Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Bax-Responsive genes for drug target identification in yeast and fungi

 

The invention describes the use of nucleic acids and polypeptides which are involved in a pathway eventually leading to programmed cell death of yeast or fungi for the preparation of a medicament for treating diseases associated with yeast or fungi or for the treatment of prolifeative disorders or for preventing apoptosis in certain diseases. Methods are provided to identify compounds which selectively modulate the expression or functionality of said polypeptides in the same or a parallel pathway. Also provided are compounds as well as pharmaceutical compositions, medicaments and vaccines. The invention also comprises new nucleic acid sequences, probes and primers derived thereof, expression vectors and host cells transformed with said vectors, polypeptides and antibodies raised against said polypeptides.

1. An isolated nucleic acid representing a synthetic BAX-gene selected from the group consisting of: a) a nucleic acid comprising a sequence as represented by SEQ ID NO 1, b) a nucleic acid comprising a fragment of a sequence of SEQ ID NO 1 and encoding a functional fragment of the sequence represented by SEQ ID NO 2, c) a nucleic acid comprising a sequence as represented in any of SEQ ID NOs 3 to 10, d) a nucleic acid which is more than 75% identical to the nucleic acid as represented by SEQ ID NO 1, or to a nucleic acid according to the nucleic acid as defined in b) or c), and, e) a nucleic acid as defined in any one of (a) to (i) interrupted by intervening DNA sequences, or a nucleic acid representing the complement of any of said nucleic acids as defined in (a) to (d).

2. An isolated nucleic acid according to claim 1 which is DNA, cDNA, genomic DNA, synthetic DNA, or RNA wherein T is replaced by U.

3. A vector comprising a nucleic acid as defined in claim 1 or 2.

4. A vector according to claim 3 which is an expression vector wherein said nucleic acid sequence is operably linked to one or more control sequences allowing the expression in prokaryotic and/or eukaryotic host cells.

5. An expression vector according to claim 4 which comprises an inducible promoter

6. An expression vector according to claim 4 or 5 which comprises a sequence encoding a reporter molecule.

7. A vector according to any of claims 3 to 6 for inducing programmed cell death in Candida spp.

8. A host cell transformed, transfected or infected with a vector according to any of claims 3 to 7.

9. A host cell of claim 8 which is a bacterial, yeast or fungal cell.

10. A host cell according to claim 8 or 9 wherein said cell is a Candida spp. cell.

11. A genetically modified yeast or fungal cell according to claim 9 wherein said modification results in the onset of at least one pathway eventually leading to programmed cell death.

12. A genetically modified Candida spp. cell according to claim 10 wherein said modification results in the onset of at least one pathway eventually leading to programmed cell death.

13. A method for identifying Bax-resistant yeast or fungi comprising the steps of: a) providing (a) genetically modified yeast or fungi according to claim 11, b) treating said genetically modified yeast or fungi with a mutagen, c) isolating resistant yeast or fungal cells, and, d) optionally identifying and/or characterizing mutated genes In said resistant yeast or fungal cells.

14. A method for identifying Candida spp. sequences which are differentially expressed in a pathway eventually leading to programmed cell death using a nucleic acid as defined in claim 1 or 2, a vector according to any of claims 3 to 7 or a genetically modified host cell according to claim 10.

15. A method for obtaining and identifying Candida spp. sequences involved in a pathway eventually leading to programmed cell death comprising the steps of: a) providing a two hybrid system wherein a polypeptide encoded by a nucleic acid according to claim 1 or a vector according to any of claims 3 to 7 as a bait and a Candida spp. cDNA library as a prey are expressed, b) detecting an interaction between said polypeptide and a Candida spp. polypeptide encoded by said cDNA library, and, c) identifying said Candida spp. polypeptide or cDNA.

16. A method for identifying inhibitors (or inhibitor sequences) of Bax-induced cell death comprising the steps of: a) providing a genetically modified organism according to claim 10, b) expressing a cDNA library in said genetically modified organism, and, c) identifying a polypeptide or a cDNA which expression has a beneficial effect on the survival and/or growth of said genetically modified organism.

17. A method according to claim 16 wherein said genetically modified organism is a Candida spp.

18. An isolated Candida spp. nucleic acid identifiable by any of the methods of any of claims 12 to 17.

19. An isolated Candida spp. nucleic acid according to claim 18 selected from: (a) a nucleic acid encoding a protein having an amino acid sequence as represented in any of SEQ ID NOs 434, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 718, 720, 722, 724, 726, 728, 730 and 732, or encoding a functional equivalent, derivative or bioprecursor of said protein, b) a nucleic acid encoding a protein having an amino acid sequence which is more than 70% similar to any of the amino acid sequences represented in SEQ ID NOs 434, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 718, 720, 722, 724, 726, 728, 730 and 732, c) a nucleic acid encoding a protein having an amino acid sequence which is more than 70% identical to any of the amino acid sequences represented in SEQ ID NOs 434, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 718, 720, 722, 724, 726, 728, 730 and 732, d) a nucleic acid comprising a sequence as represented in any of SEQ ID NOs 433, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669, 671, 673, 687, 717, 719, 721, 723, 725, 727, 729 and 731, e) a nucleic acid which is more than 70% identical to any of the nucleic acid sequences as represented by any of SEQ ID NOs 433, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669, 671, 673, 687, 717, 719, 721, 723, 725, 727, 729 and 731, and f) a nucleic acid encoding a functional fragment of any of the nucleic acid sequences as specified in any of a) to d),

20. An isolated nucleic acid as defined in according to claim 19 which is DNA, cDNA, genomic DNA, synthetic DNA, or RNA wherein T is replaced by U.

21. An isolated nucleic acid capable of selectively hybridizing to a nucleic acid as defined in any of claims 18 to 20 or the complement thereof.

22. An antisense molecule comprising a nucleic acid capable of selectively hybridizing to a nucleic acid as defined in any of claims 18 to 21.

23. A nucleic acid probe which selectively hybridises with any of the nucleic acid molecules as defined in claim 18 or 19.

24. A nucleic acid primer which selectively amplifies any of the nucleic acid molecules defined in claim 18 or 19.

25. An expression vector comprising a nucleic acid according to any of claims 18 to 22.

26. An expression vector according to claim 25 which is an expression vector wherein said nucleic acid is operably linked to one or more control sequences allowing the expression in prokaryotic and/or eukaryotic host cells.

27. An expression vector according to claim 25 or 26 which comprises an inducible promoter.

28. An expression vector according to any of claims 25 to 27 which comprises a sequence encoding a reporter molecule.

29. A host cell transformed, transfected or infected with the vector of any of claims 25 to 28.

30. An isolated nucleic acid according to any of claims 18 to 22 for use as a medicament.

31. An isolated polypeptide which is involved in a pathway for programmed cell death of Candida spp. and encoded by a nucleic acid as defined in claim 18 or 19, wherein said polypeptide is selected from: (a) a polypeptide having an amino acid sequence as represented in any of SEQ ID NOs 434, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 718, 720, 722, 724, 726, 728, 730 and 732, or encoding a functional equivalent, derivative or bioprecursor of said protein; (b) a polypeptide having an amino acid sequence which is more than 70% similar to any of the amino acid sequences as represented by any of SEQ ID NOs 434, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 718, 720, 722, 724, 726, 728, 730 and 732, (c) a polypeptide having an amino acid sequence which is more than 70% identical to any of the amino acid sequences as represented by any of SEQ ID NOs 434, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 718, 720, 722, 724, 726, 728, 730 and 732, and (d) a functional fragment of any of said polypeptides as defined in a) to c).

32. A polypeptide according to claim 31 for use as a medicament.

33. An antibody capable of specifically binding to a polypeptide of claim 30 or to a specific epitope of said polypeptide.

34. An antibody according to claim 33 for use as a medicament.

35. A pharmaceutical composition comprising an antibody of claim 33 or 34.

36. Use of an isolated nucleic acid encoding a polypeptide which is involved in a pathway eventually leading to programmed cell death of yeast or fungi and which nucleic acid is selected from: (a) a nucleic acid encoding a protein having an amino acid sequence as represented in any of SEQ ID NOs 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730 and 732, or encoding a functional equivalent, derivative or bioprecursor of said protein; (b) a nucleic acid encoding a protein having an amino acid sequence which is more than 70% similar to any of the amino acid sequences as represented by any of SEQ ID NOs 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730 and 732, (c) a nucleic acid encoding a protein having an amino acid sequence which is more than 70% identical to any of the amino acid sequences as represented by any of SEQ ID NOs 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730 and 732, (d) a nucleic acid comprising a sequence as represented in any of SEQ ID NOs 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669, 671, 673, 687, 691, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729 and 731, (e) a nucleic acid which is more than 70% Identical to any of the nucleic acid sequences as represented by any of SEQ ID NOs 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669, 671, 673, 687, 691, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729 and 731, (f) a nucleic acid encoding a functional fragment of any of the nucleic acid sequences as specified in a) to e), and (g) the complement of any of the nucleic acid molecule as specified in a) to f), for the preparation of a medicament for treating diseases associated with yeast or fungi.

37. Use of an isolated polypeptide which is involved in a pathway eventually leading to programmed cell death of yeast or fungi, said polypeptide being selected from: (a) a polypeptide having an amino acid sequence as represented in any of SEQ ID NOs 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730 and 732, or encoding a functional equivalent, derivative or bioprecursor of said protein, (b) a polypeptide having an amino acid sequence which is more than 70% similar o any of the amino acid sequences as represented by any of SEQ ID NOs 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730 and 732, (c) a polypeptide having an amino acid sequence which is more than 70% identical to any of the amino acid sequences as represented by any of SEQ ID 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 20, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730 and 732, and, (d) a functional fragment of any of said polypeptides as defined in a) to c), for the preparation of a medicament for treating diseases associated with yeast or fungi.

38. A pharmaceutical or fungicidal composition comprising a nucleic acid as defined in claim 36 or a polypeptide as defined in claim 37 together with a pharmaceutically acceptable carrier diluent or excipient therefor.

39. A vaccine for immunizing a mammal against yeast or fungal infections comprising at least one nucleic acid as defined in claim 36 or at least one polypeptide as defined in claim 37 in a pharmaceutically acceptable carrier.

40. A genetically modified yeast or fungus in which modification results in the overexpression or underexpression of at least one of the nucleic acids as defined in claim 36 or the polypeptides as defined in claim 36, which overexpression or underexpression of said nucleic acid or polypeptide prevents, delays or sensitizes for apoptosis of said genetically modified yeast or fungus.

41. A method of identifying compounds which selectively modulate expression or functionality of polypeptides involved in a pathway eventually leading to programmed cell death of yeast or fungi or in metabolic pathways in which said polypeptides are involved, which method comprises: (a) contacting a compound to be tested with a genetically modified yeast or fungus according to claim 40, in addition to contacting wild type cells with said compound, (b) monitoring the growth and/or death rate and/or activity of said genetically modified cells compared to said wild type cells; wherein differential growth or activity of said genetically modified yeast or fungi cells is indicative of selective action of said compound on a polypeptide in the same or a parallel pathway, (c) alternatively monitoring the growth and/or death rate and/or activity of said genetically modified cells compared to genetically modified cells which were not contacted with the compound to be tested, wherein differential growth or activity of said genetically modified yeast of fungi cells is indicative of selective action of said compound on a polypeptide in the same or a parallel pathway, (d) alternatively monitoring changes in morphologic and/or functional properties of components in said genetically modified cells caused by the addition of the compound to be tested, and, (e) identifying the compound.

42. A method of identifying compounds which selectively modulate expression or functionality of polypeptides involved in a pathway eventually leading to programmed cell death of yeast and fungi or in metabolic pathways in which said polypeptides are involved, which method comprises: (a) contacting a compound to be tested with yeast or fungal cells transformed, transfected or infected with an expression vector comprising an antisense sequence of at least one of the nucleic acid as defined in claim 36, which expression results in underexpression of said polypeptide, in addition to contacting one or more wild type cells with said compound, (b) monitoring the growth and/or death rate and/or activity of said transformed, transfected or infected cells compared to said wild type cells; wherein differential growth or activity of said transformed, transfected or infected yeast or fungal cells is indicative of selective action of said compound on a polypeptide in the same or a parallel pathway, (c) alternatively monitoring the growth and/or death rate and/or activity of said transformed, transfected or infected cells compared to transformed, transfected or infected cells which were not contacted with the compound to be tested, wherein differential growth or activity of said mutated yeast of fungi cells is indicative of selective action of said compound on a polypeptide in the same or a parallel pathway, (d) alternatively monitoring changes in morphologic and/or functional properties of components in said transformed, transfected or infected cells caused by the addition of the compound to be tested, and, (e) identifying the compound.

43. A method of identifying compounds or polypeptides which bind to or modulate the properties of polypeptides which are involved in a pathway eventually leading to programmed cell death of yeast or fungi, which method comprises: (a) contacting a compound or polypeptides to be tested with at least one of the polypeptides as defined in claim 37, (b) detecting the complex formed between the compound or polypeptide to be tested and said polypeptide, (c) alternatively, examining the diminution of complex formation between said polypeptide and a binding partner, caused by the addition of the compound or polypeptide being tested, (d) alternatively, examining the alteration in the functional activity of the polypeptide, caused by the addition of the compound or polypeptide being tested, and, (e) identifying the compound or protein.

44. A method for identifying compounds interacting with a polypeptide involved in a pathway eventually leading to programmed cell death of yeast and fungi comprising the steps of: (a) providing a two-hybrid screening system wherein a polypeptide of claim 37 and a protein interacting with said polypeptide or an interacting polypeptide obtainable by a method of claim 41, are expressed, (b) interacting said compound with the complex formed by the expressed proteins as defined in a), (c) detecting a second complex, wherein the presence of said second complex identifies a compound which specifically binds to one of said polypeptide or to said second complex, and, (d) identifying the compound.

45. A method of identifying compounds which selectively modulate expression of polypeptides which are involved in a pathway eventually leading to programmed cell death of yeast or fungi which method comprises: (a) contacting host cells transformed, transfected or infected with an expression vector comprising a promoter sequence of a nucleic acid as defined in claim 36 joined in frame with a reporter gene, (b) monitoring increased or decreased expression of said reporter gene caused by the addition of the compound being tested, and, (c) identifying the compound.

46. A method for identifying polypeptides involved in a pathway eventually leading to programmed cell death comprising the steps of: (a) providing a two-hybrid system wherein a polypeptide encoded by a nucleic acid according to claim 36 or a vector according to any of claims 3 to 7 as a bait and a yeast or fungal cDNA library as a prey are used, (b) detecting an interaction between said polypeptide and a yeast or fungal polypeptide encoded by said cDNA library, and, (c) identifying said yeast or fungal polypeptide.

47. A method according to any of claims 41 to 46 wherein said yeast or fungus is chosen from Saccharomyces cerevisiae, Schizosaccharomyces pombe, Candida albicans, or Aspergillus fumigatus.

48. A compound or polypeptide identifiable according to the method of any of claims 41 to 47.

49. A compound or polypeptide according to claim 48 for use as a medicament.

50. A method for preparing a pharmaceutical composition for treating diseases associated with yeast or fungi comprising admixing a compound or polypeptide according to claim 49 with a suitable pharmaceutically acceptable carrier.

51. A pharmaceutical composition comprising a compound or polypeptide according to claim 49 together with a suitable pharmaceutically acceptable carrier.

52. Use of a compound or polypeptide according to claim 48 or 49 or a pharmaceutical composition according to claim 51 or obtainable by the method of claim 50 for the preparation of a medicament for treating diseases associated with yeast and fungi.

53. A method for preventing infection with yeast or fungi comprising administering a composition according to claim 51 or obtainable by the method of claim 50 to a mammal in an effective amount to stimulate the production of protective antibody or protective T-cell response.

54. Use of an antibody capable of specifically binding to at least one of the polypeptides as defined in claim 37 or to a specific epitope of said polypeptide, for the preparation of a medicament for treating diseases associated with yeast and fungi.

55. Use according to any of claims 52 to 54 wherein said disease is associated with yeast or fungi, where the yeast or fungus is chosen from Candida spp., Aspergillus spp., Microsporum spp., Trichophyton spp., Fusarium spp., Zygomycetes spp., Botritis, spp., Cladosporium spp., Malassezia spp., Epidermophyton floccosum, Blastomyces dermatitidis, Coccidioides immitis, Histoplasma capsulatum, Paracoccidioides brasiliensis, Cryptococcus neoformans, and Sporothrix schenckii.

56. Use of a compound or polypeptide according to claim 48 or 49 or a pharmaceutical composition according to claim 51 or a genetically modified organism as defined in claim 40 for the preparation of a medicament for modifying the endogenic flora of humans and other mammals.

57. A genetically modified mammalian cell or non-human organism in which modification results in the overexpression or underexpression of at least one of the nucleic acids as defined in claim 36 or a human homologue thereof or at least one of the polypeptides as defined in claim 37 or a human homologue thereof, which overexpression or underexpression of said nucleic acid or polypeptide prevents, delays or sensitizes for apoptosis of said genetically modified mammalian cell or in said genetically modified non-human organism.

58. A genetically modified mammalian cell or non-human organism according to claim 57 wherein said modification comprises the expression of an antisense molecule to at least one of the nucleic acids as defined in claim 36 or an antisense molecule to a mammalian homologue of said nucleic acid.

59. A method for identifying compounds for stimulating or inhibiting apoptosis comprising the use of at least one of the nucleic acids as defined in claim 36 or a human homologue thereof and/or at least one of the polypeptides as defined in claim 37 or a human homologue thereof and/or a genetically modified mammalian cell or non-human organism according to claim 57 or 58.

60. A compound identifiable according to the method of claim 59.

61. A compound according to claim 60 for use as a medicament.

62. A method for preparing a pharmaceutical composition for treating proliferative disorders or for preventing apoptosis in certain diseases comprising admixing a compound according to claim 60 or 61 with a suitable pharmaceutically acceptable carrier.

63. Use of a compound according to claim 60 or 61 for the preparation of a medicament for treating proliferative disorders or for preventing apoptosis in certain disorders.

64. Use of a nucleic acid selected from any of the nucleic acids as defined in claim 36 or a human homologue thereof for treating an/or preventing and/or alleviating proliferative disorders or for the prevention of apoptosis in certain diseases.

65. Use of a nucleic acid selected from any of the nucleic acids as defined in claim 36 or a human homologue thereof for the preparation of a medicament for treating and/or preventing and/or alleviating proliferative disorders or for the prevention of apoptosis in certain diseases.

66. Use of an antisense molecule to at least one of the nucleic acids as defined in claim 36 or an antisense molecule to a mammalian homologue of said nucleic acid for treating and/or preventing and/or alleviating proliferative disorders or for preventing apoptosis in certain disorders.

67. Use of an antisense molecule to at least one of the nucleic acids as defined in claim 36 or an antisense molecule to a mammalian homologue of said nucleic acid for the preparation of a medicament for treating and/or preventing and/or alleviating proliferative disorders or for preventing apoptosis in certain disorders.

68. Use of a polypeptide selected from any of the polypeptides as defined in claim 37 or a human homologue thereof for treating and/or preventing and/or alleviating proliferative disorders or for the prevention of apoptosis in certain diseases.

69. A pharmaceutical composition for use as a medicament for treating proliferative disorders or for the prevention of apoptosis in certain diseases comprising a nucleic acid molecule as defined in claim 36 or a human homologue thereof or an antisense molecule to at least one of the nucleic acids as defined in claim 36 or an antisense molecule to a mammalian homologue of said nucleic acid or a polypeptide as defined in claim 37 or a human homologue thereof together with a pharmaceutically acceptable carrier diluent or excipient therefor.

70. A vaccine for immunizing mammals against proliferative disorders or for preventing apoptosis in certain diseases comprising least one nucleic acid as defined in claim 36 or a human homologue thereof or at least one polypeptide as defined in claim 37 or a human analogue thereof in a pharmaceutically acceptable carrier.

71. Use of an antibody capable of specifically binding to at least one of the polypeptides as defined in claim 37 or to a human homologue thereof or to a specific epitope of said polypeptide or said human homologue, for the preparation of a medicament for treating proliferative disorders or for the prevention of apoptosis in certain diseases.

72. An expression vector comprising a human homologue of a nucleic acid as defined in claim 36.

73. An expression vector according to claim 72 which is an expression vector wherein said nucleic acid sequence is operably linked to one or more control sequences allowing the expression in prokaryotic and/or eukaryotic host cells.

74. An expression vector according to claim 72 or 73 which comprises an inducible promoter.

75. An expression vector according to any of claims 72 to 74 which comprises a sequence encoding a reporter molecule.

76. A host cell transformed, transfected or infected with the vector of any of claims 72 to 75.

77. An isolated nucleic acid comprising a human homologue of at least one of the nucleic acids as defined in claim 36.

78. An antisense molecule comprising a nucleic acid sequence capable of selectively hybridising to the nucleic acid molecule of claim 77.

79. A polypeptide encoded by a nucleic acid of claim 77.

FIELD OF THE INVENTION

[0001] The present invention relates to the identification of genes and proteins encoded thereof from yeast and fungi whose expression is modulated upon programmed cell death and which genes, proteins or functional fragments and equivalents thereof may be used as selective targets for drugs to treat infections caused by or associated with yeast and fungi or for the treatment of proliferative disorders or for the prevention of apoptosis in certain diseases.

BACKGROUND TO THE INVENTION

[0002] Invasive fungal infections (e.g. Candida spp., Aspergillus spp., Fusarium spp., Zygomycetes spp.) (Walsh, 1992) have emerged during the past two decades as important pathogens causing formidable morbidity and mortality in an increasingly diverse and progressively expanding population of immunocompromised patients. Those with the acquired immune deficiency syndrome (AIDS) constitute the most rapidly growing group of patients at risk for life-threatening mycosis. But fungal Infections have also increased in frequency in several populations of other susceptible hosts, including very-low-birth-weight infants, cancer patients receiving chemotherapy, organ transplant recipients, burn patients and surgical patients with complications.

[0003] These fungal infections are not limited to humans and other mammals, but are also important in plants where they can cause diseases or cause the production of unwanted compounds (e.g. Fusarium spp., Aspergillus spp., Botritis spp., Cladosporium spp.).

[0004] Although recent advances in antifungal chemotherapy have had an impact on these mycoses, expanding populations of immunocompromised patients will require newer approaches to antifungal therapy. The discovery of novel antifungal agents is thus an essential element of any new antifungal therapy.

