporters other than Pdr12 (unpublished data). Unadapted YOJ211-9A (wild-type) and YOJ211-9B ( cmk2) cells both displayed this more limited benzoate efflux (Fig. 6A). However, almost all the intracellular [¹⁴C]-benzoate was effluxed with the addition of glucose to the non-sorbate-pretreated cmk1 and cmk1, cmk2 cells (Fig. 6A). This extent of benzoate efflux by these non-acid-pretreated cmk1 and cmk1, cmk2 cells is normally only seen with wild-type cells after preadaptation to weak acid stress (Fig. 6B). Cells lacking Cmk1 therefore constitutively express the capacity for active benzoate extrusion, even without prior exposure to weak acid stress. This is consistent with the other experiments (Fig. 5) showing a high constitutive Pdr12 ABC transporter activity in these cells.

The increased Pdr12 activity with the loss of Cmk1 is not the result of increased PDR12 gene transcription

To determine whether the loss of Cmk1 activates the PDR12 promoter, we measured the activity of a PDR12 promoter-LacZ gene fusion introduced into strains YOJ211-9A, -B, -C and -D on plasmid pPWP(PDR12-773) (see Experimental procedures). The PDR12 promoter has an activator element that is unresponsive to a wide range of different stresses (heat shock, ethanol, osmostress, oxidative stress). However, this same element is moderately activated by growth at acid pH (pH 4.5) and strongly activated by weak organic acid stress (maximally by 0.5-1 mM sorbate in pH 4.5 cultures and 8 mM sorbate in pH 6.8 cultures; unpublished results). Measurements of PDR12 promoter-LacZ expression in strains YOJ211-9A, -9B, -9C and -9D revealed both the basal and the maximally sorbate-induced levels of PDR12 promoter activity to be essentially unaffected by the loss of either Cmk1 or Cmk2 (data not shown). Northern blot analysis also showed no increases in PDR12 gene transcript levels in non-weak acid-treated cmk1 cells (data not shown). It follows, therefore, that Cmk1 loss is not increasing transcription of the PDR12 gene. Instead, it must be acting to increase Pdr12 transporter activity by a post-transcriptional mechanism.

Cmk1 loss does not influence the Pdr12 protein levels of cells grown in the absence of weak acid stress

Pdr12 protein is expressed in the plasma membrane of yeast cells growing at pH 4.5, although at a lower level than in cells subjected to severe weak acid stress (Piper et al., 1998). As PDR12 gene transcription is not influenced by the loss of Cmk1, the Pdr12 transporter must be either more active, or more stable, in cmk1 compared with wild-type cells that have not been pretreated with weak acid. To investigate the latter possibility, we analysed the levels of Pdr12 protein levels in unadapted YOJ211-9A, -9B, -9C and -9D. The steady-state levels of this transporter were not increased in non-sorbate-pretreated pH 4.5 cmk1 or cmk1, cmk2 cultures (Fig. 7A). The sorbate-induced levels of Pdr12 are also largely unaffected by the loss of all CaMK isoforms in yeast, Pdr12 appearing to be a protein that is relatively stable in such cells (Fig. 7C). This indicates that the loss of Cmk1 is not stabilizing an otherwise rapidly turning over Pdr12 protein. Together, the available data are fully consistent with Cmk1 acting, not by any repression of PDR12 transcription or increase in Pdr12 turnover rate, but through a decrease in the activity of the Pdr12 transporter expressed in low-pH cultures of wild-type cells not subject to weak acid stress.

Western blots of 12.5% gels (Fig. 7A and B) revealed the presence of forms of Pdr12 protein with differing gel mobility. These different forms did not resolve on blots of 7.5% gels (Fig. 7C). The slowly migrating forms in Fig. 7A are consistent with a phosphorylated state of Pdr12, as phosphatase digestion of the protein samples before gel fractionation caused conversion of these slowly migrating Pdr12 forms to the more rapidly migrating form (Fig. 7B). However, neither the total amount of Pdr12 in cells nor this phosphorylation of Pdr12 were appreciably influenced by the loss of Cmk1 (Fig. 7A). The Pdr12 phosphorylation that these gels detect is therefore not correlated with the Cmk1 regulation of Pdr12 activity.

