|
| |
Scientific
Publications - Work Done by Microbiology Reader Bioscreen C
Molecular
Microbiology, 2001, 40 (5), 1227-1239
Pleiotropic transcriptional repressor CodY senses the intracellular pool
o f branched-chain amino acids in Lactococcus lactis
|
Eric Guédon,
Pascale Serror, S. Dusko Ehrlich, Pierre Renault and Christine
Delorme* |
|
ABSTRACT
Proteolysis is essential for supplying Lactococcus lactis with
amino acids during growth in milk. Expression of the major components of the L.
lactis proteolytic system, including the cell wall proteinase (PrtP), the
oligopeptide transport system (Opp) and at least four intracellular peptidases
(PepO1, PepN, PepC, PepDA2), was shown previously to be controlled negatively by
a rich nitrogen source. The transcription of prtP, opp-pepO1, pepN and pepC
genes is regulated by dipeptides in the medium. Random insertion mutants
derepressed for nitrogen control in the expression of the oligopeptide transport
system were isolated using an opp-lacZ fusion. A third of the mutants were
targeted in the same locus. The product of the inactivated gene shared 48%
identity with CodY from Bacillus subtilis, a pleiotropic repressor of the
dipeptide permease operon (dpp) and several genes including genes involved in
amino acid degradation and competence induction. The signal controlling
CodY-dependent repression was searched for by analysing the response of the
opp-lux fusion to the addition of 67 dipeptides with different amino acid
compositions. Full correlation was found between the dipeptide content in
branched-chain amino acids (BCAA; isoleucine, leucine or valine) and their
ability to mediate the repression of opp-pepO1 expression. The repressive effect
resulting from specific regulatory dipeptides was abolished in L. lactis mutants
affected in terms of their transport or degradation into amino acids, showing
that the signal was dependent on the BCAA pool in the cell. Lastly, the
repression of opp-pepO1 expression was stronger in a mutant unable to degrade
BCAAs, underlining the central role of BCAAs as a signal for CodY activity. This
pattern of regulation suggests that, in L. lactis and possibly other
Gram-positive bacteria, CodY is a pleiotropic repressor sensing nutritional
supply as a function of the BCAA pool in the cell.
|
| |
| INTRODUCTION Many bacteria, such as
most members of the Streptococcaceae family, are auxotrophic for several
amino acids. Bacteria belonging to this family generally live in
nutritionally rich ecological niches such as plants, human mucosa and milk.
Free amino acids are not abundant in these environments, and amino acid
supply is mainly provided in the form of peptides or proteins. These
nitrogen sources require the action of peptidases and transport systems in
order to obtain the necessary amino acids for bacteria growth. Among
Streptococcaceae, Lactococcus spp. are the paradigm for studying
protein degradation and peptide utilization (reviewed by Kunji et al., 1996;
Christensen et al., 1999). The proteolytic system of Lactococcus lactis is
composed of about 20 enzymes and, among them, proteinase, transport systems
and several intracellular peptidases have homologues in other Streptococcus
spp. As dairy strains are auxotrophic for leucine (L), isoleucine (I),
valine (V) and histidine, L. lactis growth is strictly dependent on protein
degradation during milk fermentation (Delorme et al., 1993; Godon et al.,
1993; Juillard et al., 1998). Degradation of caseins (milk proteins) is
initiated by the extracellular proteinase PrtP that is bound to the cell
wall (Hugenholtz et al., 1987; Juillard et al., 1995; 1998). Peptides
produced by PrtP are then internalized by three transport systems, one for
oligopeptides (Opp) and two for di-tripeptides (DtpT and DtpP) (Tynkkynen
et al., 1993; Foucaud et al., 1995). Internalized peptides are hydrolysed
further by more than 15 intracellular peptidases (Kunji et al., 1996). A
summary scheme of the peptide utilization pathway, stressing the
constitution of the branched-chain amino acids (BCAA) pool, is presented in
Fig. 1.
In a previous work, the regulation of 16 genes encoding the proteolytic
system of L. lactis was systematically analysed under different
environmental conditions using transcriptional fusions with luciferase
reporter genes (Guédon et al., 2001). We showed that the expression of six
transcriptional units is repressed in the presence of rich nitrogen sources
such as casein hydrolysates, casitone and casamino acids (CAA). The
co-regulated genes correspond to the extracellular proteinase (prtP ), the
oligopeptide transport operon and one of the four endopeptidases
(opp-pepO1), one of the three dipeptidases (pepDA2 ) and three of the four
aminopeptidases (pepN, pepC, pepX) (Guédon et al., 2001). The transcription
of these co-regulated genes thus probably responds to the same signal.
In other Gram-positive bacteria, such as Bacillus subtilis and
Streptococcus pneumoniae, the expression of several genes has also been
shown to be dependent on a rich nitrogen source such as CAA. In B.
subtilis, the products of CAA-regulated genes are involved in various
metabolic pathways, including nitrogen metabolism (Slack et al., 1991;
Fisher et al., 1996; Wray et al., 1997; Débarbouilléet al., 1999), the
development of competence (Serror and Sonenshein, 1996a) and chemotaxis
(Mirel et al., 2000). The dipeptide permease operon (dpp) is one of them.
Analysis of its regulation has led to the identification of the CodY
regulator (Slack et al., 1993; 1995). The CodY protein has been found to
mediate the CAA-dependent regulation not only of dpp expression but
also of the histidine degradative operon (hut ), the urease
structural genes (ureABC ), the isoleucine and valine degradative
operon (bkd ), the
 -aminobutyric
acid permease gene (gabP ), the flagellin gene (hag) and two
genes required for the development of competence (comK and srfA)
(Slack et al., 1995; Ferson et al., 1996; Fisher et al., 1996; Serror and
Sonenshein, 1996a; Wray et al., 1997; Débarbouilléet al., 1999; Mirel
et al., 2000). CodY has also been shown to be a DNA-binding protein that
binds to the promoter regions of dpp, comK and srfA(Serror
and Sonenshein, 1996a, b). CAA is a mixture of amino acids and oligopeptides
and constitutes a rich nitrogen source. Although the precise nature of the
signal recognized by CodY in CAA-dependent regulation is still unknown, it
has been suggested that the signal could be the reflection of the
nutritional state of the cell, suggesting that the CodY regulator mediates
nutritional repression (Slack et al., 1995; Ferson et al., 1996; Fisher
et al., 1996; Wray et al., 1997; Fisher, 1999; Mirel et al., 2000).