[0005] Classical approaches for identifying antifungal compounds have relied almost exclusively on inhibition of fungal or yeast growth as an endpoint. Libraries of natural products, semi-synthetic, or synthetic chemicals are screened for their ability to kill or arrest growth of the target pathogen or a related nonpathogenic model organism. These tests are cumbersome and provide no information about a compound's mechanism of action. The promising lead compounds that emerge from such screens must then be tested for possible host-toxicity and detailed mechanism of action studies must subsequently be conducted to identify the affected molecular target.

[0006] Cells from multicellular organisms can commit suicide in response to specific signals or injury by an intrinsic program of cell death. Apoptosis is a form of programmed cell death which leads to elimination of unnecessary or damaged cells. Cells that are either unwanted or potentially harmful to the organism undergo the apoptotic process and show events like cell shrinkage, chromatin condensation, cytoplasmic condensation, digestion of nuclear DNA, loss of mitochondrial membrane potential, plasma membrane blebbing and phagocytosis of the cell debris (Schwartz, et al. 1993). The Bcl-2 family of proteins is centrally involved in the control of the programmed cell death process (PCD). Proteins of this group belong either to the inhibitors of cell death (Bcl-2, Bcl-X.sub.L) or to the group of proteins promoting apoptosis (Bax, Bak) (Oltvai and Korsmeyer 1994; Knudson and Korsmeyer 1997; Reed et al. 1998). The ability of the Bcl-2 family of proteins to regulate life and death of a cell is conserved across evolution. Finding of homologues of PCD regulatory genes in plants and animals suggests the possibility that some functions involved in this process may originally have evolved in unicellular organisms, before a divergent development between the plant and the animal kingdom had happened (Apte et al. 1995).

[0007] Expression of the pro-apoptotic human or mouse Bax protein in Saccharomyces cerevisiae did induce cell death in this budding yeast (Sato et al. 1994; Greenhalf et al. 1996; Zha et al. 1996). It was initially described as a process that resembled autophagy with dissolution of the internal organelles and vacuolisation. The apoptotic features characteristic for multicellular eucaryotic cells like morphological changes In nuclear shape and chromatin condensation, were not observed in this yeast (Zha et al. 1996). It was therefore suggested that Bax-induced cell death in S. cerevisiae is due to the toxicity of the Bax protein itself, mediated by a hypothetical pore-formation without any involvement of a death program (Muchmore et al. 1996).

[0008] Bax expression in the fission yeast Schizosaccharomyces pombe did in contrast show some of the typical apoptotic changes like DNA fragmentation, chromatin condensation, dissolution of the nuclear envelope and cytosolic vacuolisation, suggesting the presence of the evolutionary conserved PCD pathway in this unicellular eucaryote (Ink et al. 1997; Jurgensmeier et al. 1997). Since it is very unlikely that species dependent differences in the toxicity of the Bax protein are the reason for this observed difference between the two yeasts, a bona fide cell death pathway may well be present in S. cerevisiae.

[0009] Recent findings of a yeast mutant in the cell division cycle gene CDC48 show a number of morphological and molecular features that are considered typical indicators of apoptosis markers in metazoan cells: exposure of phosphatidylserine on the outer leaflet of the cytoplasmic membrane, DNA breakage as well as chromatin condensation and fragmentation, supporting the existence of a basic PCD machinery in this unicellular yeast. This theory was supported by the analysis of a wild type yeast cell expressing the human Bax protein. Comprehensive tests for morphological markers of apoptosis did show a series of changes, identical to morphological markers defining apoptosis (Ligr, Madeo et al. 1998). Recent findings from the same group (Madeo et al., 1999) implicate oxygen stress as a general regulator of apoptosis in yeast but the actual mechanism of Bax lethality in S. cerevisiae remains unclear. It is an aim of the present invention to provide new bax sequences for expression in yeast and fungi and tools for identifying yeast and candida functions in the pathways leading to programmed cell death.

[0010] It is an aim of the present invention to provide nucleic acids as well as polypeptides which represent potential molecular targets for the identification of new compounds which can be used in alleviating diseases or conditions associated with yeast or fungal infections.

[0011] It is a further aim of the present invention to provide uses of these nucleic acid and polypeptide molecules for treating diseases associated with yeast or fungi or for the preparation of (a) medicament(s) for treating said diseases.

[0012] It is also an aim of the invention to provide pharmaceutical compositions and vaccines comprising these nucleic acids or polypeptides.

[0013] It is also an aim of the present invention to provide vectors comprising these nucleic acids, as well as host cells transfected or transformed with said vectors.

[0014] It is also an aim of the invention to provide antibodies against these polypeptides, which can be used as such, or in a composition as a medicament for treating diseases associated with yeast and fungi.

[0015] It is another aim of the invention to provide methods to selectively identify compounds or polypeptides capable of inhibiting or activating expression of the polypeptides of the invention or capable of selectively modulating expression or functionality of such polypeptides. The nucleic acid and polypeptide molecules alternatively can be incorporated into an assay or kit to identify these compounds or polypeptides.

[0016] It is also an aim of the invention to provide methods for preventing infection with yeast or fungi.

[0017] It is a further aim of the invention to provide human homologues for the nucleic acids and polypeptides of the invention for use in treating proliferative disorders, such as cancer, or for the prevention of apoptosis in certain diseases, or for the preparation of a medicament for treating such disorders or diseases.

[0018] All the aims of the present invention have been met by the embodiments as set out below.

SUMMARY OF THE INVENTION

[0019] Since it has been discovered that the mammalian bax gene triggers apoptotic changes in yeast (Ligr et al., 1998), this can be an indication that the molecular pathways eventually leading to programmed cell death may also be partially present in yeast cells and other unicellular eukaryotes. Identification of genes involved in this process could be important for the development of new antifungal therapeutics.

[0020] The present inventors overexpressed the Bax protein in the pathogenic yeast Candida albicans and found that this leads to a similar phenotype. However these results could only be received after having constructed a new synthetic BAX gene which could be adequately expressed in this pathogenic organism.

[0021] Furthermore, the present inventors identified a range of specific nucleic acids which are involved in the molecular pathways eventually leading to programmed cell death. The present inventors were able to identify via macro array screening a range of genes involved in a pathway eventually leading to programmed cell death in the yeast Saccharomyces cerevisiae. Genes which were differentially expressed (analysed using the Pathways.TM. software) at different time points after Bax expression are envisaged as candidate genes in the present invention.

[0022] Additionally, the invention also relates to Candida spp. homologues of the S. cerevisiae candidate genes and their uses in stimulating or preventing cell death in yeast and fungi, especially pathogenic yeast and fungi are herewith envisaged.

[0023] Furthermore, also part of the invention are the human homologues of these apoptosis-associated S. cerevisiae nucleic acids and polypeptides and their potential use in treating proliferative disorders in human and other mammals.

DETAILED DESCRIPTION OF THE INVENTION

[0024] The present invention relates to the use of a nucleic acid molecule encoding a polypeptide which is involved in a pathway eventually leading to programmed cell death of yeast or fungi and which nucleic acid sequence is selected from,

[0025] (a) a nucleic acid encoding a protein having an amino acid sequence as represented in any of SEQ ID NOs 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730 and 732, or encoding a functional equivalent, derivative or bioprecursor of said protein,

[0026] (b) a nucleic acid encoding a protein having an amino acid sequence which is more than 70% similar, preferably more than 75% or 80% similar, more preferably more than 85%, 90% or 95% similar and most preferably more than 97% similar to any of the amino acid sequences as represented by any of SEQ ID NOs 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730 and 732,

[0027] (c) a nucleic acid encoding a protein having an amino acid sequence which is more than 70% identical, preferably more than 75% or 80% identical, more preferably more than 85%, 90% or 95% identical and most preferably more than 97% identical to any of the amino acid sequences as represented by any of SEQ ID NOs 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730 and 732,

[0028] (d) a nucleic acid comprising a sequence as represented in any of SEQ ID NOs 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669, 671, 673, 687, 691, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729 and 731,

[0029] (e) a nucleic acid which is more than 70% identical, preferably more than 75 or 80% identical, more preferably more than 85%, or 90% or 95% identical and most preferably more than 97% identical to any of the nucleic acid sequences as represented by any of SEQ ID NOs 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669, 671, 673, 687, 691, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729 and 731,

[0030] (f) a nucleic acid encoding a functional fragment of any of the nucleic acids as specified in a) to e); and

[0031] (g) the complement of any of the nucleic acids as specified in a) to f),

[0032] for the preparation of a medicament for treating diseases associated with yeast or fungi. Sequence similarity searches were performed using the BLAST software package version 2. Identity and similarity percentages were calculated using BLOSUM62 as a scoring matrix. As known in the art, "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. Moreover, also known in the art is "identity" which means the degree of sequence relatedness between two polypeptide or two polynucleotide sequences as determined by the identity of the match between two strings of such sequences. Both identity and similarity can be readily calculated. While there exist a number of methods to measure identity and similarity between two polynucleotide or polypeptide sequences, the terms "identity" and "similarity" are well known to skilled artisans (Carillo and Lipton, 1988). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in "Guide to Huge Computers (Bishop, 1994) and Carillo and Lipton (1988). Preferred methods to determine identity are designed to give the largest match between the two sequences tested. Methods to determine identity and similarity are codified in computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCG program package (Devereux et al., 1984), BLASTP, BLASTN and FASTA (Altschul et al, 1990).

[0033] The expression functional fragment of a nucleic acid" as used herein means the minimal nucleic acid which is necessary to encode a functional protein (or polypeptide). For instance, in situations where a nucleic acid is provided comprising at the 5' end and at the 3' end more nucleotides than the actual open reading frame, the invention also relates to fragments of the nucleic acid which are smaller but which still contain the workable open reading frame. Also meant are parts of the open reading frame encoding a polypeptide having the same properties as the polypeptide encoded by the complete open reading frame.

[0034] The expression "a pathway eventually leading to programmed cell death" refers to a sequence of steps ultimately leading to cell death and which can be triggered at various steps in this pathway by various agents, such as Bax, Bak, CED4, hydrogen peroxide, diamide and farnesol. The nucleic acid sequences to be used according to this aspect of the invention from Saccharomyces cerevisiae are defined in SEQ ID NOs 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 395, 691, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713 and 715; from Candida albicans are defined in SEQ ID NOs 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669, 671, 673, 687, 718, 720, 722, 724, 726, 728, 730 and 732.

[0035] The yeast or fungi according to the invention may be, but are not restricted to, pathogenic yeast or fungi. As such, yeast or fungi may cause infections in healthy individuals as well as in immunocompromised patients.

[0036] The expression "treating diseases associated with yeast and fungi" not only refers to diseases or infections caused by said organisms but also refers to allergic reactions caused by said organisms, such as the so-called "professional diseases" in, for instance, bakery and brewery and that are caused by yeast or fungi which are commonly known as "non-pathogenic". Some examples of specific diseases associated with yeast or fungi are further exemplified.

[0037] The invention further relates to the use of nucleic acid sequence homologues of SEQ ID NOs 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669, 671, 673, 687, 691, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729 and 731 but isolated from other yeast and fungi strains which are also involved in a pathway eventually leading to programmed cell death. According to a more specific embodiment, these nucleic acid sequences are derived from Aspergillus fumigatus.

[0038] In a more specific embodiment the invention relates to a nucleic acid encoding a polypeptide which is involved in a pathway eventually leading to programmed cell death of yeast or fungi selected from:

[0039] (a) a nucleic acid encoding a protein having an amino acid sequence as represented in any of SEQ ID NOs 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 718, 720, 722, 724, 726, 728, 730 and 732, or encoding a functional equivalent, derivative or bioprecursor of said protein;

[0040] (b) a nucleic acid encoding a protein having an amino acid sequence which is more than 70% similar, preferably more than 75% or 80% similar, more preferably more than 85%, 90% or 95% similar and most preferably more than 97% similar to any of the amino acid sequences as represented by any of SEQ ID NOs 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 718, 720, 722, 724, 726, 728, 730 and 732,

[0041] (c) a nucleic acid encoding a protein having an amino acid sequence which is more than 70% identical, preferably more than 75% or 80% identical, more preferably more than 85%, 90% or 95% identical and most preferably more than 97% identical to any of the amino acid sequences as represented by any of SEQ ID NOs 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 718, 720, 722, 724, 726, 728, 730 and 732,

[0042] (d) a nucleic acid comprising a sequence as represented in any of SEQ ID 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669, 671, 673, 687, 717, 719, 721, 723, 725, 727, 729 and 731;

[0043] (e) a nucleic acid which is more than 70% identical, preferably more than 75% or 80% identical, more preferably more than 85%, 90% or 95% identical and most preferably more than 97% identical to any of the nucleic acid sequences as represented by any of SEQ ID NO 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669, 671, 673, 687, 717, 719, 721, 723, 725, 727, 729 and 731,

[0044] (f) a nucleic acid encoding a functional fragment of any of the nucleic acid sequences as specified in a) to e), and,

[0045] (g) the complement of any of the nucleic acids as specified in a) to f).

[0046] In a preferred embodiment the invention relates to nucleic acids from Candida albicans, as represented by the SEQ ID NOs 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669, 671, 673, 687, 717, 719, 721, 723, 725, 727, 729 and 731.

[0047] In an even more preferred embodiment the invention relates to an isolated nucleic acid from mammal or human origin which nucleic acid corresponds to a mammal or human homologue of at least one of the sequences represented in SEQ ID NOs 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669, 671, 673, 687, 691, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729 and 731.

[0048] Therefore, according to a further preferred embodiment, the invention relates to an isolated nucleic acid from mammal or human origin which nucleic acid sequence is selected from:

[0049] (a) a nucleic acid encoding a protein having an amino acid sequence as represented in any of SEQ ID NOs 676, 678, 680, 682, 684 and 686, or encoding a functional equivalent, derivative or bioprecursor of said protein;

[0050] (b) a nucleic acid encoding a protein having an amino acid sequence which is more than 70% similar, preferably more than 75% or 80% similar, more preferably more than 85%, 90% or 95% similar and most preferably more than 97% similar to any of the amino acid sequences as represented by any of SEQ ID NOs 676, 678, 680, 682, 684 and 686;

[0051] (c) a nucleic acid encoding a protein having an amino acid sequence which is more than 70% identical, preferably more than 75% or 80% identical, more preferably more than 85%, 90% or 95% identical and most preferably more than 97% identical to any of the amino acid sequences as represented by any of SEQ ID NOs 676, 678, 680, 682, 684 and 686;

[0052] (d) a nucleic acid comprising a sequence as represented in any of SEQ ID NOs 675, 677, 679, 681, 683 and 685;

[0053] (e) a nucleic acid which is more than 70% identical, preferably more than 75 or 80% identical, more preferably more than 85%, or 90% or 95% identical and most preferably more than 97% identical to any of the nucleic acid sequences as represented by any of SEQ ID NOs 675, 677, 679, 681, 683 and 685;

[0054] (f) a nucleic acid encoding a functional fragment of any of the nucleic acids as specified in a) to e); and

[0055] (g) the complement of any of the nucleic acids as specified in a) to f),

[0056] for the preparation of a medicament for treating diseases associated with yeast or fungi.

[0057] The invention also relates to the use of said nucleic acids for treating and/or preventing and/or alleviating proliferative disorders or for the prevention of apoptosis in certain disorders or diseases.

[0058] The expression "proliferative disorders" or "proliferative diseases" refers to an abnormality within a patient or animal such as cancer. Normal cells start to proliferate due to a change in the coding or non-coding sequence of the DNA resulting in a swollen or distended tissue. Mutation may arise without obvious cause. An abnormal benign or malignant mass of tissue is formed that is not inflammatory. Cells of pre-existent tissue start to divide unexpectedly and resulting cell mass possesses no physiologic function.

[0059] The expression "apoptosis" or "apoptosis-related diseases" includes diseases such as autoimmunity diseases, ischemia, diseases related with viral infections or neurodegenerations.

[0060] It should be clear that the invention also relates to all nucleic acids according to the invention and which are specifically described above, and which can be DNA, cDNA, genomic DNA, synthetic DNA, or RNA wherein T is replaced by U. A nucleic acid according to the invention may also comprise any modified nucleotide known in the art.

[0061] The term "nucleic acid sequence" also includes the complementary sequence to any single stranded sequence given.

[0062] According to the invention, these sequences and their homologues in other yeast and fungi or in human or other mammals as well as the polypeptides which they encode represent novel molecular targets which can be incorporated into an assay to selectively identify compounds capable of inhibiting or activating expression of such polypeptides. Furthermore, the invention also relates to the potential use of said sequences in alleviating diseases or conditions associated with yeast or fungi infections, such as diseases caused by Candida spp., Aspergillus spp., Microsporum spp., Trichophyton spp., Fusarium spp., Zygomycetes spp., Botritis spp., Cladosporium spp., Malassezia spp., Epidermophyton floccosum, Blastomyces dermatitidis, Coccidioides immitis, Histoplasma capsulatum, Paracoccidioides brasiliensis, Cryptococcus neoformans, and Sporothrix schenckii, such as, but not limited to:

[0063] Candidiasis, caused by C. albicans and other members of the genus Candida, which are primary or secondary mycotic infections, also named candidosis, moniliasis and thrush;

[0064] Aspergilliosis, caused by members of the genus Aspergillus, form a spectrum of diseases;

[0065] Histoplasmosis, caused by Histoplasma capsulatum, which is a pulmonary disease always seen in HIV positive or other immunocompromised individuals;

[0066] Paracoccidioidomycosis, caused by Paracoccidioides brasiliensis, which is a granulomatous disease that originates as a pulmonary disease;

[0067] Blastomycosis, caused by Blastomyces dermatitidis, which may be a benign and self-limiting infection or a chronic granulomatous and suppurative mycosis, also named Chicago disease or Gilchrist's disease;

[0068] Coccidioidomycosis, caused by Coccidioides imminitis, and which is a respiratory infection that typically resolves rapidly, but the mycosis can become acute, chronic, severe or fatal; also named San Joaquin Valley fever or Valley fever;

[0069] Cryptococcosis, caused by Cryptococcus neoformans, which is a chronic, subacute to acute pulmonary, systemic or meningitic disease, also named Torulosis;

[0070] Sporotrichosis, caused by Sporothrix schenckii, which is a chronic infection characterized by nodular lesions of cutaneous or subcutaneous tissues and adjacent lymphatics that suppurate, ulcerate and drain.

[0071] Some of the pathways leading to apoptosis are conserved between mammalian cells and yeast or fungi. Therefore the invention also relates to the potential use of homologous sequences from human or mammalian origin for preventing and/or alleviating diseases or conditions where apoptosis or non-apoptosis of cells is impaired, for instance in proliferative disorders. In this respect also cancer can be seen as a proliferative disorder. Furthermore, targets which are part of such a conserved pathway may be used to stimulate or inhibit the apoptosis in mammalian cells. E.g. stimulation of apoptosis is desirable in the treatment of tumor cells/tissues.

[0072] Human homologues according to the invention can be obtained by selective hybridisation of the yeast and candida nucleic acid molecules of the invention against human genome or cDNA libraries according to methods well known in the art (Sambrook et al., 1989). Human polypeptide homologues are obtained from the corresponding human nucleic acid homologous nucleotide sequences.

[0073] The present invention further relates to a nucleic acid capable of selectively hybridising to at least one of the nucleic acid molecules according to the invention, or the complement thereof.

[0074] The term "selectively hybridising" or "specifically hybridising" means hybridising under conditions wherein sequences can be detected which are homologues of the sequences of the invention, but which are for instance derived from heterologous cells or organisms, and wherein said sequences do not hybridize with known sequences. In a preferred embodiment, mammalian homologues can be detected. It is well known to the person skilled in the art which methods for hybridisation can be used and which conditions are necessary for selectively or specifically hybridising. Preferably, hybridization under high stringency conditions can be applied (Sambrook et al., 1989).

[0075] As such, the present invention also relates to the use of the nucleic acid sequences of the invention for detecting homologues in heterologous organisms including but not limited to mammalian organisms.

[0076] The invention also relates to an isolated nucleic acid comprising a human homologue of at least one of the yeast or candida nucleic acids described earlier. The invention also relates to a polypeptide encodable by said human homologue of said nucleic acid.

[0077] In a further embodiment the invention also relates to an expression vector comprising a human homologue of at least one of the yeast or candida nucleic acids described herein. Said expression vector according can be an expression vector wherein said nucleic acid sequence is operably linked to one or more control sequences allowing the expression in prokaryotic and/or eukaryotic host cells. According to a further embodiment, the expression vector comprises an inducible promoter and/or a reporter molecule.

[0078] The invention also relates to a host cell transformed, transfected or infected with any of the above described vectors.

[0079] According to a preferred embodiment, the invention relates to an antisense version of any of the nucleic acids of the invention and described above.

[0080] The present invention more particularly relates to an antisense molecule comprising a nucleic acid capable of selectively hybridising to at least one of the nucleic acids of the invention. In an interesting embodiment the invention relates to a nucleic acid capable of selectively hybridising to a human homologue of at least one yeast or candida nucleic acid described herein.

[0081] Polynucleotides according to the invention may be inserted into vectors in an antisense orientation in order to provide for the production of antisense RNA. Antisense RNA or other antisense nucleic acids may also be produced by synthetic means.

[0082] The present invention also advantageously provides nucleic acid molecules of at least approximately 10 contiguous nucleotides of a nucleic acid according to the invention and preferably from 10 to 50 nucleotides. These sequences may, advantageously be used as probes or primers to initiate replication, or the like. Such nucleic acid sequences may be produced according to techniques well known in the art, such as by recombinant or synthetic means. The probes will hybridise specifically with any of the nucleic acid molecules of the invention. The primers will specifically amplify any of the nucleic acid molecules of the invention. The probes or primers according to the invention may also be used in diagnostic kits or the like for detecting the presence of a nucleic acid according to the invention. These tests generally comprise contacting the probe with the sample under hybridising conditions and detecting the presence of any duplex or triplex formation between the probe and any nucleic acid in the sample.

[0083] According to the present invention these probes may be anchored to a solid support. Preferably, they are present on an array so that multiple probes can simultaneously hybridize to a single biological sample. The probes can be spotted onto the array or synthesized in situ on the array. (Lockhart et al., 1996). A single array can contain more than 100, 500 or even 1,000 different probes in discrete locations. Such arrays can be used to screen for compounds interacting with said probes.