FIGURES

Fig 1.  Bioscreen cultures of S. cerevisiae

Fig 2.  The time taken for unadapted (A) or weak acid-adapted (B) S. cerevisiae;

Fig 3.  The effects of adding sorbic acid to mid-exponential cultures of S. cerevisiae

Fig 4.  The time taken for non-weak acid-adapted wild-type S. cerevisiae cells (solid bars)

Fig 5.  Efflux of fluorescein from S. cerevisiae

Fig 6.  Efflux of radiolabelled benzoic acid from S. cerevisiae

Fig 7.  A. Western blot analysis of Pdr12 protein levels  

Table 1.  Yeast strains used in this study.

DISCUSSION

This study identifies a distinct role for the Cmk1 isoform of yeast CaMK as a negative regulator of resistance to weak organic acids. Future studies will investigate whether this regulation involves a control over Cmk1 activity exerted by Ca²⁺-calmodulin signalling. It is already known that Ca²⁺-calmodulin, through its effects on calcineurin, regulates a number of the membrane-bound inorganic ion pumps of yeast (Matheos et al., 1997; Stathopoulos and Cyert, 1997).

The sorbic and benzoic acid-resistant phenotype of cmk1 cells is very similar to that of wild-type cells that have become adapted to weak acid stress through growth in the presence of subinhibitory levels of these preservatives ( Figs 2B, 5B and 6B ). It is manifested as an almost complete lack of any growth inhibition after the addition of sorbic or benzoic acid to low-pH cmk1 cultures, in amounts that normally induce prolonged periods of cell stasis (Figs 1-3). Despite the importance of CaMKs in decoding the intracellular Ca²⁺ signals in mammalian cells (Dupont and Goldbeter, 1998; Van Eldik and Watterson, 1998), the homologues of these kinases in yeast are all non-essential. Strains lacking all four putative CaMK genes (CMK1, CMK2, CLK1 and RCK1) are viable and appear to have no apparent deleterious phenotype under standard culture conditions (Melcher and Thorner, 1996). Cmk1 and Cmk2 also have different substrate specificities, and Cmk2 displays activation by autophosphorylation that is not seen with Cmk1 (Ohya et al., 1991). It would therefore not be surprising if Cmk1 and Cmk2 have different functions. Our results reinforce the notion that Cmk1 may play a significant role in yeast adaptation to stress. An earlier study (Iida et al., 1995) showed that cmk1 cells cannot induce maximal thermotolerance levels in response to heat shock stress. In contrast, this investigation reveals that the weak acid resistance of these same cells is constitutively high. However, both studies independently identify a role for Cmk1 rather than other CaMK isoforms in stress resistance determination.

Adaptation of S. cerevisiae to water-soluble weak organic acids requires high activity of the Pdr12 ABC transporter, this being needed for active extrusion of preservative anions from the cytosol (Piper et al., 1998; Holyoak et al., 1999). Without an active efflux process, these anions will accumulate to very high levels in acid-stressed cells. In aerobic S. cerevisiae, this anion accumulation is associated with severe oxidative stress, the growth inhibition of acid-stressed pdr12 cells being substantially reversed with loss of superoxide dismutase activities (Piper, 1999). The primary defence of S. cerevisiae against weak acid anion accumulation is the extrusion of these anions by the Pdr12 ABC transporter. Thus, Pdr12 is induced to very high levels in the plasma membrane of weak acid-adapted yeast cells, such that its levels approach those of the most abundant plasma membrane protein, the plasma membrane H⁺-ATPase (Piper et al., 1998). However, Pdr12 is also induced, although at lower level, in cells in low-pH growth (Piper et al., 1998). Our data are fully consistent with Cmk1 being a negative regulator of the activity of this Pdr12 expressed in low-pH cultures. The evidence for this is: first, that non-acid-pretreated cmk1 strains have the same constitutive resistances to monocarboxylic weak acids (Fig. 2A) as weak acid-adapted cells (Holyoak et al., 1999), resistances that are Pdr12 dependent. Secondly, the same non-sorbate-pretreated cmk1 cells are capable of energy-dependent extrusion of fluorescein from the cytosol (Fig. 5), a Pdr12-dependent function normally displayed only by cells preadapted to weak acid stress (Holyoak et al., 1999). Finally, non-adapted cells lacking Cmk1 can catalyse active efflux of radiolabelled benzoate from the cytosol to an extent normally seen with wild-type cells only after they have adapted to weak acid stress (Fig. 6).