We and others have demonstrated previously in L. lactis that
dipeptides LP and PL form part of the signal mediating the regulation
dependent on a rich nitrogen source (Marugg et al., 1995; Guédon et al.,
2001). The expression of at least four transcriptional units (prtP,
opp-pepO1, pepN and pepC) encoding products involved in the initial steps of
casein degradation are negatively regulated by these two dipeptides,
although the strength of repression is lower than in the presence of
casitone (Guédon et al., 2001). In this work, we have identified several
regulatory dipeptides involved in the regulation of these genes.
Characterization of the peptide signal was performed using mutants in the
transport and degradation of peptides. In parallel, random insertion
mutagenesis allowed us to select mutants unable to respond to the peptide
signal and to identify the L. lactis CodY regulator. |
|
RESULTS
|
|
Regulation of opp-pepO1 transcription depends
on dipeptide composition
The transcription of the opp-pepO1 operon encoding the
oligopeptide transport system of L. lactis is controlled by two
promoters, PoppD localized upstream of the operon and PoppA
upstream of the last two genes, oppA and pepO1 (Tynkkynen et al., 1993;
Guédon et al., 2001). We have shown previously that a complex mixture of
peptides, such as casein hydrolysates (casitone and CAA), induces 40- to
150-fold repression of the transcription of both promoters (Guédon et al.,
2001). Moreover, two specific dipeptides, LP and PL, also repress opp-pepO1
transcription, but only about 10-fold. In order to discover whether other
dipeptides have a regulatory role, we tested the effect of 65 new dipeptides
on the expression of PoppA fused to lux genes (Table 1). Each was added
independently. Maximal luciferase activity was detected in chemically
defined medium (CDM) containing 18 amino acids as the nitrogen source
(5040 ± 300 lux OD
 1
[103]) (see Experimental procedures). The expression of
the PoppA-lux fusion was not influenced by the supplementation of 31
out of the 67 dipeptides [activities between 3000 and 5500 lux OD
1
[103]). Lastly, the addition of 36 dipeptides to CDM led to a
five- to 10-fold reduction in luciferase expression (500-1000 lux OD
1
[103]). Dipeptides with or without an effect on PoppA-lux
will be referred to as regulatory or inactive dipeptides respectively. A
sample of nine inactive and 16 regulatory dipeptides was used to check their
effect on the expression of PoppD, the second promoter of the
opp-pepO1 operon (Table 1). The expression of luciferase from the PoppD-lux
fusion was maximal in CDM supplemented or not with inactive dipeptides
(2820 ± 160 lux OD
1
[103] and 2000-3200 lux OD
1
[103] respectively). In contrast, luciferase activity was four-
to sevenfold lower in the presence of regulatory dipeptides (400-700 lux OD
1
[103]). The two opp-pepO1 promoters are thus negatively
regulated by a set of regulatory dipeptides. Remarkably, the 36 regulatory
dipeptides contain at least one of the three branched-chain amino acids
(BCAAs), I, L and V (Table 1). Conversely, none of the inactive peptides
contain BCAAs. From another point of view, we did not find other features
common to regulatory peptides, such as hydrophobicity, PI and PM. Therefore,
BCAA content might be the determining feature for the regulatory activity of
dipeptides. |
|
Uptake of dipeptides is required for the repression
of opp-pepO1 transcription
As shown above, dipeptides containing BCAAs are somehow involved in the
repression of L. lactis opp-pepO1 transcription. We wondered whether
this signal is transduced from the external medium by a specialized system
or internalized into the cell. In order to address this question,
opp-pepO1 expression was measured in a mutant impaired in the transport
of several regulatory dipeptides. A dtpT mutant was constructed and
tested for its inability to transport several regulatory dipeptides. Four
regulatory dipeptides, LV, AL, KL and TL, were added independently as the
sole leucine source in CDM (depleted in free L) and tested for their ability
to sustain the growth of the wild type and dtpT mutant. Indeed, L.
lactis MG1363 is auxotrophic for L and could only grow if an L source
(free L or peptides containing L) is available in the medium (Godon et al.,
1993). L. lactis MG1363 grew at a similar growth rate in CDM
containing free L or one of the four dipeptides. In contrast, the dtpT
mutant was not able to grow in CDM depleted in free L and containing KL or
TL dipeptides as the sole leucine source (data not shown). KL and TL are
thus only transported in L. lactis MG1363 by the DtpT transport
system (Fig. 1). The growth of the dtpT mutant was similar to that of
the wild type with LV and slightly slower with AL as the leucine source (µmax
0.13 versus 0.16 h
1).
These results showed that LV and AL were transported by DtpP. However, DtpP
could not fully compensate the DtpT defect for AL transport.
The PoppD-lux fusion was transferred by conjugation in the
dtpT strain. The effect of CDM supplementation with LV, AL, KL and TL
dipeptides on PoppD-lux expression was measured (Table 2). The
addition of TL or KL, which are transported exclusively by DtpT, reduced
luciferase activity 4.5- to fivefold in the wild-type strain, whereas they
had no significant effect on the dtpT mutant. The addition of LV,
which is not transported specifically by DtpT, reduced luciferase activity
eight- and 4.5-fold in the wild-type and mutant strains respectively. These
results showed that only internalized regulatory dipeptides can repress
opp-pepO1 transcription. Regulatory dipeptides thus have to be
transported into the cell to exert their repressor effect on opp-pepO1
expression. The absence or low level of regulation upon addition of AL to
the dtpT mutant indicates that the uptake of this dipeptide is
insufficient to induce full repression, in accordance with the observation
that AL uptake might limit the growth of the dtpT strain in a medium
without leucine. |
|
Cleavage of dipeptides is required for the repression
of opp-pepO1 transcription
Repression of opp-pepO1 transcription requires internalized
regulatory dipeptides. The regulatory signal could thus be either dipeptides
or products of their cleavage. To discriminate between these two hypotheses,
we measured the expression of the opp-pepO1 operon in a mutant unable
to hydrolyse several regulatory dipeptides. The prolidase of L. lactis,
PepQ, is the only lactococcal dipeptidase able to hydrolyse X-Pro dipeptides
(Fig. 1) (Booth et al., 1990; Christensen et al., 1999). A MG1363 pepQ
mutant deficient in prolidase activity was constructed and tested for its
inability to degrade LP and VP dipeptides by monitoring its growth with
these dipeptides as sole L or V sources as described above. Indeed, MG1363
is also auxotrophic for V. As expected, unlike the wild-type strain, the
pepQ mutant was not able to grow in CDM depleted in free L or V and
containing LP or VP dipeptides as the sole L or V source respectively. The
pepQ mutant was thus unable to hydrolyse LP or VP dipeptides (Fig. 1).