[0084] Advantageously, the nucleic acid sequences, according to the invention may be produced using recombinant or synthetic means, such as for example using PCR cloning mechanisms which generally involve making a pair of primers, which may be from approximately 10 to 50 nucleotides to a region of the gene which is desired to be cloned, bringing the primers into contact with mRNA, cDNA, or genomic DNA from the yeast or fungal cell, performing a polymerase chain reaction under conditions which bring about amplification of the desired region, isolating the amplified region or fragment and recovering the amplified DNA. Generally, such techniques as defined herein are well known in the art, such as described in Sambrook et al. (1989). These techniques can be used to clone homologues of the nucleic acid sequences of the invention in other organisms.

[0085] The nucleic acids or oligonucleotides according to the invention may carry a revealing label. Suitable labels include radioisotopes such as .sup.32P, .sup.33P or .sup.35S, enzyme labels or other protein labels such as biotin or fluorescent markers. Such labels may be added to the nucleic acids or oligonucleotides of the invention and may be detected using techniques known in the art.

[0086] According to another embodiment of the invention, the nucleic acid sequences according to the invention as defined above may, advantageously, be included in a suitable vector, preferably an expression vector which may be transformed, transfected or infected into a host cell. In such an expression vector the nucleic acid is operably linked to one or more control sequences allowing the expresssison in host cells, such as a suitable promotor, or the like, to ensure expression of the proteins according to the invention in a suitable prokaryotic or eukaryotic host cell. Said promoter may be either constitutive, inducible or cell- or tissue- or organ-specific. The expression vector may advantageously be a plasmid, cosmid, virus or other suitable vector which is known to those skilled in the art. The expression vector and the host cell defined herein also form part of the present invention. Said host cell can be from bacterial, yeast, fungal, insect, mammal or human origin, or any other host wherein said vector can be introduced by at least one of the methods known in the art. However, preferred host cells are lower eukaryotic cells such as a yeast cell or a fungal cell. Yeast and fungal cells are particularly advantageous because they provide the necessary post-translational modifications to the expressed proteins of the invention, similar to those of the natural proteins from which they are derived. These modifications confer optimal conformation of said proteins, which when isolated may advantageously be used in kits, methods or the like.

[0087] In a further embodiment, the expression vector may further comprise an inducible promoter, and/or further a reporter molecule.

[0088] The invention further relates to any one of the nucleic acids as defined above for use as a medicament.

[0089] Nucleotide sequences according to the invention are particularly advantageous for providing selective therapeutic targets for treating yeast or fungi-associated infections. For example, an antisense nucleic acid capable of binding to the nucleic acid sequences according to the invention may be used to selectively inhibit expression of the corresponding polypeptides, leading to impaired growth or death of yeast and fungi with reductions of associated illnesses or diseases.

[0090] Also envisaged in the present invention are promoter or other control sequences that are comprised within the nucleic acids of the invention, said nucleic acid control sequences can also serve as a target for the identification of compounds or proteins which interfere with the control of expression of downstream encoded polypeptides.

[0091] Furthermore, also the human homologues of the yeast and candida nucleic acids may be useful in diseases where apoptosis of cells plays a substantial role, both in situations where apoptosis of (particular) cells is wanted or unwanted.

[0092] The invention thus also relates to the use of any of the nucleic acids of the invention or to a human homologue thereof for treating proliferative disorders or for the prevention of apoptosis in certain disorders or diseases. As described above, the invention also relates to the use of antisense molecules of the nucleic acids of the invention or to an antisense of any of the human homologues for treating proliferative disorders or for the prevention of apoptosis in certain disorders or diseases.

[0093] Said nucleic acids, human homologues and antisense molecules can also be used for the preparation of a medicament for treating or preventing the above-mentioned diseases.

[0094] According to yet another embodiment, the invention relates to at least one polypeptide encodable by a nucleic acid of the invention.

[0095] The invention also relates to the use of a polypeptide which is involved in a pathway eventually leading to programmed cell death of yeast or fungi, said polypeptide being selected from:

[0096] (a) a protein having an amino acid sequence as represented in any of SEQ ID NOs 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730 and 732, or encoding a functional equivalent, derivative or bioprecursor of said protein;

[0097] (b) a protein having an amino acid sequence which is more than 70% similar, preferably more than 75% or 80% similar, more preferably more than 85%, 90% or 95% similar and most preferably more than 97% similar to any of the amino acid sequences as represented by any of SEQ ID NOs 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730 and 732,

[0098] (c) a protein having an amino acid sequence which is more than 70% identical, preferably more than 75% or 80% identical, more preferably more than 85%, 90% or 95% identical and most preferably more than 97% identical to any of the amino acid sequences as represented by any of SEQ ID NOs 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730 and 732, and,

[0099] (d) a functional fragment of any of said proteins as defined in a) to c),

[0100] for the preparation of a medicament for treating diseases associated with yeast or fungi.

[0101] The term "functional fragment" of a protein means a truncated version of the original protein or polypeptide referred to. The truncated protein sequence can vary widely in length; the minimum size being a sequence of sufficient size to provide a sequence with at least a comparable function and/or activity of the original sequence referred to, while the maximum size is not critical. In some applications, the maximum size usually is not substantially greater than that required to provide the desired activity and/or function(s) of the original sequence. A functional fragment can also relate to a subunit with similar function as said protein. Typically, the truncated amino acid sequence will range from about 5 to about 60 amino acids in length. More typically, however, the sequence will be a maximum of about 50 amino acids in length, preferably a maximum of about 60 amino acids. It is usually desirable to select sequences of at least about 10, 12 or 15 amino acids.

[0102] Functional fragments include those comprising an epitope which is specific or unique for the proteins according to the invention. Epitopes may be determined using, for example, peptide scanning techniques as described in Geysen et al. (1986). Preferred functional fragments have a length of at least, for example, 5, 10, 25, 50, 75, 100, 125, 150, 175 or 200 amino acids.

[0103] The polypeptides to be used according to the invention from Saccharomyces cerevisiae, are represented by SEQ ID NOs 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714 and 716. Also according to the invention is the use of the polypeptides from Candida albicans as represented by the SEQ ID NOs 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 718, 720, 722, 724, 726, 728, 730 and 732, and the use of human polypeptides as represented by SEQ ID NOs 676, 678, 680, 682, 684 and 686.

[0104] Thus, according to a preferred embodiment, the present invention relates to an isolated polypeptide which is involved in a pathway for programmed cell death of yeast or fungi, for instance a Candida spp., selected from:

[0105] (a) a polypeptide having an amino acid sequence as represented in any of SEQ ID NOs 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 718, 720, 722, 724, 726, 728, 730 and 732, or encoding a functional equivalent, derivative or bioprecursor of said protein;

[0106] (b) a polypeptide having an amino acid sequence which is more than 70% similar, preferably more than 75% or 80% similar, more preferably more than 85%, 90% or 95% similar and most preferably more than 97% similar to any of the amino acid sequences as represented by any of SEQ ID NOs 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 718, 720, 722, 724, 726, 728, 730 and 732,

[0107] (c) a polypeptide having an amino acid sequence which is more than 70% identical, preferably more than 75% or 80% identical, more preferably more than 85%, 90% or 95% identical and most preferably more than 97% identical to any of the amino acid sequences as represented by any of SEQ ID NOs 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 688, 718, 720, 722, 724, 726, 728, 730 and 732, and

[0108] (d) a functional fragment of any of said polypeptides as defined in a) to c).

[0109] According to a further preferred embodiment, the present invention relates to an isolated polypeptide which is involved in a pathway for programmed cell death of mammalian cells selected from:

[0110] (a) a polypeptide having an amino acid sequence as represented in any of SEQ ID NOs 676, 678, 680, 682, 684 and 686, or encoding a functional equivalent, derivative or bioprecursor of said protein;

[0111] (b) a polypeptide having an amino acid sequence which is more than 70% similar, preferably more than 75% or 80% similar, more preferably more than 85%, 90% or 95% similar and most preferably more than 97% similar to any of the amino acid sequences as represented by any of SEQ ID NOs human 676, 678, 680, 682, 684 and 686;

[0112] (c) a polypeptide having an amino acid sequence which is more than 70% identical, preferably more than 75% or 80% identical, more preferably more than 85%, 90% or 95% identical and most preferably more than 97% identical to any of the amino acid sequences as represented by any of SEQ ID NOs 676, 678, 680, 682, 684 and 686; and,

[0113] (d) a functional fragment of any of said polypeptides as defined in a) to c).

[0114] The invention also relates to the polypeptides of the invention and described above for use as a medicament.

[0115] Pharmaceutical or fungicidal compositions comprising at least one of the nucleic acids, antisense molecules, polypeptides of the invention optionally together with a pharmaceutically acceptable carrier, diluent or excipient therefor, are also part of the invention.

[0116] The polypeptides described above or the human or mammal homologues thereof can also be used for treating proliferative disorders or for the prevention of apoptosis in certain diseases.

[0117] The invention furthermore relates to a pharmaceutical composition for use as a medicament for treating proliferative disorders or for the prevention of apoptosis in certain diseases comprising a nucleic acid molecule of the invention or a human homologue thereof, an antisense molecule to at least one of the nucleic acids of the invention or an antisense molecule to a mammalian homologue of said nucleic acid or a polypeptide of the invention or a human homologue thereof together with a pharmaceutically acceptable carrier, diluent or excipient therefor.

[0118] The polypeptide or protein according to the invention may also include variants of any of the polypeptides of the invention as specified above having conservative amino acid changes.

[0119] The present invention also relates to a vaccine for immunizing a mammal comprising at least one (recombinant) nucleic acid molecule or at least one (recombinant) polypeptide of the invention in a pharmaceutically acceptable carrier. Preferred vaccines are those that can be used for immunization against infections caused by yeast and fungi. Other preferred vaccines can be used for immunizing mammals against proliferative disorders or for preventing apoptosis in certain diseases.

[0120] Pharmaceutically acceptable carriers include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition. Suitable carriers are typically large, slowly metabolizing macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers; and inactive virus particles. Such carriers are well known to those of ordinary skill in the art.

[0121] A "vaccine" is an immunogenic composition capable of eliciting protection against infections caused by yeast or fungi, whether partial or complete.

[0122] Said vaccine compositions may include prophylactic as well as therapeutic vaccine compositions. When a vaccine is used for protecting individuals against certain infections or diseases, it is called a prophylactic vaccine. A vaccine may also be useful for treatment of an individual, in which case it is called a therapeutic vaccine.

[0123] The term "therapeutic" refers to a composition capable of treating infections caused by yeast or fungi or capable of treating proliferative disorders.

[0124] Also encompassed within the present invention are antibodies, monoclonal or polyclonal, capable of specifically binding to one or more epitopes of the polypeptides or proteins of the invention. The polypeptides of the invention are represented in SEQ ID NOs 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 324, 326, 328, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730 and 732.

[0125] The term "specific binding" implies that there is substantially no cross-reaction of the antibody with other proteins.

[0126] The antibodies according to the invention may be produced according to techniques which are known to those skilled in the art. Monoclonal antibodies may be prepared using conventional hybridoma technology as described by Kohler and Milstein (1979). Polyclonal antibodies may also be prepared using conventional technology well known to those skilled in the art, and which comprises inoculating a host animal, such as a mouse, with a protein or epitope according to the invention and recovering the immune serum. The present invention also includes fragments of whole antibodies which maintain their binding activity, such as for example, Fv, F(ab') and F(ab').sub.2 fragments as well as single chain antibodies.

[0127] The antibodies of the invention are capable of specifically binding to at least one of the yeast or candida polypeptides as defined earlier or to a human homologue thereof or to a specific epitope of said polypeptide or said human homologue. The invention also relates to the use of said antibodies in treating and/or preventing and/or alleviating proliferative disorders or for the prevention of apoptosis in certain diseases. Said antibodies may also be used for the preparation of a medicament for and/or preventing and/or alleviating proliferative disorders or for the prevention of apoptosis in certain diseases.

[0128] Antibodies according to the invention may also be used in a method of detecting the presence of a polypeptide according to the invention, which method comprises reacting the antibody with a sample and identifying any protein bound to said antibody. A kit may also be provided for performing said method which comprises an antibody according to the invention and means for reacting the antibody with said sample.

[0129] The antibodies according to the invention may be used as a medicament or may be comprised in a pharmaceutical composition. According to a more specific embodiment, the antibodies may be used in the preparation of a medicament for treating diseases associated with yeast and fungi where the yeast or fungus is chosen from, but not restricted to Candida spp., Aspergillus spp., Microsporum spp., Trichophyton spp., Fusarium spp., Zygomycetes spp., Botritis, spp., Cladosporium spp., Malassezia spp., Epidermophyton floccosum, Blastomyces dermatitidis, Coccidioides imminitis, Histoplasma capsulatum, Paracoccidioides brasiliensis, Cryptococcus neoformans, and Sporothrix schenckii.

[0130] The invention also relates to a method of preventing infection with yeast or fungi, comprising administering a composition containing at least one polypeptide of the invention to a mammal in effective amount to stimulate the production of protective antibody or protective T-cell response.

[0131] According to another embodiment, the present invention provides a method of identifying compounds or polypeptides which selectively inhibit, induce or interfere with the expression/production of the polypeptides encoded by the nucleotide sequences of the Invention, or compounds which selectively inhibit, activate or interfere with the functionality of polypeptides expressed from the nucleotide sequences according to the invention, or which selectively inhibit, induce or interfere with the metabolic pathways in which these polypeptides are involved. Compounds (or polypeptides) may carry agonistic or antagonistic properties. The compounds (and polypeptides) to be screened may be of extracellular, intracellular, biologic or chemical origin.

[0132] Different alternative methods for identification of said compounds or polypeptides form part of the present invention.

[0133] According to a specific embodiment the invention relates to a method of identifying compounds which selectively modulate expression or functionality of polypeptides involved in a pathway eventually leading to programmed cell death of yeast and fungi or in metabolic pathways in which said polypeptides are involved, which method comprises (a) contacting a compound to be tested with yeast or fungal cells transformed, transfected or infected with an expression vector comprising an antisense sequence of at least one of the nucleic acid sequences of the invention, which expression results in underexpression of said polypeptide, in addition to contacting one or more wild type cells with said compound, (b) monitoring the growth and/or death rate or activity of said transformed, transfected or infected cells compared to said wild type cells; wherein differential growth or activity of said transformed, transfected or infected yeast or fungal cells is indicative of selective action of said compound on a polypeptide in the same or a parallel pathway, (c) alternatively monitoring the growth and/or death rate and/or activity of said transformed, transfected or infected cells compared to transformed, transfected or infected cells which were not contacted with the compound to be tested, wherein differential growth or activity of said mutated yeast or fungi cells is indicative of selective action of said compound on a polypeptide in the same or a parallel pathway, (d) alternatively monitoring changes in morphologic and/or functional properties of components in said transformed, transfected or infected cells caused by the addition of the compound to be tested, and (e) optionally identifying the compound.

[0134] Alternative methods for identifying compounds which selectively modulate expression or functionality of polypeptides involved in a pathway eventually leading to programmed cell death of yeast or fungi or in metabolic pathways in which said compounds are involved, may comprise the use of any other method known in the art resulting in gene activation, gene inactivation, gene modulation or gene silencing.

[0135] Another alternative to the above described method comprises (a) contacting a compound to be tested with a genetically modified yeast or fungus in which modification results in the overexpression or underexpression of at least one of the nucleic acids or the polypeptides of the invention, which overexpression or underexpression of said nucleic acid or polypeptide prevents, delays or sensitizes for apoptosis of said genetically modified yeast or fungus, in addition to contacting wild type cells with said compound, (b) monitoring the growth and/or death rate and/or activity of said genetically modified yeast or fungi cells compared to said wild type cells wherein differential growth or activity of said genetically modified yeast or fungi cells is indicative of selective action of said compound on a polypeptide in the same or a parallel pathway, (c) alternatively monitoring the growth and/or death rate and/or activity of said genetically modified cells compared to genetically modified cells which were not contacted with the compound to be tested, wherein differential growth or activity of said genetically modified yeast of fungi cells is indicative of selective action of said compound on a polypeptide in the same or a parallel pathway, (d) alternatively monitoring changes in morphologic and/or functional properties of components in said genetically modified cells caused by the addition of the compound to be tested, and, (e) optionally identifying the compound.

[0136] The invention also relates to a method of identifying compounds which selectively modulate expression of polypeptides which are involved in a pathway eventually leading to programmed cell death of yeast or fungi which method comprises (a) contacting host cells transformed, transfected or infected with an expression vector comprising a promoter sequence of a nucleic acid molecule of the invention joined in frame with a reporter gene and (b) monitoring increased or decreased expression of said reporter gene caused by the addition of the compound being tested. This enables to analyse the influence of the compound onto all/most aspects of transcriptional activation. Alternatively additional tests can routinely be performed to test the influence of the compound onto mRNA stability, translation and protein stability. All these aspects influence the concentration of corresponding proteins and consequently influence the effect of these on the metabolism of the cell.

[0137] The invention further relates to a method of identifying compounds or polypeptides which bind to or modulate the properties of polypeptides which are involved in a pathway eventually leading to programmed cell death of yeast or fungi, which method comprises (a) contacting a compound or polypeptide to be tested with at least one of the polypeptides of the invention, (b) detecting the complex formed between the compound or polypeptide to be tested and said polypeptide, (c) alternatively, examining the diminution/increase of complex formation between said polypeptide and a receptor/binding partner, caused by the addition of the compound or polypeptide being tested, (c) alternatively, examining the alteration in the functional activity of the polypeptide, caused by the addition of the compound or polypeptide being tested, and (d) optionally identifying the compound or polypeptide.

[0138] The invention also relates to a method for identifying compounds interacting with a polypeptide involved in a pathway eventually leading to programmed cell death of yeast and fungi comprising the steps of (a) providing a two-hybrid screening system wherein a polypeptide of the invention and a protein interacting with said polypeptide or an interacting polypeptide obtainable by a method as described above, are expressed, (b) interacting said compound with the complex formed by the expressed proteins as defined in a), (c) detecting a second complex, wherein the presence of said second complex identifies a compound which specifically binds to one of said polypeptide or to said second complex, and optionally (d) identifying the compound. According to another embodiment the invention relates to a method for identifying compounds which selectively modulate expression of polypeptides which are involved in a pathway eventually leading to programmed cell death of yeast or fungi which method comprises: (a) contacting host cells transformed, transfected or infected with an expression vector comprising a promoter sequence of a nucleic acid of the invention joined in frame with a reporter gene, (b) monitoring increased or decreased expression of said reporter gene caused by the addition of the compound being tested, and, optionally (c) identifying the compound.

[0139] Yet another embodiment of the invention is a method for identifying polypeptides involved in a pathway eventually leading to programmed cell death comprising the steps of: (a) providing a two hybrid system wherein a polypeptide encoded by a nucleic acid or by any of the vectors of the invention as a bait and a S. cerevisiae cDNA library as a prey are used, (b) detecting an interaction between said polypeptide and a S. cerevisiae polypeptide encoded by said cDNA library, and, optionally (c) identifying said S. cerevisiae polypeptide.

[0140] The term "cells" as used in the above methods relates to any type of cells such as, but not limited to bacterial, yeast, fungal, plant or human cells.

[0141] Compounds found using this approach may additionally be tested on their efficiency in killing or inhibiting the growth of wild type cells in order to confirm their utility as medicament for treating wild type pathogenic strains/tumor cells.

[0142] According to the invention, the term "mutation" includes point mutations, deletions, insertions, duplications or any modification in the nucleic acid encoding said polypeptide, or at a different location in the genome of said cells, influencing the expression of said nucleic acid or polypeptide. In case point mutations occur, the number of nucleotides will be identical compared to the original sequence; only a change in nucleotide sequence can be observed. This stands in contrast with the other listed mutations where the number of the nucleotides will be different from the number observed in the wild type sequence and consequently will also reflect in a change of the nucleotide sequence.

[0143] Changes in morphologic and/or functional properties of cell components which can be monitored include for example morphological and molecular changes such as abnormal cell morphology, nuclear fragmentation, DNA breakage or changes in the expression of certain enzymes such as caspases, as well as monitoring changes in membrane potential or activity of mitochondria and release of cytochrome c from mitochondria. All these changes can be monitored on the whole cell which is contacted to the compound to be tested.

[0144] Detection of the complex formation can be performed using several approaches. First, binding of a compound onto a polypeptide can be studied using classical binding tests: one of the binding partners, compound or polypeptide is labeled and interaction of both is measured. Most of these tests comprise following steps: incubating both binding partners in conditions where binding is allowed, separation of free label from bound label present in the complex formed between both partners, and measuring the number of labeled complexes formed. Separation of free and bound label can be performed via filtration, centrifugation or other means as known by the person skilled in the art. Other techniques allow visualisation of complex formation without the need of such a separating step. For example, test systems using SPA (scincillation proximity assay) beads are based on the principle that radioactive .sup.3H can only be measured when present in scincillation fluid. SPA beads contain scincillation fluid and can be coated with one of the binding partners. When this bead is approached and binds the other binding partner which is radioactively labeled, a signal will be detected allowing the complex to be visualised. Binding of the radioactive compound onto the scincillation bead is needed in order to result in a detectable signal; non-bound radioactive partners that stay free into the solution will not result in a detectable signal.

[0145] The protein or peptide fragments according to the invention employed in such a method may be for example in solution or coated on suspended beads as described above. Alternatively, these can be affixed to a solid support, borne on a cell or phage surface or located intracellularly.

[0146] When protein or peptide fragments are coated on solid supports, they can be tested for their binding affinity for large numbers of compounds. These can be used in different kinds of high throughput screenings in order to identify compounds having suitable binding affinity to the polypeptides according to the invention. Platform technologies or technologies based on SPR (see below) can be applied.

[0147] One may measure for example, the formation of complexes between the proteins of the invention and the compound being tested. Alternatively, one may examine the diminution or increase of complex formation between the protein according to the invention and a receptor/binding partner caused by the compound being tested.

[0148] Proteins which interact with the polypeptide of the invention may be identified by investigating protein-protein interactions using the two-hybrid vector system first proposed by Chien et al. (1991).

[0149] This technique is based on functional reconstitution in vivo of a transcription factor which activates a reporter gene. More particularly the technique comprises providing an appropriate host cell with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA binding domain and an activating domain, expressing in the host cell a first hybrid DNA sequence encoding a first fusion of a fragment or all of a nucleic acid sequence according to the invention and either said DNA binding domain or said activating domain of the transcription factor, expressing in the host at least one second hybrid DNA sequence, such as a library or the like, encoding putative binding proteins to be investigated together with the DNA binding or activating domain of the transcription factor which is not incorporated in the first fusion; detecting any binding of the proteins to be investigated with a protein according to the invention by detecting for the presence of any reporter gene product in the host cell; optionally isolating second hybrid DNA sequences encoding the binding protein.