Cmk1 loss is resulting in increased activity of the Pdr12 transporter protein expressed in pH 4.5 cultures (Figs 4-6). It is not stimulating PDR12 gene expression (data not shown) or elevating the Pdr12 protein levels of cmk1 strains not pretreated with weak acid (Fig. 7A). However, it is not clear whether Cmk1 is negatively regulating the Pdr12 transporter by phosphorylating this protein directly or acting indirectly by phosphorylating a modulator of Pdr12. The apparent Pdr12 phosphorylation that we have detected is clearly independent of Cmk1 (Fig. 7A). Pdr12 has a number of sequences that might be potential CaMK recognition motifs (Kemp and Pearson, 1990). Unfortunately, establishing their function is not straightforward, as the S. cerevisiae PDR12 gene is toxic to Escherichia coli cells (unpublished observations), with the result that construction of point mutants within this gene is difficult.

Weak acid adaptation appears to be a discrete, multifaceted stress response of yeast cells, a response that has so far received relatively little attention at the molecular level. This study indicates that counteracting severe weak acid stress at low pH probably involves the removal of a negative Cmk1 control over Pdr12 activity, thereby allowing a high Pdr12-catalysed acid anion efflux from the cytosol. Activity of Cmk1 may keep Pdr12 inactive as a transporter in low-pH cultures until its action is required. Weak organic acids are only a major threat to homeostasis in low-pH cultures. It is therefore tempting to speculate that Pdr12 may be present in the plasma membrane of cells growing at low pH so that these cells can be poised to respond rapidly to weak acid stress.

There are other important aspects to weak acid adaptation besides induction of high Pdr12 activity. Adaptation has to involve increasing the activity of the plasma membrane H⁺-ATPase, in order to counteract the intracellular acidification caused by weak acid dissociation in the cytosol (Holyoak et al., 1996; Piper et al., 1997). Cmk1 might also participate in these events, as the C-terminal regulatory domain of yeast plasma membrane H⁺-ATPase is a potential site of CaMK phosphorylation (for a review, see Braley and Piper, 1997). Also, in adapting cells, mechanisms have to be set in place at either the cell wall or the plasma membrane that reduce the diffusional entry of undissociated weak acid to the cell, otherwise the Pdr12- and H⁺-ATPase-catalysed efflux of acid anions and protons would lead to an energetically wasteful futile cycle of diffusional acid entry and active efflux of acid anions and protons (Warth, 1989; Henriques et al., 1997; Holyoak et al., 1999).

EXPERIMENTAL PROCDURES

Yeast strains and yeast culture

The S. cerevisiae strains used in this study are listed in Table 1. They were cultured essentially as described in earlier reports (Holyoak et al., 1996; 1999; Piper et al., 1997; 1998).