The PoppD-lux fusion was transferred by conjugation into
the pepQ strain. The effect of adding LP and VP dipeptides to CDM on
PoppD-lux expression was measured (Table 3). The addition of LP or
VP, which are specifically degraded by PepQ, reduced luciferase activity
eightfold in the wild-type strain, whereas it had no significant effect in
the pepQ mutant. As a control, the addition of PL, which is cleaved
by other peptidases, reduced luciferase activity eight- and sevenfold in the
wild-type and the mutant strains respectively. Regulatory dipeptides should
thus be cleaved in the cell to exert their repressor effect on opp-pepO1
expression. These results showed that the regulatory signal is not the
dipeptides themselves but the products of their cleavage or the breakdown
products of amino acids. As the presence of BCAAs in dipeptides was required
for regulation, it was likely that BCAAs or derivative products of BCAAs
were the signal for opp-pepO1 repression. |
|
BCAAs are directly involved in the repression of
opp-pepO1 transcription
As shown above, the regulatory signal for opp-pepO1 expression
could be BCAAs or their breakdown products. In order to test whether
degradation products of BCAAs could be the signal for opp-pepO1
repression, we measured the expression of this operon in a mutant unable to
catabolize BCAAs. In L. lactis, the first step in BCAA degradation is
transamination catalysed by two aminotransferases, the BCAA aminotransferase
(BcaT) active on the three BCAAs and the aromatic aminotransferase (AraT)
active on leucine (Fig. 1) (Rijnen et al., 1999; Yvon et al., 2000). In a
double bcaT araT mutant, the transformation of BCAAs into keto acids is
completely abolished and might lead to BCAA accumulation in the cell (Yvon
and Rijnen, 2001).
A PoppD-lux fusion was transferred into a double bcaT
araT mutant by conjugation. The effect of the bcaT araT mutation
on PoppD-lux expression was measured in the presence and absence of
regulatory dipeptides (PL, LP, VP) (Table 3). In all conditions, luciferase
activities were fivefold lower in the mutant strain compared with the
wild-type strain. Nevertheless, the regulatory dipeptides led to the same
repression range of eight- to 13-fold in the mutant as in the wild type.
These results showed that opp-pepO1 expression was still repressed by
regulatory dipeptides in the bcaT araT mutant and indicated that the
regulatory signal was not a product of BCAA catabolism. In the absence or
presence of the regulatory dipeptides, opp-pepO1 repression was
fivefold stronger when BCAA degradation was abolished, suggesting that BCAA
accumulation was responsible for a greater repression of opp-pepO1
expression in the bcaT araT mutant (Table 3). Therefore, the signal
for peptide-dependent regulation of opp-pepO1 expression could be
intracellular BCAAs or a product of a secondary metabolism that depends on
BCAA availability in the cell. |
|
Identification of a transcriptional regulator for
opp-pepO1 expression
To identify genetic factors involved in the repression of opp-pepO1
transcription by peptides, we searched for mutations that derepressed
opp-pepO1 expression in a medium containing a mixture of peptides. The
mutagenesis was performed by random insertion of pGhost8-ISS1 into
JIM7605, a MG1363 strain containing the promoterless lacZ gene under
the control of the PoppA promoter region. In the presence of Xgal,
this strain gave blue colonies in CDM, whereas the colonies were white in
M17. This observation reflected the 150-fold repression of transcription
from the PoppA in cells grown in peptide-rich media such as M17
(Guédon et al., 2001). Mutants derepressed for PoppA
expression upon insertion of pGhost8-ISS1 were thus selected as blue
clones on M17 plates containing Xgal. From 50 000 colonies containing
pGhost8-ISS1 integrated into the chromosome, 42 blue clones were
isolated. To ensure that they resulted from a single insertion event,
chromosomal DNA of these clones was analysed by Southern blot hybridization.
Of the 42 mutants, 15 shared the same restriction pattern and might thus
contain an insertion of pGhost8-ISS1 at the same locus. Chromosomal
DNA fragments flanking the pGhost8-ISS1 of 13 insertion sites were
rescued in Escherichia coli and sequenced. The 13 insertions occurred
in the same region of the chromosome, as the most distant insertions were
795 bp apart. The analysis of the sequence revealed that 12 insertions were
distributed in a single open reading frame (ORF), and one was 25 bp upstream
of its start codon. This ORF encodes a peptide of 262 amino acids sharing
48% identity (67% similarity) on its entire length with CodY of Bacillus
subtilis and with several putative gene products from partially
sequenced genomes of Gram-positive bacteria. The alignment of these proteins
and the location of ISS1 insertion leading to the interruption of the
protein in L. lactis are presented in Fig. 2. It is interesting to
note that the highest conservation is within the helix-turn-helix (HTH)
motif region of the protein (Fig. 2; Serror and Sonenshein, 1996b). A
potential promoter with
35
and imperfect extended
10
boxes (TTGTTT and TGGTATACT respectively) might
initiate transcription about 49 bp upstream of the ORF start codon. A
putative rho-independent terminator is located 76 bp downstream of the ORF
stop codon. Northern blot analysis showed that the ORF is transcribed as a
single transcript of 1 kb (data not shown). pGhost8-ISS1 was also
inserted at two other loci, and similar analysis of mutants showed that
eight and six insertions inactivated the dtpT gene and the operon
encoding enzyme II of mannose-glucose-fructose PTS respectively. From a
previously presented experiment, it was expected that a deficiency in the
uptake of regulatory dipeptides by DtpT reduced the repression of
opp-pepO1 transcription. However, the role of enzyme II of
mannose-glucose-fructose PTS is not yet clear, but might be indirect in
glucose medium.
As the CodY homologue of L. lactis was most probably involved in
the peptide-dependent repression of opp-pepO1 transcription, the
effect of three regulatory dipeptides, PL, LV and VP, added independently
was tested on a PoppD-lux fusion in a codY mutant (Table 3).
The PoppD-lux fusion was transferred by conjugation into the
codY strain JIM7596 (Table 4). Luciferase activity was equivalent for
the codY mutant in CDM or in CDM supplemented with PL, LP or VP
dipeptides (Table 3). This result, indicating that repression by regulatory
dipeptides was completely removed in the codY mutant, was confirmed
by dot-blot analysis. Total RNA isolated from wild-type and codY
cells grown in CDM with or without casitones was hybridized with a fragment
of the oppA gene as a probe, and the intensity of oppA mRNA
was quantified. The strength of repression by casitone was only twofold in
the codY mutant compared with 25-fold in the wild-type strain (data
not shown). Taken together, these results showed that CodY repressed
opp-pepO1 expression as a function of the availability of regulatory
peptides in the medium, or that its role was epistatic to this signal. |
|
CodY regulates several proteolysis genes in L.
lactis
The L. lactis CodY regulator was found by screening for mutants
derepressed in the expression of the opp-pepO1 operon in peptide-rich
medium. As several genes have been shown previously to be regulated by
peptides and PL/LP dipeptides in L. lactis (Guédon et al.,
2001), the effect of a mixture of peptides on their transcription was tested
in the codY mutant. The PpepN-lux and PpepC-lux fusions
were transferred into the codY strain by conjugation (Table 4).