[0150] An example of such a technique utilizes the GAL4 protein in yeast. Gal4 is a transcriptional activator of galactose metabolism in yeast and has a separate domain for binding to activators upstream of the galactose metabolising genes as well as a protein-binding domain. Nucleotide vectors may be constructed, one of which comprises the nucleotide residues encoding the DNA binding domain of Gal4. These binding domain residues may be fused to a known protein encoding sequence, such as for example the nucleic acids according to the invention. The other vector comprises the residues encoding the protein-binding domain of Gal4. These residues are fused to residues encoding a test protein. Any interaction between polypeptides encoded by the nucleic acid according to the invention and the protein to be tested leads to transcriptional activation of a reporter molecule in a GAL4 transcription deficient yeast cell into which the vectors have been transformed. Preferably, a reporter molecule such as .beta.-galactosidase is activated upon restoration of transcription of the yeast galactose metabolism genes. Alternatively, other reporter proteins can be used such as EGFP (enhanced green fluorescent protein), or hEGFP. This latter has a decreased lifetime enabling the system to screen for compounds improving the interaction of studied binding partners.

[0151] The two-hybrid approach was first developed for yeast, and is an ideal screening system when looking for compounds active in killing yeast or fungi. Indeed, proteins expressed in this system will most probably carry the correct modifications as found in the pathogenic yeast strains. In addition, compounds active in this test system allow to screen and select compounds which are able to enter the cell, this selection is not possible when using in vitro test systems. When compounds are needed to target mammalian cells, modification of the studied proteins can be different, changing the structure of corresponding proteins. Moreover working with yeast might block certain compounds to enter the cell, which are normally able to traverse the mammalian cell membrane. Consequently, working with mammalian two-hybrid system for this purpose will give already an immediate selection of the compounds that may enter mammalian cells.

[0152] Alternative in vitro methods can be used to investigate protein-protein interactions. Protein interaction analysis in vitro can shed light on their role in the intact cell by providing valuable information on specificity, affinity, and structure-function relation ship. Significant progress in this respect has become with the advent, in the last few years, of commercially available biosensor technology. This allows to study macromolecular interactions in real-time, providing a wealth of high-quality data that can be used for kinetic analysis, affinity measurements, competition studies, etc. A major advantage of biosensor analysis is that there is no requirement for labeling one of the interacting components and then separating bound from free molecules--a fact that simplifies experimental procedures and provides more accurate measurements. The principle of surface plasmon resonance (SPR) is based on the detection of a change of the refractive index of the medium when a compound or protein binds to an immobilised partner molecule. For the SPR technology, one needs to load one of the interacting partners to the chip surface, followed by the superfusion of the second binding partner or more molecules. The second partner can be available as purified product, but alternatively a complex suspension containing this partner can also be used. Interaction of two or more compounds can be analysed, alternatively, compounds can be identified interfering or increasing this binding affinity towards each other.

[0153] SPR is not restricted to protein-protein interactions; any macromolecule with a suitable size will change the refractive index of the medium in contact with the biosensor surface and therefore give a signal. Studies have been done with protein-DNA interactions, as well as protein-lipid interactions. Moreover intact viruses, and even cells, can also be injected over the biosensor surface, in order to analyse their binding to receptors, lectins, and so on.

[0154] Alternatively, NMR is also an excellent tool for a detailed study of protein-protein or DNA-protein interactions. Isotope edited or isotope filtered experiments whereby one compound is isotopically labeled with .sup.15N or .sup.13C are an ideal way to study these complexes. This method does not allow high throughput analysis of compounds interfering or enhancing molecular interactions. Nevertheless, medium or low throughput systems can be used to confirm results obtained by the high throughout assays or in cases where none of the binding partners are labeled. Other techniques which can be used to study interactions are: overlay, ligand blotting, band-shift, co-immuno-precipitation, size exclusion chromatography and microcalorimetry (In. "Protein targeting Protocols" Ed. Clegg R. A. Humana Press, Totowa, New Yersey).

[0155] Compounds modulating pathways leading to apoptosis may change the activity of the polypeptide of the invention. Therefore screening tests may be setup looking for altered protein activity of the polypeptide of the invention. Based on the amino acid sequence a possible function of the polypeptide might be envisaged; activities can be confirmed and corresponding activity test can be started.

[0156] Alternatively additional tests can be performed to test the influence of the compound onto protein stability, post-translational modification, precursor processing and protein translocation. All these aspects influence the concentration and/or activity of corresponding proteins and consequently influence the effect of these onto the metabolism of the cell. Also here, medium or low throughput systems can be used to confirm results obtained by the high throughout assays.

[0157] In cases compounds need to be found to target tumor cells, screening assays will have to be used focused on the stimulation of the apoptotic pathway. This invention therefore also relates to in vitro and in vivo model systems comprising tumor tissue or cells expressing the polypeptides according to the invention which can be used to screen for therapeutic agents. In vivo modelsystems allow to test for compound efficacity but also the toxicity of these compounds can be tested. The compounds identified using any of the methods described in the invention not only include compounds which exert their effect in promoting cell death of yeast and fungi, but also include compounds which prevent or delay cell death. The latter compounds can be used to prevent or delay apoptosis of endogenic yeast or fungi in humans and other mammals which may be caused by pathogens or toxic environmental components.

[0158] According to a preferred aspect of the invention, the yeast or fungi according to any of the methods described, are chosen from Candida spp., Aspergillus spp., Microsporum spp., Trichophyton spp., Fusarium spp., Zygomycetes spp., Botritis, spp., Cladosporium spp., Malassezia spp., Epidermophyton floccosum, Blastomyces dermatitidis, Coccidioides imminitis, Histoplasma capsulatum, Paracoccidioides brasiliensis, Cryptococcus neoformans, and Sporothrix schenckii.

[0159] The invention also relates to a compound identified using any of the methods of the invention. Compounds identifiable or identified using a method according to the invention, may advantageously be used as a medicament. The invention also relates to a method for treating diseases associated with yeast or fungi comprising admixing a compound obtainable by a method of the invention with a suitable pharmaceutically acceptable carrier.

[0160] The invention further relates to a method for preparing pharmaceutical composition for treating diseases associated with yeast or fungi comprising admixing a compound as identified above with a suitable pharmaceutically acceptable carrier. The invention also relates to said pharmaceutical composition.

[0161] The compounds or pharmaceutical compositions of the invention can be used for the preparation of a medicament to treat diseases or conditions associated with yeast and fungi infections, more preferably where the yeast or fungus is chosen from Candida spp., Aspergillus spp., Microsporum spp., Trichophyton spp., Fusarium spp., Zygomycetes spp., Botritis, spp., Cladosporium spp., Malassezia spp., Epidermophyton floccosum, Blastomyces dermatitidis, Coccidioides imminitis, Histoplasma capsulatum, Paracoccidioides brasiliensis, Cryptococcus neoformans, and Sporothrix schenckii.

[0162] These compounds may also advantageously be included in a pharmaceutical composition together with a pharmaceutically acceptable carrier, diluent or excipient therefor.

[0163] A medicament according to the invention not only relates to fungicidal and fungistatic compounds for treating humans or mammals but also relates to fungicides for treating plants.

[0164] According to yet another embodiment, the invention relates to a genetically modified yeast or fungus in which modification results in the overexpression or underexpression of at least one of the nucleic acids or the polypeptides of the invention, which overexpression or underexpression of said nucleic acid or polypeptide prevents, delays or sensitizes for apoptosis of said genetically modified yeast or fungus. These genetically modified organisms may have a positive effect on the endogenic flora of humans and other mammals. The genetically modified yeast or fungi can be included in a pharmaceutical composition or can be used for the preparation of a medicament for prophylactic or therapeutic use.

[0165] Also according to the invention is the use of a compound obtainable by a method of the invention, a pharmaceutical composition or a genetically modified organism as described above for the preparation of a medicament for modifying the endogenic flora of humans and other mammals.

[0166] According to another embodiment, the invention relates to a genetically modified mammalian cell or non-human organism in which modification results in the overexpression or underexpression of at least one of the nucleic acids of the invention or a human homologue thereof or at least one of the polypeptides of the invention or a human homologue thereof, which overexpression or underexpression of said nucleic acid or polypeptide prevents or delays apoptosis of said genetically modified mammalian cell or in said genetically modified non-human organism.

[0167] According to a preferred embodiment, the invention relates to a genetically modified mammalian cell or non-human organism as described above wherein said modification comprises the expression of an antisense molecule to at least one of the nucleic acids of the invention or an antisense molecule to a mammalian homologue of said nucleic acid.

[0168] The invention also relates to a method for identifying compounds for stimulating or inhibiting apoptosis comprising the use of at least one of the nucleic acid sequences of the invention or a human homologue thereof and/or at least one of the polypeptides of the invention or a human homologue thereof and/or a genetically modified mammalian cell or non-human organism as described in the invention.

[0169] Some examples of preferred human homologues of yeast and/or Candida spp. sequences which can be used in the above methods are represented in SEQ ID NOs 675 to 686.

[0170] The invention further relates to the compounds identifiable according to the above-described method and their use as a medicament.

[0171] The invention further relates to a method for preparing a pharmaceutical composition for treating proliferative disorders or for preventing apoptosis in certain diseases comprising admixing a compound identifiable according to the above-described methods with a suitable pharmaceutically acceptable carrier.

[0172] The invention also relates to the use of compounds obtainable by the above described methods for the preparation of a medicament for treating proliferative disorders or for preventing apoptosis in certain disorders.

[0173] Furthermore, the present inventors overexpressed the Bax protein in the pathogenic yeast Candida albicans and found that this leads to a similar phenotype. However these results could only be received after having constructed a new synthetic bax gene which could be adequately expressed in this pathogenic organism.

[0174] Therefore, the present invention relates to an isolated nucleic acid representing a synthetic BAX-gene for expression in Candida spp. selected from the group of:

[0175] a) a nucleic acid comprising a sequence as represented by SEQ ID NO 1,

[0176] b) a nucleic acid comprising a fragment of a sequence of SEQ ID NO 1 and encoding a functional fragment of the sequence represented by SEQ ID NO 2,

[0177] c) a nucleic acid comprising a sequence as represented in any of SEQ ID NOs 3 to 10,

[0178] d) a nucleic acid which is more than 75% identical, preferably more than 80%, 85%, 90% or 95% identical, most preferably more than 97% identical to the nucleic acid as represented by SEQ ID NO 1, or to a nucleic acid according to the nucleic acid as defined in b) or c), and

[0179] e) a nucleic acid as defined in any one of (a) to (i) interrupted by intervening DNA sequences,

[0180] or a nucleic acid representing the complement of any of said nucleic acids as defined in (a) to (d).

[0181] The synthetic BAX gene shows 73.7% identity with the gene coding for Bax-a. It should be clear that the present invention also relates to nucleic acids wherein other, also frequently used Candida spp. codons, are used instead of the choice made for the sequence represented in SEQ ID NO 1. (Table 8)

[0182] It should be clear that all nucleic acids according to the invention and which are specifically described above, can be DNA, cDNA, genomic DNA, synthetic DNA, or RNA wherein T is replaced by U.

[0183] According to another embodiment of the invention, the nucleic acid sequences according to the invention as defined above may, advantageously, be included in a suitable vector, preferably an expression vector which may be transformed, transfected or infected into a host cell. In such an expression vector the nucleic acid is operably linked to one or more control sequences allowing the expression in host cells, such as a suitable promotor, or the like, to ensure expression of the proteins according to the invention in a suitable prokaryotic or eukaryotic host cell. In this respect, a constitutive or an inducible promoter can be used.

[0184] As described in the examples, the invention also relates to nucleic acids and constructs comprising the synthetic BAX, or parts thereof, as a fusion with a carrier gene, such as, but not restricted to the yeast GFP gene. It is not necessary to include the complete gene of the fusion partner in the expression construct, so the invention relates to various fusion products which can result from the synthetic BAX gene and its fusion partner.

[0185] The expression vectors comprising the synthetic construct or fusion protein and the host cell defined herein also form part of the present invention. Said host cell can be from bacterial, yeast, fungal, insect, mammal or human origin. An interesting host cell according to the invention is a Candida spp. cell.

[0186] In another embodiment, the expression vector may further comprise an inducible promoter, and/or further a reporter molecule.

[0187] The invention also relates to a vector as described above for inducing programmed cell death in Candida spp.

[0188] The invention further also relates a genetically modified yeast or fungal cell as described above wherein said modification results in the onset of at least one pathway eventually leading to programmed cell death.

[0189] The invention also relates to a genetically modified Candida spp. cell wherein said modification results in the onset of at least one pathway eventually leading to programmed cell death

[0190] According to a further embodiment, the invention relates to a method for identifying genes in Candida spp. which are differentially expressed in a pathway eventually leading to programmed cell death using a synthetic BAX gene, as described above, or a vector comprising said gene as described herein, or a genetically modified yeast or fungal cell as described above.

[0191] In this respect different model systems are envisaged. It has been shown in the present invention that expression of the synthetic BAX gene as a fusion protein more rapidly kills the host cells than when expressed without a fusion partner. Accordingly there will be a difference in which Candida spp. genes will be differentially expressed in each system. The invention thus relates to methods for identifying genes in Candida spp. which are differentially expressed in a pathway eventually leading to programmed cell death, wherein in said methods the host cells will need a longer or shorter time period for starving. Said time period is dependent on the expression construct or system used.

[0192] The invention further relates to a method for obtaining and identifying Candida spp. sequences (genes or polypeptides) involved in a pathway eventually leading to programmed cell death comprising the steps of:

[0193] a) providing a two hybrid system wherein a polypeptide encoded by a nucleic acid as described above or a vector as described above as a bait and a Candida spp. cDNA library as a prey are expressed,

[0194] b) detecting an interaction between said polypeptide and a Candida spp. polypeptide encoded by said cDNA library, and,

[0195] c) identifying said Candida spp. polypeptide.

[0196] The invention also relates to a method for identifying inhibitors (or inhibitor sequences) of Bax-induced cell death comprising the steps of:

[0197] a) providing a genetically modified organism as described above,

[0198] b) expressing a cDNA library in said genetically modified organism, and,

[0199] c) identifying a polypeptide or a cDNA which expression has a beneficial effect on the survival and/or growth of said genetically modified organism.

[0200] The invention further relates to a method for identifying Bax-resistant yeast or fungi comprising the steps of:

[0201] a) providing (a) genetically modified yeast or fungi as described above,

[0202] b) treating said genetically modified yeast or fungi with a mutagen,

[0203] c) isolating resistant yeast or fungal cells, and,

[0204] d) optionally identifying and/or characterizing mutated genes in said resistant yeast or fungal cells.

[0205] The invention further relates to any of the methods described above wherein said genetically modified organism is a Candida spp.

[0206] The invention also relates to an isolated Candida spp. nucleic acid identifiable by any of the methods described above.

[0207] The invention, now being generally described, may be more clearly understood by reference to the following examples, which are included merely for purposes of illustration of certain aspects and embodiments of the present invention and are not intended to limit the invention. The contents of all references referred to in this text are hereby incorporated by reference.

FIGURE AND TABLE LEGENDS

[0208] FIG. 1. Saccharomyces cerevisiae sequences based on information obtained from the Saccharomyces Genome Database (SGD) (SEQ ID NOs 17 to 396 and SEQ ID NOs 691 to 716)

[0209] FIG. 2. Candida albicans (SEQ ID NOs 397 to 674, 687, 688 and 717 to 732) and human homologues (SEQ ID NOs 675 to 686).

[0210] Human homologues were confirmed via forward and reverse BLAST using BLOSUM62 as a scoring matrix.

[0211] YGL080W (SEQ ID NO 161) codes for a yeast protein with an unknown cellular role and an unknown biochemical function. The human homologue (330 bp (SEQ ID NO 675), 109 aa (SEQ ID NO 676)) LOC51660/g7706369 has no reported cellular role or biochemical function.

[0212] YGR243W (SEQ ID NO 189) codes for a yeast protein with an unknown cellular role and an unknown biochemical function. The human homologue (384 bp (SEQ ID NO 677), 127 aa (SEQ ID NO 678)) DKFZP564B167/g5817257 has no reported cellular role or biochemical function.

[0213] YGR183C (QCR9) (Table 3) codes for a yeast protein with a known cellular role and a known biochemical function. QCR9 codes for subunit 9 of ubiquinol cytochrome-c reductase (7.3 kDa protein) which is a component of the ubiquinol cytochrome-c reductase complex. Cellular role: energy generation. Biochemical function: oxidoreductase and active transporter. The human homologue (132aa (SEQ ID NO 679), 399 bp (SEQ ID NO 680)) AF161536 was predicted to have an analogous cellular role and biochemical function.

[0214] YBR009C (SEQ ID NO 37), YGR209C (SEQ ID NO 187) and YPR028W (SEQ ID NO 393) correspond to known yeast ORFs. Their human homologues have a reported cellular role or biochemical function.

[0215] FIG. 3. Yeast genome macroarray containing a total of 6144 gene ORFs spotted on 2 nylon membrane filters (I and II). Each filter contains 2 fields and each field is divided into 8 grids, organised in 24 rows and 8 columns.

[0216] The spots represent the genome wide expression profile without (Minus BAX) and with (Plus BAX) induction of Bax expression for 30 min, 1 hour, 2 hours, 3 hours and 6 hours.

[0217] FIG. 4 Yeast cells with a disrupted YGR183C gene are fully resistant to Bax-induced cell death. Resistance is observed in both the low-copy (A) and the high-copy (B) Bax expression system. Clonogenic survival was determined by recovering cells at various times from galactose-containing medium and plating of 1000 cells on glucose-based semisolid medium. Data are representative of three experiments (mean.+-.SD, n=3). SD bars are obscured by symbols.

[0218] FIG. 5. Scheme for the synthesis of the synthetic BAX gene using C. albicans optimal codons.

[0219] FIG. 6. DNA (SEQ ID NO 1) and protein (SEQ ID NO 2) sequence of the synthetic C. albicans BAX gene.

[0220] FIG. 7. Representation of the expression constructs of the synthetic CaBAX gene (A) and the yEGFP-synth CaBAX fusion (B).

[0221] FIG. 8. Growth of the Candida Albicans transformants: the individual transformants of pGAL1P:synthCaBAX and pGAL1P:GFP-synthCaBAX were streaked onto plates containing either 2% glucose or 2% galactose as sole carbon source. Growth was monitored 4 days later.

[0222] FIG. 9. Growth kinetics of GALL P:synthCaBAX (A) and GALL P:GFP-synthCaBAX (B) on galactose containing minimal medium.

[0223] FIG. 10. Immunoblot analysis of two independent transformants of GAL1P:synthCaBAX after 15 hours Bax induction on minimal galactose containing media. The arrow at 20 kDa indicates the position of the Bax protein. The band seen at 50 kDa probably represents a cell wall mannan. Not all of the contamination of the polyclonal Bax antibody could be removed by the threatment with S. cerevisiae mannan.

[0224] FIG. 11. Immunoblot analysis of the GAL1P:GFP-synthCaBAX strain on galactose containing minimal medium. The band appearing at 45 kDa represents the Gfp-Bax fusion protein, while the band at 20 kDa represents the Gfp protein alone.

[0225] FIG. 12. FACS analysis of two independent GAL1P:GFP-synthCaBAX transformants grown on galactose containing media: the light grey peak indicates the autofluorescence of the wt strain, the GFP-fluorescence peak is not shaded.

[0226] FIG. 13. Viability test synthCaBAX (A) and GFP-synthCaBAX transformants (B): Cells were pregrown in minimal dextrose medium and then switched to fresh minimal medium containing galactose. At the time points indicated, samples were taken and equal cell amounts were spread on minimal dextrose plates. The appearing colonies represented the viable fraction of the total pool.

[0227] Table 1. Oligonucleotides used for construction of the synthetic CaBAXx gene: start and stop codon are in bold, restriction sites used for cloning are in bold and italic.

[0228] Tables 2-6. Genes modulated by Bax expression in S. cerevisiae. This list includes the genes for which mRNA levels changed significantly after a 30 min (Table 2), 1 hour (Table 3), 2 hours (Table 4), 3 hours (Table 5) or 6 hours (Table 6) induction of Bax protein expression. The Qt values were calculated using the Pathways.TM. software (Research Genetics).

[0229] Table 7. Genes modulated by Bax expression in S. cerevisiae. This list includes all the genes for which mRNA levels changed significantly after induction of Bax protein exppression. The Ot values were calculated using the Pathways software (Research Genetics). Positive values correspond with upregulated genes. Negative values correspond with downregulated genes. (Comparable with .Arrow-up bold. and .dwnarw. respectively in Tables 2-6).

[0230] Table 8. Codon usage for the synthetic BAX gene.

[0231] Table 9. Regulation of 23 selected "Bax-specific" functions.

EXAMPLES

Example 1

Differential Gene Expression Analysis Upon Bax-Induced Cell Death

[0232] Materials and Media

[0233] Bacterial strain Escherichia coli MC1061 (Casadaban and Cohen, 1980) was used for the construction and the amplification of plasmids. Yeast strains were grown under normal conditions on standard media (Sherman et al., 1979). The Saccharomyces cereviseae strain INVSc1 (Invitrogen.RTM., San Diego, Calif., USA) was transformed by means of the lithium acetate method (Schiestl and Gietz, 1989) with YIpUTyL or YIpUTYLMuBax, after linearisation in the Ty .delta. element (Zhu, 1986).

[0234] Cloning of Mouse BAX cDNA

[0235] Mouse bax cDNA, encoding the mouse Bax-.alpha. protein, was cloned by Pfu DNA polymerase (Stratagene.RTM., Lo Jolla, Calif., USA) chain reaction amplification (PCR) from an EL4/13.18 thymoma cDNA library (BCCM.TM./LMBP-LIB15) by making use of the primers:

1 5'-ATGGACGGGTCCGGGAGCAG-3' (SEQ ID NO 689) and 5'-TCAGCCCATCTTCTTCCAGATGGTGAG-3'. (SEQ ID NO 690)

[0236] The resulting PCR product was cloned in a HincII-openend pUC19 according to standard procedures (Sambrook J. et al., 1989).