Weak acid sensitivity

Cultures of strains YOJ211-9A, -B, -C and -D (Table 1) were diluted in fresh YEPD, pH 4.5, and either inoculated into the wells of a Bioscreen microtitre plate (100-well honeycomb; Life Sciences International) or inoculated into flasks to give an inoculum size of 5.0  10³ cells ml ¹ as described previously (Piper et al., 1997; Holyoak et al., 1999). The stated concentrations of formic (C1), acetic (C2), propionic (C3), butyric (C4), valeric (C5), caproic (C6), heptanoic (C7), caprylic (C8), nonanoic (C9), capric (C10), sorbic or benzoic acid were then added to the wells or flasks. Growth at 30°C with continuous shaking was monitored by change in optical density (OD) at 600 nm in either a Labsystems Bioscreen automated turbidometric analyser (Life Sciences International) or a spectrophotometer (Phillips PU8630).

Measurement of fluorescein efflux from whole cells

Cell suspensions of S. cerevisiae YOJ211-9A, -B, -C and -D were loaded with fluorescein diacetate exactly as described previously (Holyoak et al., 1999). Loaded cells were transferred to a 50 ml magnetically stirred jacketed heating vessel at 30°C, and fluorescein efflux was started by the addition of 10 mM glucose. Samples of 1 ml (containing 1.8 mg of dry weight cells) were taken at set time intervals over a period of 5 min, and the cells were removed by rapid centrifugation (13 000 g for 4 min). Levels of fluorescein in the supernatant were measured in a magnetically stirred, optically clear, quartz cuvette (Helma; Fisher Scientific) using a Shimadzu RF-1501 fluorometer. To measure supernatant fluorescence, all readings followed an excitation scan between 400 and 500 nm with emission set at 525 nm (bandwidths 10 nm). Supernatant fluorescence intensity data were collected at an excitation wavelength of 435 nm (pH-independent point; Bracey et al., 1998). This was carried out over a 10 min time period after the addition of glucose.

Fluorescence microscopy

To visualize levels of intracellular fluorescein and subsequent energy-dependent efflux of the dye, cells were studied by confocal scanning laser microscopy (CSLM). The cells were visualized using a Bio-Rad MRC 600 CSLM fitted with a 20 mW krypton-argon mixed gas laser (Bio-Rad) and an objective magnification of 60 (Nikon  60 oil, 1.4 numerical aperture, Plan Apo objective). Split-screen images were acquired using dual-channel collection mode. The first channel was a transmitted illumination phase-contrast image; the second channel was an epifluorescent image of intracellular fluorescein (excitation line 488 nm). Each image was averaged over at least three frames to reduce background noise.

Measurement of benzoic acid efflux

This was exactly as described previously (Piper et al., 1998), except that 10 µCi [7-¹⁴C]-benzoic acid (740 mBq mmol ¹; NEN) was used in each experiment.

Measurement of PDR12 promoter activity

Plasmid pPWP(PDR12-773) bearing a gene that would act as a reporter of PDR12 promoter activity (PDR12-LacZ) was generated by substituting the -773 to +6 region of PDR12 for corresponding HSP12 promoter sequences within the YCp50-based vector pUP41a (Watt and Piper, 1997). This PDR12 region was first polymerase chain reaction (PCR) amplified from yeast genomic DNA using the primers ATAGAATTCAAAGATGGATTGTTTACCAGC and CTGGGATCCAGACATTTTTTTATTAATAAGAAC (EcoR1 and BamH1 sites, respectively, underlined), then digested with EcoR1 and BamH1 and, finally, ligated into EcoR1 plus BamH1-cleaved pUP41a. pPWP(PDR12-773) was transformed into S. cerevisiae YOJ211-9A, -B, -C and -D by selection for uracil prototrophy.