Luciferase activities were compared between cells grown in CDM and M17. In
the wild-type strain, the luciferase activities of PoppD-, PpepC-
and PpepN-lux fusions were 63-, 12- and 36-fold lower in M17 than
in CDM respectively (Table 5). In contrast, in the codY mutant, the
luciferase activity measured in M17 was less than threefold lower than that
in CDM. These results showed that repression of these three fusions by
regulatory peptides was almost fully abolished in the codY mutant. In
addition to the opp-pepO1 operon, CodY also repressed the
transcription of pepN and pepC.
FIGURES
Fig. 1. Peptide
utilization pathway and constitution of the BCAA pool in BCAA auxotrophic
L. lactis. ...
Fig. 2. Alignment of
L. lactis CodY with amino acid sequences available in databases. The
sequences w...
Fig. 3. Model of CodY
peptide-dependent regulation. In L. lactis, the genes encoding
important enzyme...
Table 1. Effect on the
expression of a PoppA-lux fusion of a set of 67 dipeptides added
independently ...
Table 2. Effect of dtpT mutation on the
expression of the PoppD-lux fusion.
Table 3. Effect of pepQ, bcaT-araT and codY
mutations on the expression of the PoppD-lux fusion.
Table 4. Bacterial
strains and plasmids.
Table 5. Effect of codY mutation on the
expression of PoppD-, PpepN- and PpepC-lux
fusions.
DISCUSSION |
| |
|
CodY may be a pleiotropic regulator in Gram-positive
bacteria
In a previous study, we showed that the transcription of the opp-pepO1
operon is repressed 40- to 150-fold in peptide-rich media such as M17 or CDM
supplemented with casein hydrolysates (casitone and CAA) (Guédon et al.,
2001). In the present work, we obtained mutants in which the expression of
the Opp system is derepressed in M17. More than one-third were inactivated
for a gene encoding a protein with high homology to the transcriptional
regulator CodY from B. subtilis (Fig. 2). Inactivation of codY relieves the
repression of opp-pepO1 transcription in L. lactis, suggesting that CodY is
the most important factor in the control of opp-pepO1 transcription. In B.
subtilis, CodY was initially identified as the repressor for the dipeptide
permease operon (dpp) (Slack et al., 1993; 1995), and this regulator has
been shown to be involved in the nutritional repression of several genes
(Serror and Sonenshein, 1996a; Ferson et al., 1996; Fisher et al., 1996;
Wray et al., 1997; Débarbouilléet al., 1999; Fisher, 1999; Mirel et al.,
2000). In L. lactis, CodY regulates at least three transcriptional units
(pepN, pepC genes and the opp-pepO1 operon), indicating that CodY is a
pleiotropic regulator. It is likely that the regulation of the other
peptide-regulated genes, such as prtP, pepDA2 and pepX, may also depend on
CodY (Table 5; Fig. 3; Guédon et al., 2001).
CodY protein is present in several Gram-positive bacteria (Fig. 2). In B.
subtilis, CodY mediates the CAA repression of more than a dozen
transcriptional units (Fisher, 1999; Ratnayake-Lecamwasam et al., 2001) and
was shown to bind, in vitro, to the dpp, srfA, comK and hut promoters
(Serror and Sonenshein, 1996a, b; P. Serror and A. L. Sonenshein, personal
communication). In L. lactis, opp-pepO1 expression is repressed by adding
casitone, CAA or single regulatory dipeptides to CDM, a medium containing
all the amino acids necessary for growth (Table 1; Guédon et al., 2001). As
the dipeptide-dependent regulation of opp-pepO1 is completely abolished in
the L. lactis codY mutant strain, it is likely that CodY mediates repression
by regulatory dipeptides (Table 3). Although we could not exclude an
indirect effect of the CodY regulator on opp-pepO1 transcription, if
the model of CodY regulation proposed in B. subtilis is valid for
L. lactis, CodY would directly repress opp-pepO1 transcription in
response to a peptide-dependent signal. |
|
Level of intracellular BCAAs modulates CodY activity
In B. subtilis, the transcription of the hut, gabP,
ureABC and hag genes is repressed by CodY in the presence of a
mixture of at least 16 amino acids(Atkinson et al., 1990; 1993; Ferson
et al., 1996; Fisher et al., 1996; Wray et al., 1997; Mirel et al., 2000).
CodY regulation has thus been regarded as nutritional repression (Slack
et al., 1993; 1995; Fisher, 1999). In this work, we have shown in L.
lactis that all regulatory dipeptides contain BCAAs. This common feature
is an essential factor in the peptide repression of opp-pepO1
transcription. Nevertheless, to specify the nature of the signal depending
on dipeptides containing BCAAs, we used several mutants affected in the
metabolism of dipeptides, as summarized in Fig. 1. We showed first that the
regulatory dipeptides have to enter into the cell in order to repress
opp-pepO1 transcription. Indeed, several regulatory dipeptides
specifically transported by DtpT no longer have a regulatory effect in a
dtpT mutant. Secondly, we showed that dipeptides have to be cleaved into
amino acids by the peptidolytic system in the cell. X-P dipeptides that are
specifically cleaved by PepQ no longer have an effect in a pepQ
mutant. This result indicates that the signal for CodY repression is BCAAs
or their derivative products. BCAAs are either used for protein synthesis or
catabolized into keto acids (Yvon et al., 2000). Thirdly, we
demonstrated that BCAAs are involved in the repression of the opp-pepO1
operon, as its expression is repressed in the bcaT araT mutant, which
is unable to transform BCAAs into keto acids. Interestingly, in the absence
of regulatory dipeptides, the inactivation of BCAA catabolism leads to a
greater repression of opp-pepO1 than in wild-type cells, also
suggesting that this higher level of repression might result from an
increased pool of BCAAs in the cell. The observed decrease in repression by
the AL dipeptide in the dtpT strain presenting a deficiency in AL
uptake also favours the notion that the pool of BCAAs is the signal in
CodY-dependent regulation. However, the exact nature of the
molecule-mediating interaction with CodY in response to BCAA signal remains
unknown, as the addition of peptides differing only in terms of BCAA content
(AI, AL and AV) has the same repression effect on opp-pepO1
expression. In a codY strain, the level of opp-pepO1
expression appears to be twofold repressed in M17 compared with the
derepression observed in CDM supplemented with regulatory dipeptides
(Tables 3 and 5). Although this strength of repression is at the limit of
significance for strains growing at different growth rates, we could not
exclude the possibility that rich peptide sources contain nutrients other
than amino acids and peptides that might affect gene expression
independently of CodY. Moreover, the opp-pepO1 expression is 10-fold more
repressed by casitone than by regulatory dipeptides (Guédon et al., 2001),
suggesting that opp-pepO1 expression could be regulated by at least one
additional mechanism of regulation, such as all the B. subtilis genes
controlled by CodY (Slack et al., 1991; Wray et al., 1997;
Débarbouilléet al., 1999; Mirel et al., 2000).