[0237] Plasmid Constructions

[0238] The 2.mu. ori and the URA3 marker gene were removed from pUT332 (Gatignol et al., 1990) by successive digestions with ClaI and BglII. A BamHI-HindIII GAL1 promoter fragment was ligated into the BglII-HindIII-opened plasmid. A XbaI-FspI FLP terminator fragment was inserted into this XbaI-HindIII(blunted)-opened plasmid so that the plasmid YIpUT was obtained. Insertion of a blunted EcoRI-BsaAI Ty .delta. element in the KpnI-AatII-opened and blunted YIpUT resulted in the plasmid YIpUTy. Subsequent insertion of the LEU2 marker gene, as a blunted BsaAI-BsrGI fragment, in the BamHI-openend and blunted YIpUTy resulted in the plasmid YIpUTyL.

[0239] Mouse bax cDNA was excised from pUC19 by digestion with XbaI and HindIII and subcloned into the XbaI-HindIII-opened plasmid YIpUTyL, obtaining the final expression plasmid YIpUTyLMuBax.

[0240] The plasmid YIpUTyLMuBax has been deposited in the BCCM.TM./LMBP culture collection as pSCTyGALmBax with accession number 3871 under restricted use.

[0241] GeneFilters

[0242] The Yeast GeneFilters.TM. were purchased from Research Genetics Inc. (Huntsville, Ala., USA).

[0243] The Yeast GeneFilters.TM. are hybridization ready nylon membranes containing a total of 6144 gene ORFs (Open Reading Frames) individually amplified by PCR and spotted on 2 nylon membrane filters (Filter I and II). The filters are cut in the upper right corner and the DNA is on the labeled side of the filter.

[0244] Filter I contains 3072 ORFs organized into two fields (fields 1 and 2). Each field contains 1536 ORFs divided into 8 grids (A, B, C, D, E, F, G and H). The grids are organized in 24 rows and 8 columns.

[0245] Filter II contains 3072 ORFs organized in two fields (field 3 and 4). Fields 3 and 4 are organized in the same way as fields 1 and 2.

[0246] The Yeast ORF Target

[0247] The yeast filters consist of over 6144 PCR products corresponding to 6144 yeast ORFs derived from the SGD. The PCR reactions used ORF specific primer pairs designed to amplify the entire open reading frame. The primers were generated from unique sequences containing the start codon ATG and termination codon (kindly provided by M. Cherry at Stanford Genome Center). Thus the PCR product contains the complete open reading frame including the start and stop codons. These products were purified and resuspended at 50 nanograms per microliter in a colored solution to allow the printing to be monitored. A robotic device was used to spot approximately 1/10 of a microliter of the denatured PCR product solution on a positively charged nylon membrane. The DNA was then UV cross-linked to the membrane.

[0248] Results

[0249] Induction of Bax-Expression in Yeast Cells

[0250] A preculture of yeast strain INVSc1 containing YIpUTyLMuBax, wherein 5 Bax cassettes under the control of the GAL1 promotor are integrated in the genome near Ty .delta. elements, was grown overnight in minimal glucose-containing medium in parallel with the yeast strain INVSc1 containing YIpUTyL as a control. The precultures were diluted in 100-ml minimal glucose-containing medium and grown until an OD.sub.600 of 1 was reached. Subsequently, the yeast cells were transferred into 100-ml galactose-containing medium and incubated for an additional period of 30 min, 1 hour, 2 hours, 3 hours or 6 hours.

[0251] RNA Isolation

[0252] Total RNA was isolated using RNApure.TM. Reagent (Genhunter Corporation Nashville, Tenn., USA) according to the GenHunter protocol. 1.5 10.sup.9 cells were concentrated in a microcentrifuge tube and 1 ml RNApure.TM. Reagent was added together with 1 g of glass pearls. The yeast cells were broken by thorough mixing during five 2-minutes periods, and placed on ice in-between to avoid RNA degradation. Chloroform (150 .mu.l) was added to the lysate and centrifuged for 10 min at 4.degree. C. and at 15000 rpm. The supernatant was transferred to a new tube and the RNA was precipitated with an equal volume of isopropanol. After 10 min incubation on ice, the RNA was pelleted by centrifugation and the pellet was washed with 70% ice-cold ethanol. The dried RNA pellet was resuspended in 50 pi RNAse free dH.sub.2O.

[0253] First Strand cDNA Synthesis in the Presence of .alpha.-.sup.33P dCTP

[0254] Probes with high specific activity were prepared by first strand cDNA synthesis using total RNA isolated from INVSc1 YIpUTyLMuBax or INVSc1 YIpUTyL yeast cells and incorporation of .alpha.-.sup.33P dCTP as follows: 2 .mu.l (1 .mu.g/ml) of Oligo dT was added to 20 .mu.g of total RNA in a maximal volume of 8 .mu.l RNase-free dH.sub.2O and incubated at 70.degree. C. for 10 min. After cooling down on ice for 1 min, the following components were added:

[0255] 6 .mu.l 5.times. concentrated First Strand Buffer (GIBCO-BRL, Paisley, UK)

[0256] 1 .mu.l 0.1 M DTT

[0257] 1 .mu.l RNase Block (40 units/.mu.l) (Stratagene)

[0258] 1.5 .mu.l 20 mM dXTP-solution (X=A, G and T) (Amersham Pharmacia biotech Uppsala, Sweden)

[0259] 1.5 .mu.l SuperScript.TM. Reverse Transcriptase (200 units/.mu.l) (GIBCO-BRL)

[0260] 10 .mu.l .alpha.-.sup.33 P dCTP (10 mCi/ml, 3000 Ci/mmol) (Amersham Pharmacia biotech Uppsala, Sweden),

[0261] and incubated for 2 h at 37.degree. C. during which first strand cDNA synthesis took place.

[0262] Unincorporated label was separated from the probe on a Sephadex G-50 column (Amersham Pharmacia biotech Uppsala, Sweden). The radioactivity incorporated in the probe was measured by liquid scintillation. The specific activity of the probes was 5.10.sup.8 cpm/.mu.g for both the INVSc1YIpUTyL and the INVSc1 YIpUTyLMuBax probes.

[0263] Additionally, the length of first strand cDNA probes was controlled on an alkaline 2% agarose gel using standard electrophoresis techniques, and resulted in the detection, via stimulated phosphorescence autoradiography, of the bulk of the fragments around 500 bp.

[0264] Hybridisation with the S. cerevisiae Yeast GeneFilters.TM. and Signal Detection

[0265] The Yeast GeneFilters.TM. were successively hybridised with the .alpha.-.sup.33P dCTP labelled cDNA probes using the MicroHyb.TM. solution provided by the manufacturer (Research Genetics Inc., Huntsville, Ala., USA). This solution was applied as well in the prehybridisation step as during hybridisation. The MicroHyb.TM. solution contains formamide to allow hybridisation to occur at lower temperatures.

[0266] The hybridisation experiment was performed essentially as follows: during prehybridisation, the Yeast GeneFilters.TM. were placed in a hybridisation flask (35.times.250 mm) filled with 5 ml MicroHyb.TM. solution (42.degree. C.) containing 5 .mu.l polydA (1 .mu.g/ml) and incubated for 24 hours at 42.degree. C. whilst rotating (10 rpm). After disposal of the prehybridisation solution, the denatured (3 min at 100.degree. C.) cDNA was added in 5 ml prewarmed MicroHyb solution and again incubated overnight at 42.degree. C. whilst rotating. Following two wash steps of 20 min in wash buffer (2.times.SSC, 1% SDS) at 50.degree. C., a third wash step was performed in a second wash buffer (0.5.times.SSC, 1% SDS) for an additional 15 min at room temperature. The Yeast GeneFilters.TM. were placed in a Phosphorlmager.TM. cassette (Molecular Dynamics, Sunnyvale, Calif., USA) with storage phosphor screen. After 4 days of development the screen was scanned at a resolution of 50 .mu.m using the (BioRad, Richmond, Calif., USA) Personal FX. The results of these can be seen in FIG. 3.

Example 2

Quantification of Hybridisation Signals

[0267] Quantification of the hybridisation signals was done using the Pathways.TM. software (Research Genetics, Huntsville, Ala., USA) and these signals were normalised against all data points. Comparison of these normalised data revealed differentially expressed candidate genes. Visual inspection of the hybridisation spots confirmed their selection. The genes as well as the factors with which they are up- or down-regulated are listed in the Tables 2 to 6 for each individual time point. An overview of the up and down regulated genes modulated in function of induction of Bax expression for several time points is shown in Table 7. The sequences of these genes and amino acid sequences that they encode are shown in FIG. 1.

Example 3

Comparative Gene Expression Analysis Upon Bax-Induced Cell Death and H.sub.2O.sub.2-Induced Cell Death

[0268] The Oxidative H.sub.2O.sub.2-Challenge

[0269] A preculture of yeast strain INVSc1 containing YIpUTyL was grown overnight in minimal glucose-containing medium. The preculture was diluted in 100-ml minimal glucose-containing medium and grown until an OD.sub.600 of 1 was reached. Subsequently, the yeast cells were transferred into 100-ml galactose-containing medium supplemented with 0.1 mM H.sub.2O.sub.2, and incubated for an additional period of 1 hour. This oxidative challenge resulted in the same final toxicity as a 1-hour induction of Bax expression in the same growth conditions.

[0270] First Strand cDNA Synthesis in the Presence of .alpha.-.sup.33P dCTP

[0271] RNA was isolated as mentioned in Example 1. Probes with high specific activity were prepared (detailed in Example 1) by first strand cDNA synthesis using total RNA isolated from INVSc1 YIpUTyLMuBax or INVSc1 YIpUTyL (growth conditions as described in Example 1) or oxidatively stressed INVSc1 YIpUTyL yeast cells.

[0272] The specific activity of all probes was 5.10.sup.8 cpm/.mu.g.

[0273] Quantification of Hybridisation Signals

[0274] Hybridisation and signal detection as described in Example 1. Conversion of the digital images to a 16 bit TIFF format using the Quantity One program (BioRad, Hercules, Calif., USA) preserved image data and was necessary for file import into the Pathways.RTM. software (Research Genetics, Huntsville, Ala., USA). Pathways.RTM. was used for the quantification of hybridisation signals and these signals were normalised against all data points.

[0275] Identification of Bax-Responsive Genes

[0276] Pairwise comparisons of the normalised data obtained from INVSc1 YIpUTyLMuBax (B) and INVSc1 YIpUTyL (C) revealed differentially expressed genes. To determine the -fold induction or repression, the normalised signal intensity after Bax induction (B) was divided by that before the shock (C). Visual inspection of the hybridisation spots confirmed their selection (replacement).

[0277] Identification of Bax-Specific Genes within the Bax-Responsive Pool

[0278] Pairwise comparisons of the normalised data obtained from INVSc1 YIpUTyLMuBax (B) and INVSc1 YIpUTyL (C) at the 1-hour time point revealed differentially expressed genes. Linear ratios (B vs C) were estimated significant when changes were at least two-fold and the normalised signal intensity of one spot was at least tenfold above the average background value. The normalised data of the Bax-responsive genes were compared with data obtained from the H.sub.2O.sub.2-stressed INVSc1 YIpUTyL (H). A Bax-responsive (up-regulated/down-regulated) gene was considered to be Bax-specific when the normalised signal intensity after Bax induction was at least twice as high/low as the corresponding intensity after oxidative stress. Visual inspection of the hybridisation spots confirmed their selection. An overview of the Bax-specific genes for the 1-hour time point is shown in Table 9. The sequences of these genes and amino acid sequences that they encode are shown in FIG. 2.

Example 4

Search for Homologues in Candida albicans and Human

[0279] Sequence similarity searches against public and commercial sequence databases were performed with the BLAST software package (Altschul et al., 1990) version 2. Both the original nucleotide sequence and the six-frame conceptual translations were used as query sequences. The used public databases were the EMBL nucleotide sequence database (Stoesser et al., 1998), the SWISS-PROT protein sequence database and its supplement TrEMBL (Bairoch and Apweiler, 1998), and the ALCES Candida albicans sequence database (Stanford University, University of Minesota). The commercial sequence database used was the PathoSeq.TM. microbial genomic database (Incyte Pharmaceuticals Inc., Palo Alto, Calif., USA).

[0280] Sequence similarity searches were performed using the BLAST software package version 2. The identity between 2 sequences was calculated as percentage identical residues, the similarity percentage between two sequences was calculated using BLOSUM62 as a scoring matrix.

[0281] The sequences of homologues Candida spp. and human genes and the corresponding amino acid sequences are shown in FIG. 2.

Example 5

Screening for Compounds Modulating Expression of Polypeptides Involved in Induction of Cell Death of C. albicans

[0282] The method proposed is based on observations (Sandbaken et at, 1990; Hinnebusch and Liebman 1991; Ribogene PCT WO 95/11969, 1995) suggesting that underexpression or overexpression of any component of a process (e.g. translation) could lead to altered sensitivity to an inhibitor of a relevant step in that process. Such an inhibitor should be more potent against a cell limited by a deficiency in the macromolecule catalyzing that step and/or less potent macromolecule, as compared to the wild type (WT) cell.

[0283] Mutant yeast strains, for example, have shown that some steps of translation are sensitive to the stoichiometry of macromolecules involved. (Sandbaken et al, 1990). Such strains are more sensitive to compounds which specifically perturb translation (by acting on a component that participates in translation) but are equally sensitive to compounds with other mechanisms of action.

[0284] This method thus not only provides a means to identify whether a test compound perturbs a certain process but also an indication of the site at which it exerts its effect. The component which is present in altered form or amount in a cell whose growth is affected by a test compound is potentially the site of action of the test compound.

[0285] The assay to be set up involves measurement of growth and/or death rate of an isogenic strain which has been modified only in a certain specific allele, relative to a wild type (WT) Candida albicans strain, in the presence of R-compounds. Strains can be ones in which the expression of a specific protein is impaired upon induction of anti-sense or strains which carry disruptions in an essential gene. An in silico approach to find novel genes in Candida albicans will be performed. A number of essential genes identified in this way will be disrupted (in one allele) and the resulting strains can be used for comparative growth and/or death rate screening.

Example 6

Assay for High Throughput Screening for Drugs

[0286] 35 .mu.l minimal medium (S medium+2% galactose+2% maltose) is transferred in a transparent flat-bottomed 96 well plate (MW96) using an automated pipetting system (Multidrop, Labsystems, Helsinki, Finland). A 96-channel pipettor transfers 2.5 .mu.i of R-compound at 10.sup.-3 M in DMSO from a stock plate into the assay plate.

[0287] The selected Candida albicans strains (mutant and parent (CAI-4) strain) are stored as glycerol stocks (15%) at -70.degree. C. The strains are streaked out on selective plates (SD medium) and incubated for two days at 30.degree. C. For the parent strain, CAI-4, the medium is always supplemented with 20 .mu.g/ml uridine. A single colony is scooped up and resuspended in 1 ml minimal medium (S medium+2% galactose+2% maltose). Cells are incubated at 30.degree. C. for 8 hours while shaking at 250 rpm. A 10 ml culture is inoculated at 250.000 cells/ml. Cultures are incubated at 30.degree. C. for 24 hours while shaking at 250 rpm. Cells are counted in Coulter counter and the final culture (S medium+2% galactose+2% maltose) is inoculated at 20.000 to 50.000 cells/ml. Cultures are grown at 30.degree. C. while shaking at 250 rpm until a final OD.sub.600 of 0.24 (+/-0.04) is reached.

[0288] 200 .mu.l of this yeast suspension is added to all wells of MW96 plates containing R-compounds in a 450 p, total volume. MW96 plates are incubated (static) at 30.degree. C. for 48 hours.

[0289] Optical densities are measured after 48 hours.

[0290] Test growth is expressed as a percentage of positive control growth for both mutant (x) and wild type (y) strains. The ratio (x/y) of these derived variables is calculated.

Example 7

Yeast Cell Viability Assay Upon Induction of Bax Expression

[0291] Materials and Media

[0292] Yeast stains were grown under normal conditions on standard media (Sherman et al., 1979). The Saccharomyces cerevisiae BY4742 wild type strain and BY4742 with the YGR183C gene disruption (EUROSCARF collection) were transformed by means of the lithium acetate method (Schiestl and Gietz, 1989) with the low-copy centromeric pRS415Bax plasmid or pRS415 as a control, or with the high-copy episomal pRS425Bax plasmid or pRS425 as a control.

[0293] Plasmid Constructions

[0294] The Bax expression cassette, a BsgI(blunted)-SapI(blunted) fragment excised from YIpUTyLMuBax containing the GALL promoter, the bax cDNA and the FLP terminator, was ligated into the Ectl3611-opened pRS415 (ATCC 87520) and pRS425 (ATCC 77106) plasmids, obtaining the low-copy centromeric pRS415Bax and the high-copy episomal pRS425Bax expression plasmids.

[0295] Results

[0296] Single colonies of yeast cells transformed with pRS415 or pRS415Bax or pRS425 or pRS425Bax were grown in 10 ml minimal glucose-containing medium with vigorous aeration at 30.degree. C. to an optical density of 1 OD.sub.600. Cells were pelleted by centrifugation and washed two times with sterile dH.sub.2O before resuspending in 10 ml minimal galactose-containing medium. After culturing for various times at 30.degree. C., the total cell density of the cultures was determined, and 1000 cells were spread on minimal glucose-based semisolid medium, followed by incubation at 30.degree. C. for 3 days. The number of colonies on plates from the 0 hr cultures was designated as 100% (FIG. 4).

Example 8

Bax Expression in Candida Cells

[0297] Strains

[0298] The Candida albicans strain CAI4 (ura3.congruent.) was used to perform the experiments (Fonzi and Irwin 1993).

[0299] E. coli transformations were done using the Top10 strain from Invitrogen (San Diego, Calif., USA) (F' mcrA .congruent.(mrr-hsdRMS-mcrBC- ) .congruent.80lacZ.quadrature.M15 .congruent.lacX74 deoR recA1 araD139 .congruent.(ara/leu)7697 galU galK rpsL (Str.sup.R) endA1 nupG).

[0300] Media

[0301] Synthetic dextrose media (SD), containing 2% glucose, 1.34% Yeast Nitrogen Base without amino acids and 0.77 g/l CSM-ura (Bio 101, Vista, Calif., USA) was used to grow the Candida albicans transformants. In case of the wild type (CAI4), the media was supplemented with 50 .mu.g/ml uridine. To prepare plates the media was solidified with 2% agar. Expression of the synthetic BAX gene was performed using 2% galactose as carbon source.

[0302] Construction of the Codon-Optimised BAX Gene

[0303] Construction of the synthetic BAX gene followed the nomenclature described for Candida albicans (Lloyd and Sharp 1992; Brown, et al. 1991; http://alces.med.umn.edu/candida/codons.html; http://www.kazusa.or.jp/cod- on). To ensure a high expression of the synthetic gene, the subset of `optimal` codons of highly expressed genes was used to design the synthetic BAX gene.

[0304] The synthCaBAX gene was constructed in three parts using eight oligonucleotides (FIG. 5). The sequences of the oligonucleotides are given in Table 7. Primer A1 introduced upstream of the ATG codon a Pst I site and a Bgl II site. The Pst I site was used later on for direct cloning into the Candida albicans expression vector, while the Bgl II site served as a linker for a yEGFP fusion. Primer C2 introduced a Sma I site, suitable for cloning into the expression vector.

[0305] Fragment A and B were synthesised in two steps: in a first PCR round primer X1 and X2 (X represents A or B, respectively) were used together. The resulting fragment served as a template in a second PCR round together with primers X1 and X3. Fragment C was synthesised in a single PCR round using the primers C1 and C2. Fragment A and B were cloned into the pCR-BluntII-TOPO vector (Stratagene), while fragment C was cloned into the pCR2.1-TOPO vector (Stratagene). All three fragments were sequenced to ensure that no mutation was introduced by the PCR.

[0306] Subsequently, fragment A was digested with Pst I and Taq I, fragment B wit Taq I and Bam HI and fragment C with Bam HI and Sma I. The three products were cloned in a quadruple ligation into pUC21 digested with Pst I and Sma I resulting in the plasmid pUC21:synthCandidaBAX. The sequence of the synthetic BAX gene is shown in FIG. 6.

[0307] Construction of Synthetic BAX- and GFP-Synthetic BAX Expression Plasmids

[0308] A Pst I-Sma I fragment containing the ORF of the synthetic BAX gene was cloned into the Pst I-Stu I digested vector pGAL1ACT1LUC (W. Martinet, EP application nr 99204557.5) resulting in the expression construct pGAL1P:synthCaBAX (FIG. 7A). To facilitate recognition of the AUG codon during formation of initiation complexes a purine base (A) was introduced at position -3 from the AUG codon (Kozak 1981) using the Quick change site directed mutagenesis kit from Stratagene.

[0309] The yeast enhanced GFP gene yEGFP; (Cormack et al. 1997) was amplified by PCR using primer 5'-AACTGCAGATGTCTAAAGGTGAAGMTTATTC-3' (SEQ ID NO 11) as upstream primer and primer 5'-GGAAGATCTTCCTTTGTACAATTCATCC ATACC-3' (SEQ ID NO 12) as downstream primer. The sense primer introduced a Pst I site (shown in bold and italic), while the anti-sense primer contained a Bgl II linker (shown in bold and italic) for fusion with the synthetic BAX gene. After cloning of the yEGFP gene into the pCR2.1-TOPO vector (Stratagene), the gene was sequenced to ensure that no mutation was introduced by PCR.

[0310] The yEGFP-synth Candida BAX fusion was created by cloning a PstI-BglII yEGFP fragment together with a Bgl II-Sma I synthetic Candida BAX fragment into the Pst I-Stu I digested expression vector pGAL1 ACT1LUC. The obtained pGAL1 P:yEGFP-synthCaBAX fusion construct (FIG. 7B) was sequenced to ensure that no frameshift had occurred.

[0311] Creation of the Synthetic BAX Expression Strains

[0312] Transformation of the expression plasmids was performed using a modified procedure (Logghe, unpublished) of the spheroblasting protocol (Herreros et al. 1992). The plasmids were linearised with Bpu1102 I to allow directed integration into the genome at the GALL promoter site. Correct integration was analysed by Southern blotting. Therefore genomic DNA from different transformants was prepared using the Nucleon.RTM. extraction and purification kit (Amersham Pharmacia Biotech) and digested with Xba I. The BAX probe used in the Southern blot was prepared by PCR. The PCR was performed using the pGAL1 P:synthCaBAX plasmid as template, together with the sense primer 5'-ATGGATGGTTCTGGTGMC-3' (SEQ ID NO 13) and the anti-sense primer 5'-TTAACCCATTTTTTTCCAGATG-3' (SEQ ID NO 14). Standard PCR conditions were used. For detection of the yEGFP a probe was synthesised by PCR using primer 5'-AGAGATCTCGAGGGATCC-3' (SEQ ID NO 15) as sense primer and primer 5'-GCATTATTTGTACMTTCATCC-3' (SEQ ID NO 16) as anti-sense primer. Southern blot hybridisation and detection were performed using the AlkPhos DIRECT labelling and detection system (Amersham Pharmacia Biotech) following the instructions of the manufacturer.