Western blot analysis

Total protein extracts were prepared either by a described procedure of extracting cells with trichloroacetic acid (Egner et al., 1995) or, alternatively, by resuspending the cell pellet in two volumes of extraction buffer (Panaretou and Piper, 1992), adding an equivalent volume of glass beads and disrupting the cells in a bead beater for 1 min, then allowing the beads to settle for 1 min on ice. The total protein concentrations of all extracts was determined by Bio-Rad protein assay. Samples (each of 5 µg of total cell protein) were incubated for 2 min at 80°C in gel sample buffer, then fractionated on 7.5% or 12.5% PAGE, Western blotted and the blots analysed for Pdr12 protein levels as described earlier (Piper et al., 1998). For phosphatase digestion, 20 µg of protein extract was diluted 1:5 with 1 mM ZnCl₂, 1 mM MgCl₂, 0.1 M glycine-HCl, pH 10.4, then incubated for 60 min at 37°C with 1 U of bacterial alkaline phosphatase (Sigma P-4252), before the addition of 5 µl of protein to gel sample buffer (30 µl), a 2 min heating at 80°C and application to the protein gel.

ACKNOWLEDGEMENTS

We would like to thank Professors Y. Anraku and J. Thorner for providing yeast strains; also Helen Hunt and Angelika Kren for technical help with fluorescence microscopy and immunoblotting experiments. This work was supported by Biotechnology and Biological Sciences Research Council (BBSRC) grant 31/D10371 (P.W.P.); Austrian Science Foundation FWF project P-12661-BIO (K.K.); a CASE studentship supported by BBSRC and Unilever (S.T.) and a British Council exchange grant (K.K. and P.W.P.).

REFERENCES

•    Bracey, D., Holyoak, C.D., Coote, P.J. (1998) Comparison of the inhibitory effect of sorbic acid and amphotericin B on Saccharomyces cerevisiae: is growth inhibition dependent on reduced intracellular pH? J Appl Microbiol 85: 1056-1066.

•    Braley, R. & Piper, P.W. (1997) The C-terminus of yeast plasma membrane H+-ATPase is essential for the regulation of this enzyme by heat shock protein Hsp30, but not for stress activation. FEBS Lett 418: 123-126.

•    Danielsson, A., Larsson, C., Larsson, K., Gustafsson, L., Adler, L. (1996) A genetic analysis of the role of calcium and calmodulin in Ca++ dependent improvement of NaCl tolerance of Saccharomyces cerevisiae. Curr Genet 30: 476-484.

•    Dupont, G. & Goldbeter, A. (1998) CaM kinase II as frequency decoder of Ca2+ oscillations. Bioessays 20: 607-610.

•    Egner, R., Mahé, Y., Pandjaitan, R., Kuchler, K. (1995) Endocytosis and vacuolar degradation of the plasma membrane localized Pdr5 ATP binding cassette multidrug transporter in Saccharomyces cerevisiae. Mol Cell Biol 15: 5879-5887.

•    Garrett-Engele, P., Moilanen, B., Cyert, M.S. (1995) Calcineurin, the Ca2+/calmodulin-dependent protein phosphatase, is essential in yeast mutants with cell integrity defects and in mutants that lack a functional vacuolar H+-ATPase. Mol Cell Biol 8: 4103-4114.

•    Geiser, J.R., Sundberg, H.A., Chang, B.H., Muller, E.G.D., Davis, T.N. (1993) The essential mitotic target of calmodulin is the 110-kilodalton component of the spindle pole body in Saccharomyces cerevisiae. Mol Cell Biol 13: 7913-7924.

•    Henriques, M., Quintas, C., Loureiro-Dias, M.C. (1997) Extrusion of benzoic acid in Saccharomyces cerevisiae by an energy-dependent mechanism. Microbiology 143: 1877-1883.

•    Holyoak, C.D., Stratford, M., McMullin, Z., Cole, M.B., Crimmins, K., Brown, A.J., et al. (1996) Activity of the plasma membrane H(+)-ATPase and optimal glycolytic flux are required for rapid adaptation and growth of Saccharomyces cerevisiae in the presence of the weak-acid preservative sorbic acid. Appl Environ Microbiol 62: 3158-3164.

•    Holyoak, C.D., Bracey, D., Piper, P.W., Kuchler, K., Coote, P.J. (1999) The Saccharomyces cerevisiae weak acid-inducible ABC transporter Pdr12 transports fluorescein and preservative anions from the cytosol by an energy-dependent mechanism. J Bacteriol 181: 4644-4652.