As L. lactis MG1363 is auxotrophic for BCAAs, our experiments were
performed in the presence of BCAAs in CDM (CDM contains 0.8 mM of each
BCAA). As a result, one might expect full repression of opp-pepO1 in
this medium if BCAAs are the signal for CodY regulation. However, the
addition of several peptide sources still repressed opp-pepO1
expression. This observation might be the result of a low efficiency of
amino acid uptake that would limit BCAA availability inside the cell for
complete repression of gene expression by CodY. This low efficiency would be
overcome by the addition of peptides that are taken up more efficiently. The
hypothesis of a low efficiency of BCAA uptake is in agreement with the
observation that a 50-fold increase in BCAA concentration in CDM led to the
same level of repression of opp-pepO1 as in CDM supplemented with
regulatory dipeptide (data not shown). Lastly, a 10-fold decrease in BCAA
concentration had only a slight derepression effect on opp-pepO1
expression, suggesting that its expression was almost totally derepressed in
CDM as in the codY strain (data not shown;Table 5). These results
suggest that, in CDM, partial BCAA starvation could occur in the cell, and
that global response to amino acid starvation, such as the stringent
response, could be activated (Cashel et al., 1996). However, an increase in
BCAA concentration or the addition of dipeptides do not increase the growth
rate, suggesting that BCAAs do not limit growth in CDM. Furthermore, in L.
lactis, expression of the BCAA biosynthetic operon, which is regulated by
BCAAs, might be an indicator of the BCAA starvation state. Interestingly, as
in L. lactis prototrophic strains, the transcription of the cryptic BCAA
biosynthetic operon of auxotrophic strains is still induced at low BCAA
concentration (data not shown, Godon et al., 1993). Because the expression
of the BCAA biosynthetic operon is repressed in CDM, it is likely that cells
are not starving for BCAAs. Furthermore, it has been established that,
during growth of L. lactis in a minimal media containing similar amounts of
BCAAs as in CDM, only a basal level of (p)ppGpp was detected, suggesting
that the stringent response was not induced (Rallu et al., 2000). Two recent
works support the view that CodY repression mediated by the BCAA pool was
independent of the stringent response. First, in B. subtilis, the stringent
response is not essential for derepression of dpp expression, a
CodY-regulated gene (Ratnayake-Lecamwasam et al., 2001). In addition, B.
subtilis CodY has been shown to interact with GTP in vitro, suggesting that
amino acid nutritional repression is mediated via the intracellular pool of
GTP (Ratnayake-Lecamwasam et al., 2001). It is likely that L. lactis CodY
also binds GTP, but the connection between the GTP pool and intracellular
BCAAs remains unclear. Secondly, Streptococcus pyogenes virulence and
proteolysis genes, including homologues of L. lactis CodY-regulated genes,
are regulated by valine and isoleucine starvation independently of the
presence of the relA gene (Steiner and Malke, 2000). Moreover, as these
genes have been shown to be derepressed by BCAA depletion, we suggest that
they might be regulated by CodY. |
|
Model for BCAAs and CodY regulation
A model of regulation might be proposed for the L. lactis CodY
regulon, interpreting the available data (Fig. 3). The key products involved
in the initial steps of protein degradation for nitrogen supply, such as
PrtP proteinase, Opp transporter and PepN, PepC, PepO1 peptidases, belong to
the CodY regulon. Expression of these co-regulated genes is repressed by the
CodY repressor in response to the intracellular BCAA pool. After protein
degradation and peptide assimilation, amino acid availability is not
limiting in the cell, and CodY would repress functions whose expression is
no longer required at a high level. Independently of the stringent response,
the intracellular pool of BCAAs would be a sensor of amino acid availability
via the CodY repressor and thus lead to a feedback repression of genes
involved in proteolysis (Fig. 3). As in B. subtilis, L. lactis CodY would
thus have a general role in metabolism and might be considered as a
nutritional regulator. In L. lactis, the intracellular pool of BCAAs could
act directly on CodY or via a modulation of the GTP pool, as B. subtilis
CodY is a GTP-binding protein (Ratnayake-Lecamwasam et al., 2001). Although
our data are consistent with a BCAA effect independent of the stringent
response, we cannot exclude the possibility that a decrease in the GTP pool
during the stringent response could also modulate CodY activity.
Further work is required to determine the extent of the CodY pleiotropic
role in L. lactis, especially on the regulation of other
peptide-regulated genes involved in nitrogen assimilation or in other
metabolisms. Other investigations should be carried out to demonstrate the
direct interaction of CodY with the promoter region of the target genes and
to determine how CodY senses BCAA availability, either directly or
indirectly through the GTP pool. |
|
EXPERIMENTAL PROCEDURES
|
|
Bacterial strains, plasmids, media and growth
conditions
The bacterial strains used in this study are listed in Table 4. E. coli
TG1 and TG1RepA strains were used for plasmid propagation. The TG1RepA
strain allowed the replication of RepA replication-dependent plasmid
derivatives pVar-2 and pJIM2242. E. coli was grown in Luria-Bertani medium
at 37°C (Maniatis et al., 1982). L. lactis strains were grown at 30°C in an
M17 glucose medium (M17) or in chemically defined medium (CDM) (Terzaghi and
Sandine, 1975; Sissler et al., 1999). CDM contained 18 amino acids (AA) (all
except aspartic acid and glutamic acid) necessary for rapid growth of L.
lactis dairy strains (Sissler et al., 1999). When specified, CDM was
supplemented with 1 mM of the dipeptides listed in Table 1. These dipeptides
were purchased from Sigma and are referred to by abbreviations corresponding
to their amino acid sequence with a one-letter symbol, for example PL and LP
are prolylleucine and leucylproline respectively. When required,
5-bromo-4-chloro-3-indolyl- -d-galactoside
(40 µg ml
1;
Xgal), erythromycin (5 µg ml
1
for L. lactis, 100 µg ml
1
for E. coli ), chloramphenicol (5 µg ml
1
for L. lactis, 20 µg ml
1
for E. coli ), tetracycline (5 µg ml
1
for L. lactis, 10 µg ml
1
for E. coli ) or ampicillin (100 µg ml
1
for E. coli ) were added to the culture medium. Growth was measured
kinetically with a Microbiology Reader Bioscreen C (Labsystems). |
|
DNA manipulation procedures
Plasmids and total DNA were prepared as described previously (Maniatis
et al., 1982; Loureiros dos Santos and Chopin, 1987; Simon and Chopin,
1988). Procedures for DNA manipulations and E. coli transformation were
performed essentially as described by Maniatis et al. (1982). All enzymes
for DNA technology were used according to the manufacturers' specifications.