[0313] Western Blot Analysis

[0314] For Western blot analysis cells were pre-grown over night in SD-ura media till late log phase. The cells were harvested by centrifugation, washed twice with water and inoculated in SG-ura to induce Bax expression. Induction was performed for 15 hours. Yeast crude extracts were prepared as described before (Sambook, Fritsch et al. 1989). Detection of the Bax protein was performed using a polyclonal rabbit anti-mouse/rat Bax antibody (Pharmingen). Due to contamination of this antibody with yeast cell wall mannan antibodies, a very high background occurred. This problem could be avoided by pre-incubation of the antibody with 0.5 mg/ml purified yeast mannan (Rossanese et al. 1999). Detection of the Gfp protein was done using an anti-Gfp monoclonal antibody (Molecular Probes, Eugene, Oreg., USA).

[0315] Growth Curves

[0316] For growth curves, yeast cells were grown for 24 h in SD-ura medium (supplemented with uridine for the wild type). These cultures were harvested, washed twice with water and inoculated to an OD.sub.600 of 0.1 into fresh SD-ura or SG-ura media. Growth was monitored in microtitre plates using the Bioscreen C system (Labsystems).

[0317] Viability Tests

[0318] Cells were pregrown in minimal dextrose medium to an OD.sub.600 of 1. After washing the cells twice with water they were switched to minimal medium containing galactose as carbon source. At the time points indicated, samples were taken and equal cell amounts were spread on minimal dextrose plates. The appearing colonies represent the viable fraction of the pool.

[0319] Results: Conditional Expression of the Synthetic BAX Gene in Candida albicans

[0320] A cDNA encoding the full-length mouse Bax protein was placed under control of the Candida albicans GALL promoter allowing for conditional expression when cells are grown in galactose containing media. Initial experiments were performed using the wild type mouse bax gene. Expression of this gene did not result in any detectable phenotype, no difference in growth compared to the wild type was observed when cells were grown on galactose containing media (data not shown). This could be due to the non-traditional codon strategy adopted by Candida albicans and related species. Analysis of the codons used in the mouse BAX gene revealed a for Candida albicans not optimal codon usage as found for highly expressed genes in this yeast. To ensure a high expression of the BAX gene a codon-adapted, synthetic version of the gene was created using the strategy described above. The synthetic BAX gene was fused to the yEGFP to allow screening for transformants with a high yEGFP-synthCaBAX expression level using FACS technology. The newly obtained plasmids pGAL1 P:synthCaBAX and pGAL1:GFP-synthCaBAX were transformed into the C. albicans CAI4 strain. Transformants were selected on uridine-fee minimal medium. About 25 transformants of each expression construct were chosen and streaked onto minimal dextrose medium (non-inducing conditions) as well as on minimal galactose medium (inducing conditions). After two days incubation at 30.degree. C. all transformants did grow on the glucose containing media. When galactose was used as a sole carbon source, most of the transformants did not grow (FIG. 8). Southern blot analysis of the galactose negative transformants revealed that a copy of the synthCaBAX gene had been integrated into the endogenous copy of the GALL promoter. To study differences in growth, the transformants were grown over night in synthetic glucose containing medium. Subsequently, cells were washed with water and switched to fresh medium containing galactose as carbon source. While the wild type strain did grow well on galactose containing media no growth was observed for the Bax expressing transformants (FIGS. 9A and B). Western blot analysis of the synthCaBAX transformants showed accumulation of the Bax protein (15 hours Bax induction, FIG. 10). A similar result was observed when immunoblotting was performed with the GFP-synthCaBAX expressing strains. Here the fusion protein was detected at the expected molecular weight of about 45K under inducing conditions (galactose as carbon source). In addition to the fusion protein a band appeared at the molecular weight of about 20K. This corresponds to the molecular weight of the Gfp protein alone. Addition of a Gfp-expressing strain as a positive control to the western blot did confirm these results. Here the Gfp protein was detected at the same molecular weight as the unexpected band in the GFP-synthCaBAX expressing strain (FIG. 11). This is most probably due to a partly proteolytic degradation of the fusion protein. Analysis of the Gfp-fluorescence using FACS technology showed a high Gfp-fluorescence signal for the transformants expressing the fusion protein (FIG. 12). When cell viability was analysed, different results were obtained for the synthCaBAX strain and the GFP-synthCaBAX strain. The synthCaBAX strain showed quite a rapid decrease in the amount of colony forming units during the first 6 hours of incubation on galactose containing media. Afterwards the process slowed down significantly. This is in contrast to the results obtained for the strain expressing the gfp-synthCabax fusion protein. Here almost all the cells died at a very rapid rate during the first 3 hours of incubation in media containing galactose as sole carbon source. It is possible that the Bax trigger in the synthCabax expressing cells is not strong enough to kill all cells. The cell has enough time to activate a sort of defence mechanism, possibly by proteolytic degradation of the Bax protein. The situation is different for the fusion protein. Gfp is a very stable protein itself. Fusion of the Gfp to another protein could result in a stabilisation of this protein. It would be more resistant to proteolytic degradation. This would explain the situation for the Gfp-Bax fusion. The Gfp-Bax protein is more protected from proteolytic degradation. Like that it is for a longer period present in the cell. The death trigger is herewith stronger, so the cells die faster. The time that the cells have to activate the proteolytic machinery is not sufficient for them to survive.

2TABLE 1 Oligo Sequence 5' -> 3' A1 AACTGCAGGAAGATCTTCCATGGATGGTTCTGGTGAACAATTGGGTTCTGGTGG (SED ID NO 3) TCCAACCTCTTCTGAACAAATCATGAAAACCGGTGCTTTCTTGTTG A2 TAGAAGCATCTTGTGGTGGTTGTTCCAAGGTCAATTCTGGGGTTTCACCAGCC (SEQ ID NO 4) ATTCTACCAGCTCTATCTTGGATGAAACCTTGCAACAAGAAAGCACC A3 GGAATTCTCGACATCAGCGATCATTCTTTGCAATTCCATGTTAGAATCCAATTC (SEQ ID NO 5) ATCACCGATTCTTCTCAAACATTCAGACAATTTTTTGGTAGAAGCATCTTGTG B1 GGAATTCGCTGATGTCGATACCGATTCTCCAAGAGAAGTCTTCTTCAGAGTCG (SED ID NO 6) CTGCTGATATGTTCGCTGATGGTAACTTCAACTG B2 AATTCTGGGACTTTGGTACACAAAGCTTTCAAGACCAATTTAGAAGCGAAGTA (SEQ ID NO 7) GAACAAAGCGACGACTCTACCCCAGTTGAAGTTACCA B3 CCACCTTGATCTTGGATCCAGACCAACAATCTTTCTCTCAAGAAATCCAAGGTC (SEQ ID NO 8) CAACCCATGATGGTTCTGATCAATTCTGGGACTTTG C1 ATTGTTGGTCTGGATCCAAGATCAAGGTGGTTGGGAAGGTTTGTTGTCTTACTT (SEQ ID NO 9) CGGTACCCCAACCTGGCAAACCGTCA C2 TCCCCCGGGGGATTAACCCATTTT- TTTCCAGATGGTCAAAGAAGCGGTCAAGAC (SEQ ID NO 10) ACCAGCGACGAAGATGGTGACGGTTTGCCAGGTTGGG

[0321]

3TABLE 2 Overview of the differentially expressed genes after 30 min Bax expression Comparison: INVSc1 YIpUTL versus INVSc1 YIpUTyLB Normalised intensities Up/ ORF Gene L YLB down Qt value Cellular role: Cell cycle control YBR133C HSL7 18932.54 37877.20 .Arrow-up bold. 2.00 Cellular role: Polymerase II transcription YDR253C MET32 17661.13 45567.17 .Arrow-up bold. 2.58 YBR112C SSN6 26698.87 65315.83 .Arrow-up bold. 2.45 YDR145W TAF61 38697.96 73117.62 .Arrow-up bold. 1.89 YBR289W SNF5 33111.77 72328.70 .Arrow-up bold. 2.18 YDR216W ADR1 30127.45 8815.87 .dwnarw. 3.42 YEL009C GCN4 16533.76 3030.44 .dwnarw. 5.46 YBR089C-A NHP6B 22698.63 6297.49 .dwnarw. 3.60 YMR043W MCM1 39141.64 84180.45 .Arrow-up bold. 2.15 YKR092C SRP40 5965.63 16105.82 .Arrow-up bold. 2.70 YMR273C ZDS1 14699.61 35508.04 .Arrow-up bold. 2.42 YPL089C RLM1 34922.91 67856.88 .Arrow-up bold. 1.94 YOR372C NDD1 20285.12 44445.20 .Arrow-up bold. 2.19 YPL037C EGD1 30633.33 5250.70 .dwnarw. 5.83 Cellular role: Cell polarity YBL085W BOI1 7693.29 18614.99 .Arrow-up bold. 2.42 Cellular role: Chromatine structure YBR009C HHF1 16668.00 4178.80 .dwnarw. 3.99 YNL030W HHF2 49878.04 12566.96 .dwnarw. 3.97 YDR224C HTB1 67355.40 23156.82 .dwnarw. 2.91 YBL002W HTB2 25269.02 5383.97 .dwnarw. 4.69 Cellular role: RNA processing YER112W USS1 12776.74 31470.70 .Arrow-up bold. 2.46 YPL190C NAB3 6381.36 17892.11 .Arrow-up bold. 2.80 YNL112W DBP2 9956.84 28036.48 .Arrow-up bold. 2.82 Cellular role: Energy generation YPL078C ATP4 26902.69 5980.38 .dwnarw. 4.50 YDL004W ATP16 36525.08 3004.34 .dwnarw. 12.16 YDR377W ATP17 14419.41 756.86 .dwnarw. 19.05 YDR529C QCR7 35346.95 5394.65 .dwnarw. 6.55 YGR008C STF2 13275.51 2276.27 .dwnarw. 5.83 YEL039C CYC7 13604.38 2689.66 .dwnarw. 5.06 YKL150W MCR1 105337.67 30743.75 .dwnarw. 3.43 YLR038C COX12 52687.73 5455.83 .dwnarw. 9.66 YLR327C 113.966.77 54.014.65 .dwnarw. 2.11 Cellular role: Carbohydrate metabolism YBR149W ARA1 15149.55 4095.17 .dwnarw. 3.70 YHR094C HXT1 12526.90 785.73 .dwnarw. 15.94 YDR345C HXT3 36643.13 1632.48 .dwnarw. 22.45 YDR343C HXT6 77064.71 32060.05 .dwnarw. 2.40 YDR342C HXT7 76349.13 27615.15 .dwnarw. 2.76 Cellular role: Signal transduction YER177W BMH1 22856.29 44771.71 .Arrow-up bold. 1.96 YDR099W BMH2 40127.38 74572.38 .Arrow-up bold. 1.86 YGR070W ROM1 12055.28 28169.57 .Arrow-up bold. 2.34 YGR023W MTL1 7354.78 19648.06 .Arrow-up bold. 2.67 Cellular role: Protein synthesis YGR034W RPL26B 71942.48 74625.22 .Arrow-up bold. 1.04 Cellular role: Protein folding YLR216C CPR6 9616.80 31126.02 .Arrow-up bold. 3.24 Cellular role: Protein modification/degradation YFR052W RPN12 5583.57 14855.67 .Arrow-up bold. 2.66 YDL147W RPN5 31932.20 52939.11 .Arrow-up bold. 1.66 YGR132C PHB1 15429.56 5591.19 .dwnarw. 2.76 YGR135W PRE9 39921.63 5517.17 .dwnarw. 7.24 YFR010W UBP6 1892.76 828.94 .dwnarw. 2.28 Cellular role: Cell stress YIR037W GPX3 7869.22 21789.00 .Arrow-up bold. 2.77 YDR513W TTR1 55986.32 33263.12 .dwnarw. 1.68 YCL035C GRX1 70248.30 10969.97 .dwnarw. 6.40 YFL014W HSP12 41689.29 18658.48 .dwnarw. 2.23 YHR053C CUP1A 72852.07 43488.52 .dwnarw. 1.68 YHR055C CUP1B 71934.03 56799.80 .dwnarw. 2.77 YMR173W DDR48 16670.70 5022.40 .dwnarw. 3.32 YMR251W- HOR7 26879.95 417.36 .dwnarw. 64.41 A YLR043C TRX1 58251.39 4435.79 .dwnarw. 13.13 YBL064C PRX1 21525.00 40969.00 .Arrow-up bold. 1.90 YOL151W GRE2 2624.55 24152.03 .Arrow-up bold. 9.20 Cellular role: Unknown YBL081W 73834.11 74612.35 .Arrow-up bold. 1.01 YDR366C 39998.46 57428.80 .Arrow-up bold. 1.44 YCR004C YCP4 6869.06 28115.73 .Arrow-up bold. 4.09 YCR013C 3988.55 15144.34 .Arrow-up bold. 3.80 YBR050C REG2 4687.91 14408.20 .Arrow-up bold. 3.07 YBL109W 18744.60 35440.24 .Arrow-up bold. 1.89 YDR154C 19565.23 69428.03 .Arrow-up bold. 3.55 YEL071W DLD3 22235.73 68790.83 .Arrow-up bold. 3.09 YHR095W 14426.76 34896.68 .Arrow-up bold. 2.42 YGR069W 43413.57 72420.39 .Arrow-up bold. 1.67 YDR544C 13567.00 27004.37 .Arrow-up bold. 1.99 YGR236C 24927.59 8032.35 .dwnarw. 3.10 YIL057C 24246.39 773.56 .dwnarw. 31.34 YGL080W 23425.00 3217.81 .dwnarw. 7.28 YGL072C 16437.52 2652.80 .dwnarw. 6.20 YHR056C RSC30 72072.88 57446.85 .dwnarw. 1.25 YKL054C VID31 17990.49 38258.80 .Arrow-up bold. 2.13 YLR311C 7992.40 24164.87 .Arrow-up bold. 3.02 YJR115W 64690.69 102066.34 .Arrow-up bold. 1.58 YJL188C BUD19 7580.28 22325.70 .Arrow-up bold. 2.95 YKR040C 50934.78 100733.41 .Arrow-up bold. 1.98 YLR053C 8117.66 20317.34 .Arrow-up bold. 2.50 YOR121C 59950.94 92470.43 .Arrow-up bold. 1.54 YNL143C 98911.28 110534.34 .Arrow-up bold. 1.12 YOR131C 7941.55 22353.72 .Arrow-up bold. 2.81 YNL338W 21800.45 38777.28 .Arrow-up bold. 1.78 YNL179C 13729.36 39516.53 .Arrow-up bold. 2.88 YOL150C 3408.74 60298.39 .Arrow-up bold. 17.69 YMR107W 65118.70 10042.46 .dwnarw. 6.48 YKL065C YET1 69556.19 12804.88 .dwnarw. 5.43 YJR096W 21780.37 10655.13 .dwnarw. 2.04 YJL161W 16468.73 2618.26 .dwnarw. 6.29 YML128C MSC1 80130.20 13795.84 .dwnarw. 5.81 YMR251W 26879.95 417.36 .dwnarw. 64.41 YMR173W- 110104.98 61951.23 .dwnarw. 1.78 A YPL201C 17913.32 5018.97 .dwnarw. 3.57 YOR285W 64074.73 29749.43 .dwnarw. 2.15 YOR286W 13458.08 733.06 .dwnarw. 18.36 Cellular role: Cell wall maintenance YKR076W ECM4 2674.15 13040.04 .Arrow-up bold. 4.88 YLR390W ECM19 5472.05 15145.85 .Arrow-up bold. 2.77 Cellular role: Membrane fusion YHR138C 19921.35 3707.57 .dwnarw. 5.37 Cellular role: Vesicular transport YHR161C YAP180A 13086.35 30160.90 .Arrow-up bold. 2.30 YPL085W SEC16 6668.57 15206.49 .Arrow-up bold. 2.28 YKL196C YKT6 18933.84 2890.07 .dwnarw. 6.55 YPR028W YIP2 25434.34 2049.47 .dwnarw. 12.41 Cellular role: DNA repair/recombination YDL059C RAD59 1948.61 13089.13 .Arrow-up bold. 6.72 Cellular role: DNA synthesis YEL032W MCM3 23422.85 44327.48 .Arrow-up bold. 1.89 Cellular role: Amino acid metabolism YIL074C SER33 3978.42 16702.66 .Arrow-up bold. 4.20 YGR155W CYS4 4184.59 19270.89 .Arrow-up bold. 4.61 Cellular role: Fatty acid metabolism YHR179W OYE2 2291.36 40274.02 .Arrow-up bold. 17.58 Cellular role: Protein translocation YNL131W TOM22 16287.21 1679.78 .dwnarw. 9.70 Cellular role: Small molecule transport YDR276C SNA1 21148.46 1580.68 .dwnarw. 13.38 YOR267C HRK1 62689.30 110516.24 .Arrow-up bold. 1.76 YHR039-C VMA10 60107.90 8490.93 .dwnarw. 7.08 YOR382W FIT2 6780.82 27236.15 .Arrow-up bold. 4.02

[0322]

4TABLE 3 Overview of the differentially expressed genes after 1 h Bax expression Comparison: INVSc1 YIpUTL versus INVSc1 YIpUTyLB Normalised intensities Up/ ORF Gene L YLB down Qt value Cellular role: Polymerase II transcription YDR145W TAF61 20729.58 57376.27 .Arrow-up bold. 2.77 YDR216W ADR1 5925.91 18459.00 .Arrow-up bold. 3.11 YBR112C CYC8 50186.77 64511.50 .Arrow-up bold. 1.29 YMR043W MCM1 21011.54 53700.49 .Arrow-up bold. 2.56 YPL089C RLM1 23440.54 64284.32 .Arrow-up bold. 2.74 YOR372C NDD1 26412.58 50804.99 .Arrow-up bold. 1.92 Cellular role: Cell cycle control YBR133C HSL7 18761.64 53238.86 .Arrow-up bold. 2.84 Cellular role: Cell polarity YBL085W BOI1 37895.40 57761.52 .Arrow-up bold. 1.52 Cellular role: Chromatine structure YDR224C HTB1 13661.40 55656.34 .Arrow-up bold. 4.07 Cellular role: Energy generation YGR183C QCR9 23181.54 81865.40 .Arrow-up bold. 3.53 YLR294C 5054.57 28994.72 .Arrow-up bold. 5.74 YKL150W MCR1 43663.07 60593.16 .Arrow-up bold. 1.39 YMR256C COX7 7606.58 28801.54 .Arrow-up bold. 3.79 YOL126C MDH2 34144.61 65326.97 .Arrow-up bold. 1.91 YLR327C 97415.94 101651.17 .Arrow-up bold. 1.04 Cellular role: Vesicular transport YHR161C YAP180A 11602.81 34695.20 .Arrow-up bold. 2.99 YLR206W ENT2 14439.24 34621.70 .Arrow-up bold. 2.40 Cellular role: Carbohydrate metabolism YDR342C HXT7 65273.56 22231.06 .dwnarw. 2.94 YDR343C HXT6 43572.28 6075.38 .dwnarw. 7.17 YDR345C HXT3 76352.52 40296.00 .dwnarw. 1.89 YGR192C TDH3 38472.30 14145.84 .dwnarw. 2.72 YKR097W PCK1 22919.81 38225.98 .Arrow-up bold. 1.67 YOR374W ALD4 33711.37 2607.43 .dwnarw. 12.93 Cellular role: Signal transduction YER177W BMH1 16298.14 31748.91 .Arrow-up bold. 1.95 YDR099W BMH2 50572.45 65123.58 .Arrow-up bold. 1.29 Cellular role: Cell wall maintenance YLR110C CCW12 102525.29 11230.41 .dwnarw. 9.13 Cellular role: Protein modification/degradation YOR261C RPN8 12575.49 32568.47 .Arrow-up bold. 2.59 Cellular role: Cell stress YHR053C CUP1A 32531.53 63579.94 .Arrow-up bold. 1.95 YHR055C CUP1B 27939.92 65142.82 .Arrow-up bold. 2.33 YMR173W DDR48 38338.83 60514.70 .Arrow-up bold. 1.58 YOR031W CRS5 2922.32 23848.60 .Arrow-up bold. 8.16 YLR109W AHP1 43067.08 6302.46 .dwnarw. 6.83 Cellular role: Unknown YBL081W 82476.13 44279.86 .Arrow-up bold. 1.86 YBL109W 22998.63 63428.23 .Arrow-up bold. 2.76 YDR366C 14599.17 46494.73 .Arrow-up bold. 3.18 YDR154C 21296.57 56534.93 .Arrow-up bold. 2.65 YGR236C SPG1 17717.80 64439.96 .Arrow-up bold. 3.64 YHR056C RSC30 27020.16 65110.42 .Arrow-up bold. 2.41 YGR182C 8171.02 34669.96 .Arrow-up bold. 4.24 YDR544C 14797.70 37704.91 .Arrow-up bold. 2.55 YHR162W 13836.79 33381.64 .Arrow-up bold. 2.41 YGR243W 30829.66 59765.39 .Arrow-up bold. 1.94 YBR050C REG2 14008.24 29603.16 .Arrow-up bold. 2.11 YEL071W DLD3 19487.41 35273.39 .Arrow-up bold. 1.81 YDR133C 83074.54 62986.96 .dwnarw. 1.32 YDR134C 83111.03 16839.53 .dwnarw. 4.94 YHL021C 46028.06 8577.00 .dwnarw. 5.37 YKL054C VID31 28018.46 66537.91 .Arrow-up bold. 2.37 YLR311C 7803.52 31160.73 .Arrow-up bold. 3.99 YMR107W 13453.15 78850.98 .Arrow-up bold. 5.86 YKL066W 8751.84 24129.32 .Arrow-up bold. 2.76 YMR173W-A 38338.83 60514.70 .Arrow-up bold. 1.58 YML053C 23670.86 66254.48 .Arrow-up bold. 2.80 YOR121C 17039.58 58016.58 .Arrow-up bold. 3.40 YOL106W 19917.67 69853.66 .Arrow-up bold. 3.51 YNL338W 17864.90 49911.08 .Arrow-up bold. 2.79 YJR115W 84858.02 98161.71 .Arrow-up bold. 1.16 Cellular role: Small molecule transport YOR267C HRK1 90123.84 96824.51 .Arrow-up bold. 1.07