•    Iida, H., Ohya, Y., Anraku, Y. (1995) Calmodulin-dependent protein kinase II and calmodulin are required for induced thermotolerance in Saccharomyces cerevisiae. Curr Genet 27: 190-193.

•    Kemp, B.E. & Pearson, R.B. (1990) Protein kinase recognition sequence motifs. Trends Biochem Sci 15: 342-346.

•    Matheos, D.P., Kingsbury, T.J., Ahsan, U.S., Cunningham, K.W. (1997) Tcn1p/Crz1p, a calcineurin-dependent transcription factor that differentially regulates gene expression in Saccharomyces cerevisiae. Genes Dev 11: 3445-3458.

•    Melcher, M.L. & Thorner, J. (1996) Identification and characterisation of the CLK1 gene product, a novel Cam kinase-like protein from the yeast Saccharomyces cerevisiae. J Biol Chem 271: 29958-29968.

•    Mendoza, I., Rubio, F., Rodriguez-Navarro, A., Pardo, J.M. (1994) The protein phosphatase calcineurin is essential for NaCl tolerance of Saccharomyces cerevisiae. J Biol Chem 269: 8792-8796.

•    Ohya, Y., Kawasaki, H., Suzuki, K., Londesborough, J., Anraku, Y. (1991) Two yeast genes encoding calmodulin-dependent protein kinases; isolation, sequencing and bacterial expressions of CMK1 and CMK2. J Biol Chem 266: 12784-12794.

•    Panaretou, B. & Piper, P.W. (1992) The plasma membrane of yeast acquires a novel heat-shock protein (hsp30) and displays a decline in proton-pumping ATPase levels in response to both heat shock and the entry to stationary phase. Eur J Biochem 206: 635-640.

•    Pausch, M.H., Kaim, D., Kunisawa, R., Admon, A., Thorner, J. (1991) Multiple Ca2+/calmodulin-dependent protein kinase genes in a unicellular eukaryote. EMBO J 6: 1511-1522.

•    Piper, P.W. (1999) Yeast superoxide dismutase mutants reveal a prooxidant action of weak organic acid food preservatives. Free Radic Biol Med 27: 1219-1227.

•    Piper, P.W., Ortiz-Calderon, C., Holyoak, C., Coote, P., Cole, M. (1997) Hsp30, the integral plasma membrane heat shock protein of Saccharomyces cerevisiae, is a stress-inducible regulator of plasma membrane ATPase. Cell Stress 2: 12-24.

•    Piper, P., Mahé, Y., Thompson, S., Pandjaitan, R., Holyoak, C., Egner, R., et al. (1998) The Pdr12 ABC transporter is required for the development of weak organic acid resistance in yeast. EMBO J 17: 4257-4265.

•    Sikorski, R.S. & Hieter, P. (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122: 19-27.

•    Stathopoulos, A.M. & Cyert, M.S. (1997) Calcineurin acts through the CRZ1/TCN1-encoded transcription factor to regulate gene expression in yeast. Genes Dev 11: 3432-3444.

•    Van Eldik, L.J. & Watterson, D.M. (1998) Calmodulin and Signal Transduction. New York: Academic Press.

•    Verduyn, C., Postma, E., Scheffers, W.A., Van Dijken, J.P. (1992) Effect of benzoic acid on metabolic fluxes in yeasts: a continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast 8: 501-517.

•    Warth, A.D. (1989) Transport of benzoic and propanoic acids by Zygosaccharomyces bailii. J Gen Microbiol 135: 1383-1390.

•    Watt, R. & Piper, P.W. (1997) UBI4, the polyubiquitin gene of Saccharomyces cerevisiae, is a heat shock gene that is also subject to catabolite repression control. Mol Gen Genet 253: 439-447.

(order Full Text from publisher)

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005