Electrotransformation and conjugation of L. lactis were performed as
described by Holo and Nes (1989) and Gasson et al. (1992) respectively. For
conjugation, a mixture containing equal cell numbers of overnight cultures
of donor and recipient strains was spread onto M17 plates and incubated for
12 h at 30°C. The cells were then resuspended in 1 ml of M17 liquid medium,
and appropriate dilutions were plated on M17 medium containing erythromycin
and chloramphenicol. Integration by single crossing over of pJIM2242 and
pVar-2 derivatives in the chromosome of L. lactis MG1363 was performed with
the helper plasmid pGhost8 as described by Godon et al. (1995). Proper
integration in the chromosome was screened by polymerase chain reaction
(PCR) amplification with specific primers and checked further by Southern
blot hybridization. The oligonucleotides used in this work were synthesized
by a DNA synthesizer oligo 1000M system (Beckman). Standard procedures were
used for Southern blotting, and hybridization was performed with DNA probes
labelled with the ECL direct nucleic acid labelling system (Sambrook et al.,
1989). Hybridization and detection were performed according to the Amersham
ECL protocol. DNA sequencing was performed on both strands using a
fluorescent sequencing procedure (Perkin-Elmer Biosystems). |
|
Construction of transcriptional fusions with
opp-pepO1 promoters
The pVar-2 plasmid was a conditional replicative plasmid derived from
pORI28 (Guédon et al., 2000). This vector contained lux genes as reporters
and an internal fragment of the cluA gene from the L. lactis chromosomal sex
factor. This fragment made it possible to target pVar-2 insertion in the sex
factor by homologous recombination (Guédon et al., 2001). A 587 bp PCR
fragment product amplified with GGGAATT
CTGCTTTTATTATTTCCT-3'/CGGGATCCTACTTGTTCTA AAA-3' primers and containing the
first promoter region (PoppD) including the putative start codon of
opp-pepO1 operon from L. lactis MG1363 (Tynkkynen et al.,
1993) was cloned into pGEM-T easy vector (Promega). It was then used to
construct the integrative plasmid pJIM3074 carrying the PoppD-lux
transcriptional fusion as described in Table 4. pJIM3074 was integrated at
the cluA locus of L. lactis MG1363 by single crossing over. In
the resulting strain, the intact cluA gene is followed by tandem
copies of the PoppD promoter fused with the lux genes. From
this donor strain, PoppD-lux transcriptional fusion was transferred
into various MG1363 derivatives by conjugation of the sex factor.
The integrative plasmid pJIM3114 contained an in frame fusion of oppA
and lacZ. To construct this plasmid, a 688 bp fragment from L.
lactis MG1363 containing the second promoter region of the opp-pepO1
operon (PoppA) including the putative start codon of oppA was
cloned into pJIM762 as described in Table 4. pJIM3114 was integrated at the
opp-pepO1 locus in the chromosome of L. lactis MG1363 by
single crossing over. The resulting strain JIM7605 carried one copy of
pJIM3114, allowing the expression of the lacZ gene under the control
of the PoppA promoter. |
|
Construction of negative mutants of L. lactis
The pepQ, dtpT and codY genes were inactivated by
the insertion of pJIM3113, pJIM3111 and pJIM3112, respectively, containing
internal fragments of these genes. The PCR fragments corresponding to
internal fragments of the pepQ, dtpT and codY genes
were amplified using ATCCGAC AACTCTAAATTATCT'-3'/TAGCAGCGCGAGCTCCTGATA-3',
TGACTCACGTCGTGACACTGGA-3'/TCCGTTCAAGAG ACCTGGAAGT-3' and
CAGTATGACTGAACGTTGGC-3'/G CGATAACATGCCCTTCTTCA-3' primers, respectively, and
cloned into pGEM-T easy vector, then fused with the L. lactis
integration vector pJIM2242 as described in Table 4. The resulting plasmids
were integrated into the chromosome of L. lactis MG1363 by single
crossing over, yielding strains JIM7589, JIM7583 and JIM7596 inactivated for
the pepQ, dtpT and codY genes respectively. |
|
Mutagenesis and characterization of transposition
targets
Mutagenesis with pGhost8-ISS1 was performed essentially as
described previously (Maguin et al., 1996; Rallu et al., 2000). Cells
containing the PoppA-lacZ fusion and pGhost8-ISS1 were
grown overnight at 30°C in M17 with erythromycin and tetracycline. Saturated
cultures were diluted 1:1000 in M17, incubated for 150 min at 30°C and
shifted to 37.5°C for 150 min. Samples were then diluted and plated at
37.5°C. Mutants were selected as blue clones growing on M17 containing
erythromycin, tetracycline and Xgal. The transposition events resulted in
the integration of pGhost8 flanked by duplicated copies of ISS1 (Maguin
et al., 1996; Rallu et al., 2000). The fragments flanking ISS1 and
pGhost8 were rescued in E. coli TG1RepA after digestion of the
chromosome by EcoRI or HindIII and ligation. The EcoRI
junctions were sequenced using primers TCACCTCATATAAATTCC CCA-3' or
AAATGGAACGCTCTTCGG-3' and the HindIII junctions using primers
CGCCAGGGTTTTCCCAGTCACGA C-3' or ACCAACAGCGACAATAATCACA-3'. |
|
Determination of luciferase activity in L. lactis
Luciferase assays were performed with a Berthold lumat LB9501 apparatus.