[0323]

5TABLE 4 Overview of the differentially expressed genes after 2 h Bax expression Comparison: INVSc1 YIpUTL versus INVSc1 YIpUTyLB Normalised intensities Up/ Qt ORF Gene L YLB Down value Cellular role: Protein modification/degradation YCL052C PBN1 5261.22 8175.70 .Arrow-up bold. 1.55 YDL147W RPN5 22386.40 47857.67 .Arrow-up bold. 2.14 YOR261C RPN8 27349.25 42198.05 .Arrow-up bold. 1.54 YGR132C PHB1 5252.03 8459.53 .Arrow-up bold. 1.61 YBR139W 9458.26 3611.21 .dwnarw. 2.62 Cellular role: Unknown YDR202C RAV2 7483.71 10089.19 .Arrow-up bold. 1.35 YBR062C 4893.97 9894.82 .Arrow-up bold. 2.02 YDR366C 25468.2 59682.92 .Arrow-up bold. 2.34 YBL109W 24803.62 37444.64 .Arrow-up bold. 1.51 YDR154C 21166.26 33434.35 .Arrow-up bold. 1.58 YEL071W DLD3 34153.85 44083.39 .Arrow-up bold. 1.29 YGR236C SPG1 16978.52 31419.12 .Arrow-up bold. 1.85 YGR182C 30569.31 58805.05 .Arrow-up bold. 1.92 YDR544C 15937.14 24421.99 .Arrow-up bold. 1.53 YHR162W 26610.34 33794.73 .Arrow-up bold. 1.27 YHR056C RSC30 33372.66 68425.24 .Arrow-up bold. 2.05 YDR133C 75520.99 62984.59 .dwnarw. 1.20 YCR010C ADY2 17240.59 11835.82 .dwnarw. 1.46 YDR134C 72723.66 9776.23 .dwnarw. 7.44 YGR069W 65418.73 53767.35 .dwnarw. 1.22 YIL057C 16510.16 2198.04 .dwnarw. 7.51 YGL072C 12209.68 6509.91 .dwnarw. 1.88 YGL080W 22550.76 11525.24 .dwnarw. 1.96 YLR311C 11095.31 24660.47 .Arrow-up bold. 2.22 YJR115W 74757.79 103422.48 .Arrow-up bold. 1.38 YMR099C 7057.15 11477.42 .Arrow-up bold. 1.63 YMR173W-A 31901.05 48886.91 .Arrow-up bold. 1.47 YML132W COS3 24648.97 34895.33 .Arrow-up bold. 1.42 YKL066W 13581.94 25433.97 .Arrow-up bold. 1.87 YJL142C 7205.86 11920.21 .Arrow-up bold. 1.65 YLR346C 6447.57 11569.63 .Arrow-up bold. 1.79 YLR053C 41161.10 78636.82 .Arrow-up bold. 1.91 YMR110C 19410.64 29661.23 .Arrow-up bold. 1.53 YKR075C 19104.57 29948.72 .Arrow-up bold. 1.57 YOR121C 36492.56 59452.09 .Arrow-up bold. 1.63 Cellular role: Unknown YOL106W 31382.10 76664.72 .Arrow-up bold. 2.44 YNL338W 24117.93 38981.22 .Arrow-up bold. 1.62 YNL134C 9617.33 14613.60 .Arrow-up bold. 1.52 YKL065C YET1 52422.65 33794.03 .dwnarw. 1.55 YMR009W 20666.22 9519.29 .dwnarw. 2.17 YJL144W 10316.92 3122.77 .dwnarw. 3.30 YML128C MSC1 584128.13 25434.11 .dwnarw. 2.29 YNL179C 21938.96 10883.98 .dwnarw. 2.02 YOL109W ZEO1 22711.98 6581.11 .dwnarw. 3.45 YNR002C FUN34 18241.25 9752.25 .dwnarw. 1.87 Cellular role: Chromatine structure YDR224C HTB1 25356.73 30827.54 .Arrow-up bold. 1.22 YBL002W HTB2 9241.68 14261.54 .Arrow-up bold. 1.54 YBL003C HTA2 3453.55 6553.49 .Arrow-up bold. 1.90 YNL031C HHT2 13376.02 2348.84 .dwnarw. 5.69 Cellular role: Polymerase II transcription YBR289W SNF5 59542.27 65885.13 .Arrow-up bold. 1.11 YDR073W SNF11 12190.01 23088.03 .Arrow-up bold. 1.89 YMR043W MCM1 66457.16 77022.05 .Arrow-up bold. 1.16 YPL089C RLM1 49844.99 60624.28 .Arrow-up bold. 1.22 Cellular role: Signal transduction YDR099W BMH2 55902.13 73874.51 .Arrow-up bold. 1.32 Cellular role: Cell stress YBL064C PRX1 11203.87 14815.42 .Arrow-up bold. 1.32 YBR101C 25016.27 35781.64 .Arrow-up bold. 1.43 YLR043C TRX1 10864.53 3912.03 .dwnarw. 2.78 YGR209C TRX2 30492.33 37829.20 .Arrow-up bold. 1.24 YER103W SSA4 8763.38 15799.18 .Arrow-up bold. 1.80 YHR055C CUP1B 18824.43 77613.05 .Arrow-up bold. 4.12 YHR053C CUP1A 32726.62 63536.72 .Arrow-up bold. 1.94 YDR256C CTA1 9614.29 4232.17 .dwnarw. 2.27 YCR021C HSP30 8090.05 3604.78 .dwnarw. 2.24 YCL035C GRX1 28437.57 12843.99 .dwnarw. 2.21 YGR086C 36796.12 24272.57 .dwnarw. 1.52 YFL014W HSP12 61868.64 23288.19 .dwnarw. 2.66 YOR031W CRS5 6015.69 14519.12 .Arrow-up bold. 2.41 YMR251W-A HOR7 17731.14 4231.39 .dwnarw. 4.19 YOR120W GCY1 114252.98 78052.05 .dwnarw. 1.46 Cellular role: Protein synthesis YAL003W EFB1 3044.80 5772.68 .Arrow-up bold. 1.90 YOL127W RPL25 6266.96 12055.41 .Arrow-up bold. 1.92 YHR010W RPL27 4057.16 10856.34 .Arrow-up bold. 2.68 YLR325C RPL38 5401.85 12955.89 .Arrow-up bold. 2.40 YJL189W RPL39 2044.64 8010.67 .Arrow-up bold. 3.92 YIL148W RPL40A 5052.35 11595.54 .Arrow-up bold. 2.30 YKR094C RPL40B 3994.57 10011.13 .Arrow-up bold. 2.54 YOL139C CDC33 4132.18 8956.14 .Arrow-up bold. 2.17 Cellular role: Protein folding YLR216C CPR6 20353.43 32713.37 .Arrow-up bold. 1.61 YKL117W SBA1 11144.25 1500.56 .dwnarw. 7.43 Cellular role: Vesicular transport YCR009C RVS161 5350.32 9780.92 .Arrow-up bold. 1.83 YHR161C YAP180A 25136.63 32461.67 .Arrow-up bold. 1.29 YBL078C AUT7 16528.91 9843.25 .dwnarw. 1.68 Cellular role: Carbohydrate metabolism YBL058W SHP1 4626.50 8179.94 .Arrow-up bold. 1.77 YBR149W ARA1 30706.41 9637.76 .dwnarw. 3.19 YDR178W SDH4 14880.91 6237.35 .dwnarw. 2.39 YHR094C HXT1 30389.99 18383.00 .dwnarw. 1.65 YMR011W HXT2 39524.90 21221.96 .dwnarw. 1.86 YDR345C HXT3 77025.40 56749.40 .dwnarw. 1.36 YDR343C HXT6 73149.70 8676.17 .dwnarw. 8.43 YDR342C HXT7 75331.76 27052.43 .dwnarw. 2.78 YKL060C FBA1 16273.54 21323.23 .Arrow-up bold. 1.31 Cellular role: Cell cycle control YBR133C HSL7 32903 41964.32 .Arrow-up bold. 1.28 Cellular role: Energy generation YMR256C COX7 18558.01 40422.91 .Arrow-up bold. 2.18 YML129C COX14 11418.54 21798.88 .Arrow-up bold. 1.91 YFR033C QCR6 9159.48 13398.67 .Arrow-up bold. 1.46 YDR529C QCR7 24821.75 16556.87 .dwnarw. 1.50 YJL166W QCR8 15554.30 24509.26 .Arrow-up bold. 1.58 YHR001W-A QCR10 12416.35 23465.31 .Arrow-up bold. 1.89 YBR039W ATP3 11709.79 3088.19 .dwnarw. 3.79 YPL078C ATP4 11325.64 13769.72 .Arrow-up bold. 1.22 YPL271W ATP15 3261.75 7839.05 .Arrow-up bold. 2.40 YLR327C 51742.90 128511.27 .Arrow-up bold. 2.48 YLR294C 15832.61 38544.44 .Arrow-up bold. 2.43 YAL060W FUN49 11792.72 5778.91 .dwnarw. 2.04 Cellular role: Small molecule transport YDR276C SNA1 19337.39 12392.29 .dwnarw. 1.56 YGR197C SNG1 4766.18 10484.09 .Arrow-up bold. 2.20 YHR039C-B VMA10 21190.93 10592.98 .dwnarw. 2.00 YOR267C HRK1 111849.17 101339.10 .dwnarw. 1.10 Cellular role: RNA processing YGR250C 8709.92 17358.43 .Arrow-up bold. 1.99 Cellular role: Cell wall maintenance YER150W SP11 55592.73 22403.59 .dwnarw. 2.48 YLR110C CCW12 35147.41 5786.88 .dwnarw. 6.07 Cellular role: Cell polarity YOR122C PFY1 14459.45 20176.41 .Arrow-up bold. 1.40 Cellular role: Amino acid metabolism YPR035W GLN1 20894.14 7522.05 .dwnarw. 2.78

[0324]

6TABLE 5 Overview of the differentially expressed genes after 3 h Bax expression Comparison: INVSc1 YIpUTL versus INVSc1 YIpUTyLB Normalised intensities Up/ ORF Gene L YLB down Qt value Cellular role: Cell cycle control YBR133C HSL7 63562.10 43191.28 .dwnarw. 1.47 Cellular role: Cell polarity YBL085W BOI1 32734.79 23497.41 .dwnarw. 1.39 Cellular role: Chromatine structure YDR545W YRF1-1 20111.51 11479.67 .dwnarw. 1.75 Cellular role: Energy generation YCR005C CIT2 11882.42 25632.94 .Arrow-up bold. 2.16 YGR183C QCR9 74474.20 11510.99 .dwnarw. 6.47 YOL126C MDH2 55984.88 17978.10 .dwnarw. 3.11 Cellular role: Carbohydrate metabolism YBR019C GAL10 3092.50 15697.54 .Arrow-up bold. 5.08 YDR345C HXT3 14086.41 25657.66 .Arrow-up bold. 1.82 YKR097W PCK1 50736.44 20858.02 .dwnarw. 2.43 Cellular role: Signal transduction YDR099W BMH2 63285.16 56028.91 .dwnarw. 1.13 Cellular role: Protein synthesis YHR010W RPL27A 23254.90 7217.14 .dwnarw. 3.22 YLR325C RPL38 26725.96 9121.29 .dwnarw. 2.93 Cellular role: Cell stress YFL014W HSP12 40848.44 69781.91 .Arrow-up bold. 1.71 YHR053C CUP1A 20399.10 65037.14 .Arrow-up bold. 3.19 YHR055C CUP1B 21763.09 64594.58 .Arrow-up bold. 2.97 YMR173W DDR48 75407.16 36354.37 .dwnarw. 2.07 YOL052C-A DDR2 20479.72 33702.23 .Arrow-up bold. 1.65 Cellular role: Unknown YIL057C 7602.78 24104.02 .Arrow-up bold. 3.17 YHR056C RSC30 41473.41 64809.08 .Arrow-up bold. 1.56 YDR544C 55075.67 29731.72 .dwnarw. 1.85 YKR040C 48049.71 59649.47 .Arrow-up bold. 1.24 YNL338W 86107.91 30045.62 .dwnarw. 2.87 YJR115W 74889.58 81238.98 .dwnarw. 1.08 YBL109W 64754.79 57185.99 .dwnarw. 1.13 YMR173W-A 75407.16 36354?37 .dwnarw. 2.07

[0325]

7TABLE 6 Overview of the differentially expressed genes after 6 h Bax expression Comparison: INVSc1 YIpUTL versus INVSc1 YIpUTyLB Normalised Intensities Up/ ORF Gene L YLB down Qt value Cellular role: Cell stress YDR171W HSP42 13484.04 27183.07 .Arrow-up bold. 2.02 YFL014W HSP12 41197.12 29081.08 .dwnarw. 1.42 YDR513W TTR1 19985.22 12935.62 .dwnarw. 1.54 YCL035C GRX1 31735.39 12930.71 .dwnarw. 2.45 YGR209C TRX2 54455.65 47569.21 .dwnarw. 1.14 YHR053C CUP1A 81488.84 15289.39 .dwnarw. 5.33 YHR055C CUP1B 81278.95 20031.69 .dwnarw. 4.06 YMR251W-A HOR7 18824.54 5914.28 .dwnarw. 3.18 Cellular role: Signal transduction YDR099W BMH2 29412.99 58598.42 .Arrow-up bold. 1.99 Cellular role: Protein synthesis YGL147C RPL9A 13655.66 1585.97 .dwnarw. 8.61 YGR085C RPL11B 27465.15 3791.35 .dwnarw. 7.24 YDR418W RPL12B 14417.77 1555.24 .dwnarw. 9.27 YLR029C RPL15A 37122.11 9321.81 .dwnarw. 3.98 YOR312C RPL20B 50334.94 5706.59 .dwnarw. 8.82 YBR191W RPL21A 21740.90 2571.30 .dwnarw. 8.46 YPL079W RPL21B 31059.43 5023.61 .dwnarw. 6.18 YOL127W RPL25 75971.72 11749.17 .dwnarw. 6.47 YHR010W RPL27A 45716.64 8096.40 .dwnarw. 5.65 YDR471W RPL27B 14636.79 2613.40 .dwnarw. 5.60 YDL075W RPL31A 11969.47 2611.53 .dwnarw. 4.58 YBL092W RPL32 7872.80 857.85 .dwnarw. 9.18 YDL191W RPL35A 28582.59 6046.25 .dwnarw. 4.73 YDL136W RPL35B 25433.49 5064.51 .dwnarw. 5.02 YLR325C RPL38 48051.23 8217.18 .dwnarw. 5.85 YIL148W RPL40A 47028.95 9543.65 .dwnarw. 4.93 YKR094C RPL40B 39900.50 5957.78 .dwnarw. 6.70 YHR141C RPL42B 10163.88 937.21 .dwnarw. 10.84 YML063W RPS1B 15916.48 1144.54 .dwnarw. 13.91 YGL123W RPS2 12505.56 2243.26 .dwnarw. 5.57 YOR096W RPS7A 24164.37 3223.60 .dwnarw. 7.50 YBL072C RPS8A 17198.50 3233.30 .dwnarw. 5.32 YER102W RPS8B 16234.83 1791.18 .dwnarw. 9.06 YBR189W RPS9B 10075.22 2150.89 .dwnarw. 4.68 YOR293W RPS10A 51787.23 12110.74 .dwnarw. 4.28 YDR064W RPS13 9736.57 1587.67 .dwnarw. 6.13 YDR450W RPS18A 37913.71 5674.60 .dwnarw. 6.68 YML026C RPS18B 14458.01 2027.28 .dwnarw. 7.13 YKL156W RPS27A 23725.18 11117.26 .dwnarw. 2.13 YLR167W RPS31 38648.54 2611.97 .dwnarw. 14.80 YJL138C TIF2 20154.61 7264.66 .dwnarw. 2.77 Cellular role: Energy metabolism YGR183C QCR9 57357.59 80447.53 .Arrow-up bold. 1.40 YDL004W ATP16 25047.95 10988.85 .dwnarw. 2.28 YKL150W MCR1 50931.46 37076.83 .dwnarw. 1.37 YLR038C COX12 39506.06 29534.70 .dwnarw. 1.34 Cellular role: Unknown YDR442W 14654.61 2242.42 .dwnarw. 6.54 YDR134C 17025.59 10561.72 .dwnarw. 1.61 YHR056C RSC30 81350.52 31447.10 .dwnarw. 2.59 YKR040C 48390.21 90125.88 .Arrow-up bold. 1.86 YLR414C 13463.40 8085.92 .dwnarw. 1.67 YLR312C 25589.67 16184.57 .dwnarw. 1.58 YJL188C BUD19 22074.09 4526.39 .dwnarw. 4.88 YOR285W 75099.98 61896.00 .dwnarw. 1.21 YOL109W ZEO1 66287.15 35502.43 .dwnarw. 1.87 Cellular role: Chromatine structure YBR009C HHF1 11173.15 5416.74 .dwnarw. 2.06 YNL030W HHF2 31366.74 20132.23 .dwnarw. 1.56 Cellular role: Nucleotide metabolism YDR399W HPT1 13339.03 5333.81 .dwnarw. 2.50 Cellular role: Polymerase II transcription YEL009C GCN4 34617.98 20798.63 .dwnarw. 1.66 YPL037C EGD1 17862.37 8229.01 .dwnarw. 2.17 Cellular role: Vesicular transport YBL078C AUT7 42661.70 32333.01 .dwnarw. 1.32 YOR327C SNC2 22716.56 13704.48 .dwnarw. 1.66 Cellular role: Small molecule transport YHR039C-B VMA10 44429.30 23826.51 .dwnarw. 1.86 Cellular role: Cell wall maintenance YKL097W-A CWP2 13529.93 1617.20 .dwnarw. 8.37 Cellular role: Carbohydrate metabolism YKL060C FBA1 33329.74 10367.82 .dwnarw. 3.21

[0326]