L. lactis culture (1 ml) was mixed with 5 µl of non-aldehyde, and
light emission was measured immediately. The value of the peak obtained was
standardized to the OD600 of the culture. Luciferase activity was
measured throughout the growth of the culture. Values reported in Tables 2,
3 and 5 were measured at an OD600 of 0.4. |
|
Northern blot analysis
Total RNA was isolated from L. lactis MG1363 grown in CDM and in
CDM casitones [1.5% (w/v); Sigma] to exponential phase (OD600 = 0.5)
and prepared as described previously for B. subtilis (Glatron and
Rapoport, 1972). After extraction and treatment with phenol-chloroform, RNA
was precipitated with ethanol. Dots containing 1, 2.5 and 5 µg of
glyoxalated RNA were spotted directly on nylon membranes (Maniatis et al.,
1982). A 368 bp PCR product amplified with
AGCAGCTACACTCCTAAGTGCT-3'/CGGGATCCGTTACT TCTGAACCA-3' primers and
corresponding to an internal fragment of oppA was used as the DNA
probe. It was labelled with the ECL direct nucleic acid labelling kit.
Hybridization and detection were performed according to the Amersham ECL
protocol. Hybridization data were collected on a Storm instrument and
quantified by an image analysis package of
imagequant software (Molecular Dynamics). |
| |
| ACKNOWLEDGEMENTS
|
| We thank A. L. Sonenshein for critical
reading of the manuscript. We thank M. Yvon and E. Chambellon for the gift
of L. lactis TIL358 strain, and V. Monnet for helpful discussions.
This work was supported by contract BIO4-CT960016 in the Starlab project of
the Commission of the European Communities. |
REFERENCES
• Atkinson, M.R., Wray, L.V., Jr, Fisher, S.H. (1990) Regulation of histidine
and proline degradation enzymes by amino acid availability in Bacillus subtilis.
J Bacteriol 172: 4758-4765.
• Atkinson, M.R., Wray, L.V., Jr, Fisher, S.H. (1993) Activation of the
Bacillus subtilis hut operon at the onset of stationary growth phase in nutrient
sporulation medium results primarily from the relief of amino acid repression of
histidine transport. J Bacteriol 175: 4282-4289.
• Booth, M., Jennings, P.V., Ni Fhaolain, I., O'Cuinn, G. (1990) Prolidase
activity of Lactococcus lactis subsp. cremoris AM2: partial purification and
characterization. J Dairy Res 57: 245-254.
• Cashel, M., Gentry, D.R., Hernandez, V.J., Vinella, D. (1996) The stringent
response. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular
Biology. Neidhardt, F.C., et al,. (eds). Washington, DC: American Society for
Microbiology Press, pp. 1458-1496.
• Chopin, A., Chopin, M.C., Moillot-Batt, A., Langella, P. (1984) Two
plasmid-determined restriction and modification systems in Streptococcus lactis.
Plasmid 11: 260-263.
• Christensen, J.E., Dudley, E.G., Pederson, J.A., Steele, J.L. (1999)
Peptidases and amino acid catabolism in lactic acid bacteria. Antonie Van
Leeuwenhoek 76: 217-246.
• Débarbouillé, M., Gardan, R., Arnaud, M., Rapoport, G. (1999) Role of BkdR,
a transcriptional activator of the SigL-dependent isoleucine and valine
degradation pathway in Bacillus subtilis. J Bacteriol 181: 2059-2066.
• Delorme, C., Godon, J.J., Ehrlich, S.D., Renault, P. (1993) Gene
inactivation in Lactococcus lactis: histidine biosynthesis. J Bacteriol 175:
4391-4399.
• Ferson, A.E., Wray, L.V., Jr, Fisher, S.H. (1996) Expression of the
Bacillus subtilis gabP gene is regulated independently in response to nitrogen
and amino acid availability. Mol Microbiol 22: 693-701.
• Fisher, S.H. (1999) Regulation of nitrogen metabolism in Bacillus subtilis:
vive la difference! Mol Microbiol 32: 223-232.
• Fisher, S.H., Rohrer, K., Ferson, A.E. (1996) Role of CodY in regulation of
the Bacillus subtilis hut operon. J Bacteriol 178: 3779-3784.
• Foucaud, C., Kunji, E.R., Hagting, A., Richard, J., Konings, W.N.,
Desmazeaud, M., Poolman, B. (1995) Specificity of peptide transport systems in
Lactococcus lactis: evidence for a third system which transports hydrophobic di-
and tripeptides. J Bacteriol 177: 4652-4657.
• Gasson, M.J. (1983) Plasmid complements of Streptococcus lactis NCDO 712
and other lactic streptococci after protoplast-induced curing. J Bacteriol 154:
1-9.
• Gasson, M.J., Swindell, S., Maeda, S., Dodd, H.M. (1992) Molecular
rearrangement of lactose plasmid DNA associated with high-frequency transfer and
cell aggregation in Lactococcus lactis 712. Mol Microbiol 6: 3213-3223.
• Gilson, T.J. (1984) Studies on the EpsteinBarr virus genome. PhD Thesis.
University of Cambridge, Cambridge, UK.
• Glatron, M.F. & Rapoport, G. (1972) Biosynthesis of the parasporal
inclusion of Bacillus thuringiensis: half-life of its corresponding messenger
RNA. Biochimie 54: 1291-1301.
• Godon, J.J., Delorme, C., Bardowski, J., Chopin, M.C., Ehrlich, S.D.,
Renault, P. (1993) Gene inactivation in Lactococcus lactis - branched-chain
amino acid biosynthesis. J Bacteriol 175: 4383-4390.
• Godon, J.J., Pillidge, C.J., Jury, K., Shearman, C.A., Gasson, M.J. (1995)
Molecular analysis of the Lactococcus lactis sex factor. Dev Biol Stand 85:
423-430.
• Guédon, E., Renault, P., Ehrlich, S.D., Delorme, C. (2000) Evaluation of
the genetic expression diversity in lactococci, development of tools and
peptidases application. Sci Aliments 20: 55-62.
• Guédon, E., Renault, P., Ehrlich, S.D., Delorme, C. (2001) Transcriptional
pattern of genes coding for proteolytic system of Lactococcus lactis and
evidence for a coordinated regulation of key enzymes by nitrogen supply. J
Bacteriol 183.
• Holo, H. & Nes, I.F. (1989) High-frequency transformation by
electroporation of Lactococcus lactis subsp. cremoris grown with glycine in
osmotically stabilized media. Appl Environ Microbiol 55: 3119-3123.
• Hugenholtz, J., Van Sinderen, D., Kok, J., Konings, W.N. (1987) Cell
wall-associated proteases of Streptococcus cremoris Wg2. Appl Environ Microbiol
53: 853-859.
• Juillard, V., Le Bars, D., Kunji, E.R., Konings, W.N., Gripon, J.C.,
Richard, J. (1995) Oligopeptides are the main source of nitrogen for Lactococcus
lactis during growth in milk. Appl Environ Microbiol 61: 3024-3030.
• Juillard, V., Guillot, A., LeBars, D., Gripon, J.C. (1998) Specificity of
milk peptide utilization by Lactococcus lactis. Appl Environ Microbiol 64:
1230-1236.
• Kunji, E.R., Mierau, I., Hagting, A., Poolman, B., Konings, W.N. (1996) The
proteolytic systems of lactic acid bacteria. Antonie Van Leeuwenhoek 70:
187-221.
• Law, J., Buist, G., Haandrikman, A., Kok, J., Venema, G., Leenhouts, K.
(1995) A system to generate chromosomal mutations in Lactococcus lactis which
allows fast analysis of targeted genes. J Bacteriol 177: 7011-7018.
• Loureiro Dos Santos, A.L. & Chopin, A. (1987) Shotgun cloning in
Streptococcus lactis. FEMS Microbiol Lett 42: 209-212.
• Maguin, E., Prevost, H., Ehrlich, S.D., Gruss, A. (1996) Efficient
insertional mutagenesis in lactococci and other gram-positive bacteria. J
Bacteriol 178: 931-935.
• Maniatis, T., Fritsch, E.F., Sambrook, J. (1982) Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
• Marugg, J.D., Meijer, W., van Kranenburg, R., Laverman, P., Bruinenberg,
P.G., de Vos, W.M. (1995) Medium-dependent regulation of proteinase gene
expression in Lactococcus lactis: control of transcription initiation by
specific dipeptides. J Bacteriol 177: 2982-2989.
• Mirel, D.B., Estacio, W.F., Mathieu, M., Olmsted, E., Ramirez, J.,
Marquez-Magana, L.M. (2000) Environmental regulation of Bacillus subtilis sigma
(D)-dependent gene expression. J Bacteriol 182: 3055-3062.
• Rallu, F., Gruss, A., Ehrlich, S.D., Maguin, E. (2000) Acid- and
multistress-resistant mutants of Lactococcus lactis: identification of
intracellular stress signals. Mol Microbiol 35: 517-528.
• Ratnayake-Lecamwasam, M., Serror, P., Wong, K.W., Sonenshein, A.L. (2001)
Bacillus subtilis CodY, a repressor of early stationary phase genes, is a GTP
binding protein. Genes Dev 15.
• Renault, P., Nogrette, J.F., Galleron, N., Godon, J.J., Ehrlich, S.D.
(1995) Specificity of insertion of Tn1545 transposon family in Lactococcus
lactis subsp. lactis. In Genetics of Streptococci, Enterococci and Lactococci.
Feretti, J.J., Gilmore, M.S., Klaenhammer, T.R., and Brown, F. (eds).
Developments in Biological Standards. Basel: Karger, pp. 535-541.
• Renault, P., Corthier, G., Goupil, N., Delorme, C., Ehrlich, S.D. (1996)
Plasmid vectors for Gram-positive bacteria switching from high to low copy
number. Gene 183: 175-182.
• Rijnen, L., Bonneau, S., Yvon, M. (1999) Genetic characterization of the
major lactococcal aromatic aminotransferase and its involvement in conversion of
amino acids to aroma compounds. Appl Environ Microbiol 65: 4873-4880.
• Sambrook, J., Fritsch, E.F., Maniatis, T. (1989) Molecular Cloning. A
Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press.
• Serror, P. & Sonenshein, A.L. (1996a) CodY is required for nutritional
repression of Bacillus subtilis genetic competence. J Bacteriol 178: 5910-5915.
• Serror, P. & Sonenshein, A.L. (1996b) Interaction of CodY, a novel Bacillus
subtilis DNA-binding protein, with the dpp promoter region. Mol Microbiol 20:
843-852.
• Simon, D. & Chopin, A. (1988) Construction of a vector plasmid family and
its use for molecular cloning in Streptococcus lactis. Biochimie 70: 559-566.
• Sissler, M., Delorme, C., Bond, J., Ehrlich, S.D., Renault, P., Francklyn,
C. (1999) An aminoacyl-tRNA synthetase paralog with a catalytic role in
histidine biosynthesis. Proc Natl Acad Sci USA 96: 8985-8990.
• Slack, F.J., Mueller, J.P., Strauch, M.A., Mathiopoulos, C., Sonenshein,
A.L. (1991) Transcriptional regulation of a Bacillus subtilis dipeptide
transport operon. Mol Microbiol 5: 1915-1925.
• Slack, F.J., Mueller, J.P., Sonenshein, A.L. (1993) Mutations that relieve
nutritional repression of the Bacillus subtilis dipeptide permease operon. J
Bacteriol 175: 4605-4614.
• Slack, F.J., Serror, P., Joyce, E., Sonenshein, A.L. (1995) A gene required
for nutritional repression of the Bacillus subtilis dipeptide permease operon.
Mol Microbiol 15: 689-702.
• Steiner, K. & Malke, H. (2000) Life in protein-rich environments: the
relA-independent response of Streptococcus pyogenes to amino acid starvation.
Mol Microbiol 38: 1004-1016.
• Terzaghi, B. & Sandine, W.E. (1975) Improved medium for lactic streptococci
and their bacteriophages. Appl Microbiol 29: 807-813.
• Tynkkynen, S., Buist, G., Kunji, E.R.S., Kok, J., Poolman, B., Venema, G.,
Haandrikman, A.J. (1993) Genetic and biochemical characterization of the
oligopeptide transport system of Lactococcus lactis. J Bacteriol 175: 7523-7532.
• van der Vossen, J.M., van der Lelie, D., Venema, G. (1987) Isolation and
characterization of Streptococcus cremoris Wg2-specific promoters. Appl Environ
Microbiol 53: 2452-2457.
• Wray, L.V., Jr, Person, A.E., Fisher, S.H. (1997) Expression of the
Bacillus subtilis ureABC operon is controlled by multiple regulatory factors
including CodY, GlnR, TnrA, and Spo0H. J Bacteriol 179: 5494-5501.
• Yvon, M. & Rijnen, L. (2001) Cheese flavour formation by amino acid
catabolism. Int Dairy J (in press).
• Yvon, M., Chambellon, E., Bolotin, A., Roudot-Algaron, F. (2000)
Characterization and role of the branched-chain aminotransferase (BcaT) isolated
from Lactococcus lactis subsp cremoris NCDO 763. Appl Environ Microbiol 66:
571-577.
(Full Text online) Back to Automation in
Microbiology main page
|