8TABLE 7 Sequence ID NO ORF GENE 30 min 1 h 2 h 3 h 6 h SEQ ID NO 17 YAL003W EFB1 1.90 SEQ ID NO 19 VAL060W FUN49 -2.00 SEQ ID NO 21 YBL002W HTB2 -4.69 1.54 SEQ ID NO 23 YBL058W SHP1 1.77 SEQ ID NO 25 YBL064C PRX1 1.90 1.32 SEQ ID NO 27 YBL072C RPS8A -5.32 SEQ ID NO 29 YBL081W 1.01 1.86 SEQ ID NO 31 YBL085W BOI1 2.42 1.52 -1.39 SEQ ID NO 33 YBL092W RPL32 2.76 -9.18 SEQ ID NO 35 YBL109W 1.89 2.76 1.51 -1.13 SEQ ID NO 37 YBR009C HHF1 -3.99 -2.06 SEQ ID NO 39 YBR019C GAL10 5.08 SEQ ID NO 41 YBR039W ATP3 -3.70 SEQ ID NO 43 YBR050C REG2 3.07 2.11 SEQ ID NO 45 YBR062C 2.02 SEQ ID NO 47 YBR089C-A NHP6B -3.60 SEQ ID NO 49 YBR101C 1.43 SEQ ID NO 51 YBR112C SSN6 2.45 1.29 SEQ ID NO 53 YBR133C HSL7 2.00 2.84 1.28 -1.47 SEQ ID NO 55 YBR139W -2.60 SEQ ID NO 57 YBR149W ARA1 -3.70 -3.11 SEQ ID NO 59 YBR189W RPS9B -4.68 SEQ ID NO 61 YBR191W RPL21A -8.46 SEQ ID NO 63 YBR289W SNF5 2.18 1.11 SEQ ID NO 65 YCL035C GRX1 -6.40 -2.20 -2.45 SEQ ID NO 67 YCL052C PBN1 1.55 SEQ ID NO 69 YCR004C YCP4 4.09 SEQ ID NO 71 YCR005C CIT2 2.16 SEQ ID NO 73 YCR009C RVS161 1.83 SEQ ID NO 75 YCR010C -1.40 SEQ ID NO 77 YCR013C 3.80 SEQ ID NO 79 YCR021C HSP30 -2.20 SEQ ID NO 81 YDL004W ATP16 -12.16 -2.28 SEQ ID NO 83 YDL059C RAD59 6.72 SEQ ID NO 85 YDL075W RPL31A -4.58 SEQ ID NO 87 YDL147W RPN5 1.66 2.14 SEQ ID NO 89 YDR064W RPS13 -6.13 SEQ ID NO 91 YDR073W SNF11 1.89 SEQ ID NO 93 YDR099W BMH2 1.86 1.29 1.32 -1.13 1.99 SEQ ID NO 95 YDR133C -1.32 -1.20 SEQ ID NO 97 YDR134C -4.94 -7.40 -1.61 SEQ ID NO 99 YDR145W TAF61 1.89 2.77 SEQ ID NO 101 YDR154C 3.55 2.65 1.58 SEQ ID NO 103 YDR171W HSP42 2.02 SEQ ID NO 105 YDR178W SDH4 -2.30 SEQ ID NO 107 YDR202C RAV2 1.35 SEQ ID NO 109 YDR216W ADR1 -3.42 3.11 SEQ ID NO 111 YDR224C HTB1 -2.91 4.07 1.22 SEQ ID NO 113 YDR253C MET32 2.58 SEQ ID NO 115 YDR256C CTA1 -2.20 SEQ ID NO 117 YDR276C SNA1 -13.38 -1.50 SEQ ID NO 119 YDR342C HXT7 -2.76 -2.94 -2.70 SEQ ID NO 121 YDR343C HXT6 -2.40 -7.17 -8.40 SEQ ID NO 123 YDR345C HXT3 -22.45 -1.89 -1.30 1.82 SEQ ID NO 125 YDR366C 1.44 3.18 2.34 SEQ ID NO 127 YDR377W ATP17 -19.05 SEQ ID NO 129 YDR399W HPT1 -2.50 SEQ ID NO 131 YDR418W RPL12B -9.27 SEQ ID NO 133 YDR513W TTR1 -1.68 -1.54 SEQ ID NO 135 YDR544C 1.99 2.55 1.53 -1.85 SEQ ID NO 137 YDR545W YRF1-1 -1.75 SEQ ID NO 139 YEL009C GCN4 -5.46 -1.66 SEQ ID NO 697 YEL032W MCM3 1.89 SEQ ID NO 141 YEL039C CYC7 -5.06 SEQ ID NO 143 YEL071W DLD3 3.09 1.81 1.29 SEQ ID NO 145 YER103W SSA4 1.80 SEQ ID NO 147 YER112W USS1 2.46 SEQ ID NO 149 YER150W SPI1 -2.40 SEQ ID NO 151 YER177W BMH1 1.96 1.95 SEQ ID NO 153 YFR010W UBP6 -2.28 SEQ ID NO 155 YFR033C QCR6 1.46 SEQ ID NO 157 YFR052W RPN12 2.66 SEQ ID NO 159 YGL072C -6.20 -1.80 SEQ ID NO 161 YGL080W -7.28 -1.90 SEQ ID NO 163 YGL123W RPS2 -5.57 SEQ ID NO 165 YGR008C STF2 -5.83 SEQ ID NO 167 YGR023W MTL1 2.67 SEQ ID NO 169 YGR034W RPL26B 1.04 SEQ ID NO 171 YGR069W 1.67 -1.20 SEQ ID NO 173 YGR070W ROM1 2.34 SEQ ID NO 175 YGR086C -1.50 SEQ ID NO 177 YGR132C PHB1 -2.76 1.61 SEQ ID NO 179 YGR135W PRE9 -7.24 SEQ ID NO 181 YGR155W CYS4 4.61 SEQ ID NO 183 YGR192C TDH3 -2.72 SEQ ID NO 185 YGR197C SNG1 2.20 SEQ ID NO 187 YGR209C TRX2 1.24 -1.14 SEQ ID NO 189 YGR243W 1.94 SEQ ID NO 191 YGR250C 1.99 SEQ ID NO 193 YHL021C -5.37 SEQ ID NO 195 YHR001W-A QCR10 1.89 SEQ ID NO 197 YHR039C-B VMA10 -7.08 -2.00 -1.86 SEQ ID NO 199 YHR053C CUP1A -1.68 1.95 1.94 3.19 -5.33 SEQ ID NO 201 YHR055C CUP1B -2.77 2.33 4.12 2.97 -4.06 SEQ ID NO 203 YHR056C -1.25 2.41 2.05 1.56 -2.59 SEQ ID NO 205 YHR094C HXT1 -15.94 -1.60 SEQ ID NO 207 YHR095W 2.42 SEQ ID NO 209 YHR138C -5.37 SEQ ID NO 211 YHR161C YAP180A 2.30 2.99 1.29 SEQ ID NO 213 YHR162W 2.41 1.27 SEQ ID NO 215 YHR179W OYE2 17.58 SEQ ID NO 217 YIL057C -31.34 -7.50 3.17 SEQ ID NO 219 YIL074C SER33 4.20 SEQ ID NO 221 YIR037W GPX3 2.77 SEQ ID NO 223 YJL138C TIF2 -2.77 SEQ ID NO 225 YJL142C 1.65 SEQ ID NO 227 YJL144W -3.30 SEQ ID NO 229 YJL161W -6.29 SEQ ID NO 231 YJL166W QCR8 1.58 SEQ ID NO 233 YJR096W -2.04 SEQ ID NO 235 YJR115W 1.58 1.16 1.38 -1.08 SEQ ID NO 237 YKL054C VID31 2.13 2.37 SEQ ID NO 239 YKL060C FBA1 1.31 -3.21 SEQ ID NO 241 YKL065C YET1 -5.43 -1.55 SEQ ID NO 243 YKL066W 2.76 1.87 SEQ ID NO 245 YKL097W-A CWP2 -8.37 SEQ ID NO 247 YKL117W SBA1 -7.43 SEQ ID NO 249 YKL150W MCR1 -3.43 1.39 -1.37 SEQ ID NO 251 YKL156W RPS27A -2.13 SEQ ID NO 253 YKL196C YKT6 -6.55 SEQ ID NO 255 YKR040C 1.98 1.24 1.86 SEQ ID NO 257 YKR075C 1.57 SEQ ID NO 259 YKR076W ECM4 4.88 SEQ ID NO 261 YKR092C SRP40 2.70 SEQ ID NO 263 YKR097W PCK1 1.67 -2.43 SEQ ID NO 265 YLR029C RPL15A -3.98 SEQ ID NO 267 YLR038C COX12 -9.66 -1.34 SEQ ID NO 269 YLR043C TRX1 -13.13 -2.78 SEQ ID NO 271 YLR053C 2.50 1.91 SEQ ID NO 273 YLR109W AHP1 -6.83 SEQ ID NO 275 YLR110C -9.13 -6.07 SEQ ID NO 277 YLR206W ENT2 2.40 SEQ ID NO 279 YLR216C CPR6 3.24 1.61 SEQ ID NO 281 YLR294C 5.74 2.43 SEQ ID NO 283 YLR311C 3.02 3.99 2.22 SEQ ID NO 285 YLR312C -1.58 SEQ ID NO 287 YLR327C -2.10 1.04 2.48 SEQ ID NO 289 YLR346C 1.79 SEQ ID NO 291 YLR390W ECM19 2.77 SEQ ID NO 293 YLR414C -1.67 SEQ ID NO 295 YML053C 2.80 SEQ ID NO 297 YML129C COX14 1.91 SEQ ID NO 299 YML132W COS3 1.42 SEQ ID NO 301 YMR009W -2.17 SEQ ID NO 303 YMR011W HXT2 -1.86 SEQ ID NO 305 YMR043W MCM1 2.15 2.56 1.16 SEQ ID NO 307 YMR099C 1.63 SEQ ID NO 309 YMR107W -6.48 5.86 SEQ ID NO 311 YMR110C 1.53 SEQ ID NO 313 YMR173W DDR48 -3.32 1.58 -2.07 SEQ ID NO 691 YMR173W-A -1.78 1.58 1.47 -2.07 SEQ ID NO 315 YMR251W -64.41 SEQ ID NO 317 YMR251W-A HOR7 -64.41 -4.19 -3.18 SEQ ID NO 319 YMR256C COX7 3.79 2.18 SEQ ID NO 321 YMR273C ZDS1 2.42 SEQ ID NO 323 YNL030W HHF2 -3.97 -1.56 SEQ ID NO 325 YNL031C HHT2 -5.69 SEQ ID NO 327 YNL112W DBP2 2.82 SEQ ID NO 329 YNL131W TOM22 -9.70 SEQ ID NO 331 YNL134C 1.52 SEQ ID NO 333 YNL143C 1.12 SEQ ID NO 335 YNL179C 2.88 -2.02 SEQ ID NO 337 YNL338W 1.78 2.79 1.62 -2.87 SEQ ID NO 339 YNR002C FUN34 -1.87 SEQ ID NO 709 YOL052C-A DDR2 1.65 SEQ ID NO 341 YOL106W 3.51 2.44 SEQ ID NO 343 YOL109W ZEO1 -3.45 -1.87 SEQ ID NO 345 YOL126C MDH2 1.91 -3.11 SEQ ID NO 347 YOL139C CDC33 2.17 SEQ ID NO 349 YOL150C 17.69 SEQ ID NO 351 YOL151W GRE2 9.20 SEQ ID NO 353 YOR120W GCY1 -1.46 SEQ ID NO 355 YOR121C 1.54 3.40 1.63 SEQ ID NO 357 YOR122C PFY1 1.40 SEQ ID NO 359 YOR131C 2.81 SEQ ID NO 361 YOR261C RPN8 2.59 1.54

SEQ ID NO 363 YOR267C 1.76 1.07 -1.10 SEQ ID NO 365 YOR285W -2.15 -1.21 SEQ ID NO 367 YOR286W -18.36 SEQ ID NO 369 YOR327C SNC2 -1.66 SEQ ID NO 371 YOR372C NDD1 2.19 1.92 SEQ ID NO 373 YOR374W ALD4 -12.93 SEQ ID NO 375 YOR382W 4.02 SEQ ID NO 377 YPL037C EGD1 -5.83 -2.17 SEQ ID NO 379 YPL078C ATP4 -4.50 1.22 SEQ ID NO 381 YPL079W RPL21B -6.18 SEQ ID NO 383 YPL085W SEC16 2.28 SEQ ID NO 385 YPL089C RLM1 1.94 2.74 1.22 SEQ ID NO 387 YPL190C NAB3 2.80 SEQ ID NO 389 YPL201C -3.57 SEQ ID NO 391 YPL271W ATP15 2.40 SEQ ID NO 393 YPR028W YIP2 -12.41 SEQ ID NO 395 YPR035W GLN1 -2.78

[0327]

9TABLE 8 C. albicans 522 CDS's S. cerevisiae 11645 CDS's total codon chosen for codons used in total aa codons frequency: per thousand number synthCaBAX gene wt muBAX gene frequency: per thousand number Ala GCU 30.7 8686 x 6 21.1 118595 GCC 12.7 3582 4 12.6 70785 GCA 15.4 4357 2 16.2 91018 GCG 2 578 1 6.1 34546 Arg CGU 5.9 1682 1 6.5 36518 CGC 0.7 204 1 2.6 14571 CGA 3.5 989 3 3 16957 CGG 0.8 220 3 1.7 9801 AGA 23.6 6673 x 1 21.3 119672 AGG 2.7 769 2 9.3 52057 Asn AAU 37.9 10731 x 1 36 202351 AAC 18.7 5293 2 24.9 140194 Asp GAU 43.6 12323 x 5 37.8 212658 GAC 14.7 4152 7 20.4 114451 Cys UGU 9.7 2757 x 1 8 44797 UGC 1.7 493 1 4.7 26357 Gln CAA 35.2 9964 x 1 27.5 154529 CAG 6.9 1948 8 12.2 68463 Glu GAA 49.5 14001 X 3 45.9 257930 GAG 11.5 3252 10 19.1 107568 Gly GGU 33.5 9492 x 2 23.9 134515 GGC 4.5 1281 7 9.7 54629 GGA 13.7 3874 2 10.9 61481 His GGG 7.7 2182 8 6 33627 CAU 14 3964 13.7 77260 CAC 5.8 1642 7.8 43878 Ile AUU 39.9 11281 3 30.2 169795 AUC 14.2 4005 x 7 17.1 96126 AUA 12.3 3478 17.8 100027 Leu UUA 1 295 26.3 148133 UUG 36.1 10204 x 2 27.1 152590 CUU 9.8 2777 2 12.2 68479 CUC 2.5 694 7 5.4 30218 CUA 4 1133 1 13.4 75414 Lys AAA 48.6 13760 x 2 42.1 236746 AAG 19.4 5477 6 30.8 173174 Met AUG 18.4 5219 x 8 20.9 117410 Phe UUU 28.6 8100 4 26 146355 UUC 15.9 4486 x 7 18.2 102389 Pro CCU 13.2 3722 1 13.6 76366 CCC 3.6 1027 5 6.8 38247 CCA 26.6 7531 x 18.2 102277 CCG 2.4 686 1 5.3 29758 Ser CUG 3.1 875 9 10.4 58583 UCU 23.3 6595 x 1 23.6 132608 UCC 10.3 2928 4 14.2 79928 UCA 24.6 6955 18.8 105570 UCG 6.5 1836 1 8.6 48186 AGU 23.6 6673 14.2 79649 AGC 4.5 1269 5 9.7 54330 Thr ACU 30.7 8689 1 20.2 113634 ACC 13.9 3928 x 8 12.6 70777 ACA 17.4 4928 5 17.7 99759 ACG 3.6 1019 1 8 44817 Trp UGG 11 3115 x 6 10.3 58092 Tyr UAU 24 6782 18.8 105489 UAC 11.6 3280 x 2 14.7 82483 Val GUU 33.2 9391 1 22 123726 GUC 10.3 2927 x 3 11.6 65203 GUA 8 2265 11.8 66100 GUG 10 2842 7 10.7 60033

[0328]

10TABLE 9 Regulation of 23 selected "Bax.specific" functions ORF Gene Control Bax H2O2 B vs C Cellular role: Amino-acid metabolism YOR302W YOR302W 11541.92 26806.35 8895.74 2.32 Cellular role: Cell stress YML028W TSA1 12889.91 2166.45 11327.36 0.17 Cellular role: Chromatin/chromosome structure YBR009C HHF1 2149.69 8655.43 2909.14 4.03 YDR224C HTB1 13661.40 55656.34 18829.27 4.07 YNL030W HHF2 8676.99 19603.93 4732.39 2.26 Cellular role: Energy generation YBL099W ATP1 2728.21 8786.71 1644.48 3.22 YGR183C QCR9 23181.54 81865.40 24053.00 3.53 YJL166W QCR8 5296.71 18093.93 5001.65 3.42 YLR038C COX12 7336.65 19935.69 5118.43 2.72 Cellular role: Signal transduction YHR135C YCK1 3939.64 8358.11 3707.17 2.12 YOL100W PKH2 2218.45 6088.96 2619.31 2.74 Cellular role: Transcription factor YDR216W ADR1 5925.91 18459.00 6434.43 3.11 Cellular role: Unknown YDR504C YDR504C 2741.47 6908.49 2839.62 2.52 YGR146C YGR146C 2099.74 5616.94 1303.89 2.68 YGR236C SPG1 17717.80 64439.96 24134.29 3.64 YHR138C YHR138C 6218.30 14817.41 5220.50 2.38 YJL142C YJL142C 6988.27 16006.02 6740.46 2.29 YKL123W YKL123W 2826.82 5952.34 2766.04 2.11 YLR414C YLR414C 4510.80 11867.69 3531.27 2.63 YMR107W YMR107W 13453.15 78850.98 17417.00 5.86 YOL099C YOL099C 3690.45 11604.72 5454.15 3.14 YPL201C YPL201C 15960.14 33633.74 7449.66 2.11 YJL060W YJL060W 8798.50 2406.39 6356.11 0.27

REFERENCES

[0329] Altshul, S. F., Gish, W., Miller, W., Myers, E. W. and Lipman D. J. (1990). Basic ocal alignment search tool. J. Mol. Biol. 215, 403-410.

[0330] Apte, S. S., M. G. Mattei M. F. Seldin and B. R. Olsen (1995). "The highly conserved defender against the death 1 (DADL) gene maps to human chromosome 14q11-q12 and mouse chromosome 14 and has plant and nematode homologs." FEBS Lett 363(3): 304-6.

[0331] Bairoch, A. and Apweiler, R. (1998). The SWISS-PROT protein sequence data bank and its supplement TrEMBL in 1998. Nucleic acids Res. 26, 38-42.

[0332] Bishop M. J., ed. (1994). Guide to Huge Computers, Academic Press, San Diego.

[0333] Brown, A. J., G. Bertram, et al. (1991). "Codon utilisation in the pathogenic yeast, Candida albicans." Nucleic Acids Res 19(15): 4298.

[0334] Carillo, H. and Lipton, D. (1988). SIAM J. Applied Math. 48,1073.

[0335] Casadaban, M. J., and Cohen, S. N. (1980). Analysis of gene control signals by DNA fusion and cloning in Escherichia coli. J. Mol. Biol. 138,179-207.

[0336] Chien, C. T., Bartel, P. L., Sternglanz, R., and Fields, S. (1991). The 2-hybrid system--a method to identify and clone genes for proteins that interact with a protein of interest. Proc. Natl. Acad Sci USA 88, 9578-9582.

[0337] Cormack, B. P., G. Bertram, et al. (1997). "Yeast-enhanced green fluorescent protein (yEGFP) a reporter of gene expression in Candida albicans." Microbiology 143(Pt 2): 303-11.

[0338] Devereux, J., Haeberli, P. and Smithies, 0. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Research 12, 387-395.

[0339] Fonzi, W. A. and M. Y. Irwin (1993). "Isogenic strain construction and gene mapping in Candida albicans." Genetics 134(3): 717-28.

[0340] Gatignol, A., Dassin, M. and Tiraby, G. (1990). Cloning of Saccharomyces cerevisiae promoters using a probe vector based on phleomycin resistance. Gene 91, 35-41.

[0341] Geysen, H. M., Rodda, S. J. and Mason, T. J. (1986). A priori delineation of a peptide which mimics a discontinuous antigenic determinant. Mol. Immunol. 23, 709-715.

[0342] Greenhalf, W., C. Stephan, and B. Chaudhuri (1996). "Role of mitochondria and C-terminal membrane anchor of Bcl-2 in Bax induced growth arrest and mortality in Saccharomyces cerevisiae." FEBS Lett 380(1-2): 169-75.

[0343] Herreros, E., M. I. Garcia-Saez, et al. (1992). "A reorganized Candida albicans DNA sequence promoting homologous non-integrative genetic transformation." Mol Microbiol 6(23): 3567-74.

[0344] Hinnebush, A. G. and Liebman, S. W., in: The Molecular Biology of the Yeast Saccharomyces (1991). Broach, J. R., Pringle, J. R. and Jones, E. W., eds., CSH Laboratory Press, NY.

[0345] Ink, B., M. Zornig, B. Baum, N. Hajibagheri, C. James, T. Chittenden and G. Evan (1997). "Human Bak induces cell death in Schizosaccharomyces pombe with morphological changes similar to those with apoptosis in mammalian cells." Mol Cell_Biol 17(5): 2468-74.

[0346] Jurgenmeiser, J. M., Krajewski, S., Armstrong, R., Wilson, G. M., Oltersdorf, T., Fritz, L. C., Red, J. C., and Ottilie, S. (1997). Bax- and Bak-induced cell death in the fission yeast Schizosaccharomyces pombe. Mol. Biol. Cell 8, 325-329.

[0347] Knudson, C. M. and S. J. Korsmeyer (1997). "Bcl-2 and Bax function independently to regulate cell death." Nat Genet 16(4): 358-63.

[0348] Kohler, F. and Milstein, C. (1975). Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256, 495-497.

[0349] Kozak, M. (1981). "Possible role of flanking nucleotides in recognition of the AUG initiator codon by eukaryotic ribosomes." Nucleic Acids Res 9(20): 5233-62.

[0350] Ligr, M., Madeo, F., Froehlich, E., Hilt, W., Froehlich, K.-U. and Wolf, D. H. (1998). Mammalian Bax triggers apoptotic changes in yeast. FEBS Lett. 438, 61-65.

[0351] Lloyd, A. T. and P. M. Sharp (1992). "Evolution of codon usage patterns: the extent and nature of divergence between Candida albicans and Saccharomyces cerevisiae." Nucleic Acids Res 20(20): 5289-95.

[0352] Lockhart, D. J. Dong, H. Byrne, M. C., Follettie, M., Gallo, M. V., Chee, M. S., Mitteman, M., Wang, C., Kobayashi, M., Horton, H and Brown, E. L. (1996). Expression monitoring by hybridisation to high density oligonucleotide arrays. Nature Biotechnology 14, 1675-1680.

[0353] Madeo, F., Frohlich, E., Ligr, M., Grey, M., Sigrist, S. J., Wolf, D. H., and Frohlich, K. U. (1999). Oxygen stress: a regulator of apoptosis in yeast. J Cell Biol 145, 757-767.

[0354] Muchmore, S. W., M. Sattler, H. Liang, R. P. Meadows, J. E. Harlan, H. S. Yoon, D. Oltvai, Z. N. and S. J. Korsmeyer (1994). "Checkpoints of dueling dimers foil death wishes [comment]." Cell 79(2): 189-92.

[0355] Reed, J. C., J. M. Jurgensmeier, and S. Matsuyama (1998). "BcI-2 family proteins and mitochondria." Biochim Biophys Acta 1366(1-2): 127-37.

[0356] RiboGene Inc., Patent application (1995) PCT WO 95/11969.

[0357] Rossanese, O. W., J. Soderholm, et al. (1999). "Golgi structure correlates with transitional endoplasmic reticulum organization in Pichia pastoris and Saccharomyces cerevisiae." J Cell Biol 145(1): 69-81.

[0358] Sambrook J., Fritsch E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2.sup.nd Ed., CSH Laboratory Press, NY.

[0359] Sambrook, J., E. F. Fritsch, et al. (1989). Detection and Analysis of Proteins Expressed from Cloned Genes. Molecular Cloning: A Laboratory Manual. New York, Cold Spring Harbor Laboratory Press. 3: 18.35.

[0360] Sandbaken, M. G., Lupisella, J. A., DiDomenico, B., and Chakraburtty, K. (1990). Protein synthesis in yeast Structural and functional analysis of the gene encoding elongation factor III. J. Biol. Chem. 265, 15838-15844.

[0361] Sato, T., M. Hanada, S. Bodrug, S. Irie, N. Iwama, L. H. Boise, C. B. Thompson, E. Golemis, L. Fong, H. G. Wang and J. C. Reed (1994). "Interactions among members of the Bcl-2 protein family analyzed with a yeast two-hybrid system [published erratum appears in Proc Natl Acad Sci USA 1995 Feb. 28;92(5):2016]." Proc Natl_Acad Sci USA 91(20): 9238-42.

[0362] Sherman, F., Fink, G. R., and Hicks, J. B. (1979). Methods in yeast genetics, CSH Laboratory Press, NY.

[0363] Schiestl, R. H., and Gietz, D. R. (1989). High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet. 16, 339-346.

[0364] Schwartz, L. M., S. W. Smith, M. E. Jones and B. A. Osborne (1993). "Do all programmed cell deaths occur via apoptosis?" Proc Natl Acad Sci USA 90(3): 980-4.

[0365] Stoesser, G., Moseley, M. A., /Sleep, J., McGowran, M., Garcia-Pastor, M. and Sterk, P. (1998). Nucleic Acids Res. 26, 8-15.

[0366] Walsh, T. J. (1992). Invasive Fungal Infections: Problems and Challenges for Developing New Antifungal Compounds, in: "Emerging Targets in Antibacterial and Antifungal Chemotherapy", J. A. Sutcliffe and N. H. Georgopapadakou, eds, Chapman and Hall, NY, pp 349-373.

[0367] Zha, H., H. A. Fisk, M. P. Yaffe, N. Mahajan, B. Herman and J. C. Reed (1996). "Structure-function comparisons of the proapoptotic protein Bax in yeast and mammalian cells." Mol Cell Biol 16(11): 6494-508

[0368] Zhu, J. (1986). One step selection of a multicopy integrant based on yeast genomic transformation. In "Heterologous gene expression in Saccharomyces cerevisiae using a dominant selection and amplification system". Ghent University, doctoral dissertation, p 45.

Sequence CWU 0

SEQUENCE LISTING The patent application contains a lengthy "Sequence Listing" section. A copy of the "Sequence Listing" is available in electronic form from the USPTO web site (http://seqdata.uspto.gov/sequence.html?DocID=20040161840). An electronic copy of the "Sequence Listing" will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).

(Full Text online)

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005